COMPOSITIONS AND METHODS FOR MODULATING SECRETED FRIZZLED RECEPTOR PROTEIN 1 (SFRP1) GENE EXPRESSION

Abstract
The present invention provides agents and compositions for modulating expression (e.g., enhanced or reduced expression) of a secreted frizzled related protein 1 (SFRP1) gene by targeting an SFRP1 expression control region and methods of use thereof for treating an SFRP1 associated disorder, e.g., hair loss.
Description
REFERENCE TO ELECTRONIC SEQUENCE LISTING

The application contains a Sequence Listing which has been submitted electronically in .XML format and is hereby incorporated by reference in its entirety. Said .XML copy, created on Dec. 22, 2023, is named “131717-00602_SL.xml” and is 500,621 bytes in size. The sequence listing contained in this .XML file is part of the specification and is hereby incorporated by reference herein in its entirety.


BACKGROUND OF THE INVENTION

Soluble modulators of Wnt signaling, such as members of the Secreted Frizzled Related Protein (SFRP) family (e.g., SFRP1, SFRP2, SFRP3, SFRP4, and SFRP5), are proteins that contain cysteine-rich domains homologous to the putative Wnt-binding site of Frizzled proteins that inhibit Wnt binding to Frizzled proteins. One example of a SFRP family member is Secreted Frizzled Related Protein 1 (SFRP1).


Alopecia is a disease or condition which results in hair loss in a subject. The most common forms of alopecia are androgenic alopecia (hormone imbalance), alopecia areata (immune disorders); traction alopecia (mechanical stress), senescent alopecia (age); and cicatricial alopecia (inflammatory disorders). Prevalence of androgenic alopecia in men and women is about 60% and 24%, respectively. A 66%-74% lifetime prevalence of psychiatric disorders has been reported in alopecia areata patients, with a 38%-39% lifetime prevalence of depression and a 39%-62% prevalence of generalized anxiety disorder (Fricke et al., Epidemiology and burden of alopecia areata: a systematic review, Clin Cosmet Investig Dermatol. 2015; 8: 397-403).


The hair follicle goes through multiple stages including Anagen I-IV (growth), Catagen (cessation of growth), and Telogen (resting). Loss of hair predominately occurs during Anagen IV to Telogen phases.


SFRP1 is expressed most commonly in endometrium, fat, gall bladder, heart, kidney, ovary, prostate, salivary gland, testis and urinary bladder cells (Fagerberg L, et al., Analysis of the human tissue-specific expression by genome-wide integration of transcriptomics and antibody-based proteomics. Mol Cell Proteomics. 2014 February; 13(2):397-406. doi: 0.1074/mcp.M113.035600). SFRP1 is also expressed in dermal cells. Recently, Hawkshaw et al., demonstrated that downregulation of SFRP1 resulted in ex vivo hair growth (Hawkshaw N, et al., (2018) PLOS Biology 16(5): e2003705. doi: 10.1371/journal.pbio.2003705).


Accordingly, there is a need in the art for compositions and methods that treat alopecia, such as androgenic alopecia and alopecia areata.


SUMMARY OF THE INVENTION

The present invention provides agents and compositions for modulating the expression (e.g., enhancing or reducing expression) of a Secreted Frizzled Related Protein 1 (SFRP1) gene by targeting an SFRP1 expression control region. The SFRP1 gene may be in a cell, e.g., a mammalian cell, such as a mammalian somatic cell, e.g., a human somatic cell. The present invention also provides methods of using the agents and compositions of the invention for modulating the expression of an SFRP1 gene or for treating a subject who would benefit from modulating the expression of an SFRP1 gene, e.g., a subject suffering or prone to suffering from an SFRP1-associated disease.


Accordingly, in one aspect, the present invention provides a site-specific Secreted Frizzled Receptor Protein 1 (SFRP1) disrupting agent, comprising a site-specific SFRP1 targeting moiety which targets an SFRP1 expression control region.


In one embodiment, the site-specific SFRP1 targeting moiety comprises a polymeric molecule. In one embodiment, the polymeric molecule comprises a polyamide. In one embodiment, the polymeric molecule comprises a polynucleotide.


In one embodiment, the expression control region comprises an SFRP1-specific transcriptional control element. In one embodiment, the transcriptional control element comprises an SFRP1 promoter. In one embodiment, the transcriptional control element comprises a transcriptional enhancer. In one embodiment, the transcriptional control element comprises a transcriptional repressor.


In one embodiment, the site-specific SFRP1 targeting moiety comprises a nucleotide sequence having at least 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide identity to the entire nucleotide sequence of any of the nucleotide sequences in any one of Tables 2 and 6.


In one embodiment, the polymeric molecule comprising a polynucleotide encoding a Cas or dCas polypeptide, or a fragment thereof, and a polynucleotide encoding a guide RNA that specifically binds to the SFRP1 expression control region; or a DNA-binding domain of a Transcription activator-like effector (TALE) polypeptide or a zinc finger (ZNF) polypeptide, or fragment thereof, that specifically binds to the SFRP1 expression control region. In one embodiment, the DNA-binding domain of the TALE or ZNF polypeptide comprises an amino acid sequence having at least about 85%, 90%, 95%, 96%, 97%, 98% or 99% amino acid identity to the entire amino acid sequence of any one of the amino acid sequences listed in column 5 of Table 5A.


In one embodiment, the expression control region comprises one or more SFRP1-associated anchor sequences within an anchor sequence-mediated conjunction comprising a first and a second SFRP1-associated anchor sequence. In one embodiment, the expression control region comprises one or more CCCTC-binding factor (CTCF) binding motifs. In one embodiment, the anchor sequence-mediated conjunction comprises one or more transcriptional control elements internal to the conjunction. In one embodiment, the anchor sequence-mediated conjunction comprises one or more transcriptional control elements external to the conjunction. In one embodiment, the first and/or the second anchor sequence is located within about 500 kb of the transcriptional control element. In one embodiment, the first and/or the second anchor sequence is located within about 300 kb of the transcriptional control element. In one embodiment, the first and/or the second anchor sequence is located within 10 kb of the transcriptional control element.


In one embodiment, a nucleotide sequence having at least 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide identity to the entire nucleotide sequence of any one of the nucleotide sequences in Table 3. In one embodiment, a first nucleotide sequence having at least 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide identity to the entire nucleotide sequence of GD-29879, a second nucleotide sequence having at least 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide identity to the entire nucleotide sequence of GD-29880, and a third nucleotide sequence having at least 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide identity to the entire nucleotide sequence of GD-29881.


In one embodiment, the polymeric molecule comprises a polynucleotide encoding a DNA-binding domain, or fragment thereof, of a zinc finger polypeptide (ZNF) or a transcription activator-like effector (TALE) polypeptide that specifically binds to the SFRP1 expression control region. In one embodiment, the DNA-binding domain of the TALE or ZNF polypeptide comprises an amino acid sequence having at least about 85%, 90%, 95%, 96%, 97%, 98% or 99% amino acid identity to the entire amino acid sequence of any one of the amino acid sequences listed in Table 1B.


In one embodiment, the site-specific SFRP1 disrupting agent comprises a nucleotide modification.


In one embodiment, the polymeric molecule comprises a peptide nucleic acid (PNA).


In another aspect, the present invention provides a nucleic acid molecule, wherein the nucleic acid molecule encodes the site-specific SFRP1 disrupting agent of various embodiments of the above aspects or any other aspect of the invention delineated herein.


In another aspect, the present invention provides a vector comprising the site-specific SFRP1 disrupting agent of various embodiments of the above aspects or any other aspect of the invention delineated herein. In one embodiment, the vector is a viral expression vector.


In another aspect, the present invention provides a cell comprising the site-specific SFRP1 disrupting agent of various embodiments of the above aspects or any other aspect of the invention delineated herein or the vector of various embodiments of the above aspects or any other aspect of the invention delineated herein.


In one aspect, the site-specific SFRP1 disrupting agent is present in a composition. In another aspect, the composition comprises a pharmaceutical composition.


In one embodiment, the pharmaceutical composition comprises a lipid formulation. In another aspect, the lipid formulation comprises one or more cationic lipids, one or more non-cationic lipids, one or more cholesterol-based lipids, or one or more PEG-modified lipids, or combinations of any of the foregoing. In another aspect, the pharmaceutical composition comprises a lipid nanoparticle.


In one embodiment, the present invention provides a site-specific SFRP1 disrupting agent, comprising a nucleic acid molecule encoding a fusion protein, the fusion protein comprising a site-specific SFRP1 targeting moiety which targets an SFRP1 expression control region, and an effector molecule.


In one embodiment, the site-specific SFRP1 targeting moiety comprises a polynucleotide encoding a Cas or dCas polypeptide, or a fragment thereof, and a polynucleotide encoding a guide RNA that specifically binds to the SFRP1 expression control region; or a DNA-binding domain of a Transcription activator-like effector (TALE) polypeptide or a zinc finger (ZNF) polypeptide, or fragment thereof, that specifically binds to the SFRP1 expression control region.


In one embodiment, the DNA-binding domain of the TALE or zinc finger polypeptide comprises an amino acid sequence having at least 85%, 90%, 95%, 96%, 97%, 98% or 99% amino acid identity to the entire amino acid sequence of an amino acid sequence selected from the amino acid sequences listed in column 5 of Table 5A.


In one embodiment, the effector molecule comprises a polypeptide or a nucleic acid molecule encoding a polypeptide. In one embodiment, the fusion protein comprises a peptide-nucleic acid fusion.


In one embodiment, the effector is selected from the group consisting of a nuclease, a physical blocker, an epigenetic recruiter, and an epigenetic modifier, and combinations of any of the foregoing. In one embodiment, the effector is selected from the group consisting of euchromatic histone-lysine N-methyltransferase 2 (G9a), enhancer of zeste homolog 2 (EZH2), MQ1 domain (MQ1), Krüppel associated box (KRAB) transcriptional repression domain, and histone deacetylase 8 (HDAC8). In one embodiment, the effector is MQ1. In one embodiment, the effector is KRAB.


In one embodiment, the effector comprises a CRISPR associated protein (Cas) polypeptide or nucleic acid molecule encoding the Cas polypeptide. In one embodiment, the Cas polypeptide is an enzymatically inactive Cas polypeptide. In one embodiment, the site-specific SFRP1 disrupting agent further comprises a catalytically active domain of human exonuclease 1 (hEXO1).


In one embodiment, the epigenetic modifier comprises a transcriptional enhancer or a transcriptional repressor.


In one embodiment, the transcriptional repressor is selected from the group comprising euchromatic histone-lysine N-methyltransferase 2 (G9a), enhancer of zeste homolog 2 (EZH2), MQ1 domain (MQ1), and histone deacetylase 8 (HDAC8).


In one embodiment, the transcriptional repressor is MQ1 domain. In one embodiment, the MQ1 domain comprises an amino acid sequence having at least about 85%, 90%, 95%, 96%, 97%, 98% or 99% amino acid identity to the entire amino acid sequence of SEQ ID NO: 79. In one embodiment, the transcriptional repressor comprises two, three, four, or five MQ1s.


In one embodiment, the transcriptional repressor is a EZH2. In one embodiment, the EZH2 comprises an amino acid sequence having at least about 85%, 90%, 95%, 96%, 97%, 98% or 99% identity to the entire amino acid sequence of SEQ ID NO: 78.


In one embodiment, the epigenetic modifier comprises a DNA methylase, a DNA demethylase, a histone transacetylase, or a histone deacetylase.


In one embodiment, the effector molecule comprises a Krüppel associated box (KRAB) transcriptional repression domain. In one embodiment, the KRAB comprises an amino acid sequence having at least about 85%, 90%, 95%, 96%, 97%, 98% or 99% identity to the entire amino acid sequence of SEQ ID NO: 297.


In one embodiment, the effector molecule comprises a Transcription activator-like effector nuclease (TALEN) polypeptide.


In one embodiment, the site-specific SFRP1 disrupting agent further comprises a second nucleic acid molecule encoding a second fusion protein, wherein the second fusion comprises a second site-specific SFRP1 targeting moiety which targets a second SFRP1 expression control region and a second effector molecule, wherein the second SFRP1 expression control region is different than the SFRP1 expression control region.


In one embodiment, the first nucleic acid molecule and the second nucleic acid molecule are located on the same nucleic acid molecule or on different nucleic acid molecules.


In one embodiment, the SFRP1 expression control region comprises a ZF target sequence comprising SEQ ID NOs: 150, 151, 152, or a combination thereof and the second SFRP1 expression control region comprises a ZF target sequence comprising SEQ ID NOs: 150, 151, 152, or a combination thereof.


In one embodiment, the second effector is different than the effector.


In one embodiment, the second effector is the same as the effector.


In one embodiment, the fusion protein and the second fusion protein are operably linked.


In one embodiment, the fusion protein and the second fusion protein comprise an amino acid sequence that has at least about 85%, 90%, 95%, 96%, 97%, 98% or 99% amino acid sequence identity to the entire amino acid sequence of a polypeptide selected from the group consisting of dCas9-MQ1 (SEQ ID NO: 159), G9A-dCas9 (SEQ ID NO: 162), EZH2-dCas9 (SEQ ID NO: 163), dCas9-HDAC8 (SEQ ID NO: 164), and dCas9-KRAB (SEQ ID NO: 161).


In one embodiment, the fusion protein is encoded by a polynucleotide comprising a nucleotide sequence that has at least about 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide sequence identity to the entire nucleotide sequence of a polynucleotide selected from the group consisting of dCas9-MQ1 mRNA (SEQ ID NO: 165), G9A-dCas9 mRNA (SEQ ID NO: 168), EZH2-dCas9 mRNA (SEQ ID NO: 169), dCas9-HDAC8 mRNA (SEQ ID NO: 170), and dCas9-KRAB mRNA (SEQ ID NO: 167).


In one aspect, the present invention provides a site-specific SFRP1 disrupting agent, comprising a nucleic acid molecule encoding a fusion protein, wherein the fusion protein comprises an amino acid sequence having at least about 85%, 90%, 95%, 96%, 97%, 98% or 99% amino acid identity to the entire amino acid sequence of a polypeptide selected from the group consisting of ZF1-MQ1 (SEQ ID NO: 120), ZF2-MQ1 (SEQ ID NO: 121), ZF3-MQ1 (SEQ ID NO: 122), ZF1-G9A (SEQ ID NO: 126), ZF2-G9A (SEQ ID NO: 127), ZF3-G9A (SEQ ID NO: 128), ZF1-HDAC8 (SEQ ID NO: 132), ZF2-HDAC8 (SEQ ID NO: 133), ZF3-HDAC8 (SEQ ID NO: 134), ZF1-EZH2 (SEQ ID NO: 129), ZF2-EZH2 (SEQ ID NO: 130), and ZF3-EZH2 (SEQ ID NO: 131), and ZF3-KRAB (SEQ ID NO: 300).


In one embodiment, the polypeptide is selected from the group consisting of ZF1-MQ1, ZF2-MQ1, and ZF3-MQ1.


In one embodiment, the polypeptide is ZF1-MQ1.


The present invention also provides vectors comprising a nucleic acid molecule encoding the site-specific SFRP1 disrupting agents of the invention as well as the vectors of the invention.


In one embodiment, the vector is a viral expression vector.


In one aspect, the present invention provides a cell comprising the site-specific SFRP1 disrupting agent of the above aspects or any other aspect of the invention delineated herein or the vector of various embodiments of the above aspects or any other aspect of the invention delineated herein.


In one embodiment, the cell is an immune cell.


In one embodiment, the site-specific SFRP1 disrupting agent is present in a composition.


In one embodiment, the composition comprises a pharmaceutical composition.


In one embodiment, the pharmaceutical composition comprises a lipid formulation.


In one embodiment, the lipid formulation comprises one or more cationic lipids, one or more non-cationic lipids, one or more cholesterol-based lipids, or one or more PEG-modified lipids, or combinations of any of the foregoing.


In one embodiment, the pharmaceutical composition comprises a lipid nanoparticle.


In one aspect, the present invention provides a method of modulating expression of secreted frizzled receptor protein 1 (SFRP1) in a cell, the method comprising contacting the cell with a site-specific SFRP1 disrupting agent, the disrupting agent comprising a site-specific SFRP1 targeting moiety which targets an SFRP1 expression control region, and an effector molecule, thereby modulating expression of SFRP1 in the cell.


In one embodiment, the modulation of expression is reduced expression of SFRP1 in the cell.


In one embodiment, the site-specific SFRP1 targeting moiety comprises a polymeric molecule. The polymeric molecule may comprise a polyamide or a polynucleotide.


In one embodiment, the expression control region comprises an SFRP1-specific transcriptional control element.


In one embodiment, the transcriptional control element comprises an SFRP1 promoter.


In one embodiment, the transcriptional control element comprises a transcriptional repressor.


In one embodiment, the site-specific SFRP1 disrupting agent comprises a nucleotide sequence having at least 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide identity to the entire nucleotide sequence of any of the nucleotide sequences in any one of Tables 2 and 6.


In one embodiment, the site-specific SFRP1 disrupting agent comprises a polynucleotide encoding a Cas or dCas polypeptide, a DNA-binding domain of a Transcription activator-like effector (TALE) polypeptide, or a zinc finger (ZNF) polypeptide, or fragment thereof, that specifically targets the SFRP1 expression control region.


In one embodiment, the DNA-binding domain of the TALE or ZNF comprises an amino acid sequence having at least 85%, 90%, 95%, 96%, 97%, 98% or 99% amino acid identity to the entire amino acid sequence of an amino acid sequence selected from the amino acid sequences listed in column 5 of Table 5A.


In one embodiment, the expression control region comprises one or more SFRP1-associated anchor sequences within an anchor sequence-mediated conjunction comprising a first and a second SFRP1-associated anchor sequence.


In one embodiment, the anchor sequence comprises a CCCTC-binding factor (CTCF) binding motif. In one embodiment, the anchor sequence-mediated conjunction comprises one or more transcriptional control elements internal to the conjunction. In one embodiment, the anchor sequence-mediated conjunction comprises one or more transcriptional control elements external to the conjunction.


In one embodiment, the first and/or the second anchor sequence is located within about 500 kb of the transcriptional control element. In one embodiment, the first and/or the second anchor sequence is located within about 300 kb of the transcriptional control element.


In one embodiment, the anchor sequence is located within 10 kb of the transcriptional control element.


In one embodiment, the expression control region comprises a SFRP1-specific transcriptional control element.


In one embodiment, the transcriptional control element comprises a SFRP1 promoter.


In one embodiment, the transcriptional control element comprises transcriptional enhancer.


In one embodiment, the transcriptional control element comprises a transcriptional repressor.


In one embodiment, the site-specific SFRP1 disrupting agent comprises a nucleotide sequence having at least 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide identity to the entire nucleotide sequence of any of the nucleotide sequences in Table 3.


In one embodiment, the site-specific SFRP1 disrupting agent comprises a polynucleotide encoding a Cas or dCas polypeptide, a DNA-binding domain, or fragment thereof, of a zinc finger polypeptide (ZNF) or a transcription activator-like effector (TALE) polypeptide that specifically binds to the SFRP1 expression control region.


In one embodiment, the DNA-binding domain of the ZNF comprises an amino acid sequence having at least 85%, 90%, 95%, 96%, 97%, 98% or 99% amino acid identity to the entire amino acid sequence of an amino acid sequence selected from the amino acid sequences listed in Table 1B.


In one embodiment, the site-specific SFRP1 disrupting agent comprises a nucleotide modification.


In one embodiment, the polymeric molecule comprises a peptide nucleic acid (PNA).


In one embodiment, the effector molecule comprises a polypeptide.


In one embodiment, the polypeptide comprises a nucleic acid molecule encoding a fusion protein comprising the site-specific SFRP1 targeting moiety which targets an SFRP1 expression regulatory region, and the effector molecule.


In one embodiment, the fusion protein comprises a peptide-nucleic acid fusion molecule.


In one embodiment, the effector is selected from the group consisting of a nuclease, a physical blocker, an epigenetic recruiter, and an epigenetic modifier, and combinations of any of the foregoing.


In one embodiment, the effector is selected from the group consisting of euchromatic histone-lysine N-methyltransferase 2 (G9a), enhancer of zeste homolog 2 (EZH2), MQ1 domain (MQ1), Krüppel associated box (KRAB) transcriptional repression domain, and histone deacetylase 8 (HDAC8).


In one embodiment, the effector is MQ1.


In one embodiment, the effector comprises a CRISPR associated protein (Cas) polypeptide or nucleic acid molecule encoding the Cas polypeptide.


In one embodiment, the Cas polypeptide is an enzymatically inactive Cas polypeptide.


In one embodiment, the Cas polypeptide further comprising a catalytically active domain of human exonuclease 1 (hEXO1).


In one embodiment, the epigenetic modifier comprises a transcriptional enhancer or a transcriptional repressor.


In one embodiment, the transcriptional repressor is selected from the group comprising euchromatic histone-lysine N-methyltransferase 2 (G9a), enhancer of zeste homolog 2 (EZH2), MQ1 domain (MQ1), Krüppel associated box (KRAB) transcriptional repression domain, and histone deacetylase 8 (HDAC8).


In one embodiment, the transcriptional repressor is MQ1 domain.


In one embodiment, the MQ1 domain comprises an amino acid sequence having at least about 85%, 90%, 95%, 96%, 97%, 98% or 99% amino acid identity to the entire amino acid sequence of SEQ ID NO: 79.


In one embodiment, the transcriptional repressor comprises two, three, four, or five MQ1s.


In one embodiment, the transcriptional repressor is EZH2.


In one embodiment, the EZH2 has an amino acid sequence having at least about 85%, 90%, 95%, 96%, 97%, 98% or 99% amino acid identity to the entire amino acid sequence of SEQ ID NO: 78.


In one embodiment, the epigenetic modifier comprises a DNA methylase, a DNA demethylase, a histone transacetylase, or a histone deacetylase.


In one embodiment, the effector molecule comprises a Krüppel associated box (KRAB) transcriptional repression domain. In one embodiment, the KRAB comprises an amino acid sequence having at least about 85%, 90%, 95%, 96%, 97%, 98% or 99% identity to the entire amino acid sequence of SEQ ID NO: 297


In one embodiment, the effector molecule comprises a Transcription activator-like effector nuclease (TALEN) polypeptide.


In one embodiment, the fusion protein comprises an enzymatically inactive Cas polypeptide and an epigenetic recruiter polypeptide.


In one embodiment, the fusion protein comprises an enzymatically active Cas polypeptide and an epigenetic modifier polypeptide.


In one embodiment, the site-specific SFRP1 disrupting agent comprises a second nucleic acid molecule encoding a second fusion protein, wherein the second fusion protein comprises a second site-specific SFRP1 targeting moiety which targets a second SFRP1 expression control region and a second effector molecule, wherein the second SFRP1 expression control region is different than the SFRP1 expression control region.


In one embodiment, the SFRP1 expression control region comprises a ZF target sequence comprising SEQ ID NOs: 150, 151, 152, or a combination thereof and the second SFRP1 expression control region comprises a ZF target sequence comprising SEQ ID NOs: 150, 151, 152, or a combination thereof.


In one embodiment, the second effector is different than the effector.


In one embodiment, the second effector is the same as the effector.


In one embodiment, the fusion protein and the second fusion protein are operably linked.


In one embodiment, the fusion protein and the second fusion protein comprise an amino acid sequence that has at least about 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to the entire amino acid sequence of a polypeptide selected from the group consisting of dCas9-MQ1 (SEQ ID NO: 159), G9A-dCas9 (SEQ ID NO: 162), EZH2-dCas9 (SEQ ID NO: 163), dCas9-HDAC8 (SEQ ID NO: 164), and dCas9-KRAB (SEQ ID NO: 161).


In one embodiment, the fusion protein comprises an amino acid sequence having at least 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to the entire amino acid sequence of a polypeptide selected from the group consisting of ZF1-MQ1 (SEQ ID NO: 120), ZF2-MQ1 (SEQ ID NO: 121), ZF3-MQ1 (SEQ ID NO: 122), ZF1-G9A (SEQ ID NO: 126), ZF2-G9A (SEQ ID NO: 127), ZF3-G9A (SEQ ID NO: 128), ZF1-HDAC8 (SEQ ID NO: 132), ZF2-HDAC8 (SEQ ID NO: 133), ZF3-HDAC8 (SEQ ID NO: 134), ZF1-EZH2 (SEQ ID NO: 129), ZF2-EZH2 (SEQ ID NO: 130), and ZF3-EZH2 (SEQ ID NO: 131), and ZF3-KRAB (SEQ ID NO: 300). In one embodiment, the polypeptide is ZF3-KRAB.


In one embodiment, the fusion protein is encoded by a polynucleotide having a sequence that has at least about 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to the entire nucleotide sequence of a polynucleotide selected from the group consisting of ZF1-MQ1 mRNA (SEQ ID NO: 135), ZF2-MQ1 mRNA (SEQ ID NO: 136), ZF3-MQ1 mRNA (SEQ ID NO: 137), ZF1-G9A mRNA (SEQ ID NO: 141), ZF2-G9A mRNA (SEQ ID NO: 142), ZF3-G9A mRNA (SEQ ID NO: 143), ZF1-HDAC8 mRNA (SEQ ID NO: 147), ZF2-HDAC8 mRNA (SEQ ID NO: 148), ZF3-HDAC8 mRNA (SEQ ID NO: 148), ZF1-EZH2 mRNA (SEQ ID NO: 144), ZF2-EZH2 mRNA (SEQ ID NO: 145), and ZF3-EZH2 mRNA (SEQ ID NO: 146), and ZF3-KRAB mRNA (SEQ ID NO: 301).


In one embodiment, the administration of the site-specific SFRP1 disrupting agent and the second site-specific SFRP1 disrupting agent has a synergistic effect in modulating the expression of SFRP1.


In one embodiment, the SFRP1 expression control region comprises a ZF1 target sequence (SEQ ID NO: 150) and the second SFRP1 expression control region comprises a sequence selected from ZF2 target sequence (SEQ ID NO: 151), and ZF3 target sequence (SEQ ID NO: 152).


In one embodiment, SFRP1 expression control region comprises a ZF1 target sequence (SEQ ID NO: 150) and the second SFRP1 expression control region comprises a ZF2 target sequence (SEQ ID NO: 151).


In one embodiment, SFRP1 expression control region comprises a ZF3 target sequence (SEQ ID NO: 152)


In one embodiment, the site-specific disrupting agent, the effector, or both the site-specific disrupting agent and the effector are present in a vector.


In one embodiment, the site-specific disrupting agent and the effector are present in the same vector.


In one embodiment, the site-specific disrupting agent and the effector are present in different vectors.


In one embodiment, the vector is a viral expression vector.


In one embodiment, the site-specific disrupting agent, the effector, or both the site-specific disrupting agent and the effector are present in a composition.


In one embodiment, the site-specific disrupting agent and the effector are present in the same composition.


In one embodiment, the site-specific disrupting agent and the effector are present in different compositions.


In one embodiment, the composition comprises a pharmaceutical composition.


In one embodiment, the pharmaceutical composition comprises a lipid formulation.


In one embodiment, the lipid formulation comprises one or more cationic lipids, one or more non-cationic lipids, one or more cholesterol-based lipids, or one or more PEG-modified lipids, or combinations of any of the foregoing.


In one embodiment, the pharmaceutical composition comprises a lipid nanoparticle.


In one embodiment, the cell is a mammalian cell.


In one embodiment, the mammalian cell is a somatic cell.


In one embodiment, the mammalian cell is a primary cell.


In one embodiment, the cell is an immune cell.


In one embodiment, the contacting is performed in vitro.


In one embodiment, the contacting is performed in vivo.


In one embodiment, the contacting is performed ex vivo.


In one embodiment, the method further comprising administering the cell to a subject.


In one embodiment, the cell is within a subject.


In one embodiment, the subject has an SFRP1-associated disease.


In one embodiment, the SFRP1-associated disease is selected from the group consisting of androgenic alopecia, alopecia areata, traction alopecia, senescent alopecia, and cicatricial alopecia. A method for treating a subject having an SFRP1-associated disease, comprising administering to the subject a therapeutically effective amount of a site-specific SFRP1 disrupting agent, the disrupting agent comprising a site-specific SFRP1 targeting moiety which targets an SFRP1 expression control region, and an effector molecule, thereby treating the subject.


In one embodiment, the SFRP1-associated disease is alopecia and the site-specific SFRP1 disrupting agent reduces expression of SFRP1 in the subject.


In one embodiment, the SFRP1-associated disease is selected from the group consisting of androgenic alopecia, alopecia areata, traction alopecia, senescent alopecia, and cicatricial alopecia and the site-specific SFRP1 disrupting agent reduces expression of SFRP1 in the subject.


In one embodiment, the site-specific SFRP1 disrupting agent and the effector molecule are administered to the subject concurrently.


In one embodiment, the site-specific SFRP1 disrupting agent and the effector molecule are administered to the subject sequentially.


In one embodiment, the effector molecule is administered to the subject prior to administration of the site-specific SFRP1 disrupting agent.


In one embodiment, the site-specific SFRP1 disrupting agent is administered to the subject prior to administration of the effector molecule.


In one aspect, the present invention provides a site-specific SFRP1 disrupting agent, comprising a site-specific SFRP1 targeting moiety which targets an SFRP1 expression control region, wherein the SFRP1 expression control region comprises the nucleotide sequence of any one of the nucleotide sequences listed in column 3 of Table 1B.


In one embodiment, the site-specific SFRP1 targeting moiety comprises a nucleotide sequence having at least 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide identity to the entire nucleotide sequence of any of the nucleotide sequences in any one of Tables 2 and 6.


In one embodiment, the site-specific SFRP1 targeting moiety comprises a polymeric molecule comprising a polynucleotide encoding a DNA-binding domain of a Transcription activator-like effector (TALE) polypeptide or a zinc finger (ZNF) polypeptide, or fragment thereof, that specifically binds to the SFRP1 expression control region.


In one embodiment, the DNA-binding domain of the TALE or ZNF polypeptide comprises an amino acid sequence having at least about 85%, 90%, 95%, 96%, 97%, 98% or 99% amino acid identity to the entire amino acid sequence of any one of the amino acid sequences listed in column 5 of Table 5A.


In one embodiment, the SFRP1 expression control region comprises a nucleotide sequence of a ZF1 target sequence (SEQ ID NO: 150).


In one embodiment, the SFRP1 expression control region comprises a nucleotide sequence of a ZF2 target sequence (SEQ ID NO: 151).


In one embodiment, the SFRP1 expression control region comprises a nucleotide sequence of a ZF3 target sequence (SEQ ID NO: 152).


In one aspect, the present invention provides a site-specific SFRP1 disrupting agent, comprising a polynucleotide encoding the amino acid sequence of ZF1-MQ1 comprising the amino acid sequence of (SEQ ID NO: 120).


In one aspect, the present invention provides a site-specific SFRP1 disrupting agent, comprising a polynucleotide encoding the amino acid sequence of ZF2-MQ1 comprising the amino acid sequence of (SEQ ID NO: 121).


In one aspect, the present invention provides a site-specific SFRP1 disrupting agent, comprising a polynucleotide encoding the amino acid sequence of ZF3-MQ1 comprising the amino acid sequence of (SEQ ID NO: 122).


In one aspect, the present invention provides a site-specific SFRP1 disrupting agent, comprising a polynucleotide encoding the amino acid sequence of ZF1-G9A comprising the amino acid sequence of (SEQ ID NO: 126).


In one aspect, the present invention provides a site-specific SFRP1 disrupting agent, comprising a polynucleotide encoding the amino acid sequence of ZF1-HDAC8 comprising the amino acid sequence of (SEQ ID NO: 132).


In one aspect, the present invention provides a site-specific SFRP1 disrupting agent, comprising a polynucleotide encoding the amino acid sequence of ZF1-EZH2 comprising the amino acid sequence of (SEQ ID NO: 129).


In one aspect, the present invention provides a site-specific SFRP1 disrupting agent, comprising a polynucleotide encoding the amino acid sequence of ZF3-KRAB comprising the amino acid sequence of (SEQ ID NO: 300).


In one aspect, the present invention provides a site-specific SFRP1 disrupting agent, comprising a polynucleotide encoding the amino acid sequence of a dCas9-MQ1 comprising the amino acid sequence of (SEQ ID NO: 158).


In one aspect, the present invention provides a site-specific SFRP1 disrupting agent, comprising a polynucleotide encoding the amino acid sequence of a dCas9-KRAB comprising the amino acid sequence of (SEQ ID NO: 161).


In one aspect, the present invention provides a vector comprising a nucleic acid molecule encoding the site-specific SFRP1 disrupting agent of the above aspects or any other aspect of the invention delineated herein.


In one embodiments, the vector is a viral expression vector.


In one aspect, the present invention provides a pharmaceutical composition comprising the site-specific SFRP1 disrupting agents of the above aspects or any other aspect of the invention delineated herein, or the vectors of the above aspects or any other aspect of the invention delineated herein.


In one embodiment, the pharmaceutical composition comprises a lipid formulation.


In one embodiment, the lipid formulation comprises one or more cationic lipids, one or more non-cationic lipids, one or more cholesterol-based lipids, or one or more PEG-modified lipids, or combinations of any of the foregoing.


In one embodiment, the pharmaceutical composition comprises a lipid nanoparticle.


In another aspect, the present invention provides a pharmaceutical composition, comprising site-specific SFRP1 disrupting agent, comprising a polynucleotide encoding the amino acid sequence of ZF1-MQ1 comprising the amino acid sequence of (SEQ ID NO: 120); and a lipid nanoparticle. In another aspect, the present invention provides a pharmaceutical composition, comprising a site-specific SFRP1 disrupting agent, comprising a polynucleotide encoding the amino acid sequence of ZF2-MQ1 comprising the amino acid sequence of (SEQ ID NO: 121); and a lipid nanoparticle.


In another aspect, the present invention provides a pharmaceutical composition, comprising a site-specific SFRP1 disrupting agent, comprising a polynucleotide encoding the amino acid sequence of a ZF3-MQ1 comprising the amino acid sequence of (SEQ ID NO: 122); and a lipid nanoparticle.


In another aspect, the present invention provides a pharmaceutical composition, comprising a site-specific SFRP1 disrupting agent, comprising a polynucleotide encoding the amino acid sequence of a ZF3-MQ1 comprising the amino acid sequence of (SEQ ID NO: 300); and a lipid nanoparticle.


In another aspect, the present invention provides a cell comprising the site-specific SFRP1 disrupting agent of the above aspects or any other aspect of the invention delineated herein, or the vector of the above aspects or any other aspect of the invention delineated herein.


In another aspect, the present invention provides a method of modulating expression of secreted frizzled related protein 1 (SFRP1) in a cell, the method comprising contacting the cell with a site-specific SFRP1 disrupting agent of the above aspects or any other aspect of the invention delineated herein, or the vector of the above aspects or any other aspect of the invention delineated herein, or the pharmaceutical composition of the above aspects or any other aspect of the invention delineated herein.


In one embodiment, the modulation of expression is enhanced expression of SFRP1 in the cell.


In one embodiment, the modulation of expression is reduced expression of SFRP1 in the cell.





BRIEF DESCRIPTION OF THE DRAWINGS


FIG. 1 depicts a schematic of the SFRP1 gene and surrounding genomic regions, upstream and downstream. CTCF regions on either side of the SFRP1 gene are labeled as “target.” sgRNAs GD29758 and GD29761 are one the left and right side of the SFRP1 gene.



FIG. 2A shows qRNA quantification of SFRP1 mRNA levels 72 hours after transfection with Cas9+sgRNAs, dCas9-MQ1+pooled promoter sgRNAs or safe harbor sgRNAs, dCas9-KRAB+pooled promoter sgRNAs or safe harbor sgRNAs in human dermal neonatal foreskin.



FIG. 2B shows qRNA quantification of SFRP1 mRNA levels 72 hours after transfection with Cas9+sgRNA, dCas9-MQ1+pooled promoter sgRNAs or safe harbor sgRNAs, dCas9-KRAB+pooled promoter sgRNAs or safe harbor sgRNAs in fibroblasts.



FIG. 3 shows qRNA quantification of SFRP1 mRNA levels 72 hours after transfection with dCas9-MQ1 or dCas9-KRAB with sgRNAs, GD29758, GD29761, GD29879 (promoter), and GD29881 (promoter). Cas9 with GD29761 and GD29758 as controls.



FIG. 4 is a schematic of the CTCF region to the left of the SFRP1 gene. sgRNAs, GD30212, GD30670, GD29758, and GD29759 are labeled.



FIG. 5 is a graph depicting the qRNA quantification of SFRP1 mRNA levels 4 days after transfection with dCas9-HDAC, dCas9-G9A, dCas9-EZH2, and dCas9-MQ1 with sgRNAs, GD29764, GD30213, GD30219, GD30211, and GD30212. Both GD30211 and GD30212 are located in the CTCF in the left of the SFRP1 gene.



FIG. 6 is a graph depicting SFRP1 expression in human dermal papilla cells after 168 hours (1 week) after transfection with dCas9MQ1, dCas9-G9A, dCas9-EZH2, or dCas9-HDAC8 with sgRNAs GD30211, GD30212, or GD30219.



FIG. 7A depicts Hi-glass data showing the location of SFRP1 IGD with left CTCF and right CTCF looping interaction and 3D contact.



FIG. 7B is a schematic of the CTCF region to the left of the SFRP1 gene. Zinc finger binding sites, MR-30884 (ZF1), MR-30885 (ZF2), and MR-30886 (ZF3) are labeled. Zing finger (ZF) proteins ZF1, ZF2, and ZF3 are fused with effectors, G9A, HDAC8, EZH2, and MQ1.



FIG. 8 is a graph depicting SFRP1 expression compared to the control when ZF-effector fusion proteins are transfected into donor hair follicle dermal papilla (HFDP) cells from a 12-year-old female. ZF1-G9A, ZF3-G9A, ZF1-EZH2, ZF2-EZH2, ZF3-EZH2, ZF1-HDAC8, and ZF3-HDAC8 were transfected and compared to dCas9/GD30211.



FIG. 9A is a graph depicting SFRP1 expression compared to the control when ZF-effector fusion proteins are transfected into donor hair follicle dermal papilla (HFDP) cells from a 12-year-old female. ZF1-MQ1, ZF3-MQ1, ZF1-MQ1, ZF1-NE, ZF2-NE, and ZF3-NE were transfected and compared after 3 days. NE: no effector.



FIG. 9B is a graph depicting SFRP1 expression compared to the control when ZF-effector fusion proteins are transfected into donor hair follicle dermal papilla (HFDP) cells from a 12-year-old female. ZF1-MQ1, ZF3-MQ1, ZF1-MQ1, ZF1-NE, ZF2-NE, and ZF3-NE were transfected and compared after 7 days. NE: no effector.



FIG. 10A is a graph depicting SFRP1 expression compared to the control when ZF-effector fusion proteins are transfected into donor hair follicle dermal papilla (HFDP) cells from a 54-year-old male. ZF1-MQ1, ZF3-MQ1, ZF1-MQ1, ZF1-NE, ZF2-NE, and ZF3-NE were transfected and compared after 3 days. NE: no effector.



FIG. 10B is a graph depicting SFRP1 expression compared to the control when ZF-effector fusion proteins are transfected into donor hair follicle dermal papilla (HFDP) cells from a 54-year-old male. ZF1-MQ1, ZF3-MQ1, ZF1-MQ1, ZF1-NE, ZF2-NE, and ZF3-NE were transfected and compared after 7 days. NE: no effector.



FIG. 11A is a schematic depicting the CTCF region left of the SFRP1 gene. Zinc finger binding sites, MR-30884 (ZF1), MR-30885 (ZF2), and MR-30886 (ZF3) are labeled.



FIG. 11B is a graph depicting methylation of the CTCF region left of the SFRP1 gene by bisulfite sequencing. Methylation of the region was compared when ZF1-MQ1, ZF2-MQ1, and ZF3-MQ1 were transfected and a control.



FIG. 12A shows Cy-5 fluorescence signals after cell transfection of DP cells of the hair follicle with Nano lipid particle formulation comprising DOTAP 3451. NLP was labeled with Cy-5. GFP mRNA was encapsulated in the NLP.



FIG. 12B shows GFP fluorescence signals after cell transfection of cells of the hair follicle with Nano lipid particle formulation comprising DOTAP 3451. Signal after transfection indicated GFP protein production and confirms active delivery.



FIG. 12C shows GFP signal in the hair follicle following transfection with DOTAP 3451 NLPs with GFP mRNA.



FIG. 12D shows Cy-5 fluorescence signals after cell transfection of DP cells of the hair follicle with Nano lipid particle formulation comprising DOTAP 4750. LNP was labeled with Cy-5. GFP mRNA was encapsulated in the NLP.



FIG. 12E shows GFP fluorescence signals after cell transfection of cells of the hair follicle with Nano lipid particle formulation comprising DOTAP 4750. Signal after transfection indicated GFP protein production and confirms active delivery.



FIG. 12F shows GFP signal in the hair follicle following transfection with DOTAP 4750 NLPs with GFP mRNA.



FIG. 13A shows human microdissected hair follicles were transduced at 200 ug/mL on day 1 with control empty LNP DOTAP 4750 without mRNA or ZF1-MQ1 formulated using DOTAP 4750.



FIG. 13B shows SFRP1 mRNA expression with and without transduction with ZF1-MQ1. Microdissected hair n=3 were harvested at day 4 for mRNA extraction and qPCR analysis.



FIG. 13C shows SFRP1 protein levels with and without transduction with ZF1-MQ1 at day 5 and day 6. A decrease in SFRP1 protein levels was observed at day 6 in the hair follicle dermal papilla compartment.



FIG. 13D shows SFRP1 protein expression in germinative and pre-cortical hair matrix after transduction with ZF1-MQ1. A decrease in SFRP1 protein levels in the germinative and pre-cortical hair matrix was observed at both day 5 and day 6.



FIG. 13E shows a representative immunofluorescence image of the SFRP1 protein levels at days 5 and 6.



FIG. 14A shows SFRP1 mRNA expression in hair follicle dermal papilla cells (HFDPC) after transduction with ZF3-KRAB(MR-32183).



FIG. 14B shows ELISA data from cell culture supernatant collected at Day 1, 2 and 3 time points after transduction with and without ZF3-KRAB(MR-32183).



FIG. 15 shows SFRP1 mRNA expression in 12 y/o hair follicle dermal papilla cell donor cells transfected with ZF3-KRAB over 8 days.



FIG. 16A shows a graph depicting the presence of the repressive chromatin modification H3K9me3 and CTCF binding of the CTCF region left of the SFRP1 gene as determined by chromatin immunoprecipitation followed by high-throughput sequencing. Arrowhead indicates the target site of ZF3. NE: no effector.



FIG. 16B shows a graph depicting SFRP1 expression compared to the control when ZF-effector fusion proteins are transfected into donor hair follicle dermal papilla (HFDP) cells from a 12-year-old female. ZF3-KRAB and ZF3-NE were transfected and compared with untreated cells after 2 days. NE: no effector.





DETAILED DESCRIPTION OF THE INVENTION

The present invention provides agents and compositions for modulating expression (e.g., enhanced or reduced expression) of a secreted frizzled related protein 1 (SFRP1) gene by targeting an SFRP1 expression control region. The SFRP1 gene may be in a cell, e.g., a mammalian cell, such as a mammalian somatic cell, e.g., a human somatic cell. The present invention also provides methods of using the agents and compositions of the invention for modulating the expression of an SFRP1 gene or for treating a subject who would benefit from modulating the expression of an SFRP1 gene, e.g., a subject suffering or prone to suffering from an SFRP1-associated disease, for example, hair loss.


The agents of the invention are referenced to herein as site-specific SFRP1 disrupting agents and are described in Section II, below.


I. Definitions

In order that the present invention may be more readily understood, certain terms are first defined. In addition, it should be noted that whenever a value or range of values of a parameter are recited, it is intended that values and ranges intermediate to the recited values are also intended to be part of this invention.


The articles “a” and “an” are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, “an element” means one element or more than one element, e.g., a plurality of elements.


The term “including” is used herein to mean, and is used interchangeably with, the phrase “including but not limited to”. The term “or” is used herein to mean, and is used interchangeably with, the term “and/or,” unless context clearly indicates otherwise.


The term “about” is used herein to mean within the typical ranges of tolerances in the art. For example, “about” can be understood as about 2 standard deviations from the mean. In certain embodiments, about means±10%. In certain embodiments, about means±5%. When about is present before a series of numbers or a range, it is understood that “about” can modify each of the numbers in the series or range.


The term “at least” prior to a number or series of numbers is understood to include the number adjacent to the term “at least”, and all subsequent numbers or integers that could logically be included, as clear from context. For example, the number of nucleotides in a nucleic acid molecule must be an integer. For example, “at least 18 nucleotides of a 21 nucleotide nucleic acid molecule” means that 18, 19, 20, or 21 nucleotides have the indicated property. When at least is present before a series of numbers or a range, it is understood that “at least” can modify each of the numbers in the series or range.


As used herein, “no more than” or “less than” is understood as the value adjacent to the phrase and logical lower values or integers, as logical from context, to zero. When “no more than” is present before a series of numbers or a range, it is understood that “no more than” can modify each of the numbers in the series or range.


As used herein, the term “substantially” refers to the qualitative condition of exhibiting total or near-total extent or degree of a characteristic or property of interest. One of ordinary skill in the art will understand that biological and chemical phenomena rarely, if ever, go to completion and/or proceed to completeness or achieve or avoid an absolute result. The term “substantially” may therefore be used in some embodiments herein to capture potential lack of completeness inherent in many biological and chemical phenomena.


As used herein, the terms “secreted frizzled related protein 1” and “SFRP1,” as used interchangeably herein, refer to the gene as well as the well-known encoded protein that is a Wnt signaling pathway component and, more specifically, a secreted extracellular polypeptide that binds to a Wnt protein. The Wnt proteins control the expression of several genes, including pre-mitotic genes involved in hair growth. SFRP1 is a Wnt antagonist. In the absence of SFRP1, Wnt can bind to the frizzled receptor, this begins a phosphorylation cascade which de-phosphorylates B-catenin, and frees it from the destruction complex. Then B-catenin is able to translocate into the nucleus where it activates pro-mitotic genes for hair growth. Decreased expression of the SFRP1 gene has been associated increased expression of pre-mitotic genes and increased hair growth. Expression of the SFRP1 gene results in sequestering of the Wnt proteins and decreased activation of pre-mitotic genes and has been associated with alopecia (e.g., androgenic alopecia, alopecia areata, traction alopecia, senescent alopecia and cicatricial alopecia). The nucleotide and amino acid sequence of SFRP1 is known and may be found in, for example, GenBank Accession Nos. NM_003012.5 (NM_003012) and NP_003003.3 (NP_003003), the entire contents of each of which are incorporated herein by reference. The nucleotide sequence of the genomic region of Chromosome 8 which includes the endogenous promoters of SFRP1 and the SFRP1 coding sequence is also known and may be found in GenBank Accession No. NC_000008.11 (41261962 . . . 41309473) and NC_000008.10 (41119481 . . . 41166992).


The SFRP1 gene is located on chromosome 8, with three exons. SFRP1 is expressed most commonly in endometrium, fat, gall bladder, heart, kidney, ovary, prostate, salivary gland, testis and urinary bladder cells (Fagerberg L, et al., Analysis of the human tissue-specific expression by genome-wide integration of transcriptomics and antibody-based proteomics. Mol Cell Proteomics. 2014 February; 13(2):397-406. doi: 0.1074/mcp.M113.035600). SFRP1 is also expressed in dermal cells.


A “Wnt protein” is a ligand of the Wnt signaling pathway component which binds to a Frizzled receptor so as to activate Wnt signaling Specific examples of Wnt proteins include at least 19 members, are known and may be found in, for example, GenBank Accession Nos. NM_005430 (Wnt-1), NM_003391 (Wnt-2), NM_004185 (Wnt-2B also known as Wnt-13), NM_030753 (Wnt-3), NM_033131 (Wnt3a), NM_030761 (Wnt-4), NM_003392 (Wnt-5A), NM_032642 (Wnt-5B), NM_006522 (Wnt-6), NM_004625 (Wnt-7A), NM_058238 (Wnt-7B), NM_058244 (Wnt-8A), NM_003393 (Wnt-8B), NM_003395 (Wnt-9A also known as Wnt-14), NM_003396 (Wnt-9B also known as Wnt-15), NM_025216 (Wnt-10A), NM_003394 (Wnt-10B), NM_004626 (Wnt-11), NM_016087 (Wnt-16). Each Wnt protein contains 23-24 conserved cysteine residues which show highly conserved spacing. McMahon, A P et al., Trends Genet. 8: 236-242 (1992); Miller J R., Genome Biol. 3(1): 3001.1-3001.15 (2002). The entire contents of each of the foregoing GenBank Accession numbers are incorporated herein by reference as of the date of filing this application. The term “site-specific SFRP1 disrupting agent,” as used herein, refers to any agent that specifically binds to a target SFRP1 expression control region and, e.g., modulates expression of an SFRP1 gene. The modulation of expression may be permanent or transient modulation. Site-specific SFRP1 disruption agents of the invention may comprise a “site-specific SFRP1 targeting moiety.”


As used herein, the term “site-specific SFRP1 targeting moiety” refers to a moiety that specifically binds to an SFRP1 expression control region, e.g., a transcriptional control region of an SFRP1 gene, such as a DNA region around/proximally upstream of the transcription start site, a promoter, an enhancer, or a repressor; or an SFRP1-associated anchor sequence, such as, for example within an SFRP1-associated anchor sequence-mediated conjunction. Exemplary “site-specific SFRP1 targeting moieties” include, but are not limited to, polyamides, nucleic acid molecules, such as RNA, DNA, or modified RNA or DNA, polypeptides, protein nucleic acid molecules, and fusion proteins.


As used herein, the terms “specific binding” or “specifically binds” refer to an ability to discriminate between possible binding partners in the environment in which binding is to occur. In some embodiments, a disrupting agent that interacts, e.g., preferentially interacts, with one particular target when other potential disrupting agents are present is said to “bind specifically” to the target (i.e., the expression control region) with which it interacts. In some embodiments, specific binding is assessed by detecting or determining the degree of association between the disrupting agent and its target; in some embodiments, specific binding is assessed by detecting or determining degree of dissociation of a disrupting agent-target complex. In some embodiments, specific binding is assessed by detecting or determining ability of the disrupting agent to compete with an alternative interaction between its target and another entity. In some embodiments, specific binding is assessed by performing such detections or determinations across a range of concentrations.


As used herein, the term “expression control region” or expression control domain’ refers to a region or domain present in a genomic DNA that modulates the expression of a target gene in a cell. A functionality associated with an expression control region may directly affect expression of a target gene, e.g., by recruiting or blocking recruitment of a transcription factor that would stimulate expression of the gene. A functionality associated with an expression control region may indirectly affect expression of a target gene, e.g., by introducing epigenetic modifications or recruiting other factors that introduce epigenetic modifications that induce a change in chromosomal topology that modulates expression of a target gene. Expression control regions may be upstream and/or downstream of the protein coding sequence of a gene and include, for example, transcriptional control elements, e.g., DNA regions around/proximally upstream of the transcription start site, promoters, enhancers, or repressors; and anchor sequences, and anchor sequence-mediated conjunctions.


The term “transcriptional control element,” as used herein, refers to a nucleic acid sequence that controls transcription of a gene. Transcriptional control elements include, for example, anchor sequences, anchor sequence-mediated conjunctions, DNA regions around/proximally upstream of the transcription start site, promoters, enhancers, promoters, transcriptional enhancers, and transcriptional repressors.


A transcription start site (TSS) is the location where transcription starts at the 5′-end of a gene sequence. The DNA regions around/proximally upstream of the TSS can regulate the expression of a gene by, for example, recruiting a transcription factor. Alteration in the modification status of one or more nucleotides (e.g., methylation) or one or more chromatin proteins (e.g., acetylation) in the DNA regions around/proximally upstream of the TSS can regulate the expression of a gene.


A promoter is a region of DNA recognized by an RNA polymerase to initiate transcription of a particular gene and is generally located upstream of the 5′-end of the transcription start site of the gene.


A “transcriptional enhancer” increases gene transcription. A “transcriptional silencer” or “transcriptional repressor” decreases gene transcription. Enhancing and silencing sequences may be about 50-3500 base pairs in length and may influence gene transcription up to about 1 megabases away.


The term “gene,” as used herein, refers to a sequence of nucleotides that encode a molecule, such as a protein, that has a function. A gene contains sequences that are transcribed (e.g., a 3′UTR), sequences that are not transcribed (e.g., a promoter), sequences that are translated (e.g., an exon), and sequences that are not translated (e.g., intron).


As used herein, the term “target gene” means an SFRP1 gene that is targeted for modulation, e.g., increase or decrease, of expression. In some embodiments, an SFRP1 target gene is part of a targeted genomic complex (e.g. an SFRP1 gene that has at least part of its genomic sequence as part of a target genomic complex, e.g. inside an anchor sequence-mediated conjunction), which genomic complex is targeted by one or more site-specific disrupting agents as described herein. In some embodiments, modulation comprises inhibition of expression of the target gene. In some embodiments, an SFRP1 gene is modulated by contacting the SFRP1 gene or a transcription control element operably linked to the SFRP1 gene with one or more site-specific disrupting agents as described herein. In some embodiments, an SFRP1 gene is aberrantly expressed (e.g., over-expressed) in a cell, e.g., a cell in a subject (e.g., a subject having an SFRP1-associated disease or auto-immune disease). In some embodiments, an SFRP1 gene is aberrantly expressed (e.g., under-expressed) in a cell, e.g., a cell in a subject (e.g., a subject having an SFRP1-associated disease or auto-immune disease).


The term “anchor sequence” as used herein, refers to a nucleic acid sequence recognized by a nucleating agent that binds sufficiently to form an anchor sequence-mediated conjunction, e.g., a complex. In some embodiments, an anchor sequence comprises one or more CTCF binding motifs. In some embodiments, an anchor sequence is not located within a gene coding region. In some embodiments, an anchor sequence is located within an intergenic region. In some embodiments, an anchor sequence is not located within either of an enhancer or a promoter. In some embodiments, an anchor sequence is located at least 400 bp, at least 450 bp, at least 500 bp, at least 550 bp, at least 600 bp, at least 650 bp, at least 700 bp, at least 750 bp, at least 800 bp, at least 850 bp, at least 900 bp, at least 950 bp, or at least 1 kb away from any transcription start site. In some embodiments, an anchor sequence is located within a region that is not associated with genomic imprinting, monoallelic expression, and/or monoallelic epigenetic marks. In some embodiments, the anchor sequence has one or more functions selected from binding an endogenous nucleating polypeptide (e.g., CTCF), interacting with a second anchor sequence to form an anchor sequence mediated conjunction, or insulating against an enhancer that is outside the anchor sequence mediated conjunction. In some embodiments of the present invention, technologies are provided that may specifically target a particular anchor sequence or anchor sequences, without targeting other anchor sequences (e.g., sequences that may contain a nucleating agent (e.g., CTCF) binding motif in a different context); such targeted anchor sequences may be referred to as the “target anchor sequence”. In some embodiments, sequence and/or activity of a target anchor sequence is modulated while sequence and/or activity of one or more other anchor sequences that may be present in the same system (e.g., in the same cell and/or in some embodiments on the same nucleic acid molecule, e.g., the same chromosome) as the other targeted anchor sequence is not modulated. In some embodiments, the anchor sequence comprises or is a nucleating polypeptide binding motif. In some embodiments, the anchor sequence is adjacent to a nucleating polypeptide binding motif.


The term “anchor sequence-mediated conjunction” as used herein, refers to a DNA structure, in some cases, a complex, that occurs and/or is maintained via physical interaction or binding of at least two anchor sequences in the DNA by one or more polypeptides, such as nucleating polypeptides, or one or more proteins and/or a nucleic acid entity (such as RNA or DNA), that bind the anchor sequences to enable spatial proximity and functional linkage between the anchor sequences.


As used herein, the term “genomic complex” is a complex that brings together two genomic sequence elements that are spaced apart from one another on one or more chromosomes, via interactions between and among a plurality of protein and/or other components (potentially including, the genomic sequence elements). In some embodiments, the genomic sequence elements are anchor sequences to which one or more protein components of the complex bind. In some embodiments, a genomic complex may comprise an anchor sequence-mediated conjunction. In some embodiments, a genomic sequence element may be or comprise a CTCF binding motif, a promoter and/or an enhancer. In some embodiments, a genomic sequence element includes at least one or both of a promoter and/or regulatory region (e.g., an enhancer). In some embodiments, complex formation is nucleated at the genomic sequence element(s) and/or by binding of one or more of the protein component(s) to the genomic sequence element(s). As will be understood by those skilled in the art, in some embodiments, co-localization (e.g., conjunction) of the genomic sites via formation of the complex alters DNA topology at or near the genomic sequence element(s), including, in some embodiments, between them. In some embodiments, a genomic complex comprises an anchor sequence-mediated conjunction, which comprises one or more loops. In some embodiments, a genomic complex as described herein is nucleated by a nucleating polypeptide such as, for example, CTCF and/or Cohesin. In some embodiments, a genomic complex as described herein may include, for example, one or more of CTCF, Cohesin, non-coding RNA (e.g., eRNA), transcriptional machinery proteins (e.g., RNA polymerase, one or more transcription factors, for example selected from the group consisting of TFIIA, TFIIB, TFIID, TFIIE, TFIIF, TFIIH, etc.), transcriptional regulators (e.g., Mediator, enhancer-binding proteins, repressor-binding proteins, histone modifiers, etc.), etc. In some embodiments, a genomic complex as described herein includes one or more polypeptide components and/or one or more nucleic acid components (e.g., one or more RNA components), which may, in some embodiments, be interacting with one another and/or with one or more genomic sequence elements (e.g., anchor sequences, promoter sequences, regulatory sequences (e.g., enhancer sequences)) so as to constrain a stretch of genomic DNA into a topological configuration (e.g., a loop) that the stretch of genomic DNA does not adopt when the complex is not formed.


An “effector molecule,” as used herein, refers to a molecule that is able to regulate a biological activity, such as enzymatic activity, gene expression, anchor sequence-mediated conjunction or cell signaling. Exemplary effectors are described in Section II, below, and in some embodiment include, for example, nucleases, physical blockers, epigenetic recruiters, e.g., a transcriptional enhancer or a transcriptional repressor, and epigenetic CpG modifiers, e.g., a DNA methylase, a DNA demethylase, a histone modifying agent, a histone transacetylase (also known as histone acetyltransferase), or a histone deacetylase, and combinations of any of the foregoing.


II. Site-Specific SFRP1 Disrupting Agents of the Invention

The present invention provides site-specific SFRP1 disrupting agents which, in one aspect of the invention include a site-specific SFRP1 targeting moiety which targets an SFRP1 expression control region. In another aspect, the site-specific disrupting agents of the invention include a site-specific SFRP1 targeting moiety which targets an SFRP1 expression control region and an effector molecule. As will be appreciated by one of ordinary skill in the art, such disrupting agents are site-specific and, thus, specifically bind to an SFRP1 expression control region (e.g., one or more transcriptional control elements and/or one or more target anchor sequences), e.g., within a cell and not to non-targeted expression control regions (e.g., within the same cell).


SFRP1 is a modulator of Wnt signaling that binds Wnt at the Frizzled binding site and inhibits Wnt from binding Frizzled and activating Frizzled. Inactive Frizzled allows for activation of pre-mitotic genes. The present invention features the use of effector molecules, e.g., chromatin remodelers, that when fused to DNA-targeting moieties can induce epigenetic changes at specific genomic regions that lead to increased transcription of targeted genes, e.g., SFRP1 gene. In certain embodiments, an effector molecule, HDAC8, G9A, EZH2, KRAB, or MQ1, fused to dCas9, which is the DNA targeting moiety, is targeted to the SFRP1 locus using single guide RNAs (sgRNAs) complementary to the DNA region around/just upstream of the transcription start site (TSS) of a SFRP1 gene and provokes changes in histone modifications, e.g., methylation.


Activation of pre-mitotic genes has been shown to be important for activating or maintaining hair growth in a subject with alopecia (e.g., androgenic alopecia (hormone imbalance), alopecia areata (immune disorders); traction alopecia (mechanical stress), senescent alopecia (age); and cicatricial alopecia (inflammatory disorders) (Hawkshaw N, et al., (2018) PLOS Biology 16(5): e2003705. doi: 10.1371/journal.pbio.2003705). The present invention features methods to directly target SFRP1 using targeting moieties (e.g., dCas9, TALEs, or ZF proteins)


The site-specific SFRP1 disrupting agents of the invention comprise a site-specific SFRP1 targeting moiety targeting an SFRP1 expression control region. The expression control region targeted by the site-specific targeting moiety may be, for example, a transcriptional control element or an anchor sequence, such as an anchor sequence within an anchor-mediated conjunction.


Thus, site-specific SFRP1 disrupting agents of the invention may modulate expression of a gene, i.e., SFRP1, e.g., by modulating expression of the gene from a DNA region around/proximally upstream of a transcription start site, an endogenous promoter, an enhancer, or an repressor; may alter methylation of the control region; may alter acetylation of the chromatin protein; may introduce one or more mutations, e.g., substitution, addition or deletion of nucleotide; may alter at least one anchor sequence; may alter at least one conjunction nucleating molecule binding site, such as by altering binding affinity for the conjunction nucleating molecule; may alter an orientation of at least one common nucleotide sequence, such as a CTCF binding motif by, e.g., substitution, addition or deletion in at least one anchor sequence, such as a CTCF binding motif.


In certain embodiments, the site-specific disrupting agents and compositions described herein target an expression control region comprising one or more SFRP1-specific transcriptional control elements to modulate expression in a cell. SFRP1-specific transcriptional control elements that can be targeted include SFRP1-specific promoters, SFRP1-specific enhancers, and SFRP1-specific repressors. In one embodiment, an SFRP1-specific promoter drives expression in dermal cells e.g., DNA region around or proximally upstream of SFRP1-transcription start site.


For example, a site-specific disrupting agent may include a site-specific targeting moiety, e.g., a nucleic acid molecule encoding a DNA-binding domain of a Transcription activator-like effector (TALE) polypeptide or a zinc finger (ZNF) polypeptide, or fragment thereof, that specifically targets and binds to an SFRP1 expression control region, such as an SFRP1 endogenous promoter region, and an effector molecule, such as an effector molecule that includes a transcriptional enhancer or transcriptional repressor that modulates, e.g., enhances or represses, expression of a target gene from an endogenous promoter to modulate gene expression. In one embodiment, the disrupting agent is “bicistronic nucleic acid molecule,” i.e., capable of making two fusion proteins from a single messenger RNA molecule, a first and a second site-specific targeting moiety, e.g., a nucleic acid molecule encoding a DNA-binding domain of a Transcription activator-like effector (TALE) polypeptide or a zinc finger (ZNF) polypeptide, or fragment thereof, that specifically targets and binds to an SFRP1 expression control region, such as a SFRP1 endogenous promoter region, and an effector molecule, such as an effector molecule that includes a transcriptional enhancer or transcriptional repressor that modulates, e.g., enhances or represses, expression of a target gene from an endogenous promoter to modulate gene expression. In some embodiments of the invention, a site-specific disrupting agent may include a site-specific targeting moiety, e.g., a nucleic acid molecule, such as a guide RNA targeting a SFRP1 endogenous DNA region around or proximally upstream of SFRP1 transcription starting site, and an effector molecule, such as an effector molecule that includes a transcriptional enhancer or transcriptional repressor that modulates, e.g., enhances or represses, expression of a target gene from an endogenous promoter to modulate gene expression.


In certain embodiments of the invention, the site-specific disrupting agents and compositions described herein target an expression control region comprising one or more SFRP1-associated anchor sequences, e.g., within an anchor sequence-mediated conjunction, comprising a first and a second SFRP1-associated anchor sequence to alter a two-dimensional chromatin structure, e.g., anchor sequence-mediated conjunctions in order to modulate expression in a cell, e.g., a cell within a subject, e.g., by modifying anchor sequence-mediated conjunctions in DNA, e.g., genomic DNA.


In one aspect, the invention includes a site-specific SFRP1 disrupting agent comprising a site-specific SFRP1 targeting moiety which targets an SFRP1 expression control region comprising one or more SFRP1-associated anchor sequences within an anchor sequence-mediated conjunction. The disrupting agent binds, e.g., specifically binds, a specific anchor sequence-mediated conjunction to alter a topology of the anchor sequence-mediated conjunction, e.g., an anchor sequence-mediated conjunction having a physical interaction of two or more DNA loci bound by a conjunction nucleating molecule.


The formation of an anchor sequence-mediated conjunction may force transcriptional control elements to interact with an SFRP1 gene or spatially constrain the activity of the transcriptional control elements. Altering anchor sequence-mediated conjunctions, therefore, allows for modulating SFRP1 expression without altering the coding sequences of the SFRP1 gene being modulated.


In some embodiments, the site-specific disrupting agents and compositions of the invention modulate expression of an SFRP1 gene associated with an anchor sequence-mediated conjunction by physically interfering between one or more anchor sequences and a conjunction nucleating molecule. For example, a DNA binding small molecule (e.g., minor or major groove binders), peptide (e.g., zinc finger, TALE, novel or modified peptide), protein (e.g., CTCF, modified CTCF with impaired CTCF binding and/or cohesion binding affinity), or nucleic acids (e.g., ssDNA, modified DNA or RNA, peptide oligonucleotide conjugates, locked nucleic acids, bridged nucleic acids, polyamides, and/or triplex forming oligonucleotides) may physically prevent a conjunction nucleating molecule from interacting with one or more anchor sequences to modulate SFRP1 gene expression.


In some embodiments, the site-specific disrupting agents and compositions of the invention modulate expression of an SFRP1 gene associated with an anchor sequence-mediated conjunction by modification of an anchor sequence, e.g., epigenetic modifications, e.g., histone protein modifications, or genomic editing modifications. For example, one or more anchor sequences associated with an anchor sequence-mediated conjunction comprising an SFRP1 gene may be targeted for methylation modification by a DNA methyltransferase, e.g., dCas9-methyltransferase fusion, e.g., antisense oligonucleotide-enzyme fusion, to modulate expression of the gene. In another example, one or more anchor sequences associated with an anchor sequence-mediated conjunction comprising an SFRP1 gene may be targeted for genome editing, e.g., Cas9-mediated genome editing.


In some embodiments, the site-specific disrupting agents and compositions of the invention modulate expression of an SFRP1 gene associated with an anchor sequence-mediated conjunction, e.g., activate or represses transcription, e.g., induces epigenetic changes to chromatin or genome editing.


In some embodiments, an anchor sequence-mediated conjunction includes one or more anchor sequences, an SFRP1 gene, and one or more transcriptional control elements, such as an enhancing or silencing element. In some embodiments, the transcriptional control element is within, partially within, or outside the anchor sequence-mediated conjunction.


In one embodiment, the anchor sequence-mediated conjunction comprises a loop, such as an intra-chromosomal loop. In certain embodiments, the anchor sequence-mediated conjunction has a plurality of loops. One or more loops may include a first anchor sequence, a nucleic acid sequence, a transcriptional control element, and a second anchor sequence. In another embodiment, at least one loop includes, in order, a first anchor sequence, a transcriptional control element, and a second anchor sequence; or a first anchor sequence, a nucleic acid sequence, and a second anchor sequence. In yet another embodiment, either one or both of the nucleic acid sequences and the transcriptional control element is located within or outside the loop. In still another embodiment, one or more of the loops comprises a transcriptional control element.


In some embodiments, the anchor sequence-mediated conjunction includes a TATA box, a CAAT box, a GC box, or a CAP site.


In some embodiments, the anchor sequence-mediated conjunction comprises a plurality of loops, and where the anchor sequence-mediated conjunction comprises at least one of an anchor sequence, a nucleic acid sequence, and a transcriptional control element in one or more of the loops.


In one aspect, the site-specific disrupting agents and compositions of the invention may introduce a targeted alteration to an anchor sequence-mediated conjunction to modulate expression of a nucleic acid sequence with a disrupting agent that binds the anchor sequence. In some embodiments, the anchor sequence-mediated conjunction is altered by targeting one or more nucleotides within the anchor sequence-mediated conjunction for substitution, addition or deletion.


In some embodiments, expression, e.g., transcription, is activated by inclusion of an activating loop or exclusion of a repressive loop. In one such embodiment, the anchor sequence-mediated conjunction comprises a transcriptional control sequence that increases transcription of a nucleic acid sequence, e.g., such an SFRP1 encoding nucleic acid. In another such embodiment, the anchor sequence-mediated conjunction excludes a transcriptional control element that decreases expression, e.g., transcription, of a nucleic acid sequence, e.g., such an SFRP1 encoding nucleic acid.


In some embodiments, expression, e.g., transcription, is repressed by inclusion of a repressive loop or exclusion of an activating loop. In one such embodiment, the anchor sequence-mediated conjunction includes a transcriptional control element that decreases expression, e.g., transcription, of a nucleic acid sequence, e.g., such as an SFRP1 encoding nucleic acid sequence. In another such embodiment, the anchor sequence-mediated conjunction excludes a transcriptional control sequence that increases transcription of a nucleic acid sequence, e.g., such an SFRP1 encoding nucleic acid.


Each anchor sequence-mediated conjunction comprises one or more anchor sequences, e.g., a plurality. Anchor sequences can be manipulated or altered to disrupt naturally occurring loops or form new loops (e.g., to form exogenous loops or to form non-naturally occurring loops with exogenous or altered anchor sequences). Such alterations modulate SFRP1 gene expression by changing the 2-dimensional structure of DNA containing all or a portion of an SFRP1 gene, e.g., by thereby modulating the ability of the SFRP1 gene to interact with transcriptional control elements (e.g., enhancing and silencing/repressive sequences). In some embodiments, the chromatin structure is modified by substituting, adding or deleting one or more nucleotides within an anchor sequence of the anchor sequence-mediated conjunction.


The anchor sequences may be non-contiguous with one another. In embodiments with noncontiguous anchor sequences, the first anchor sequence may be separated from the second anchor sequence by about 500 bp to about 500 Mb, about 750 bp to about 200 Mb, about Ikb to about 100 Mb, about 25 kb to about 50 Mb, about 50 kb to about 1 Mb, about 100 kb to about 750 kb, about 150 kb to about 500 kb, or about 175 kb to about 500 kb. In some embodiments, the first anchor sequence is separated from the second anchor sequence by about 500 bp, 600 bp, 700 bp, 800 bp, 900 bp, 1 kb, 5 kb, 10 kb, 15 kb, 20 kb, 25 kb, 30 kb, 35 kb, 40 kb, 45 kb, 50 kb, 55 kb, 60 kb, 65 kb, 70 kb, 75 kb, 80 kb, 85 kb, 90 kb, 95 kb, 100 kb, 125 kb, 150 kb, 175 kb, 200 kb, 225 kb, 250 kb, 275 kb, 300 kb, 350 kb, 400 kb, 500 kb, 600 kb, 700 kb, 800 kb, 900 kb, 1 Mb, 2 Mb, 3 Mb, 4 Mb, 5 Mb, 6 Mb, 7 Mb, 8 Mb, 9 Mb, 10 Mb, 15 Mb, 20 Mb, 25 Mb, 50 Mb, 75 Mb, 100 Mb, 200 Mb, 300 Mb, 400 Mb, 500 Mb, or any size therebetween.


In one embodiment, the anchor sequence comprises a common nucleotide sequence, e.g., a CTCF-binding motif:









(SEQ ID NO: 70)


N(T/C/G)N(G/A/T)CC(A/T/G)(C/G)(C/T/A)AG(G/A)(G/T)





GG(C/A/T)(G/A)(C/G)(C/T/A)(G/A/C), 


where N is any nucleotide.





A CTCF-binding motif may also be in the opposite 


orientation, e.g.,


(SEQ ID NO: 71)


(G/A/C)(C/T/A)(C/G)(G/A)(C/A/T)GG(G/T)(G/A)GA





(C/T/A)(C/G)(A/T/G)CC(G/A/T)N(T/C/G)N.






In one embodiment, the anchor sequence comprises SEQ ID NO: 70 or SEQ ID NO: 71 or a nucleotide sequence at least 75%, at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identical to either SEQ ID NO: 70 or SEQ ID NO: 71.


In some embodiments, the anchor sequence-mediated conjunction comprises at least a first anchor sequence and a second anchor sequence. The first anchor sequence and second anchor sequence may each comprise a common nucleotide sequence, e.g., each comprises a CTCF binding motif. In some embodiments, the first anchor sequence and second anchor sequence comprise different sequences, e.g., the first anchor sequence comprises a CTCF binding motif and the second anchor sequence comprises an anchor sequence other than a CTCF binding motif. In some embodiments, each anchor sequence comprises a common nucleotide sequence and one or more flanking nucleotides on one or both sides of the common nucleotide sequence.


Two CTCF-binding motifs (e.g., contiguous or non-contiguous CTCF binding motifs) that can form a conjunction may be present in the genome in any orientation, e.g., in the same orientation (tandem) either 5′->3′ (left tandem, e.g., the two CTCF-binding motifs that comprise SEQ ID NO: 70) or 3′->5′ (right tandem, e.g., the two CTCF-binding motifs comprise SEQ ID NO: 71), or convergent orientation, where one CTCF-binding motif comprises SEQ ID NO: 70 and the other comprises SEQ ID NO: 65. CTCFBSDB 2.0: Database For CTCF binding motifs And Genome Organization (http://insulatordb.uthsc.edu/) can be used to identify CTCF binding motifs associated with a target gene, e.g., SFRP1.


In some embodiments, the anchor sequence-mediated conjunction is altered by changing an orientation of at least one common nucleotide sequence, e.g., a conjunction nucleating molecule binding site.


In some embodiments, the anchor sequence comprises a conjunction nucleating molecule binding site, e.g., CTCF binding motif, and site-specific disrupting agent of the invention introduces an alteration in at least one conjunction nucleating molecule binding site, e.g. altering binding affinity for the conjunction nucleating molecule.


In some embodiments, the anchor sequence-mediated conjunction is altered by introducing an exogenous anchor sequence. Addition of a non-naturally occurring or exogenous anchor sequence to form or disrupt a naturally occurring anchor sequence-mediated conjunction, e.g., by inducing a non-naturally occurring loop to form that alters transcription of the nucleic acid sequence.


In some embodiments, the anchor sequence-mediated conjunction comprises an SFRP1 gene, and one or more, e.g., 2, 3, 4, 5, or other genes other than the SFRP1 gene.


In some embodiments, the anchor sequence-mediated conjunction is associated with one or more, e.g., 2, 3, 4, 5, or more, transcriptional control elements. In some embodiments, the SFRP1 gene is noncontiguous with one or more of the transcriptional control elements. In some embodiments where the SFRP1 gene is non-contiguous with the transcriptional control element, the gene may be separated from one or more transcriptional control elements by about 100 bp to about 500 Mb, about 500 bp to about 200 Mb, about 1 kb to about 100 Mb, about 25 kb to about 50 Mb, about 50 kb to about 1 Mb, about 100 kb to about 750 kb, about 150 kb to about 500 kb, or about 175 kb to about 500 kb. In some embodiments, the gene is separated from the transcriptional control element by about 100 bp, 300 bp, 500 bp, 600 bp, 700 bp, 800 bp, 900 bp, 1 kb, 5 kb, 10 kb, 15 kb, 20 kb, 25 kb, 30 kb, 35 kb, 40 kb, 45 kb, 50 kb, 55 kb, 60 kb, 65 kb, 70 kb, 75 kb, 80 kb, 85 kb, 90 kb, 95 kb, 100 kb, 125 kb, 150 kb, 175 kb, 200 kb, 225 kb, 250 kb, 275 kb, 300 kb, 350 kb, 400 kb, 500 kb, 600 kb, 700 kb, 800 kb, 900 kb, 1 Mb, 2 Mb, 3 Mb, 4 Mb, 5 Mb, 6 Mb, 7 Mb, 8 Mb, 9 Mb, 10 Mb, 15 Mb, 20 Mb, 25 Mb, 50 Mb, 75 Mb, 100 Mb, 200 Mb, 300 Mb, 400 Mb, 500 Mb, or any size therebetween.


In some embodiments, the type of anchor sequence-mediated conjunction may help to determine how to modulate gene expression, e.g., choice of site-specific targeting moiety, by altering the anchor sequence-mediated conjunction. For example, some types of anchor sequence-mediated conjunctions comprise one or more transcription control elements within the anchor sequence-mediated conjunction. Disruption of such an anchor sequence-mediated conjunction by disrupting the formation of the anchor sequence-mediated conjunction, e.g., altering one or more anchor sequences, is likely to decrease transcription of an SFRP1 gene within the anchor sequence-mediated conjunction.


In some embodiments, expression of the SFRP1 gene is regulated, modulated, or influenced by one or more transcriptional control elements associated with the anchor sequence-mediated conjunction. In some embodiments, the anchor sequence-mediated conjunction comprises an SFRP1 gene and one or more transcriptional control elements. For example, the SFRP1 gene and one or more transcriptional control sequences are located within, at least partially, an anchor sequence-mediated conjunction, e.g., a Type 1 anchor sequence-mediated conjunction. The anchor sequence-mediated conjunction may also be referred to as a “Type 1, EP subtype.” In some embodiments, the SFRP1 gene has a defined state of expression, e.g., in its native state, e.g., in a diseased state. For example, the SFRP1 gene may have a high level of expression. By disrupting the anchor sequence-mediated conjunction, expression of the SFRP1 gene may be decreased, e.g., decreased transcription due to conformational changes of the DNA previously open to transcription within the anchor sequence-mediated conjunction, e.g., decreased transcription due to conformational changes of the DNA creating additional distance between the SFRP1 gene and the enhancing sequences. In one embodiment, both the SFRP1 gene associated and one or more transcriptional control sequences, e.g., enhancing sequences, reside inside the anchor sequence-mediated conjunction. Disruption of the anchor sequence-mediated conjunction decreases expression of the SFRP1 gene. In one embodiment, the SFRP1 gene associated with the anchor sequence-mediated conjunction is accessible to one or more transcriptional control elements that reside inside, at least partially, the anchor sequence-mediated conjunction.


In some embodiments, expression of the SFRP1 gene is regulated, modulated, or influenced by one or more transcriptional control elements associated with, but inaccessible due to the anchor sequence-mediated conjunction. For example, the anchor sequence-mediated conjunction associated with an SFRP1 gene disrupts the ability of one or more transcriptional control elements to regulate, modulate, or influence expression of the SFRP1 gene. The transcriptional control sequences may be separated from the SFRP1 gene, e.g., reside on the opposite side, at least partially, e.g., inside or outside, of the anchor sequence-mediated conjunction as the SFRP1 gene, e.g., the SFRP1 gene is inaccessible to the transcriptional control elements due to proximity of the anchor sequence-mediated conjunction. In some embodiments, one or more enhancing sequences are separated from the SFRP1 gene by the anchor sequence-mediated conjunction, e.g., a Type 2 anchor sequence-mediated conjunction.


In some embodiments, the SFRP1 gene is inaccessible to one or more transcriptional control elements due to the anchor sequence-mediated conjunction, and disruption of the anchor sequence-mediated conjunction allows the transcriptional control element to regulate, modulate, or influence expression of the SFRP1 gene. In one embodiment, the SFRP1 gene is inside and outside the anchor sequence-mediated conjunction and inaccessible to the one or more transcriptional control elements. Disruption of the anchor sequence-mediated conjunction increases access of the transcriptional control elements to regulate, modulate, or influence expression of the SFRP1 gene, e.g., the transcriptional control elements increase expression of the SFRP1 gene. In one embodiment, the SFRP1 gene is inside the anchor sequence-mediated conjunction and inaccessible to the one or more transcriptional control elements residing outside, at least partially, the anchor sequence-mediated conjunction. Disruption of the anchor sequence-mediated conjunction increases expression of the SFRP1 gene. In one embodiment, the SFRP1 gene is outside, at least partially, the anchor sequence-mediated conjunction and inaccessible to the one or more transcriptional control elements residing inside the anchor sequence-mediated conjunction. Disruption of the anchor sequence-mediated conjunction increases expression of the SFRP1 gene.


A. SFRP1 Site-Specific Targeting Moieties

The site-specific SFRP1 targeting moieties of the invention target an SFRP1 expression control region and may comprise a polymer or polymeric molecule, such as a polyamide (i.e., a molecule of repeating units linked by amide binds, e.g., a polypeptide), a polymer of nucleotides (such as a guide RNA, a nucleic acid molecule encoding a TALE polypeptide or a zinc finger polypeptides), a peptide nucleic acid (PNA), or a polymer of amino acids, such as a peptide or polypeptide, e.g., a fusion protein, etc. Suitable site-specific SFRP1 targeting moieties, compositions, and methods of use of such agents and compositions are described below and in PCT Publication WO 2018/049073, the entire contents of which are expressly incorporated herein by reference.


In another embodiment, a site-specific disrupting agent of the invention comprises a site-specific SFRP1 targeting moiety comprising a nucleic acid molecule, such as a guide RNA (or gRNA) or a guide RNA and an effector, or fragment thereof, or nucleic acid molecule encoding an effector, or fragment thereof.


In one embodiment, a site specific disrupting agent of the invention comprises a site-specific SFRP1 targeting moiety comprising a nucleic acid molecule encoding a polypeptide, such as a DNA-binding domain, of a Transcription activator-like effector (TALE) polypeptide or a zinc finger (ZNF) polypeptide, or fragment thereof, that is engineered to specifically target an SFRP1 expression control region to modulate expression of an SFRP1 gene.


In another embodiment, a site-specific disrupting agent of the invention comprises a site-specific SFRP1 targeting moiety comprising a polynucleotide, such as a PNA, e.g., a nucleic acid gRNA linked to an effector polypeptide, or fragment thereof.


In another embodiment, a site-specific disrupting agent of the invention comprises a site-specific SFRP1 targeting moiety comprising a fusion molecule, such as a nucleic acid molecule encoding a DNA-binding domain, of a Transcription activator-like effector (TALE) polypeptide or a zinc finger (ZNF) polypeptide, or fragment thereof, and an effector.


In one embodiment, such site-specific disrupting agents comprise a second fusion protein, wherein the second fusion protein comprises a second site-specific SFRP1 targeting moiety which targets a second SFRP1 expression control region and a second effector molecule, wherein the second SFRP1 expression control region is different than the SFRP1 expression control region.


In another embodiment, a site-specific disrupting agent of the invention comprises a site-specific SFRP1 targeting moiety comprising a fusion molecule, such as a nucleic acid molecule encoding a fusion protein comprising a Cas polypeptide and, e.g., an epigenetic recruiter or an epigenetic CpG modifier.


In yet, another embodiment, a site-specific disrupting agent of the invention comprises a site-specific SFRP1 targeting moiety comprising a fusion molecule, such as fusion protein comprising a Cas polypeptide and, e.g., an epigenetic recruiter or an epigenetic CpG modifier.


As used herein, in its broadest sense, the term “nucleic acid” refers to any compound and/or substance that is or can be incorporated into an oligonucleotide chain. In some embodiments, a nucleic acid is a compound and/or substance that is or can be incorporated into a polynucleotide chain via a phosphodiester linkage. As will be clear from context, in some embodiments, “nucleic acid” refers to an individual nucleic acid residue (e.g., a nucleotide and/or nucleoside); in some embodiments, “nucleic acid” refers to a polynucleotide chain comprising individual nucleic acid residues. In some embodiments, a “nucleic acid” is or comprises RNA; in some embodiments, a “nucleic acid” is or comprises DNA. In some embodiments, a “nucleic acid” is a “mixmer” comprising locked nucleic acid molecules and deoxynucleic acid molecules. In some embodiments, a nucleic acid is, comprises, or consists of one or more natural nucleic acid residues. In some embodiments, a nucleic acid is, comprises, or consists of one or more nucleic acid analogs. In some embodiments, a nucleic acid analog differs from a nucleic acid in that it does not utilize a phosphodiester backbone. For example, in some embodiments, a nucleic acid is, comprises, or consists of one or more “peptide nucleic acids”, which are known in the art and have peptide bonds instead of phosphodiester bonds in the backbone, are considered within the scope of the present invention. Alternatively or additionally, in some embodiments, a nucleic acid has one or more phosphorothioate and/or 5′-N-phosphoramidite linkages rather than phosphodiester bonds. In some embodiments, a nucleic acid is, comprises, or consists of one or more natural nucleosides (e.g., adenosine, thymidine, guanosine, cytidine, uridine, deoxyadenosine, deoxythymidine, deoxy guanosine, and deoxycytidine). In some embodiments, a nucleic acid is, comprises, or consists of one or more nucleoside analogs (e.g., 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolo-pyrimidine, 3-methyl adenosine, 5-methylcytidine, C-5 propynyl-cytidine, C-5 propynyl-uridine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyl-uridine, C5-propynyl-cytidine, C5-methylcytidine, 2-aminoadenosine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, 0(6)-methylguanine, 2-thiocytidine, methylated bases, intercalated bases, and combinations thereof). In some embodiments, a nucleic acid comprises one or more modified sugars (e.g., 2′-fluororibose, ribose, 2′-deoxyribose, arabinose, and hexose) as compared with those in natural nucleic acids. In some embodiments, a nucleic acid has a nucleotide sequence that encodes a functional gene product such as an RNA or protein. In some embodiments, a nucleic acid includes one or more introns. In some embodiments, nucleic acids are prepared by one or more of isolation from a natural source, enzymatic synthesis by polymerization based on a complementary template (in vivo or in vitro), reproduction in a recombinant cell or system, and chemical synthesis. In some embodiments, a nucleic acid is at least 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 1 10, 120, 130, 140, 150, 160, 170, 180, 190, 20, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 600, 700, 800, 900, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000 or more residues long. In some embodiments, a nucleic acid is partly or wholly single stranded; in some embodiments, a nucleic acid is partly or wholly double stranded. In some embodiments a nucleic acid has a nucleotide sequence comprising at least one element that encodes, or is the complement of a sequence that encodes, a polypeptide. In some embodiments, a nucleic acid has enzymatic activity.


As used herein, the terms “peptide,” “polypeptide,” and “protein” refer to a compound comprised of amino acid residues covalently linked by peptide bonds, or by means other than peptide bonds. A protein or peptide must contain at least two amino acids, and no limitation is placed on the maximum number of amino acids that can comprise a protein's or peptide's sequence. Polypeptides include any peptide or protein comprising two or more amino acids joined to each other by peptide bonds or by means other than peptide bonds. As used herein, the term refers to both short chains, which also commonly are referred to in the art as peptides, oligopeptides and oligomers, for example, and to longer chains, which generally are referred to in the art as proteins, of which there are many types.


In certain embodiments, a polypeptide is or may comprise a chimeric or “fusion protein.” As used herein, a “chimeric protein” or “fusion protein” comprises all or part (preferably a biologically active part) of a first protein operably linked to a heterologous second polypeptide (i.e., a polypeptide other than the first protein). Within the fusion protein, the term “operably linked” is intended to indicate that the first protein or segment thereof and the heterologous polypeptide are fused in-frame to each other. The heterologous polypeptide can be fused to the amino-terminus or the carboxyl-terminus of the first protein or segment.


A “polyamide” is a polymeric molecule with repeating units linked by amide binds. Proteins are examples of naturally occurring polyamides. In some embodiments, a polyamide comprises a peptide nucleic acid (PNA).


A “peptide nucleic acid” (“PNA”) is a molecule in which one or more amino acid units in the PNA have an amide containing backbone, e.g., aminoethyl-glycine, similar to a peptide backbone, with a nucleic acid side chain in place of the amino acid side chain. Peptide nucleic acids (PNA) are known to hybridize complementary DNA and RNA with higher affinity than their oligonucleotide counterparts. This character of PNA not only makes them a stable hybrid with the nucleic acid side chains, but at the same time, the neutral backbone and hydrophobic side chains result in a hydrophobic unit within the polypeptide. The nucleic acid side chain includes, but is not limited to, a purine or a pyrimidine side chain such as adenine, cytosine, guanine, thymine and uracil. In one embodiment, the nucleic acid side chain includes a nucleoside analog as described herein.


In one embodiment, a site-specific SFRP1 targeting moiety of the invention comprises a polyamide. Suitable polyamides for use in the agents and compositions of the invention are known in the art.


In one embodiment, a site-specific SFRP1 targeting moiety of the invention comprises a polynucleotide. In some embodiments, the nucleotide sequence of the polynucleotide encodes an SFRP1 gene or an SFRP1 expression product. In some embodiments, the nucleotide sequence of the polynucleotide does not include an SFRP1 coding sequence or an SFRP1 expression product. For example, in some embodiments, a site-specific SFRP1 targeting moiety of the invention comprises a polynucleotide that hybridizes to a target expression control region, e.g., a promoter, an anchor sequence, or a DNA region around or proximally upstream of the transcription starting site. In some embodiments, the nucleotide sequence of the polynucleotide is a complement of a target DNA region around or proximally upstream of the transcription starting site, or has a sequence that is at least 80%, at least 85%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identical to a complement of the target sequence.


The polynucleotides of the invention may include deoxynucleotides, ribonucleotides, modified deoxynucleotides, modified ribonucleotides (e.g., chemical modifications, such as modifications that alter the backbone linkages, sugar molecules, and/or nucleic acid bases), and artificial nucleic acids. In some embodiments, the polynucleotide includes, but is not limited to, genomic DNA, cDNA, peptide nucleic acids (PNA) or peptide oligonucleotide conjugates, locked nucleic acids (LNA), bridged nucleic acids (BNA), polyamides, triplex forming oligonucleotides, modified DNA, antisense DNA oligonucleotides, tRNA, mPvNA, rPvNA, modified RNA, miRNA, gRNA, and siRNA or other RNA or DNA molecules.


In some embodiments, the polynucleotides of the invention have a length from about 2 to about 5000 nts, about 10 to about 100 nts, about 50 to about 150 nts, about 100 to about 200 nts, about 150 to about 250 nts, about 200 to about 300 nts, about 250 to about 350 nts, about 300 to about 500 nts, about 10 to about 1000 nts, about 50 to about 1000 nts, about 100 to about 1000 nts, about 1000 to about 2000 nts, about 2000 to about 3000 nts, about 3000 to about 4000 nts, about 4000 to about 5000 nts, or any range there between.


The polynucleotides of the invention may include nucleosides, e.g., purines or pyrimidines, e.g., adenine, cytosine, guanine, thymine and uracil. In some embodiments, the polynucleotides include one or more nucleoside analogs. The nucleoside analog includes, but is not limited to, a nucleoside analog, such as 5-fluorouracil; 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 4-methylbenzimidazole, 5-(carboxyhydroxylmethyl) uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, dihydrouridine, beta-D-galactosylqueosine, inosine, N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D-mannosylqueosine, 5′-methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-N6-isopentenyladenine, uracil-5-oxyacetic acid (v), wybutoxosine, pseudouracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-oxyacetic acid methylester, uracil-5-oxyacetic acid (v), 5-methyl-2-thiouracil, 3-(3-amino-3-N-2-carboxypropyl) uracil, (acp3)w, 2,6-diaminopurine, 3-nitropyrrole, inosine, thiouridine, queuosine, wyosine, diaminopurine, isoguanine, isocytosine, diaminopyrimidine, 2,4-difluorotoluene, isoquinoline, pyrrolo[2,3-]pyridine, and any others that can base pair with a purine or a pyrimidine side chain.


In some embodiments, the site-specific SFRP1 targeting moieties of the invention comprise a polynucleotide encoding a polypeptide that comprises a DNA-binding domain (DBD), or fragment thereof, of a zinc finger polypeptide (ZNF) or a transcription activator-like effector (TALE) polypeptide, that is engineered to specifically target an SFRP1 expression control region to modulate expression of an SFRP1 gene.


The design and preparation of such zinc finger polypeptides which specifically bind to a DNA target region of interest, such as an SFRP1 expression control region, is well known in the art. For example, zinc finger (ZNF) proteins contain a DNA binding motif that specifically binds a triplet of nucleotides. Thus, to design and prepare the site-specific SFRP1 targeting moieties of the invention, a modular assembly process which includes combining separate zinc finger DNA binding domains that can each recognize a specific 3-basepair DNA sequence to generate 3-finger, 4-, 5-, 6-, 7-, or 8-zinc finger polypeptide that recognizes specific target sites ranging from 9 basepairs to 24 basepairs in length may be used. Another suitable method may include 2-finger modules to generate ZNF polynucleotides with up to six individual zinc fingers. See, e.g., Shukla V K, et al., Nature. 459 (7245) 2009: 437-41; Dreier B, et al., JBC. 280 (42) 2005: 35588-97; Dreier B, et al. JBC 276 (31) 2001: 29466-78; Bae K H, et al., Nature Biotechnology. 21 (3) 2003: 275-80.


In some embodiments, a site-specific SFRP1 targeting moiety of the invention comprises a polynucleotide encoding a polypeptide that comprises a DNA-binding domain (DBD), or fragment thereof, of a zinc finger, that is engineered to specifically target an SFRP1 expression control region to modulate expression of an SFRP1 gene. Exemplary amino acid sequences encoding a zinc finger that binds to a nucleotide triplet suitable for use in the present invention are provide in Table 1A below. (See, e.g., Gersbach et al., Synthetic Zinc Finger Proteins: The Advent of Targeted Gene Regulation and Genome Modification Technologies).













TABLE 1A







Amino Acid





Sequence of





Zing Finger





DNA Binding

SEQ



Domain
Nucleotide
ID



(Finger)
Triplet
NO.









RKDALRG
TTG
 1







TTGALTE
CTT
 2







QRHHLVE
CTC
 3







QNSTLTE
CTA
 4







RNDALTE
CTG
 5







HKNALQN
ATT
 6







RRSACRR
ATC
 7







QKSSLIA
ATA
 8







RRDELNV
ATG
 9







TSGSLVR
GTT
10







DPGALVR
GTC
11







QSSSLVR
GTA
12







RSDELVR
GTG
13







RLRDIQF
TCT
14







RSDERKR
TCC
15







RSDHLTT
TCA
16







RLRALDR
TCG
17







TKNSLTE
CCT
18







SKKHLAE
CCC
19







TSHSLTE
CCA
20







RNDTLTE
CCG
21







THLDLIR
ACT
22







DKKDLTR
ACC
23







SPADLTR
ACA
24







RTDTLRD
ACG
25







TSGELVR
GCT
26







DCRDLAR
GCC
27







QSGDLRR
GCA
28







RSDDLVR
GCG
29







ARGNLRT
TAT
30







SRGNLKS
TAC
31







QASNLIS
TAA
32







REDNLHT
TAG
33







TSGNLTE
CAT
34







SKKALTE
CAC
35







QSGNLTE
CAA
36







RADNLTE
CAG
37







TTGNLTV
AAT
38







DSGNLRV
AAC
39







QRANLRA
AAA
40







RKDNLKN
AAG
41







TSGNLVR
GAT
42







DPGNLVR
GAC
43







QSSNLVR
GAA
44







RSDNLVR
GAG
45







APKALGW
TGC
46







QAGHLAS
TGA
47







RSDHLTT
TGG
48







SRRTCRA
CGT
49







HTGHLLE
CGC
50







QSGHLTE
CGA
51







RSDKLTE
CGG
52







HRTTLTN
AGT
53







ERSHLRE
AGC
54







QLAHLRA
AGA
55







RSDHLTN
AGG
56







TSGHLVR
GGT
57







DPGHLVR
GGC
58







QRAHLER
GGA
59







RSDKLVR
GGG
60










A zinc finger DNA binding domain comprises an N-terminal region and a C-terminal region with the “fingers” that bind to the target DNA sequence in between. The N-terminal region generally is 7 amino acids in length. The C-terminal region is generally 6 amino acids in length. Thus, the N-terminal region generally comprises the amino acid sequence of X1X2X3X4X5X6X7. “X” can be any amino acid. In some embodiments, the N-terminal region comprises the exemplary amino acid sequence of LEPGEKP (SEQ ID NO: 309). “X” can be any amino acid. The C-terminal region generally comprises the amino acid sequence of X25X26X27X28X29X30. In certain embodiments, the C-terminal region comprises the exemplary amino acid sequence of TGKKTS (SEQ ID NO: 310)


Each finger in the DNA binding domain is flanked by a N-terminal backbone located to the N-terminus of the finger and a C-terminal backbone located to the C-terminus of the finger. The N-terminal backbone of the finger generally is 11 amino acids long with two conservative cysteines (C) locate at 3rd and 6th positions. Thus, the N-terminal backbone of the finger generally comprises the amino acid sequence of X8X9CX10X11CX12X13X14X15X16. “X” can be any amino acid. The C-terminal backbone of the finger generally is 5 amino acids long with two conservative histines (H) located at 1st and 5th positions. Thus, the C-terminal backbone of the finger generally comprises the amino acid sequence of HX17X18X19H. “X” can be any amino acid. In some embodiments, the N-terminal backbone comprises the exemplary amino acid sequence of YKCPECGKSFS (SEQ ID NO: 61) and the C-terminal backbone comprises the exemplary amino acid sequence of HQRTH (SEQ ID NO: 62). Two “fingers” are linked through a linker. A linker generally is 5 amino acids in length and comprises the amino acid sequence of X20X21X22X23X24. “X” can be any amino acid. In certain embodiments, the linker comprises the exemplary amino acid sequence of TGEKP (SEQ ID NO: 63). Thus, the zinc finger of a site specific SFRP1 site-specific disrupting agent has a structure as follows: (N-terminal backbone—finger—C-terminal backbone—linker), and the zinc finger DNA binding domain of a site specific SFRP1 site-specific disrupting agent has a structure as follows: [N-terminal region (N-terminal backbone—finger—C-terminal backbone—linker)n-C-terminal region]. “N” represents the number of triplets of nucleotides to which the zinc finger DNA binding domain and, thus, to which the SFRP1 site-specific disrupting agent binds.


The “finger” amino acid sequences of four nucleotide triplets are unknown, however, if such a triplet is identified in a target area of interest, two “linker span sequences”—linker span 1 and linker span 2—are useful to circumvent the issue. Linker span 1 is used to skip one base pair if a “finger” amino acid sequence of a triplet is not available. Linker span 2 is used to skip 2 base pairs if a “finger” amino acid sequence of a triplet is not available. Linker span 1 is generally 12 amino acids long. Linker span 2 is generally 16 amino acids long. Thus, linker span 1 generally comprises the amino acid sequence of X31X32X33X34X35X36X37X38X39X40X41X42. Linker span 2 generally comprises the amino acid sequence of X43X44X45X46X47X48X49X50X51X52X53X54X55X56X57X58. In some embodiments, linker span 1 comprises the amino acid sequence of THPRAPIPKPFQ (SEQ ID NO: 311). In certain embodiments, linker span 2 comprises the amino acid sequence of TPNPHRRTDPSHKPFQ (SEQ ID NO: 312). When linker span 1 and/or linker span 2 is used, the finger—linker span 1/span 2—finger comprises the structure as follows: N-terminal back bone—finger—C-terminal backbone—linker span 1/span 2—N-terminal backbone—finger—C-terminal backbone—linker.


Table 1B provides the amino acid sequence of exemplary zinc finger DNA binding domains of the disrupting agents comprising a zinc finger DNA binding domain described in the working examples below (see Table 5A).


In some embodiments, a zinc finger DNA binding domain suitable for use in the disrupting agents of the invention comprises an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% amino acid identity to the entire amino acid sequence of any one of the zinc finger DNA binding domains provided in Table 1B.














TABLE 1B










Genomic







Coordi- 







nates







of the







Target 


Name




Start Site


of 




in Genome


Exem-




Reference


plary




Consortium


Zinc 




Human


Finger




Build 37


DNA

SEQ

SEQ
(GRCh37):


Binding
Amino Acid
ID
Target
ID
Chromosome


Domain
Sequence
NO:
Sequence
NO:
8)







ZF1
LEPGEKPYKCPEC
64
AGAGTACC
67
GRCh37:



GKSFSTSHSLTEH

TCCACCAT

chr8:



QRTHTGEKPYKCP

GACCA

41003852-



ECGKSFSQAGHLA



41003872



SHQRTHTGEKPYK







CPECGKSFSTSHS







LTEHQRTHTGEKP







YKCPECGKSFSTS







HSLTEHQRTHTGE







KPYKCPECGKSFS







TKNSLTEHQRTHT







GEKPYKCPECGKS







FSQSSSLVRHQRT







HTGEKPYKCPECG







KSFSQLAHLRAHQ







RTHTGKKTS









ZF2
LEPGEKPYKCPEC
65
CCAGGCAC
68
GRCh37:



GKSFSRSDELVRH

ATGGAGAG

chr8:



QRTHTGEKPYKCP

CTGTG

41003954-



ECGKSFSTSGELV



41003974



RHQRTHTGEKPYK







CPECGKSFSQLAH







LRAHQRTHTGEKP







YKCPECGKSFSRS







DHLTTHQRTHTGE







KPYKCPECGKSFS







SPADLTRHQRTHT







GEKPYKCPECGKS







FSDPGHLVRHQRT







HTGEKPYKCPECG







KSFSTSHSLTEHQ







RTHTGKKTS









ZF3
LEPGEKPYKCPEC
66
CAGATGTG
69
GRCh37:



GKSFSDPGHLVRH

AAGGGCAC

chr8:



QRTHTGEKPYKCP

TGGGC

41004002-



ECGKSFSRNDALT



41004022



EHQRTHTGEKPYK







CPECGKSFSQSGD







LRRHQRTHTGEKP







YKCPECGKSFSRS







DHLTNHQRTHTGE







KPYKCPECGKSFS







QAGHLASHQRTHT







GEKPYKCPECGKS







FSRRDELNVHQRT







HTGEKPYKCPECG







KSFSRADNLTEHQ







RTHTGKKTS









Similarly, the design and preparation of such TALE polypeptides which specifically bind to a DNA target region of interest, such as an SFRP1 expression control region, is well known in the art. For example, the TALE DNA binding domain contains a repeated highly conserved 33-34 amino acid sequence with divergent 12th and 13th amino acids. These two positions, referred to as the Repeat Variable Diresidue (RVD), are highly variable and show a strong correlation with specific nucleotide recognition. This straightforward relationship between amino acid sequence and DNA recognition has allowed for the engineering of specific DNA-binding domains by selecting a combination of repeat segments containing the appropriate RVDs. See, e.g., Boch J Nature Biotechnology. 29 (2) 2011: 135-6; Boch J, et al., Science. 326 (5959) 2009: 1509-12; Moscou M J & Bogdanove A J Science. 326 (5959) 2009: 1501.


In some embodiments, the site-specific SFRP1 targeting moieties of the invention comprising a polynucleotide comprise a guide RNA (or gRNA) or nucleic acid encoding a guide RNA. A gRNA is a short synthetic RNA molecule comprising a “scaffold” sequence necessary for, e.g., directing an effector to an SFRP1 expression control element which may, e.g., include an about 20 nucleotide site-specific sequence targeting a genomic target sequence comprising the SFRP1 expression control element.


Generally, guide RNA sequences are designed to have a length of between about 17 to about 24 nucleotides (e.g., 19, 20, or 21 nucleotides) and are complementary to the target sequence. Custom gRNA generators and algorithms are available commercially for use in the design of effective guide RNAs. Gene editing has also been achieved using a chimeric “single guide RNA” (“sgRNA”), an engineered (synthetic) single RNA molecule that mimics a naturally occurring crRNA-tracrRNA complex and contains both a tracrRNA (for binding the nuclease) and at least one crRNA (to guide the nuclease to the sequence targeted for editing). Chemically modified sgNAs have also been demonstrated to be effective in genome editing; see, for example, Hendel et al. (2015) Nature Biotechnol., 985-991.


In certain embodiments, the site-specific SFRP1 targeting moieties of the invention comprise a guide RNA (or gRNA) or nucleic acid encoding a guide RNA and a protein or a peptide. In some embodiment, the protein or the peptide comprises a CRISPR associated protein (Cas) polypeptide, or fragment thereof (e.g., a Cas9 polypeptide, or fragment thereof). In one embodiment, a suitable Cas polypeptide is an enzymatically inactive Cas polypeptide, e.g., a “dead Cas polypeptide” or “dCas” polypeptide.


Exemplary site-specific SFRP1 targeting moieties comprising a polynucleotide, e.g., gRNA, are provided in Table 3, below. In some embodiments, the polynucleotide comprises a nucleotide sequence at least 75%, at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identical to the entire nucleotide sequence of any one of the nucleotide sequences in Table 3.


Exemplary site-specific SFRP1 promoter targeting moieties comprising a polynucleotide, e.g., gRNA, are also provided in Table 6, below. In some embodiments, the polynucleotide comprises a nucleotide sequence at least 75%, at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identical to the entire nucleotide sequence of any one of the nucleotide sequences in Table 6.


It will be understood that, although the sequences in Tables 2 and 6 are described as modified (or unmodified), the nucleic acid molecules encompassed by the of the invention, e.g., a site-specific disrupting agent, may comprise any one of the sequences set forth in any one of Tables 2 or 6 that is unmodified or modified differently than described therein. It will also be understood that although some of the sequences in Table 6 have “Ts”, when used as an RNA molecule, such as a guide RNA, in the site-specific targeting moieties of the invention, the “Ts” may be replaced with “Us.”


In some embodiments, a site-specific SFRP1 targeting moiety comprising a polynucleotide, e.g., gRNA, comprises a nucleotide sequence complementary to an anchor sequence. In one embodiment, the anchor sequence comprises a CTCF-binding motif or consensus sequence: N(T/C/G)N(G/A/T)CC(A/T/G)(C/G)(C/T/A)AG(G/A)(G/T)GG(C/A/T)(G/A)(C/G)(C/T/A)(G/A/C) (SEQ ID NO: 70), where N is any nucleotide. A CTCF-binding motif or consensus sequence may also be in the opposite orientation, e.g., (G/A/C)(C/T/A)(C/G)(G/A)(C/A/T)GG(G/T)(G/A)GA(C/T/A)(C/G)(A/T/G)CC(G/A/T)N(T/C/G)N (SEQ ID NO: 71). In some embodiments, the nucleic acid sequence comprises a sequence complementary to a CTCF-binding motif or consensus sequence.


In some embodiments, the polynucleotide comprises a nucleotide sequence at least 75%, at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% complementary to an anchor sequence.


In some embodiments, the polynucleotide comprises a nucleotide sequence at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% complementary to a CTCF-binding motif or consensus sequence. In some embodiments, the polynucleotide is selected from the group consisting of a gRNA, and a sequence complementary or a sequence comprising at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% complementary sequence to an anchor sequence.


In some embodiments, a site-specific SFRP1 targeting moiety comprising a polynucleotide of the invention is an RNAi molecule. RNAi molecules comprise RNA or RNA-like structures typically containing 15-50 base pairs (such as about 8-25 base pairs) and having a nucleobase sequence identical (complementary) or nearly identical (substantially complementary) to a coding sequence in an expressed target gene within the cell. RNAi molecules include, but are not limited to: short interfering RNAs (siRNAs), double-strand RNAs (dsRNA), micro RNAs (miRNAs), short hairpin RNAs (shRNA), meroduplexes, and dicer substrates (U.S. Pat. Nos. 8,084,599, 8,349,809, and 8,513,207). In one embodiment, the invention includes a composition to inhibit expression of a gene encoding a polypeptide described herein, e.g., a conjunction nucleating molecule.


RNAi molecules comprise a sequence substantially complementary, or fully complementary, to all or a fragment of a target gene. RNAi molecules may complement sequences at the boundary between introns and exons to prevent the maturation of newly-generated nuclear RNA transcripts of specific genes into mRNA for transcription. RNAi molecules complementary to specific genes can hybridize with the mRNA for that gene and prevent its translation. The antisense molecule can be DNA, RNA, or a derivative or hybrid thereof. Examples of such derivative molecules include, but are not limited to, peptide nucleic acid (PNA) and phosphorothioate-based molecules such as deoxyribonucleic guanidine (DNG) or ribonucleic guanidine (R G).


RNAi molecules can be provided to the cell as “ready-to-use” RNA synthesized in vitro or as an antisense gene transfected into cells which will yield RNAi molecules upon transcription. Hybridization with mRNA results in degradation of the hybridized molecule by RNAse H and/or inhibition of the formation of translation complexes. Both result in a failure to produce the product of the original gene.


The length of the RNAi molecule that hybridizes to the transcript of interest should be around 10 nucleotides, between about 15 or 30 nucleotides, or about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more nucleotides. The degree of identity of the antisense sequence to the targeted transcript should be at least 75%, at least 80%, at least 85%, at least 90%, or at least 95.


RNAi molecules may also comprise overhangs, i.e. typically unpaired, overhanging nucleotides which are not directly involved in the double helical structure normally formed by the core sequences of the herein defined pair of sense strand and antisense strand. RNAi molecules may contain 3′ and/or 5′ overhangs of about 1-5 bases independently on each of the sense strands and antisense strands. In one embodiment, both the sense strand and the antisense strand contain 3′ and 5′ overhangs. In one embodiment, one or more of the 3′ overhang nucleotides of one strand base pairs with one or more 5′ overhang nucleotides of the other strand. In another embodiment, the one or more of the 3′ overhang nucleotides of one strand base do not pair with the one or more 5′ overhang nucleotides of the other strand. The sense and antisense strands of an RNAi molecule may or may not contain the same number of nucleotide bases. The antisense and sense strands may form a duplex wherein the 5′ end only has a blunt end, the 3′ end only has a blunt end, both the 5′ and 3′ ends are blunt ended, or neither the 5′ end nor the 3′ end are blunt ended. In another embodiment, one or more of the nucleotides in the overhang contains a thiophosphate, phosphorothioate, deoxynucleotide inverted (3′ to 3′ linked) nucleotide or is a modified ribonucleotide or deoxynucleotide.


Small interfering RNA (siRNA) molecules comprise a nucleotide sequence that is identical to about 15 to about 25 contiguous nucleotides of the target mRNA. In some embodiments, the siRNA sequence commences with the dinucleotide AA, comprises a GC-content of about 30-70% (about 50-60%, about 40-60%, or about 45%-55%), and does not have a high percentage identity to any nucleotide sequence other than the target in the genome of the mammal in which it is to be introduced, for example as determined by standard BLAST search.


siRNAs and shRNAs resemble intermediates in the processing pathway of the endogenous microRNA (miRNA) genes (Bartel, Cell 116:281-297, 2004). In some embodiments, siRNAs can function as miRNAs and vice versa (Zeng et al., Mol Cell 9: 1327-1333, 2002; Doench et al., Genes Dev 17:438-442, 2003). MicroRNAs, like siRNAs, use RISC to downregulate target genes, but unlike siRNAs, most animal miRNAs do not cleave the mRNA. Instead, miRNAs reduce protein output through translational suppression or polyA removal and mRNA degradation (Wu et al., Proc Natl Acad Sci USA 103:4034-4039, 2006). Known miRNA binding sites are within mRNA 3′ UTRs; miRNAs seem to target sites with near-perfect complementarity to nucleotides 2-8 from the miRNA's 5′ end (Rajewsky, Nat Genet 38 Suppl: S8-13, 2006; Lim et al, Nature 433:769-773, 2005). This region is known as the seed region. Because siRNAs and miRNAs are interchangeable, exogenous siRNAs downregulate mRNAs with seed complementarity to the siRNA (Birmingham et al., Nat Methods 3: 199-204, 2006. Multiple target sites within a 3′ UTR give stronger downregulation (Doench et al., Genes Dev 17:438-442, 2003).


Lists of known miRNA sequences can be found in databases maintained by research organizations, such as Wellcome Trust Sanger Institute, Perm Center for Bioinformatics, Memorial Sloan Kettering Cancer Center, and European Molecule Biology Laboratory, among others. Known effective siRNA sequences and cognate binding sites are also well represented in the relevant literature. RNAi molecules are readily designed and produced by technologies known in the art. In addition, there are computational tools that increase the chance of finding effective and specific sequence motifs (Pei et al. 2006, Reynolds et al. 2004, Khvorova et al. 2003, Schwarz et al. 2003, Ui-Tei et al. 2004, Heale et al. 2005, Chalk et al. 2004, Amarzguioui et al. 2004).


An RNAi molecule modulates expression of RNA encoded by a gene. Because multiple genes can share some degree of sequence homology with each other, in some embodiments, the RNAi molecule can be designed to target a class of genes with sufficient sequence homology. In some embodiments, the RNAi molecule can contain a sequence that has complementarity to sequences that are shared amongst different gene targets or are unique for a specific gene target. In some embodiments, the RNAi molecule can be designed to target conserved regions of an RNA sequence having homology between several genes thereby targeting several genes in a gene family (e.g., different gene isoforms, splice variants, mutant genes, etc.). In some embodiments, the RNAi molecule can be designed to target a sequence that is unique to a specific RNA sequence of a single gene.


In some embodiments, the RNAi molecule targets a sequence in a conjunction nucleating molecule, e.g., CTCF, cohesin, USF 1, YY1, TATA-box binding protein associated factor 3 (TAF3), ZNF 143, or another polypeptide that promotes the formation of an anchor sequence-mediated conjunction, or an epigenetic modifying agent, e.g., an enzyme involved in post-translational modifications including, but are not limited to, DNA methylases (e.g., DNMT3a, DNMT3b, DNMTL), DNA demethylation (e.g., the TET family enzymes catalyze oxidation of 5-methylcytosine to 5-hydroxymethylcytosine and higher oxidative derivatives), histone methyltransferases, histone deacetylase (e.g., HDAC1, HDAC2, HDAC3), sirtuin 1, 2, 3, 4, 5, 6, or 7, lysine-specific histone demethylase 1 (LSD1), histone-lysine-N-methyltransferase (Setdbl), euchromatic histone-lysine N-methyltransferase 2 (G9a), histone-lysine N-methyltransferase (SUV39H1), enhancer of zeste homolog 2 (EZH2), viral lysine methyltransferase (vSET), histone methyltransferase (SET2), protein-lysine N-methyltransferase (SMYD2), and others. In one embodiment, the RNAi molecule targets a protein deacetylase, e.g., sirtuin 1, 2, 3, 4, 5, 6, or 7. In one embodiment, the invention includes a composition comprising an RNAi that targets a conjunction nucleating molecule, e.g., CTCF.


In some embodiments, the site-specific SFRP1 targeting moiety comprises a peptide or protein moiety. In some embodiments, a site-specific disrupting agent comprises a fusion protein. In some embodiments, an effector is a peptide or protein moiety. The peptide or protein moieties may include, but is not limited to, a peptide ligand, antibody fragment, or targeting aptamer that binds a receptor such as an extracellular receptor, neuropeptide, hormone peptide, peptide drug, toxic peptide, viral or microbial peptide, synthetic peptide, and agonist or antagonist peptide.


Exemplary peptides or protein include a DNA-binding protein, a CRISPR component protein, a conjunction nucleating molecule, a dominant negative conjunction nucleating molecule, an epigenetic modifying agent, or any combination thereof. In some embodiments, the peptide comprises a nuclease, a physical blocker, an epigenetic recruiter, and an epigenetic CpG modifier, and fragments and combinations of any of the foregoing. In some embodiments, the peptide comprises a DNA-binding domain of a protein, such as a helix-turn-helix motif, a leucine zipper, a Zn-finger, a TATA box binding proteins, a transcription factor.


Peptides or proteins may be linear or branched. The peptide or protein moiety may have a length from about 5 to about 200 amino acids, about 15 to about 150 amino acids, about 20 to about 125 amino acids, about 25 to about 100 amino acids, about 20 to about 70 amino acids, about 20 to about 80 amino acids, about 20 to about 90 amino acids, about 30 to about 100 amino acids, about 30 to about 60 amino acids, about 30 to about 80 amino acids, about 35 to about 85 amino acids, about 40 to about 100 amino acids, or about 50 to about 125 amino acids or any range there between.


As indicated above, in some embodiments, the site-specific SFRP1 targeting moieties of the invention comprise a fusion protein.


In some embodiments, the fusion proteins of the invention include a site-specific SFRP1 targeting moiety which targets an SFRP1 expression control region and an effector molecule. In other embodiments, a fusion protein of the invention comprises an effector molecule. Exemplary effector molecules are described below and in some embodiments include, for example, nucleases, physical blockers, epigenetic recruiters, e.g., a transcriptional enhancer or a transcriptional repressor, and epigenetic CpG modifiers, e.g., a DNA methylase, a DNA demethylase, a histone modifying agent, a histone transacetylase (also known as histone acetyltransferase), or a histone deacetylase, and combinations of any of the foregoing.


For example, a site-specific targeting moiety may comprise a gRNA and an effector, such as a nuclease, e.g., a Cas9, e.g., a wild type Cas9, a nickase Cas9 (e.g., Cas9 D10A), a dead Cas9 (dCas9), eSpCas9, Cpf1, C2C1, or C2C3, or a nucleic acid encoding such a nuclease. The choice of nuclease and gRNA(s) is determined by whether the targeted mutation is a deletion, substitution, or addition of nucleotides, e.g., a deletion, substitution, or addition of nucleotides to a target sequence. Fusions of a catalytically inactive endonuclease e.g., a dead Cas9 (dCas9, e.g., D10A; H840A) tethered with all or a portion of (e.g., biologically active portion of) an (one or more) effector domain create chimeric proteins that can be linked to the polypeptide to guide the composition to specific DNA sites by one or more RNA sequences (e.g., DNA recognition elements including, but not restricted to zinc finger arrays, sgRNA, TAL arrays, peptide nucleic acids described herein) to modulate activity and/or expression of one or more target nucleic acids sequences (e.g., to methylate or demethylate a DNA sequence).


In one embodiment, a fusion protein of the invention may comprise an effector molecule comprising, for example, a CRISPR associated protein (Cas) polypeptide, or fragment thereof, (e.g., a Cas9 polypeptide, or fragment thereof) and an epigenetic recruiter or an epigenetic CpG modifier.


In one embodiment, a suitable Cas polypeptide is an enzymatically inactive Cas polypeptide, e.g., a “dead Cas polypeptide” or “dCas” polypeptide


Exemplary Cas polypeptides that are adaptable to the methods and compositions described herein are described below. Using methods known in the art, a Cas polypeptide can be fused to any of a variety of agents and/or molecules as described herein; such resulting fusion molecules can be useful in various disclosed methods.


In one aspect, the invention includes a composition comprising a protein comprising a domain, e.g., an effector, that acts on DNA (e.g., a nuclease domain, e.g., a Cas9 domain, e.g., a dCas9 domain; a DNA methyltransferase, a demethylase, a deaminase), in combination with at least one guide RNA (gRNA) or antisense DNA oligonucleotide that targets the protein to site-specific target sequence, wherein the composition is effective to alter, in a human cell, the expression of a target gene. In some embodiments, the enzyme domain is a Cas9 or a dCas9. In some embodiments, the protein comprises two enzyme domains, e.g., a dCas9 and a methylase or demethylase domain.


In one aspect, the invention includes a composition comprising a protein comprising a domain, e.g., an effector, that comprises a transcriptional control element (e.g., a nuclease domain, e.g., a Cas9 domain, e.g., a dCas9 domain; a transcriptional enhancer; a transcriptional repressor), in combination with at least one guide RNA (gRNA) or antisense DNA oligonucleotide that targets the protein to a site-specific target sequence, wherein the composition is effective to alter, in a human cell, the expression of a target gene. In some embodiments, the enzyme domain is a Cas9 or a dCas9. In some embodiments, the protein comprises two enzyme domains, e.g., a dCas9 and a transcriptional enhancer or transcriptional repressor domain.


As used herein, a “biologically active portion of an effector domain” is a portion that maintains the function (e.g. completely, partially, minimally) of an effector domain (e.g., a “minimal” or “core” domain).


The chimeric proteins described herein may also comprise a linker, e.g., an amino acid linker. In some aspects, a linker comprises 2 or more amino acids, e.g., one or more GS sequences. In some aspects, fusion of Cas9 (e.g., dCas9) with two or more effector domains (e.g., of a DNA methylase or enzyme with a role in DNA demethylation or protein acetyl transferase or deacetylase) comprises one or more interspersed linkers (e.g., GS linkers) between the domains. In some aspects, dCas9 is fused with 2-5 effector domains with interspersed linkers.


In some embodiments, a site-specific SFRP1 targeting moiety comprises a conjunction nucleating molecule, a nucleic acid encoding a conjunction nucleating molecule, or a combination thereof. In some embodiments, an anchor sequence-mediated conjunction is mediated by a first conjunction nucleating molecule bound to the first anchor sequence, a second conjunction nucleating molecule bound to the noncontiguous second anchor sequence, and an association between the first and second conjunction nucleating molecules. In some embodiments, a conjunction nucleating molecule may disrupt, e.g., by competitive binding, the binding of an endogenous conjunction nucleating molecule to its binding site.


The conjunction nucleating molecule may be, e.g., CTCF, cohesin, USF1, YY1, TATA-box binding protein associated factor 3 (TAF3), ZNF143 (Zinc Finger Protein 143) binding motif, or another polypeptide that promotes the formation of an anchor sequence-mediated conjunction. The conjunction nucleating molecule may be an endogenous polypeptide or other protein, such as a transcription factor, e.g., autoimmune regulator (AIRE), another factor, e.g., X-inactivation specific transcript (XIST), or an engineered polypeptide that is engineered to recognize a specific DNA sequence of interest, e.g., having a zinc finger, leucine zipper or bHLH domain for sequence recognition. The conjunction nucleating molecule may modulate DNA interactions within or around the anchor sequence-mediated conjunction. For example, the conjunction nucleating molecule can recruit other factors to the anchor sequence that alters an anchor sequence-mediated conjunction formation or disruption.


The conjunction nucleating molecule may also have a dimerization domain for homo- or heterodimerization. One or more conjunction nucleating molecules, e.g., endogenous and engineered, may interact to form the anchor sequence-mediated conjunction. In some embodiments, the conjunction nucleating molecule is engineered to further include a stabilization domain, e.g., cohesion interaction domain, to stabilize the anchor sequence-mediated conjunction. In some embodiments, the conjunction nucleating molecule is engineered to bind a target sequence, e.g., target sequence binding affinity is modulated. In some embodiments, the conjunction nucleating molecule is selected or engineered with a selected binding affinity for an anchor sequence within the anchor sequence-mediated conjunction. Conjunction nucleating molecules and their corresponding anchor sequences may be identified through the use of cells that harbor inactivating mutations in CTCF and Chromosome Conformation Capture or 3C-based methods, e.g., Hi-C or high-throughput sequencing, to examine topologically associated domains, e.g., topological interactions between distal DNA regions or loci, in the absence of CTCF. Long-range DNA interactions may also be identified. Additional analyses may include ChlA-PET analysis using a bait, such as Cohesin, YY1 or USF1, ZNF143 binding motif, and MS to identify complexes that are associated with the bait.


B. Effector Molecules

Effector molecules for use in the compositions and methods of the invention include those that modulate a biological activity, for example increasing or decreasing enzymatic activity, gene expression, cell signaling, and cellular or organ function. Preferred effector molecules of the invention are nucleases, physical blockers, epigenetic recruiters, e.g., a transcriptional enhancer or a transcriptional repressor, and epigenetic CpG modifiers, e.g., a DNA methylase, a DNA demethylase, a histone modifying agent, a histone transacetylase (also known as histone acetyltransferase), or a histone deacetylase, and combinations of any of the foregoing.


Additional effector activities may also include binding regulatory proteins to modulate activity of the regulator, such as transcription or translation. Effector molecules also may include activator or inhibitor (or “negative effector”) functions as described herein. In another example, the effector molecule may inhibit substrate binding to a receptor and inhibit its activation, e.g., naltrexone and naloxone bind opioid receptors without activating them and block the receptors' ability to bind opioids. Effector molecules may also modulate protein stability/degradation and/or transcript stability/degradation. For example, proteins may be targeted for degradation by the polypeptide co-factor, ubiquitin, onto proteins to mark them for degradation. In another example, an effector molecule inhibits enzymatic activity by blocking the enzyme's active site, e.g., methotrexate is a structural analog of tetrahydrofolate, a coenzyme for the enzyme dihydrofolate reductase that binds to dihydrofolate reductase 1000-fold more tightly than the natural substrate and inhibits nucleotide base synthesis.


In some embodiments, the effector molecule is a chemical, e.g., a chemical that modulates a cytosine (C) or an adenine(A) (e.g., Na bisulfite, ammonium bisulfite). In some embodiments, the effector molecule has enzymatic activity (methyl transferase, demethylase, nuclease (e.g., Cas9), a deaminase). In some embodiments, the effector molecule sterically hinders formation of an anchor sequence-mediated conjunction or binding of an RNA polymerase to a promoter.


The effector molecule with effector activity may be any one of the small molecules, peptides, fusion proteins, nucleic acids, nanoparticle, aptamers, or pharmacoagents with poor PK/PD described herein.


In some embodiments, the effector molecule is an inhibitor or “negative effector molecule”. In the context of a negative effector molecule that modulates formation of an anchor sequence-mediated conjunction, in some embodiments, the negative effector molecule is characterized in that dimerization of an endogenous nucleating polypeptide is reduced when the negative effector molecule is present as compared with when it is absent. For example, in some embodiments, the negative effector molecule is or comprises a variant of the endogenous nucleating polypeptide's dimerization domain, or a dimerizing portion thereof.


For example, in certain embodiments, an anchor sequence-mediated conjunction is altered (e.g., disrupted) by use of a dominant negative effector, e.g., a protein that recognizes and binds an anchor sequence, (e.g., a CTCF binding motif), but with an inactive (e.g., mutated) dimerization domain, e.g., a dimerization domain that is unable to form a functional anchor sequence-mediated conjunction. For example, the Zinc Finger domain of CTCF can be altered so that it binds a specific anchor sequence (by adding zinc fingers that recognize flanking nucleic acids), while the homo-dimerization domain is altered to prevent the interaction between the engineered CTCF and endogenous forms of CTCF.


In some embodiments, the effector molecule comprises a synthetic conjunction nucleating molecule with a selected binding affinity for an anchor sequence within a target anchor sequence-mediated conjunction, (the binding affinity may be at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or higher or lower than the affinity of an endogenous conjunction nucleating molecule that associates with the target anchor sequence. The synthetic conjunction nucleating molecule may have between 30-90%, 30-85%, 30-80%, 30-70%, 50-80%, 50-90% amino acid sequence identity to the endogenous conjunction nucleating molecule). The conjunction nucleating molecule may disrupt, such as through competitive binding, the binding of an endogenous conjunction nucleating molecule to its anchor sequence. In some more embodiments, the conjunction nucleating molecule is engineered to bind a novel anchor sequence within the anchor sequence-mediated conjunction.


In some embodiments, a dominant negative effector molecule has a domain that recognizes specific DNA sequences (e.g., an anchor sequence, a CTCF anchor sequence, flanked by sequences that confer sequence specificity), and a second domain that provides a steric presence in the vicinity of the anchoring sequence. The second domain may include a dominant negative conjunction nucleating molecule or fragment thereof, a polypeptide that interferes with conjunction nucleating molecule sequence recognition (e.g., the amino acid backbone of a peptide/nucleic acid or PNA), a nucleic acid sequence ligated to a small molecule that imparts steric interference, or any other combination of DNA recognition elements and a steric blocker.


In some embodiments, the effector molecule is an epigenetic modifying agent. Epigenetic modifying agents useful in the methods and compositions described herein include agents that affect, e.g., DNA methylation/demethylation, histone acetylation/deacetylation, and RNA-associated silencing. In some embodiments, the effectors sequence-specifically target an epigenetic enzyme (e.g., an enzyme that generates or removes epigenetic marks, e.g., acetylation and/or methylation). Exemplary epigenetic effectors may target an expression control region comprising, e.g., a transcriptional control element or an anchor sequence, by a site-specific disrupting agent comprising a site-specific targeting moiety.


In some embodiments, an effector molecule comprises one or more components of a gene editing system. Components of gene editing systems may be used in a variety of contexts including but not limited to gene editing. For example, such components may be used to target agents that physically modify, genetically modify, and/or epigenetically modify SFRP1 sequences.


Exemplary gene editing systems include the clustered regulatory interspaced short palindromic repeat (CRISPR) system, zinc finger nucleases (ZFNs), and Transcription Activator-Like Effector-based Nucleases (TALEN). ZFNs, TALENs, and CRISPR-based methods are described, e.g., in Gaj et al. Trends Biotechnol. 31.7(2013):397-405; CRISPR methods of gene editing are described, e.g., in Guan et al, Application of CRISPR-Cas system in gene therapy: Pre-clinical progress in animal model. DNA Repair 2016 Jul. 30 [Epub ahead of print]; Zheng et al, Precise gene deletion and replacement using the CRISPR/Cas9 system in human cells. BioTechniques, Vol. 57, No. 3, September 2014, pp. 115-124.


CRISPR systems are adaptive defense systems originally discovered in bacteria and archaea. CRISPR systems use RNA-guided nucleases termed CRISPR-associated or “Cas” endonucleases (e.g., Cas9 or Cpfl) to cleave foreign DNA. In a typical CRISPR/Cas system, an endonuclease is directed to a target nucleotide sequence (e.g., a site in the genome that is to be sequence-edited) by sequence-specific, non-coding “guide RNAs” that target single- or double-stranded DNA sequences. Three classes (I-III) of CRISPR systems have been identified. The class II CRISPR systems use a single Cas endonuclease (rather than multiple Cas proteins). One class II CRISPR system includes a type II Cas endonuclease such as Cas9, a CRISPR RNA (“crRNA”), and a trans-activating crRNA (“tracrRNA”). The crRNA contains a “guide RNA”, typically about 20-nucleotide RNA sequence that corresponds to a target DNA sequence. The crRNA also contains a region that binds to the tracrRNA to form a partially double-stranded structure which is cleaved by RNase III, resulting in a crRNA/tracrRNA hybrid. The crRNA/tracrRNA hybrid then directs the Cas9 endonuclease to recognize and cleave the target DNA sequence. The target DNA sequence must generally be adjacent to a “protospacer adjacent motif (“PAM”) that is specific for a given Cas endonuclease; however, PAM sequences appear throughout a given genome. CRISPR endonucleases identified from various prokaryotic species have unique PAM sequence requirements; examples of PAM sequences include 5′-NGG (Streptococcus pyogenes), 5′-NNAGAA (Streptococcus thermophilus CRISPR1), 5′-NGGNG (Streptococcus thermophilus CRISPR3), and 5′-NNNGATT (Neisseria meningitidis). Some endonucleases, e.g., Cas9 endonucleases, are associated with G-rich PAM sites, e.g., 5′-NGG, and perform blunt-end cleaving of the target DNA at a location 3 nucleotides upstream from (5 ‘ from) the PAM site. Another class II CRISPR system includes the type V endonuclease Cpfl, which is smaller than Cas9; examples include AsCpfl (from Acidaminococcus sp.) and LbCpfl (from Lachnospiraceae sp.). Cpf 1-associated CRISPR arrays are processed into mature crRNAs without the requirement of a tracrRNA; in other words a Cpfl system requires only the Cpfl nuclease and a crRNA to cleave the target DNA sequence. Cpfl endonucleases, are associated with T-rich PAM sites, e.g., 5’-TTN. Cpfl can also recognize a 5′-CTA PAM motif. Cpfl cleaves the target DNA by introducing an offset or staggered double-strand break with a 4- or 5-nucleotide 5′ overhang, for example, cleaving a target DNA with a 5-nucleotide offset or staggered cut located 18 nucleotides downstream from (3′ from) from the PAM site on the coding strand and 23 nucleotides downstream from the PAM site on the complimentary strand; the 5-nucleotide overhang that results from such offset cleavage allows more precise genome editing by DNA insertion by homologous recombination than by insertion at blunt-end cleaved DNA. See, e.g., Zetsche et al. (2015) Cell, 163:759-771.


A variety of CRISPR associated (Cas) genes or proteins can be used in the present invention and the choice of Cas protein will depend upon the particular conditions of the method.


Specific examples of Cas proteins include class II systems including Cas1, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, CaslO, Cpfl, C2C1, or C2C3. In some embodiments, a Cas protein, e.g., a Cas9 protein, may be from any of a variety of prokaryotic species. In some embodiments a particular Cas protein, e.g., a particular Cas9 protein, is selected to recognize a particular protospacer-adjacent motif (PAM) sequence. In some embodiments, the site-specific targeting moiety includes a sequence targeting polypeptide, such as an enzyme, e.g., Cas9. In certain embodiments a Cas protein, e.g., a Cas9 protein, may be obtained from a bacteria or archaea or synthesized using known methods.


In certain embodiments, a Cas protein may be from a gram positive bacteria or a gram negative bacteria. In certain embodiments, a Cas protein may be from a Streptococcus, (e.g., a S. pyogenes, a S. thermophilus) a Cryptococcus, a Corynebacterium, a Haemophilus, a Eubacterium, a Pasteurella, a Prevotella, a Veillonella, or a Marinobacter. In some embodiments nucleic acids encoding two or more different Cas proteins, or two or more Cas proteins, may be introduced into a cell, zygote, embryo, or animal, e.g., to allow for recognition and modification of sites comprising the same, similar or different PAM motifs. In some embodiments, the Cas protein is modified to deactivate the nuclease, e.g., nuclease-deficient Cas9, and to recruit transcription activators or repressors, e.g., the co-subunit of the E. coli Pol, VP64, the activation domain of p65, KRAB, or SID4X, to induce epigenetic modifications, e.g., histone acetyltransferase, histone methyltransferase and demethylase, DNA methyltransferase and enzyme with a role in DNA demethylation (e.g., the TET family enzymes catalyze oxidation of 5-methylcytosine to 5-hydroxymethylcytosine and higher oxidative derivatives).


For the purposes of gene editing, CRISPR arrays can be designed to contain one or multiple guide RNA sequences corresponding to a desired target DNA sequence; see, for example, Cong et al. (2013) Science, 339:819-823; Ran et al. (2013) Nature Protocols, 8:2281-2308. At least about 16 or 17 nucleotides of gRNA sequence are required by Cas9 for DNA cleavage to occur; for Cpfl at least about 16 nucleotides of gRNA sequence is needed to achieve detectable DNA cleavage.


Whereas wild-type Cas9 generates double-strand breaks (DSBs) at specific DNA sequences targeted by a gRNA, a number of CRISPR endonucleases having modified functionalities are available, for example: a “nickase” version of Cas9 generates only a single-strand break; a catalytically inactive Cas9 (“dCas9”) does not cut the target DNA but interferes with transcription by steric hindrance. dCas9 can further be fused with a heterologous effector to repress (CRISPRi) or activate (CRISPRa) expression of a target gene. For example, Cas9 can be fused to a transcriptional silencer (e.g., a KRAB domain) or a transcriptional activator (e.g., a dCas9-VP64 fusion). A catalytically inactive Cas9 (dCas9) fused to Fokl nuclease (“dCas9-FokI”) can be used to generate DSBs at target sequences homologous to two gRNAs. See, e.g., the numerous CRISPR/Cas9 plasmids disclosed in and publicly available from the Addgene repository (Addgene, 75 Sidney St., Suite 550A, Cambridge, MA 02139; addgene.org/crispr). A “double nickase” Cas9 that introduces two separate double-strand breaks, each directed by a separate guide RNA, is described as achieving more accurate genome editing by Ran et al. (2013) Cell, 154: 1380-1389.


CRISPR technology for editing the genes of eukaryotes is disclosed in US Patent Application Publications 2016/0138008A1 and US2015/0344912A1, and in U.S. Pat. Nos. 8,697,359, 8,771,945, 8,945,839, 8,999,641, 8,993,233, 8,895,308, 8,865,406, 8,889,418, 8,871,445, 8,889,356, 8,932,814, 8,795,965, and 8,906,616. Cpfl endonuclease and corresponding guide RNAs and PAM sites are disclosed in US Patent Application Publication 2016/0208243 A1.


In some embodiments, an effector comprises one or more components of a CRISPR system described hereinabove.


In some embodiments, suitable effectors for use in the agents, compositions, and methods of the invention include, for example, nucleases, physical blockers, epigenetic recruiters, e.g., a transcriptional enhancer or a transcriptional repressor, and epigenetic CpG modifiers, e.g., a DNA methylase, a DNA demethylase, a histone modifying agent, a histone transacetylase, or a histone deacetylase, and combinations of any of the foregoing.


Suitable effectors include a polypeptide or its variant. The term “variant,” as used herein, refers to a polypeptide that is derived by incorporation of one or more amino acid insertions, substitutions, or deletions in a precursor polypeptide (e.g., “parent” polypeptide). In certain embodiments, a variant polypeptide has at least about 85% amino acid sequence identity, e.g., about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100%, amino acid sequence identity to the entire amino acid sequence of a parent polypeptide.


The term “sequence identity,” as used herein, refers to a comparison between pairs of nucleic acid or amino acid molecules, i.e., the relatedness between two amino acid sequences or between two nucleotide sequences. In general, the sequences are aligned so that the highest order match is obtained. Methods for determining sequence identity are known and can be determined by commercially available computer programs that can calculate the percentage of identity between two or more sequences. A typical example of such a computer program is CLUSTAL.


Exemplary effectors include ubiquitin, bicyclic peptides as ubiquitin ligase inhibitors, transcription factors, DNA and protein modification enzymes such as topoisomerases, topoisomerase inhibitors such as topotecan, DNA methyltransferases such as the DNMT family (e.g., DNMT3a, DNMT3b, DNMTL), protein methyltransferases (e.g., viral lysine methyltransferase (vSET), protein-lysine N-methyltransferase (SMYD2), deaminases (e.g., APOBEC, UG1), histone methyltransferases such as enhancer of zeste homolog 2 (EZH2), PRMT1, histone-lysine-N-methyltransferase (Setdbl), histone methyltransferase (SET2), euchromatic histone-lysine N-methyltransferase 2 (G9a), histone-lysine N-methyltransferase (SUV39H1), and G9a), histone deacetylase (e.g., HDAC1, HDAC2, HDAC3), enzymes with a role in DNA demethylation (e.g., the TET family enzymes catalyze oxidation of 5-methylcytosine to 5-hydroxymethylcytosine and higher oxidative derivatives), protein demethylases such as KDMIA and lysine-specific histone demethylase 1 (LSD1), helicases such as DHX9, acetyltransferases, deacetylases (e.g., sirtuin 1, 2, 3, 4, 5, 6, or 7), kinases, phosphatases, DNA-intercalating agents such as ethidium bromide, sybr green, and proflavine, efflux pump inhibitors such as peptidomimetics like phenylalanine arginyl-naphthylamide or quinoline derivatives, nuclear receptor activators and inhibitors, proteasome inhibitors, competitive inhibitors for enzymes such as those involved in lysosomal storage diseases, zinc finger proteins, TALENs, specific domains from proteins, such as a KRAB domain, an MeCP2 domain, an MQ1 domain, a DNMT3a-3L domain a TET1 domain, and a TET2 domain, protein synthesis inhibitors, nucleases (e.g., Cpfl, Cas9, zinc finger nuclease), fusions of one or more thereof (e.g., dCas9-DNMT, dCas9-APOBEC, dCas9-UGl, dCas9-KRAB, dCas9-KRAB-MeCP2, dCas9-MQ1, dCas9-DNMT3a-3L, dCas9-TET1, dCas9-TET2, dCas9-EZH2, dCas9-HDAC8, dCas9-G9A, and dCas9-MC/MN).


In some embodiments, a suitable nuclease for use in the agent, compositions, and methods of the invention comprises a Cas9 polypeptide, or enzymatically active portion thereof. In one embodiment, the Cas9 polypeptide, or enzymatically active portion thereof, further comprises a catalytically active domain of human exonuclease 1 (hEXO1), e.g., 5′ to 3′ exonuclease activity and/or an RNase H activity. In other embodiments, a suitable nuclease comprises a transcription activator like effector nuclease (TALEN). In yet other embodiments, a suitable nuclease comprises a zinc finger protein.


The term TALEN, as used herein, is broad and includes a monomeric TALEN that can cleave double stranded DNA without assistance from another TALEN. The term TALEN is also used to refer to one or both members of a pair of TALENs that are engineered to work together to cleave DNA at the same site. TALENs that work together may be referred to as a left-TALEN and a right-TALEN, which references the handedness of DNA. See U.S. Ser. No. 12/965,590; U.S. Ser. No. 13/426,991 (U.S. Pat. No. 8,450,471); U.S. Ser. No. 13/427,040 (U.S. Pat. No. 8,440,431); U.S. Ser. No. 13/427,137 (U.S. Pat. No. 8,440,432); and U.S. Ser. No. 13/738,381, all of which are incorporated by reference herein in their entirety.


TAL effectors (TALE) are proteins secreted by Xanthomonas bacteria. The DNA binding domain contains a highly conserved 33-34 amino acid sequence with the exception of the 12th and 13th amino acids. These two locations are highly variable (Repeat Variable Diresidue (RVD)) and show a strong correlation with specific nucleotide recognition. This simple relationship between amino acid sequence and DNA recognition has allowed for the engineering of specific DNA binding domains by selecting a combination of repeat segments containing the appropriate RVDs.


The non-specific DNA cleavage domain from the end of the FokI endonuclease can be used to construct hybrid nucleases that are active in a yeast assay. These reagents are also active in plant cells and in animal cells. Initial TALEN studies used the wild-type FokI cleavage domain, but some subsequent TALEN studies also used FokI cleavage domain variants with mutations designed to improve cleavage specificity and cleavage activity. The FokI domain functions as a dimer, requiring two constructs with unique DNA binding domains for sites in the target genome with proper orientation and spacing. Both the number of amino acid residues between the TALEN DNA binding domain and the FokI cleavage domain and the number of bases between the two individual TALEN binding sites are parameters for achieving high levels of activity. The number of amino acid residues between the TALEN DNA binding domain and the FokI cleavage domain may be modified by introduction of a spacer (distinct from the spacer sequence) between the plurality of TAL effector repeat sequences and the FokI endonuclease domain. The spacer sequence may be 12 to 30 nucleotides, e.g., 12-15, 12-20, 20-25, or 15-30 nucleotides.


The relationship between amino acid sequence and DNA recognition of the TALE binding domain allows for designable proteins. In this case artificial gene synthesis is problematic because of improper annealing of the repetitive sequence found in the TALE binding domain. One solution to this is to use a publicly available software program (DNAWorks) to calculate oligonucleotides suitable for assembly in a two step PCR; oligonucleotide assembly followed by whole gene amplification. A number of modular assembly schemes for generating engineered TALE constructs have also been reported. Both methods offer a systematic approach to engineering DNA binding domains that is conceptually similar to the modular assembly method for generating zinc finger DNA recognition domains.


Once the TALEN genes have been assembled they are inserted into plasmids; the plasmids are then used to transfect the target cell where the gene products are expressed and enter the nucleus to access the genome. TALENs can be used to edit genomes by inducing double-strand breaks (DSB), which cells respond to with repair mechanisms. In this manner, they can be used to correct mutations in the genome which, for example, cause disease.


As used herein, a “zinc finger polypeptide” or “zinc finger protein” is a protein that binds to DNA, RNA and/or protein, in a sequence-specific manner, by virtue of a metal stabilized domain known as a zinc finger. Zinc finger proteins are nucleases having a DNA cleavage domain and a DNA binding zinc finger domain. Zinc finger polypeptides may be made by fusing the nonspecific DNA. cleavage domain of an endonuclease with site-specific DNA binding zinc finger domains. Such nucleases are powerful tools for gene editing and can be assembled to induce double strand breaks (DSBs) site-specifically into genomic DNA. ZFNs allow specific gene disruption as during DNA repair, the targeted genes can be disrupted via mutagenic non-homologous end joint (NHEJ) or modified via homologous recombination (HR) if a closely related DNA template is supplied.


Zinc finger nucleases are chimeric enzymes made by fusing the nonspecific DNA. cleavage domain of the endonuclease FokI with site-specific DNA binding zinc finger domains. Due to the flexible nature of zinc finger proteins (ZFPs), ZFNs can be assembled that induce double strand breaks (DSBs) site-specifically into genomic DNA. ZFNs allow specific gene disruption as during DNA repair, the targeted genes can be disrupted via mutagenic non-homologous end joint (NHEJ) or modified via homologous recombination (HR) if a closely related DNA template is supplied.


In some embodiments, a suitable physical blocker for use in the agent, compositions, and methods of the invention comprises a gRNA, antisense DNA, or triplex forming oligonucleotide (which may target an expression control unit) steric block a transcriptional control element or anchoring sequence. The gRNA recognizes specific DNA sequences and further includes sequences that interfere with, e.g., a conjunction nucleating molecule sequence to act as a steric blocker. In some embodiments, the gRNA is combined with one or more peptides, e.g., S-adenosyl methionine (SAM), that acts as a steric presence. In other embodiments, a physical blocker comprises an enzymatically inactive Cas9 polypeptide, or fragment thereof (e.g., dCas9). In one embodiment, an epigenetic recruiter silences or represses transcription of a target gene. In some embodiments, a suitable epigenetic recruiter for use in the agent, compositions, and methods of the invention comprises a KRAB domain, or an MeCP2 domain.


In one embodiment, a suitable epigenetic recruiter for use in the agent, compositions, and methods of the invention comprises dCas9-MQ1 fusion, a dCas9-G9A fusion, a dCas9-EZH2 fusion, a dCas9-HDAC8 fusion, a dCas9-KRAB fusion, or a dCas9-KRAB-MeCP2 fusion.


As used herein, “KRAB” refers to a Krüppel associated box (KRAB) transcriptional repression domain present in human zinc finger protein-based transcription factors (KRAB zinc finger proteins).


As used herein, “MeCp2” refers to methyl CpG binding protein 2 which represses transcription, e.g., by binding to a promoter comprising methylated DNA.


In one embodiment, an epigenetic CpG modifier methylates DNA and inactivates or represses transcription. In some embodiments, a suitable epigenetic CpG modifier for use in the agent, compositions, and methods of the invention comprises a MQ1 domain or a DNMT3a-3L domain. In one embodiment, an epigenetic CpG modifier demethylates DNA and activates or stimulates transcription. In some embodiments, a suitable epigenetic recruiter for use in the agent, compositions, and methods of the invention comprises a TET1 or TET2 domain.


As used herein “MQ1” refers to a prokaryotic DNA methyltransferase.


As used herein “DNMT3a-3L” refers to a fusion of a DNA methyltransferase, Dnmt3a and a Dnmt3L which is catalytically inactive, but directly interacts with the catalytic domains of Dnmt3a.


As used herein “TET1” refers to “ten-eleven translocation methylcytosine dioxygenase 1,” a member of the TET family of enzymes, encoded by the TET1 gene. TET1 is a dioxygenase that catalyzes the conversion of the modified DNA base 5-methylcytosine (5-mC) to 5-hydroxymethylcytosine (5-hmC) by oxidation of 5-mC in an iron and alpha-ketoglutarate dependent manner, the initial step of active DNA demethylation in mammals. Methylation at the C5 position of cytosine bases is an epigenetic modification of the mammalian genome which plays an important role in transcriptional regulation. In addition to its role in DNA demethylation, plays a more general role in chromatin regulation. Preferentially binds to CpG-rich sequences at promoters of both transcriptionally active and Polycomb-repressed genes. Involved in the recruitment of the O-GlcNAc transferase OGT to CpG-rich transcription start sites of active genes, thereby promoting histone H2B GlcNAcylation by OGT. Exemplary TET1 nucleotide and amino acid sequence can be found at GenBank Accession Nos.: NM_030625.3, NP_085128.2.


As used herein, “TET2” refers to “ten-eleven translocation 2 (TET2),” a member of the TET family of enzymes, encoded by the TET1 gene. Similarly to TET1, TET2 is a dioxygenase that catalyzes the conversion of the modified genomic base 5-methylcytosine (5mC) into 5-hydroxymethylcytosine (5hmC) and plays a key role in active DNA demethylation. TET2 a preference for 5-hydroxymethylcytosine in CpG motifs. TET2 also mediates subsequent conversion of 5hmC into 5-formylcytosine (5fC), and conversion of 5fC to 5-carboxylcytosine (5caC). The conversion of 5mC into 5hmC, 5fC and 5caC probably constitutes the first step in cytosine demethylation. Methylation at the C5 position of cytosine bases is an epigenetic modification of the mammalian genome which plays an important role in transcriptional regulation. In addition to its role in DNA demethylation, also involved in the recruitment of the O-GlcNAc transferase OGT to CpG-rich transcription start sites of active genes, thereby promoting histone H2B GlcNAcylation by OGT. Exemplary nucleotide and amino acid sequence can be found at Genbank Accession No.: NM_001127208.2, NP_001120680.1.


In some embodiments, a suitable epigenetic recruiter for use in the agent, compositions, and methods of the invention comprises a MQ1 domain, a DNMT3a-3L, TET1, or TET2 domain. In one embodiment, a suitable epigenetic recruiter for use in the agent, compositions, and methods of the invention comprises a dCas9-MQ1 fusion, a dCas9-DNMT3a-3L fusion, a dCas9-TET1 fusion or a dCas9-TET2 fusion.









TABLE 2







Effector polypeptides













Effector 

SEQ
Effector 
SEQ

SEQ


Poly-

ID
Protein
ID

ID


peptide
Effector DNA sequence
NO:
Sequence
NO:
Effector RNA sequence
NO:





HDAC8
GAAGAACCTGAGGAGCCTGCCGATTCCGGAC
 72
EEPEEPADSGQSLVP
 76
GAAGAACCUGAGGAGCCUGCCGAUUCCGGACA
80


(NP_060956.
AGAGCCTGGTGCCCGTGTATATCTACTCCCCC

VYIYSPEYVSMCDSL

GAGCCUGGUGCCCGUGUAUAUCUACUCCCCCG



1)
GAATACGTGTCTATGTGCGACAGCTTGGCTAA

AKIPKRASMVHSLIE

AAUACGUGUCUAUGUGCGACAGCUUGGCUAA




GATTCCGAAGCGGGCATCAATGGTGCACTCGC

AYALHKQMRIVKPKV

GAUUCCGAAGCGGGCAUCAAUGGUGCACUCGC




TGATCGAGGCCTACGCCCTGCACAAGCAGATG

ASMEEMATFHTDAYL

UGAUCGAGGCCUACGCCCUGCACAAGCAGAUG




AGAATCGTGAAGCCCAAGGTCGCCTCAATGG

QHLQKVSQEGDDDHP

AGAAUCGUGAAGCCCAAGGUCGCCUCAAUGGA




AAGAGATGGCCACCTTCCACACCGACGCCTAC

DSIEYGLGYDCPATE

AGAGAUGGCCACCUUCCACACCGACGCCUACU




TTGCAACATCTCCAAAAAGTGTCCCAGGAAGG

GIFDYAAAIGGATIT

UGCAACAUCUCCAAAAAGUGUCCCAGGAAGGG




GGACGACGACCACCCTGACTCCATTGAGTACG

AAQCLIDGMCKVAIN

GACGACGACCACCCUGACUCCAUUGAGUACGG




GCCTGGGTTACGACTGCCCAGCTACCGAAGG

WSGGWHHAKKDEASG

CCUGGGUUACGACUGCCCAGCUACCGAAGGGA




GATCTTCGACTACGCCGCTGCCATTGGCGGAG

FCYLNDAVLGILRLR

UCUUCGACUACGCCGCUGCCAUUGGCGGAGCG




CGACCATCACTGCCGCGCAGTGCCTCATCGAC

RKFERILYVDLDLHH

ACCAUCACUGCCGCGCAGUGCCUCAUCGACGG




GGAATGTGCAAGGTCGCCATCAACTGGTCCG

GDGVEDAFSFTSKVM

AAUGUGCAAGGUCGCCAUCAACUGGUCCGGAG




GAGGCTGGCACCACGCCAAGAAGGATGAAGC

TVSLHKFSPGFFPGT

GCUGGCACCACGCCAAGAAGGAUGAAGCCUCC




CTCCGGCTTCTGCTACCTTAACGACGCCGTGCT

GDVSDVGLGKGRYYS

GGCUUCUGCUACCUUAACGACGCCGUGCUGGG




GGGAATCCTTCGCCTGCGAAGAAAGTTCGAAC

VNVPIQDGIQDEKYY

AAUCCUUCGCCUGCGAAGAAAGUUCGAACGGA




GGATTTTGTATGTGGACCTGGATCTGCATCAT

QICESVLKEVYQAFN

UUUUGUAUGUGGACCUGGAUCUGCAUCAUGG




GGAGATGGCGTGGAGGATGCCTTCTCCTTCAC

PKAVVLQLGADTIAG

AGAUGGCGUGGAGGAUGCCUUCUCCUUCACC




CTCGAAAGTCATGACCGTGTCACTTCACAAGT

DPMCSFNMTPVGIGK

UCGAAAGUCAUGACCGUGUCACUUCACAAGUU




TCTCACCCGGCTTCTTCCCTGGGACCGGAGAT

CLKYILQWQLATLIL

CUCACCCGGCUUCUUCCCUGGGACCGGAGAUG




GTGTCCGACGTCGGTCTGGGAAAGGGCCGCT

GGGGYNLANTARCWT

UGUCCGACGUCGGUCUGGGAAAGGGCCGCUA




ACTACTCCGTGAACGTGCCGATCCAGGACGGT

YLTGVILGKTLSSEI

CUACUCCGUGAACGUGCCGAUCCAGGACGGUA




ATCCAGGACGAGAAGTACTACCAGATCTGCGA

PDHEFFTAYGPDYVL

UCCAGGACGAGAAGUACUACCAGAUCUGCGAG




GAGCGTGCTGAAGGAAGTGTACCAGGCCTTC

EITPSCRPDRNEPHR

AGCGUGCUGAAGGAAGUGUACCAGGCCUUCAA




AATCCCAAGGCCGTGGTGCTGCAGCTTGGCGC

IQQILNYIKGNLKHV

UCCCAAGGCCGUGGUGCUGCAGCUUGGCGCG




GGACACTATTGCGGGCGACCCGATGTGCTCCT

V

GACACUAUUGCGGGCGACCCGAUGUGCUCCUU




TCAACATGACCCCCGTCGGTATTGGAAAGTGC



CAACAUGACCCCCGUCGGUAUUGGAAAGUGCC




CTGAAGTACATCCTGCAATGGCAGCTGGCTAC



UGAAGUACAUCCUGCAAUGGCAGCUGGCUACC




CCTGATCCTGGGAGGAGGCGGATACAACCTC



CUGAUCCUGGGAGGAGGCGGAUACAACCUCGC




GCAAACACCGCCCGGTGTTGGACTTACCTGAC



AAACACCGCCCGGUGUUGGACUUACCUGACUG




TGGGGTCATCCTGGGAAAGACTCTGTCATCCG



GGGUCAUCCUGGGAAAGACUCUGUCAUCCGA




AGATTCCCGACCACGAGTTCTTCACCGCGTAC



GAUUCCCGACCACGAGUUCUUCACCGCGUACG




GGCCCAGATTACGTGCTCGAAATCACTCCTTCC



GCCCAGAUUACGUGCUCGAAAUCACUCCUUCC




TGCCGGCCTGATAGAAATGAGCCGCACCGCAT



UGCCGGCCUGAUAGAAAUGAGCCGCACCGCAU




ACAGCAGATCCTCAACTACATTAAGGGCAACC



ACAGCAGAUCCUCAACUACAUUAAGGGCAACC




TGAAGCACGTGGTG



UGAAGCACGUGGUG






G9A
GGAAGCGCCGCTATCGCCGAAGTGCTGCTGA
 73
GSAAIAEVLLNARCD
 77
GGAAGCGCCGCUAUCGCCGAAGUGCUGCUGAA
81


(NP_006700.
ATGCCAGATGCGATCTGCATGCCGTGAACTAC

LHAVNYHGDTPLHIA

UGCCAGAUGCGAUCUGCAUGCCGUGAACUACC



3)
CACGGCGACACCCCTCTGCATATCGCCGCTAG

ARESYHDCVLLFLSR

ACGGCGACACCCCUCUGCAUAUCGCCGCUAGA




AGAGAGCTACCATGACTGTGTGCTGCTGTTTC

GANPELRNKEGDTAW

GAGAGCUACCAUGACUGUGUGCUGCUGUUUC




TGAGCAGAGGCGCCAATCCCGAGCTCAGAAA

DLTPERSDVWFALQL

UGAGCAGAGGCGCCAAUCCCGAGCUCAGAAAC




CAAAGAGGGCGACACCGCTTGGGATCTGACA

NRKLRLGVGNRAIRT

AAAGAGGGCGACACCGCUUGGGAUCUGACACC




CCCGAGAGATCCGACGTGTGGTTCGCTCTGCA

EKIICRDVARGYENV

CGAGAGAUCCGACGUGUGGUUCGCUCUGCAAC




ACTGAATAGAAAACTGAGACTGGGCGTCGGC

PIPCVNGVDGEPCPE

UGAAUAGAAAACUGAGACUGGGCGUCGGCAA




AATAGGGCCATTAGAACCGAGAAGATCATCTG

DYKYISENCETSTMN

UAGGGCCAUUAGAACCGAGAAGAUCAUCUGU




TAGGGACGTGGCTAGGGGCTACGAGAACGTG

IDRNITHLQHCTCVD

AGGGACGUGGCUAGGGGCUACGAGAACGUGC




CCCATCCCTTGTGTGAACGGAGTGGATGGAGA

DCSSSNCLCGQLSIR

CCAUCCCUUGUGUGAACGGAGUGGAUGGAGA




GCCTTGCCCCGAGGATTACAAATACATCAGCG

CWYDKDGRLLQEFNK

GCCUUGCCCCGAGGAUUACAAAUACAUCAGCG




AGAACTGCGAAACCTCCACCATGAATATCGAT

IEPPLIFECNQACSC

AGAACUGCGAAACCUCCACCAUGAAUAUCGAU




AGAAACATTACACACCTCCAGCACTGTACATG

WRNCKNRVVQSGIKV

AGAAACAUUACACACCUCCAGCACUGUACAUG




CGTGGACGATTGCAGCAGCAGCAACTGTCTGT

RLQLYRTAKMGWGVR

CGUGGACGAUUGCAGCAGCAGCAACUGUCUG




GCGGCCAACTGAGCATCAGATGCTGGTACGA

ALQTIPQGTFICEYV

UGCGGCCAACUGAGCAUCAGAUGCUGGUACGA




CAAGGATGGCAGACTGCTGCAAGAGTTCAAC

GELISDAEADVREDD

CAAGGAUGGCAGACUGCUGCAAGAGUUCAACA




AAGATCGAACCCCCTCTGATCTTCGAGTGTAA

SYLFDLDNKDGEVYC

AGAUCGAACCCCCUCUGAUCUUCGAGUGUAAC




CCAAGCTTGCAGCTGTTGGAGGAACTGCAAG

IDARYYGNISRFINH

CAAGCUUGCAGCUGUUGGAGGAACUGCAAGA




AATAGGGTCGTGCAGTCCGGAATCAAGGTGA

LCDPNIIPVRVFMLH

AUAGGGUCGUGCAGUCCGGAAUCAAGGUGAG




GACTGCAGCTGTATAGAACAGCTAAGATGGG

QDLRFPRIAFFSSRD

ACUGCAGCUGUAUAGAACAGCUAAGAUGGGA




ATGGGGAGTCAGAGCTCTGCAGACCATCCCCC

IRTGEELGFDYGDRF

UGGGGAGUCAGAGCUCUGCAGACCAUCCCCCA




AAGGCACATTCATCTGTGAGTACGTCGGCGAA

WDIKSKYFTCQCGSE

AGGCACAUUCAUCUGUGAGUACGUCGGCGAAC




CTCATCAGCGACGCTGAGGCCGATGTGAGGG

KCKHSAEAIALEQSR

UCAUCAGCGACGCUGAGGCCGAUGUGAGGGA




AGGACGACAGCTATCTCTTCGACCTCGACAAC

LARLDPHPELLPELG

GGACGACAGCUAUCUCUUCGACCUCGACAACA




AAGGACGGCGAGGTGTACTGCATCGACGCTA

SLPPVNT

AGGACGGCGAGGUGUACUGCAUCGACGCUAG




GATATTACGGCAACATCAGCAGATTCATCAAC



AUAUUACGGCAACAUCAGCAGAUUCAUCAACC




CACCTCTGCGACCCCAATATCATCCCCGTGAG



ACCUCUGCGACCCCAAUAUCAUCCCCGUGAGA




AGTGTTCATGCTCCATCAAGATCTGAGATTCCC



GUGUUCAUGCUCCAUCAAGAUCUGAGAUUCCC




TAGGATCGCCTTCTTCAGCTCTAGAGACATTA



UAGGAUCGCCUUCUUCAGCUCUAGAGACAUUA




GAACCGGCGAGGAGCTGGGATTCGACTACGG



GAACCGGCGAGGAGCUGGGAUUCGACUACGGC




CGACAGGTTCTGGGACATCAAGAGCAAGTACT



GACAGGUUCUGGGACAUCAAGAGCAAGUACU




TCACATGCCAATGCGGCAGCGAGAAATGCAA



UCACAUGCCAAUGCGGCAGCGAGAAAUGCAAG




GCATAGCGCCGAGGCCATTGCTCTGGAGCAGT



CAUAGCGCCGAGGCCAUUGCUCUGGAGCAGUC




CTAGACTGGCTAGGCTGGACCCTCACCCCGAG



UAGACUGGCUAGGCUGGACCCUCACCCCGAGC




CTGCTGCCCGAACTGGGATCTCTGCCTCCCGT



UGCUGCCCGAACUGGGAUCUCUGCCUCCCGUG




GAATACC



AAUACC






EZH2
GGACAGACGGGCAAAAAGAGCGAAAAGGGA
 74
GQTGKKSEKGPVCWR
 78
GGACAGACGGGCAAAAAGAGCGAAAAGGGACC
82


(NP_0011901
CCCGTCTGCTGGCGGAAACGAGTGAAAAGCG

KRVKSEYMRLRQLKR

CGUCUGCUGGCGGAAACGAGUGAAAAGCGAA



76.1)
AATACATGCGCCTGCGGCAACTCAAGAGGTTC

FRRADEVKSMFSSNR

UACAUGCGCCUGCGGCAACUCAAGAGGUUCCG




CGCAGAGCCGACGAGGTCAAGAGCATGTTCA

QKILERTEILNQEWK

CAGAGCCGACGAGGUCAAGAGCAUGUUCAGCA




GCAGCAACAGACAAAAGATCCTGGAGAGGAC

QRRIQPVHILTSVSS

GCAACAGACAAAAGAUCCUGGAGAGGACCGAA




CGAAATCCTCAACCAGGAATGGAAGCAGCGC

LRGTRECSVTSDLDF

AUCCUCAACCAGGAAUGGAAGCAGCGCAGGAU




AGGATCCAGCCGGTGCACATCCTGACCAGCGT

PTQVIPLKTLNAVAS

CCAGCCGGUGCACAUCCUGACCAGCGUCAGCA




CAGCAGCCTCAGAGGCACCCGCGAGTGCAGC

VPIMYSWSPLQQNFM

GCCUCAGAGGCACCCGCGAGUGCAGCGUGACC




GTGACCAGCGACCTGGACTTCCCCACCCAAGT

VEDETVLHNIPYMGD

AGCGACCUGGACUUCCCCACCCAAGUGAUCCC




GATCCCGCTGAAAACCCTCAACGCAGTGGCCA

EVLDQDGTFIEELIK

GCUGAAAACCCUCAACGCAGUGGCCAGCGUGC




GCGTGCCGATCATGTACAGCTGGAGCCCCCTG

NYDGKVHGDRECGFI

CGAUCAUGUACAGCUGGAGCCCCCUGCAGCAG




CAGCAGAACTTCATGGTCGAGGACGAAACCG

NDEIFVELVNALGQY

AACUUCAUGGUCGAGGACGAAACCGUGCUGCA




TGCTGCACAACATCCCGTACATGGGCGACGAA

NDDDDDDDGDDPEER

CAACAUCCCGUACAUGGGCGACGAAGUGCUGG




GTGCTGGACCAGGACGGAACCTTCATCGAGG

EEKQKDLEDHRDDKE

ACCAGGACGGAACCUUCAUCGAGGAACUGAUC




AACTGATCAAGAACTACGACGGAAAGGTGCA

SRPPRKFPSDKIFEA

AAGAACUACGACGGAAAGGUGCACGGGGACAG




CGGGGACAGGGAATGCGGGTTCATCAACGAC

ISSMFPDKGTAEELK

GGAAUGCGGGUUCAUCAACGACGAGAUCUUC




GAGATCTTCGTCGAGCTCGTCAACGCCCTGGG

EKYKELTEQQLPGAL

GUCGAGCUCGUCAACGCCCUGGGACAAUACAA




ACAATACAACGACGACGACGACGACGACGAC

PPECTPNIDGPNAKS

CGACGACGACGACGACGACGACGGGGACGACC




GGGGACGACCCAGAAGAACGGGAGGAAAAG

VQREQSLHSFHTLFC

CAGAAGAACGGGAGGAAAAGCAGAAGGACCUG




CAGAAGGACCTGGAGGACCACCGCGACGACA

RRCFKYDCFLHPFHA

GAGGACCACCGCGACGACAAGGAAAGCAGACC




AGGAAAGCAGACCCCCCAGGAAGTTCCCGAG

TPNTYKRKNTETALD

CCCCAGGAAGUUCCCGAGCGACAAGAUCUUCG




CGACAAGATCTTCGAAGCCATCAGCAGCATGT

NKPCGPQCYQHLEGA

AAGCCAUCAGCAGCAUGUUCCCGGACAAGGGA




TCCCGGACAAGGGAACCGCCGAGGAGCTGAA

KEFAAALTAERIKTP

ACCGCCGAGGAGCUGAAGGAAAAGUACAAGGA




GGAAAAGTACAAGGAACTGACCGAGCAGCAG

PKRPGGRRRGRLPNN

ACUGACCGAGCAGCAGCUCCCAGGAGCACUGC




CTCCCAGGAGCACTGCCGCCGGAATGCACACC

SSRPSTPTINVLESK

CGCCGGAAUGCACACCAAACAUCGACGGACCGA




AAACATCGACGGACCGAACGCCAAGAGCGTG

DTDSDREAGTETGGE

ACGCCAAGAGCGUGCAGAGGGAGCAGAGCCUG




CAGAGGGAGCAGAGCCTGCACAGCTTCCACA

NNDKEEEEKKDETSS

CACAGCUUCCACACCCUGUUCUGCCGGAGAUG




CCCTGTTCTGCCGGAGATGCTTCAAATACGAC

SSEANSRCQTPIKMK

CUUCAAAUACGACUGCUUCCUGCACCCCUUCC




TGCTTCCTGCACCCCTTCCACGCCACCCCGAAC

PNIEPPENVEWSGAE

ACGCCACCCCGAACACCUACAAGCGCAAGAACA




ACCTACAAGCGCAAGAACACCGAAACCGCCCT

ASMFRVLIGTYYDNF

CCGAAACCGCCCUGGACAACAAGCCGUGCGGA




GGACAACAAGCCGTGCGGACCCCAATGCTACC

CAIARLIGTKTCRQV

CCCCAAUGCUACCAGCACCUGGAAGGCGCCAA




AGCACCTGGAAGGCGCCAAGGAGTTCGCCGC

YEFRVKESSIIAPAP

GGAGUUCGCCGCAGCACUGACCGCCGAGCGGA




AGCACTGACCGCCGAGCGGATCAAAACCCCG

AEDVDTPPRKKKRKH

UCAAAACCCCGCCGAAAAGACCCGGAGGCAGAC




CCGAAAAGACCCGGAGGCAGACGGAGAGGG

RLWAAHCRKIQLKKD

GGAGAGGGAGACUCCCAAACAACAGCAGCAGA




AGACTCCCAAACAACAGCAGCAGACCGAGCA

GSSNHVYNYQPCDHP

CCGAGCACGCCGACCAUCAACGUGCUCGAGAG




CGCCGACCATCAACGTGCTCGAGAGCAAGGA

RQPCDSSCPCVIAQN

CAAGGACACCGACAGCGACAGGGAAGCGGGAA




CACCGACAGCGACAGGGAAGCGGGAACCGAA

FCEKFCQCSSECQNR

CCGAAACCGGAGGAGAAAACAACGACAAGGAG




ACCGGAGGAGAAAACAACGACAAGGAGGAG

FPGCRCKAQCNTKQC

GAGGAAGAAAAGAAGGACGAGACAAGCAGCAG




GAAGAAAAGAAGGACGAGACAAGCAGCAGC

PCYLAVRECDPDLCL

CAGCGAAGCCAACAGCAGAUGCCAAACCCCGAU




AGCGAAGCCAACAGCAGATGCCAAACCCCGA

TCGAADHWDSKNVSC

CAAGAUGAAGCCGAACAUCGAGCCGCCGGAGA




TCAAGATGAAGCCGAACATCGAGCCGCCGGA

KNCSIQRGSKKHLLL

ACGUGGAAUGGAGCGGAGCCGAAGCGAGCAU




GAACGTGGAATGGAGCGGAGCCGAAGCGAG

APSDVAGWGIFIKDP

GUUCCGGGUGCUGAUCGGCACCUACUACGACA




CATGTTCCGGGTGCTGATCGGCACCTACTACG

VQKNEFISEYCGEII

ACUUCUGCGCCAUCGCACGCCUGAUCGGAACC




ACAACTTCTGCGCCATCGCACGCCTGATCGGA

SQDEADRRGKVYDKY

AAGACGUGCCGCCAGGUCUACGAGUUCCGCGU




ACCAAGACGTGCCGCCAGGTCTACGAGTTCCG

MCSFLFNLNNDFVVD

CAAGGAGAGCAGCAUCAUCGCACCAGCACCAGC




CGTCAAGGAGAGCAGCATCATCGCACCAGCA

ATRKGNKIRFANHSV

CGAGGACGUCGACACCCCACCACGGAAGAAGA




CCAGCCGAGGACGTCGACACCCCACCACGGA

NPNCYAKVMMVNGDH

AGCGGAAACACAGACUCUGGGCCGCACACUGC




AGAAGAAGCGGAAACACAGACTCTGGGCCGC

RIGIFAKRAIQTGEE

AGAAAGAUCCAGCUGAAGAAGGACGGAAGCAG




ACACTGCAGAAAGATCCAGCTGAAGAAGGAC

LFFDYRYSQADALKY

CAACCACGUGUACAACUACCAACCAUGCGACCA




GGAAGCAGCAACCACGTGTACAACTACCAACC

VGIEREMEIP

CCCGAGACAACCCUGCGACAGCAGCUGCCCCUG




ATGCGACCACCCGAGACAACCCTGCGACAGCA



CGUGAUCGCCCAGAACUUCUGCGAAAAGUUCU




GCTGCCCCTGCGTGATCGCCCAGAACTTCTGC



GCCAGUGCAGCAGCGAGUGCCAGAACAGGUUC




GAAAAGTTCTGCCAGTGCAGCAGCGAGTGCC



CCAGGAUGCCGCUGCAAGGCCCAGUGCAACAC




AGAACAGGTTCCCAGGATGCCGCTGCAAGGC



CAAGCAAUGCCCAUGCUACCUCGCCGUGAGGG




CCAGTGCAACACCAAGCAATGCCCATGCTACC



AGUGCGACCCGGACCUGUGCCUCACAUGCGGA




TCGCCGTGAGGGAGTGCGACCCGGACCTGTG



GCAGCGGACCACUGGGACAGCAAGAACGUCAG




CCTCACATGCGGAGCAGCGGACCACTGGGAC



CUGCAAGAACUGCAGCAUCCAGAGAGGAAGCA




AGCAAGAACGTCAGCTGCAAGAACTGCAGCA



AGAAGCACCUCCUGCUGGCGCCAAGCGACGUG




TCCAGAGAGGAAGCAAGAAGCACCTCCTGCT



GCCGGAUGGGGAAUCUUCAUCAAGGACCCAGU




GGCGCCAAGCGACGTGGCCGGATGGGGAATC



CCAAAAGAACGAAUUCAUCAGCGAAUACUGCG




TTCATCAAGGACCCAGTCCAAAAGAACGAATT



GAGAAAUCAUCAGCCAGGACGAAGCCGACCGC




CATCAGCGAATACTGCGGAGAAATCATCAGCC



AGAGGGAAGGUGUACGACAAGUACAUGUGCA




AGGACGAAGCCGACCGCAGAGGGAAGGTGT



GCUUCCUCUUCAACCUGAACAACGACUUCGUA




ACGACAAGTACATGTGCAGCTTCCTCTTCAACC



GUGGACGCCACCAGAAAGGGCAACAAGAUCCG




TGAACAACGACTTCGTAGTGGACGCCACCAGA



CUUCGCCAACCACAGCGUGAACCCGAACUGCU




AAGGGCAACAAGATCCGCTTCGCCAACCACAG



ACGCGAAGGUCAUGAUGGUGAACGGCGACCAC




CGTGAACCCGAACTGCTACGCGAAGGTCATGA



CGGAUCGGGAUCUUCGCCAAGCGGGCCAUCCA




TGGTGAACGGCGACCACCGGATCGGGATCTTC



AACCGGAGAGGAGCUGUUCUUCGACUACCGG




GCCAAGCGGGCCATCCAAACCGGAGAGGAGC



UACAGCCAAGCGGACGCCCUGAAAUACGUGGG




TGTTCTTCGACTACCGGTACAGCCAAGCGGAC



CAUCGAGCGGGAGAUGGAGAUCCCA




GCCCTGAAATACGTGGGCATCGAGCGGGAGA








TGGAGATCCCA










MQ1
AGCAAGGTGGAGAACAAGACCAAGAAGCTGC
 75
SKVENKTKKLRVFEA
 79
AGCAAGGUGGAGAACAAGACCAAGAAGCUGCG
83


(P15840.3)
GGGTGTTCGAGGCCTTCGCCGGCATCGGCGCC

FAGIGAQRKALEKVR

GGUGUUCGAGGCCUUCGCCGGCAUCGGCGCCC




CAGCGGAAGGCCCTGGAGAAGGTGCGGAAG

KDEYEIVGLAEWYVP

AGCGGAAGGCCCUGGAGAAGGUGCGGAAGGA




GACGAGTACGAGATCGTGGGCCTGGCCGAGT

AIVMYQAIHNNFHTK

CGAGUACGAGAUCGUGGGCCUGGCCGAGUGG




GGTACGTGCCCGCCATCGTGATGTACCAGGCC

LEYKSVSREEMIDYL

UACGUGCCCGCCAUCGUGAUGUACCAGGCCAU




ATCCACAACAACTTCCACACCAAGCTGGAGTA

ENKTLSWNSKNPVSN

CCACAACAACUUCCACACCAAGCUGGAGUACAA




CAAGAGCGTGAGCCGGGAGGAGATGATCGAC

GYWKRKKDDELKIIY

GAGCGUGAGCCGGGAGGAGAUGAUCGACUAC




TACCTGGAGAACAAGACCCTGAGCTGGAACA

NAIKLSEKEGNIFDI

CUGGAGAACAAGACCCUGAGCUGGAACAGCAA




GCAAGAACCCCGTGAGCAACGGCTACTGGAA

RDLYKRTLKNIDLLT

GAACCCCGUGAGCAACGGCUACUGGAAGCGGA




GCGGAAGAAGGACGACGAGCTGAAGATCATC

YSFPCQDLSQQGIQK

AGAAGGACGACGAGCUGAAGAUCAUCUACAAC




TACAACGCCATCAAGCTGAGCGAGAAGGAGG

GMKRGSGTRSGLLWE

GCCAUCAAGCUGAGCGAGAAGGAGGGCAACAU




GCAACATCTTCGACATCCGGGACCTGTACAAG

IERALDSTEKNDLPK

CUUCGACAUCCGGGACCUGUACAAGCGGACCC




CGGACCCTGAAGAACATCGACCTGCTGACCTA

YLLMENVGALLHKKN

UGAAGAACAUCGACCUGCUGACCUACAGCUUC




CAGCTTCCCCTGCCAGGACCTGAGCCAGCAGG

EEELNQWKQKLESLG

CCCUGCCAGGACCUGAGCCAGCAGGGCAUCCA




GCATCCAGAAGGGCATGAAGCGGGGCAGCG

YQNSIEVLNAADFGS

GAAGGGCAUGAAGCGGGGCAGCGGCACCCGGA




GCACCCGGAGCGGCCTGCTGTGGGAGATCGA

SQARRRVFMISTLNE

GCGGCCUGCUGUGGGAGAUCGAGCGGGCCCU




GCGGGCCCTGGACAGCACCGAGAAGAACGAC

FVELPKGDKKPKSIK

GGACAGCACCGAGAAGAACGACCUGCCCAAGU




CTGCCCAAGTACCTGCTGATGGAGAACGTGG

KVLNKIVSEKDILNN

ACCUGCUGAUGGAGAACGUGGGCGCCCUGCU




GCGCCCTGCTGCACAAGAAGAACGAGGAGGA

LLKYNLTEFKKTKSN

GCACAAGAAGAACGAGGAGGAGCUGAACCAGU




GCTGAACCAGTGGAAGCAGAAGCTGGAGAGC

INKASLIGYSKFNSE

GGAAGCAGAAGCUGGAGAGCCUGGGCUACCAG




CTGGGCTACCAGAACAGCATCGAGGTGCTGA

GYVYDPEFTGPTLTA

AACAGCAUCGAGGUGCUGAACGCCGCCGACUU




ACGCCGCCGACTTCGGCAGCAGCCAGGCCCG

SGANSRIKIKDGSNI

CGGCAGCAGCCAGGCCCGGCGGCGGGUGUUCA




GCGGCGGGTGTTCATGATCAGCACCCTGAACG

RKMNSDETFLYIGFD

UGAUCAGCACCCUGAACGAGUUCGUGGAGCU




AGTTCGTGGAGCTGCCCAAGGGCGACAAGAA

SQDGKRVNEIEFLTE

GCCCAAGGGCGACAAGAAGCCCAAGAGCAUCA




GCCCAAGAGCATCAAGAAGGTGCTGAACAAG

NQKIFVCGNSISVEV

AGAAGGUGCUGAACAAGAUCGUGAGCGAGAA




ATCGTGAGCGAGAAGGACATCCTGAACAACCT

LEAIIDKIGG

GGACAUCCUGAACAACCUGCUGAAGUACAACC




GCTGAAGTACAACCTGACCGAGTTCAAGAAAA



UGACCGAGUUCAAGAAAACCAAGAGCAACAUC




CCAAGAGCAACATCAACAAGGCCAGCCTGATC



AACAAGGCCAGCCUGAUCGGCUACAGCAAGUU




GGCTACAGCAAGTTCAACAGCGAGGGCTACG



CAACAGCGAGGGCUACGUGUACGACCCCGAGU




TGTACGACCCCGAGTTCACCGGCCCCACCCTG



UCACCGGCCCCACCCUGACCGCCAGCGGCGCCA




ACCGCCAGCGGCGCCAACAGCCGGATCAAGA



ACAGCCGGAUCAAGAUCAAGGACGGCAGCAAC




TCAAGGACGGCAGCAACATCCGGAAGATGAA



AUCCGGAAGAUGAACAGCGACGAGACCUUCCU




CAGCGACGAGACCTTCCTGTACATCGGCTTCG



GUACAUCGGCUUCGACAGCCAGGACGGCAAGC




ACAGCCAGGACGGCAAGCGGGTGAACGAGAT



GGGUGAACGAGAUCGAGUUCCUGACCGAGAAC




CGAGTTCCTGACCGAGAACCAGAAGATCTTCG



CAGAAGAUCUUCGUGUGCGGCAACAGCAUCAG




TGTGCGGCAACAGCATCAGCGTGGAGGTGCT



CGUGGAGGUGCUGGAGGCCAUCAUCGACAAG




GGAGGCCATCATCGACAAGATCGGCGGC



AUCGGCGGC






KRAB
GACGCCAAGAGCCTGACCGCCTGGAGCCGGA
302
DAKSLTAWSRTLVTF
297
GACGCCAAGAGCCUGACCGCCUGGAGCCGGAC
298



CCCTGGTGACCTTCAAGGACGTGTTCGTGGAC

KDVFVDFTREEWKLL

CCUGGUGACCUUCAAGGACGUGUUCGUGGAC




TTCACCCGGGAGGAGTGGAAGCTGCTGGACA

DTAQQILYRNVMLEN

UUCACCCGGGAGGAGUGGAAGCUGCUGGACAC




CCGCCCAGCAGATCCTGTACCGGAACGTGATG

YKNLVSLGYQLTKPD

CGCCCAGCAGAUCCUGUACCGGAACGUGAUGC




CTGGAGAACTACAAGAACCTGGTGAGCCTGG

VILRLEKGEEPWLVE

UGGAGAACUACAAGAACCUGGUGAGCCUGGGC




GCTACCAGCTGACCAAGCCCGACGTGATCCTG

ERIHQETHPDSETAF

UACCAGCUGACCAAGCCCGACGUGAUCCUGCG




CGGCTGGAGAAGGGCGAGGAGCCCTGGCTG

EIKSSV

GCUGGAGAAGGGCGAGGAGCCCUGGCUGGUG




GTGGAGCGGGAGATCCACCAGGAAACCCACC



GAGCGGGAGAUCCACCAGGAGACCCACCCCGAC




CCGACAGCGAAACCGCCTTCGAGATCAAGAG



AGCGAGACCGCCUUCGAGAUCAAGAGCAGCGU




CAGCGTG



G









III. Delivery of a Site-Specific SFRP1 Disrupting Agent of the Invention and Compositions Comprising a Site-Specific an SFRP1 Disrupting Agents of the Invention

The delivery of the disrupting agents of the invention to a cell e.g., a cell within a subject, such as a human subject (e.g., a subject in need thereof, such as a subject having an SFRP1-associated disorder, e.g., alopecia) may be achieved in a number of different ways. For example, delivery may be performed by contacting a cell with a disrupting agent of the invention either in vitro, ex vivo, or in vivo. In vivo delivery may be performed directly by administering a composition, such as a lipid composition, comprising a disrupting agent to a subject. Alternatively, in vivo delivery may be performed indirectly by administering one or more vectors that encode and direct the expression of the disrupting agent in a cell of a subject. These alternatives are discussed further below. In vitro introduction into a cell includes methods known in the art such as electroporation and lipofection. Further approaches are described herein below and/or are known in the art.


In some embodiments, the disrupting agent comprises a nucleic acid molecule encoding a fusion protein, the fusion protein comprising a site-specific SFRP1 targeting moiety, such as a polynucleotide encoding a DNA-binding domain of a Transcription activator-like effector (TALE) polypeptide or a zinc finger (ZNF) polypeptide, or fragment thereof, that specifically targets and binds to the SFRP1 expression control region and an effector molecule, such as a MQ1.


In other embodiments, the disrupting agent comprises a guide RNA and an mRNA encoding an effector molecule. The ratio of guide RNA to mRNA may be about 100:1 to about 1:100 (wt:wt).


In general, any method of delivery of a site-specific SFRP1 disrupting agent of the invention (in vitro, ex vivo, or in vivo) may be adapted for use with the disrupting agents of the invention (see e.g., Akhtar S. and Julian R L., (1992) Trends Cell. Biol. 2(5): 139-144 and WO94/02595, which are incorporated herein by reference in their entireties). For in vivo delivery, factors to be considered for delivering a site-specific SFRP1 disrupting agent of the invention include, for example, biological stability of the disrupting agent, prevention of non-specific effects, and accumulation of the disrupting agent in the target tissue. The non-specific effects of a disrupting agent can be minimized by local administration, for example, by direct injection or implantation into a tissue or topically administering a composition comprising the disrupting agent. Local administration to a treatment site maximizes local concentration of the disrupting agent, limits the exposure of the disrupting agent to systemic tissues that can otherwise be harmed by the disrupting agent or that can degrade the disrupting agent, and permits a lower total dose of the disrupting agent to be administered.


For administering a site-specific SFRP1 disrupting agent systemically for the treatment of a disease, such as an SFRP1-associate disease, the disrupting agent, e.g., a disrupting agent comprising a site-specific targeting moiety comprising a nucleic acid molecule, can be modified or alternatively delivered using a drug delivery system; both methods act to prevent the rapid degradation of a site-specific targeting moiety comprising a nucleic acid molecule by endo- and exo-nucleases in vivo. Modification of a disrupting agent comprising a site-specific targeting moiety comprising a nucleic acid molecule or a pharmaceutical carrier also permits targeting of the disrupting agent to a target tissue and avoidance of undesirable off-target effects. For example, a disrupting agent of the invention may be modified by chemical conjugation to lipophilic groups such as cholesterol to enhance cellular uptake and prevent degradation.


Alternatively, a disrupting agent of the invention may be delivered using a drug delivery system such as a nanoparticle, a dendrimer, a polymer, a liposome, or a cationic delivery system. Positively charged cationic delivery systems facilitate binding of disrupting agent (e.g., negatively charged molecule) and also enhance interactions at the negatively charged cell membrane to permit efficient uptake of a disrupting agent by the cell. Cationic lipids, dendrimers, or polymers can either be bound to a disrupting agent, or induced to form a vesicle or micelle (see e.g., Kim S H. et al., (2008) Journal of Controlled Release 129(2): 107-116) that encases the disrupting agent. The formation of vesicles or micelles further prevents degradation of the disrupting agent when administered systemically. Methods for making and administering cationic complexes are well within the abilities of one skilled in the art (see e.g., Sorensen, D R., et al. (2003) J. Mol. Biol 327:761-766; Verma, U N. et al., (2003) Clin. Cancer Res. 9:1291-1300; Arnold, A S et al. (2007) J. Hypertens. 25:197-205, which are incorporated herein by reference in their entirety). Some non-limiting examples of drug delivery systems useful for systemic delivery of a disrupting agent of the invention include DOTAP (Sorensen, D R., et al (2003), supra; Verma, U N. et al., (2003), supra), Oligofectamine, “solid nucleic acid lipid particles” (Zimmermann, T S. et al., (2006) Nature 441:111-114), cardiolipin (Chien, P Y. et al., (2005) Cancer Gene Ther. 12:321-328; Pal, A. et al., (2005) Int J. Oncol. 26:1087-1091), polyethyleneimine (Bonnet M E. et al., (2008) Pharm. Res. August 16 Epub ahead of print; Aigner, A. (2006) J. Biomed. Biotechnol. 71659), Arg-Gly-Asp (RGD) peptides (Liu, S. (2006) Mol. Pharm. 3:472-487), and polyamidoamines (Tomalia, D A. et al., (2007) Biochem. Soc. Trans. 35:61-67; Yoo, H. et al., (1999) Pharm. Res. 16:1799-1804). In some embodiments, a disrupting agent (e.g., gRNA, or mRNA) forms a complex with cyclodextrin for systemic administration. Methods for administration and pharmaceutical compositions comprising cyclodextrins may be found in U.S. Pat. No. 7,427,605, the entire contents of which are incorporated herein by reference.


The disrupting agents of the invention may be incorporated into pharmaceutical compositions suitable for administration. Such compositions typically include one or more species of disrupting agent and a pharmaceutically acceptable carrier. As used herein the language “pharmaceutically acceptable carrier” is intended to include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration. The use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active compound, use thereof in the compositions is contemplated. Supplementary active compounds can also be incorporated into the compositions.


The pharmaceutical compositions of the present invention may be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration may be topical (including ophthalmic, vaginal, rectal, intranasal, transdermal), oral, or parenteral. Parenteral administration includes intravenous drip, subcutaneous, intraperitoneal or intramuscular injection, or intrathecal or intraventricular administration.


The route and site of administration may be chosen to enhance delivery or targeting of the disrupting agent comprising a site-specific targeting moiety to a particular location. For example, to target hair follicle cells, topical administration or subcutaneous injection, etc., may be used.


Formulations for topical administration may include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids, and powders. Conventional pharmaceutical carriers, aqueous, powder or oily bases, thickeners and the like may be necessary or desirable. Coated condoms, gloves and the like may also be useful.


Compositions for oral administration include powders or granules, suspensions or solutions in water, syrups, elixirs or non-aqueous media, tablets, capsules, lozenges, or troches. In the case of tablets, carriers that can be used include lactose, sodium citrate and salts of phosphoric acid. Various disintegrants such as starch, and lubricating agents such as magnesium stearate, sodium lauryl sulfate and talc, are commonly used in tablets. For oral administration in capsule form, useful diluents are lactose and high molecular weight polyethylene glycols. When aqueous suspensions are required for oral use, the nucleic acid compositions can be combined with emulsifying and suspending agents. If desired, certain sweetening or flavoring agents can be added.


Compositions for intravenous administration may include sterile aqueous solutions which may also contain buffers, diluents, and other suitable additives.


Formulations for parenteral administration may include sterile aqueous solutions which may also contain buffers, diluents, and other suitable additives. For intravenous use, the total concentration of solutes may be controlled to render the preparation isotonic.


In one embodiment, the administration of a disrupting agent composition of the invention is parenteral, e.g., intravenous (e.g., as a bolus or as a diffusible infusion), intradermal, intraperitoneal, intramuscular, intrathecal, intraventricular, intracranial, subcutaneous, transmucosal, buccal, sublingual, endoscopic, rectal, oral, vaginal, topical, pulmonary, intranasal, urethral, or ocular. Administration can be provided by the subject or by another person, e.g., a health care provider. The composition may be provided in measured doses or in a dispenser which delivers a metered dose. Selected modes of delivery are discussed in more detail below.


In certain embodiments, the disrupting agents of the invention are polynucleotides, such as mRNAs, and are formulated in lipid nanoparticles (LNPs).


A. Compositions Comprising a Site-Specific SFRP1 Disrupting Agent of the Invention

The site-specific SFRP1 disrupting agents of the invention may be formulated into compositions, such as pharmaceutical compositions, using one or more excipients to: (1) increase stability; (2) increase cell transfection; (3) permit sustained or delayed release (e.g., from a depot formulation); (4) alter the biodistribution (e.g., target the disrupting agent to specific tissues or cell types); (5) increase the translation of an encoded protein in vivo; and/or (6) alter the release profile of an encoded protein in vivo. In addition to traditional excipients, such as any and all solvents, dispersion media, diluents, or other liquid vehicles, dispersion or suspension aids, surface active agents, isotonic agents, thickening or emulsifying agents, preservatives, excipients for use in the compositions of the invention may include, without limitation, lipidoids, liposomes, lipid nanoparticles, polymers, lipoplexes, core-shell nanoparticles, peptides, proteins, cells transfected with nucleic acid molecules, modified nucleic acid molecules, or RNA (e.g., for transplantation into a subject), hyaluronidase, nanoparticle mimics and combinations thereof. Accordingly, the pharmaceutical compositions of the invention can include one or more excipients, each in an amount that together increases the stability of the disrupting agent, increases cell transfection by the disrupting agent, increases the expression of modified nucleic acid, or mRNA encoded protein, and/or alters the release profile of a disrupting agent. Further, the disrupting agents of the present invention may be formulated using self-assembled nucleic acid nanoparticles (see, e.g., U.S. Patent Publication No. 2016/0038612A1, which is incorporated herein by reference in its entirety).


i. Lipidoid


The synthesis of lipidoids has been extensively described and formulations containing these compounds are particularly suited for delivery of a disrupting agent of the invention, such as a disrupting agent comprising a site-specific SFRP1 targeting moiety comprising a nucleic acid molecule, e.g., comprising modified nucleic acid molecules or mRNA (see Mahon et al., Bioconjug Chem. 2010 21:1448-1454; Schroeder et al., J Intern Med. 2010 267:9-21; Akinc et al., Nat Biotechnol. 2008 26:561-569; Love et al., Proc Natl Acad Sci USA. 201 0 107: 1864-1869; Siegwart et al., Proc Natl Acad Sci USA. 2011108:12996-3001; the contents of all of which are incorporated herein in their entireties).


For example, lipidoids have been used to effectively deliver double stranded small interfering RNA molecules, single stranded nucleic acid molecules, modified nucleic acid molecules or modified mRNA. (See, e.g., US Patent Publication 2016/0038612A1). Complexes, micelles, liposomes or particles can be prepared containing these lipidoids and, therefore, provide effective delivery of a site-specific SFRP1 targeting moiety comprising a nucleic acid molecule, as judged by the production of an encoded protein, following the administration of a lipidoid formulation, e.g., via localized and/or systemic administration. Lipidoid complexes of can be administered by various means including, but not limited to, intravenous, intramuscular, intradermal, intraperitoneal or subcutaneous routes.


In vivo delivery of a site-specific SFRP1 targeting moiety comprising, e.g., a nucleic acid molecule, may be affected by many parameters, including, but not limited to, the formulation composition, nature of particle PEGylation, degree of loading, polynucleotide to lipid ratio, and biophysical parameters such as, but not limited to, particle size (Akinc et al., Mol Ther. 2009 17:872-879; herein incorporated by reference in its entirety). As an example, small changes in the anchor chain length of poly(ethylene glycol) (PEG) lipids may result in significant effects on in vivo efficacy. Formulations with different lipidoids, including, but not limited to penta[3-(1-laury laminopropiony I)]-triethy lenetetramine hydrochloride (TETA-5LAP; aka 98NI2-5, see Murugaiah et al., Analytical Biochemistry, 401:61 (2010); the contents of which are herein incorporated by reference in their entirety), C12-200 (including derivatives and variants), and MDI, may be used.


In one embodiment, a disrupting agent comprising a site-specific SFRP1 targeting moiety comprising, e.g., a nucleic acid molecule, is formulated with a lipidoid for systemic intravenous administration to target cells of the hair follicle. For example, a final optimized intravenous formulation comprising a disrupting agent comprising a site-specific SFRP1 targeting moiety comprising a nucleic acid molecule, and a lipid molar composition of 42% 98NI2-5, 48% cholesterol, and 10% PEG-lipid with a final weight ratio of about 7.5 to 1 total lipid to nucleic acid molecule, and a C14 alkyl chain length on the PEG lipid, with a mean particle size of roughly 50-60 nm, can result in the distribution of the formulation to be greater than 90% to the dermal papilla cells, inner root sheath cells, outer root sheath cells, and/or germinal matrix cells. In another example, an intravenous formulation using a C12-200 lipidoid (see, e.g., PCT Publication No. WO 2010/129709, which is herein incorporated by reference in its entirety) having a molar ratio of 50/10/38.5/1.5 of C12-200/disteroylphosphatidyl choline/cholesterol/PEG-DMG, with a weight ratio of 7 to 1 total lipid to nucleic acid molecule, and a mean particle size of 80 nm may be used to deliver a disrupting agent comprising a site-specific SFRP1 targeting moiety comprising a nucleic acid molecule, to dermal papilla cells. In another embodiment, an MDI lipidoid-containing formulation may be used to effectively deliver a disrupting agent comprising a site-specific SFRP1 targeting moiety comprising a nucleic acid molecule, to dermal papilla cells in vivo. The characteristics of optimized lipidoid formulations for intramuscular or subcutaneous routes may vary significantly depending on the target cell type and the ability of formulations to diffuse through the extracellular matrix into the blood stream. Lipidoid-formulated nucleic acid molecules may be used to deliver the formulation to several cells types including, but not limited to, dermal papilla cells, inner root sheath cells, outer root sheath cells, and germinal matrix cells. Different ratios of lipidoids and other components including, but not limited to, disteroylphosphatidyl choline, cholesterol and PEG-DMG, may be used to optimize the formulation for delivery to different cell types including, but not limited to, dermal papilla cells, inner root sheath cells, outer root sheath cells, germinal matrix cells, etc. For example, the component molar ratio may include, but is not limited to, 50% CI2-200, 10% disteroylphosphatidyl choline, 38.5% cholesterol, and 1.5% PEG-DMG (see Leuschner et al., Nat Biotechnol 2011 29: 1005-101 0; the contents of which are herein incorporated by reference in its entirety). The use of lipidoid formulations for the localized delivery to cells (such as, but not limited to, adipose cells and muscle cells) via either subcutaneous, intradermal or intramuscular delivery, may not require all of the formulation components desired for systemic delivery and, as such, may comprise only the lipidoid and a disrupting agent comprising a site-specific SFRP1 targeting moiety comprising, e.g., a nucleic acid molecule, as described herein.


Combinations of different lipidoids may be used to improve the efficacy of the formulations by increasing cell transfection and/or increasing the translation of encoded protein contained therein (see Whitehead et al., Mol. Ther. 2011, 19:1688-1694, the contents of which are herein incorporated by reference in their entirety).


In one embodiment, the lipidoid may be prepared from the conjugate addition of alklamines to acrylates. As a non-limiting example, a lipidoid may be prepared by the methods described in PCT Patent Publication No. WO 2014/028487, the contents of which are herein incorporated by reference in its entirety. In one embodiment, the lipidoid may comprise a compound having formula (I), formula (II), formula (III), formula (IV) or formula (V) as described in PCT Patent Publication No. WO 2014/028487, the contents of which are herein incorporated by reference in their entirety. In one embodiment, the lipidoid may be biodegradable.


ii. Liposomes, Lipoplexes, and Lipid Nanoparticles


A disrupting agent of the invention may be formulated using one or more liposomes, lipoplexes, or lipid nanoparticles. In one embodiment, pharmaceutical compositions of the invention include liposomes. Liposomes are artificially-prepared vesicles which are primarily composed of a lipid bilayer and may be used as a delivery vehicle for the administration of nutrients and pharmaceutical formulations. Liposomes may be of different sizes such as, but not limited to, a multilamellar vesicle (MLV) which may be hundreds of nanometers in diameter and may contain a series of concentric bilayers separated by narrow aqueous compartments, a small unicellular vesicle (SUV) which may be smaller than 50 nm in diameter, and a large unilamellar vesicle (LUV) which may be between 50 and 500 nm in diameter. Liposome design may include, but is not limited to, opsonins or ligands in order to improve the attachment of liposomes to unhealthy tissue or to activate events such as, but not limited to, endocytosis. Liposomes may contain a low or a high pH in order to improve the delivery of the pharmaceutical formulations. The formation of liposomes may depend on the physicochemical characteristics such as, but not limited to, the pharmaceutical formulation entrapped and the liposomal ingredients, the nature of the medium in which the lipid vesicles are dispersed, the effective concentration of the entrapped substance and its potential toxicity, any additional processes involved during the application and/or delivery of the vesicles, the optimization size, polydispersity and the shelf-life of the vesicles for the intended application, and the batch-to-batch reproducibility and possibility of large-scale production of safe and efficient liposomal products.


As a non-limiting example, liposomes, such as synthetic membrane vesicles, may be prepared by the methods, apparatus and devices described in U.S. Patent Publication Nos. 2013/0177638, 2013/0177637, 2013/0177636, 201/30177635, 2013/0177634, 2013/0177633, 2013/0183375, 2013/0183373, 2013/0183372 and 2016/0038612) and PCT Patent Publication No WO 2008/042973, the contents of each of which are herein incorporated by reference in their entirety.


In one embodiment, a pharmaceutical composition described herein may include, without limitation, liposomes such as those formed from 1,2-dioleyloxy-N,N-dimethyl ami-nopropane (DODMA) liposomes, DiLa2 liposomes from Marina Biotech (Bothell, Wash.), 1,2-dilinoleyloxy-3-dimethylaminopropane (DLin-DMA), 2,2-dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]-dioxolane (DLin-KC2-DMA), and MC3 (US20100324120; herein incorporated by reference in its entirety) and liposomes which may deliver small molecule drugs such as, but not limited to, DOXIL® from Janssen Biotech, Inc. (Horsham, Pa.). In one embodiment, a pharmaceutical composition described herein may include, without limitation, liposomes such as those formed from the synthesis of stabilized plasmid-lipid particles (SPLP) or stabilized nucleic acid lipid particle (SNALP) that have been previously described and shown to be suitable for oligonucleotide delivery in vitro and in vivo (see Wheeler et al. Gene Therapy. 1999 6:271-281; Zhang et al. Gene Therapy. 19996:1438-1447; Jeffs et al. Pharm Res. 2005 22:362-372; Morrissey et al., Nat Biotechnol. 2005 2:1002-1007; Zimmermann et al., Nature. 2006 441:111-114; Heyes et al. J Contr Rel. 2005 107:276-287; Semple et al. Nature Biotech. 2010 28:172-176; Judge et al. J Clin Invest. 2009 119:661-673; deFougerolles Hum Gene Ther. 2008 19:125-132; U.S. Patent Publication Nos 2013/0122104, 2013/0303587, and 2016/0038612; the contents of each of which are incorporated herein in their entireties). The original manufacturing method of Wheeler et al. was a detergent dialysis method, which was later improved by Jeffs et al. and is referred to as the spontaneous vesicle formation method. The liposome formulations of the invention may be composed of 3 to 4 lipid components in addition a disrupting agent comprising a site-specific SFRP1 targeting moiety. As an example a liposome of the invention can contain, but is not limited to, 55% cholesterol, 20% disteroylphosphatidyl choline (DSPC), 10% PEG-SDSG, and 15% 1,2-dioleyloxy-N,N-dimethylaminopropane (DODMA), as described by Jeffs et al. As another example, liposome formulations of the invention may contain, but are not limited to, 48% cholesterol, 20% DSPC, 2% PEG-c-DMA, and 30% cationic lipid, where the cationic lipid can be 1,2-distearloxy-N,N-dimethylaminopropane (DSDMA), DODMA, DLin-DMA, or 1,2-dilinolenyloxy-3-dimethy laminopropane (DLenDMA), as described by Heyes et al. In some embodiments, liposome formulations may comprise from about 25.0% cholesterol to about 40.0% cholesterol, from about 30.0% cholesterol to about 45.0% cholesterol, from about 35.0% cholesterol to about 50.0% cholesterol and/or from about 48.5% cholesterol to about 60% cholesterol. In another embodiment, formulations of the invention may comprise a percentage of cholesterol selected from the group consisting of 28.5%, 31.5%, 33.5%, 36.5%, 37.0%, 38.5%, 39.0% and 43.5%. In some embodiments, liposome formulations of the invention may comprise from about 5.0% to about 10.0% DSPC and/or from about 7.0% to about 15.0% DSPC.


In one embodiment, a pharmaceutical composition may include liposomes which may be formed to deliver a disrupting agent of the invention. The disrupting agent comprising a site-specific SFRP1 targeting moiety comprising may be encapsulated by the liposome and/or it may be contained in an aqueous core which may then be encapsulated by the liposome (see, e.g., PCT Patent Publication Nos. WO 2012/031046, WO 2012/031043, WO 2012/030901 and WO 2012/006378 and U.S. Patent Publication Nos. 2013/0189351, 2013/0195969 and 201/30202684, the contents of each of which are herein incorporated by reference in their entirety).


In another embodiment, liposomes for use in the present invention may be formulated for targeted delivery. As a non-limiting example, the liposome may be formulated for targeted delivery to the dermal papilla cells, etc. Such a liposome may include, but is not limited to, a liposome described in U.S. Patent Publication No. 2013/0195967, the contents of which are herein incorporated by reference in its entirety.


In one embodiment, formulations comprising liposomes and a disrupting agent may be administered topically, subcutaneously, intramuscularly, intradermally, or intravenously.


In another embodiment, a lipid formulation of the invention may include at least one cationic lipid, a lipid which enhances transfection and a least one lipid which contains a hydrophilic head group linked to a lipid moiety (International Pub. No. WO2011076807 and U.S. Pub. No. 20110200582; the entire contents of each of which is herein incorporated by reference in their entirety). In another embodiment, a lipid formulation of the invention is a lipid vesicle which may have crosslinks between functionalized lipid bilayers (see U.S. Patent Publication No. 2012/0177724, the contents of which are herein incorporated by reference in their entirety).


In one embodiment, a formulation comprising a disrupting agent is a lipid nanoparticle (LNP) which may comprise at least one lipid. The lipid may be selected from, but is not limited to, DLin-DMA, DLin-K-DMA, 98NI2-5, CI2-200, DLin-MC3-DMA, DLin-KC2-DMA, DODMA, PLGA, PEG, PEG-DMG, PEGylated lipids and amino alcohol lipids. In another aspect, the lipid may be a cationic lipid such as, but not limited to, DLin-DMA, DLin-D-DMA, DLin-MC3-DMA, DLin-KC2-DMA, DODMA and amino alcohol lipids. The amino alcohol cationic lipid may be the lipids described in and/or made by the methods described in U.S. Patent Publication No. 2013/0150625.


In one embodiment, the cationic lipid may be selected from, but not limited to, a cationic lipid described in PCT Publication Nos. WO 2012/040184, WO 2011/153120, WO 2011/149733, WO 2011/090965, WO 2011/043913, WO 2011/022460, WO 2012/061259, WO 2012/054365, WO 2012/044638, WO 2010/080724, WO 2010/21865, WO 2008/103276, WO 2013/086373 and WO 2013/086354, U.S. Pat. Nos. 7,893,302, 7,404,969, 8,283, 333, 8,466,122 and 8,569,256, and U.S. Patent Publication Nos. 2010/0036115, 2012/0202871, 2013/0064894, 2013/0129785, 2013/0150625, 2013/0178541, 2013/0225836 and 2014/0039032; the contents of each of which are herein incorporated by reference in their entirety. In another embodiment, the cationic lipid may be selected from, but not limited to, formula A described in PCT Publication Nos. WO 2012/040184, WO 0111/53120, WO 2011/149733, WO 2011/090965, WO 2011/043913, WO 2011/022460, WO 2012/061259, WO 2012/054365, WO 2012/044638 and WO 2013/116126 or U.S. Patent Publication Nos. 2013/0178541 and 2013/0225836; the contents of each of which is herein incorporated by reference in their entirety. In yet another embodiment, the cationic lipid may be selected from, but not limited to, formula CLI-CLXXIX of PCT Publication No. WO 2008/103276, formula CLICLXXIX of U.S. Pat. No. 7,893,302, formula CLICLXXXXII of U.S. Pat. No. 7,404,969 and formula I-VI of us Patent Publication No. 2010/0036115, formula I of U.S. Patent Publication No 2013/0123338; each of which is herein incorporated by reference in their entirety.


In one embodiment, the cationic lipid may be synthesized by methods known in the art and/or as described in PCT Publication Nos. WO 2012/040184 WO 2011/153120, WO 2011/149733, WO 2011/090965: WO 2011/043913, WO 2011/022460, WO 2012/061259, WO 2012/054365, WO 2012/044638, WO 2010/080724, WO 2010/21865, WO 2013/126803, WO 2013/086373, and WO 2013/086354; the contents of each of which are herein incorporated by reference in their entirety.


In one embodiment, the lipids which may be used in the formulations and/or for delivery of the disrupting agents described herein may be a cleavable lipid. As a non-limiting example, a cleavable lipid and/or pharmaceutical compositions comprising cleavable lipids include those described in PCT Patent Publication No. WO 2012/170889, the contents of which are herein incorporated by reference in their entirety. As another non-limiting example, the cleavable lipid may be HGT4001, HGT4002, HGT4003, HGT4004 and/or HGT4005 as described in PCT Patent Publication No. WO 2012/170889, the contents of which are herein incorporated by reference in their entirety.


In one embodiment, polymers which may be used in the formulation and/or delivery of the disrupting agents described herein may include, but is not limited to, poly(ethylene) glycol (PEG), polyethylenimine (PEI), dithiobis(succinimidylpropionate) (DSP), Dimethy 1-3,3′-dithiobispropionimidate (DTBP), poly(ethylene imine) biscarbamate (PEIC), poly(L-lysine) (PLL), histidine modified PLL, poly(N-vinylpyrrohdone) (PVP), poly(propylenimine (PPI), poly(amidoamine) (PAMAM), poly(amido ethylenimine) (SS-PAEI), triehtylenetetramine (TETA), poly(ß-aminoester), poly(4-hydroxy-L-proine ester) (PHP), poly(allylamine), poly(α-[4-aminobutyl]-L-glycolic acid (PAGA), Poly(D,L-lactic-coglycolid acid (PLGA), Poly(N-ethyl-4-vinylpyridinium bromide), poly(phosphazene)s (PPZ), poly(phosphoester)s (PPE), poly(phosphoramidate)s (PPA), poly(N-2-hydroxypropylmethacrylamide) (pHPMA), poly(2-(dimethylamino)ethyl methacrylate) (pDMAEMA), poly(2-aminoethyl propylene phosphate) PPE_EA), Chitosan, galactosylated chitosan, N-dodecylated chitosan, histone, collagen and dextran-spermine. In one embodiment, the polymer may be an inert polymer such as, but not limited to, PEG. In one embodiment, the polymer may be a cationic polymer such as, but not limited to, PEI, PLL, TETA, poly(allylamine), Poly(N-ethyl-4-vinylpyridinium bromide), pHPMA and pDMAEMA. In one embodiment, the polymer may be a biodegradable PEI such as, but not limited to, DSP, DTBP and PEIC. In one embodiment, the polymer may be biodegradable such as, but not limited to, histone modified PLL SSPAEI, poly(β-aminoester), PHP, PAGA, PLGA, PPZ, PPE, PPA and PPE-EA.


In one embodiment, an LNP formulation of the invention may be prepared according to the methods described in PCT Publication Nos. WO 2011/127255 or WO 2008/103276, the contents of each of which are herein incorporated by reference in their entirety. As a non-limiting example, a disrupting agent comprising a site-specific SFRP1 targeting moiety may be encapsulated in an LNP formulation as described in PCT Publication Nos. WO 2011/127255 and/or WO 2008/103276; the contents of each of which are herein incorporated by reference in their entirety. As another non-limiting example, a disrupting agent comprising a site-specific SFRP1 targeting moiety as described herein, may be formulated in a nanoparticle to be delivered by a parenteral route as described in U.S. Patent Publication No. 2012/0207845 and PCT Publication No. WO 2014/008334; the contents of each of which are herein incorporated by reference in their entirety.


In one embodiment, LNP formulations described herein may be administered intramusculary. The LNP formulation may comprise a cationic lipid described herein, such as, but not limited to, DLin-DMA, DLin-KC2-DMA, DLin-MC3-DMA, DODMA and C12-200.


In one embodiment, LNP formulations described herein comprising a disrupting agent as described herein, may be administered intradermally. The LNP formulation may comprise a cationic lipid described herein, such as, but not limited to, DLin-DMA, DLin-KC2-DMA, DLin-MC3-DMA, DODMA and C12-200.


The nanoparticle formulations may comprise conjugate, such as a phosphate conjugate, a polymer conjugates, a conjugate that enhances the delivery of nanoparticle as described in US Patent Publication No. US20160038612 A1.


In one embodiment, the lipid nanoparticle formulation comprises DLin-MC3-DMA as described in US Patent Publication No. US20100324120.


In one embodiment, the lipid nanoparticle comprises a lipid compound, or a pharmaceutically acceptable salt, tautomer or stereoisomer thereof, or a lipid nanoparticle formulation, as described in U.S. Pat. No. 10,723,692B2, US Patent Publication Nos. US20200172472A1, US20200163878A1, US20200046838A1, US20190359556A1, US20190314524A1, US20190274968A1, US20190022247A1, US20180303925A1, US20180185516A1, US20160317676A1, International Patent Publication No.: WO20200146805A1, WO2020081938A1, WO2019089828A1, WO2019036030A1, WO2019036028A1, WO2019036008A1, WO 2018200943A1, WO2018191719A1, WO2018107026A1, WO2018081480A1, the contents of each of which are herein incorporated by reference in their entirety (Acuitas Therapeutics, Inc.).


In one embodiment, the lipid nanoparticle comprises an amino lipid, or a pharmaceutically acceptable salt, tautomer or stereoisomer thereof, or a lipid nanoparticle formulation, described by Tekmira Pharmaceuticals Corp. in U.S. Pat. No. 9,139,554B2, U.S. Pat. No. 9,051,567B2, U.S. Pat. No. 8,883,203B2, US Patent Publication US20110117125A1, the contents of each of which are herein incorporated by reference in their entirety. In one particular example, the compound described in U.S. Pat. No. 9,139,554B2 is DLin-kC2-DMA.


In one embodiment, the lipid nanoparticle comprises an amino lipid, or a pharmaceutically acceptable salt, tautomer or stereoisomer thereof, or a lipid nanoparticle formulation, described by Arbutus Biopharma Corp. in U.S. Ser. No. 10/561,732B2, U.S. Pat. No. 9,938,236B2, U.S. Pat. No. 9,687,550B2, US Patent Publication US20190240354A1, US20170027658A1, WO2020097493A1, WO2020097520A1, WO2020097540A1, WO2020097548A1, the contents of each of which are herein incorporated by reference in their entirety.


Lipid nanoparticles may be engineered to alter the surface properties of particles so the lipid nanoparticles may penetrate the mucosal barrier. Mucus is located on mucosal tissue such as, but not limited to, oral (e.g., the buccal and esophageal membranes and tonsil tissue), ophthalmic, gastrointestinal (e.g., stomach, small intestine, large intestine, colon, rectum), nasal, respiratory (e.g., nasal, pharyngeal, tracheal and bronchial membranes), genital (e.g., vaginal, cervical and urethral membranes). Nanoparticles larger than 10-200 nm which are preferred for higher drug encapsulation efficiency and the ability to provide the sustained delivery of a wide array of drugs have been thought to be too large to rapidly diffuse through mucosal barriers. Mucus is continuously secreted, shed, discarded or digested and recycled so most of the trapped particles may be removed from the mucosla tissue within seconds or within a few hours. Large polymeric nanoparticles (200 nm-500 nm in diameter) which have been coated densely with a low molecular weight polyethylene glycol (PEG) diffused through mucus only 4 to 6-fold lower than the same particles diffusing in water (Lai et al. PNAS 2007 104(5): 1482-487; Lai et al. Adv Drug Deliv Rev. 200961(2): 158-171; the contents of each of which are herein incorporated by reference in their entirety). The transport of nanoparticles may be determined using rates of permeation and/or fluorescent microscopy techniques including, but not limited to, fluorescence recovery after photobleaching (FRAP) and high resolution multiple particle tracking (MPT). As a non-limiting example, compositions which can penetrate a mucosal barrier may be made as described in U.S. Pat. No. 8,241,670 or International Patent Publication No. WO2013110028, the contents of each of which are herein incorporated by reference in their entirety.


In one embodiment, a disrupting agent comprising a site-specific SFRP1 targeting moiety as described herein, is formulated as a lipoplex, such as, without limitation, the ATUPLEX™ system, the DACC system, the DBTC system and other siRNAlipoplex technology from Silence Therapeutics (London, United Kingdom), STEMFECFM from STEMGENT® (Cambridge, Mass.), and polyethylenimine (PEI) or protamine-based targeted and non-targeted delivery of nucleic acids (Aleku et al. Cancer Res. 2008 68:9788-9798; Strumberg et al. Int J Clin Pharmacol Ther 2012 50:76-78; Santel et al., Gene Ther 2006 13:1222-1234; Santel et al., Gene Ther 200613:1360-1370; Gutbier et al., PulmPharmacol. Ther. 201023:334-344; Kaufmann et al. Microvasc Res 2010 80:286-293; Weide et al. J Immunother. 2009 32:498-507; Weide et al. J Immnnother. 2008 31:180-188; Pascolo Expert Opin. Biol. Ther. 4:1285-1294; Fotin-Mleczek et al., 2011 J. Immunother. 34: 1-15; Song et al., Nature Biotechnol. 2005, 23:709-717; Peer et al., Proc NatlAcad Sci USA. 2007 6; 104:4095-4100; deFougerolles Hum Gene Ther. 2008 19: 125-132; all of which are incorporated herein by reference in their entirety).


In one embodiment such formulations may also be constructed or compositions altered such that they passively or actively are directed to different cell types in vivo, for example, epithelial cells (Akinc et al. Mol Ther. 2010 18:1357-1364; Song et al., Nat Biotechnol. 2005 23:709-717; Judge et al., J ClinInvest. 2009 119:661-673; Kaufmann et al., Microvasc Res 2010 80:286-293; Santel et al., Gene Ther 200613:1222-1234; Santel et al., Gene Ther 2006 13: 1360-1370; Gutbier et al., Pulm Pharmacol. Ther. 2010 23:334-344; Basha et al., Mol. Ther. 2011 19:2186-2200; Fenske and Cullis, Expert Opin Drug Deliv. 20085:25-44; Peer et al., Science. 2008 319:627-630; Peer and Lieberman, Gene Ther. 2011 18: 1127-1133; all of which are incorporated herein by reference in its entirety). Formulations can also be selectively targeted through expression of different ligands on their surface as exemplified by, but not limited by, folate, transferrin, N-acetylgalactosamine (GaINAc), and antibody targeted approaches (Kolhatkar et al., Curr Drug Discov Technol. 2011 8: 197-206; Musacchio and Torchilin, Front Biosci. 201116: 1388-1412; Yu et al., Mol Membr Biol. 2010 27:286-298; Patil et al., Crit Rev Ther Drug Carrier Syst. 2008 25: 1-61; Benoit et al., Biomacromolecules. 2011 12:2708-2714; Zhao et al., Expert Opin Drug Deliv. 2008 5:309-319; Akinc et al., Mol Ther. 2010 18:1357-1364; Srinivasan et al., Methods Mol Biol. 2012 820: 105-116; Ben-Arie et al., Methods Mol Biol. 2012 757:497-507; Peer 2010 J Control Release. 20:63-68; Peer et al., Proc Natl Acad Sci USA. 2007 104:4095-4100; Kim et al., Methods Mol Biol. 2011 721:339-353; Subramanya et al., Mol Ther. 2010 18:2028-2037; Song et al., Nat Biotechnol. 2005 23:709-717; Peer et al., Science. 2008 319:627-630; Peer and Lieberman, Gene Ther. 2011 18:1127-1133; the contents of all of which are incorporated herein by reference in its entirety).


In one embodiment, a disrupting agent comprising a site-specific SFRP1 targeting moiety of the invention, may be formulated as a solid lipid nanoparticle. A solid lipid nanoparticle (SLN) may be spherical with an average diameter between 10 to 1000 nm. SLN possess a solid lipid core matrix that can solubilize lipophilic molecules and may be stabilized with surfactants and/or emulsifiers. In a further embodiment, the lipid nanoparticle may be a self-assembly lipid-polymer nanoparticle (see Zhang et al., ACS Nano, 2008, 2 (8), pp 1696-1702; herein incorporated by reference in its entirety). As a non-limiting example, the SLN may be the SLN described in PCT Publication No. WO2013/105101, the contents of which are herein incorporated by reference in their entirety. As another non-limiting example, the SLN may be made by the methods or processes described in PCT Publication No. WO 2013/105101, the contents of which are herein incorporated by reference in their entirety.


Liposomes, lipoplexes, or lipid nanoparticles may be used to improve the efficacy of a disrupting agent comprising a site-specific SFRP1 targeting moiety comprising, e.g., a nucleic acid molecule, to direct protein production as these formulations may be able to increase cell transfection by a nucleic acid molecule; and/or increase the translation of encoded protein (e.g., an effector of the invention). One such example involves the use of lipid encapsulation to enable the effective systemic delivery of polyplex plasmid DNA (Heyes et al., Mol Ther. 2007 15:713-720; the contents of which are herein incorporated by reference in its entirety). The liposomes, lipoplexes, or lipid nanoparticles of the invention may also increase the stability of a disrupting agent comprising a site-specific SFRP1 targeting moiety comprising, e.g., a nucleic acid molecule. Liposomes, lipoplexes, or lipid nanoparticles are described in U.S. Patent Publication No. 2016/0038612, the contents of which are incorporated herein by reference in their entirety.


In one embodiment, a disrupting agent comprising a site-specific SFRP1 targeting moiety comprising may be formulated for controlled release and/or targeted delivery. As used herein, “controlled release” refers to a pharmaceutical composition or compound release profile that conforms to a particular pattern of release to effect a therapeutic outcome. In one embodiment, a disrupting agent comprising a site-specific SFRP1 targeting moiety, as described herein, may be encapsulated into a delivery agent described herein and/or known in the art for controlled release and/or targeted delivery. As used herein, the term “encapsulate” means to enclose, surround or encase. As it relates to the formulation of the compounds of the invention, encapsulation may be substantial, complete or partial. The term “substantially encapsulated” means that at least greater than 50, 60, 70, 80, 85, 90, 95, 96, 97, 98, 99, 99.9, 99.9 or greater than 99.999% of the pharmaceutical composition or disrupting agent of the invention may be enclosed, surrounded or encased within the delivery agent. “Partial encapsulation” or “partially encapsulated” means that less than 10, 10, 20, 30, 40 50 or less of the pharmaceutical composition or disrupting agent of the invention may be enclosed, surrounded or encased within the delivery agent. Advantageously, encapsulation may be determined by measuring the escape or the activity of the pharmaceutical composition or compound of the invention using fluorescence and/or electron micrograph. For example, at least 1, 5, 10, 20, 30, 40, 50, 60, 70, 80, 85, 90, 95, 96, 97, 98, 99, 99.9, 99.99 or greater than 99.99% of the pharmaceutical composition or disrupting agent of the invention are encapsulated in the delivery agent.


In one embodiment, a disrupting agent comprising a site-specific SFRP1 targeting moiety comprising as described herein, may be encapsulated in a therapeutic nanoparticle. Therapeutic nanoparticles may be formulated by methods described herein and known in the art such as, but not limited to, PCT Publication Nos. WO 2010/005740, WO 2010/030763, WO 2010/005721, WO 2010/005723, WO 2012/054923, U.S. Patent Publication Nos. 2201/10262491, 2010/0104645, 2010/0087337, 2010/0068285, 2011/0274759, 2010/0068286, 2012/0288541, 2013/0123351, 2013/0230567, 2013/0236500, 2013/0302433, 2013/0302432, 1013/0280339 and 2013/0251757, and U.S. Pat. Nos. 8,206,747, 8,293,276 8,318,208, 8,318,211, 8,623,417, 8,617,608, 8,613,954, 8,613,951, 8,609,142, 8,603,534 and 8,563,041; the contents of each of which is herein incorporated by reference in their entirety. In another embodiment, therapeutic polymer nanoparticles may be prepared by the methods described in U.S. Patent Publication No. 2012/0140790, herein incorporated by reference in its entirety. As a non-limiting example, the therapeutic nanoparticle may comprise about 4 to about 25 weight percent of a disrupting agent and about 10 to about 99 weight percent of a diblock poly (lactic) acid-poly (ethylene)glycol copolymer comprising poly(lactic) acid as described in US Patent Publication No. 2013/0236500, the contents of which are herein incorporated by reference in its entirety. As another non-limiting example, the nanoparticle may comprise about 0.2 to about 35 weight percent of a disrupting agent and about 10 to about 99 weight percent of a diblock poly(lactic) acid-poly(ethylene)glycol copolymer as described in U.S. Patent Publication Nos. 2013/0280339 and 2010251757 and U.S. Pat. No. 8,652,528, the contents of each of which are herein incorporated by reference in their entirety.


In one embodiment, a disrupting agent formulated in therapeutic nanoparticles may be administered intramuscularly, intradermally, or intravenously.


In one embodiment, a disrupting agent formulated in ACCURINS™ nanoparticles may be administered intramuscularly, intradermally, or intravenously.


In one embodiment, a disrupting agent may be delivered in therapeutic nanoparticles having a high glass transition temperature such as, but not limited to, the nanoparticles described in US Patent Publication Nos. 2014/0030351 and 2011/0294717, the entire contents of each of which are incorporated herein by reference.


In one embodiment, the therapeutic nanoparticle may be formulated for sustained release. As used herein, “sustained release” refers to a pharmaceutical composition or compound that conforms to a release rate over a specific period of time. The period of time may include, but is not limited to, hours, days, weeks, months and years. As a nonlimiting example, the sustained release nanoparticle may comprise a polymer and a disrupting agent of the present invention (see PCT Publication No. WO2010075072 and U.S. Patent Publication Nos. 2010/0216804, 2011/0217377, 2012/0201859, 2013/0243848 and 2013/0243827, each of which is herein incorporated by reference in their entirety).


In one embodiment, a disrupting agent of the invention may be encapsulated in, linked to and/or associated with synthetic nanocarriers. Synthetic nanocarriers include, but are not limited to, those described in PCT Publication. Nos. WO 2010/005740, WO 2010/030763, WO 2012/13501, WO 2012/149252, WO 2012149255, WO 2012149259, WO 2012149265, WO 2012149268, WO 2012149282, WO 2012149301, WO 2012149393, WO 2012149405, WO 2012149411 and WO 2012149454 and US Patent Publication Nos. 20110262491, 20100104645, 20100087337, 20120244222 and US20130236533, and U.S. Pat. No. 8,652,487, the contents of each of which is herein incorporated by reference in their entirety. The synthetic nanocarriers may be formulated using methods known in the art and/or described herein. As a nonlimiting example, the synthetic nanocarriers may be formulated by the methods described in PCT Publication Nos. WO 2010005740, WO 2010030763 and WO 201213501 and US Patent Publication Nos. 20110262491, 20100104645, 20100087337 and 20120244222, each of which is herein incorporated by reference in their entirety. In another embodiment, the synthetic nanocarrier formulations may be lyophilized by methods described in PCT Publication No. WO 2011072218 and U.S. Pat. No. 8,211,473; each of which is herein incorporated by reference in their entirety. In yet another embodiment, formulations of the present invention, including, but not limited to, synthetic nanocarriers, may be lyophilized or reconstituted by the methods described in US Patent Publication No. 20130230568, the contents of which are herein incorporated by reference in its entirety.


In one embodiment, synthetic nanocarriers comprising a disrupting agent may be administered intramuscularly, intradermally, or intravenously.


In some embodiments, a disrupting agent may be formulated for delivery using smaller LNPs. Such particles may comprise a diameter from below 0.1 μm up to 1000 μm such as, but not limited to, less than 0.1 μm, less than 1.0 μm, less than 5 μm, less than 10 μm, less than 15 μm, less than 20 μm, less than 25 μm, less than 30 μm, less than 35 μm, less than 40 μm, less than 50 μm, less than 55 μm, less than 60 μm, less than 65 μm, less than 70 μm, less than 75 μm, less than 80 μm, less than 85 μm, less than 90 μm, less than 95 μm, less than 100 μm, less than 125 μm, less than 150 μm, less than 175 μm, less than 200 μm, less than 225 μm, less than 250 μm, less than 275 μm, less than 300 μm, less than 325 μm, less than 350 μm, less than 375 μm, less than 400 μm, less than 425 μm, less than 450 μm, less than 475 μm, less than 500 μm, less than 525 μm, less than 550 μm, less than 575 μm, less than 600 μm, less than 625 μm, less than 650 μm, less than 675 μm, less than 700 μm, less than 725 μm, less than 750 μm, less than 775 μm, less than 800 μm, less than 825 μm, less than 850 μm, less than 875 μm, less than 900 μm, less than 925 μm, less than 950 μm, less than 975 μm.


In another embodiment, a disrupting agent may be formulated for delivery using smaller LNPs which may comprise a diameter from about 1 nm to about 100 nm, from about 1 nm to about 10 nm, about 1 nm to about 20 nm, from about 1 nm to about 30 nm, from about 1 nm to about 40 nm, from about 1 nm to about 50 nm, from about 1 nm to about 60 nm, from about 1 nm to about 70 nm, from about 1 nm to about 80 nm, from about 1 nm to about 90 nm, from about 5 nm to about from 100 nm, from about 5 nm to about 10 nm, about 5 nm to about 20 nm, from about 5 nm to about 30 nm, from about 5 nm to about 40 nm, from about 5 nm to about 50 nm, from about 5 nm to about 60 nm, from about 5 nm to about 70 nm, from about 5 nm to about 80 nm, from about 5 nm to about 90 nm, about 10 to about 50 nm, from about 20 to about 50 nm, from about 30 to about 50 nm, from about 40 to about 50 nm, from about 20 to about 60 nm, from about 30 to about 60 nm, from about 40 to about 60 nm, from about 20 to about 70 nm, from about 30 to about 70 nm, from about 40 to about 70 nm, from about 50 to about 70 nm, from about 60 to about 70 nm, from about 20 to about 80 nm, from about 30 to about 80 nm, from about 40 to about 80 nm, from about 50 to about 80 nm, from about 60 to about 80 nm, from about 20 to about 90 nm, from about 30 to about 90 nm, from about 40 to about 90 nm, from about 50 to about 90 nm, from about 60 to about 90 nm and/or from about 70 to about 90 nm.


In one embodiment, a disrupting agent may be formulated in smaller LNPs and may be administered intramuscularly, intradermally, or intravenously.


In one embodiment, a disrupting agent may be formulated for delivery using the drug encapsulating microspheres described in PCT Patent Publication No. WO 2013063468 or U.S. Pat. No. 8,440,614, each of which is herein incorporated by reference in its entirety. In another aspect, the amino acid, peptide, polypeptide, lipids (APPL) are useful in delivering the disrupting agents of the invention to cells (see PCT Patent Publication No. WO 2013063468, herein incorporated by reference in its entirety).


In one aspect, the lipid nanoparticle may be a limit size lipid nanoparticle described in PCT Patent Publication No. WO 2013059922, herein incorporated by reference in its entirety. The limit size lipid nanoparticle may comprise a lipid bilayer surrounding an aqueous core or a hydrophobic core; where the lipid bilayer may comprise a phospholipid such as, but not limited to, diacylphosphatidylcholine, a diacylphosphatidylethanolamine, a ceramide, a sphingomyelin, a dihydrosphingomyelin, a cephalin, a cerebroside, a C8-C20 fatty acid diacylphophatidylcholine, and I-palmitoyl-2-oleoyl phosphatidylcholine (POPC). In another aspect the limit size lipid nanoparticle may comprise a polyethylene glycol-lipid such as, but not limited to, DLPEPEG, DMPE-PEG, DPPC-PEG and DSPE-PEG.


In one embodiment, a disrupting agent of the invention may be delivered, localized and/or concentrated in a specific location using the delivery methods described in PCT Patent Publication No. WO 2013063530, the contents of which are herein incorporated by reference in its entirety. As a non-limiting example, a subject may be administered an empty polymeric particle prior to, simultaneously with or after delivering the disrupting agent to the subject. The empty polymeric particle undergoes a change in volume once in contact with the subject and becomes lodged, embedded, immobilized or entrapped at a specific location in the subject.


In one embodiment, a disrupting agent may be formulated in an active substance release system (See e.g., US Patent Publication No. 20130102545, herein incorporated by reference in its entirety). The active substance release system may comprise 1) at least one nanoparticle bonded to an oligonucleotide inhibitor strand which is hybridized with a catalytically active nucleic acid and 2) a compound bonded to at least one substrate molecule bonded to a therapeutically active substance (e.g., a disrupting agent of the invention), where the therapeutically active substance is released by the cleavage of the substrate molecule by the catalytically active nucleic acid.


In one embodiment, the nanoparticles of the present invention may be water soluble nanoparticles such as, but not limited to, those described in PCT Publication No. WO 2013090601, the contents of which are herein incorporated by reference in its entirety. The nanoparticles may be inorganic nanoparticles which have a compact and zwitterionic ligand in order to exhibit good water solubility. The nanoparticles may also have small hydrodynamic diameters (HD), stability with respect to time, pH, and salinity and a low level of non-specific protein binding.


In one embodiment, the nanoparticles of the present invention are stealth nanoparticles or target-specific stealth nanoparticles such as, but not limited to, those described in U.S. Patent Publication Nos. 20130172406 (Bind), 20130251817 (Bind), 2013251816 (Bind) and 20130251766 (Bind), the contents of each of which are herein incorporated by reference in its entirety. The stealth nanoparticles may comprise a diblock copolymer and a chemotherapeutic agent. These stealth nanoparticles may be made by the methods described in us Patent Publication Nos. 20130172406, 20130251817, 2013251816 and 20130251766, the contents of each of which are herein incorporated by reference in its entirety. As a non-limiting example, the stealth nanoparticles may target cancer cells such as the nanoparticles described in US Patent Publication Nos. 20130172406, 20130251817, 2013251816 and 20130251766, the contents of each of which are herein incorporated by reference in its entirety.


In one embodiment, stealth nanoparticles comprising a disrupting agent of the invention may be administered intramuscularly, intradermally, or intravenously.


In one embodiment, a disrupting agent of the invention may be formulated in and/or delivered in a lipid nanoparticle comprising a plurality of cationic lipids such as, but not limited to, the lipid nanoparticles described in US Patent Publication No. 20130017223, the contents of which are herein incorporated by reference in its entirety. As a non-limiting example, the LNP formulation may comprise a first cationic lipid and a second cationic lipid. As another non-limiting example, the LNP formulation may comprise DLin-MC2-DMA and DLinMC4-DMA. As yet another non-limiting example, the LNP formulation may comprise DLin-MC3-DMA and CI2-200. In one embodiment, the LNP formulations comprising a plurality of cationic lipids (such as, but not limited to, those described in US Patent Publication No. US20130017223, the contents of which are herein incorporated by reference in its entirety) and may be administered intramuscularly, intradermally, or intravenously.


In one embodiment, a disrupting agent as described herein, may be formulated in and/or delivered in a lipid nanoparticle comprising the cationic lipid DLin-MC3-DMA and the neutral lipid DOPE. The lipid nanoparticle may also comprise a PEG based lipid and a cholesterol or antioxidant. These lipid nanoparticle formulations comprising DLin-MC3-DMA and DOPE and a disrupting agent may be administered intramuscularly, intradermally, or intravenously.


In one embodiment, the lipid nanoparticle comprising DLin-MC3-DMA and DOPE may comprise a PEG lipid such as, but not limited to, pentaerythritol PEG ester tetrasuccinimidyl and pentaerythritol PEG ether tetra-thiol, PEGc-DOMG, PEG-DMG (1,2-Dimyristoyl-sn-glycerol, methoxypolyethylene Glycol), PEG-DSG (1,2-Distearoyl-snglycerol, methoxypolyethylene Glycol), PEG-DPG (1,2-Dipalmitoyl-sn-glycerol, methoxypolyethylene glycol), PEG-DSA (PEG coupled to 1,2-distearyloxypropyl-3-amine), PEG-DMA (PEG coupled to 1,2-dimyristyloxypropyl-3-amine, PEG-c-DNA, PEG-c-DMA, PEG-S-DSG, PEG-c-DMA, PEG-DPG, PEG-DMG 2000 and those described herein and/or known in the art.


In one embodiment, the lipid nanoparticle comprising DLin-MC3-DMA and DOPE may include 0.5% to about 3.0%, from about 1.0% to about 3.5%, from about 1.5% to about 4.0%, from about 2.0% to about 4.5%, from about 2.5% to about 5.0% and/or from about 3.0% to about 6.0% of the lipid molar ratio of a PEG lipid.


In one embodiment, the lipid nanoparticle comprising DLin-MC3-DMA and DOPE may include 25.0% cholesterol to about 50.0% cholesterol, from about 30.0% cholesterol to about 45.0% cholesterol, from about 35.0% cholesterol to about 50.0% cholesterol and/or from about 48.5% cholesterol to about 60% cholesterol. In one embodiment, formulations may comprise a percentage of cholesterol selected from the group consisting of 28.5%, 31.5%, 33.5%, 36.5%, 37.0%, 38.5%, 39.0%, 43.5% and 48.5%.


In one embodiment, the lipid nanoparticle comprising DLin-MC3-DMA and DOPE may include 25.0% antioxidant to about 50.0% antioxidant, from about 30.0% antioxidant to about 45.0% antioxidant, from about 35.0% antioxidant to about 50.0% antioxidant and/or from about 48.5% antioxidant to about 60% antioxidant. In one embodiment, formulations may comprise a percentage of antioxidant selected from the group consisting of 28.5%, 31.5%, 33.5%, 36.5%, 37.0%, 38.5%, 39.0%, 43.5% and 48.5%.


The disrupting agent of the invention can be formulated using natural and/or synthetic polymers. Non-limiting examples of polymers which may be used for delivery include, but are not limited to, DYNAMIC POLYCONJUGATE® (Arrowhead Research Corp., Pasadena, Calif.) formulations from MIRUS® Bio (Madison, Wis.) and Roche Madison (Madison, Wis.), PHASERX™ polymer formulations such as, without limitation, SMARTT POLYMER TECHNOLOGY® (Seattle, Wash.), DMRIIDOPE, poloxamer, VAXFECTIN® adjuvant from Vical (San Diego, Calif.), chitosan, cyclodextrin from Calando Pharmaceuticals (Pasadena, Calif.), dendrimers and poly(lactic-co-glycolic acid) (PLGA) polymers, RONDEL™ (RNAi/Oligonucleotide Nanoparticle Delivery) polymers (Arrowhead Research Corporation, Pasadena, Calif.) and pH responsive co-block polymers such as, but not limited to, PHASERX™ (Seattle, Wash.).


The polymer formulations may permit the sustained or delayed release of a disrupting agent (e.g., following intramuscular, intradermal or subcutaneous injection). The altered release profile of the disrupting agent can result in, for example, translation of an encoded protein over an extended period of time. The polymer formulation may also be used to increase the stability of the disrupting agent. For example, biodegradable polymers have been previously used to protect nucleic acids other than modified mRNA from degradation and been shown to result in sustained release of payloads in vivo (Rozema et al., Proc Natl Acad Sci USA. 2007 104:12982-12887; Sullivan et al., Expert Opin Drug Deliv. 2010 7:1433-1446; Convertine et al., Biomacromolecules. 2010 Oct. 1; Chu et al., Acc Chern Res. 2012 Jan. 13; Manganiello et al., Biomaterials. 2012 33:2301-2309; Benoit et al., Biomacromolecules. 2011 12:2708-2714; Singha et al., Nucleic Acid Ther. 2011 2: 133-147; deFougerolles Hum Gene Ther. 2008 19:125-132; Schaffert and Wagner, Gene Ther. 2008 16:1131-1138; Chaturvedi et al., Expert Opin Drug Deliv. 2011 8: 1455-1468; Davis, Mol Pharm. 2009 6:659-668; Davis, Nature 201 0464: 1067-1070; each of which is herein incorporated by reference in its entirety).


In one embodiment, the pharmaceutical compositions may be sustained release formulations. In a further embodiment, the sustained release formulations may be for subcutaneous delivery. Sustained release formulations may include, but are not limited to, PLGA microspheres, ethylene vinyl acetate (EVAc), poloxamer, GELSITE® (Nanotherapeutics, Inc. Alachua, Fla.), HYLENEX® (Halozyme Therapeutics, San Diego Calif.), surgical sealants such as fibrinogen polymers (Ethic on Inc. Cornelia, Ga.), TISSELL® (Baxter International, Inc Deerfield, Ill.), PEG-based sealants, and COSEAL® (Baxter International, Inc Deerfield, Ill.).


B. Vector Encoded Site-Specific SFRP1 Disrupting Agents of the Invention

Disrupting agents comprising a site-specific SFRP1 targeting moiety, e.g., comprising a nucleic acid molecule, may be expressed from transcription units inserted into DNA or RNA vectors (see, e.g., Couture, A, et al., TIG. (1996), 12:5-10; WO 00/22113, WO 00/22114, and U.S. Pat. No. 6,054,299). In some embodiment, expression is sustained (months or longer), depending upon the specific construct used and the target tissue or cell type. These transgenes can be introduced as a linear construct, a circular plasmid, or a viral vector, which can be an integrating or non-integrating vector. The transgene can also be constructed to permit it to be inherited as an extrachromosomal plasmid (see, Gassmann, et al., (1995) Proc. Natl. Acad. Sci. USA 92:1292). Different components of the disrupting agent, e.g., gRNA and effector, can be located on separate expression vectors that can be co-introduced (e.g., by transfection or infection) into a target cell. Alternatively, each individual component can be transcribed by promoters both of which are located on the same expression plasmid.


Delivery of a disrupting agent expressing vector can be systemic, such as by intravenous or intramuscular administration, by administration to target cells ex-planted from the patient followed by reintroduction into the patient, or by any other means that allows for introduction into a desired target cell.


In certain embodiment, the nucleic acids described herein or the nucleic acids encoding a protein described herein, e.g., an effector, are incorporated into a vector, e.g., a viral vector.


The individual strand or strands of a disrupting agent comprising a site-specific SFRP1 targeting moiety comprising a nucleic acid molecule can be transcribed from a promoter in an expression vector. Where two separate strands are to be expressed to generate, for example, a dsRNA, two separate expression vectors can be co-introduced (e.g., by transfection or infection) into a target cell. Alternatively, each individual strand of a nucleic acid molecule can be transcribed by promoters both of which are located on the same expression plasmid. In one embodiment, a nucleic acid molecule is expressed as inverted repeat polynucleotides joined by a linker polynucleotide sequence such that the nucleic acid molecule has a stem and loop structure.


Expression vectors are generally DNA plasmids or viral vectors. Expression vectors compatible with eukaryotic cells, preferably those compatible with vertebrate cells, can be used to produce recombinant constructs for the expression of a disrupting agent as described herein.


Constructs for the recombinant expression of a disrupting agent will generally require regulatory elements, e.g., promoters, enhancers, etc., to ensure the expression of the disrupting agent in target cells.


Expression of natural or synthetic nucleic acids is typically achieved by operably linking a nucleic acid encoding the nucleic acid of interest to a regulatory region, such as a promoter, and incorporating the construct into an expression vector. The vectors can be suitable for replication and integration in eukaryotes.


Regulatory regions, such as a promoter, suitable for operable linking to a nucleic acid molecules can be operably linked to a regulatory region such as a promoter. can be from any species. Any type of promoter can be operably linked to a nucleic acid sequence. Examples of promoters include, without limitation, tissue-specific promoters, constitutive promoters, and promoters responsive or unresponsive to a particular stimulus (e.g., inducible promoters). Additional promoter elements, e.g., enhancing sequences, regulate the frequency of transcriptional initiation. Typically, these are located in the region 30-110 bp upstream of the start site, although a number of promoters have recently been shown to contain functional elements downstream of the start site as well. The spacing between promoter elements frequently is flexible, so that promoter function is preserved when elements are inverted or moved relative to one another. In the thymidine kinase (tk) promoter, the spacing between promoter elements can be increased to 50 bp apart before activity begins to decline. Depending on the promoter, individual elements can function either cooperatively or independently to activate transcription.


One example of a suitable promoter is the immediate early cytomegalovirus (CMV) promoter sequence. This promoter sequence is a strong constitutive promoter sequence capable of driving high levels of expression of any polynucleotide sequence operatively linked thereto. Another example of a suitable promoter is Elongation Growth Factor-1a (EF-1a). However, other constitutive promoter sequences may also be used, including, but not limited to the simian virus 40 (SV40) early promoter, mouse mammary tumor virus (MMTV), human immunodeficiency virus (HIV) long terminal repeat (LTR) promoter, MoMuLV promoter, an avian leukemia virus promoter, an Epstein-Barr virus immediate early promoter, a Rous sarcoma virus promoter, as well as human gene promoters such as, but not limited to, the actin promoter, the myosin promoter, the hemoglobin promoter, and the creatine kinase promoter.


Further, the present invention should not be limited to the use of constitutive promoters. Inducible promoters are also contemplated as part of the invention. The use of an inducible promoter provides a molecular switch capable of turning on expression of the polynucleotide sequence which it is operatively linked when such expression is desired, or turning off the expression when expression is not desired. Examples of inducible promoters include, but are not limited to a metallothionine promoter, a glucocorticoid promoter, a progesterone promoter, and a tetracycline promoter.


Additional regulatory regions that may be useful in nucleic acid constructs, include, but are not limited to, transcription and translation terminators, initiation sequences, polyadenylation sequences, translation control sequences (e.g., an internal ribosome entry segment, IRES), enhancers, inducible elements, or introns. Such regulatory regions may not be necessary, although they may increase expression by affecting transcription, stability of the mRNA, translational efficiency, or the like. Such regulatory regions can be included in a nucleic acid construct as desired to obtain optimal expression of the nucleic acids in the cell(s). Sufficient expression, however, can sometimes be obtained without such additional elements.


The expression vector to be introduced can also contain either a selectable marker gene or a reporter gene or both to facilitate identification and selection of expressing cells from the population of cells sought to be transfected or infected through viral vectors. In other aspects, the selectable marker may be carried on a separate piece of DNA and used in a co-transfection procedure. Both selectable markers and reporter genes may be flanked with appropriate transcriptional control sequences to enable expression in the host cells. Useful selectable markers include, for example, antibiotic-resistance genes, such as neo and the like. Non-limiting examples of selectable markers include puromycin, ganciclovir, adenosine deaminase (ADA), aminoglycoside phosphotransferase (neo, G418, APH), dihydrofolate reductase (DHFR), hygromycin-B-phosphtransferase, thymidine kinase (TK), and xanthin-guanine phosphoribosyltransferase (XGPRT). Such markers are useful for selecting stable transformants in culture. Other selectable markers include fluorescent polypeptides, such as green fluorescent protein or yellow fluorescent protein.


Signal peptides may also be included and can be used such that an encoded polypeptide is directed to a particular cellular location (e.g., the cell surface).


Reporter genes may be used for identifying potentially transfected cells and for evaluating the functionality of transcriptional control sequences. In general, a reporter gene is a gene that is not present in or expressed by the recipient source and that encodes a polypeptide whose expression is manifested by some easily detectable property, e.g., enzymatic activity. Expression of the reporter gene is assayed at a suitable time after the DNA has been introduced into the recipient cells. Suitable reporter genes may include genes encoding luciferase, beta-galactosidase, chloramphenicol acetyl transferase, secreted alkaline phosphatase, or the green fluorescent protein gene (e.g., Ui-Tei et al., 2000 FEBS Letters 479: 79-82). Suitable expression systems are well known and may be prepared using known techniques or obtained commercially. In general, the construct with the minimal 5′ flanking region showing the highest level of expression of reporter gene is identified as the promoter. Such promoter regions may be linked to a reporter gene and used to evaluate agents for the ability to modulate promoter-driven transcription.


Other aspects to consider for vectors and constructs are known in the art.


In some embodiments, a vector, e.g., a viral vector comprises a disrupting agent comprising a site-specific SFRP1 targeting moiety comprising a nucleic acid molecule.


Viral vector systems which can be utilized with the methods and compositions described herein include, but are not limited to, (a) adenovirus vectors (e.g., an Ad5/F35 vector); (b) retrovirus vectors, including but not limited to lentiviral vectors (including integration competent or integration-defective lentiviral vectors), moloney murine leukemia virus, etc.; (c) adeno-associated virus vectors; (d) herpes simplex virus vectors; (e) SV 40 vectors; (f) polyoma virus vectors; (g) papilloma virus vectors; (h) picornavirus vectors; (i) pox virus vectors such as an orthopox, e.g., vaccinia virus vectors or avipox, e.g. canary pox or fowl pox; and (j) a helper-dependent or gutless adenovirus. Replication-defective viruses can also be advantageous. Different vectors will or will not become incorporated into the cells' genome. The constructs can include viral sequences for transfection, if desired. Alternatively, the construct can be incorporated into vectors capable of episomal replication, e.g. EPV and EBV vectors. See, e.g., U.S. Pat. Nos. 6,534,261; 6,607,882; 6,824,978; 6,933,113; 6,979,539; 7,013,219; and 7,163,824, the entire contents of each of which is incorporated by reference herein.


Vectors, including those derived from retroviruses such as adenoviruses and adeno-associated viruses and lentiviruses, are suitable tools to achieve long-term gene transfer since they allow long-term, stable integration of a transgene and its propagation in daughter cells. Examples of vectors include expression vectors, replication vectors, probe generation vectors, and sequencing vectors. The expression vector may be provided to a cell in the form of a viral vector. Viral vector technology is well known in the art, and described in a variety of virology and molecular biology manuals.


In one embodiment, a suitable viral vector for use in the present invention is an adeno-associated viral vector, such as a recombinant adeno-associate viral vector.


Recombinant adeno-associated virus vectors (rAAV) are gene delivery systems based on the defective and nonpathogenic parvovirus adeno-associated type 2 virus. All vectors are derived from a plasmid that retains only the AAV 145 bp inverted terminal repeats flanking the transgene expression cassette. Efficient gene transfer and stable transgene delivery due to integration into the genomes of the transduced cell are key features for this vector system. (Wagner et al., Lancet 351:9117 1702-3 (1998), Kearns et al., Gene Ther. 9:748-55 (1996)). AAV serotypes, including AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8 and AAV9, can be used in accordance with the present invention.


Replication-deficient recombinant adenoviral vectors (Ad) can be produced at high titer and readily infect a number of different cell types. Most adenovirus vectors are engineered such that a transgene replaces the Ad E1a, E1b, and/or E3 genes; subsequently the replication defective vector is propagated in human 293 cells that supply deleted gene function in trans. Ad vectors can transduce multiple types of tissues in vivo, including nondividing, differentiated cells such as those found in the hair follicle (e.g., dermal papilla cells). Conventional Ad vectors have a large carrying capacity. An example of the use of an Ad vector in a clinical trial involved polynucleotide therapy for antitumor immunization with intramuscular injection (Sterman et al., Hum. Gene Ther. 7:1083-9 (1998)). Additional examples of the use of adenovirus vectors for gene transfer in clinical trials include Rosenecker et al., Infection 24:1 5-10 (1996); Sterman et al., Hum. Gene Ther. 9:7 1083-1089 (1998); Welsh et al., Hum. Gene Ther. 2:205-18 (1995); Alvarez et al., Hum. Gene Ther. 5:597-613 (1997); Topf et al., Gene Ther. 5:507-513 (1998); Sterman et al., Hum. Gene Ther. 7:1083-1089 (1998).


Packaging cells are used to form virus particles that are capable of infecting a host cell. Such cells include 293 cells, which package adenovirus, and w2 cells or PA317 cells, which package retrovirus. Viral vectors used in gene therapy are usually generated by a producer cell line that packages a nucleic acid vector into a viral particle. The vectors typically contain the minimal viral sequences required for packaging and subsequent integration into a host (if applicable), other viral sequences being replaced by an expression cassette encoding the protein to be expressed. The missing viral functions are supplied in trans by the packaging cell line. For example, AAV vectors used in gene therapy typically only possess inverted terminal repeat (ITR) sequences from the AAV genome which are required for packaging and integration into the host genome. Viral DNA is packaged in a cell line, which contains a helper plasmid encoding the other AAV genes, namely rep and cap, but lacking ITR sequences. The cell line is also infected with adenovirus as a helper. The helper virus promotes replication of the AAV vector and expression of AAV genes from the helper plasmid. The helper plasmid is not packaged in significant amounts due to a lack of ITR sequences. Contamination with adenovirus can be reduced by, e.g., heat treatment to which adenovirus is more sensitive than AAV.


IV. Methods of the Invention
A. Modulation of Expression of SFRP1 in a Cell

The present invention also provides methods of use of the agents and compositions described herein to modulate expression of secreted frizzled related protein 1-(SFRP1) in a cell. The methods include contacting the cell (e.g., hair follicle dermal papilla cells, hair matrix, inner root sheath, outer root sheath, fibrous root sheath) with a site-specific SFRP1 disrupting agent, the disrupting agent comprising a site-specific SFRP1 targeting moiety which targets an SFRP1 expression control region, and an effector molecule, thereby modulating expression of SFRP1 in the cell. The site-specific disrupting agent, the effector, or both the site-specific disrupting agent and the effector may be present in a composition, such as a composition described above. In some embodiments, the site-specific disrupting agent and the effector are present in the same compositions. In other embodiments, the site-specific disrupting agent and the effector are present in different compositions. In some embodiments, the methods of the invention include contacting a cell with two site-specific SFRP1 disrupting agents (a first and a second agent). The two site specific SFRP1 disrupting agents may be present in the same composition, e.g., pharmaceutical composition, e.g., pharmaceutical composition comprising an LNP, or in separate compositions, e.g., pharmaceutical composition, e.g., pharmaceutical composition comprising an LNP. The cell may be contacted with the first site specific SFRP1 disrupting agent at one time and contacted with the second site specific SFRP1 disrupting agent at a second time, or the cell may be contacted with both agents at the same time.


Expression of SFRP1 may be enhanced or reduced as compared to, for example, a cell that was not contacted with the site-specific SFRP1 disrupting agent. Modulation in gene expression can be assessed by any methods known in the art. For example, a modulation in the expression may be determined by determining the mRNA expression level of a gene, e.g., in a cell, a plurality of cells, and/or a tissue sample, using methods routine to one of ordinary skill in the art, e.g., northern blotting, qRT-PCR; by determining the protein level of a gene using methods routine to one of ordinary skill in the art, such as western blotting, immunological techniques.


The term “reduced” in the context of the level of SFRP1 gene expression or SFRP1 protein production in a subject, or a disease marker or symptom refers to a statistically significant decrease in such level. The decrease can be, for example, at least 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%, or below the level of detection for the detection method. In certain embodiments, the expression of the target is normalized, i.e., decreased towards or to a level accepted as within the range of normal for an individual without such disorder. As used here, “lower” in a subject can refer to lowering of gene expression or protein production in a cell in a subject does not require lowering of expression in all cells or tissues of a subject. For example, as used herein, lowering in a subject can include lowering of gene expression or protein production in the dermal papilla cells of a subject.


The term “reduced” can also be used in association with normalizing a symptom of a disease or condition, i.e. decreasing the difference between a level in a subject suffering from an SFRP1-associated disease towards or to a level in a normal subject not suffering from an SFRP1-associated disease. As used herein, if a disease is associated with an elevated value for a symptom, “normal” is considered to be the upper limit of normal. If a disease is associated with a decreased value for a symptom, “normal” is considered to be the lower limit of normal.


The term “enhanced” in the context of the level of SFRP1 gene expression or SFRP1 protein production in a subject, or a disease marker or symptom refers to a statistically significant increase in such level. The increase can be, for example, at least 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%, or above the level of detection for the detection method. In certain embodiments, the expression of the target is normalized, i.e., increase towards or to a level accepted as within the range of normal for an individual without such disorder. As used here, “higher” in a subject can refer to increasing gene expression or protein production in a cell in a subject does not require increasing expression in all cells or tissues of a subject. For example, as used herein, increasing in a subject can include increasing gene expression or protein production in the dermal papilla cells of a subject.


The term “enhanced” can also be used in association with normalizing a symptom of a disease or condition, i.e. increasing the difference between a level in a subject suffering from an SFRP1-associated disease towards or to a level in a normal subject not suffering from an SFRP1-associated disease. As used herein, if a disease is associated with an elevated value for a symptom, “normal” is considered to be the upper limit of normal. If a disease is associated with a decreased value for a symptom, “normal” is considered to be the lower limit of normal.


In some embodiments, a suitable cell for use in the methods of the invention is a mammalian cell. In some embodiments, the cell is a somatic cell. In some embodiments, the cell is a primary cell. For example, in some embodiments, the cell is a mammalian somatic cell. In some embodiments, the mammalian somatic cell is a primary cell. In some embodiments, the mammalian somatic cell is a non-embryonic cell.


B. In Vitro Methods of the Invention

The step of contacting may be performed in vitro, in vivo (i.e., the cell may be within a subject), or ex vivo. In some embodiments, contacting a cell is performed ex vivo and the methods further include, prior to the step of contacting, a step of removing the cell (e.g., a mammalian cell) from a subject. In some embodiments, the methods further comprise, after the step of contacting, a step of (b) administering the cell (e.g., mammalian cells) to a subject.


In some embodiments, the cell is a hair follicle dermal papilla cells, hair matrix, inner root sheath, outer root sheath, fibrous root sheath. In some embodiments, the cell is contacted with a site-specific Secreted Frizzled Receptor Protein 1 (SFRP1) disrupting agent. In some embodiments, the site-specific SFRP1 disrupting agent is a repressor of SFRP1.


In some embodiments, the cell contacted with the SFRP1 disrupting agent can be used ex vivo to determine hair follicle growth or hair follicle growth in intact hair-skin system.


C. In Vivo Methods of the Invention

The in vivo methods of the invention may include administering to a subject an agent or composition, or cells of the invention.


The term “subject,” as used herein refers to an organism, for example, a mammal (e.g., a human, a non-human mammal, a non-human primate, a primate, a laboratory animal, a mouse, a rat, a hamster, a gerbil, a cat, or a dog). In some embodiments a human subject is an adult, adolescent, or pediatric subject. In some embodiments, a subject had a disease or a condition. In some embodiments, the subject is suffering from a disease, disorder or condition, e.g., a disease, disorder or condition that can be treated as provided herein. In some embodiments, a subject is susceptible to a disease, disorder, or condition; in some embodiments, a susceptible subject is predisposed to and/or shows an increased risk (as compared to the average risk observed in a reference subject or population) of developing the disease, disorder or condition. In some embodiments, a subject displays one or more symptoms of a disease, disorder or condition. In some embodiments, a subject does not display a particular symptom (e.g., clinical manifestation of disease) or characteristic of a disease, disorder, or condition. In some embodiments, a subject does not display any symptom or characteristic of a disease, disorder, or condition. In some embodiments, a subject is a patient. In some embodiments, a subject is an individual to whom diagnosis and/or therapy is and/or has been administered.


Subjects that would benefit from the methods of the invention include subjects having an “SFRP1-associated disease” or a subject at risk of an “SFRP1-associated disease.”


Thus, the present invention further provides methods of treatment of a subject in need thereof. The treatment methods of the invention include administering an agent or composition of the invention to a subject, e.g., a subject that would benefit from a modulation of SFRP1 expression, such as a subject having an SFRP1-associated disease, in a therapeutically effective amount. In some embodiments, the methods of the invention include the subject may be administered two site-specific SFRP1 disrupting agents (a first and a second agent). The two site specific SFRP1 disrupting agents may be present in the same composition, e.g., pharmaceutical composition, e.g., pharmaceutical composition comprising an LNP, or in separate compositions, e.g., pharmaceutical composition, e.g., pharmaceutical composition comprising an LNP. The subject may be administered the first site specific SFRP1 disrupting agent at one time and administered the second site specific SFRP1 disrupting agent at a second time, or the subject may be administered both agents at the same time.


In addition, the present invention provides methods for preventing at least one symptom in a subject that would benefit from a modulation of SFRP1 expression, such as a subject having an SFRP1-associated disease, by administering to the subject an agent or a composition, or cells of the invention in a prophylactically effective amount.


“Therapeutically effective amount,” as used herein, is intended to include the amount of an agent or composition or cells that, when administered to a patient for treating a subject having a SFRP1-associated disease, is sufficient to effect treatment of the disease (e.g., by diminishing, ameliorating, or maintaining the existing disease or one or more symptoms of disease or its related comorbidities). The “therapeutically effective amount” may vary depending on the agent or composition or cells, how it is administered, the disease and its severity and the history, age, weight, family history, genetic makeup, stage of pathological processes mediated by SFRP1 gene expression, the types of preceding or concomitant treatments, if any, and other individual characteristics of the patient to be treated.


“Prophylactically effective amount,” as used herein, is intended to include the amount of an agent or composition or cells that, when administered to a subject who does not yet experience or display symptoms of an SFRP1-associated disease, but who may be predisposed to an SFRP1-associated disease, is sufficient to prevent or delay the development or progression of the disease or one or more symptoms of the disease for a clinically significant period of time. The “prophylactically effective amount” may vary depending on the agent or composition, how it is administered, the degree of risk of disease, and the history, age, weight, family history, genetic makeup, the types of preceding or concomitant treatments, if any, and other individual characteristics of the patient to be treated.


As used herein, “prevention” or “preventing,” when used in reference to a disease, disorder or condition thereof, that would benefit from a reduction in expression of an SFRP1 gene or production of SFRP1 protein, refers to a reduction in the likelihood that a subject will develop a symptom associated with such a disease, disorder, or condition, e.g., a sign or symptom of SFRP1 gene expression or SFRP1 activity.


A “therapeutically-effective amount” or “prophylactically effective amount” also includes an amount of an agent or composition that produces some desired local or systemic effect at a reasonable benefit/risk ratio applicable to any treatment. Agents and compositions employed in the methods of the present invention may be administered in a sufficient amount to produce a reasonable benefit/risk ratio applicable to such treatment. In some embodiments, a therapeutically effective amount or prophylactically effect amount is administered in a single dose; in some embodiments, multiple unit doses are required to deliver a therapeutically or prophylactically effective amount.


As used herein, the phrase “symptoms are reduced” may be used when one or more symptoms of a particular disease, disorder or condition is reduced in magnitude (e.g., intensity, severity, etc.) and/or frequency. In some embodiments, a delay in the onset of a particular symptom is considered one form of reducing the frequency of that symptom.


When the subject to be treated is a mammal such as a human, the composition or cells can be administered by any means known in the art including, but not limited to oral, intraperitoneal, or parenteral routes, including intracranial (e.g., intraventricular, intraparenchymal, and intrathecal), intravenous, intramuscular, subcutaneous, transdermal, airway (aerosol), nasal, rectal, and topical (including buccal and sublingual) administration. In certain embodiments, the compositions are administered by intravenous infusion or injection. In certain embodiments, the compositions are administered by subcutaneous injection.


As used herein, the term “SFRP1-associated disease,” includes a disease or disorder or condition that would benefit from a modulation, e.g., an decrease, in SFRP1 gene expression, replication, or protein activity, such as a disease or disorder that is associated with Wnt signaling. Non-limiting examples of SFRP1-associated diseases include androgenic alopecia (hormone imbalance), alopecia areata (immune disorders); traction alopecia (mechanical stress), senescent alopecia (age); and cicatricial alopecia (inflammatory disorders).


Administration of the agents or compositions or cells of the invention according to the methods of the invention may result in a reduction of the severity, signs, symptoms, or markers of an SFRP1-associated disease or disorder in a patient with an SFRP1-associated disease or disorder. By “reduction” in this context is meant a statistically significant decrease in such level. The reduction (absolute reduction or reduction of the difference between the elevated level in the subject and a normal level) can be, for example, at least about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%, or to below the level of detection of the assay used.


Administration of the agents or compositions or cells according to the methods of the invention may stably or transiently modulating expression of a target gene. In some embodiments, a modulation of expression persists for at least about 1 hr to about 30 days, or at least about 2 hrs, 6 hrs, 12 hrs, 18 hrs, 24 hrs, 2 days, 3, days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 15 days, 16 days, 17 days, 18 days, 19 days, 20 days, 21 days, 22 days, 23 days, 24 days, 25 days, 26 days, 27 days, 28 days, 29 days, 30 days, or longer or any time therebetween. In some other embodiments, a modulation of expression persists for no more than about 30 mins to about 7 days, or no more than about 1 hr, 2 hrs, 3 hrs, 4 hrs, 5 hrs, 6 hrs, 7 hrs, 8 hrs, 9 hrs, 10 hrs, 11 hrs, 12 hrs, 13 hrs, 14 hrs, 15 hrs, 16 hrs, 17 hrs, 18 hrs, 19 hrs, 20 hrs, 21 hrs, 22 hrs, 24 hrs, 36 hrs, 48 hrs, 60 hrs, 72 hrs, 4 days, 5 days, 6 days, 7 days, or any time therebetween.


The agents or compositions or cells may be administered once to the subject or, alternatively, multiple administrations may be performed over a period of time. For example, two, three, four, five, or more administrations may be given to the subject during one treatment or over a period of time. In some embodiments, six, eight, ten, 12, 15 or 20 or more administrations may be given to the subject during one treatment or over a period of time as a treatment regimen.


In some embodiments, administrations may be given as needed, e.g., for as long as symptoms associated with the disease, disorder or condition persist. In some embodiments, repeated administrations may be indicated for the remainder of the subject's life. Treatment periods may vary and could be, e.g., one day, two days, three days, one week, two weeks, one month, two months, three months, six months, a year, or longer.


Efficacy of treatment or prevention of disease can be assessed, for example by measuring disease progression, disease remission, symptom severity, reduction in pain, quality of life, dose of a medication required to sustain a treatment effect, level of a disease marker, or any other measurable parameter appropriate for a given disease being treated or targeted for prevention. It is well within the ability of one skilled in the art to monitor efficacy of treatment or prevention by measuring any one of such parameters, or any combination of parameters. As discussed herein, the specific parameters to be measured depend on the SFRP1-associated disease that the subject is suffering from.


Comparisons of the later readings with the initial readings provide a physician an indication of whether the treatment is effective. It is well within the ability of one skilled in the art to monitor efficacy of treatment or prevention by measuring any one of such parameters, or any combination of parameters. In connection with the administration of an agent or composition, “effective against” an SFRP1-associated disorder indicates that administration in a clinically appropriate manner results in a beneficial effect for at least a statistically significant fraction of patients, such as an improvement of symptoms, a cure, a reduction in disease, extension of life, improvement in quality of life, or other effect generally recognized as positive by medical doctors familiar with treating SFRP1-associated disorders.


A treatment or preventive effect is evident when there is a statistically significant improvement in one or more parameters of disease status, or by a failure to worsen or to develop symptoms where they would otherwise be anticipated. As an example, a favorable change of at least 10% in a measurable parameter of disease, and preferably at least 20%, 30%, 40%, 50% or more can be indicative of effective treatment. Efficacy for a given agent or composition can also be judged using an experimental animal model for the given disease as known in the art. When using an experimental animal model, efficacy of treatment is evidenced when a statistically significant reduction in a marker or symptom is observed.


Alternatively, the efficacy can be measured by a reduction in the severity of disease as determined by one skilled in the art of diagnosis based on a clinically accepted disease severity grading scale. Any positive change resulting in e.g., lessening of severity of disease measured using the appropriate scale, represents adequate treatment using an agent or composition as described herein.


As used herein, the terms “treating” or “treatment” refer to a beneficial or desired result including, but not limited to, alleviation or amelioration of one or more signs or symptoms associated with SFRP1 gene expression or SFRP1 protein production. “Treatment” can also mean prolonging survival as compared to expected survival in the absence of treatment.


D. Combination Methods

The present invention further provides combination methods to stimulate hair growth. In some embodiments, treatment with a site-specific SFRP1 disrupting agent suppressing expression of SFRP1 can be combined with other hair growth products, for example, JAK inhibitors and/or minoxidil. Minoxidil may prolong anagen phase and increase hair follicle size when administered topically. JAK inhibitors may result in hair follicles re-entry into anagen state and promote rapid hair growth.


The present invention is next described by means of the following examples. However, the use of these and other examples anywhere in the specification is illustrative only, and in no way limits the scope and meaning of the invention or of any exemplified form. The invention is not limited to any particular preferred embodiments described herein. Many modifications and variations of the invention may be apparent to those skilled in the art and can be made without departing from its spirit and scope. The contents of all references, patents and published patent applications cited throughout this application, including the figures and informal sequence listing, are incorporated herein by reference.


EXAMPLES
Example 1. Modulation of SFRP1 Expression

This example describes the guide RNA (guides) directed to the SFRP1 insulated genomic domain (IGD) to modulate the expression of SFRP1. FIG. 1 depicts the SFRP1 IGD where SFRP1 is in the middle and the regions upstream and downstream of the gene are shown. The guide RNAs GD29758 and GD29761 are shown to target regions on either side of the SFRP1 gene.


Human Dermal Neonatal Foreskin and GM017117 Fibroblast cells were transfected with RNA guides using the Cas9 system, dCas9-effector system, and safe harbor transfection control. The primary goal of this screen is to see downregulation of SFRP1 mRNA in both cell lines in order to inform our decision upon which guide and effector combination should be screened in our cell line of interest (hair follicle dermal papilla cell line; Promocell). Finally, as a control, untreated cells alone will be used for normalization of SFRP1 gene expression.


In this example, 10,000 cells per well were plated into a 24 well plate. Guides 29754-29767 were dosed at 1.25 ug/mL (FIGS. 2A and 2B). The nucleotide sequences of the guide RNAs are provided in Table 3, below. Pooled promoter guides and safe harbor guides were transfected at 1.25 ug/mL and 0.625 ug/mL. Both cell lines were taken down after 72 hours for RT-qPCR analysis of the SFRP1 mRNA. RNA was extracted using the Macherey-Nagel 96 RNA kit according to the manufacturer protocol. Once the RNA was isolated, it was reverse transcribed into cDNA via Lunascript Supermix™ (NEB) according to manufacturer's protocol. Next, cDNA was diluted two-fold and was analyzed by quantitative PCR (qPCR). PCR was analyzed with TAQMAN™ Fast Advanced Master Mix (Thermo Scientific) primer/probe set (SFRP1(fam) target probe).


After analyzing the qPCR (excel) and graphing the data (prism) which guides showed downregulation was determined. Guides 29758, 29760, 29761 and promoter guide pooled guides showed down regulation 72 hours after initial transfection of both the Human Dermal Neonatal Foreskin (FIG. 2A) and GM017117 Fibroblasts (FIG. 2B).









TABLE 3







Site-Specific SFRP1 Targeting Moieties (sgRNA)- The first 20 nucleotides in each moiety


below comprise the targeting portion of the moiety.










SEQ



Iden-
ID



tifier
NO.
Modified Nucleotide Sequence 5′ to 3′





GD-
 84
mGs;mGs;mAs;rA;rU;rA;rG;rU;rG;rG;rU;rG;rC;rC;rA;rU;rC;rU;rG;rA;rG;rU;rU;rU;rU;


29754

rA;rG;rA;rG;rC;rU;rA;rG;rA;rA;rA;rU;rA;rG;rC;rA;rA;rG;rU;rU;rA;rA;rA;rA;rU;rA;




rA;rG;rG;rC;rU;rA;rG;rU;rC;rC;rG;rU;rU;rA;rU;rC;rA;rA;rC;rU;rU;rG;rA;rA;rA;rA;




rA;rG;rU;rG;rG;rC;rA;rC;rC;rG;rA;rG;rU;rC;rG;rG;rU;rG;rC;rUs;mUs;mUs;mU





GD-
 85
mAs;mAs;mUs;rG;rC;rC;rA;rC;rC;rC;rA;rC;rG;rC;rA;rA;rG;rG;rA;rG;rG;rU;rU;rU;rU;


29755

rA;rG;rA;rG;rC;rU;rA;rG;rA;rA;rA;rU;rA;rG;rC;rA;rA;rG;rU;rU;rA;rA;rA;rA;rU;rA;




rA;rG;rG;rC;rU;rA;rG;rU;rC;rC;rG;rU;rU;rA;rU;rC;rA;rA;rC;rU;rU;rG;rA;rA;rA;rA;




rU;rG;rG;rC;rA;rC;rC;rG;rA;rG;rU;rC;rG;rG;rU;rG;rC;rUs;mUs;mUs;mUrA;rG;





GD-
 86
mGs;mGs;mCs;rC;rC;rU;rC;rA;rG;rC;rA;rC;rA;rC;rA;rG;rA;rA;rG;rG;rG;rU;rU;rU;rU;


29756

rA;rG;rA;rG;rC;rU;rA;rG;rA;rA;rA;rU;rA;rG;rC;rA;rA;rG;rU;rU;rA;rA;rA;rA;rU;rA;




rA;rG;rG;rC;rU;rA;rG;rU;rC;rC;rG;rU;rU;rA;rU;rC;rA;rA;rC;rU;rU;rG;rA;rA;rA;rA;




rA;rG;rU;rG;rG;rC;rA;rC;rC;rG;rA;rG;rU;rC;rG;rG;rU;rG;rC;rUs;mUs;mUs;mU





GD-
 87
mAs;mUs;mGs;rG;rC;rC;rC;rU;rC;rA;rG;rC;rA;rC;rA;rC;rA;rG;rA;rA;rG;rU;rU;rU;rU;


29757

rA;rG;rA;rG;rC;rU;rA;rG;rA;rA;rA;rU;rA;rG;rC;rA;rA;rG;rU;rU;rA;rA;rA;rA;rU;rA;




rA;rG;rG;rC;rU;rA;rG;rU;rC;rC;rG;rU;rU;rA;rU;rC;rA;rA;rC;rU;rU;rG;rA;rA;rA;rA;




rA;rG;rU;rG;rG;rC;rA;rC;rC;rG;rA;rG;rU;rC;rG;rG;rU;rG;rC;rUs;mUs;mUs;mU





GD-
 88
mCs;mAs;mAs;rU;rA;rC;rC;rA;rG;rG;rA;rG;rG;rG;rA;rC;rC;rU;rG;rC;rG;rU;rU;rU;rU;


29758

rA;rG;rA;rG;rC;rU;rA;rG;rA;rA;rA;rU;rA;rG;rC;rA;rA;rG;rU;rU;rA;rA;rA;rA;rU;rA;




rA;rG;rG;rC;rU;rA;rG;rU;rC;rC;rG;rU;rU;rA;rU;rC;rA;rA;rC;rU;rU;rG;rA;rA;rA;rA;




rA;rG;rU;rG;rG;rC;rA;rC;rC;rG;rA;rG;rU;rC;rG;rG;rU;rG;rC;rUs;mUs;mUs;mU





GD-
 89
mCs;mAs;mUs;rG;rU;rC;rA;rC;rC;rA;rC;rU;rC;rC;rA;rC;rC;rU;rG;rC;rG;rU;rU;rU;rU;


29759

rA;rG;rA;rG;rC;rU;rA;rG;rA;rA;rA;rU;rA;rG;rC;rA;rA;rG;rU;rU;rA;rA;rA;rA;rU;rA;




rA;rG;rG;rC;rU;rA;rG;rU;rC;rC;rG;rU;rU;rA;rU;rC;rA;rA;rC;rU;rU;rG;rA;rA;rA;rA;




rA;rG;rU;rG;rG;rC;rA;rC;rC;rG;rA;rG;rU;rC;rG;rG;rU;rG;rC;rUs;mUs;mUs;mU





GD-
 90
mAs;mGs;mUs;rA;rA;rA;rG;rA;rU;rC;rG;rG;rC;rC;rA;rC;rA;rA;rC;rG;rG;rU;rU;rU;rU;


29760

rA;rG;rA;rG;rC;rU;rA;rG;rA;rA;rA;rU;rA;rG;rC;rA;rA;rG;rU;rU;rA;rA;rA;rA;rU;rA;




rA;rG;rG;rC;rU;rA;rG;rU;rC;rC;rG;rU;rU;rA;rU;rC;rA;rA;rC;rU;rU;rG;rA;rA;rA;rA;




rA;rG;rU;rG;rG;rC;rA;rC;rC;rG;rA;rG;rU;rC;rG;rG;rU;rG;rC;rUs;mUs;mUs;mU





GD-
 91
mGs;mGs;mAs;rA;rG;rC;rU;rG;rC;rA;rG;rA;rC;rC;rG;rG;rC;rA;rG;rA;rG;rU;rU;rU;rU;


29761

rA;rG;rA;rG;rC;rU;rA;rG;rA;rA;rA;rU;rA;rG;rC;rA;rA;rG;rU;rU;rA;rA;rA;rA;rU;rA;




rA;rG;rG;rC;rU;rA;rG;rU;rC;rC;rG;rU;rU;rA;rU;rC;rA;rA;rC;rU;rU;rG;rA;rA;rA;rA;




rA;rG;rU;rG;rG;rC;rA;rC;rC;rG;rA;rG;rU;rC;rG;rG;rU;rG;rC;rUs;mUs;mUs;mU





GD-
 92
mCs;mAs;mCs;rA;rC;rC;rA;rC;rA;rC;rG;rG;rA;rA;rG;rA;rA;rG;rU;rG;rG;rU;rU;rU;rU;


29762

rA;rG;rA;rG;rC;rU;rA;rG;rA;rA;rA;rU;rA;rG;rC;rA;rA;rG;rU;rU;rA;rA;rA;rA;rU;rA;




rA;rG;rG;rC;rU;rA;rG;rU;rC;rC;rG;rU;rU;rA;rU;rC;rA;rA;rC;rU;rU;rG;rA;rA;rA;rA;




rA;rG;rU;rG;rG;rC;rA;rC;rC;rG;rA;rG;rU;rC;rG;rG;rU;rG;rC;rUs;mUs;mUs;mU





GD-
 93
mGs;mAs;mUs;rA;rC;rA;rU;rU;rC;rU;rU;rU;rC;rC;rU;rC;rC;rU;rC;rC;rG;rU;rU;rU;rU;


29763

rA;rG;rA;rG;rC;rU;rA;rG;rA;rA;rA;rU;rA;rG;rC;rA;rA;rG;rU;rU;rA;rA;rA;rA;rU;rA;




rA;rG;rG;rC;rU;rA;rG;rU;rC;rC;rG;rU;rU;rA;rU;rC;rA;rA;rC;rU;rU;rG;rA;rA;rA;rA;




rA;rG;rU;rG;rG;rC;rA;rC;rC;rG;rA;rG;rU;rC;rG;rG;rU;rG;rC;rUs;mUs;mUs;mU





GD-
 94
mUs;mUs;mGs;rA;rG;rA;rA;rU;rC;rC;rC;rU;rU;rU;rA;rC;rC;rU;rG;rG;rG;rU;rU;rU;rU;


29764

rA;rG;rA;rG;rC;rU;rA;rG;rA;rA;rA;rU;rA;rG;rC;rA;rA;rG;rU;rU;rA;rA;rA;rA;rU;rA;




rA;rG;rG;rC;rU;rA;rG;rU;rC;rC;rG;rU;rU;rA;rU;rC;rA;rA;rC;rU;rU;rG;rA;rA;rA;rA;




rA;rG;rU;rG;rG;rC;rA;rC;rC;rG;rA;rG;rU;rC;rG;rG;rU;rG;rC;rUs;mUs;mUs;mU





GD-
 95
mUs;mAs;mCs;rC;rC;rA;rA;rG;rA;rG;rC;rG;rU;rC;rG;rG;rG;rA;rG;rG;rG;rU;rU;rU;rU;


29765

rA;rG;rA;rG;rC;rU;rA;rG;rA;rA;rA;rU;rA;rG;rC;rA;rA;rG;rU;rU;rA;rA;rA;rA;rU;rA;




rA;rG;rG;rC;rU;rA;rG;rU;rC;rC;rG;rU;rU;rA;rU;rC;rA;rA;rC;rU;rU;rG;rA;rA;rA;rA;




rA;rG;rU;rG;rG;rC;rA;rC;rC;rG;rA;rG;rU;rC;rG;rG;rU;rG;rC;rUs;mUs;mUs;mU





GD-
 96
mGs;mGs;mUs;rU;rG;rG;rC;rC;rC;rC;rG;rC;rC;rC;rA;rC;rC;rU;rG;rG;rG;rU;rU;rU;rU;


29766

rA;rG;rA;rG;rC;rU;rA;rG;rA;rA;rA;rU;rA;rG;rC;rA;rA;rG;rU;rU;rA;rA;rA;rA;rU;rA;




rA;rG;rG;rC;rU;rA;rG;rU;rC;rC;rG;rU;rU;rA;rU;rC;rA;rA;rC;rU;rU;rG;rA;rA;rA;rA;




rA;rG;rU;rG;rG;rC;rA;rC;rC;rG;rA;rG;rU;rC;rG;rG;rU;rG;rC;rUs;mUs;mUs;mU





GD-
 97
mGs;mGs;mCs;rG;rG;rG;rG;rA;rC;rU;rG;rU;rC;rU;rU;rC;rG;rC;rG;rG;rG;rU;rU;rU;rU;


29767

rA;rG;rA;rG;rC;rU;rA;rG;rA;rA;rA;rU;rA;rG;rC;rA;rA;rG;rU;rU;rA;rA;rA;rA;rU;rA;




rA;rG;rG;rC;rU;rA;rG;rU;rC;rC;rG;rU;rU;rA;rU;rC;rA;rA;rC;rU;rU;rG;rA;rA;rA;rA;




rA;rG;rU;rG;rG;rC;rA;rC;rC;rG;rA;rG;rU;rC;rG;rG;rU;rG;rC;rUs;mUs;mUs;mU





GD-
 98
mGs;mAs;mCs;rG;rG;rA;rC;rG;rU;rG;rG;rU;rA;rA;rC;rG;rA;rG;rU;rG;rG;rU;rU;rU;rU;


29879

rA;rG;rA;rG;rC;rU;rA;rG;rA;rA;rA;rU;rA;rG;rC;rA;rA;rG;rU;rU;rA;rA;rA;rA;rU;rA;


(pro-

rA;rG;rG;rC;rU;rA;rG;rU;rC;rC;rG;rU;rU;rA;rU;rC;rA;rA;rC;rU;rU;rG;rA;rA;rA;rA;


moter)

rA;rG;rU;rG;rG;rC;rA;rC;rC;rG;rA;rG;rU;rC;rG;rG;rU;rG;rC;rUs;mUs;mUs;mU





GD-
 99
mCs;mGs;mGs;rU;rU;rU;rA;rC;rU;rA;rG;rA;rA;rC;rC;rA;rG;rA;rC;rG;rG;rU;rU;rU;rU;


29880

rA;rG;rA;rG;rC;rU;rA;rG;rA;rA;rA;rU;rA;rG;rC;rA;rA;rG;rU;rU;rA;rA;rA;rA;rU;rA;


(pro-

rA;rG;rG;rC;rU;rA;rG;rU;rC;rC;rG;rU;rU;rA;rU;rC;rA;rA;rC;rU;rU;rG;rA;rA;rA;rA;


moter)

rA;rG;rU;rG;rG;rC;rA;rC;rC;rG;rA;rG;rU;rC;rG;rG;rU;rG;rC;rUs;mUs;mUs;mU





GD-
100
mAs;mAs;mGs;rG;rG;rG;rA;rA;rU;rG;rG;rA;rU;rC;rA;rC;rG;rG;rC;rG;rG;rU;rU;rU;rU;


29881

rA;rG;rA;rG;rC;rU;rA;rG;rA;rA;rA;rU;rA;rG;rC;rA;rA;rG;rU;rU;rA;rA;rA;rA;rU;rA;


(pro-

rA;rG;rG;rC;rU;rA;rG;rU;rC;rC;rG;rU;rU;rA;rU;rC;rA;rA;rC;rU;rU;rG;rA;rA;rA;rA;


moter)

rA;rG;rU;rG;rG;rC;rA;rC;rC;rG;rA;rG;rU;rC;rG;rG;rU;rG;rC;rUs;mUs;mUs;mU





GD-
101
mCs;mCs;mCs;rU;rU;rU;rC;rU;rC;rA;rG;rA;rU;rC;rU;rG;rC;rU;rG;rG;rG;rU;rU;rU;rU;


30209

rA;rG;rA;rG;rC;rU;rA;rG;rA;rA;rA;rU;rA;rG;rC;rA;rA;rG;rU;rU;rA;rA;rA;rA;rU;rA;




rA;rG;rG;rC;rU;rA;rG;rU;rC;rC;rG;rU;rU;rA;rU;rC;rA;rA;rC;rU;rU;rG;rA;rA;rA;rA;




rA;rG;rU;rG;rG;rC;rA;rC;rC;rG;rA;rG;rU;rC;rG;rG;rU;rG;rC;rUs;mUs;mUs;mU





GD-
102
mGs;mAs;mCs;rC;rG;rG;rC;rC;rA;rG;rC;rC;rA;rU;rU;rC;rU;rG;rA;rC;rG;rU;rU;rU;rU;


30210

rA;rG;rA;rG;rC;rU;rA;rG;rA;rA;rA;rU;rA;rG;rC;rA;rA;rG;rU;rU;rA;rA;rA;rA;rU;rA;




rA;rG;rG;rC;rU;rA;rG;rU;rC;rC;rG;rU;rU;rA;rU;rC;rA;rA;rC;rU;rU;rG;rA;rA;rA;rA;




rA;rG;rU;rG;rG;rC;rA;rC;rC;rG;rA;rG;rU;rC;rG;rG;rU;rG;rC;rUs;mUs;mUs;mU





GD-
103
mCs;mCs;mUs;rA;rA;rA;rU;rC;rA;rC;rC;rU;rG;rG;rU;rC;rA;rU;rG;rG;rG;rU;rU;rU;rU;


30211

rA;rG;rA;rG;rC;rU;rA;rG;rA;rA;rA;rU;rA;rG;rC;rA;rA;rG;rU;rU;rA;rA;rA;rA;rU;rA;




rA;rG;rG;rC;rU;rA;rG;rU;rC;rC;rG;rU;rU;rA;rU;rC;rA;rA;rC;rU;rU;rG;rA;rA;rA;rA;




rA;rG;rU;rG;rG;rC;rA;rC;rC;rG;rA;rG;rU;rC;rG;rG;rU;rG;rC;rUs;mUs;mUs;mU





GD-
104
mGs;mCs;mUs;rU;rG;rC;rC;rC;rA;rA;rU;rG;rU;rC;rC;rC;rG;rC;rC;rC;rG;rU;rU;rU;rU;


30212

rA;rG;rA;rG;rC;rU;rA;rG;rA;rA;rA;rU;rA;rG;rC;rA;rA;rG;rU;rU;rA;rA;rA;rA;rU;rA;




rA;rG;rG;rC;rU;rA;rG;rU;rC;rC;rG;rU;rU;rA;rU;rC;rA;rA;rC;rU;rU;rG;rA;rA;rA;rA;




rA;rG;rU;rG;rG;rC;rA;rC;rC;rG;rA;rG;rU;rC;rG;rG;rU;rG;rC;rUs;mUs;mUs;mU





GD-
105
mAs;mAs;mCs;rA;rA;rC;rU;rC;rU;rU;rU;rG;rU;rG;rA;rC;rA;rG;rG;rA;rG;rU;rU;rU;rU;


30213

rA;rG;rA;rG;rC;rU;rA;rG;rA;rA;rA;rU;rA;rG;rC;rA;rA;rG;rU;rU;rA;rA;rA;rA;rU;rA;




rA;rG;rG;rC;rU;rA;rG;rU;rC;rC;rG;rU;rU;rA;rU;rC;rA;rA;rC;rU;rU;rG;rA;rA;rA;rA;




rA;rG;rU;rG;rG;rC;rA;rC;rC;rG;rA;rG;rU;rC;rG;rG;rU;rG;rC;rUs;mUs;mUs;mU





GD-
106
mUs;mAs;mCs;rU;rU;rU;rA;rU;rU;rG;rA;rU;rG;rC;rG;rG;rU;rG;rA;rU;rG;rU;rU;rU;rU;


30214

rA;rG;rA;rG;rC;rU;rA;rG;rA;rA;rA;rU;rA;rG;rC;rA;rA;rG;rU;rU;rA;rA;rA;rA;rU;rA;




rA;rG;rG;rC;rU;rA;rG;rU;rC;rC;rG;rU;rU;rA;rU;rC;rA;rA;rC;rU;rU;rG;rA;rA;rA;rA;




rA;rG;rU;rG;rG;rC;rA;rC;rC;rG;rA;rG;rU;rC;rG;rG;rU;rG;rC;rUs;mUs;mUs;mU





GD-
107
mCs;mAs;mGs;rA;rC;rU;rG;rU;rG;rA;rU;rA;rG;rU;rU;rG;rA;rA;rG;rC;rG;rU;rU;rU;rU;


30215

rA;rG;rA;rG;rC;rU;rA;rG;rA;rA;rA;rU;rA;rG;rC;rA;rA;rG;rU;rU;rA;rA;rA;rA;rU;rA;




rA;rG;rG;rC;rU;rA;rG;rU;rC;rC;rG;rU;rU;rA;rU;rC;rA;rA;rC;rU;rU;rG;rA;rA;rA;rA;




rA;rG;rU;rG;rG;rC;rA;rC;rC;rG;rA;rG;rU;rC;rG;rG;rU;rG;rC;rUs;mUs;mUs;mU





GD-
108
mAs;mGs;mCs;rA;rG;rU;rA;rG;rC;rG;rU;rG;rU;rA;rA;rA;rG;rA;rC;rG;rG;rU;rU;rU;rU;


30216

rA;rG;rA;rG;rC;rU;rA;rG;rA;rA;rA;rU;rA;rG;rC;rA;rA;rG;rU;rU;rA;rA;rA;rA;rU;rA;




rA;rG;rG;rC;rU;rA;rG;rU;rC;rC;rG;rU;rU;rA;rU;rC;rA;rA;rC;rU;rU;rG;rA;rA;rA;rA;




rA;rG;rU;rG;rG;rC;rA;rC;rC;rG;rA;rG;rU;rC;rG;rG;rU;rG;rC;rUs;mUs;mUs;mU





GD-
109
mGs;mCs;mGs;rG;rU;rG;rC;rG;rG;rA;rA;rA;rG;rA;rU;rC;rA;rU;rG;rG;rG;rU;rU;rU;rU;


30217

rA;rG;rA;rG;rC;rU;rA;rG;rA;rA;rA;rU;rA;rG;rC;rA;rA;rG;rU;rU;rA;rA;rA;rA;rU;rA;




rA;rG;rG;rC;rU;rA;rG;rU;rC;rC;rG;rU;rU;rA;rU;rC;rA;rA;rC;rU;rU;rG;rA;rA;rA;rA;




rA;rG;rU;rG;rG;rC;rA;rC;rC;rG;rA;rG;rU;rC;rG;rG;rU;rG;rC;rUs;mUs;mUs;mU





GD-
110
mGs;mAs;mCs;rU;rU;rC;rC;rG;rA;rA;rA;rG;rU;rG;rU;rU;rC;rA;rA;rG;rG;rU;rU;rU;rU;


30218

rA;rG;rA;rG;rC;rU;rA;rG;rA;rA;rA;rU;rA;rG;rC;rA;rA;rG;rU;rU;rA;rA;rA;rA;rU;rA;




;rArG;rG;rC;rU;rA;rG;rU;rC;rC;rG;rU;rU;rA;rU;rC;rA;rA;rC;rU;rU;rG;rA;rA;rA;rA;




rA;rG;rU;rG;rG;rC;rA;rC;rC;rG;rA;rG;rU;rC;rG;rG;rU;rG;rC;rUs;mUs;mUs;mU





GD-
111
mCs;mUs;mUs;rC;rA;rU;rG;rA;rA;rG;rA;rU;rC;rU;rG;rC;rA;rG;rC;rG;rG;rU;rU;rU;rU;


30219

rA;rG;rA;rG;rC;rU;rA;rG;rA;rA;rA;rU;rA;rG;rC;rA;rA;rG;rU;rU;rA;rA;rA;rA;rU;rA;




rA;rG;rG;rC;rU;rA;rG;rU;rC;rC;rG;rU;rU;rA;rU;rC;rA;rA;rC;rU;rU;rG;rA;rA;rA;rA;




rA;rG;rU;rG;rG;rC;rA;rC;rC;rG;rA;rG;rU;rC;rG;rG;rU;rG;rC;rUs;mUs;mUs;mU





GD-
112
mUs;mCs;mAs;rG;rG;rU;rA;rU;rG;rA;rG;rA;rA;rU;rC;rG;rU;rC;rC;rU;rG;rU;rU;rU;rU;


30220

rA;rG;rA;rG;rC;rU;rA;rG;rA;rA;rA;rU;rA;rG;rC;rA;rA;rG;rU;rU;rA;rA;rA;rA;rU;rA;




rA;rG;rG;rC;rU;rA;rG;rU;rC;rC;rG;rU;rU;rA;rU;rC;rA;rA;rC;rU;rU;rG;rA;rA;rA;rA;




rA;rG;rU;rG;rG;rC;rA;rC;rC;rG;rA;rG;rU;rC;rG;rG;rU;rG;rC;rUs;mUs;mUs;mU





GD-
113
mCs;mUs;mGs;rG;rA;rG;rC;rA;rU;rU;rC;rA;rU;rG;rG;rA;rA;rC;rG;rG;rG;rU;rU;rU;rU;


30221

rA;rG;rA;rG;rC;rU;rA;rG;rA;rA;rA;rU;rA;rG;rC;rA;rA;rG;rU;rU;rA;rA;rA;rA;rU;rA;




rA;rG;rG;rC;rU;rA;rG;rU;rC;rC;rG;rU;rU;rA;rU;rC;rA;rA;rC;rU;rU;rG;rA;rA;rA;rA;




rA;rG;rU;rG;rG;rC;rA;rC;rC;rG;rA;rG;rU;rC;rG;rG;rU;rG;rC;rUs;mUs;mUs;mU





GD-
114
mGs;mGs;mAs;rA;rU;rU;rC;rC;rG;rC;rA;rC;rU;rC;rU;rC;rA;rC;rA;rA;rG;rU;rU;rU;rU;


30222

rA;rG;rA;rG;rC;rU;rA;rG;rA;rA;rA;rU;rA;rG;rC;rA;rA;rG;rU;rU;rA;rA;rA;rA;rU;rA;




rA;rG;rG;rC;rU;rA;rG;rU;rC;rC;rG;rU;rU;rA;rU;rC;rA;rA;rC;rU;rU;rG;rA;rA;rA;rA;




rA;rG;rU;rG;rG;rC;rA;rC;rC;rG;rA;rG;rU;rC;rG;rG;rU;rG;rC;rUs;mUs;mUs;mU





GD-
115
mUs;mGs;mGs;rA;rG;rA;rA;rA;rU;rA;rG;rA;rG;rC;rC;rG;rG;rG;rC;rA;rG;rU;rU;rU;rU;


30223

rA;rG;rA;rG;rC;rU;rA;rG;rA;rA;rA;rU;rA;rG;rC;rA;rA;rG;rU;rU;rA;rA;rA;rA;rU;rA;




rA;rG;rG;rC;rU;rA;rG;rU;rC;rC;rG;rU;rU;rA;rU;rC;rA;rA;rC;rU;rU;rG;rA;rA;rA;rA;




rA;rG;rU;rG;rG;rC;rA;rC;rC;rG;rA;rG;rU;rC;rG;rG;rU;rG;rC;rUs;mUs;mUs;mU





GD-
116
mGs;mCs;mUs;rU;rG;rC;rC;rC;rA;rA;rU;rG;rU;rC;rC;rC;rG;rC;rC;rC;rG;rU;rU;rU;rU;


30212

rA;rG;mA;mG;mC;mU;mA;mG;mA;mA;mA;mU;mA;mG;rC;rA;rA;rG;rU;rU;rA;rA;rA;


in

rA;rU;rA;rA;rG;rG;rC;rU;rA;rG;rU;rC;rC;rG;rU;rU;rA;rU;rC;mA;mA;mC;mU;mU;mG


vivo

;mA;mA;mA;mA;mA;mG;mU;mG;mG;mC;mA;mC;mC;mG;mA;mG;mU;mC;mG;mG;




mU;mG;mC;mUs;mUs;mUs;mU









Example 2. Modulation of SFRP1 Expression Using dCas9-MQ1 and dCas9-KRAB

This example describes the screening process for guide and effector combinations in hair follicle dermal papilla cells. Guide and effector combinations were screened in HFDPC with 1 ug of GD29758, 29761, 29879, or 29881 with dCas9-MQ1, dCas9-KRAB, Cas9 or GFP (control). Targeting the SFRP1 IGD with DNA methyltransferase (MQ1) or DNA repressor krüpple associate box domain (KRAB). SFRP1 mRNA expression was measured relative to cells untreated and normalized to Abl1.


The results showed that SFRP1 expression can be downregulated in hair follicle dermal papilla cells (FIG. 3). dCas9-MQ1 guides showed the highest percentage of SFRP1 mRNA downregulation, with Promoter GD29879 dCas9-MQ1 downregulating by 95% as compared to untreated cells. This same promoter guide, GD29879 paired with dCas9-KRAB showed a similar level of downregulation as compared to untreated cells. GD29758 paired with dCas-MQ1 or dCas9-KRAB downregulated SFRP1 by 85% and 16.5%, respectively, as compared to untreated cells. GD29761 paired with dCas-MQ1 or dCas9-KRAB downregulated SFRP1 by 79% and 55%, respectively, as compared to untreated cells. GD29881 paired with dCas-MQ1 or dCas9-KRAB downregulated SFRP1 by 86% and 76.4%, respectively, as compared to untreated cells. GFP was used as a transfection control and showed no downregulation when compared to cells untreated. Similarly, Cas9 with guides, showed approximately 10% downregulation.









TABLE 4







Abbreviations of nucleotide monomers used in nucleic


acid sequence representation. It will be understood


that these monomers, when present in an oligonucleotide,


are mutually linked by 5′-3′-phosphodiester bonds.










Abbreviation
Nucleotide(s)







A
Adenosine-3′-phosphate



As
adenosine-3′-phosphorothioate



C
cytidine-3′-phosphate



Cs
cytidine-3′-phosphorothioate



G
guanosine-3′-phosphate



Gs
guanosine-3′-phosphorothioate



U
Uridine-3′-phosphate



Us
uridine-3′-phosphorothioate



N
any nucleotide, modified or unmodified



mA
2′-O-methyladenosine-3′-phosphate



mAs
2′-O-methyladenosine-3′-phosphorothioate



mC
2′-O-methylcytidine-3′-phosphate



mCs
2′-O-methylcytidine-3′-phosphorothioate



mG
2′-O-methylguanosine-3′-phosphate



mGs
2′-O-methylguanosine-3′-phosphorothioate



mU
2′-O-methyluridine-3′-phosphate



mUs
2′-O-methyluridine-3′-phosphorothioate



s
phosphorothioate linkage



r
ribonucleotide










Example 3. Guide RNAs Focusing on Left CTCF

As described in Examples 1 and 2, the sites of effective repression of the SFRP1 gene were identified using dCas9 fusion proteins and guides directed to the CTCF region to the left of the SFRP1 gene. Based on this data, new RNA guides were designed in the region labeled 655. FIG. 4 depicts the CTCF region to the left of the SFRP1 gene.


New guides and effector combinations targeting the SFRP1 IGD were screened. Down-regulation of SFRP1 mRNA expression was observed with guides and dCas-effectors DNA methyltransferase (MQ1), histone deacetylase (HDAC8), or histone methyltransferase (EZH2 and G9A). Targeting SFRP1 IGD and achieving a mRNA down-regulation of 20% will promote the pre-mitotic pathways in the hair follicle dermal papilla. This is a validated target for hair growth.


GD29764, GD30213, GD30219, GD30211 and GD30212 were screened with 4 different effectors (e.g., dCas9-MQ1, dCas9-HDAC8, dCas9-EZH2, dCas9-KRAB, and dCas9-G9A). GD29764, GD30213, and GD30219 target the right CTCF. GD30211 and GD30212 target the left CTCF at different distances from the CTCF motif, and showed strong downregulation with MQ1 and EZH2 (FIG. 5). The mRNAs encoding GD29764, GD30213, GD30219, GD30211, GD30212, GFP and their various fused infectors were formulated in MC3. Hair follicle dermal papilla were seeded at 80% (5,000 cells/well) confluence in a 96-well plate in HFDP growth medium (Promocell, C-26502) and were allowed to grow to 100% confluence. LNP formulations (Nanoassemblr® Spark™; 2 ug/mL) were then added to the cells in triplicate and were incubated for 6 hours. After 6 hours, all wells received a full media change, and then were left to grow for 4 days. On day 4, the cells were taken down and were processed via Macherey-Nagel 96 Nucleospin RNA kits, in order to isolate RNA from whole cell lysate. RNA samples were retrotranscribed to cDNA using LunaScript RT SuperMix (NEB) and analyzed by quantitative PCR (qPCR) (technical replicates ran on a 384 well qPCR plate and with 2 house keepers per plate). PCR was analyzed with TAQMAN™ Fast Advanced Master Mix (Thermo Scientific) primer/probe set (SFRP1(fam) target probe and GAPDH/Abl1(vic) HK probes). SFRP1 expression was quantified relative to the expression of GAPDH and Abl1, separately using the ΔΔCt method, and untreated samples as negative controls.


These data showed that GD30211 and GD30212 were able to downregulate the expression of SFRP1 mRNA by as much as 50% when used in combination with EZH2 and MQ1 (FIG. 5). HDAC8 and G9A also showed similar levels of downregulation; this comes out to be ˜40% decrease in expression when compared to cells untreated. Finally, the GD30211 and GD30212 EZH2 and MQ1 treatments were able to downregulate the expression of SFRP1 mRNA by approximately 25% more than seen in GFP treated cells.















TABLE 5A





Column 1


Column 4





Exemplary
Column 2
Column 3
Sequence of
Column 5
Column 6


SFRP1
Amino Acid
Nucleotide
Target Site in
Amino Acid
Nucleotide
Column 7


Disrupting Agents
Sequence
Sequence
SFRP1 Expression
Sequence of the
Sequence of the
Genomic Coordinates of the


Comprising a
of the
of the
Control Region
DNA Binding
DNA Binding
Target Site in the SFRP1


Zinc Finger
Disrupting
Disrupting
Targeted by the
Domain of the
Domain of the
Expression Control Region


DNA Binding
Agent in
Agents
Disrupting Agents
Disrupting Agent
Disrupting Agent
(Genome Reference Consortium


Domain and an
Column 1
in Column 1
in Column 1
in Column 1
in Column 1
Human Build 37


Effector Name
(SEQ ID NO:)
(SEQ ID NO).
(SEQ ID NO.)
(SEQ ID NO.)
(SEQ ID NO.)
(GRCh37): Chromosome 8)





















ZF01-MQ1
120
135
150
153
156
GRCh37: chr8: 41003852-41003872


ZF02-MQ1
121
136
151
154
157
GRCh37: chr8: 41003954-41003974


ZF03-MQ1
122
137
152
155
158
GRCh37: chr8: 41004002-41004022


ZF01-NE
123
138
150
153
156
GRCh37: chr8: 41003852-41003872


ZF02-NE
124
139
151
154
157
GRCh37: chr8: 41003954-41003974


ZF03-NE
125
140
152
155
158
GRCh37: chr8: 41004002-41004022


ZF01-G9A
126
141
150
153
156
GRCh37: chr8: 41003852-41003872


ZF02-G9A
127
142
151
154
157
GRCh37: chr8: 41003954-41003974


ZF03-G9A
128
143
152
155
158
GRCh37: chr8: 41004002-41004022


ZF01-EZH2
129
144
150
153
156
GRCh37: chr8: 41003852-41003872


ZF02-EZH2
130
145
151
154
157
GRCh37: chr8: 41003954-41003974


ZF03-EZH2
131
146
152
155
158
GRCh37: chr8: 41004002-41004022


ZF01-HDAC8
132
147
150
153
156
GRCh37: chr8: 41003852-41003872


ZF02-HDAC8
133
148
151
154
157
GRCh37: chr8: 41003954-41003974


ZF03-HDAC8
134
149
152
155
158
GRCh37: chr8: 41004002-41004022


ZF03-KRAB
303
301
152
155
158
GRCh37: chr8: 41004002-41004022



















TABLE 5B








Column 4





Amino acid



Column 2
Column 3
Sequence


Column 1
Amino acid
Nucleotide
of DNA Binding


Exemplary Effector
sequence
sequence
Domain of the


Fusion Protein of
of the Effector
of the Effector
Effector


Exemplary SFRP1
Fusion Protein
Fusion Protein
Fusion Protein


Disrupting Agents
in Column 1
in Column 1
in Column 1


Name
(SEQ ID NO:)
(SEQ ID NO:)
(SEQ ID NO:)







dCas9-MQ1
195
201
171


dCas9
196
202
171


dCas9-KRAB
197
203
171


G9A-dCas9
198
204
171


EZH2-dCas9
199
205
171


dCas9-HDAC8
200
206
171









Example 4. Durability of SFRP1 Downregulation Using Guides Targeting the Left CTCF Using MQ1, G9A, EZH2 and HDAC8

This example describes the effect of GD30211 and GD30212 (targeting left CTCF at different distances from the CTCF motif) with various effectors and their ability to downregulate the mRNA expression of SFRP1 in Hair Follicle Dermal Papilla Cells. Effectors include DNA methyltransferase (MQ1), histone deacetylase (HDAC8), histone methyltransferase (EZH2 and G9A) as well as a positive GFP control (FIG. 6). Cells were treated for 6 hours at 2 ug/mL and were allowed to grow for 168 hours with fresh media (PromoCell, C-26502). RT-qPCR was ran and analyzed on RNA lysate in order to determine the percent of SFRP1 downregulation achieved by GD30211/12 and four different effectors and how durable the effect is. Targeting SFRP1 IGD and achieving a mRNA down-regulation of 20% will promote pre-mitotic pathways in the hair follicle dermal papilla. This is a validated target for hair growth.


Hair Follicle Dermal Papilla and were transfected with two guides targeting the left CTCF (GD30211/12) and used various effectors in order to methylate, deacetylate and demethylate at the targeted areas. The primary goal of this experiment is to determine how durable the effect of SFRP1 downregulation would be using 2 ug/mL dose of various guide and effector combinations. Cells were plated in 96 well plate format at 80% confluence and were allowed to grow to 100% confluence before transfection. LNPs were formulated (Nanoassemblr® Spark™) using MC3 lipid and were transfected at 2 ug/mL in 100 uL of total HFDP media (PromoCell). Cells were harvested according to manufacturer's protocol (PromoCell) and were processed by Nucleospin 96 RNA kit by Macherey-Nagel.


These data show a durability of effect 168 hours after the initial 2 ug/mL transfection. GD30212 (closer to the CTCF) shows further downregulation than GD30211 when used in combination with dCas-9 fusion effectors G9A, EZH2 or HDAC8 (FIG. 6).


Example 5. Modulation of SFRP-1 Expression by ZFs Fusion Proteins in Primary HFDP Cells


FIG. 7A Hi-glass data showing the location of SFRP1 IGD with left CTCF and right CTCF looping interaction and 3D contact. FIG. 7B depicts the location of various guides targeting the CTCF motifs and the ZF controllers designed around the location of these various guide location.


This example describes down-regulating SFRP1 expression by using MR-30825 (ZF1-G9A), MR-30826 (ZF2-G9A), MR-30827 (ZF3-G9A), MR-30828 (ZF1-EZH2), MR-30829 (ZF2-EZH2), MR-30830 (ZF3-EZH2), MR-30831 (ZF1-HDAC8), MR-30832 (ZF2-HDAC8), MR-30833 (ZF3-HDAC8).


Hair follicle dermal papilla cells were transfected with a 2 ug/mL dose of each of the combinations for 6 hours, followed by a media change (PromoCell, C-26502), and take-down 3 days after initial transfection. Controls include cells untreated, GFP, GD30219 (right CTCF) and dCas9-GD30211 (left CTCF). All LNPs for this experiment were formulated (Nanoassemblr® Spark™) in MC3 lipid. This experiment was run in three different Hair follicle dermal papilla donors (12 year old female; Lot #454Z019.12, 54 year old male; Lot #406Z003.2, and a 79 year old female; Lot #453Z010 donors). The data shown here is from the 12 year old donor and is representative of the trend of downregulation in both the 54 year old donor and the 70 year old donor.


GD30219 alone did not show any downregulation, as expected, indicating that GD30219 has no steric effect on SFRP1 CTCF and therefore does not affect the expression of SFRP1 (FIG. 8). GFP showed no downregulation as well. dCas9-GD30211 treatment has the same intention as GD30219 and exhibits less than 10% downregulation in this treatment group. The strongest down regulation occurs when ZFs 1-3 are used in combination with EZH2.


Example 6. Modulation of SFRP1 Expression with ZF-MQ1 Controllers in Hair Follicle Dermal Papilla Donors from a 12 Year Old Female Donor

This example describes the screening process of ZFs 1-3 alone, and in combination with MQ1, in a 12 y/o HFDPC donor (PromoCell; Lot #454Z019.12). The downregulation of SFRP1 was measured at day 3 and at day 7 using RT-qPCR analysis. MR-30884 (ZF1-MQ1), MR-30885 (ZF2-MQ1), MR-30886 (ZF3-MQ1), MR-30887 (ZF1-No Effector), MR-30888 (ZF2-No effector), MR-30889 (ZF3-No effector) and GFP were all formulated (Nanoassemblr® Spark™) with MC3 lipid. The cells were taken down at day 3 and day 7 for RT-qPCR analysis of SFRP1 expression.


Hair follicle dermal papilla cells were plated into a 96 well plate at 80% confluence (5,000 cells) and were allowed to grow to 100% confluence. HFDPC were then transfected with MR-30884, 30885, 30886, 30887, 30888, 30889 and GFP for 6 hours. After 6 hours, the cells had their media (PromoCell, C-26502) refreshed and were allowed to grow for 3 days and 7 days. Once the respective time point was reached, the cells were taken down and processed using the Macherey-Nagel 96 RNA kits on the Tecan Resolvex® A200 for high throughput processing. RNA was isolated from whole cell lysate and was retrotranscribed into cDNA using Lunascript® RT SuperMix (NEB) and analyzed via quantitative PCR (qPCR) with technical replicates.


The produced data from RT-qPCR from the isolated RNA from treated HFDP showed a strong downregulation of SFRP1 (˜75% downregulation) for each of the ZFs in combination with MQ1. As expected, ZFs 1-3 with no effector show no downregulation as compared to cells in the 3 day data. At Day 7, SFRP1 gene expression was suppressed and maintained with ZF1-3-MQ1 in donor 1 and ZF1-MQ1 and ZF3-MQ1 maintained durability of gene down regulation in donor 2. This shows a strong durability of effect for methylation.


Example 7. Bisulfite Sequencing of CTCF Methylation with ZF-MQ1 Controller

Bisulfite sequencing was performed on hair follicle dermal papilla cells after transfecting with MR-30884-30889 (MR-30884 (ZF1-MQ1), MR-30885 (ZF2-MQ1), MR-30886 (ZF3-MQ1), MR-30887 (ZF1-No Effector), MR-30888 (ZF2-No effector), MR-30889 (ZF3-No effector)) at 2 ug/mL. This data represents 3 days of growth after a 6 hour transfection. Once the time point was reached, the cells were taken down and processed. DNA was isolated from HFDPC via Lucigen Masterpure™ DNA kit and DNA pellets were processed by the genomics team following the Zymogen Lightning™ BSS Protocol.


Cells were plated at 80% confluence in 6 well plates (Costar) and were allowed to grow to 100% confluence before being transfected with a 2 ug/mL dose formulated (Nanoassemblr® Spark™) in MC3. Cells were treated for 6 hours and then had their media refreshed (PromoCell, C-26502). These cells were allowed to grow for three days and were taken down for processing via the Lucigen kit. DNA pellets were produced by the end of the protocol and were frozen down for processing via the genomics team. Bisulfite sequencing data shows DNA methylation using MR-30884 and MR-30885 after 2 days. MR-30888 (ZF2-NE) shows no DNA methylation.


Example 8. Lipid Formulations are Enabled to Penetrate Deeper Layers of the Hair Bulb and Shaft and Show Delivery to Hair Follicle Dermal Papilla (HFDP) Cells

The ability of formulations to penetrate the multiple layers of the hair follicle and show protein production via mRNA transduction is investigated in ex vivo isolated hair follicle model (FIGS. 12A-12F). Two Omega formulations with DOTAP as the cationic lipid were prepared with Cy-5 labelling of the LNPs. GFP mRNA is encapsulated in the formulations as the reporter mRNA. Fluorescence signals of Cy5 and GFP is monitored and imaged 72 h following treatment of the hair follicles. In the images, white color indicates Cy-5 and green color indicates GFP signal. DOTAP 3451 (FIGS. 12A-12C) formulation with slight positive charge and less than 100 nm size was able to penetrate moderately into the hair bulb and interact with the cells in the DP region as can be seen from FIG. 12A. FIG. 12B indicates the GFP protein production and confirms the active mRNA delivery to target DP cells. DOTAP 4750 (FIGS. 12D-12F) formulation with very high positive charge and 180-200 nm size was able to show good penetration into DP region as demonstrated in FIG. 12D. FIG. 12E shows strong GFP signal in the DP cells and confirms the high transfection of target cell population.


Moreover, FIGS. 12C and 12F shows the overall GFP signal in the hair follicle following treatment with DOTAP 3541 and DOTAP 4750, respectively. As can be seen in the images, high positively charged DOTAP formulations generated a very strong signal in all layers of the hair shaft and bulb. These results suggest the positive charge and DOTAP chemistry of the LNPs are the driving forces for both penetration and transfection of different cell layers in the hair follicles. Lower panels in FIGS. 12A, 12B, 12D, and 12E show the zoomed in areas of indicated with squares in the upper panel images.


Table 6 below provides exemplary target nucleotide sequences and corresponding sgRNA nucleotide sequences suitable for use in the present invention.















TABLE 6





Genomic








Coordinates 








of the Target








Start Site in








Genome








Reference








Consortium








Human Build








37 (GRCh37):


SEQ


SEQ


Chromosome

Target
ID


ID


8)
Strand
sequence
NO
PAM
sgRNA sequence
NO







40983802-
−1
GGAATAGTGGTGC
213
TGG
GGAATAGTGGTGCCATCTGAGTTTTAGAGCTAGAAATAGC
246


40983824

CATCTGA


AAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGT








GGCACCGAGTCGGTGCTTTT






40983884-
−1
AATGCCACCCACG
214
GGG
AATGCCACCCACGCAAGGAGGTTTTAGAGCTAGAAATAGC
247


40983906

CAAGGAG


AAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGT








GGCACCGAGTCGGTGCTTTT






40983980-
−1
GGCCCTCAGCACA
215
GGG
GGCCCTCAGCACACAGAAGGGTTTTAGAGCTAGAAATAGC
248


40984002

CAGAAGG


AAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGT








GGCACCGAGTCGGTGCTTTT






40983982-
−1
ATGGCCCTCAGCA
216
GGG
ATGGCCCTCAGCACACAGAAGTTTTAGAGCTAGAAATAGC
249


40984004

CACAGAA


AAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGT








GGCACCGAGTCGGTGCTTTT






41004038-
 1
CAATACCAGGAG
217
AGG
CAATACCAGGAGGGACCTGCGTTTTAGAGCTAGAAATAGC
250


41004060

GGACCTGC


AAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGT








GGCACCGAGTCGGTGCTTTT






41004053-
−1
CATGTCACCACTC
218
AGG
CATGTCACCACTCCACCTGCGTTTTAGAGCTAGAAATAGC
251


41004075

CACCTGC


AAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGT








GGCACCGAGTCGGTGCTTTT






41004141-
 1
AGTAAAGATCGG
219
GGG
AGTAAAGATCGGCCACAACGGTTTTAGAGCTAGAAATAGC
252


41004163

CCACAACG


AAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGT








GGCACCGAGTCGGTGCTTTT






41261807-
−1
GGAAGCTGCAGA
220
GGG
GGAAGCTGCAGACCGGCAGAGTTTTAGAGCTAGAAATAG
253


41261829

CCGGCAGA


CAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAG








TGGCACCGAGTCGGTGCTTTT






41261830-
 1
CACACCACACGG
221
GGG
CACACCACACGGAAGAAGTGGTTTTAGAGCTAGAAATAGC
254


41261852

AAGAAGTG


AAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGT








GGCACCGAGTCGGTGCTTTT






41261861-
 1
GATACATTCTTTC
222
AGG
GATACATTCTTTCCTCCTCCGTTTTAGAGCTAGAAATAGCA
255


41261883

CTCCTCC


AGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTG








GCACCGAGTCGGTGCTTTT






41261876-
−1
TTGAGAATCCCTT
223
AGG
TTGAGAATCCCTTTACCTGGGTTTTAGAGCTAGAAATAGC
256


41261898

TACCTGG


AAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGT








GGCACCGAGTCGGTGCTTTT






41386491-
−1
TACCCAAGAGCGT
224
GGG
TACCCAAGAGCGTCGGGAGGGTTTTAGAGCTAGAAATAGC
257


41386513

CGGGAGG


AAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGT








GGCACCGAGTCGGTGCTTTT






41386546-
−1
GGTTGGCCCCGCC
225
GGG
GGTTGGCCCCGCCCACCTGGGTTTTAGAGCTAGAAATAGC
258


41386568

CACCTGG


AAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGT








GGCACCGAGTCGGTGCTTTT






41386618-
−1
GGCGGGGACTGTC
226
CGG
GGCGGGGACTGTCTTCGCGGGTTTTAGAGCTAGAAATAGC
259


41386640

TTCGCGG


AAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGT








GGCACCGAGTCGGTGCTTTT






41167057-
−1
GACGGACGTGGT
227
CGG
GACGGACGTGGTAACGAGTGGTTTTAGAGCTAGAAATAGC
260


41167079

AACGAGTG


AAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGT








GGCACCGAGTCGGTGCTTTT






41167119-
 1
CGGTTTACTAGAA
228
CGG
CGGTTTACTAGAACCAGACGGTTTTAGAGCTAGAAATAGC
261


41167141

CCAGACG


AAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGT








GGCACCGAGTCGGTGCTTTT






41167219-
 1
AAGGGGAATGGA
229
TGG
AAGGGGAATGGATCACGGCGGTTTTAGAGCTAGAAATAG
262


41167241

TCACGGCG


CAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAG








TGGCACCGAGTCGGTGCTTTT






41003641-
 1
CCCTTTCTCAGAT
230
AGG
CCCTTTCTCAGATCTGCTGGGTTTTAGAGCTAGAAATAGCA
263


41003663

CTGCTGG


AGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTG








GCACCGAGTCGGTGCTTTT






41003719-
 1
GACCGGCCAGCC
231
AGG
GACCGGCCAGCCATTCTGACGTTTTAGAGCTAGAAATAGC
264


41003741

ATTCTGAC


AAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGT








GGCACCGAGTCGGTGCTTTT






41003861-
−1
CCTAAATCACCTG
232
TGG
CCTAAATCACCTGGTCATGGGTTTTAGAGCTAGAAATAGC
265


41003883

GTCATGG


AAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGT








GGCACCGAGTCGGTGCTTTT






41003936-
 1
GCTTGCCCAATGT
233
AGG
GCTTGCCCAATGTCCCGCCCGTTTTAGAGCTAGAAATAGC
266


41003958

CCCGCCC


AAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGT








GGCACCGAGTCGGTGCTTTT






41004234-
 1
AACAACTCTTTGT
234
AGG
AACAACTCTTTGTGACAGGAGTTTTAGAGCTAGAAATAGC
267


41004256

GACAGGA


AAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGT








GGCACCGAGTCGGTGCTTTT






41004347-
 1
TACTTTATTGATG
235
CGG
TACTTTATTGATGCGGTGATGTTTTAGAGCTAGAAATAGC
268


41004369

CGGTGAT


AAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGT








GGCACCGAGTCGGTGCTTTT






41004411-
 1
CAGACTGTGATAG
236
AGG
CAGACTGTGATAGTTGAAGCGTTTTAGAGCTAGAAATAGC
269


41004433

TTGAAGC


AAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGT








GGCACCGAGTCGGTGCTTTT






41261400-
 1
AGCAGTAGCGTGT
237
GGG
AGCAGTAGCGTGTAAAGACGGTTTTAGAGCTAGAAATAGC
270


41261422

AAAGACG


AAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGT








GGCACCGAGTCGGTGCTTTT






41261498-
 1
GCGGTGCGGAAA
238
TGG
GCGGTGCGGAAAGATCATGGGTTTTAGAGCTAGAAATAGC
271


41261520

GATCATGG


AAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGT








GGCACCGAGTCGGTGCTTTT






41261593-
−1
GACTTCCGAAAGT
239
AGG
GACTTCCGAAAGTGTTCAAGGTTTTAGAGCTAGAAATAGC
272


41261615

GTTCAAG


AAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGT








GGCACCGAGTCGGTGCTTTT






41261706-
−1
CTTCATGAAGATC
240
TGG
CTTCATGAAGATCTGCAGCGGTTTTAGAGCTAGAAATAGC
273


41261728

TGCAGCG


AAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGT








GGCACCGAGTCGGTGCTTTT






41261996-
−1
TCAGGTATGAGAA
241
GGG
TCAGGTATGAGAATCGTCCTGTTTTAGAGCTAGAAATAGC
274


41262018

TCGTCCT


AAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGT








GGCACCGAGTCGGTGCTTTT






41262076-
−1
CTGGAGCATTCAT
242
AGG
CTGGAGCATTCATGGAACGGGTTTTAGAGCTAGAAATAGC
275


41262098

GGAACGG


AAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGT








GGCACCGAGTCGGTGCTTTT






41262213-
−1
GGAATTCCGCACT
243
TGG
GGAATTCCGCACTCTCACAAGTTTTAGAGCTAGAAATAGC
276


41262235

CTCACAA


AAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGT








GGCACCGAGTCGGTGCTTTT






41262278-
 1
TGGAGAAATAGA
244
TGG
TGGAGAAATAGAGCCGGGCAGTTTTAGAGCTAGAAATAG
277


41262300

GCCGGGCA


CAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAG








TGGCACCGAGTCGGTGCTTTT






41003936-
 1
GCTTGCCCAATGT
245
AGG
GCTTGCCCAATGTCCCGCCCGTTTTAGAGCTAGAAATAGC
278


41003958

CCCGCCC


AAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGT








GGCACCGAGTCGGTGCTTTT









In some embodiments, the guide RNA is GD-28662 (GGGGCCACTAGGGACAGGAT (SEQ ID NO: 313)) targeting the safe harbor locus at GRCh37: chr19:55627120-55627139.


In some embodiments, the linker has the amino acid sequence of THPRAPIPKPFQ (SEQ ID NO: 311). In other embodiments, the linker has the amino acid sequence of TPNPHRRTDPSHKPFQ (SEQ ID NO: 312).


Example 9. SFRP1 mRNA and Protein Downregulation in Human Microdissected Hair

Human microdissected hair follicles were transformed with ZF1-MQ1 or control empty lipid nanoparticle (FIG. 13A). Four days after treatment, the hair follicle cells were harvested and SFRP1 mRNA was determined using qPRC analysis (FIG. 13B). SFRP1 mRNA expression decreased about 25% when treated with ZF1-MQ1 compared to treatment with the control vector. Quantification of SFRP1 protein levels shows a decrease in SFRP1 protein expression in the hair follicle dermal papillae cell compart (FIG. 13C), which resulted in the reduction of SFRP1 proteins secreted into the germinative and pre-cortical hair matrix compartment within the hair bulb (FIG. 13D). A representative immunofluorescence image of the SFRP1 protein levels at day 5 and 6 (FIG. 13E).


Example 10. ZF3-KRAB Decreases SFRP1 mRNA and Protein Expression in Primary Hair Follicle Dermal Papilla Cells
Methods

qPCR


12 y/o hair follicle dermal papilla donor cells were seeded and allowed to reach approximately 85% confluence. Cells were transfected with 1 ug/mL ZF3-KRAB or ZF-no effector and incubated for 24 hrs in HFDPC Media. After 24 hours, dosed media was replaced with fresh HFDPC media. Cell culture supernatant and cell pellets were collected at 1 day, 2 day and 3 days after dosing media. mRNA was extracted as previously described using Machery-Nagel RNA extraction kit according to manufacturer protocol. Extracted RNA was then normalized utilizing Tecan plate reader for spectral analysis of RNA concentration and reverse-transcribed to cDNA with a normalized input of RNA. cDNA was produced using New England BioLabs Lunascript RT Mastermix. cDNA was diluted 2× once reverse-transcribed. Taqman mastermix, and probes targeting SFRP1_m1 and GAPDH_m1 were used for qPCR analysis. Technical replicates were processed as well. qPCR results were analyzed via ΔΔCT relative to untreated control cells.


ELISA

ELISA was performed according to Abcam manufacturer's protocol (Catalog: Ab277082) with undiluted cell culture supernatant samples.


CHIP and CHIP Analysis

For each condition, 5e5 cells were harvested 48 hours post-transfection and fixed for 15 minutes in 1% formaldehyde. Cell pellets were frozen at −80 C until multi-modal chromatin shearing in SDS lysis buffer containing protease inhibitors. Thawed, fixed cells were sonicated using 3×30s pulses using a probe sonicator (Qsonica Q700) at 30 amplitude followed by the PIXUL multi-sample sonicator for 36 minutes. Chromatin immunoprecipitation was followed by tagmentation and high-throughput sequencing (Gustafsson C, et al, BMC Genomics, 2019). Briefly, antibody-coated Dynabeads (H3K9me3, Diagenode #C15410193; CTCF, Cell Signaling #3418) were washed with 0.5% BSA and mixed with cell lysates in PCR tubes and incubated rotating overnight at 4 C. Immunoprecipitated chromatin was washed with low-salt buffer, high-salt buffer, and LiCl buffer, followed by two washes with TE buffer and two washes of ice cold Tris-HCl. Bead bound chromatin was resuspended in 30 μl tagmentation buffer containing 1 μl transposase (Illumina #20034198), and the samples were incubated at 37 C for 10 min followed by two washes with low-salt buffer. Bead bound tagmented chromatin was PCR amplified for 12 cycles using NEBNext High Fidelity PCR master mix (NEB #M0541) and indexed amplification primers (Mezger A, et al, Nature Communications, 2018). 5% of sheared chromatin was preserved for input controls, which were tagmented and amplified in parallel. Libraries were sequenced on an Illumina NovaSeq using a 2×50 bp paired-end strategy. Illumina sequencing data in FASTQ format were QCed using FASTQC and sequencing adapters were removed using Trimmomatic. Trimmed FASTQ files were aligned to hg19 using Bowtie 2 using the default (sensitive) configuration. Optical duplicates were marked with Picard tools. Deduplicated, mapped BAM files were used to generate BIGWIG files for visualization.


Hair Follicle Organ Culture Ex Vivo

Amputated hair follicles were microdissected from FUEs as previously described (Edelkamp et al., Molecular Dermatology 2020, Langan et al., Exp Dermatol 2015). qPCR: RNA from n=3 hair follicles per group was extracted using ARCTURUS® PicoPure® RNA Isolation Kit (Thermo Fisher) including a DNase digestion step using the RNase-Free DNase Set from Oiagen. Then, 500 ng of RNA were reverse-transcribed into cDNA using the Tetro cDNA synthesis Kit from Bioline. qPCR reactions were performed in technical triplicates for each hair follicle using the respective TAQMAN™ probes (Thermo Fisher) and the Taq Man™ Fast Advanced Master Mix (Thermo Fisher) according to the manufacturer's instructions and a touchdown protocol (based on Zhang Q et al., Plos One 2015). Target mRNA expression levels were independently normalized to each housekeeping gene (GAP DH, TBP) or normalized to the arithmetic mean of the housekeeping genes, using the 2-/1/1Ct method enabling results to be presented as fold change (Riedel at al., PLOS One 2014).


Results

ZF3-KRAB(MR-32183) or ZF3-No effector (MR-30888) was transformed in 12 y/o HFDPC donor cells. ZF3-KRAB(MR-32183) shows strong downregulation of SFRP1 mRNA at day 1 (˜40%) and further downregulation by day 2 (˜70%) (FIG. 14A). By day 3, SFRP1 mRNA expression began to recover (˜50%). ZF2-No effector (MR-30888) shows no decrease in SFRP1 mRNA expression at Day 1 and Day 2.


ELISA was performed according to manufacturer's protocol (Abcam) with undiluted cell culture supernatant samples (FIG. 14B). Three biological replicates were averaged together for the final SFRP1 protein expression data. Day 1 supernatant shows little to no change in SFRP1 protein concentration between untreated, ZF3-KRAB and ZF2-No Effector. Day 2 supernatant shows strong downregulation of SFRP1 protein expression with ZF3-KRAB (˜50% relative to Untreated). Similarly, Day 3 supernatant shows strong downregulation of SFRP1 protein expression with ZF3-KRAB (˜50% relative to untreated). ZF2-No effector shows slightly increased SFRP1 protein concentration relative to untreated control at Day 2 and Day 3. There is a strong correlation between SFRP1 mRNA downregulation and the level of SFRP1 protein expressed in the cell culture supernatant.


12 y/o hair follicle dermal papilla cell donor cells are transfected with 1 ug/mL ZF3-KRAB or ZF-no effector and incubated for 24 hrs in HFDPC Media. Media change occurred at 24H. Cell pellets were collected at day 1, 2, 3, 4, 7 and 8 for qPCR analysis. ZF3-KRAB(MR-32183) shows strong downregulation of SFRP1 mRNA at day 1 (˜50%) and further downregulation by day 2 (˜65%). By day 3, SFRP1 mRNA expression begins to recover (˜40%). Day 4, 7 and 8 show SFRP1 mRNA downregulation by ZF3-KRAB (˜25% at each of these time points). There is strong and durable downregulation of SFRP1 mRNA by MR-32183(ZF3-KRAB) up to day 3. (FIG. 15)


Chromatin was analyzed when ZF3-KRAB and ZF3-NE were transfected for 2 days and compared to an untreated control. (FIG. 16A)


Repressive chromatin modification H3K9me3 and CTCF binding of the CTCF region left of the SFRP1 gene as determined by chromatin immunoprecipitation followed by high-throughput sequencing (FIG. 16A). ZF3-KRAB lead to deposition of the repressive chromatin mark H3K9me3 at the ZF3-KRAB target site within 48 hours of transfection, compared to ZF3-NE and untreated controls. Concomitantly, CTCF binding at this locus was specifically depleted in the ZF3-KRAB treated condition and is associated with a reduction of SFRP1 mRNA expression by 50%, compared to untreated controls (FIG. 16B).


EQUIVALENTS

Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the present invention described herein. Such equivalents are intended to be encompassed by the following claims.

Claims
  • 1. A site-specific Secreted Frizzled Receptor Protein 1 (SFRP1) disrupting agent, comprising a site-specific SFRP1 targeting moiety which targets an SFRP1 expression control region.
  • 2. The site-specific SFRP1 disrupting agent of claim 1, (a) wherein the site-specific SFRP1 targeting moiety comprises a polymeric molecule; optionally a polyamide or a polynucleotide; optionally, wherein the polymeric molecule comprises a peptide nucleic acid (PNA);(b) wherein the expression control region comprises an SFRP1-specific transcriptional control element; optionally, wherein the transcriptional control element comprises an SFRP1 promoter, a transcriptional enhancer, or a transcriptional repressor;(c) wherein the expression control region comprises one or more SFRP1-associated anchor sequences within an anchor sequence-mediated conjunction comprising a first and a second SFRP1-associated anchor sequence;optionally, wherein the expression control region comprises one or more CCCTC-binding factor (CTCF) binding motifs;optionally, wherein the anchor sequence-mediated conjunction comprises one or more transcriptional control elements internal to the conjunction.optionally, the anchor sequence-mediated conjunction comprises one or more transcriptional control elements external to the conjunction.optionally, wherein the first and/or the second anchor sequence is located within about 500 kb, within about 300 kb, or within about 10 kb of the transcriptional control element;(d) wherein the disrupting agent comprises a nucleotide modification;(c) wherein the site-specific SFRP1 targeting moiety comprises a nucleotide sequence having at least 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide identity to the entire nucleotide sequence of any of the nucleotide sequences in any one of Tables 2 and 6; and/or(f) wherein the polymeric molecule comprises a polynucleotide encoding a Cas or dCas polypeptide, or a fragment thereof, and a polynucleotide encoding a guide RNA that specifically binds to the SFRP1 expression control region; or a DNA-binding domain of a Transcription activator-like effector (TALE) polypeptide or a zinc finger (ZNF) polypeptide, or fragment thereof, that specifically binds to the SFRP1 expression control region; optionally, wherein the DNA-binding domain of the TALE or ZNF polypeptide comprises an amino acid sequence having at least about 85%, 90%, 95%, 96%, 97%, 98% or 99% amino acid identity to the entire amino acid sequence of any one of the amino acid sequences listed in column 5 of Table 5A.
  • 3.-18. (canceled)
  • 19. The site-specific SFRP1 disrupting agent of claim 1, wherein the SFRP1 disrupting agent comprises (a) a nucleotide sequence having at least 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide identity to the entire nucleotide sequence of any one of the nucleotide sequences in Table 3;(b) a first nucleotide sequence having at least 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide identity to the entire nucleotide sequence of GD-29879, a second nucleotide sequence having at least 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide identity to the entire nucleotide sequence of GD-29880, and a third nucleotide sequence having at least 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide identity to the entire nucleotide sequence of GD-29881; and/or(c) the polymeric molecule comprises a polynucleotide encoding a DNA-binding domain, or fragment thereof, of a zinc finger polypeptide (ZNF) or a transcription activator-like effector (TALE) polypeptide that specifically binds to the SFRP1 expression control region; optionally, wherein the DNA-binding domain of the TALE or ZNF polypeptide comprises an amino acid sequence having at least about 85%, 90%, 95%, 96%, 97%, 98% or 99% amino acid identity to the entire amino acid sequence of any one of the amino acid sequences listed in Table 1B.
  • 20.-25. (canceled)
  • 28. A cell comprising the site-specific SFRP1 disrupting agent of claim 1.
  • 29. The site-specific SFRP1 disrupting agent of claim 1, wherein the site-specific SFRP1 disrupting agent is present in a composition; optionally, wherein the composition comprises a pharmaceutical composition; optionally, (a) wherein the pharmaceutical composition comprises a lipid formulation; optionally, wherein the lipid formulation comprises one or more cationic lipids, one or more non-cationic lipids, one or more cholesterol-based lipids, or one or more PEG-modified lipids, or combinations of any of the foregoing; and/or(b) wherein the pharmaceutical composition comprises a lipid nanoparticle.
  • 30.-33. (canceled)
  • 34. A site-specific SFRP1 disrupting agent, comprising a nucleic acid molecule encoding a fusion protein, the fusion protein comprising a site-specific SFRP1 targeting moiety which targets an SFRP1 expression control region, and an effector molecule.
  • 35. The site-specific SFRP1 disrupting agent of claim 34, (a) wherein the site-specific SFRP1 targeting moiety comprises a polynucleotide encoding a Cas or dCas polypeptide, or a fragment thereof, and a polynucleotide encoding a guide RNA that specifically binds to the SFRP1 expression control region; or a DNA-binding domain of a Transcription activator-like effector (TALE) polypeptide or a zinc finger (ZNF) polypeptide, or fragment thereof, that specifically binds to the SFRP1 expression control region; optionally, wherein the DNA-binding domain of the TALE or zinc finger polypeptide comprises an amino acid sequence having at least 85%, 90%, 95%, 96%, 97%, 98% or 99% amino acid identity to the entire amino acid sequence of an amino acid sequence selected from the amino acid sequences listed in column 5 of Table 5A;(b) wherein the effector molecule comprises a polypeptide or a nucleic acid molecule encoding a polypeptide;(c) wherein the fusion protein comprises a peptide-nucleic acid fusion;(d) wherein the effector is selected from the group consisting of a nuclease, a physical blocker, an epigenetic recruiter, an epigenetic modifier, and combinations of any of the foregoing; optionally, wherein the effector is selected from the group consisting of euchromatic histone-lysine N-methyltransferase 2 (G9a), enhancer of zeste homolog 2 (EZH2), MQ1 domain (MQ1), Krüppel associated box (KRAB) transcriptional repression domain, and histone deacetylase 8 (HDAC8); optionally, wherein the effector is MQ1;(e) wherein the effector comprises a CRISPR associated protein (Cas) polypeptide or nucleic acid molecule encoding the Cas polypeptide; optionally, wherein the Cas polypeptide is an enzymatically inactive Cas polypeptide, or further comprising a catalytically active domain of human exonuclease 1 (hEXO1);(f) wherein the epigenetic modifier comprises a transcriptional enhancer or a transcriptional repressor; optionally, wherein the transcriptional repressor is selected from the group comprising euchromatic histone-lysine N-methyltransferase 2 (G9a), enhancer of zeste homolog 2 (EZH2), MQ1 domain (MQ1), Krüppel associated box (KRAB) transcriptional repression domain, and histone deacetylase 8 (HDAC8); optionally,(i) wherein the transcriptional repressor is MQ1 domain; optionally, wherein the MQ1 domain comprises an amino acid sequence having at least about 85%, 90%, 95%, 96%, 97%, 98% or 99% amino acid identity to the entire amino acid sequence of SEQ ID NO: 79; optionally, wherein the transcriptional repressor comprises two, three, four, or five MQ1s;(ii) wherein the transcriptional repressor is a EZH2; optionally, wherein the EZH2 comprises an amino acid sequence having at least about 85%, 90%, 95%, 96%, 97%, 98% or 99% identity to the entire amino acid sequence of SEQ ID NO: 78;(g) wherein the epigenetic modifier comprises a DNA methylase, a DNA demethylase, a histone transacetylase, or a histone deacetylase;(h) wherein the effector molecule comprises a Krüppel associated box (KRAB) transcriptional repression domain; optionally, wherein the KRAB comprises an amino acid sequence having at least about 85%, 90%, 95%, 96%, 97%, 98% or 99% identity to the entire amino acid sequence of SEQ ID NO: 297; and/or(i) wherein the effector molecule comprises a Transcription activator-like effector nuclease (TALEN) polypeptide.
  • 36.-55. (canceled)
  • 56. The site-specific SFRP1 disrupting agent of claim 34, further comprising a second nucleic acid molecule encoding a second fusion protein, wherein the second fusion comprises a second site-specific SFRP1 targeting moiety which targets a second SFRP1 expression control region and a second effector molecule, wherein the second SFRP1 expression control region is different than the SFRP1 expression control region; optionally, (a) wherein the first nucleic acid molecule and the second nucleic acid molecule are located on the same nucleic acid molecule or on different nucleic acid molecules(b) wherein the SFRP1 expression control region comprises a ZF target sequence comprising SEQ ID NOs: 150, 151, 152, or a combination thereof and the second SFRP1 expression control region comprises a ZF target sequence comprising SEQ ID NOs: 150, 151, 152, or a combination thereof;(c) wherein the second effector is different than the effector;(d) wherein the second effector is the same as the effector; and/or(e) wherein the fusion protein and the second fusion protein are operably linked; optionally, (i) wherein the fusion protein and the second fusion protein comprise an amino acid sequence that has at least about 85%, 90%, 95%, 96%, 97%, 98% or 99% amino acid sequence identity to the entire amino acid sequence of a polypeptide selected from the group consisting of dCas9-MQ1 (SEQ ID NO: 159), G9A-dCas9 (SEQ ID NO: 162), EZH2-dCas9 (SEQ ID NO: 163), dCas9-HDAC8 (SEQ ID NO: 164), and dCas9-KRAB (SEQ ID NO: 161); or(ii) wherein the fusion protein is encoded by a polynucleotide comprising a nucleotide sequence that has at least about 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide sequence identity to the entire nucleotide sequence of a polynucleotide selected from the group consisting of dCas9-MQ1 mRNA (SEQ ID NO: 165), G9A-dCas9 mRNA (SEQ ID NO: 168), EZH2-dCas9 mRNA (SEQ ID NO: 169), dCas9-HDAC8 mRNA (SEQ ID NO: 170), and dCas9-KRAB mRNA (SEQ ID NO: 167).
  • 57.-63. (canceled)
  • 64. A site-specific SFRP1 disrupting agent, comprising a nucleic acid molecule encoding a fusion protein, wherein the fusion protein comprises an amino acid sequence having at least about 85%, 90%, 95%, 96%, 97%, 98% or 99% amino acid identity to the entire amino acid sequence of a polypeptide selected from the group consisting of ZF1-MQ1 (SEQ ID NO: 120), ZF2-MQ1 (SEQ ID NO: 121), ZF3-MQ1 (SEQ ID NO: 122), ZF1-G9A (SEQ ID NO: 126), ZF2-G9A (SEQ ID NO: 127), ZF3-G9A (SEQ ID NO: 128), ZF1-HDAC8 (SEQ ID NO: 132), ZF2-HDAC8 (SEQ ID NO: 133), ZF3-HDAC8 (SEQ ID NO: 134), ZF1-EZH2 (SEQ ID NO: 129), ZF2-EZH2 (SEQ ID NO: 130), ZF3-EZH2 (SEQ ID NO: 131), and ZF3-KRAB (SEQ ID NO: 303); optionally,(a) wherein the polypeptide is selected from the group consisting of ZF1-MQ1, ZF2-MQ1, and ZF3-MQ1; optionally, wherein the polypeptide is ZF1-MQ1; or(b) wherein the polypeptide is ZF3-KRAB.
  • 65.-68. (canceled)
  • 68. A vector comprising a nucleic acid molecule encoding the site-specific SFRP1 disrupting agent of claim 34; optionally, wherein the vector is a viral expression vector.
  • 69. (canceled)
  • 70. A cell comprising the site-specific SFRP1 disrupting agent of claim 34; optionally, wherein the cell is an immune cell.
  • 71. (canceled)
  • 72. The site-specific SFRP1 disrupting agent of claim 34, wherein the site-specific SFRP1 disrupting agent is present in a composition; optionally, wherein the composition comprises a pharmaceutical composition; optionally (a) wherein the pharmaceutical composition comprises a lipid formulation, wherein the lipid formulation comprises one or more cationic lipids, one or more non-cationic lipids, one or more cholesterol-based lipids, or one or more PEG-modified lipids, or combinations of any of the foregoing; and/or(b) wherein the pharmaceutical composition comprises a lipid nanoparticle.
  • 73.-76. (canceled)
  • 77. A method of modulating expression of secreted frizzled receptor protein 1 (SFRP1) in a cell, the method comprising contacting the cell with the site-specific SFRP1 disrupting agent of claim 1, and an effector molecule, thereby modulating expression of SFRP1 in the cell.
  • 78. The method of claim 77, wherein the modulation of expression is reduced expression of SFRP1 in the cell; (a) wherein the site-specific disrupting agent, the effector, or both the site-specific disrupting agent and the effector are present in a vector; optionally, wmoduherein the site-specific disrupting agent and the effector are present in the same vector or different vectors; optionally, wherein the vector is a viral expression vector;(b) wherein the site-specific disrupting agent, the effector, or both the site-specific disrupting agent and the effector are present in a composition; optionally, wherein the site-specific disrupting agent and the effector are present in the same composition or different compositions;(c) wherein the cell is a mammalian cell; optionally, wherein the mammalian cell is a somatic cell or a primary cell;(d) wherein the cell is an immune cell; and/or(e) wherein the contacting is performed in vitro, in vivo, or ex vivo; and/or(f) further comprising administering the cell to a subject.
  • 79.-157. (canceled)
  • 158. The method of claim 77, wherein the cell is within a subject; optionally, wherein the subject has an SFRP1-associated disease; optionally, wherein the SFRP1-associated disease is selected from the group consisting of androgenic alopecia, alopecia areata, traction alopecia, senescent alopecia, and cicatricial alopecia.
  • 159.-160. (canceled)
  • 161. A method for treating a subject having an SFRP1-associated disease, comprising administering to the subject a therapeutically effective amount of the site-specific SFRP1 disrupting agent of claim 1, and an effector molecule, thereby treating the subject.
  • 162. The method of claim 161, (a) wherein the SFRP1-associated disease is alopecia and the site-specific SFRP1 disrupting agent reduces expression of SFRP1 in the subject;(b) wherein the SFRP1-associated disease is selected from the group consisting of androgenic alopecia, alopecia areata, traction alopecia, senescent alopecia, and cicatricial alopecia and the site-specific SFRP1 disrupting agent reduces expression of SFRP1 in the subject;(c) wherein the site-specific SFRP1 disrupting agent and the effector molecule are administered to the subject concurrently;(d) wherein the site-specific SFRP1 disrupting agent and the effector molecule are administered to the subject sequentially;(e) wherein the effector molecule is administered to the subject prior to administration of the site-specific SFRP1 disrupting agent; and/or(f) wherein the site-specific SFRP1 disrupting agent is administered to the subject prior to administration of the effector molecule.
  • 163.-197. (canceled)
CROSS-REFERENCE TO RELATED APPLICATIONS

The instant application is a continuation of International Application No. PCT/US2022/036389, filed on Jul. 7, 2022, which claims the benefit of priority to U.S. Provisional Application No. 63/219,153, filed on Jul. 7, 2021. The entire contents of each of the foregoing applications are incorporated herein by reference.

Provisional Applications (1)
Number Date Country
63219153 Jul 2021 US
Continuations (1)
Number Date Country
Parent PCT/US2022/036389 Jul 2022 WO
Child 18405286 US