Patent Application
20210130818
Organisms have evolved multiple mechanisms to maintain genome integrity. As the cellular genome is constantly exposed to environmental damage, multiple DNA damage repair pathways exist to protect the genome from harmful or potentially catastrophic alterations. Double-strand break (DSB) repair pathways are highly conserved between eukaryotes including mammalian species. Non-homologous DNA end-joining (NHEJ) and homologous-directed recombination (HDR) are two major DNA repair pathways that can either act in concert or antagonistic manner. HDR is a pathway which uses template DNA such as an intact sister chromosomal copy or an exogenous donor to repair the DSBs, and thus can robustly generate perfect repair. However, HDR efficiency depends on species, cell type and the stage of the cell cycles. In mammalian cells, NHEJ has been considered the major pathway to repair the DNA, whereas HDR is more common in Saccharomyces cerevisiae. NHEJ is an imperfect process, which often leads to gain or loss of a few nucleotides at each end of the breakage site. This character can lead to subsequent deleterious genetic alteration that results in cellular malfunctioning, cancer or aging. The DNA repair enzymes KU70, KU80, and Ligase IV (LIG4) play central roles in NHEJ-mediated DNA repair, whereas KU70 and KU80 proteins stabilize the DNA ends and put them in physical proximity to facilitate end ligation performed by LIG4. On the other hand, proteins such as BRCA1/2, RAD50, RAD51 and various cell cycle regulators are directly involved in HDR, although the pathway has yet to be fully characterized.
The type II bacterial adaptive immune system, clustered regularly interspaced palindromic repeats (CRISPR)-associated protein 9 (Cas9) is a powerful genome editing tool. The Cas9-single guide RNA (sgRNA) complex induces site-specific DSBs, which can be repaired by either of the two main DNA repair pathways, NHEJ and HDR. The error-prone repairs by NHEJ often introduce unpredictable frame shift insertions and deletions (indels), leading to loss-of-function of target genes. In contrast, HDR can either generate perfect DNA repair or precise genome modification guided by donor templates. However, HDR is substantially less efficient compared to NHEJ in mammalian cells and most often restricted to S/G2 phase(s) of the cell cycle. Owning to the importance of HDR in mediating precise genetic modification, extensive efforts have been made to change the balance of DNA repair pathways. However, due to the intricacy of the DNA repair pathways, the available tools to enhance HDR are still limited to a few choices with relatively small effect. Moreover, little success to date has been achieved to directly augment the HDR pathway itself. Thus, manipulation of both HDR and NHEJ using simple genetic tools might enable or strengthen a variety of genome editing applications.
A need exists for compositions and methods for enhancing HDR. The present invention satisfies this need.
As described herein, the present invention relates to compositions and methods for enhancing homology directed repair (HDR) and/or decreasing DNA non-homologous end-joining (NHEJ) following CRISPR editing in a cell.
One aspect of the invention includes a vector comprising a first promoter, a dead guide RNA (dgRNA) comprising a 14-15 base pair (bp) sequence that targets a homology directed repair (HDR) gene and two MS2 binding loops, a second promoter, an MCP sequence, and a P65-HSF1 sequence.
Another aspect of the invention includes a vector comprising a first promoter, a dgRNA comprising a 14-15 base pair (bp) sequence that targets a non-homologous end joining (NHEJ) gene and a Com binding loop, a second promoter, a Com sequence, and a KRAB sequence.
Yet another aspect of the invention includes a vector comprising a promoter, a nonfunctional green fluorescent reporter containing a CRISPR targeting site, a self cleaving peptide, and a red fluorescent reporter containing a 2-bp shifted reading frame.
Still another aspect of the invention includes a vector comprising a first promoter, an rtTA sequence, a second promoter, a dead guide RNA (dgRNA) comprising a 14-15 base pair (bp) sequence that targets a homology directed repair (HDR) gene and two MS2 binding loops, a TREG3G promoter sequence, an MCP sequence, and a P65-HSF1 sequence.
In one aspect, the invention includes a vector comprising a first promoter sequence, an rtTA sequence, a second promoter, a dgRNA comprising a 14-15 base pair (bp) sequence that targets a non-homologous end joining (NHEJ) gene and a COM binding loop, a TREG3G promoter sequence, a COM sequence, and KRAB sequence.
In another aspect, the invention includes a vector comprising a first promoter, a dgRNA comprising a CDK1-2 targeting sequence and and two MS2 binding loops, a second promoter, an MCP sequence, and a P65-HSF1 sequence.
In yet another aspect, the invention includes a composition comprising any vector of the present invention and a Cas9.
In still another aspect, the invention includes a cell comprising one or more of the vectors of the present invention.
Another aspect of the invention includes a method of enhancing homology directed repair (HDR) and/or decreasing DNA non-homologous end-joining (NHEJ) following CRISPR editing in a cell. The method comprises administering to the cell a Cas9, a sgRNA, an activation plasmid, and a HDR donor template. The activation plasmid comprises a first promoter, a dead guide RNA (dgRNA) comprising a 14-15 base pair (bp) sequence that targets a homology directed repair (HDR) gene and two MS2 binding loops, a second promoter, an MCP sequence, and a P65-HSF1 sequence.
Yet another aspect of the invention includes a method of enhancing homology directed repair (HDR) and/or decreasing DNA non-homologous end-joining (NHEJ) following CRISPR editing in a cell, comprising administering to the cell a Cas9, a sgRNA, a repression plasmid, and a HDR donor template. The repression plasmid comprises a first promoter, a dgRNA comprising a 14-15 base pair (bp) sequence that targets a non-homologous end joining (NHEJ) gene and a Com binding loop, a second promoter, a Com sequence, and KRAB sequence.
Still another aspect of the invention includes a method of enhancing homology directed repair (HDR) and/or decreasing DNA non-homologous end-joining (NHEJ) following CRISPR editing in a cell, comprising administering to the cell a Cas9, a sgRNA, an activation plasmid, a repression plasmid, and a HDR donor template. The activation plasmid comprises a first promoter, a dead guide RNA (dgRNA) comprising a 14-15 base pair (bp) sequence that targets a homology directed repair (HDR) gene and two MS2 binding loops, a second promoter, an MCP sequence, and a P65-HSF1 sequence. The repression plasmid comprises a first promoter, a dgRNA comprising a 14-15 base pair (bp) sequence that targets a non-homologous end joining (NHEJ) gene and a Com binding loop, a second promoter, a Com sequence, and KRAB sequence.
In another aspect, the invention includes a composition comprising two of the vectors of the present invention.
In yet another aspect, the invention includes a kit comprising two of the vectors of the present invention, and instructional material for use thereof.
In various embodiments of the above aspects or any other aspect of the invention delineated herein, the vector comprises SEQ ID NO: 1. In one embodiment, the vector comprises SEQ ID NO: 2. In one embodiment, the vector comprises SEQ ID NO: 29. In one embodiment, the vector comprises SEQ ID NO: 30. In one embodiment, the vector comprises the nucleotide sequence of SEQ ID NO: 31 or SEQ ID NO: 32. In one embodiment, the vector comprises SEQ ID NO: 38.
In one embodiment, the HDR gene is selected from the group consisting of CDK1, CtIP, BRCA1/2, RAD50, and RAD51. In one embodiment, the sequence that targets a HDR gene is selected from the group consisting of SEQ ID NOs: 3-12. In one embodiment, the NHEJ gene is selected from the group consisting of LIG4, KU70 and KU80. In one embodiment, the NHEJ sequence is selected from the group consisting of SEQ ID NOs. 13-22.
In one embodiment, the first promoter comprises a CMV promoter or a U6 promoter and the second promoter comprises a CMV promoter or a U6 promoter. In one embodiment, the promoter is a CMV promoter. In one embodiment, the vector further comprises at least one component selected from the group consisting of an NLS sequence, a linker sequence, a polyA sequence, an SV40 sequence, and an antibiotic resistance sequence. In one embodiment, the vector further comprises a SV40 poly (A) signal.
In one embodiment, the nonfunctional green fluorescent reporter comprises an EGFP variant wherein codons 53-63 are disrupted.
In one embodiment, the cell is a human embryonic kidney 293 (HEK293) cell. In one embodiment, the cell further comprises a Cas9.
In one embodiment, the vector comprises a lentiviral backbone.
In one embodiment, the activation plasmid targets CDK1-2 and/or the repression plasmid targets KU80-1. In one embodiment, the repression and/or activation plasmid further comprises an inducible expression system. In one embodiment, the inducible expression system is a Tet-On system inducible by doxycycline (Dox).
In one embodiment, the activation plasmid comprises SEQ ID NO: 1. In one embodiment, the repression plasmid comprises SEQ ID NO: 2. In one embodiment, the first promoter of the repression and/or activation plasmid comprises a CMV promoter or a U6 promoter and the second promoter of the repression and/or activation plasmid comprises a CMV promoter or a U6 promoter. In one embodiment, the repression and/or activation plasmid further comprises at least one component selected from the group consisting of an NLS sequence, a linker sequence, a polyA sequence, an SV40 sequence, and an antibiotic resistance sequence.
In one embodiment, any method of the present invention further comprises administering the cell to an animal. In one embodiment, the repression and/or activation plasmid is packaged into a lentiviral vector. In one embodiment, the method further comprises administering the lentiviral vector to an animal. In one embodiment, the animal is a human.
In one embodiment, the composition further comprises a Cas9. In one embodiment, the kit further comprises a Cas9.
The following detailed description of specific embodiments of the invention will be better understood when read in conjunction with the appended drawings. For the purpose of illustrating the invention, there are shown in the drawings exemplary embodiments. It should be understood, however, that the invention is not limited to the precise arrangements and instrumentalities of the embodiments shown in the drawings.
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention pertains. Although any methods and materials similar or equivalent to those described herein can be used in the practice for testing of the present invention, the preferred materials and methods are described herein. In describing and claiming the present invention, the following terminology will be used.
It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting.
The articles “a” and “an” are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, “an element” means one element or more than one element. “About” as used herein when referring to a measurable value such as an amount, a temporal duration, and the like, is meant to encompass variations of ±20% or ±10%, more preferably ±5%, even more preferably ±1%, and still more preferably ±0.1% from the
As used herein, the term “autologous” is meant to refer to any material derived from the same individual to which it is later to be re-introduced into the individual.
“Allogeneic” refers to any material derived from a different animal of the same species.
As used herein, the term “bp” refers to base pair.
The term “complementary” refers to the degree of anti-parallel alignment between two nucleic acid strands. Complete complementarity requires that each nucleotide be across from its opposite. No complementarity requires that each nucleotide is not across from its opposite. The degree of complementarity determines the stability of the sequences to be together or anneal/hybridize. Furthermore various DNA repair functions as well as regulatory functions are based on base pair complementarity.
The term “CRISPR/Cas” or “clustered regularly interspaced short palindromic repeats” or “CRISPR” refers to DNA loci containing short repetitions of base sequences followed by short segments of spacer DNA from previous exposures to a virus or plasmid. Bacteria and archaea have evolved adaptive immune defenses termed CRISPR/CRISPR-associated (Cas) systems that use short RNA to direct degradation of foreign nucleic acids. In bacteria, the CRISPR system provides acquired immunity against invading foreign DNA via RNA-guided DNA cleavage.
The “CRISPR/Cas9” system or “CRISPR/Cas9-mediated gene editing” refers to a type II CRISPR/Cas system that has been modified for genome editing/engineering. It is typically comprised of a “guide” RNA (gRNA) and a non-specific CRISPR-associated endonuclease (Cas9). “Guide RNA (gRNA)” is used interchangeably herein with “short guide RNA (sgRNA)” or “single guide RNA (sgRNA). The sgRNA is a short synthetic RNA composed of a “scaffold” sequence necessary for Cas9-binding and a user-defined ˜20 nucleotide “spacer” or “targeting” sequence which defines the genomic target to be modified. The genomic target of Cas9 can be changed by changing the targeting sequence present in the sgRNA.
“CRISPRa” system refers to a modification of the CRISPR-Cas9 system that functions to activate or increase gene expression. In certain embodiments, the CRISPRa system is comprised of dCas9, at least one transcriptional activator, and at least one sgRNA that functions to increase expression of at least one gene of interest.
“dCas9” as used herein refers to a catalytically dead Cas9 protein that lacks endonuclease activity.
“dgRNA” or “dead guide RNA” refers to a guide RNA which is catalytically inactive yet maintains target-site binding capacity.
A “disease” is a state of health of an animal wherein the animal cannot maintain homeostasis, and wherein if the disease is not ameliorated then the animal's health continues to deteriorate. In contrast, a “disorder” in an animal is a state of health in which the animal is able to maintain homeostasis, but in which the animal's state of health is less favorable than it would be in the absence of the disorder. Left untreated, a disorder does not necessarily cause a further decrease in the animal's state of health.
The term “downregulation” as used herein refers to the decrease or elimination of gene expression of one or more genes.
“Effective amount” or “therapeutically effective amount” are used interchangeably herein, and refer to an amount of a compound, formulation, material, or composition, as described herein effective to achieve a particular biological result or provides a therapeutic or prophylactic benefit. Such results may include, but are not limited to, anti-tumor activity as determined by any means suitable in the art.
“Encoding” refers to the inherent property of specific sequences of nucleotides in a polynucleotide, such as a gene, a cDNA, or an mRNA, to serve as templates for synthesis of other polymers and macromolecules in biological processes having either a defined sequence of nucleotides (i.e., rRNA, tRNA and mRNA) or a defined sequence of amino acids and the biological properties resulting therefrom. Thus, a gene encodes a protein if transcription and translation of mRNA corresponding to that gene produces the protein in a cell or other biological system. Both the coding strand, the nucleotide sequence of which is identical to the mRNA sequence and is usually provided in sequence listings, and the non-coding strand, used as the template for transcription of a gene or cDNA, can be referred to as encoding the protein or other product of that gene or cDNA.
As used herein “endogenous” refers to any material from or produced inside an organism, cell, tissue or system.
As used herein, the term “exogenous” refers to any material introduced from or produced outside an organism, cell, tissue or system.
The term “expression” as used herein is defined as the transcription and/or translation of a particular nucleotide sequence driven by its promoter.
“Expression vector” refers to a vector comprising a recombinant polynucleotide comprising expression control sequences operatively linked to a nucleotide sequence to be expressed. An expression vector comprises sufficient cis-acting elements for expression; other elements for expression can be supplied by the host cell or in an in vitro expression system. Expression vectors include all those known in the art, such as cosmids, plasmids (e.g., naked or contained in liposomes) and viruses (e.g., Sendai viruses, lentiviruses, retroviruses, adenoviruses, and adeno-associated viruses) that incorporate the recombinant polynucleotide.
“Homologous” as used herein, refers to the subunit sequence identity between two polymeric molecules, e.g., between two nucleic acid molecules, such as, two DNA molecules or two RNA molecules, or between two polypeptide molecules. When a subunit position in both of the two molecules is occupied by the same monomeric subunit; e.g., if a position in each of two DNA molecules is occupied by adenine, then they are homologous at that position. The homology between two sequences is a direct function of the number of matching or homologous positions; e.g., if half (e.g., five positions in a polymer ten subunits in length) of the positions in two sequences are homologous, the two sequences are 50% homologous; if 90% of the positions (e.g., 9 of 10), are matched or homologous, the two sequences are 90% homologous.
“Identity” as used herein refers to the subunit sequence identity between two polymeric molecules particularly between two amino acid molecules, such as, between two polypeptide molecules. When two amino acid sequences have the same residues at the same positions; e.g., if a position in each of two polypeptide molecules is occupied by an Arginine, then they are identical at that position. The identity or extent to which two amino acid sequences have the same residues at the same positions in an alignment is often expressed as a percentage. The identity between two amino acid sequences is a direct function of the number of matching or identical positions; e.g., if half (e.g., five positions in a polymer ten amino acids in length) of the positions in two sequences are identical, the two sequences are 50% identical; if 90% of the positions (e.g., 9 of 10), are matched or identical, the two amino acids sequences are 90% identical.
As used herein, an “instructional material” includes a publication, a recording, a diagram, or any other medium of expression which can be used to communicate the usefulness of the compositions and methods of the invention. The instructional material of the kit of the invention may, for example, be affixed to a container which contains the nucleic acid, peptide, and/or composition of the invention or be shipped together with a container which contains the nucleic acid, peptide, and/or composition. Alternatively, the instructional material may be shipped separately from the container with the intention that the instructional material and the compound be used cooperatively by the recipient.
“Isolated” means altered or removed from the natural state. For example, a nucleic acid or a peptide naturally present in a living animal is not “isolated,” but the same nucleic acid or peptide partially or completely separated from the coexisting materials of its natural state is “isolated.” An isolated nucleic acid or protein can exist in substantially purified form, or can exist in a non-native environment such as, for example, a host cell.
The term “knockdown” as used herein refers to a decrease in gene expression of one or more genes.
The term “knockout” as used herein refers to the ablation of gene expression of one or more genes.
A “lentivirus” as used herein refers to a genus of the Retroviridae family. Lentiviruses are unique among the retroviruses in being able to infect non-dividing cells; they can deliver a significant amount of genetic information into the DNA of the host cell, so they are one of the most efficient vectors for gene delivery. HIV, SIV, and FIV are all examples of lentiviruses. Vectors derived from lentiviruses offer the means to achieve significant levels of gene transfer in vivo.
By the term “modified” as used herein, is meant a changed state or structure of a molecule or cell of the invention. Molecules may be modified in many ways, including chemically, structurally, and functionally. Cells may be modified through the introduction of nucleic acids.
By the term “modulating,” as used herein, is meant mediating a detectable increase or decrease in the level of a response in a subject compared with the level of a response in the subject in the absence of a treatment or compound, and/or compared with the level of a response in an otherwise identical but untreated subject. The term encompasses perturbing and/or affecting a native signal or response thereby mediating a beneficial therapeutic response in a subject, preferably, a human.
A “mutation” as used herein is a change in a DNA sequence resulting in an alteration from a given reference sequence (which may be, for example, an earlier collected DNA sample from the same subject). The mutation can comprise deletion and/or insertion and/or duplication and/or substitution of at least one deoxyribonucleic acid base such as a purine (adenine and/or thymine) and/or a pyrimidine (guanine and/or cytosine). Mutations may or may not produce discernible changes in the observable characteristics (phenotype) of an organism (subject).
By “nucleic acid” is meant any nucleic acid, whether composed of deoxyribonucleosides or ribonucleosides, and whether composed of phosphodiester linkages or modified linkages such as phosphotriester, phosphoramidate, siloxane, carbonate, carboxymethylester, acetamidate, carbamate, thioether, bridged phosphoramidate, bridged methylene phosphonate, phosphorothioate, methylphosphonate, phosphorodithioate, bridged phosphorothioate or sulfone linkages, and combinations of such linkages. The term nucleic acid also specifically includes nucleic acids composed of bases other than the five biologically occurring bases (adenine, guanine, thymine, cytosine and uracil). In the context of the present invention, the following abbreviations for the commonly occurring nucleic acid bases are used. “A” refers to adenosine, “C” refers to cytosine, “G” refers to guanosine, “T” refers to thymidine, and “U” refers to uridine.
Unless otherwise specified, a “nucleotide sequence encoding an amino acid sequence” includes all nucleotide sequences that are degenerate versions of each other and that encode the same amino acid sequence. The phrase nucleotide sequence that encodes a protein or an RNA may also include introns to the extent that the nucleotide sequence encoding the protein may in some version contain an intron(s).
The term “oligonucleotide” typically refers to short polynucleotides, generally no greater than about 60 nucleotides. It will be understood that when a nucleotide sequence is represented by a DNA sequence (i.e., A, T, G, C), this also includes an RNA sequence (i.e., A, U, G, C) in which “U” replaces “T”.
As used herein, the terms “peptide,” “polypeptide,” and “protein” are used interchangeably, and refer to a compound comprised of amino acid residues covalently linked by peptide bonds. A protein or peptide must contain at least two amino acids, and no limitation is placed on the maximum number of amino acids that can comprise a protein's or peptide's sequence. Polypeptides include any peptide or protein comprising two or more amino acids joined to each other by peptide bonds. As used herein, the term refers to both short chains, which also commonly are referred to in the art as peptides, oligopeptides and oligomers, for example, and to longer chains, which generally are referred to in the art as proteins, of which there are many types. “Polypeptides” include, for example, biologically active fragments, substantially homologous polypeptides, oligopeptides, homodimers, heterodimers, variants of polypeptides, modified polypeptides, derivatives, analogs, fusion proteins, among others. The polypeptides include natural peptides, recombinant peptides, synthetic peptides, or a combination thereof.
“Parenteral” administration of an immunogenic composition includes, e.g., subcutaneous (s.c.), intravenous (i.v.), intramuscular (i.m.), or intrasternal injection, or infusion techniques.
As used herein, the terms “peptide,” “polypeptide,” and “protein” are used interchangeably, and refer to a compound comprised of amino acid residues covalently linked by peptide bonds. A protein or peptide must contain at least two amino acids, and no limitation is placed on the maximum number of amino acids that can comprise a protein's or peptide's sequence. Polypeptides include any peptide or protein comprising two or more amino acids joined to each other by peptide bonds. As used herein, the term refers to both short chains, which also commonly are referred to in the art as peptides, oligopeptides and oligomers, for example, and to longer chains, which generally are referred to in the art as proteins, of which there are many types. “Polypeptides” include, for example, biologically active fragments, substantially homologous polypeptides, oligopeptides, homodimers, heterodimers, variants of polypeptides, modified polypeptides, derivatives, analogs, fusion proteins, among others. The polypeptides include natural peptides, recombinant peptides, synthetic peptides, or a combination thereof.
The term “polynucleotide” as used herein is defined as a chain of nucleotides. Furthermore, nucleic acids are polymers of nucleotides. Thus, nucleic acids and polynucleotides as used herein are interchangeable. One skilled in the art has the general knowledge that nucleic acids are polynucleotides, which can be hydrolyzed into the monomeric “nucleotides.” The monomeric nucleotides can be hydrolyzed into nucleosides. As used herein polynucleotides include, but are not limited to, all nucleic acid sequences which are obtained by any means available in the art, including, without limitation, recombinant means, i.e., the cloning of nucleic acid sequences from a recombinant library or a cell genome, using ordinary cloning technology and PCR™, and the like, and by synthetic means. Conventional notation is used herein to describe polynucleotide sequences: the left-hand end of a single-stranded polynucleotide sequence is the 5′-end; the left-hand direction of a double-stranded polynucleotide sequence is referred to as the 5′-direction.
A “sample” or “biological sample” as used herein means a biological material from a subject, including but is not limited to organ, tissue, exosome, blood, plasma, saliva, urine and other body fluid. A sample can be any source of material obtained from a subject.
The term “subject” is intended to include living organisms in which an immune response can be elicited (e.g., mammals). A “subject” or “patient,” as used therein, may be a human or non-human mammal. Non-human mammals include, for example, livestock and pets, such as ovine, bovine, porcine, canine, feline and murine mammals. Preferably, the subject is human.
As used herein, a “substantially purified” cell is a cell that is essentially free of other cell types. A substantially purified cell also refers to a cell which has been separated from other cell types with which it is normally associated in its naturally occurring state. In some instances, a population of substantially purified cells refers to a homogenous population of cells. In other instances, this term refers simply to cell that have been separated from the cells with which they are naturally associated in their natural state. In some embodiments, the cells are cultured in vitro. In other embodiments, the cells are not cultured in vitro.
A “target site” or “target sequence” refers to a genomic nucleic acid sequence that defines a portion of a nucleic acid to which a binding molecule may specifically bind under conditions sufficient for binding to occur.
The term “therapeutic” as used herein means a treatment and/or prophylaxis. A therapeutic effect is obtained by suppression, remission, or eradication of a disease state.
The term “transfected” or “transformed” or “transduced” as used herein refers to a process by which exogenous nucleic acid is transferred or introduced into the host cell. A “transfected” or “transformed” or “transduced” cell is one which has been transfected, transformed or transduced with exogenous nucleic acid. The cell includes the primary subject cell and its progeny.
To “treat” a disease as the term is used herein, means to reduce the frequency or severity of at least one sign or symptom of a disease or disorder experienced by a subject.
A “vector” is a composition of matter which comprises an isolated nucleic acid and which can be used to deliver the isolated nucleic acid to the interior of a cell. Numerous vectors are known in the art including, but not limited to, linear polynucleotides, polynucleotides associated with ionic or amphiphilic compounds, plasmids, and viruses. Thus, the term “vector” includes an autonomously replicating plasmid or a virus. The term should also be construed to include non-plasmid and non-viral compounds which facilitate transfer of nucleic acid into cells, such as, for example, polylysine compounds, liposomes, and the like. Examples of viral vectors include, but are not limited to, Sendai viral vectors, adenoviral vectors, adeno-associated virus vectors, retroviral vectors, lentiviral vectors, and the like.
Ranges: throughout this disclosure, various aspects of the invention can be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 2.7, 3, 4, 5, 5.3, and 6. This applies regardless of the breadth of the range.
CRISPR systems have been proven as versatile tools for site-specific genome engineering in mammalian species. During the gene editing processes, these RNA-guide nucleases introduce DNA double strand breaks (DSBs), in which non-homologous end joining (NHEJ) dominates the DNA repair pathway, limiting the efficiency of homology-directed repair (HDR), the alternative pathway essential for precise gene targeting. Multiple approaches have been developed to enhance HDR, including chemical compound or RNA interference mediated inhibition of NHEJ factors, small molecule activation of HDR enzymes, or cell cycle timed delivery of CRISPR complex. However, these approaches face multiple challenges, yet have moderate or variable effects. Herein, a new approach was developed that programs both NHEJ and HDR pathways with CRISPR activation and interference (CRISPRa/i) to achieve significantly enhanced HDR efficiency of CRISPR mediated gene editing. The manipulation of NHEJ and HDR pathway components, such as CtIP, CDK1, KU70, KU80 and LIG4, was performed with dead guide RNAs (dgRNAs), thus relying on only a single catalytically active Cas9 to perform CRISPRa/i as well as precise gene editing. While reprogramming of most DNA repair factors or their combinations tested enhanced HDR efficiency, simultaneously activating CDK1 and repressing KU80 has strongest effect with nearly 4-8-fold improvement. Doxycycline-induced dgRNA-based CRISPRa/i programming of DNA repair enzymes as well as viral packaging enabled flexible and tunable HDR enhancement in mammalian cells. This study provides an effective, flexible and safer strategy to enhance precise genome modifications, which broadly impacts human gene editing and therapy.
As described herein, the compositions and methods described herein provide many advantages including but not limited to: 1) the manipulation of NHEJ and HDR pathway components, such as CtIP, CDK1, KU70, KU80 and LIG4, was performed with a dead guide RNA (dgRNA), thus relying on only a single catalytically active Cas9 to perform CRISPRa/i as well as precise gene editing. 2) Reprogramming of most DNA repair factors or combinations tested enhanced HDR efficiency. 3) With simultaneously activation of CDK1 by dgRNA-MS2:MPH and/or repression of KU80 by dgRNA-Com:CK, the HDR efficiency can be enhanced by over an order of magnitude (upto 13 fold enhancement in two independent cell lines, one of the strongest effect among all methods available). 4) This is a genetic approach; thus the components can join force with an armamentarium of other genetic tools such as inducible gene expression modules via simple genetic engineering. 5) The CRISPRa/i constructs can be packaged into viral vectors for efficient delivery into a large repertoire of cell types. 6) Finally, this approach of HDR enhancement thus can be easily adapted for in vivo settings, which is essential for the application of gene therapy.
Certain aspects of the invention include compositions comprising plasmids, vectors, and kits for use in enhancing homology directed repair (HDR) and/or reducing non-homologous end joining (NHEJ) in a cell following CRISPR-mediated editing.
In certain embodiments, the invention includes use of “dead guide RNAs” (dgRNAs). Recently, these 14-nt or 15-nt guide RNAs have been shown to be catalytically inactive yet maintain target-site binding capacity (Kiani et al. (2015) Nat Methods 12, 1051-1054; Dahlman et al. (2015) Nat Biotechnol 33(11): 1159-1161). Thus, these catalytically dead guide RNAs (dgRNAs) can be utilized to modulate gene expression using a catalytically active Cas9. Therefore, an active Cas9 nuclease can be repurposed to simultaneously perform genome editing and regulate gene transcription using both types of gRNAs in the same cell. As demonstrated herein, dgRNAs together with the associated CRISPR activation (CRISPRa) and interference (CRISPRi) modules are deployed to achieve HDR enhancement using a single active Cas9.
In one aspect, the invention provides an activation plasmid/vector (dgRNA-MS2:MPH). The vector utilizes the MS2-P65-HSF (MPH) activation complex, which mediates efficient target upregulation by binding to MS2 loops in the dgRNA (Konermann et al. (2013) Nature 500:472-476). In one embodiment, the vector comprises a first promoter, a dead guide RNA (dgRNA) comprising a 14-15 base pair (bp) sequence that targets a homology directed repair (HDR) gene and two MS2 binding loops, a second promoter, a MS2 bacteriophage coat protein (MCP) sequence, and a P65-HSF1 sequence. In one embodiment, the vector comprises SEQ ID NO: 1. The HDR gene can include but is not limited to CDK1, CtIP, BRCA1/2, RAD50, and RAD51. In one embodiment, the sequence that targets a HDR gene is selected from the group consisting of SEQ ID NOs: 3-12.
In another aspect, the invention includes a repression plasmid/vector (dgRNA-Com:CK). The vector utilizes a Com-KRAB (CK) fusion domain. KRAB is a potent transcriptional repressor that recruits chromatin modifiers to silence target genes (Groner et al (2010) PLos Genet. 6:e1000869). Com is a well-characterized viral RNA sequence recognized by Com RNA binding protein (Zalatan et al. (2015) Cell 160(0):339-350). In certain embodiments of the vectors presented herein, a Com binding loop was constructed into a dgRNA scaffold for recruiting the Com-KRAB (CK) fusion domain to repress NHEJ-related genes. In one embodiment, the vector comprises a first promoter, a dgRNA comprising a 14-15 base pair (bp) sequence that targets a non-homologous end joining (NHEJ) gene and a Com binding loop, a second promoter, a Com sequence, and KRAB sequence. In one embodiment, the vector comprises SEQ ID NO: 2. Examples of NHEJ genes include but are not limited to LIG4, KU70 and KU80. In one embodiment, the NHEJ sequence is selected from the group consisting of SEQ ID NOs. 13-22.
In yet another aspect, the invention includes inducible repression and activation plasmids/vectors. In one embodiment, the vector comprises a first promoter sequence, an rtTA sequence, a second promoter sequence, a dead guide RNA (dgRNA) comprising a 14-15 base pair (bp) sequence that targets a HDR gene and two MS2 binding loops, a TREG3G promoter sequence, an MCP sequence, and a P65-HSF1 sequence. In one embodiment, the vector comprises SEQ ID NO: 29. In one embodiment, the sequence that targets a HDR gene is selected from the group consisting of SEQ ID NOs: 3-12. In another embodiment, the vector comprises a first promoter sequence, an rtTA sequence, a second promoter, a dgRNA comprising a 14-15 base pair (bp) sequence that targets a NHEJ gene and a COM binding loop, a TREG3G promoter sequence, a COM sequence, and KRAB sequence. In one embodiment, the vector comprises SEQ ID NO: 30. In one embodiment, the NHEJ sequence is selected from the group consisting of SEQ ID NOs. 13-22.
Another aspect of the invention includes a traffic light reporter plasmid/vector. In one embodiment, the vector comprises a promoter, a nonfunctional green fluorescent reporter containing a CRISPR targeting site, a self cleaving peptide, and a red fluorescent reporter containing a 2-bp shifted reading frame. In certain embodiments, the nonfunctional green fluorescent reporter comprises an EGFP variant wherein codons 53-63 are disrupted. In one embodiment, the vector comprises the nucleotide sequence of SEQ ID NO: 31. In one embodiment, the vector comprises the nucleotide sequence of SEQ ID NO: 32.
Any promoter known to one of ordinary skill in the art can be incorporated into any of the vectors/plasmids of the present invention. Suitable promoter and enhancer elements are known to those of skill in the art. For expression in a bacterial cell, suitable promoters include, but are not limited to, lad, lacZ, T3, T7, gpt, lambda P and trc. For expression in a eukaryotic cell, suitable promoters include, but are not limited to, light and/or heavy chain immunoglobulin gene promoter and enhancer elements; cytomegalovirus immediate early promoter; herpes simplex virus thymidine kinase promoter; early and late SV40 promoters; promoter present in long terminal repeats from a retrovirus; mouse metallothionein-I promoter; and various art-known tissue specific promoters. Suitable reversible promoters, including reversible inducible promoters are known in the art. Such reversible promoters may be isolated and derived from many organisms, e.g., eukaryotes and prokaryotes. Modification of reversible promoters derived from a first organism for use in a second organism, e.g., a first prokaryote and a second a eukaryote, a first eukaryote and a second a prokaryote, etc., is well known in the art. Such reversible promoters, and systems based on such reversible promoters but also comprising additional control proteins, include, but are not limited to, alcohol regulated promoters (e.g., alcohol dehydrogenase I (alcA) gene promoter, promoters responsive to alcohol transactivator proteins (AlcR), etc.), tetracycline regulated promoters, (e.g., promoter systems including TetActivators, TetON, TetOFF, etc.), steroid regulated promoters (e.g., rat glucocorticoid receptor promoter systems, human estrogen receptor promoter systems, retinoid promoter systems, thyroid promoter systems, ecdysone promoter systems, mifepristone promoter systems, etc.), metal regulated promoters (e.g., metallothionein promoter systems, etc.), pathogenesis-related regulated promoters (e.g., salicylic acid regulated promoters, ethylene regulated promoters, benzothiadiazole regulated promoters, etc.), temperature regulated promoters (e.g., heat shock inducible promoters (e.g., HSP-70, HSP-90, soybean heat shock promoter, etc.), light regulated promoters, synthetic inducible promoters, and the like.
Other examples of suitable promoters include the immediate early cytomegalovirus (CMV) promoter sequence. This promoter sequence is a strong constitutive promoter sequence capable of driving high levels of expression of any polynucleotide sequence operatively linked thereto. Other constitutive promoter sequences may also be used, including, but not limited to a simian virus 40 (SV40) early promoter, a mouse mammary tumor virus (MMTV) or human immunodeficiency virus (HIV) long terminal repeat (LTR) promoter, a MoMuLV promoter, an avian leukemia virus promoter, an Epstein-Barr virus immediate early promoter, a Rous sarcoma virus promoter, the EF-1 alpha promoter, as well as human gene promoters such as, but not limited to, an actin promoter, a myosin promoter, a hemoglobin promoter, and a creatine kinase promoter. Further, the invention should not be limited to the use of constitutive promoters. Inducible promoters are also contemplated as part of the invention. The use of an inducible promoter provides a molecular switch capable of turning on expression of the polynucleotide sequence which it is operatively linked when such expression is desired, or turning off the expression when expression is not desired. Examples of inducible promoters include, but are not limited to a metallothionine promoter, a glucocorticoid promoter, a progesterone promoter, and a tetracycline promoter.
In one embodiment, the vector comprises a CMV promoter and/or a U6 promoter. Certain embodiments of the invention include more than one promoter per plasmid/vector. It should be known to one of ordinary skill in the art that the when a plasmid/vector comprises more than one promoter, said promoters can include two or more of the same promoter or two or more different promoters. For example, the vector may comprise a first promoter comprising a CMV promoter and a second promoter comprising a U6 promoter.
In addition, any of the vectors/plasmids of the present invention can include additional components. For example, the vector can further comprise an NLS sequence, a linker sequence, a polyA sequence, an SV40 sequence, and an antibiotic resistance gene/sequence. Any antibiotic resistance gene/sequence or selection marker known to one of ordinary skill in the art can be include in the vector. For example, the vector can comprise a Zeocin sequence. In one embodiment, the vector comprises a Hygromycin sequence.
The invention should be construed to encompass any type of vector known to one of ordinary skill in the art. For example, the vector can comprise a lentivirus, but can also comprise other viral vectors including but not limited to adenovirus, adeno-associated virus, retrovirus, hybrid viral vectors, or any combinations thereof. In one embodiment, the vector comprises a lentiviral backbone. In one embodiment, the vector comprises the nucleotide sequence of SEQ ID NO: 38.
In another aspect, the invention includes a cell or cell line comprising any of the plasmids/vectors of the present invention. Any type of cell line known to one of ordinary skill in the art can be utilized. For example, the invention can include a human embryonic kidney 293 (HEK293) cell or cell line comprising a plasmid/vector of the present invention. Other cell types include but are not limited to HeLa cells, T cells, autologous cells, and CAR T cells. The cell can include addition components, including but not limited to components useful for gene editing. For example, Cas9 can be included in the cell. Cas9 can be administered to the cell in any form, such as a plasmid, DNA, RNA, and protein.
Certain aspects of the invention include methods for increasing homology directed repair (HDR) and/or decreasing non-homolgous end joining (NHEJ) in a cell. Certain aspects include methods for gene editing in a cell or in an animal.
One aspect of the invention includes a method of enhancing homology directed repair (HDR) and/or decreasing DNA non-homologous end-joining (NHEJ) following CRISPR editing in a cell. The method comprises administering to the cell a Cas9, a sgRNA, an activation plasmid, and a HDR donor template. The activation plasmid comprises a first promoter, a dead guide RNA (dgRNA) comprising a 14-15 base pair (bp) sequence that targets a homology directed repair (HDR) gene and two MS2 binding loops, a second promoter, an MCP sequence, and a P65-HSF1 sequence.
Another aspect of the invention includes a method of enhancing homology directed repair (HDR) and/or decreasing DNA non-homologous end-joining (NHEJ) following CRISPR editing in a cell comprising administering to the cell a Cas9, a sgRNA, a repression plasmid, and a HDR donor template. The repression plasmid comprises a first promoter, a dgRNA comprising a 14-15 base pair (bp) sequence that targets a non-homologous end joining (NHEJ) gene and a Com binding loop, a second promoter, a Com sequence, and KRAB sequence.
Yet another aspect of the invention includes a method of enhancing homology directed repair (HDR) and/or decreasing DNA non-homologous end-joining (NHEJ) following CRISPR editing in a cell, comprising administering to the cell a Cas9, a sgRNA, an activation plasmid, a repression plasmid, and a HDR donor template. The activation plasmid comprises a first promoter, a dead guide RNA (dgRNA) comprising a 14-15 base pair (bp) sequence that targets a homology directed repair (HDR) gene and two MS2 binding loops, a second promoter, an MCP sequence, and a P65-HSF1 sequence. The repression plasmid comprises a first promoter, a dgRNA comprising a 14-15 base pair (bp) sequence that targets a non-homologous end joining (NHEJ) gene and a Com binding loop, a second promoter, a Com sequence, and KRAB sequence.
In one embodiment, the activation plasmid targets CDK1-2 and/or the repression plasmid targets KU80-1. In one embodiment, the HDR gene is selected from the group consisting of CDK1, CtIP, BRCA1/2, RAD50, and RAD51. In one embodiment, NHEJ gene is selected from the group consisting of LIG4, KU70 and KU80. In one embodiment, the sequence that targets a HDR gene is selected from the group consisting of SEQ ID NOs: 3-12. In one embodiment, the sequence that targets a NHEJ gene is selected from the group consisting of SEQ ID NOs. 13-22.
In one embodiment, the activation plasmid comprises SEQ ID NO: 1. In one embodiment, the repression plasmid comprises SEQ ID NO: 2.
The repression and/or activation plasmid can be designed to further comprise an inducible expression system. For example, a Tet-On system can be included in the plasmid, which is inducible by doxycycline (Dox).
The first promoter of the repression and/or activation plasmid can comprise a CMV promoter or a U6 promoter and the second promoter of the repression and/or activation plasmid can comprise a CMV promoter or a U6 promoter. The repression and/or activation plasmid may further comprise additional components including but not limited to a NLS sequence, a linker sequence, a polyA sequence, an SV40 sequence, and an antibiotic resistance sequence.
The sgRNAs can be designed to target any gene or non-coding region of interest.
The repression and/or activation plasmids can be packaged into a lentiviral vector and be administered to an animal. In one embodiment, the animal is a human. Administration to the animal may be performed by any means known to one of ordinary skill in the art.
The CRISPR/Cas9 system is a facile and efficient system for inducing targeted genetic alterations. Target recognition by the Cas9 protein requires a ‘seed’ sequence within the guide RNA (gRNA) and a conserved dinucleotide containing protospacer adjacent motif (PAM) sequence upstream of the gRNA-binding region. The CRISPR/Cas9 system can thereby be engineered to cleave virtually any DNA sequence by redesigning the gRNA in cell lines (such as 2931 cells), primary cells, and CAR T cells. The CRISPR/Cas9 system can simultaneously target multiple genomic loci by co-expressing a single Cas9 protein with two or more gRNAs, making this system uniquely suited for multiple gene editing or synergistic activation of target genes.
The Cas9 protein and guide RNA form a complex that identifies and cleaves target sequences. Cas9 is comprised of six domains: REC I, REC II, Bridge Helix, PAM interacting, FINK and RuvC. The Reel domain binds the guide RNA, while the Bridge helix binds to target DNA. The HNH and RuvC domains are nuclease domains. Guide RNA is engineered to have a 5′ end that is complementary to the target DNA sequence. Upon binding of the guide RNA to the Cas9 protein, a conformational change occurs activating the protein. Once activated, Cas9 searches for target DNA by binding to sequences that match its protospacer adjacent motif (PAM) sequence. A PAM is a two or three nucleotide base sequence within one nucleotide downstream of the region complementary to the guide RNA. In one non-limiting example, the PAM sequence is 5′-NGG-3′. When the Cas9 protein finds its target sequence with the appropriate PAM, it melts the bases upstream of the PAM and pairs them with the complementary region on the guide RNA. Then the RuvC and HNH nuclease domains cut the target DNA after the third nucleotide base upstream of the PAM.
One non-limiting example of a CRISPR/Cas system used to inhibit gene expression, CRISPRi, is described in U.S. Patent Appl. Publ. No. US20140068797. CRISPRi induces permanent gene disruption that utilizes the RNA-guided Cas9 endonuclease to introduce DNA double stranded breaks, which trigger error-prone repair pathways to result in frame shift mutations. A catalytically dead Cas9 lacks endonuclease activity. When coexpressed with a guide RNA, a DNA recognition complex is generated that specifically interferes with transcriptional elongation, RNA polymerase binding, or transcription factor binding. This CRISPRi system efficiently represses expression of targeted genes.
CRISPR/Cas gene disruption occurs when a guide nucleotide sequence specific for a target gene and a Cas endonuclease are introduced into a cell and form a complex that enables the Cas endonuclease to introduce a double strand break at the target gene. In certain embodiments, the CRISPR/Cas system comprises an expression vector, such as, but not limited to, an pAd5F35-CRISPR vector. In other embodiments, the Cas expression vector induces expression of Cas9 endonuclease. Other endonucleases may also be used, including but not limited to, T7, Cas3, Cas8a, Cas8b, Cas10d, Cse1, Csy1, Csn2, Cas4, Cas10, Csm2, Cmr5, Fok1, other nucleases known in the art, and any combinations thereof.
In certain embodiments, inducing the Cas9 expression vector comprises exposing the cell to an agent that activates an inducible promoter in the Cas9 expression vector. In such embodiments, the Cas9 expression vector includes an inducible promoter, such as one that is inducible by exposure to an antibiotic (e.g., by tetracycline or a derivative of tetracycline, for example doxycycline). However, it should be appreciated that other inducible promoters can be used. The inducing agent can be a selective condition (e.g., exposure to an agent, for example an antibiotic) that results in induction of the inducible promoter. This results in expression of the Cas expression vector.
In certain embodiments, guide RNA(s) and Cas9 can be delivered to a cell as a ribonucleoprotein (RNP) complex. RNPs are comprised of purified Cas9 protein complexed with gRNA and are well known in the art to be efficiently delivered to multiple types of cells, including but not limited to stem cells and immune cells (Addgene, Cambridge, Mass., Mirus Bio LLC, Madison, Wis.).
The guide RNA is specific for a genomic region of interest and targets that region for Cas endonuclease-induced double strand breaks. The target sequence of the guide RNA sequence may be within a loci of a gene or within a non-coding region of the genome. In certain embodiments, the guide nucleotide sequence is at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40 or more nucleotides in length.
Guide RNA (gRNA), also referred to as “short guide RNA” or “sgRNA”, provides both targeting specificity and scaffolding/binding ability for the Cas9 nuclease. The gRNA can be a synthetic RNA composed of a targeting sequence and scaffold sequence derived from endogenous bacterial crRNA and tracrRNA. gRNA is used to target Cas9 to a specific genomic locus in genome engineering experiments. Guide RNAs can be designed using standard tools well known in the art.
In the context of formation of a CRISPR complex, “target sequence” refers to a sequence to which a guide sequence is designed to have some complementarity, where hybridization between a target sequence and a guide sequence promotes the formation of a CRISPR complex. Full complementarity is not necessarily required, provided there is sufficient complementarity to cause hybridization and promote formation of a CRISPR complex. A target sequence may comprise any polynucleotide, such as a DNA or a RNA polynucleotide. In certain embodiments, a target sequence is located in the nucleus or cytoplasm of a cell. In other embodiments, the target sequence may be within an organelle of a eukaryotic cell, for example, mitochondrion or nucleus. Typically, in the context of an endogenous CRISPR system, formation of a CRISPR complex (comprising a guide sequence hybridized to a target sequence and complexed with one or more Cas proteins) results in cleavage of one or both strands in or near (e.g., within about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 50 or more base pairs) the target sequence. As with the target sequence, it is believed that complete complementarity is not needed, provided this is sufficient to be functional.
In certain embodiments, one or more vectors driving expression of one or more elements of a CRISPR system are introduced into a host cell, such that expression of the elements of the CRISPR system direct formation of a CRISPR complex at one or more target sites. For example, a Cas enzyme, a guide sequence linked to a tracr-mate sequence, and a tracr sequence could each be operably linked to separate regulatory elements on separate vectors. Alternatively, two or more of the elements expressed from the same or different regulatory elements may be combined in a single vector, with one or more additional vectors providing any components of the CRISPR system not included in the first vector. CRISPR system elements that are combined in a single vector may be arranged in any suitable orientation, such as one element located 5′ with respect to (“upstream” of) or 3′ with respect to (“downstream” of) a second element. The coding sequence of one element may be located on the same or opposite strand of the coding sequence of a second element, and oriented in the same or opposite direction. In certain embodiments, a single promoter drives expression of a transcript encoding a CRISPR enzyme and one or more of the guide sequence, tracr mate sequence (optionally operably linked to the guide sequence), and a tracr sequence embedded within one or more intron sequences (e.g., each in a different intron, two or more in at least one intron, or all in a single intron).
In certain embodiments, the CRISPR enzyme is part of a fusion protein comprising one or more heterologous protein domains (e.g. about or more than about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more domains in addition to the CRISPR enzyme). A CRISPR enzyme fusion protein may comprise any additional protein sequence, and optionally a linker sequence between any two domains. Examples of protein domains that may be fused to a CRISPR enzyme include, without limitation, epitope tags, reporter gene sequences, and protein domains having one or more of the following activities: methylase activity, demethylase activity, transcription activation activity, transcription repression activity, transcription release factor activity, histone modification activity, RNA cleavage activity and nucleic acid binding activity. Additional domains that may form part of a fusion protein comprising a CRISPR enzyme are described in U.S. Patent Appl. Publ. No. US20110059502, which is incorporated herein by reference. In certain embodiments, a tagged CRISPR enzyme is used to identify the location of a target sequence.
Conventional viral and non-viral based gene transfer methods can be used to introduce nucleic acids in mammalian and non-mammalian cells or target tissues. Such methods can be used to administer nucleic acids encoding components of a CRISPR system to cells in culture, or in a host organism. Non-viral vector delivery systems include DNA plasmids, RNA (e.g., a transcript of a vector described herein), naked nucleic acid, and nucleic acid complexed with a delivery vehicle, such as a liposome. Viral vector delivery systems include DNA and RNA viruses, which have either episomal or integrated genomes after delivery to the cell (Anderson, 1992, Science 256:808-813; and Yu, et al., 1994, Gene Therapy 1:13-26).
In certain embodiments, the CRISPR/Cas is derived from a type II CRISPR/Cas system. In some embodiments, the CRISPR/Cas sytem is derived from a Cas9 protein. The Cas9 protein can be from Streptococcus pyogenes, Streptococcus thermophilus, or other species.
In general, Cas proteins comprise at least one RNA recognition and/or RNA binding domain. RNA recognition and/or RNA binding domains interact with the guiding RNA. Cas proteins can also comprise nuclease domains (i.e., DNase or RNase domains), DNA binding domains, helicase domains, RNAse domains, protein-protein interaction domains, dimerization domains, as well as other domains. The Cas proteins can be modified to increase nucleic acid binding affinity and/or specificity, alter an enzymatic activity, and/or change another property of the protein. In certain embodiments, the Cas-like protein of the fusion protein can be derived from a wild type Cas9 protein or fragment thereof. In other embodiments, the Cas can be derived from modified Cas9 protein. For example, the amino acid sequence of the Cas9 protein can be modified to alter one or more properties (e.g., nuclease activity, affinity, stability, and so forth) of the protein. Alternatively, domains of the Cas9 protein not involved in RNA-guided cleavage can be eliminated from the protein such that the modified Cas9 protein is smaller than the wild type Cas9 protein. In general, a Cas9 protein comprises at least two nuclease (i.e., DNase) domains. For example, a Cas9 protein can comprise a RuvC-like nuclease domain and a HNH-like nuclease domain. The RuvC and HNH domains work together to cut single strands to make a double-stranded break in DNA. (Jinek, et al., 2012, Science, 337:816-821). In certain embodiments, the Cas9-derived protein can be modified to contain only one functional nuclease domain (either a RuvC-like or a HNH-like nuclease domain). For example, the Cas9-derived protein can be modified such that one of the nuclease domains is deleted or mutated such that it is no longer functional (i.e., the nuclease activity is absent). In some embodiments in which one of the nuclease domains is inactive, the Cas9-derived protein is able to introduce a nick into a double-stranded nucleic acid (such protein is termed a “nickase”), but not cleave the double-stranded DNA. In any of the above-described embodiments, any or all of the nuclease domains can be inactivated by one or more deletion mutations, insertion mutations, and/or substitution mutations using well-known methods, such as site-directed mutagenesis, PCR-mediated mutagenesis, and total gene synthesis, as well as other methods known in the art.
In one non-limiting embodiment, a vector drives the expression of the CRISPR system. The art is replete with suitable vectors that are useful in the present invention. The vectors to be used are suitable for replication and, optionally, integration in eukaryotic cells. Typical vectors contain transcription and translation terminators, initiation sequences, and promoters useful for regulation of the expression of the desired nucleic acid sequence. The vectors of the present invention may also be used for nucleic acid standard gene delivery protocols. Methods for gene delivery are known in the art (U.S. Pat. Nos. 5,399,346, 5,580,859 & 5,589,466, incorporated by reference herein in their entireties).
Further, the vector may be provided to a cell in the form of a viral vector. Viral vector technology is well known in the art and is described, for example, in Sambrook et al. (4th Edition, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York, 2012), and in other virology and molecular biology manuals. Viruses, which are useful as vectors include, but are not limited to, retroviruses, adenoviruses, adeno-associated viruses, herpes viruses, Sindbis virus, gammaretrovirus and lentiviruses. In general, a suitable vector contains an origin of replication functional in at least one organism, a promoter sequence, convenient restriction endonuclease sites, and one or more selectable markers (e.g., WO 01/96584; WO 01/29058; and U.S. Pat. No. 6,326,193).
In certain embodiments an expression system is used for the introduction of gRNAs and (d)Cas9 proteins into the cells of interest. Typically employed options include but are not limited to plasmids and viral vectors such as adeno-associated virus (AAV) vector or lentivirus vector.
Methods of introducing nucleic acids into a cell include physical, biological and chemical methods. Physical methods for introducing a polynucleotide, such as RNA, into a host cell include calcium phosphate precipitation, lipofection, particle bombardment, microinjection, electroporation, and the like. RNA can be introduced into target cells using commercially available methods which include electroporation (Amaxa Nucleofector-II (Amaxa Biosystems, Cologne, Germany)), (ECM 830 (BTX) (Harvard Instruments, Boston, Mass.) or the Gene Pulser II (BioRad, Denver, Colo.), Multiporator (Eppendort, Hamburg Germany). RNA can also be introduced into cells using cationic liposome mediated transfection using lipofection, using polymer encapsulation, using peptide mediated transfection, or using biolistic particle delivery systems such as “gene guns” (see, for example, Nishikawa, et al. Hum Gene Ther., 12(8):861-70 (2001).
Biological methods for introducing a polynucleotide of interest into a host cell include the use of DNA and RNA vectors. Viral vectors, and especially retroviral vectors, have become the most widely used method for inserting genes into mammalian, e.g., human cells. Other viral vectors can be derived from lentivirus, poxviruses, herpes simplex virus I, adenoviruses and adeno-associated viruses, and the like. See, for example, U.S. Pat. Nos. 5,350,674 and 5,585,362.
Chemical means for introducing a polynucleotide into a host cell include colloidal dispersion systems, such as macromolecule complexes, nanocapsules, microspheres, beads, and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes. An exemplary colloidal system for use as a delivery vehicle in vitro and in vivo is a liposome (e.g., an artificial membrane vesicle).
Lipids suitable for use can be obtained from commercial sources. For example, dimyristyl phosphatidylcholine (“DMPC”) can be obtained from Sigma, St. Louis, Mo.; dicetyl phosphate (“DCP”) can be obtained from K & K Laboratories (Plainview, N.Y.); cholesterol (“Choi”) can be obtained from Calbiochem-Behring; dimyristyl phosphatidylglycerol (“DMPG”) and other lipids may be obtained from Avanti Polar Lipids, Inc. (Birmingham, Ala.). Stock solutions of lipids in chloroform or chloroform/methanol can be stored at about −20° C. Chloroform is used as the only solvent since it is more readily evaporated than methanol. “Liposome” is a generic term encompassing a variety of single and multilamellar lipid vehicles formed by the generation of enclosed lipid bilayers or aggregates. Liposomes can be characterized as having vesicular structures with a phospholipid bilayer membrane and an inner aqueous medium. Multilamellar liposomes have multiple lipid layers separated by aqueous medium. They form spontaneously when phospholipids are suspended in an excess of aqueous solution. The lipid components undergo self-rearrangement before the formation of closed structures and entrap water and dissolved solutes between the lipid bilayers (Ghosh et al., 1991 Glycobiology 5: 505-10). However, compositions that have different structures in solution than the normal vesicular structure are also encompassed. For example, the lipids may assume a micellar structure or merely exist as nonuniform aggregates of lipid molecules. Also contemplated are lipofectamine-nucleic acid complexes.
Regardless of the method used to introduce exogenous nucleic acids into a host cell or otherwise expose a cell to the inhibitor of the present invention, in order to confirm the presence of the nucleic acids in the host cell, a variety of assays may be performed. Such assays include, for example, “molecular biological” assays well known to those of skill in the art, such as Southern and Northern blotting, RT-PCR and PCR; “biochemical” assays, such as detecting the presence or absence of a particular peptide, e.g., by immunological means (ELISAs and Western blots) or by assays described herein to identify agents falling within the scope of the invention.
Moreover, the nucleic acids may be introduced by any means, such as transducing the cells, transfecting the cells, and electroporating the cells. One nucleic acid may be introduced by one method and another nucleic acid may be introduced into the cell by a different method.
RNA
In one embodiment, the nucleic acids introduced into the cell are RNA. In another embodiment, the RNA is mRNA that comprises in vitro transcribed RNA or synthetic RNA. The RNA is produced by in vitro transcription using a polymerase chain reaction (PCR)-generated template. DNA of interest from any source can be directly converted by PCR into a template for in vitro mRNA synthesis using appropriate primers and RNA polymerase. The source of the DNA can be, for example, genomic DNA, plasmid DNA, phage DNA, cDNA, synthetic DNA sequence or any other appropriate source of DNA.
PCR can be used to generate a template for in vitro transcription of mRNA which is then introduced into cells. Methods for performing PCR are well known in the art. Primers for use in PCR are designed to have regions that are substantially complementary to regions of the DNA to be used as a template for the PCR. “Substantially complementary”, as used herein, refers to sequences of nucleotides where a majority or all of the bases in the primer sequence are complementary, or one or more bases are non-complementary, or mismatched. Substantially complementary sequences are able to anneal or hybridize with the intended DNA target under annealing conditions used for PCR. The primers can be designed to be substantially complementary to any portion of the DNA template. For example, the primers can be designed to amplify the portion of a gene that is normally transcribed in cells (the open reading frame), including 5′ and 3′ UTRs. The primers can also be designed to amplify a portion of a gene that encodes a particular domain of interest. In one embodiment, the primers are designed to amplify the coding region of a human cDNA, including all or portions of the 5′ and 3′ UTRs. Primers useful for PCR are generated by synthetic methods that are well known in the art. “Forward primers” are primers that contain a region of nucleotides that are substantially complementary to nucleotides on the DNA template that are upstream of the DNA sequence that is to be amplified. “Upstream” is used herein to refer to a location 5, to the DNA sequence to be amplified relative to the coding strand. “Reverse primers” are primers that contain a region of nucleotides that are substantially complementary to a double-stranded DNA template that are downstream of the DNA sequence that is to be amplified. “Downstream” is used herein to refer to a location 3′ to the DNA sequence to be amplified relative to the coding strand.
Chemical structures that have the ability to promote stability and/or translation efficiency of the RNA may also be used. The RNA preferably has 5′ and 3′ UTRs. In one embodiment, the 5′ UTR is between zero and 3000 nucleotides in length. The length of 5′ and 3′ UTR sequences to be added to the coding region can be altered by different methods, including, but not limited to, designing primers for PCR that anneal to different regions of the UTRs. Using this approach, one of ordinary skill in the art can modify the 5′ and 3′ UTR lengths required to achieve optimal translation efficiency following transfection of the transcribed RNA.
The 5′ and 3′ UTRs can be the naturally occurring, endogenous 5′ and 3′ UTRs for the gene of interest. Alternatively, UTR sequences that are not endogenous to the gene of interest can be added by incorporating the UTR sequences into the forward and reverse primers or by any other modifications of the template. The use of UTR sequences that are not endogenous to the gene of interest can be useful for modifying the stability and/or translation efficiency of the RNA. For example, it is known that AU-rich elements in 3′ UTR sequences can decrease the stability of mRNA. Therefore, 3′ UTRs can be selected or designed to increase the stability of the transcribed RNA based on properties of UTRs that are well known in the art.
In one embodiment, the 5′ UTR can contain the Kozak sequence of the endogenous gene. Alternatively, when a 5′ UTR that is not endogenous to the gene of interest is being added by PCR as described above, a consensus Kozak sequence can be redesigned by adding the 5′ UTR sequence. Kozak sequences can increase the efficiency of translation of some RNA transcripts, but does not appear to be required for all RNAs to enable efficient translation. The requirement for Kozak sequences for many mRNAs is known in the art. In other embodiments the 5′ UTR can be derived from an RNA virus whose RNA genome is stable in cells. In other embodiments various nucleotide analogues can be used in the 3′ or 5′ UTR to impede exonuclease degradation of the mRNA.
To enable synthesis of RNA from a DNA template, a promoter of transcription should be attached to the DNA template upstream of the sequence to be transcribed. When a sequence that functions as a promoter for an RNA polymerase is added to the 5′ end of the forward primer, the RNA polymerase promoter becomes incorporated into the PCR product upstream of the open reading frame that is to be transcribed. In one embodiment, the promoter is a T7 polymerase promoter, as described elsewhere herein. Other useful promoters include, but are not limited to, T3 and SP6 RNA polymerase promoters. Consensus nucleotide sequences for T7, T3 and SP6 promoters are known in the art.
In one embodiment, the mRNA has a cap on the 5′ end and a 3′ poly(A) tail which determine ribosome binding, initiation of translation and stability mRNA in the cell. On a circular DNA template, for instance, plasmid DNA, RNA polymerase produces a long concatameric product which may not be suitable for expression in eukaryotic cells. The transcription of plasmid DNA linearized at the end of the 3′ UTR results in normal sized mRNA which may not be effective in eukaryotic transfection even if it is polyadenylated after transcription.
On a linear DNA template, phage T7 RNA polymerase can extend the 3′ end of the transcript beyond the last base of the template (Schenborn and Mierendorf, Nuc Acids Res., 13:6223-36 (1985); Nacheva and Berzal-Herranz, Eur. J. Biochem., 270:1485-65 (2003)).
The conventional method of integration of polyA/T stretches into a DNA template is by molecular cloning. However polyA/T sequence integrated into plasmid DNA can cause plasmid instability, which is why plasmid DNA templates obtained from bacterial cells are often highly contaminated with deletions and other aberrations. This makes cloning procedures not only laborious and time consuming but often not reliable. That is why a method which allows construction of DNA templates with polyA/T 3′ stretch without cloning highly desirable.
The polyA/T segment of the transcriptional DNA template can be produced during PCR by using a reverse primer containing a polyT tail, such as 100T tail (size can be 50-5000 T), or after PCR by any other method, including, but not limited to, DNA ligation or in vitro recombination. Poly(A) tails also provide stability to RNAs and reduce their degradation. Generally, the length of a poly(A) tail positively correlates with the stability of the transcribed RNA. In one embodiment, the poly(A) tail is between 100 and 5000 adenosines.
Poly(A) tails of RNAs can be further extended following in vitro transcription with the use of a poly(A) polymerase, such as E. coli polyA polymerase (E-PAP). In one embodiment, increasing the length of a poly(A) tail from 100 nucleotides to between 300 and 400 nucleotides results in about a two-fold increase in the translation efficiency of the RNA. Additionally, the attachment of different chemical groups to the 3′ end can increase mRNA stability. Such attachment can contain modified/artificial nucleotides, aptamers and other compounds. For example, ATP analogs can be incorporated into the poly(A) tail using poly(A) polymerase. ATP analogs can further increase the stability of the RNA.
5′ caps also provide stability to RNA molecules. In a preferred embodiment, RNAs produced by the methods disclosed herein include a 5′ cap. The 5′ cap is provided using techniques known in the art and described herein (Cougot, et al., Trends in Biochem. Sci., 29:436-444 (2001); Stepinski, et al., RNA, 7:1468-95 (2001); Elango, et al., Biochim. Biophys. Res. Commun., 330:958-966 (2005)).
The RNAs produced by the methods disclosed herein can also contain an internal ribosome entry site (IRES) sequence. The IRES sequence may be any viral, chromosomal or artificially designed sequence which initiates cap-independent ribosome binding to mRNA and facilitates the initiation of translation. Any solutes suitable for cell electroporation, which can contain factors facilitating cellular permeability and viability such as sugars, peptides, lipids, proteins, antioxidants, and surfactants can be included.
In some embodiments, the RNA is electroporated into the cells, such as in vitro transcribed RNA.
The methods also provide the ability to control the level of expression over a wide range by changing, for example, the promoter or the amount of input RNA, making it possible to individually regulate the expression level. Furthermore, the PCR-based technique of mRNA production greatly facilitates the design of the mRNAs with different structures and combination of their domains.
One advantage of RNA transfection methods of the invention is that RNA transfection is essentially transient and vector-free. A RNA transgene can be delivered to a lymphocyte and expressed therein following a brief in vitro cell activation, as a minimal expressing cassette without the need for any additional viral sequences. Under these conditions, integration of the transgene into the host cell genome is unlikely. Cloning of cells is not necessary because of the efficiency of transfection of the RNA and its ability to uniformly modify the entire lymphocyte population.
Genetic modification of cells with in vitro-transcribed RNA (IVT-RNA) makes use of two different strategies both of which have been successively tested in various animal models. Cells are transfected with in vitro-transcribed RNA by means of lipofection or electroporation. It is desirable to stabilize IVT-RNA using various modifications in order to achieve prolonged expression of transferred IVT-RNA.
Some IVT vectors are known in the literature which are utilized in a standardized manner as template for in vitro transcription and which have been genetically modified in such a way that stabilized RNA transcripts are produced. Currently protocols used in the art are based on a plasmid vector with the following structure: a 5′ RNA polymerase promoter enabling RNA transcription, followed by a gene of interest which is flanked either 3′ and/or 5′ by untranslated regions (UTR), and a 3′ polyadenyl cassette containing 50-70 A nucleotides. Prior to in vitro transcription, the circular plasmid is linearized downstream of the polyadenyl cassette by type II restriction enzymes (recognition sequence corresponds to cleavage site). The polyadenyl cassette thus corresponds to the later poly(A) sequence in the transcript. As a result of this procedure, some nucleotides remain as part of the enzyme cleavage site after linearization and extend or mask the poly(A) sequence at the 3′ end. It is not clear, whether this nonphysiological overhang affects the amount of protein produced intracellularly from such a construct.
RNA has several advantages over more traditional plasmid or viral approaches. Gene expression from an RNA source does not require transcription and the protein product is produced rapidly after the transfection. Further, since the RNA has to only gain access to the cytoplasm, rather than the nucleus, and therefore typical transfection methods result in an extremely high rate of transfection. In addition, plasmid based approaches require that the promoter driving the expression of the gene of interest be active in the cells under study.
In another aspect, the RNA construct is delivered into the cells by electroporation. See, e.g., the formulations and methodology of electroporation of nucleic acid constructs into mammalian cells as taught in US 2004/0014645, US 2005/0052630A1, US 2005/0070841A1, US 2004/0059285A1, US 2004/0092907A1. The various parameters including electric field strength required for electroporation of any known cell type are generally known in the relevant research literature as well as numerous patents and applications in the field. See e.g., U.S. Pat. Nos. 6,678,556, 7,171,264, and 7,173,116. Apparatus for therapeutic application of electroporation are available commercially, e.g., the MedPulser™ DNA Electroporation Therapy System (Inovio/Genetronics, San Diego, Calif.), and are described in patents such as U.S. Pat. Nos. 6,567,694; 6,516,223, 5,993,434, 6,181,964, 6,241,701, and 6,233,482; electroporation may also be used for transfection of cells in vitro as described e.g. in US20070128708A1. Electroporation may also be utilized to deliver nucleic acids into cells in vitro. Accordingly, electroporation-mediated administration into cells of nucleic acids including expression constructs utilizing any of the many available devices and electroporation systems known to those of skill in the art presents an exciting new means for delivering an RNA of interest to a target cell.
In one embodiment, cells are obtained from a subject. Non-limiting examples of subjects include humans, dogs, cats, mice, rats, pigs and transgenic species thereof. Preferably, the subject is a human. Cells can be obtained from a number of sources, including peripheral blood mononuclear cells, bone marrow, lymph node tissue, spleen tissue, umbilical cord, cancer cells and tumors. In certain embodiments, any number of cell lines available in the art, may be used. In certain embodiments, cells can be obtained from a unit of blood collected from a subject using any number of techniques known to the skilled artisan, such as Ficoll separation. In one embodiment, cells from the circulating blood of an individual are obtained by apheresis or leukapheresis. The apheresis product typically contains lymphocytes, including T cells, monocytes, granulocytes, B cells, other nucleated white blood cells, red blood cells, and platelets. The cells collected by apheresis may be washed to remove the plasma fraction and to place the cells in an appropriate buffer or media, such as phosphate buffered saline (PBS) or wash solution lacks calcium and may lack magnesium or may lack many if not all divalent cations, for subsequent processing steps. After washing, the cells may be resuspended in a variety of biocompatible buffers, such as, for example, Ca-free, Mg-free PBS. Alternatively, the undesirable components of the apheresis sample may be removed and the cells directly resuspended in culture media.
In another embodiment, cells are isolated from peripheral blood. Alternatively, cells can be isolated from umbilical cord. In any event, a specific subpopulation of cells can be further isolated by positive or negative selection techniques.
Cells can also be frozen. While many freezing solutions and parameters are known in the art and will be useful in this context, in a non-limiting example, one method involves using PBS containing 20% DMSO and 8% human serum albumin, or other suitable cell freezing media. The cells are then frozen to −80° C. at a rate of 1° per minute and stored in the vapor phase of a liquid nitrogen storage tank. Other methods of controlled freezing may be used as well as uncontrolled freezing immediately at −20° C. or in liquid nitrogen.
Pharmaceutical compositions of the present invention may comprise the modified cell as described herein, in combination with one or more pharmaceutically or physiologically acceptable carriers, diluents or excipients. Such compositions may comprise buffers such as neutral buffered saline, phosphate buffered saline and the like; carbohydrates such as glucose, mannose, sucrose or dextrans, mannitol; proteins; polypeptides or amino acids such as glycine; antioxidants; chelating agents such as EDTA or glutathione; adjuvants (e.g., aluminum hydroxide); and preservatives. Compositions of the present invention are preferably formulated for intravenous administration.
Pharmaceutical compositions of the present invention may be administered in a manner appropriate to the disease to be treated (or prevented). The quantity and frequency of administration will be determined by such factors as the condition of the patient, and the type and severity of the patient's disease, although appropriate dosages may be determined by clinical trials.
It can generally be stated that a pharmaceutical composition comprising the modified cells described herein may be administered at a dosage of 104 to 109 cells/kg body weight, in some instances 105 to 106 cells/kg body weight, including all integer values within those ranges. Compositions of the invention may also be administered multiple times at these dosages. The cells or vectors can be administered by using infusion techniques that are commonly known in immunotherapy (see, e.g., Rosenberg et al., New Eng. J. of Med. 319:1676, 1988). The optimal dosage and treatment regime for a particular patient can readily be determined by one skilled in the art of medicine by monitoring the patient for signs of disease and adjusting the treatment accordingly.
The administration of the modified cells or vectors of the invention may be carried out in any convenient manner known to those of skill in the art. The cells or vectors of the present invention may be administered to a subject by aerosol inhalation, injection, ingestion, transfusion, implantation or transplantation. The compositions described herein may be administered to a patient transarterially, subcutaneously, intradermally, intratumorally, intranodally, intramedullarly, intracystically intramuscularly, by intravenous (i.v.) injection, parenterally or intraperitoneally. In other instances, the cells of the invention are injected directly into a site of inflammation in the subject, a local disease site in the subject, a lymph node, an organ, a tumor, and the like.
It should be understood that the methods and compositions that would be useful in the present invention are not limited to the particular formulations set forth in the examples. The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how to make and use the cells, expansion and culture methods, and therapeutic methods of the invention, and are not intended to limit the scope of what the inventors regard as their invention.
The practice of the present invention employs, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry and immunology, which are well within the purview of the skilled artisan. Such techniques are explained fully in the literature, such as, “Molecular Cloning: A Laboratory Manual”, fourth edition (Sambrook, 2012); “Oligonucleotide Synthesis” (Gait, 1984); “Culture of Animal Cells” (Freshney, 2010); “Methods in Enzymology” “Handbook of Experimental Immunology” (Weir, 1997); “Gene Transfer Vectors for Mammalian Cells” (Miller and Calos, 1987); “Short Protocols in Molecular Biology” (Ausubel, 2002); “Polymerase Chain Reaction: Principles, Applications and Troubleshooting”, (Babar, 2011); “Current Protocols in Immunology” (Coligan, 2002). These techniques are applicable to the production of the polynucleotides and polypeptides of the invention, and, as such, may be considered in making and practicing the invention. Particularly useful techniques for particular embodiments will be discussed in the sections that follow.
The invention is now described with reference to the following Examples. These Examples are provided for the purpose of illustration only, and the invention is not limited to these Examples, but rather encompasses all variations that are evident as a result of the teachings provided herein.
The materials and methods employed in these experiments are now described.
Generation of activation and repression plasmids: The activation plasmid dgRNA-MS2:MPH comprises a U6 promoter, an MS2 gRNA scaffold, a CMV promoter and a MCP-P65-HSF1 complex (SEQ ID NO:1). The repression plasmid dgRNA-Com:CK comprises a U6 promoter, a Com gRNA scaffold, a CMV promoter and a COM-KRAB complex (SEQ ID NO:2). All key DNA fragments in these plasmids were synthesized by GENEWIZ or IDT, then cloned into pUC57, or lentiviral plasmids using general molecular cloning and Gibson assembly (NEB). dgRNAs (14-nt or 15-nt) were designed to target the first 200 bp upstream of each TSS (Table 1, SEQ ID NOs. 3-28). Five dgRNAs were designed to target each gene. TRE-MPH (SEQ ID NO: 29) and TRE-CK (SEQ ID NO: 30) were constructed based on dgRNA-MS2:MPH and dgRNA-Com:CK by inserting CMV-rtTA cassette and replacing the CMV promoter, which drives MPH or CK expression, with a TRE3G inducible promoter. For establishment of TRE-MPH, TRE-CK, and TRE-MPH-CK cell lines, HEK293 cells were transduced with Cas9-expressing lentivirus to establish a constitutive Cas9 expression cell line, then transfected with TRE-MPH and/or TRE-CK plasmids followed by G418 selection and PCR identification.
Traffic light reporter (TLR) plasmid construction: TLR construct was assembled with a nonfunctional EGFP variant (bf-Venus) where codons 53-63 were disrupted, a T2A peptide, and a red fluorescent gene that has a 2-bp shifted reading frame (fs-mCherry)(Certo, M. T. et al. (2011) Nature Methods 8, 671-U102, doi:10.1038/Nmeth. 1648). The expression cassette of Venus-T2A-mCherry was cloned in between the CMV promoter and SV40 poly (A) signal. The CRISPR targeting site was designed at the bf-Venus disrupted region. As Cas9 specifically induces DSBs, if DSBs are repaired by the NHEJ pathway, approximately 1/3 of the repaired events would generate in-frame functional mCherry. Alternatively, if DSBs are repaired by the EGFP HDR donor to generate intact Venus, the disrupted region of bf-Venus would be corrected leaving fs-mCherry remaining out of frame.
CAGGATCCgtgagcaagggcgaggaggataactccgccatcatcaaggagttcctgcgcttcaaggtgcacatggagg
gctccgtgaacggccacgagttcgagatcgagggcgagggcgagggccgcccctacgagggcacccagaccgccaagctg
aaggtgaccaagggtggccccctgccatcgcctgggacatcctgtcccctcagttcatgtacggctccaaggcctacgtgaag
caccccgccgacatccccgactacttgaagctgtccttccccgagggcttcaagtgggagcgcgtgatgaacttcgaggacgg
cggcgtggtgaccgtgacccaggactcctctctgcaggacggcgagttcatctacaaggtgaagctgcgcggcaccaacttcc
cctccgacggccccgtaatgcagaagaagaccatgggctgggaggcctcctccgagcggatgtaccccgaggacggcgccc
tgaagggcgagatcaagcagaggctgaagctgaaggacggcggccactacgacgctgaggtcaagaccacctacaaggcc
aagaagcccgtgcagctgcccggcgcctacaacgtcaacatcaagttggacatcacctcccacaacgaggactacaccatcgt
ggaacagtacgaacgcgccgagggccgccactccaccggcggcatggacgagctgtacaagtga
ttctccttctggggcctgtgccatctctcgtttcttaggatggccttctccgacggatgtctcccttgcgtcccgcctccccttcttgta
ggcctgcatcatcaccgtttttctggacaaccccaaagtaccccgtctccctggctttagccacctctccatcctcttgctttctttgcc
tggacaccccgttctcctgtggattcgggtcacctctcactcctttcatttgggcagctcccctaccccccttacctctctagtctgtg
ctagctcttccagccccctgtcatggcatcttccaggggtccgagagctcagctagtcttcttcctccaacccgggcccctatgtcc
acttcaggacagcatgtttgctgcctccagggatcctgtgtccccgagctgggaccaccttatattcccagggccggttaatgtgg
ctctggttctgggtacttttatctgtcccctccaccccacagtggggggtaccagtcgatccaacatggcgacttgtcccatcccc
ggcatgtttaaatatactaattattcttgaactaattttaatcaaccgatttatctctatccgcaggtggcggaggttccggtgga
agcggaggtagcggcggatccgagggccgcggcagcctgctgacctgcggcgatgtggaggagaaccccgggcccAT
GGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCT
GGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGA
TGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCC
GTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCC
GCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGG
CTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGC
GCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGC
ATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACA
ACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAA
CTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTAC
CAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTAC
CTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGG
TCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTA
CAAGTAAAATAAAAGATCTTTATTTTCATTAGATCTGTGTGTTGGTTTTTTGTGTgaattc
ccactagggacaggattggtgacagaaaagccccatccttaggcctcctccttcctagtctcctgatattgggtctaaccc
ccacctcctgttaggcagattccttatctggtgacacacccccatttcctggagccatctctctccttgccagaacctctaag
gtttgcttacgatggagccagagaggatcctgggagggagagcttggcagggggtgggagggaagggggggatgcgt
gacctgcccggttctcagtggccaccctgcgctaccctctcccagaacctgagctgctctgacgcggctgtctggtgcgttt
cactgatcctggtgctgcagcttccttacacttcccaagaggagaagcagtttggaaaaacaaaatcagaataagttggt
cctgagttctaactttggctcttcacctttctagtccccaatttatattgttcctccgtgcgtcagttttacctgtgagataagg
ccagtagccagccccgtcctggcagggctgtggtgaggaggggggtgtccgtgtggaaaactccctttgtgagaatggt
gcgtcctaggtgttcaccaggtcgtggccgcctctactccctttctctttctccatccttctttccttaaagagtccccagtgct
atctgggacatattcctccgcccagagcagggtcccgcttccctaaggccctgctctgggcttctgggtttgagtccttggc
aagcccaggagaggcgctcaggcttccctgtcccccttcctcgtccaccatctcatgcccctggctctcctgccccttccct
acaggggttcctggctctgctcttcagactgagccccgt
CGGCTCTGCCTGACATGAGGGTTACCCCTCGGGGCTGTGCTGTGGAAGCTAA
GTCCTGCCCTCATTTCCCTCTCAGGCATGGAGTCCTGTGGCATCCACGAAACT
ACCTTCAACTCCATCATGAAGTGTGACGTGGACATCCGCAAAGACCTGTACG
CCAACACAGTGCTGTCTGGCGGCACCACCATGTACCCTGGCATTGCCGACAG
GATGCAGAAGGAGATCACTGCCCTGGCACCCAGCACAATGAAGATCAAGGTG
GGTGTCTTTCCTGCCTGAGCTGACCTGGGCAGGTCGGCTGTGGGGTCCTGTGG
TGTGTGGGGAGCTGTCACATCCAGGGTCCTCACTGCCTGTCCCCTTCCCTCCT
CAGATCATTGCTCCTCCTGAGCGCAAGTACTCCGTGTGGATCGGCGGCTCCAT
CCTGGCCTCGCTGTCCACCTTCCAGCAGATGTGGATCAGCAAGCAGGAGTAT
GACGAGTCCGGCCCCTCCATCGTCCACCGCAAATGCTTC
gagggccgcggcagcctgctg
acctgcggcgatgtggaggagaaccccgggcccATGGTGAGCAAGGGCGAGGAGCTGTTCACCG
GGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCA
GCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGT
TCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCT
GACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGAC
TTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAA
GGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCT
GGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTG
GGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAA
GCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGC
AGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCC
GTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACC
CCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGAT
CACTCTCGGCATGGACGAGCTGTACAAGTAAtaggcggactatgacttagttgcgttacaccctttcttga
Cell culture and transient transfection: HEK293, HEK293T, HEK293FT and HeLa cell lines were used in this study. Cells were maintained in complete media (DMEM (Invitrogen/Thermofisher) with 10% FBS (Gibco), penicillin (100 U/ml) and streptomycin (100 μg/ml) (Life Technologies/Thermofisher)) in 37° C., 5% CO2 incubators. Before performing the activation and repression experiments, Cas9-stable expressed cell lines, HEK293-Cas9, HEK293T-Cas9, HEK293FT-Cas9, and HeLa-Cas9 were generated, either by stable integration or by transduction with Cas9 lentivirus (Cas9-Puro or Cas9-Blast), followed by puromycin or blasticidin selection. All the activation and repression experiments were based on Cas9 stable-expression cell lines. The cells were cultured in 24-well plates (Corning) in complete media and transfected with plasmids using Lipofectamine 3000 (Invitrogen) in accordance with the manufacturer's instructions. In brief, 100,000 cells/well were seeded into 24-well plates 12 h before transfection. 600 ng of plasmid encoding dgRNA-MS2:MPH or dgRNA-Com:CK were transfected with 1 μl Lipofectamine 3000 and 1 μl P3000 reagent in Opti-MEM (Invitrogen). Cells were trypsinized and re-seeded into another 24-well plate 24 h after transfection. After 12 h of plating, cells were transfected with a 1:1 mass ratio of sgRNA plasmid and PCR HR donor. 600 ng total plasmid per well was transfected with 1 μl Lipofectamine 3000 and 1 μl P3000 reagent. Puromycin (0.5 g/mL), Zeocin (200 μg/mL), or Blasticidin (5 μg/mL) were added after 24 h of transfection. Media was changed per 24 h with fresh pre-warmed selection media. For Tet-On induction of gene expression, cells were treated 2 days with doxycycline at 1 μg/ml.
Lentivirus production and transduction: Briefly, HEK293FT cells (ThermoFisher) were cultured in DMEM (Invitrogen)+10% FBS (Sigma) media and seeded in 15-cm dishes before transfection. When cell confluency reached 80-90%, the media was replaced by 13 mL pre-warmed OptiMEM (Invitrogen). For transfection of each dish, 20 Fg transfer plasmids, 15 μg psPAX2 (Addgene 12260), 10 μg pMD 2.G (Addgene 12259), and 130 μL PEI were added into 434 μL OptiMEM, briefly vortexed, and incubated at room temperature for 10 min before added to the 13 mL OptiMEM. The 13 mL OptiMEM was replaced with pre-warmed 10% FBS in DMEM. Lentivirus supernatant was harvested 48 h after media change and aliquoted, and stored at −80° C. freezer. For Cas9-Puro or Cas9-Blast transduction, HEK293, HEK293T, HEK293FT, and HeLa cell lines were transduced with Cas9-Puro or Cas9-Blast lentivirus and supplemented with 2 μl of 2 mg/mL polybrene (Millipore) in 6-well plates. The puromycin (0.5 μg/mL) or blasticidin (5 μg/mL) selection was performed for 7 days after lentivirus transduction. For dgCDK1-MS2-MPH lentivirus transduction of HEK293FT-Cas9 cell line, hygromycin (200 μg/mL) selection was performed for 2-3 days.
RT-qPCR: Cells were collected and lysed using TRlzol (Invitrogen) after 48 h of drug treatment. Total RNA was isolated using RNAiso Plus (Takara). cDNA synthesis was performed using the Advantage RT-for-PCR kit (Takara). RNA levels were quantified by qPCR using SYBR Fast qPCR Mix (Takara) in 20 μl reactions. qPCR was carried out using the CFX96 Touch Real-Time PCR Detection System (Bio-Rad). Melt curves were used to confirm the specificity of primers. mRNA relative expression levels were normalized to GAPDH expression by the ΔΔCt method.
Confocal fluorescence imaging: Before performing confocal fluorescence imaging, transfected cells were trypsinized and re-seeded on glass cover slips overnight. After aspirating the medium, cells were treated with 4% formaldehyde/PBS for 15 min for fixation, where their nuclei were stained with DAPI (CST) in PBS. EGFP or mCherry fluorescence was visualized by a confocal microscope (Zeiss LSM 800). Confocal data were analyzed using Image J software (NIH, Bethesda, Md., USA).
Flow cytometry analysis: Flow cytometric (or FACS) assays were used to evaluate the percentage of EGFP- or mCherry-positive cells. Briefly, HEK293-Cas9, HEK293T-Cas9, HEK293FT-Cas9 and HeLa-Cas9 cells were transfected with sgRNA plasmid and HR donor, then cultured for 72 h. The cells were digested by Trypsin without EDTA, followed by briefly centrifugation and resuspension in PBS, then the cell density was determined and diluted to 1×106 cell/mL. Finally, these samples were analyzed using a BD Fortessa or BD FACSAria flow cytometer within one hour.
Genomic DNA isolation and DNA sequencing: The transfected cells were lysed and gDNA was extracted using the DNeasy Tissue Kit (Qiagen) following the manufacturer's instruction. For HDR-positive event identification, PCR was performed using PrimeSTAR HS DNA Polymerase (Takara) with sequence-specific primers (Table 3) using the condition: 95° C. for 4 min; 35 cycles of 95° C. for 20 s, 60° C. for 30 s, 72° C. for 1 min; 72° C. for 2 min for the final extension. PCR products were run on 1.5% agarose gel (Biowest). The specific DNA bands were recovered using AxyPrep DNA Gel Extraction Kit (Axygen). Purified PCR products were cloned into the pMD-19 T vector (Takara) according to the standard manufacturer's instructions or directly sequenced by specific primers. Plasmid mini-preparations were performed using the AxyPrep Plasmid Miniprep Kit (Axygen), and midi-preperations were performed using QIAGEN Plasmid Plus Midi Kit (Qiagen). All sequencing confirmations were carried out using Sanger sequencing.
Cell cycle analysis: Cells were harvested after CRISPR/dgRNAs activation or/and repression for 72 h, and single cell suspensions prepared in PBS with 0.1% BSA. Cells were washed and spun at 400×g for 5 min, resuspended with precooled 70% ethanol, and fixed at 4° C. overnight. Cells were washed in PBS, spun at 500×g for 5 min, resuspended in 500 L PBS containing 50 μg/mL Propidium Iodide (PI), 100 μg/mL RNase, and 0.2% Triton X-100, and incubated at 4° C. for 30 min. Before flow cytometry analysis, cells were passed through a 40 μm cell strainer to remove cell aggregates.
CCK-8 assays: Cell viability was measured using a Cell Counting Kit-8 (CCK-8) assay (Dojindo; CK04). The transfected cells (24 h after transfection) were seeded in a 96-well plate at a density of 2.5-5×103 cells. Cells were incubated for 1 h with 110 μL complete DMEM media with 10 μL CCK-8 reagent for 24 h. Cell viability detection was performed by measuring the optical absorbance at 450 nm using a multimode reader (Beckman Coulter; DTX880).
Sample size determination: No specific methods were used to predetermine sample size. Experiments were repeated 3 times unless otherwise noted.
Blinding statement: Investigators were not blinded for data collection or analysis. Most experiments were repeated at least 3 times to ensure reproducibility.
The results of the experiments are now described.
To enhance HDR efficiency of CRISPR-mediated gene editing with clean genetic approaches that avoid the potential side effects from chemical compounds, a method was developed that tunes the expression of DNA damage repair pathway components by dgRNA/active Cas9 mediated CRISPRa and CRISPRi (CRISPRa/i). A Com binding loop was constructed into a dgRNA scaffold for recruiting the Com-KRAB (CK) fusion domain to repress NHEJ-related genes (
Next, it was determined whether CDK1 and CtIP activation or LIG4, KU70 and KU80 inhibition could enhance HDR frequency for CRISPR-mediated precise gene editing. To quantitatively determine the HDR and NHEJ outcome, a Traffic Light Reporter (TLR) stable expression HEK293 cell line that also expresses Cas9 (HEK293-Cas9-TLR) was generated (
Using this TLR reporter, the HEK293-Cas9-TLR cell line was transfected with dgRNA-Com:CK and/or dgRNA-MS2:MPH plasmids targeting CDK1, CtIP, LIG4, KU70 and KU80 to modulate the expression of these factors. Twenty-four hours later, cells were co-transfected with PCR EGFP HDR template and sgVenus-ECFP expression plasmid (SEQ ID NO: 35) (
The dgCDK1-2+dgKU80-1 combination had the highest enhancement of HDR efficiency among all tested groups/programs as revealed by the TLR experiment. The effect of this system on CRISPR-mediated gene editing was tested on an endogenous genomic locus by measuring the precise integration of an HDR donor expression cassette, SA-T2A-EGFP (SEQ ID NO: 37; AAVS-SA-T2A-EGFP-AAVS-PcDNA3.1), into the first intron of the canonical AAVS1 locus upon Cas9/sgRNA induced double stranded break (
To further improve the programmability, the approach was adapted to additional conditional-expression modules and viral packaging systems. To reduce potential side effects from constitutive activation of CDK1 or deficiency of KU80, a Tet-On system inducible by doxycycline (Dox) was utilized to control the expression of CRISPRa and CRISPRi effectors, MPH and CK, respectively. Two vectors, TRE-MPH and TRE-CK, were constructed (
Three different cell lines were treated with Dox for 24 h, then the SA-T2A-EGFP HDR donor for AAVS1 locus and sgAAVS1-mCherry plasmid were co-transfected. After 48 h of transfection, EGFP+ cells in mCherry+ population were quantified by FACS. Upon Dox treatment, the percentages of EGFP+ cells significantly increased in all three groups as compared to control (
Usage of a lentiviral system was adopted for stable integration of constructs for CRISPRa of DNA repair factors (
In conclusion, the data together showed that CRISPRa/i mediated activation and inhibition of key genes related to DNA damage repair pathways is an effective way to increase the efficiency of HDR for precise genome editing in mammalian cells. With the activation of CDK1 by dgRNA-MS2:MPH and/or repression of KU80 by dgRNA-Com:CK, the HDR efficiency can be enhanced by 4-8 fold. In this system, through combinatorial usage of sgRNA and dgRNA for different purposes, genome editing, gene activation and repression were achieved simultaneously simply with a single Cas9 transgene (
The approach described herein is versatile and flexible, with active-Cas9-dgRNA mediating CRISPRa/i programming of DNA repair machinery, where the active Cas9 can still perform its function of generating DSB for HDR-mediated precise gene editing. These components can join force with an armamentarium of other genetic tools such as inducible gene expression modules via simple genetic engineering. Furthermore, the CRISPRa/i constructs can be packaged into viral vectors for efficient delivery into a large repertoire of cell types. For in vivo manipulation, the construction size of CRISPRa/i is slightly larger than traditional approaches used for Cas9-based HDR. Two AAV systems can be used for simultaneous delivery of activation or/and repression components and HDR donor template. Finally, this is a genetic approach of HDR enhancement, and thus can be easily adapted for in vivo settings in time- and tissue-specific manner, which is essential for the application of gene therapy.
The recitation of a listing of elements in any definition of a variable herein includes definitions of that variable as any single element or combination (or subcombination) of listed elements. The recitation of an embodiment herein includes that embodiment as any single embodiment or in combination with any other embodiments or portions thereof.
The disclosures of each and every patent, patent application, and publication cited herein are hereby incorporated herein by reference in their entirety. While this invention has been disclosed with reference to specific embodiments, it is apparent that other embodiments and variations of this invention may be devised by others skilled in the art without departing from the true spirit and scope of the invention. The appended claims are intended to be construed to include all such embodiments and equivalent variations.
This invention was made with government support under CA209992 awarded by the National Institutes of Health. The government has certain rights in the invention.
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/CN2018/094499 | 7/4/2018 | WO | 00 |
