The present invention relates to a composition for enhancing antitumor immunity including adenovirus co-expressing IL-12 and shVEGF.
Immunological dysfunction in cancer patients has been well known [1], and it is also clinically apparent that tumors effectively avoid anticancer immune responses. While recent anticancer treatment mainly focuses on surgical operations, chemotherapy and radiation therapy, these are all accompanied by side effects [2, 3]. To overcome such barriers and increase the efficiency of anticancer treatment, research on immunotherapy is actively progressing. In the last decades, because of new findings in basic immunology and molecular discoveries of tumor antigens, research on immunotherapies for preventing and treating cancer have been actively conducted [4]. Tumor cells express a great quantity of abnormal antigens by themselves, and these antigens cause an eradication response through immune surveillance. Even if the immune system in the body actively acts, the tumor cells can avoid immune surveillance [5, 6]. It was identified that such a phenomenon is mediated by various factors produced by tumor cells. Tumor tissues can produce immunosuppressive molecules such as a vascular endothelial growth factor (VEGF), tumor growth factor (TGF)-β and interleukin (IL)-10 [7, 8]. It has also been reported that infiltration of regulatory T cells occurs in immunosuppressed tumors [9-11]. These factors that are overexpressed in tumor tissue induce an immunosuppressive microenvironment and immune tolerance in tumors. As a result, overcoming immune surveillance is a pivotal strategy in immunotherapy.
IL-12 is one of the most effective and promising anticancer cytokines. IL-12 is a heterodimeric protein including 40 kDa and 35 kDa subunits connected by a disulfide bond, and produced by activated macrophages, monocytes, dendritic cells and active B lymphocytes. IL-12 may enhance T-helper 1 (Th1) cell immunity [12] and the cytotoxicity of cytotoxic T-lymphocytes, and suppress angiogenesis. Generally, IL-12 activates IFN-γ production of T cells and natural killer (NK) cells [13]. Local expression of IL-12 allows tumor cells to sensitively response to T-cell mediated cytotoxicity, resulting in tumor growth inhibition and the establishment of systemic immunity. However, a disadvantage of the clinical application of IL-12 is that cytokine-associated toxicity that limits the acceptable dose for a patient when administered may appear in the entire body [14-17]. In addition, overall downregulation of the immune effect may result in repeated administration of IL-12. In a patient's serum, IL-12 polarization from Th1 to Th2 immunity occurs due to an increase in IL-10 expression and a decrease in IFN-γ and TNF-β expression, and for this reason, IL-12 is repeatedly administered [18,19]. These clinical results show the limitations of IL-12 as a single therapeutic for cancer treatment.
VEGF is a signal protein produced by cells, stimulating vasculogenesis and angiogenesis [20]. Particularly, VEGF affects T cell precursors in bone marrow and thus inhibits the proliferation and maturation of T cells and dendritic cells [21]. In addition, VEGF plays an important role in angiogenesis and represents a side effect called metastasis [22]. Therefore, VEGF is a stimulating factor of tumor growth, and also acts as an inhibitory factor in anticancer immunity, and it is expected that VEGF downregulation caused by VEGF shRNA will restore immune responses and increase anticancer effects. These studies show that the therapeutic mechanism mediated by VEGF shRNA, similar to that by IL-12, is associated with enhancement in CTL or dendritic cell-mediated immune responses.
Therefore, the inventors suggest a method for more effectively increasing antitumor immunity using a combination of the above-mentioned immunotherapies.
A variety of papers and patent documents are referred throughout the specification, and their citations are indicated. The disclosures of the cited papers and patent documents are incorporated herein by reference in their entireties to more clearly describe the standard of the field of the art to which the present invention belongs and the scope of the present invention.
The inventors had attempted to develop immunotherapy for overcoming the avoidance of immune surveillance of tumors using an immunosuppressive molecule produced in tumor tissue. As a result, the inventors constructed an adenovirus co-expressing IL-12 and shVEGF and developed a composition for improving immunity and a composition for improving an anticancer effect, which include the adenovirus. In addition, the inventors identified that a therapeutic effect can be enhanced by applying such an adenovirus (RdB/IL12/shVEGF) co-expressing IL-12 and shVEGF to cancer therapy, and thus completed the present invention.
Therefore, the present invention is directed to providing an adenovirus co-expressing IL-12 and shVEGF and a composition for enhancing antitumor immunity, which includes the adenovirus.
The present invention is also directed to providing the use of an adenovirus co-expressing IL-12 and shVEGF for enhancing antitumor immunity.
The present invention is also directed to providing a method for enhancing antitumor immunity using an adenovirus co-expressing IL-12 and shVEGF.
The present invention is also directed to providing an anticancer composition including an adenovirus co-expressing IL-12 and shVEGF, the use thereof for treating cancer, and a method for treating cancer, which includes administering the composition to a subject.
The present invention is also directed to providing a composition for preventing or treating tumor-induced thymic atrophy, which includes an adenovirus co-expressing IL-12 and shVEGF, the use thereof for treating tumor-induced thymic atrophy, and a method for treating tumor-induced thymic atrophy, which includes administering the composition to a subject.
Other objects and advantages of the present invention will become more apparent by the detailed description of the invention, claims and drawings as follows.
According to an aspect of the present invention, the present invention provides a recombinant adenovirus, which includes (i) an IL-12 gene having at least one of a sequence of SEQ ID NO: 1 and a sequence of SEQ ID NO: 2, and (ii) a small hairpin RNA (shRNA) gene which is complementary to VEGF mRNA having a sequence of SEQ ID NO: 3, and suppresses VEGF gene expression, or a composition for enhancing antitumor immunity, which includes (a) a therapeutically effective amount of the recombinant adenovirus; and (b) a pharmaceutically acceptable carrier.
Upon conducting the research to develop immunotherapy to overcome the avoidance of immune surveillance of tumors using an immunosuppressive molecule produced in tumor tissue, the inventors constructed an adenovirus co-expressing IL-12 and shVEGF, and developed a composition for enhancing antitumor immunity and a composition for enhancing an anticancer effect. The inventors identified that a therapeutic effect can be improved by applying such an adenovirus co-expressing IL-12 and shVEGF (RdB/IL12/shVEGF) to gene therapy for cancer.
Cancer immunogenic therapy has been developed to be a more promising approach over the last few decades. However, to avoid the immune surveillance system, a tumor also has a variety of different strategies. To overcome such a barrier and enhance an anticancer immunity effect, a system (RdB/shVEGF) co-expressing IL-12 (RdB/IL12) and VEGF shRNA and an oncolytic co-expression adenovirus (RdB/IL12/shVEGF) system thereof were constructed as proper therapeutic adjuvants for restoring immunosuppression and increasing anticancer immunity. IL-12 induces the differentiation of Th1 cells and activates cytotoxic T lymphocytes and the cytotoxicity of NK cells, thereby increasing anticancer immunity. shVEGF is very effective for inhibiting VEGF expression, and thus stimulates the proliferation and maturation of T cells and dendritic cells. Such effects further amplify the functionality of IL-12. However, there is no research on the therapeutic effect caused by the co-expression of IL-2 and shVEGF in tumors. Therefore, the inventors first studied an effect of immunogenic therapy of injecting an adenovirus (RdB/IL12/shVEGF) co-expressing IL-2 and shVEGF into a tumor. In a B16-F10 murine melanoma model, the injection of RdB/IL12/shVEGF into a tumor greatly improves an anticancer effect. While IL-12 and IFN-γ expression levels were considerably increased in the RdB/IL12/shVEGF-treated group, a VEGF expression level was decreased. In addition, a ratio of T-helper type 1/2 cytokines was increased in splenocyte-and-B16-F10 co-cultured supernatants. The cytotoxicity of cancer-specific immune cells in RdB/IL12/shVEGF-injected mice was increased. Like the above-described result, in situ delivery of RdB/IL12/shVEGF results in a phenomenon of massive infiltration of CD4+ T cells, CD8+ T cells, NK cells and CD86+ APCs into tissues surrounding the necrotic region of a tumor. Importantly, the adenovirus co-expressing IL-12 and shVEGF prevents tumor-induced thymic atrophy, is associated with a reduction in cell death, and increases cell proliferation in the thymus. An oncolytic adenovirus co-expressing IL-12 and shVEGF can be used as an adjuvant that increases an anticancer effect, and enhances antitumor immunity.
The recombinant adenovirus of the present invention includes both of an IL-12 gene sequence and a vascular endothelial growth factor small hairpin RNA (shVEGF) gene sequence. The IL-12 gene sequence includes a nucleotide sequence represented by at least one of SEQ ID NO: 1 and SEQ ID NO: 2, and the shVEGF sequence includes a sequence complementary to a nucleotide sequence represented by SEQ ID NO: 3. More specifically, the IL-12 gene sequence includes at least one of an IL-12A (p35) gene sequence and an IL-12B (p40) gene sequence, and according to an exemplary embodiment of the present invention, the IL-12 gene sequence includes an IL-12A (p35) gene sequence, an internal ribosome entry site (IRES) sequence and an IL-12B (p40) gene sequence (refer to
It should be interpreted that the IL-12 gene sequence used in the present invention also includes a gene sequence exhibiting substantial identity or substantial similarity to the sequence of at least one of SEQ ID NO: 1 and SEQ ID NO: 2. The substantial identity refers to a sequence having at least 80% homology, more preferably 90% homology, and most preferably 95% homology, when a random sequence is aligned to correspond as much as possible with the sequence of the present invention, and the aligned sequences are analyzed using an algorithm conventionally used in the art. The substantial similarity encompasses all of the changes in an IL-12 gene sequence, for example, deletion or insertion of one or more bases, which do not affect the object of the present invention of minimized homologous recombination with a recombinant adenovirus vector. Therefore, the IL-12 gene sequence of the present invention is not limited to the sequence of SEQ ID NO: 1 or SEQ ID NO: 2 shown above, and all the examples of the IL-12 gene sequences should be interpreted to be included in the scope of the present invention as long as the sequences do not substantially affect the activity of the final product desired in the present invention.
In the present invention, small hairpin RNA or short hairpin RNA (shRNA) is an artificial RNA molecule having a hairpin structure, and is used to inhibit target gene expression through RNA interference. shRNA is usually delivered into cells via a plasmid, bacterial or virus vector. shRNA has an advantage of relatively low degradation and turnover ratios.
The term “shRNA molecule” used herein refers to a nucleic acid molecule that can mediate RNA interference or gene silencing. The shVEGF molecule used in the present invention includes a sequence complementary to VEGF mRNA, and the term “complementarity” used herein encompasses 100% complementarity, and a degree of incomplete complementarity sufficient to inhibit VEGF gene expression through an RNA interference mechanism, for example, preferably 90% complementarity, more preferably, 98% complementarity, and most preferably, 100% complementarity. In the specification, to represent 100% complementarity, it is specifically described as “completely complementary.”
According to an exemplary embodiment of the present invention, the shRNA sequence included in the adenovirus of the present invention includes the sequence of SEQ ID NO: 3 (GenBank accession number gi: 70608153) or a sequence complementary to a part thereof, and preferably, a sequence complementary to the sequence of nucleotides 92 to 112 of an VEGF-A mRNA sequence, represented by the sequence of SEQ ID NO: 3. According to a specific exemplary embodiment of the present invention, the shRNA sequence is a sequence of SEQ ID NO: 4 and a sequence of SEQ ID NO: 5. Meanwhile, the sequence of SEQ ID NO: 3 has 88% homology with a sequence of SEQ ID NO: 6, and more specifically, 88% homology with the sequence of nucleotides 17 to 438 of the sequence of SEQ ID NO: 6.
Meanwhile, the recombinant adenovirus of the present invention includes an active E1A gene and a non-activated E1B 19 gene, an E1B 55 gene or an E1B 19/E1B 55 gene. In the specification, the term “non-activated” used in relation to a gene means that a normal protein encoded by the gene is not properly functioning since gene transcription and/or translation are/is not normally performed. For example, the non-activated E1B 19 gene is a gene that does not produce an active E1B 19 kDa protein due to a mutation (substitution, addition, partial deletion or entire deletion) occurring in the gene. E1B 19 deletion may result in an increase in necrosis ability, and the deletion of the E1B 55 gene results in tumor cell specificity (refer to Patent Application No. 2002-23760). The term “deletion” used in relation to a viral genomic sequence in the specification refers to partial deletion as well as complete deletion of a corresponding sequence.
According to an exemplary embodiment of the present invention, the recombinant adenovirus includes an E1A region, and E1B regions, containing E1B 19 and 55 kDa (ΔE1B), are deleted, and an E3 region (ΔE3) is deleted. The recombinant adenovirus including the E1A gene has a replicable characteristic. The IL-12 gene and shVEGF are inserted into the E1 and E3 region-deleted adenovirus, respectively (refer to
The recombinant adenovirus used in the present invention includes a promoter operable in animal cells, preferably, mammalian cells. The proper promoter for the present invention includes a promoter derived from a mammalian virus and a promoter derived from the genome of mammalian cells, for example, a cytomegalovirus (CMV) promoter, an U6 promoter, a H1 promoter, a murine leukemia virus (MLV) long terminal repeat (LTR) promoter, an adenovirus early promoter, an adenovirus late promoter, a vaccina virus 7.5K promoter, an SV40 promoter, a HSV tk promoter, an RSV promoter, an EF1 α promoter, a methallothionin promoter, a β-actin promoter, a human IL-2 gene promoter, a human IFN gene promoter, a human IL-4 gene promoter, a human lymphotoxin gene promoter, a human GM-CSF gene promoter, a human phosphoglycerate kinase (PGK) promoter, a mouse phosphoglycerate kinase (PGK) promoter and a survivin promoter, but the present invention is not limited thereto. Most preferably, the promoter in the present invention is a CMV promoter.
In the recombinant adenovirus used in the present invention, the IL-12 gene sequence and the shVEGF sequence are operably linked to a promoter. In the specification, the term “operably linked” refers to a functional binding between a nucleic acid expression-regulatory sequence (e.g., an array of a promoter, a signal sequence, and a transcription regulating factor-binding site) and a different nucleic acid sequence, and therefore, the regulatory sequence regulates the transcription and/or translation of the different nucleic acid sequence.
The recombinant adenovirus of the present invention may further include an antibiotic-resistant gene and a reporter gene (e.g., green fluorescence protein (GFP), luciferase and β-glucuronidase) as selective markers. The antibiotic-resistant gene includes an antibiotic-resistant gene conventionally used in the art, for example, a gene resistant to ampicillin, gentamycin, carbenicillin, chloramphenicol, streptomycin, kanamycin, geneticin, neomycin and tetracycline, and preferably, is a neomycin-resistant gene. The selective marker may be expressed even in an expression system connected by a separate promoter or an internal ribosome entry site (IRES), and the IRES that can be used in the present invention is a regulatory sequence that is found in RNAs of some types of viruses and cells (McBratney et. al. Current Opinion in Cell Biology 5:961(1993)).
As to be described in an example described below, a recombinant adenovirus of the present invention, which co-expresses IL-12 and VEGF-specific shRNA, interrupts an immune surveillance avoiding mechanism of tumors by increasing IL-12 expression and suppressing VEGF expression. It has been reported that the shift from Th1 to Th2 cytokine expression has been shown in the development of various mouse and human malignant tumors, and the composition of the present invention increases a Th1/Th2 cytokine ratio by inhibiting such a Th2 immuno-deviation phenomenon (refer to
In another aspect of the present invention, the present invention provides an anticancer composition which includes (a) (i) IL-12 gene including at least one of a sequence of SEQ ID NO: 1 and a sequence of SEQ ID NO:2, and (ii) a therapeutically effective amount of a recombinant adenovirus including a small hairpin RNA (shRNA) gene which is complementary to vascular endothelial growth factor (VEGF) mRNA of a sequence of SEQ ID NO: 3, and inhibits VEGF gene expression; and (b) a pharmaceutically acceptable carrier.
The anticancer composition of the present invention uses a recombinant adenovirus included in the above-described composition for enhancing antitumor immunity, and common details between these will be omitted to avoid excessive complexity in the specification.
According to an exemplary embodiment of the present invention, the cancer includes gastric cancer, lung cancer, breast cancer, ovarian cancer, liver cancer, bronchial cancer, nasopharyngeal cancer, laryngeal cancer, pancreatic cancer, bladder cancer, colorectal cancer, colon cancer, cervical cancer, brain cancer (e.g., glioma), prostate cancer, bone cancer, head and neck cancer, skin cancer (e.g., melanoma), kidney cancer, polyploid carcinoma, thyroid cancer, parathyroid cancer and ureteral cancer, but the present invention is not limited thereto.
In still another aspect of the present invention, the present invention provides a composition for preventing or treating tumor-induced thymic atrophy, which includes (a) (i) IL-12 gene including at least one of a sequence of SEQ ID NO: 1 and a sequence of SEQ ID NO:2, and (ii) a therapeutically effective amount of a recombinant adenovirus including a small hairpin RNA (shRNA) gene which is complementary to vascular endothelial growth factor (VEGF) mRNA of a sequence of SEQ ID NO: 3, and inhibits VEGF gene expression; and (b) a pharmaceutically acceptable carrier.
The composition for preventing or treating tumor-induced thymic atrophy uses a recombinant adenovirus including in the above-described composition for enhancing antitumor immunity, and common details between these will be omitted to avoid excessive complexity in the specification.
Thymic atrophy has been usually observed in tumor-bearing mice, and results in a reduction in host immunity with respect to tumors. The composition of the present invention co-expresses IL-12 and shVEGF in tumors, thereby preventing or inhibiting thymic atrophy caused by tumor development (refer to
All of the compositions of the present invention described above include a pharmaceutically acceptable carrier. The pharmaceutically acceptable carrier used herein, conventionally used in formulation, includes lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia gum, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil, but the present invention is not limited thereto. The pharmaceutical composition of the present invention may further include a lubricant, a wetting agent, a sweetening agent, a flavoring agent, an emulsifier, a suspension, a preservative, etc., other than the above-mentioned components. Suitable pharmaceutically acceptable carriers and agents are described in Remington's Pharmaceutical Sciences (19th ed., 1995) in detail.
The composition of the present invention may be administered orally or parenterally, for example, by intravenously injection, subcutaneous injection, intramuscular injection, intraperitoneal injection or transdermal administration, and the composition of the present invention is preferably administered parenterally. According to an exemplary embodiment of the present invention, preferably, the composition for enhancing antitumor immunity of the present invention is directly intratumorally administered.
A suitable dosage of the pharmaceutical composition may be prescribed in various ways according to parameters such as a formation method, an administration method, a patient's age, body weight and sex, the severity of a disease symptom, a diet, administration time, administration route, excretion speed and reaction sensitivity. A daily dose of the pharmaceutical composition of the present invention is, for example, 0.001 to 1000 mg/kg. However, an actual dosage of the active ingredient may be determined by considering various related factors such as an amount of target tissue cells to be differentiated and proliferated, an administration route, a patient's weight, age and sex, and therefore, the dosage does not limit the scope of the present invention in any way.
Characteristics and advantages of the present invention are summarized as follows:
(a) The present invention relates to an oncolytic adenovirus co-expressing IL-12 and shVEGF, and a composition for enhancing antitumor immunity and a composition for enhancing an anticancer effect, which include the same.
(b) The inventors found that, when VEGF suppression and IL-12 expression are co-expressed in immunocompetent mouse melanoma models, immune functions are restored and an anticancer effect is enhanced.
(c) Particularly, the inventors identified that such an increase in anticancer effect is associated with an increase in anticancer immunity, an increase in Th1 cytokines and prevention of tumor-induced thymic atrophy, and thus first identified the applicability of a gene delivery system co-expressing IL-12 and shVEGF in cancer gene therapy.
Hereinafter, the present invention will be described in further detail with respect to examples. These examples are only provided to more fully describe the present invention, and it is obvious to those of ordinary skill in the art that the scope of the present invention is not limited to these examples according to the scope of the present invention.
(1) Cell Lines and Cell Culture
Dulbecco's modified Eagle's medium (DMEM; Gibco BRL, Grand Island, N.Y.) or Roswell Park Memorial Institute medium (RPMI; Gibco BRL), supplemented with 10% fetal bovine serum (FBS; Gibco BRL), L-glutamine (2 mmol/L), penicillin (100 IU/mL), and streptomycin (50 mg/mL), was used as a cell culture medium. HEK293 (human embryonic kidney cell line expressing an adenovirus E1 region), U87MG (human glioma cell line), BNL (murine liver cancer cell line), B16-F10 (murine melanoma cell line), LLC (murine lung cancer cell line), CMT-93 (murine polyploid carcinoma cell line), and Renca (murine renal adenocarcinoma cell line) were purchased from the American Type Culture Collection (ATCC; Manassas, Va.). All cell lines were cultured at 37° C. in a 5% CO2 humid environment, and subjected to a mycoplasma negative test using Hoeschst dye, cell culture and polymerase chain reaction (PCR). Escherichia coli was cultured at 37° C. in Luria Bertani medium.
(2) Animal Tests
Six- to eight-week-old male C57BL/6 mice were purchased from Charles River Laboratories International, Inc. (Wilmington, Mass.), and maintained in a laminar air-flow cabinet under a pathogen-free condition. All tests were approved by the Association for Assessment and Accreditation of Laboratory Animal Care (AAALAC), and conducted according to the guidelines established by the Hanyang University Institutional Animal Care and Use Committee.
(3) Manufacture of Oncolytic Adenovirus Co-Expressing IL-12 and shVEGF
To manufacture adenoviruses co-expressing IL-12 and shVEGF in E1 and E3 regions, first, a shVEGF-expressing E3 shuttle vector was constructed. Full-length murine shVEGF complementary DNA was cloned by RT-PCR using total RNA obtained from bone marrow-derived active dendritic cells.
shVEGF complementary DNA (nucleotides 53-982 of National Center for Biotechnology Information L15435) was manufactured using the following primer set: sense primer (5′-gatcccggaaggagagcagaagtcccatgttcaagagacatgggacttctgctctcctt tttttttggaaa-3′), antisense primer (5′-tttccaaaaaaa aaggagagcagaagtcccatgtctcttgaacatgggacttctgctctccttccgggatc-3′). The PCR product was digested with BamHI/HindIII, and cloned in a BamHI/HindIII-treated pSP72 E3/CMV-poly A adenovirus E3 shuttle vector [29], thereby manufacturing a pSP72 E3/shVEGF E3 shuttle vector. For homologous recombination, the pSP72 E3/shVEGF was co-transfected with an adenovirus total vector pdEl into Escherichia coli BJ5183, thereby manufacturing a pdEl/shVEGF adenovirus plasmid. The structure of the recombinant vector was confirmed by treatment of restriction enzymes and PCR analysis.
To construct an adenovirus E1 shuttle vector expressing IL-12, a murine IL-12 gene was cut out from pCA14/IL12 [30] and subcloned in a pXC1RdB E1 shuttle vector [23], thereby manufacturing a pXC1RdB/IL12 E1 shuttle vector. For homologous recombination, the pXC1RdB/IL12 E1 shuttle vector and pdEl/shVEGF were co-transfected into Escherichia coli BJ5183, thereby manufacturing a pRdB/IL12/shVEGF adenovirus vector (
All viruses were produced using HEK293 cells, and purification, titration and quality analysis of the adenoviruses were carried out as described in the prior art [31, 32].
(4) Enzyme-Linked Immunosorbent Assay for IL-12 and VEGF Expression
After 3×105 B16-F10 melanoma cells were inoculated into a 6-well plate, and infected with 50 MOI of RdB, RdB/IL12, RdB/shVEGF, or RdB/IL12/shVEGF adenoviruses. Forty eight hours after the infection, a supernatant was collected, and subjected to measurement of IL-12 and shVEGF expression levels using an ELISA kit (IL-12 ELISA kit: Endogen, Woburn, Mass.; VEGF ELISA kit: R&D Systems, Minneapolis, Minn.).
(5) Cytopathic Effect Assay
Cytopathic effect values are associated with a degree of virus replication, and able to be used to measure whether IL-12 and shVEGF expression affects the replicability of adenoviruses. Cells were inoculated into a 24-well plate to reach 30 to 80% confluence, and infected with 1-500 MOI of RdB, RdB/IL12, RdB/shVEGF or RdB/IL12/shVEGF adenoviruses. An apoptotic effect of viruses was visually monitored using a microscope. When virus-infected cells were completely dissolved at low MOI, dead cells were removed, and stained with 0.5% crystal violet in 50% methanol.
(6) In Vivo Antitumor Effect
B16-F10 cells (5×105) or RENCA cells were injected subcutaneously into the right abdomen of 6- to 7-week-old male C57BL/6 mice. When the tumor volume reached approximately 100 mm3, the mice were divided into groups with similar tumor sizes, different doses of a total volume of 50 μl PBS-diluted adenoviruses (RdB or RdB/shVEGF at 3×109 VP; RdB/IL-12 or RdB/IL-12/shVEGF at 6×108 VP) were administered intratumorally three times every other day. Tumor growth was monitored everyday by measuring a perpendicular tumor diameter using a caliper. Tumor volume was calculated using the following formula: volume=0.523L(W)2, in which L is a length and W is a width.
(7) Cytokine Quantification and Th1/Th2/Th17 Profiles in Tumor Tissue
Seven days after the final viral injection, tumor tissues were collected from an adenovirus-treated mouse group. The tumor tissues were homogenized in RIPA buffer (Elipis Biotech, Taejeon, South Korea) to which a proteinase inhibitor cocktail (Sigma, St. Louis, Mo.) was added. Following high speed centrifugation of the homogenate for 10 minutes, a total protein level was measured using a BSA ELISA kit (Pierce, Rockford, Ill.). Levels of IL-12, VEGF, and IFN-γ were measured by ELISA kits (IL-12 ELISA kit: Endogen; VEGF ELISA kit: R&D; IFN-γ ELISA kit: Endogen). Each experiment was conducted three times by group. Th1/Th2/Th17 type cytokine expression profiles in the tumor tissues were measured using a Th1/Th2/Th17 CBA kit (BD Biosciences Pharmingen, San Diego, Calif.). ELISA and CBA results were normalized with respect to a total protein concentration, and the results are shown as “pg/total protein (mg)” values.
(8) IFN-γ Enzyme-Linked Immune Spot (ELISPOT) Assay in Splenocytes
On day 7 after the final viral injection, spleens were collected aseptically from mice, and unicellular splenocytes were prepared [30]. The splenocytes were cultured with irradiated B16-F10 (5,000 rad) tumor cells for 3 days in the presence of recombinant human IL-2 (100 Uml-1; R&D Systems). Subsequently, IFN-γELISPOT assay was carried out [30]. Spots were measured using a computer-based immunospot system (AID Elispot Reader System, version 3.4; Autoimmun Diagnostika GmbH, Strassberg, Germany).
(9) Histological and Immunohistochemical Analyses
Tumor tissues or thymus were fixed in 10% neutral buffered formalin, and a paraffin block was manufactured and then cut into 4-mm sections. The sections were stained with H&E, and observed using an optical microscope. To detect lymphocytes and dendritic cells, tumor tissues were frozen in an OCT compound (Sakura Finetec, Torrance, Calif.), and cut into 10-mm sections. The cryosections were reacted with rat anti-mouse CD4 monoclonal antibody (BD Biosciences Pharmingen), rat anti-mouse CD8 monoclonal antibody (BD Biosciences Pharmingen), mouse anti-mouse NK-1.1 monoclonal antibody (Biolegend, San Diego, Calif.), or rat anti-mouse CD86 monoclonal antibody (BD Biosciences Pharmingen) as a primary antibody, and reacted with horseradish peroxidase-conjugated goat anti-rat IgG (BD Biosciences Pharmingen) or horseradish peroxidase-conjugated goat anti-mouse IgG (Southern Biotech, Birmingham, Ala.) as a secondary antibody. Diaminobenzidine/hydrogen peroxidase (DAKO, Copenhagen, Denmark) was used as a chromogenic substrate. All sides were counterstained with Meyer's hematoxylin. To detect proliferated cells, the slide was deparaffinated with xylene, and dehydrated by treatment of an alcohol. Intrinsic peroxidase activity was inhibited using 3% hydrogen peroxide. An anti-proliferating cell nuclear antigen monoclonal antibody PC10 (DAKO) was bound to the secondary antibody Real/Envision (DAKO). A mouse serum was added to the complex of the first and second antibodies to minimize the interaction between isolated second antibodies and murine immunoglobulins found in the tissue sections. Subsequently, the sections were reacted with a complex of the first antibody and the second antibody, followed by the reaction with streptavidin-peroxidase. Diaminobenzidine/hydrogen peroxidase was used as a chromogenic substrate. Expression levels of CD4, CD8, NK-1.1, CD86, and PCNA were semi-quantitatively analyzed using MetaMorph® image analysis software (Universal Image Corp., Buckinghamshire, UK). Results were expressed as the mean optical density of five different digital images.
(10) Extraction of Thymuses
B16-F10 murine melanoma cells were suspended in a 100 ml Hank's balanced salt solution, and then injected into the abdomen of 6- to 8-week-old male C57BL/6 mice. When the volume of the tumor reached 80 to 100 mm3 (8-10 days after cell implantation), the mice were treated with adenoviruses (RdB or RdB/shVEGF at 1×1010 VP/tumor cell-suspended PBS at 50 μl; RdB/IL-12 or RdB/IL-12/shVEGF at 5×109 VP/tumor cell-suspended PBS at 50 μl) every other day for three times. On day 7 after the final viral injection, all thymus tissues were extracted and immediately added to RPMI 1640 medium, and each thymus was weighed using an electronic scale (Ohaus Corp., Florham Park, N.J.).
(11) Terminal Deoxynucleotidyl Transferase dUTP Nick End Labeling (TUNEL) Assay
An apoptotic thymocyte population was observed by TUNEL assay [33]. The apoptotic cells were visually identified in five randomly selected regions, and photographed at magnifications of 100× and 400×. The expression level of the apoptotic thymocytes was semi-quantitatively analyzed using MetaMorph® image analysis software. Results are expressed as the mean optical density of five different digital images.
(12) Statistical Analysis
All data is expressed as the mean±SD. Statistical comparisons were made using Stat View software (Abacus Concepts, Inc., Berkeley, Calif.) and the Mann-Whitney test (non-parametric rank sum test). P values less than 0.05 were considered statistically significant (*, P<0.05; **, P<0.01).
(1) Oncolytic Adenovirus-Mediated IL-12 and shVEGF Expression
To generate oncolytic adenoviruses effectively inhibiting the expression of long-term VEGF, an oncolytic adenovirus co-expressing IL-12 and shVEGF was manufactured by inserting murine IL-12 (p35, IRES, and p40) and shVEGF genes into the E1 and E3 regions of the adenovirus (RdB) [23] (
To examine whether IL-12, shVEGF, or IL-12/shVEGF expression affects virus replication and oncolytic ability, in mouse cell lines (BNL, B16-F10, LLC, and CMT-93) with different histological types and a human cell line (U87MG), the ability to induce cytopathic effects of RdB/IL12, RdB/shVEGF, and RdB/IL12/shVEGF was measured. The human U87MG cell line exhibited higher sensitivity to adenovirus infection, than the mouse cells, and the human cell line was used for in vitro experiments. Cells were infected with RdB (oncolytic adenovirus species), RdB/IL12, RdB/shVEGF, or RdB/IL12/shVEGF, and then stained with crystal violet to observe cell lysis. As shown in
(2) Confirmation of Anticancer Effect in Cancer-Bearing Mouse Models
When compared with a single-use effect of RdB/IL-12 or RdB/shVEGF, to examine the therapeutic efficacy of RdB/IL12/shVEGF in vivo, first, B16-F10 melanoma in C57BL/6 mice were injected with RdB, RdB/IL12, RdB/shVEGF, or RdB/IL12/shVEGF. When the tumor volume averaged 80 to 100 mm3, virus treatment was started, and was performed total three times every other day. A PBS solution containing 3×109 virus particles (VPs) was treated. Tumors in PBS control mice were rapidly grown to become huge tumors, and the average tumor volume until 5 days after the final treatment was 3,000 mm3 or more (
Such results infer that, in B16-F10 murine melanoma or RENCA kidney cancer models, RdB/IL12/shVEGF has a superior antitumor activity compared to the RdB/IL12 or RdB/shVEGF group.
(3) Increased Local Expression of IL-12, VEGF, and IFN-γ in Tumor Tissues
To measure the levels of IL-12 and VEGF produced in RdB/IL12, RdB/shVEGF, or RdB/IL12/shVEGF-treated mice, tumor tissues were harvested 7 days after final viral injection. As shown in
IL-12-induced IFN-γ attenuated VEGF levels in vivo [24]. Therefore, the levels of IFN-γ expression in tumor tissues were measured. As shown in
(4) Increase in Th1/Th2 Cytokine Ratio
The shift from Th1 to Th2 cytokine expression has been reported to be shown in the growth of malignant tumors in various mice and a human, and a correlation between the cytokine level and cancer therapeutic efficacy has also been reported [25, 26]. Therefore, the inventors investigated whether RdB/IL12/shVEGF, which allows Th1 cytokine (e.g., IFN-γ) expression to be considerably increased, could shift a Th2 immune response to a Th1 immune response in splenocytes. Splenocytes of mice were harvested 7 days after final viral injection, and cultured with tumor cells in irradiated B16-F10 mice for 3 days in the presence of recombinant human IL-2. Afterward, the cultured supernatant was analyzed using a Th1/Th2/Th17 cytometric bead assay (CBA) kit. The Th1/Th2 cytokine ratio was calculated from the IFN-γ/IL-6 ratio. As shown in
(5) Occurrence of Tumor-Specific Immune Responses
Compared with oncolytic adenoviruses expressing one of IL-12 and shVEGF, RdB/IL12/shVEGF creates a tumor environment advantageous for inducing tumor-specific immune responses. Therefore, the inventors measured the number of immune cells expressing IFN-γ, which is the cytokine secreted from activated T cells, and an in vivo experiment to determine whether RdB/IL12/shVEGF increases antitumor immune responses was carried out. Splenocytes of mice were obtained 7 days after final viral injection, and cultured with tumor cells of irradiated B16-F10 mice for 24 hours in the presence of recombinant human IL-2. Afterward, IFN-γ-secreted immune cells were measured in splenocytes using an IFN-γ ELISPOT kit. As shown in
(6) Increased Infiltration of CD4+ T Cells, CD8+ T Cells and Dendritic Cells into RdB/IL12/shVEGF-Treated Tumors
To examine the histological characteristics of tumor tissues shown after RdB/IL12/shVEGF treatment, tumor tissues were stained with hematoxylin and eosin (H&E) for analysis. Histological analysis showed increased tumor necrosis in tumor tissues of the RdB/IL12/shVEGF-administered mice, compared with the RdB/IL12 and RdB/shVEGF-treated groups. However, almost all tumor cells died in the RdB/IL12/shVEGF-treated group. Immune cells infiltrated into the tumor tissues were identified by immunohistochemical analysis using CD4-, CD8-, CD11c, and CD86-specific antibodies. When compared with the RdB/IL12- or RdB/shVEGF-treated group, in the RdB/IL12/shVEGF-treated group, high frequencies of CD4+T, CD8+T, CD86, and CD11c were observed in tumors in the central and boundary regions (
These results indicated that the co-expression of IL-12 and shVEGF in tumor tissues could induce strong activation and recruitment of T cells as well as dendritic cells. However, IL-12- and shVEGF-single expression are not effective for recruitment of T cells and dendritic cells to tumor tissues. As a result, the strongest anticancer immune responses are shown in tumor tissues due to intratumoral injection of adenoviruses co-expressing IL-12 and shVEGF.
(7) Prevention of Tumor-Induced Thymic Atrophy by RdB/IL12/shVEGF Treatment
Thymic atrophy is generally observed in tumor-bearing mice, and induces the suppression of host immunity against a tumor [27, 28]. In addition, even long-term exposure to recombinant VEGF induced thymic atrophy in vivo [21]. As a result, the prevention of thymic atrophy is important in overcoming tumor-induced immunosuppression. Therefore, the inventors measured changes in thymus volume and weight of adenovirus-treated mice. As seen from
Subsequently, to examine a change in thymuses of oncolytic adenovirus-treated mice, histological and immunohistochemical staining was performed on thymic tissues. Normal morphology was observed in the thymic tissues, and this result showed that, on day 7 after final injection of RdB/IL12-, RdB/shVEGF-, and RdB/IL12/shVEGF adenoviruses, the cortex and medulla regions in mice were clearly separated (
(8) Examination of Systemic Toxicity Using Animal Models
To examine systemic toxicity caused by treatment of recombinant adenoviruses (PBS, RdB, RdB/shVEGF, RdB/IL12, or RdB/IL12/shVEGF), specifically, 7 days after final treatment of the recombinant adenoviruses, the contents of IL-12 and IFN-γ remaining in mouse serum were quantified using an ELISA kit. As a result, in all sera of the RdB/shVEGF-, RdB/IL12-, or RdB/IL12/shVEGF-treated mice, as well as PBS- or RdB-treated mice, neither IL-12 nor IFN-γ was detected at all, indicating that the recombinant adenoviruses according to the present invention did not cause systemic toxicity.
| Number | Date | Country | Kind |
|---|---|---|---|
| 10-2015-0123644 | Sep 2015 | KR | national |
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/KR2016/009717 | 8/31/2016 | WO | 00 |