Patent Application
20240173358
Described herein are compositions and methods that can be used to contract nucleotide repeat expansions, e.g., the CGG repeat in the FMR1 gene in cells of subjects, e.g., subjects with Fragile X syndrome (FXS), FXTAS Parkinsonism, or a disease associated with the expansion of nucleotide repeats, by treating the cells using a catalytically dead CRISPR-Cas9 targeted to the nucleotide repeat of the affected gene and/or by treating the cells using small molecules.
Instability of repetitive DNA sequences within the genome is associated with a number of human diseases, including Fragile X syndrome (FXS), fragile X-associated tremor/ataxia syndrome (FXTAS), Parkinson's Disease (PD), Huntington's disease (HD), myotonic dystrophy, and others. The mutation, sometimes referred to as “nucleotide repeat expansion,” (also called “repeat expansion” or “tandem nucleotide repeat expansion” or, when 3 nucleotides are repeated, “trinucleotide repeat expansion” herein), occurs when the number of triplets/repeats present in a mutated gene is greater than the number found in a normal gene. The expansion of nucleotide repeats is recognized as a major cause of neurological and neuromuscular diseases. See, e.g., Budworth, H. and McMurray, C. T. (2013) Methods Mol Biol. 1010:3-17; Ellerby, Neurotherapeutics 16:924-927 (2019).
The nucleotide repeats are defined as simple sequences of 1-6 nucleotides (or longer) that are repeated multiple times (Budworth, H. and McMurray, C. T. (2013) Methods Mol Biol. 1010:3-17). The threshold at which the repeat expansions become symptomatic varies with the specific disease (Ellerby, L. M. (2019) Neurotherapeutics 16:924-927). For example, Fragile X syndrome (FXS), also termed Martin-Bell syndrome or marker X syndrome, is one of the most common heritable neurodegenerative disorders and is caused by the expansion of CGG nucleotide repeats in the 5′-UTR of the FMR1 gene. There are two types of FXS with distinct pathological lesions depending on the length of the CGG repeats: pre-mutation and full mutation. Very long expansions resulting in over 200 CGG repeats—so-called full mutation (FM)—cause DNA hyper-methylation and consequent epigenetic silencing of the fragile X mental retardation 1 (FMR1) gene, which in turn causes a loss of expression of the fragile X mental retardation protein (FMRP) (McLennan et al., Curr Genomics. 2011 May; 12(3): 216-224). On the other hand, carriers of the pre-mutation alleles (55-200 CGG repeats) exhibit increased FMR1 mRNA levels but normal or lower FMRP expression, implying a different pathological mechanism (Tassone, F., et al., RNA, 2007. 13(4): p. 555-62). Such carriers are asymptomatic earlier in life but develop a condition called FXTAS and presumed to be caused by toxic accumulation of CGG-FMR1 RNA (Hagerman et al., Neurology. 2001 Jul. 10; 57(1):127-30), which is often also diagnosed as Parkinsonism (Niu et al., Parkinsonism Relat Disord. 2014 April; 20(4): 456-459). FMRP is a polyribosome-associated RNA binding protein that regulates the translation of mRNAs from a wide variety of genes, including many genes encoding synaptic proteins (Darnell, J. C., et al., Cell, 2011. 146(2): p. 247-61). Currently, there is no cure for FXS or FXTAS Parkinsonism available, and treatments are limited to alleviating symptoms.
In another example, Huntington's disease (HD), the nucleotide repeat lies within the gene-coding region of the huntingtin (HTT) gene; expansion of the CAG nucleotide repeat creates abnormal proteins with a gain of function as a result of the enlargement of the polyglutamine tract. Unaffected individuals may have roughly 6-29 CAG triplets in both alleles; yet, in HD patients, the disease allele may contain 36 to hundreds of CAG triplets. As the repeat number grows, the growing polyglutamine tract produces an HD gene product (called huntingtin) with increasingly aberrant properties that causes death of brain cells controlling movement (Budworth, H. and McMurray, C. T. (2013) Methods Mol Biol. 1010:3-17).
Currently there are over 40 distinct diseases known to be caused by these nucleotide repeat expansions in DNA sequence, for which there are currently no cures (Ellerby, L. M. (2019) Neurotherapeutics 16:924-927).
This application is based, in part, on the discovery that nucleotide repeat expansion (also, “tandem nucleotide repeat expansion” or, when 3 nucleotides are repeated, “trinucleotide repeat expansion” herein) can be retracted and gene function restored by administering an inactive, or catalytically dead, Cas9 protein (“dCas9”) and a guide RNA (“gRNA”) that directs the dCas9 to the gene or nucleotide repeat.
Described herein, inter alia, are methods for contracting an expansion of nucleotide repeats in a gene in a cell. The methods comprise or consist of contacting the cell with or expressing in the cell an inactive Cas9 protein (dCas9) and a guide RNA that directs the dCas9 to the gene and/or nucleotide repeat, in an amount sufficient to reduce the number of nucleotide repeats in the cell. In some embodiments, the expansion is in a fragile X mental retardation 1 (FMR1) gene, wherein the FMR1 gene is inactive due to the presence of expansion of CGG nucleotide repeats in the 5′-UTR of the FMR1 gene, and the number of nucleotide repeats in at least one allele of the gene is reduced after contact with the dCas9 and gRNA, e.g., wherein the number of CGG nucleotide repeats in the 5′-UTR of at least one allele of the FMR1 gene is reduced after contact with the dCas9 and gRNA. In some embodiments, the cell is from a subject who has a disorder caused by the expansion of nucleotide repeats, e.g., a neurodevelopmental or neurodegenerative disorder caused by the expansion of CGG nucleotide repeats, e.g., in the 5′-UTR of the FMR1 gene. In some embodiments, the cell is an induced pluripotent stem cell (iPSC) derived from a somatic cell of a subject who has a disorder caused by the expansion of nucleotide repeats, e.g., a subject who has Fragile X syndrome (FXS). In some embodiments the cell is from a subject who has >200 CGG repeats, or 50-200 CGG repeats.
Also provided herein, inter alia, are populations of cells generated by any of the methods described herein. In some embodiments, the populations of cells are generated by a method comprising contacting a population of cells with or expressing in a population of cells an inactive Cas9 protein and a guide RNA that directs the dCas9 to the gene and/or nucleotide repeat, in an amount sufficient to reduce the number of nucleotide repeats in the cell. In some embodiments, the expansion is in a fragile X mental retardation 1 (FMR1) gene, wherein the FMR1 gene is inactive due to the presence of expansion of CGG nucleotide repeats in the 5′-UTR of the FMR1 gene, and wherein the number of nucleotide repeats in at least one allele of the gene is reduced after contact with dCas9/gRNA, e.g., wherein the number of CGG nucleotide repeats in the 5′-UTR of at least one allele of the FMR1 gene is reduced after contact with the dCas9 and gRNA. In some embodiments, the cells are from a subject who has a disorder caused by the expansion of nucleotide repeats, e.g., a neurodevelopmental or neurodegenerative disorder caused by the expansion of CGG nucleotide repeats, e.g., in the 5′-UTR of the FMR1 gene, thereby creating a population of cells autologous to the subject who has a disorder caused by the expansion of nucleotide repeats or allogenic to a different subject who has a disorder caused by the expansion of nucleotide repeats. In some embodiments, the cells are an induced pluripotent stem cell (iPSC) derived from a somatic cell of a subject who has a disorder caused by the expansion of nucleotide repeats, e.g., a subject who has Fragile X syndrome (FXS), thereby creating a population of iPSC cells. In some embodiments the cells are from a subject who has >200 CGG repeats, or 50-200 CGG repeats.
Described herein, inter alia, are methods for treating a subject who has a condition associated with nucleotide repeat expansion in a gene. These methods comprise or consist of: obtaining iPSC derived from differentiated somatic cells obtained from the subject; exposing the iPSC to, or expressing in the iPSC, an inactive Cas9 protein and a guide RNA that directs the Cas9 to the gene, in an amount sufficient to reduce the number of nucleotide repeats in the cell for a time and under conditions sufficient for reduction of the number of nucleotide repeats; promoting differentiation of the reactivated cells to neural precursor cells or other neuronal cell types; and administering the cells to the brain or spinal cord of the subject (e.g., via ICV, cisternae magna, or intrathecal administration) with a condition associated with nucleotide repeat expansion.
Described herein, inter alia, are methods for treating a subject who has a condition associated with nucleotide repeat expansion in a gene. The methods comprise or consist of administering to the subject, e.g., to the brain or spinal cord of the subject (e.g., via ICV, cisternae magna, or intrathecal administration), a therapeutically effective amount of an inactive Cas9 protein and a guide RNA that directs the dCas9 to the gene or the nucleotide repeats, in an amount sufficient to reduce the number of nucleotide repeats in the cell.
Also described herein, inter alia, are methods for contracting nucleotide repeats in a gene a living cell, e.g., a cell having a number of repeats above a reference number or in a reference range. The method comprise or consist of contacting the cell with an inactive Cas9 protein and a guide RNA that directs the Cas9 to the gene or the nucleotide repeats, in an amount sufficient to reduce the number of nucleotide repeats in the cell. In some embodiments, the reference number is 30 repeats, 40 repeats, 50 repeats, or 200 repeats; or the range is 30-100 repeats, 40-200 repeats, or 50-200 repeats. In some embodiments, the reference number is the number of nucleotide repeats in a healthy cell not having a condition associated with nucleotide repeat expansion or a control cell. In some embodiments, the reference number is 0-30 repeats, 0-40, or 0-50 repeats. In some embodiments, the cell is in a living subject. In some embodiments, the cell is in the brain of the subject. In some embodiments, the cell is an iPSC derived from differentiated somatic cell obtained from a subject who has a condition associated with nucleotide repeat expansion. In some embodiments, the dCas9 and gRNA is administered to the CNS, e.g., brain or spinal cord of the subject (e.g., via ICV, cisternae magna, or intrathecal administration), or is administered systemically to the subject.
In some embodiments of any of the methods described herein, the nucleotide repeats comprise any one or more repeats listed in Table A, e.g., CGG repeats, GGC repeats, CAG repeats, CTG repeats, GAA repeats, CCCCGG repeats, CCTG repeats, ATTCT repeats, CAAA repeats, and TGGAA repeats.
In some embodiments of any of the methods described herein, the condition associated with nucleotide repeat expansion is any one or more of FXS, FXTAS, PD, HD, myotonic dystrophy, or any known disorder with repeat expansion, e.g., as listed in Table A.
Also described herein are methods for preparing a population of neural precursor cells or other neuronal cell type with decreased nucleotide repeats. The methods comprise or consist of: obtaining iPSC derived from differentiated somatic cells obtained from a subject who has a nucleotide repeat expansion, e.g., who has a condition associated with nucleotide repeat expansion; exposing the iPSC to an inactive Cas9 protein and a guide RNA that directs the dCas9 to the gene for a time and under conditions sufficient for reduction of the number of nucleotide repeats; and promoting differentiation of the iPSC to neural precursor cells or other neuronal cell type, thereby promoting differentiation of the reactivated cells to neural precursor cells or other neuronal cell types.
Provided herein, inter alia, are populations of neural precursor cells or other neuronal cell type with decreased nucleotide repeats prepared using any of the methods described herein. In some embodiments, a method of preparing a population of neural precursor cells or other neuronal cell type with decreased nucleotide repeats comprises: obtaining iPSC derived from differentiated somatic cells obtained from a subject who has a condition associated with nucleotide repeat expansion; exposing the iPSC to an inactive Cas9 protein and a guide RNA that directs the Cas9 to the gene for a time and under conditions sufficient for reduction of the number of nucleotide repeats; and promoting differentiation of the iPSC to neural precursor cells or other neuronal cell type, thereby promoting differentiation of the reactivated cells to neural precursor cells or other neuronal cell types.
This application is also based, in part, on the discovery that nucleotide repeat expansion (also called “repeat expansion” or “tandem nucleotide repeat expansion” or, when 3 nucleotides are repeated, “trinucleotide repeat expansion” herein) can be retracted and gene function restored by a combination of small molecules, wherein the combination of small molecules is any two or more of a MEK inhibitor, a Raf inhibitor, a ROCK1 inhibitor, a GSK-3β inhibitor, and a Src Inhibitor.
Described herein, inter alia, are methods for reactivating an inactive gene in a living cell, wherein the gene is inactive due to the presence of expansion of nucleotide repeats, optionally wherein the inactive gene is fragile X mental retardation 1 (FMR1), wherein the gene is inactive due to the presence of expansion of nucleotide repeats (e.g., CGG nucleotide repeats in the 5′-UTR of the FMR1 gene). The methods comprise or consist of contacting the cell with a reactivation cocktail with active factors comprising or consisting of:
In some embodiments, the number of nucleotide repeats in at least one allele of the gene is reduced after contact with the reactivation cocktail, e.g., wherein the number of CGG nucleotide repeats in the 5′-UTR of at least one allele of the FMR1 gene is reduced after contact with the reactivation cocktail. In some embodiments, the cell is from a subject who has a disorder caused by the expansion of nucleotide repeats, e.g., a neurodevelopmental or neurodegenerative disorder caused by the expansion of CGG nucleotide repeats in the 5′-UTR of the FMR1 gene. In some embodiments, the cell is an induced pluripotent stem cell (iPSC) derived from a somatic cell of a subject who has a disorder caused by the expansion of nucleotide repeats, e.g., a subject who has Fragile X syndrome (FXS). In some embodiments, the cell is from a subject who has >200 CGG repeats, or 50-200 CGG repeats.
Also provided herein, inter alia, are populations of cells generated by any of the methods described herein. In some embodiments, the populations of cells are generated by a method comprising contacting a population of cells with a reactivation cocktail with active factors comprising or consisting of:
Described herein, inter alia, are methods of treating a subject who has a condition associated with nucleotide repeat expansion. The methods comprise or consist of: obtaining iPSC derived from differentiated somatic cells obtained from the subject; exposing the iPSC to a reactivation cocktail with active factors comprising or consisting of:
Also described herein are methods for treating a subject who has a condition associated with nucleotide repeat expansion. The methods comprise or consist of administering to the subject, e.g., to the brain or spinal cord of the subject (e.g., via ICV, cisternae magna, or intrathecal administration), a therapeutically effective amount of a reactivation cocktail with active factors comprising or consisting of:
Described herein, inter alia, are methods for contracting nucleotide repeats in a living cell, e.g., a cell having a number of repeats above a reference number or in a reference range. The methods comprise or consist of contacting the cell with a reactivation cocktail with active factors comprising or consisting of:
In some embodiments, the reference number is 30 repeats, 40 repeats, 50 repeats, or 200 repeats; or the range is 30-100 repeats, 40-200 repeats, or 50-200 repeats. In some embodiments, the reference number is the number of nucleotide repeats in a healthy cell not having a condition associated with nucleotide repeat expansion or a control cell. In some embodiments, the reference number is 0-30 repeats, 0-40, or 0-50 repeats. In some embodiments, the cell is in a living subject. In some embodiments, the cell is in the brain of the subject. In some embodiments, the cell is an iPSC derived from differentiated somatic cell obtained from a subject who has a condition associated with nucleotide repeat expansion. In some embodiments, the reactivation cocktail is administered to the CNS, e.g., brain or spinal cord of the subject (e.g., via ICV, cisternae magna, or intrathecal administration), or is administered systemically to the subject.
In some embodiments of any of the methods described herein, the nucleotide repeats comprise any one or more repeats listed in Table A, e.g., CGG repeats, GGC repeats, CAG repeats, CTG repeats, GAA repeats, CCCCGG repeats, CCTG repeats, ATTCT repeats, CAAA repeats, and TGGAA repeats.
In some embodiments of any of the methods described herein, the condition associated with nucleotide repeat expansion is any one or more of FXS, FXTAS, PD, HD, myotonic dystrophy, or any known disorder with repeat expansion, e.g., as listed in Table A.
Also described herein are methods for preparing a population of neural precursor cells or other neuronal cell type with decreased nucleotide repeats. The methods comprise or consist of: obtaining iPSC derived from differentiated somatic cells obtained from a subject who has a nucleotide repeat expansion, e.g., who has a condition associated with nucleotide repeat expansion; exposing the iPSC to a reactivation cocktail with active factors comprising or consisting of:
Provided herein, inter alia, are populations of neural precursor cells or other neuronal cell type with decreased nucleotide repeats prepared using any of the methods described herein. In some embodiments, the method of preparing a population of neural precursor cells or other neuronal cell type with decreased nucleotide repeats, the method comprising obtaining iPSC derived from differentiated somatic cells obtained from a subject who has a nucleotide repeat expansion, e.g., who has a condition associated with nucleotide repeat expansion; exposing the iPSC to a reactivation cocktail with active factors comprising or consisting of:
In some embodiments, any of the methods or treatments described herein are used in combination with an inhibitor of DNA methyltransferase (DNMT), as described herein. In some embodiments, a useful DNMT inhibitor is at least one of is RG108, 5-azacytidine, decitabine, Zebularine, procainamide, procaine, psammaplin A, sinefungin, temozolomide, OM173-alphaA, DNMT3A-binding protein, theaflavin 3,3′-digallate, 1-Hydrazinophthalazine, SGI-1027, hydralazine, NSC14778, Olsalazine, Nanaomycin, SID 49645275, Δ2-isoxazoline, epigallocatechin-3-gallate (EGCG), MG98, SGI-110, SGI-1027, SW155246, SW15524601, SW155246-2, or DZNep, an ASO targeting DNMT, optionally comprising SEQ ID NO: 87, TCAAGTTGAGGCCAGAAGGA, or an siRNA targeting DNMT, optionally comprising SEQ ID NOs: 72-75.
Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Methods and materials are described herein for use in the present invention; other, suitable methods and materials known in the art can also be used. The materials, methods, and examples are illustrative only and not intended to be limiting. All publications, patent applications, patents, sequences, database entries, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control.
Other features and advantages of the invention will be apparent from the following detailed description and figures, and from the claims.
The molecular mechanism of repeat expansion and contraction in a number of genes, e.g., the FMR1 gene, is largely unknown. A few models for nucleotide repeat expansion were suggested (see, e.g., Mirkin, S. M., Nature, 2007. 447(7147): p. 932-40; Moore, H., et al., Proc Natl Acad Sci USA, 1999. 96(4): p. 1504-9; Usdin, K., N. C. House, and C. H. Freudenreich, Crit Rev Biochem Mol Biol, 2015. 50(2): p. 142-67) including DNA polymerase slippage and Okazaki fragment displacement during DNA replication. Misalignment of the repeat tracts during double-strand brake repair was also suggested as a possible model to cause repeat expansion and contraction. Repeat expansion mostly occurs on maternal transmission through pre-mutation females, and larger repeats carry higher risks of expansion (Rousseau, F., et al., N Engl J Med, 1991. 325(24): p. 1673-81).
Understanding the cellular mechanisms that promotes repeat expansion and contraction could be extremely valuable towards formulating a strategy for treating diseases associated with nucleotide repeat expansion, e.g., an FXS therapeutic, one that would enable permanent reactivation of an affected gene, e.g., the silent FMR1 gene, in a patient by shortening the repeat expansion, e.g., the CGG repeat.
As shown herein, surprisingly, it is possible inter alia to contract the CGG repeat by treating cells using a specific protocol involving small molecules and that at least the FMR1 gene can be concurrently reactivated in full. The FMR1 gene was completely silenced in human induced pluripotent stem (iPS, iPSC, hPSCs, iPSCs) and embryonic stem (ES) cell lines from FXS full mutation patients. By treating these cells with sets of small molecules, we demonstrated de-repressed FMR1 gene transcription and a very strong increase in the protein FMRP levels. In these cells, we also demonstrated that the long CGG repeat was contracted and DNA methylation was decreased.
As shown herein, it was possible to fully reactivate the FMR1 gene, inter alia, and contract the CGG repeat by inducing epigenetic state change either towards naïve state or targeted DNA de-methylation on FMR1 locus in FXS hPSCs. Without wishing to be bound by theory, since H3K9me3 didn't show a decrease and DNA de-methylation by Tet1 recruitment to FMR1 locus was sufficient to trigger both FMR1 gene reactivation and CGG repeat contraction, DNA de-methylation is thought to be a potential cause for the observed phenomena. A significant FMR1 transcription reactivation (about ˜50% of normal cell level) preceded the CGG repeat shortening, implying that it is not a major cause of the observed increase of FMR1 gene transcription although it might contribute further FMR1 gene upregulation at later phase of observed reactivation.
The present methods can be utilized to correct patient-derived iPSCs ex vivo using small molecules to trigger repeat contraction (e.g., CGG repeat contraction), and a patient's own corrected cells can be administered to treat FXS in the subject. In addition, the compositions described herein can be administered directly to the subject, e.g., to the CNS of the subject.
As the epigenetic reprogramming by the optimized small molecule treatment re-awakens the native FMR1 gene carried within the patient's own cells and, more importantly, permanently shrinks the long CGG repeat by cell-intrinsic DNA repair mechanism without introducing exogenous factors, this reactivation strategy can be utilized for a cell therapy treatment regimen for iPSC-based cell autonomous therapy for FXS. Stem cell therapy is emerging as a treatment option for various severe diseases. For example, the first successful clinical trial for an autonomous cell-based Parkinson's treatment was reported in 2020, treating by engrafting dopaminergic neuronal progenitor cells derived from the patient's iPSCs (Schweitzer, J. S., et al., N Engl J Med, 2020. 382(20): p. 1926-1932). The use of patient-specific stem cells would circumvent immune issues normally associated with transplant. Moreover, inter alia, our approach would bypass the safety concerns associated with gene editing or gene therapy relating to the introduction of foreign genetic material and the possibility of off-target mutagenesis.
As this approaches directly corrects the actual cause by permanently shortening the long CGG repeats, it differs from most of the unsuccessful FXS studies that focused on the downstream pathway dysfunctions in FXS, including recent failed clinical trials with metabotropic glutamate receptor 5 (mGluR5) antagonists (Erickson, C. A., et al., J Neurodev Disord, 2017; 9: 7.). Since FMRP modulates many different levels of pathways, FXS exhibits molecular, synaptic, and circuit levels of dysfunctions, which cannot be easily corrected via a downstream method. As the present approach reactivates or restores the function of the FMR1 by dealing with the upstream cause, the long CGG repeats, it has much greater potential to successfully alleviate a number of symptoms of FXS.
As shown herein, surprisingly, it is possible inter alia to contract the CGG repeat by treating cells using a catalytically dead CRISPR-Cas (dCas) protein targeted to the FMR1 locus; without wishing to be bound by theory, it is believed that this results in formation of an R-loop and initiation of double-strand break repair (DSBR), which in turn leads to contraction of the CGG repeat and reactivation of the FMR1 gene at therapeutic levels. The FMR1 gene was completely silenced in human induced pluripotent stem (iPS, hPSCs, iPSCs) and embryonic stem (ES) cell lines from FXS full mutation patients. By treating these cells with dCas9, we demonstrated de-repressed FMR1 gene transcription and a very strong increase in the protein FMRP levels. In these cells, we also demonstrated that the long CGG repeat was contracted and DNA methylation was decreased. In addition, premutation cells with intermediate length of CGG repeats also showed contraction by dCas9 targeting combined with naïve state media treatment, indicating this method can be utilized for other repeat-mediated diseases including, but not limited to, FXTAS, PD, and HD.
Also as shown herein, surprisingly, it is possible to contract the CGG repeat by treating cells using a specific protocol involving small molecules and that the FMR1 gene can be concurrently reactivated in full. The FMR1 gene was completely silenced in human induced pluripotent stem (iPS, hPSCs, iPSCs) and embryonic stem (ES) cell lines from FXS full mutation patients. By treating these cells with sets of small molecules, we demonstrated de-repressed FMR1 gene transcription and a very strong increase in the protein FMRP levels. In these cells, we also demonstrated that the long CGG repeat was contracted and DNA methylation was decreased.
As shown herein, it was possible to fully reactivate the FMR1 gene and contract the CGG repeat by inducing epigenetic state change either towards naïve state or targeted DNA de-methylation on FMR1 locus in FXS hPSCs. Without wishing to be bound by theory, since H3K9me3 didn't show a decrease and DNA de-methylation by Tet1 recruitment to FMR1 locus was sufficient to trigger both FMR1 gene reactivation and CGG repeat contraction, DNA de-methylation is thought to be the cause for the observed phenomena. A significant FMR1 transcription reactivation (about ˜50% of normal cell level) preceded the CGG repeat shortening, implying that it is not a major cause of the observed increase of FMR1 gene transcription although it might contribute further FMR1 gene upregulation at later phase of observed reactivation. The epigenetic reprogramming by the optimized small molecule treatment re-awakens the native FMR1 gene carried within the patient's own cells and, more importantly, permanently shrinks the long CGG repeat by cell-intrinsic DNA repair mechanism without introducing exogenous factors.
The present methods can be utilized to correct patient-derived iPSCs ex vivo using (i) dCas9 and a targeting guide RNA and/or (ii) a reactivation cocktail of small molecules to trigger trinucleotide, e.g., CGG, repeat contraction, and the patient's own corrected cells can then be administered to treat a disease associated with repeat expansion, e.g., FXS, in the subject. In addition, the compositions described herein can be administered directly to the subject, e.g., to the CNS of the subject.
The repeat contraction strategies described herein can be utilized directly (e.g., by delivering the dCas9/gRNA or reactivation cocktail to the target tissues of subject), or for a cell therapy treatment regimen for iPSC-based cell autonomous therapy for FXS. Stem cell therapy is emerging as a treatment option for various severe diseases. For example, the first successful clinical trial for an autonomous cell-based Parkinson's treatment was reported in 2020, treating by engrafting dopaminergic neuronal progenitor cells derived from the patient's iPSCs (Schweitzer, J. S., et al., N Engl J Med, 2020. 382(20): p. 1926-1932). The use of patient-specific stem cells would circumvent immune issues normally associated with transplant. Moreover, this approach would bypass the safety concerns associated with gene editing or gene therapy relating to the introduction of foreign genetic material and the possibility of off-target mutagenesis.
As this approaches directly corrects the actual cause by permanently shortening the long CGG repeats, it differs from most of the unsuccessful FXS studies that focused on the downstream pathway dysfunctions in FXS, including recent failed clinical trials with metabotropic glutamate receptor 5 (mGluR5) antagonists (Erickson, C. A., et al., J Neurodev Disord, 2017; 9:7). Since FMRP modulates many different levels of pathways, FXS exhibits molecular, synaptic, and circuit levels of dysfunctions, which cannot be easily corrected via a downstream method. As the present approach restore the function of the FMR1 gene by dealing with the upstream cause, the long CGG repeats, it has much greater potential to successfully alleviate a number of symptoms of FXS.
The present methods include using catalytically dead versions of Cas9 (dCas9) which are derived from Cas9 proteins, e.g., SpCas9 or SpCas9 variants, e.g., variants with altered PAM specificity or that have improved on-target editing capabilities. These methods can be applied to other CRISPR-Cas proteins, including other Cas9 orthologs with various levels of basal activity (SaCas9, St1Cas9, St3Cas9, NmeCas9, Nme2Cas9, CjeCas9, etc.), Cas12a orthologs, and other Cas3, Cas12, Cas13, and Cas14 proteins.
The Cas proteins can be incorporated into existing and widely used vectors, e.g., by simple site-directed mutagenesis, and can also be combined with other previously described improvements to the SpCas9 platform (e.g., truncated sgRNAs (Tsai et al., Nat Biotechnol 33, 187-197 (2015); Fu et al., Nat Biotechnol 32, 279-284 (2014)), nickase mutations (Mali et al., Nat Biotechnol 31, 833-838 (2013); Ran et al., Cell 154, 1380-1389 (2013)), dimeric FokI-dCas9 fusions (Guilinger et al., Nat Biotechnol 32, 577-582 (2014); Tsai et al., Nat Biotechnol 32, 569-576 (2014)); and high-fidelity variants (Kleinstiver et al. Nature 2016).
The SpCas9 wild type sequence is as follows:
In some embodiments, the Cas9/dCas9 has altered PAM specificity, e.g., xCas9 3.7, as described in Hu et al., Nature volume 556, pages 57-63(2018); or SpG (mutations at D1135L/S1136W/G1218K/E1219Q/R1335Q/T1337R, which targets NGN PAM sequences), or SpRY (D1135L/S1136W/G1218K/E1219Q/R1335Q/T1337R/L1111R/A1322R/A61R/N1317R/R1333P mutations, which targets almost all PAM sequences (NRN and to a lesser extent NYN PAMs) (Walton et al., Science 26 Mar. 2020:eaba8853). In some embodiments, the SpCas9 comprises a mutation at D1135E (NGG PAM); mutations at D1135V, R1335Q and T1337R (NGAN or NGNG PAM); mutations at D1135E, R1335Q and T1337R (NGAG PAM); mutations at D1135V, G1218R, R1335E and T1337R (NGCG PAM).
The SpCas9 proteins include mutations at one of the following amino acid positions to reduce or (preferably) destroy the nuclease activity of the Cas9: D10, E762, D839, H983, or D986 and H840 or N863, e.g., D10A/D10N and H840A/H840N/H840Y, to render the nuclease portion of the protein catalytically inactive; substitutions at these positions could be alanine (as they are in Nishimasu al., Cell 156, 935-949 (2014)), or other residues, e.g., glutamine, asparagine, tyrosine, serine, or aspartate, e.g., E762Q, H983N, H983Y, D986N, N863D, N863S, or N863H (see WO 2014/152432). In some embodiments, the variant includes mutations at D10A or H840A (which creates a single-strand nickase), or mutations at D10A and H840A (which abrogates nuclease activity; this mutant is known as dead Cas9 or dCas9).
The methods can include the delivery of a catalytically inactive Cas9 protein, e.g., dCas9 or dxCas9, and one or more guide RNAs that target the dCas9 to the repeat expansion region. A number of exemplary guide RNAs are provided in Table 1.
The methods can include delivering the dCas9 in a nucleic acid that encodes them. This can be performed in a variety of ways. For example, the nucleic acid encoding the dCas9 can be delivered as mRNA, or can be cloned into an intermediate vector for transformation into prokaryotic or eukaryotic cells for replication and/or expression. Intermediate vectors are typically prokaryote vectors, e.g., plasmids, or shuttle vectors, or insect vectors, for storage or manipulation of the nucleic acid encoding the dCas9 for production of the dCas9. The nucleic acid encoding the dCas9 can also be cloned into an expression vector, for administration to a plant cell, animal cell, preferably a mammalian cell or a human cell, fungal cell, bacterial cell, or protozoan cell.
To obtain expression, a sequence encoding a dCas9 is typically subcloned into an expression vector that contains a promoter to direct transcription. Suitable bacterial and eukaryotic promoters are well known in the art and described, e.g., in Sambrook et al., Molecular Cloning, A Laboratory Manual (3d ed. 2001); Kriegler, Gene Transfer and Expression: A Laboratory Manual (1990); and Current Protocols in Molecular Biology (Ausubel et al., eds., 2010). Bacterial expression systems for expressing the engineered protein are available in, e.g., E. coli, Bacillus sp., and Salmonella (Palva et al., 1983, Gene 22:229-235). Kits for such expression systems are commercially available. Eukaryotic expression systems for mammalian cells, yeast, and insect cells are well known in the art and are also commercially available.
The promoter used to direct expression of a nucleic acid depends on the particular application. For example, a strong constitutive promoter is typically used for expression and purification of fusion proteins. In contrast, when the dCas9 is to be administered in vivo for gene regulation, either a constitutive or an inducible promoter can be used, depending on the particular use of the dCas9. In addition, a preferred promoter for administration of the dCas9 can be a weak promoter, such as HSV TK or a promoter having similar activity. The promoter can also include elements that are responsive to transactivation, e.g., hypoxia response elements, Gal4 response elements, lac repressor response element, and small molecule control systems such as tetracycline-regulated systems and the RU-486 system (see, e.g., Gossen & Bujard, 1992, Proc. Natl. Acad. Sci. USA, 89:5547; Oligino et al., 1998, Gene Ther., 5:491-496; Wang et al., 1997, Gene Ther., 4:432-441; Neering et al., 1996, Blood, 88: 1147-55; and Rendahl et al., 1998, Nat. Biotechnol., 16:757-761).
In addition to the promoter, the expression vector typically contains a transcription unit or expression cassette that contains all the additional elements required for the expression of the nucleic acid in host cells, either prokaryotic or eukaryotic. A typical expression cassette thus contains a promoter operably linked, e.g., to the nucleic acid sequence encoding the dCas9, and any signals required, e.g., for efficient polyadenylation of the transcript, transcriptional termination, ribosome binding sites, or translation termination. Additional elements of the cassette may include, e.g., enhancers, and heterologous spliced intronic signals.
The particular expression vector used to transport the genetic information into the cell is selected with regard to the intended use of the dCas9, e.g., expression in plants, animals, bacteria, fungus, protozoa, etc. Standard bacterial expression vectors include plasmids such as pBR322 based plasmids, pSKF, pET23D, and commercially available tag-fusion expression systems such as GST and LacZ.
Expression vectors containing regulatory elements from eukaryotic viruses are often used in eukaryotic expression vectors, e.g., lentiviral vectors, adenoviral vectors, SV40 vectors, papilloma virus vectors, and vectors derived from Epstein-Barr virus. Other exemplary eukaryotic vectors include pMSG, pAV009/A+, pMTO10/A+, pMAMneo-5, baculovirus pDSVE, and any other vector allowing expression of proteins under the direction of the SV40 early promoter, SV40 late promoter, metallothionein promoter, murine mammary tumor virus promoter, Rous sarcoma virus promoter, polyhedrin promoter, or other promoters shown effective for expression in eukaryotic cells.
The vectors for expressing the dCas9s can include RNA Pol III promoters to drive expression of the guide RNAs, e.g., the H1, U6 or 7SK promoters. These human promoters allow for expression of dCas9s in mammalian cells following plasmid transfection.
Some expression systems have markers for selection of stably transfected cell lines such as thymidine kinase, hygromycin B phosphotransferase, and dihydrofolate reductase. High yield expression systems are also suitable, such as using a baculovirus vector in insect cells, with the gRNA encoding sequence under the direction of the polyhedrin promoter or other strong baculovirus promoters.
The elements that are typically included in expression vectors also include a replicon that functions in E. coli, a gene encoding antibiotic resistance to permit selection of bacteria that harbor recombinant plasmids, and unique restriction sites in nonessential regions of the plasmid to allow insertion of recombinant sequences.
Standard transfection methods are used to produce bacterial, mammalian, yeast or insect cell lines that express large quantities of protein, which are then purified using standard techniques (see, e.g., Colley et al., 1989, J. Biol. Chem., 264:17619-22; Guide to Protein Purification, in Methods in Enzymology, vol. 182 (Deutscher, ed., 1990)). Transformation of eukaryotic and prokaryotic cells are performed according to standard techniques (see, e.g., Morrison, 1977, J. Bacteriol. 132:349-351; Clark-Curtiss & Curtiss, Methods in Enzymology 101:347-362 (Wu et al., eds, 1983).
Any of the known procedures for introducing foreign nucleotide sequences into host cells may be used. These include the use of calcium phosphate transfection, polybrene, protoplast fusion, electroporation, nucleofection, liposomes, microinjection, naked DNA, plasmid vectors, viral vectors, both episomal and integrative, and any of the other well-known methods for introducing cloned genomic DNA, cDNA, synthetic DNA or other foreign genetic material into a host cell (see, e.g., Sambrook et al., supra). It is only necessary that the particular genetic engineering procedure used be capable of successfully introducing at least one gene into the host cell capable of expressing the Cas9.
Alternatively, the methods can include delivering the dCas9 protein and guide RNA together, e.g., as a complex. For example, the dCas9 and gRNA can be overexpressed in a host cell and purified, then complexed with the guide RNA (e.g., in a test tube) to form a ribonucleoprotein (RNP), and delivered to cells. In some embodiments, the variant dCas9 can be expressed in and purified from bacteria through the use of bacterial dCas9 expression plasmids. For example, His-tagged variant dCas9 proteins can be expressed in bacterial cells and then purified using nickel affinity chromatography. The use of RNPs circumvents the necessity of delivering plasmid DNAs encoding the nuclease or the guide, or encoding the nuclease as an mRNA. RNP delivery may also improve specificity, presumably because the half-life of the RNP is shorter and there's no persistent expression of the nuclease and guide (as you'd get from a plasmid). The RNPs can be delivered to the cells in vivo or in vitro, e.g., using lipid-mediated transfection or electroporation. See, e.g., Liang et al. “Rapid and highly efficient mammalian cell engineering via Cas9 protein transfection.” Journal of biotechnology 208 (2015): 44-53; Zuris, John A., et al. “Cationic lipid-mediated delivery of proteins enables efficient protein-based genome editing in vitro and in vivo.” Nature biotechnology 33.1 (2015): 73-80; Kim et al. “Highly efficient RNA-guided genome editing in human cells via delivery of purified Cas9 ribonucleoproteins.” Genome research 24.6 (2014): 1012-1019.
In some embodiments, the present methods and compositions can be used to contract nucleotide expansions in a living cell or population of cells from a subject with a condition associated with nucleotide expansions, e.g., a number of nucleotide repeats above a reference number, where the reference number represents a number in a normal individual or in a subject who is not affected; in some embodiments the reference number represents a range of numbers of repeats present in a person who has a permutation or is a carrier of the disease but is unaffected. A non-limiting list of conditions includes FXS, fragile X-associated tremor/ataxia syndrome (FXTAS), Parkinson's disease (PD), Huntington's disease (HD), myotonic dystrophy, and others. A non-limiting list of nucleotide repeats includes CGG repeats, GGC repeats, CAG repeats, CTG repeats, and GAA repeats. Repeats of more than three nucleotides can also be targeted as nucleotide repeats are defined as sequences of 1-6 nucleotides (or longer, e.g., 10 nts) that are repeated multiple times. See, e.g., Budworth, H. and McMurray, C. T. (2013) Methods Mol Biol. 1010:3-17; Ellerby (2019) Neurotherapeutics 16:924-927. Table 2 provides a list of exemplary repeats and associated diseases.
(DM1) myotonic dystrophy type 1; (DM2) myotonic dystrophy type 2; (DRPLA) dentatorubral-pallidoluysian atrophy; (EPM1) progressive myoclonus epilepsy type I; (FTD/ALS) Frontotemporal dementia (FTD) and amyo-trophic lateral sclerosis (ALS); (FXS) Fragile X syndrome; (MR) mental retardation; (FRDA) Friedreich ataxia; (HD) Huntington disease; (HDL-2) Huntington disease-like 2; (NCT) noncoding transcript; (SBMA) spinobulbar muscular atrophy; (SCA) spinocerebellar ataxia. Table adapted in part from Usdin, K (2008) Genome Res. 18: 1011-1019.
The methods can include obtaining iPSC generated from differentiated somatic cells obtained from the subject; exposing the iPSC to a treatment described herein to contract (reduce the number of) nucleotide repeats; optionally promoting differentiation of the corrected cells, e.g., to neural precursor cells; and administering the cells to the subject, e.g., to the CNS (spinal cord or brain) of a subject, such as to the cortex, cerebellum, hypothalamus, substantia nigra, spinal cord, putamen, hippocampus, or other CNS regions (see, e.g., Duma et al., Molecular Biology Reports volume 46, pages 5257-5272(2019); Schweitzer et al., N Engl J Med. 2020 May 14; 382(20):1926-1932; Kim et al., Alzheimers Dement (N Y). 2015 September; 1(2): 95-102), or to one or more organs (e.g., liver, lung, heart, kidney, or gut). Alternatively, the methods can include administering a composition as described herein to the subject, e.g., to the CNS of the subject (e.g., via ICV, cisternae magna, or intrathecal administration), to an organ (e.g., liver, lung, heart, kidney, or gut) or systemically. A few exemplary conditions are discussed in greater detail in the following paragraphs.
The present methods and compositions can be used to treat subjects who have fragile X syndrome (FXS). A diagnosis of FXS can be made using methods known in the art. For example, a standard diagnostic test for FXS involves using molecular genetic techniques to detect and/or sequence the FMR1 gene; in some cases the exact number of CGG triplet repeats can be determined. Methods for diagnosing FXS include Southern blotting and polymerase chain reaction (PCR) (see, e.g., Stone W L, Basit H, Los E. Fragile X Syndrome. [Updated 2020 May 4]. In: StatPearls [Internet]. Treasure Island (FL): StatPearls Publishing; 2020 January Available from ncbi.nlm.nih.gov/books/NBK459243/). Normal numbers of CGG repeats are between five and 40 repeats. Individuals with 55 to 200 repeats are considered to have an FMR1 gene premutation (PM) and typically have a normal intellect. Individuals with greater than 200 CGG repeats have a full mutation (FM) for FXS. In some embodiments, the methods and compositions described herein can be administered to a cell or subject having >50 repeats, e.g., 50-200 repeats, or >200 repeats. In subjects with 50-200, the methods can be used for contracting CGG repeats, e.g., for the purposes of reducing CGG-FMR1 accumulation in the brains of Fragile X premutation carriers.
Fragile X syndrome, also termed Martin-Bell syndrome or marker X syndrome, is one of the most common heritable neurodegenerative disorders and is caused by the expansion of CGG nucleotide repeats in the 5′-UTR of the FMR1 gene. There are two types of FXS with distinct pathological lesions depending on the length of the CGG repeats: pre-mutation and full mutation. Very long expansion resulting in over 200 CGG repeats—so-called full mutation (FM)—cause DNA hyper-methylation and consequent epigenetic silencing of the fragile X mental retardation 1 (FMR1) gene, which in turn causes a loss of expression of the fragile X mental retardation protein (FMRP) (McLennan et al., Curr Genomics. 2011 May; 12(3): 216-224). FMRP is a polyribosome-associated RNA binding protein that regulates the translation of mRNAs from a wide variety of genes, including many genes encoding synaptic proteins (Darnell, J. C., et al., Cell, 2011. 146(2): p. 247-61). Currently, there is no cure for FXS or FXTAS Parkinsonism available, and treatments are limited to alleviating symptoms.
While typically apparently normal at birth, signs of FXS can develop in early childhood, signaled by developmental delays, psychomotor delays, intellectual disabilities, elongated face, prominent ears, and post-pubertal macroorchidism (McLennan Y, et al., Curr Genomics. 2011 May; 12(3):216-24). Otitis media and sinusitis can be frequent, leading to conductive hearing problems and further developmental delays. Approximately 30% to 60% of individuals with FXS have autism. Obesity is a common problem in subjects with FXS.
The present methods and compositions can be used to treat subjects who have FXS. In some embodiments, the subject has demonstrated signs of FXS; in some embodiments, the subject has not yet demonstrated signs of FXS. The methods can thus be used to ameliorate one or more symptoms of FXS, e.g., to reduce severity of one or more symptoms; to reduce the likelihood that a subject will develop one or more symptoms of FXS; or to slow progression or worsening of one or more symptoms of FXS.
The present methods and compositions can be used to treat subjects who have fragile X-associated tremor/ataxia syndrome (FXTAS). A diagnosis of FXTAS can be made using methods known in the art. Some signs and symptoms of FXTAS include, but are not limited to, parkinsonism (resting tremors), intention tremors, ataxias, gait disturbances, MRI findings (white matter lesions involving middle cerebellar peduncles (MCP) signs, moderate to severe generalized brain atrophy, etc.), and neuropathology signs (e.g., inclusions with brain cells), short-term memory problems, and defects in “executive function” and decision-making.
The cause of FXTAS is PM (pre-mutation; discussed above), where subjects typically have 50-200 repeats of CGG. Carriers of the pre-mutation alleles (55-200 CGG repeats) exhibit increased FMR1 mRNA levels but normal or lower FMRP expression, implying a different pathological mechanism (Tassone, F., et al., RNA, 2007. 13(4): p. 555-62). Such carriers are asymptomatic earlier in life but develop Parkinsonism later in life—a condition called FXTAS and presumed to be caused by toxic accumulation of CGG-FMR1 RNA (Ma, L, et al., (2019) Acta Neuropathologica Communications 7:143; Kraff J, et al., (2007) Arch Neurol 64(7):1002-1006). As discussed above, individuals with PM have 50-200 CGG repeats (e.g., in FMR1 or NOTCH2NLC). FXTAS affects 40% of PM male carries and 15% of female PM carries. Generally, there is a high prevalence of premutation, which is 1 in 259 for men and 1 in 813 for women. Premutation causes FXTAS and is one of the most common causes of age-related neurodegenerative disorders (e.g., ALS, PD, etc). In some embodiments, the methods and compositions described herein can be administered to a cell or subject having >50 repeats, 50-200 repeats, or >200 repeats.
The present methods and compositions can be used to treat subjects who have FXTAS. In some embodiments, the subject has demonstrated signs of FXTAS; in some embodiments, the subject has not yet demonstrated signs of FXTAS. The methods can thus be used to ameliorate one or more symptoms of FXTAS, e.g., to reduce severity of one or more symptoms; to reduce the likelihood that a subject will develop one or more symptoms of FXTAS; or to slow progression or worsening of one or more symptoms of FXTAS.
The present methods and compositions can be used to treat subjects who have Parkinson's disease (PD) associated with nucleotide repeat expansion. A diagnosis of PD with TNR expansion can be made using methods known in the art. The presence of Notch homolog 2 N-terminal-like C (NOTCH2NLC) GGC (or CGG) expansion causes neuronal intranuclear inclusion body disease (NIID), a neurodegenerative condition characterized by eosinophilic intranuclear inclusions in neuronal and glial cells. Large GGC repeat numbers, ranging from 66 to 517 units, have been reported in patients affected by NIID, while control participants had fewer than 40 repeats (5-39). An intermediate-length (40-65) NOTCH2NLC GGC expansion may also occur in human neurological disease (Shi et al., Ann Neurol 2021; 89:182-187). Patients with NIID have overlapping clinical features of dementia, ataxia, parkinsonism, and peripheral neuropathy. While parkinsonism is part of the spectrum of the clinical phenotype and may be a predominant sign in some patients with NIID and a family history, subjects with NOTCH2NLC GGC repeat expansions can present with typical sporadic PD with no other clinical or imaging features of NIID, even after several years of follow-up. The higher frequency of GGC expansions of 41 to 64 repeats in patients with PD compared with controls (Ma, D., et al. (2020) JAMA Neurol. 2020 Aug. 24; 77(12):1-5). GGC expansion in NOTCH2NLC is also associated with adult leukoencephalopathy (Okubo et al., Ann Neurol. 2019 December; 86(6):809-811).
The cause of PD is typically a mix of environmental and genetic causes. However, nucleotide repeat expansion has been shown in subjects with PD. As discussed above, some individuals with PD have 40-517 CGG repeats in genes associated with PD (e.g., NOTCH2NLC). In some embodiments, the methods and compositions described herein can be administered to a cell or subject having >40 repeats, e.g., 40-200 repeats, or >200 repeats.
The present methods and compositions can be used to treat subjects who have PD or NIID. In some embodiments, the subject has demonstrated signs of PD; in some embodiments, the subject has not yet demonstrated signs of PD. The methods can thus be used to ameliorate one or more symptoms of PD, e.g., to reduce severity of one or more symptoms; to reduce the likelihood that a subject will develop one or more symptoms of PD; or to slow progression or worsening of one or more symptoms of PD.
The present methods and compositions can be used to treat subjects who have Huntington's disease (HD). A diagnosis of HD can be made using methods known in the art. The cause of Huntington's disease was found to be a CAG expansion in exon 1 of the huntingtin gene (HTT). The disease protein contains a polyglutamine expansion in the N-terminal region of the Huntingtin protein (HTT) (Ellerby, L. M. (2019) Neurotherapeutics 16:924-927). Unaffected individuals may have roughly 6-29 CAG triplets in both alleles; yet, in HD patients, the disease allele may contain 36 to hundreds of CAG triplets. As the repeat number grows, the growing polyglutamine tract produces an abnormal HD gene product (called huntingtin) with increasingly aberrant properties that causes death of brain cells controlling movement (Budworth, H. and McMurray, C. T. (2013) Methods Mol Biol. 1010:3-17). In some embodiments, the methods and compositions described herein can be administered to a cell or subject having >30 repeats, e.g., 30-100 repeats, or >100 repeats. In some embodiments, the methods and compositions described herein methods can reduce levels of huntingtin.
The present methods and compositions can be used to treat subjects who have HD. In some embodiments, the subject has demonstrated signs of HD; in some embodiments, the subject has not yet demonstrated signs of HD. The methods can thus be used to ameliorate one or more symptoms of HD, e.g., to reduce severity of one or more symptoms; to reduce the likelihood that a subject will develop one or more symptoms of HD; or to slow progression or worsening of one or more symptoms of HD.
The present methods and compositions can be used to treat subjects who have Myotonic dystrophy, or dystrophia myotonica (DM), including myotonic dystrophy type 1 (DM1) and/or myotonic dystrophy type 2 (DM2). A diagnosis of DM1 and/or DM2 can be made using methods known in the art. Myotonic dystrophy exists in two clinically and molecularly defined forms: myotonic dystrophy type 1 (DM1), also known as Steinert's disease; and myotonic dystrophy type 2 (DM2), also known as proximal myotonic myopathy, both of which are inherited in an autosomal dominant fashion [9]. DM1 is caused by a CTG expansion in the 3′ untranslated region of the dystrophia myotonica protein kinase (DMPK) gene on chromosome 19q13, while DM2 is caused by a CCTG expansion located within intron 1 of the cellular nucleic-acid-binding protein (CNBP, formerly ZNF9) gene on chromosome 3q21 (Yum K, et al. (2017) Curr Opin Genet Dev. 44: 30-37).
A healthy individual with normal DMPK alleles has 5 to 37 repeats (35 has also commonly been used as an upper threshold for normal repeat length). DM1 patients who have repeats between 38 and 50 are said to have a “pre-mutation” allele and can be asymptomatic throughout their lifetime. However, they are at increased risk of having children with larger repeats. In DM1, there can be hundreds or even thousands of CTG repeats in the DMPK gene. In DM1, the number of repeats correlates with the age of onset and the severity of the disorder. However, in DM2 there is no definite correlation between repeat length and the severity of disease. It is important to remember that these correlations are by no means perfect and should not be taken as absolute predictors of the course of the disease.
Individuals with a CTG repeat size between 38 and 49, designated premutation status or mutable normal, are asymptomatic. A mutation of 50 to approximately 150 CTG repeats can manifest as a mild DM1 type. Repeats in the range of 50 to 1,000 are seen in individuals with classic DM1. CTG repeat lengths greater than 800 may manifest as childhood DM1. With CTG repeat lengths greater than 1,000, DM1 may manifest as congenital MD. A phenomenon known as somatic mosaicism was observed in DM1 patients. This phenomenon results in expansion of CTG repeats in the DNA due to abnormal DNA repair throughout life. When the DMPK gene expansion is transmitted from parent to child, it often expands, causing the disease to manifest earlier with each generation in a family.
Penetrance tends to grow as repeat length increases, but extreme variability in penetrance of specific symptoms exists in the patient population. Somatic mosaicism and intergenerational instability are biased towards expansion in DM1, although contraction can rarely occur. It is estimated that a decrease in the CTG repeat size during transmission from parents to child is about 6.4%, most frequently during paternal transmissions. Children of DM1 parents typically inherit repeat lengths considerably larger than those present in the transmitting parent, the phenomenon known as “anticipation,” where disease severity increases and age of onset decreases in successive generations. Up to 5% of DM1 patients have interrupted repeats, in which the CTG repeat tract contains GGC, CCG, or CTC repeats. Some of these interruptions have been associated with stabilization of the CTG repeat tract length.
The repeat expansion of DM2 in intron 1 of CNBP is found within the context of a complex (TG)n(TCTG)n(CCTG)n sequence or CCTG—repeated far more times than average. The normal gene has 11 to 26 repeats; on genes of those with DM2, there are from 75 to more than 11,000 repeats, with a mean of 5,000 repeats. CCTG repeat tracts also display somatic instability. While non-pathogenic alleles contain up to 26 repeats, the range of repeats in patients is extremely broad, with measurements from 75 to 11,000 units (on average 5,000). Unlike DM1, the size of the repeat DNA expansion in DM2 does not correlate with age of onset or disease severity. This is further supported by the observation that individuals homozygous for repeat expansions have clinical features indistinguishable from that of their heterozygous siblings. Phenotypes and anticipation in DM2 are almost always milder than DM1, and DM2 lacks the congenital form. Despite these key differences, DM1 and DM2 share several hallmark clinical features such as myotonia, cataracts, and cardiac conduction defects (Yum K, et al. (2017) Curr Opin Genet Dev. 44: 30-37).
In some embodiments, the methods and compositions described herein can be administered to a cell or subject having >25 repeats, e.g., 25-100 repeats, >35 repeats, e.g., 35-100 repeats, >50 repeats, e.g., 50-150 repeats, or >100 repeats.
The present methods and compositions can be used to treat subjects who have DM1 and/or DM2. In some embodiments, the subject has demonstrated signs of DM1 and/or DM2; in some embodiments, the subject has not yet demonstrated signs of DM1 and/or DM2. The methods can thus be used to ameliorate one or more symptoms of DM1 and/or DM2, e.g., to reduce severity of one or more symptoms; to reduce the likelihood that a subject will develop one or more symptoms of DM1 and/or DM2; or to slow progression or worsening of one or more symptoms of DM1 and/or DM2.
The methods described herein can include the use of human induced pluripotent stem cells (hiPSCs), which can be generated using methods known in the art or described herein. In some embodiments, the methods for generating hiPSC can include obtaining a population of primary somatic cells from a subject who has been diagnosed with a disease associated with nucleotide repeats, e.g., FXS, and is in need of treatment for the disease. Preferably the subject is a mammal, e.g., a human. In some embodiments, the somatic cells are fibroblasts. Fibroblasts can be obtained from connective tissue in the mammalian body, e.g., from the skin, e.g., skin from the eyelid, back of the ear, a scar (e.g., an abdominal cesarean scar), or the groin (see, e.g., Fernandes et al., Cytotechnology. 2016 March; 68(2): 223-228), e.g., using known biopsy methods. Other sources of somatic cells for hiPSC include hair keratinocytes (Raab et al., Stem Cells Int. 2014; 2014:768391), blood cells, or bone marrow mesenchymal stem cells (MSCs) (Streckfuss-Bömeke et al., Eur Heart J. 2013 September; 34(33):2618-29).
According to the present methods, the cells (e.g., fibroblasts) are exposed to factors to induce reprogramming to iPSC. Although other protocols for programming can be used (e.g., as known in the art or described herein), in preferred embodiments the methods include introducing four transcription factors, i.e., Oct4, Sox2, Klf4, and L-Myc. In some embodiments, the methods comprise transfecting the cells with an OCT4, KLF4, SOX2, and L-MYC-expressing polycistronic episomal vector. See, e.g., WO 2020/237104.
References to exemplary sequences for OCT4, KLF4, SOX2, and L-MYC are provided in table 3.
In some embodiments, the methods also or alternatively include expressing in the cells one or more exogenous microRNAs, e.g., one or more of miR-106a, -106b, -136s, -200c, -302s, -369s, and -371/373. miR-302s indicates the miR-302 cluster which encompasses five miRNAs including 302a, 302b, 302c, 302d, and 367; any one or more of them can be used. In some embodiments, the methods include expressing in the cells miR-302s and miR-200c, e.g., from a single episomal vector. In some embodiments, the methods comprise introducing into the cells an episomal vector that comprises sequences coding for miR-302s and miR-200c. See, e.g., WO 2020/237104.
The sequences used can be at least 80, 85, 90, 95, or 100% identical to the exemplary (reference) sequences provided herein, but should retain the desired activity of the exemplary (reference) sequence. Calculations of “identity” between two sequences can be performed as follows. The sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second nucleic acid sequence for optimal alignment and non-identical sequences can be disregarded for comparison purposes). The length of a sequence aligned for comparison purposes is at least 60% (e.g., at least 70%, 80%, 90% or 100%) of the length of the reference sequence. The nucleotides at corresponding nucleotide positions are then compared. When a position in the first sequence is occupied by the same nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which need to be introduced for optimal alignment of the two sequences.
The comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm. In some embodiments, the percent identity between two nucleotide sequences is determined using the GAP program in the GCG software package, using a BLOSUM 62 scoring matrix with a gap penalty of 12, a gap extend penalty of 4, and a frameshift gap penalty of 5.
The primary somatic cells can be transfected directly, or they can be cultured first, removed from the culture plate and resuspended before transfection is carried out. The cells are combined with exogenous nucleic acid sequence, e.g., to—express the reprogramming factors by transient transfection or to stably integrate into the genomes. As used herein, the term “transfection” includes a variety of techniques for introducing an exogenous nucleic acid into a cell including calcium phosphate or calcium chloride precipitation, microinjection, DEAE-dextrin-mediated transfection, lipofection, or electroporation, all of which are known in the art. Where the vectors are viral vectors, transfection can include transducing the cells with viral particles. For episomal vector delivery, cells can be electroporated with reprogramming factors-expressing episomal vectors (e.g. using a commercially available or known method, e.g., AMAXA or NEON transfection system; Song et al., (2020) J Clin Invest. 130(2): 904-920; Meggis et al., (2016) Stem Cell Research 16: 128-132). Alternatively, the cells can be transfected with mRNA encoding each of the factors.
After introducing these factors into the cells, the cells are maintained in conditions and for a time sufficient for expression of the factors and induction of reprogramming to iPS cells, e.g., cells that express alkaline phosphatase (AP) as well as the more stringent pluripotency marker, TRA-1-60 (Chan et al., 2009; Tanabe et al., 2013). A number of methods are known in the art; see, e.g., Malik and Rao, Methods Mol Biol. 2013; 997:23-33. In some embodiments, the conditions comprise maintaining the cells in media, e.g., media comprising DMEM/F-12, L-glutamine (e.g., 2 mM), serum, e.g., fetal bovine serum (FBS) (e.g., 10%), Non-essential amino acid (NEAA, e.g., 1×), Nicotinamide (NAM, e.g., 1 mM), Sodium butyrate (NaB) (e.g., 25 mM), and Ascorbic acid (AA, e.g., 50 μg/ml); alternatively, DMEM media with knockout serum replacement (KSR, a defined, FBS-free medium), glutamine, and β-mercaptoethanol can be used. One of skill in the art will appreciate that other concentrations can be used. In some embodiments, the conditions comprise maintaining the cells in media with feeder cells, which are non-dividing supporter cells (e.g., irradiated embryonic fibroblasts, irradiated mouse embryonic fibroblasts). Methods can also be found the following references: Yu G., et al., (2015) “Feeder Cell Sources and Feeder-Free Methods for Human iPS Cell Culture.” In: Sasaki K., Suzuki O., Takahashi N. (eds) Interface Oral Health Science 2014. Springer, Tokyo. (pp. 145-159; doi.org/10.1007/978-4-431-55192-8_12); Thomson J A, et al. (1998) Embryonic stem cell lines derived from human blastocysts. Science 282(5391): 1145-7; Hoffman L M, Carpenter M K. Characterization and culture of human embryonic stem cells. Nat Biotechnol. 2005; 23(6):699-708; Pera M F, Reubinoff B, Trounson A. Human embryonic stem cells. J Cell Sci. 2000; 113(1):5-10, for example.
Following reprogramming to iPSC, the cells can be maintained in an hiPSC medium, e.g., comprising DMEM/F-12, L-glutamine (e.g., 2 mM), KSR (e.g., 20%), NEAA, NAM, NaB, and bFGF with feeder cells, until formation of ES-like colonies. Once established, the pluripotency of hiPSCs can be further confirmed by differentiating into three germ layers (mesoderm, ectoderm, and endoderm) and test their identities by (1) staining with antibodies against the three germ layer markers (OTX2, an ectodermal marker; SOX17, an endodermal marker; and BRACHYURY, a mesodermal marker) and (2) gene expression of lineage-specific markers (e.g., PAX6 and MAP2 for ectoderm, FOXA2, SOX17 and CK8 for endoderm, and MSX1, MYL2A and COL6A2 for mesoderm). In some embodiments for serum-free and feeder-free conditions, the iPSC cells are maintained in ESSENTIAL 8 medium or an equivalent thereof, i.e., comprising or consisting essentially of DMEM F-12, L-ascorbic acid, Selenium, Transferrin, NaHCO3, Insulin, FGF2, and TGFβ1. See, e.g., Chen et al., Nat Methods 8(5):424-429. In some embodiments, the iPSC cells are maintained in mTeSR media (from StemCell Technology) designed for serum-free and feeder-free conditions. See, e.g., Shi, M.-J., Stencel, K. and Borowski, M. (2010). “Human Embryonic Stem Cell Culture on BD Matrigel™ with mTeSR®1 Medium.” In Human Stem Cell Technology and Biology (eds G. S. Stein, M. Borowski, M. X. Luong, M.-J. Shi, K. P. Smith and P. Vazquez). https://doi.org/10.1002/9780470889909.ch11. Methods of reprogramming and maintaining iPSCs can also be found in the art; see, e.g., Ghaedi, M. and Niklason, L. E. (2019) Methods Mol Biol. 1576: 55-92; and Takahashi K, et al. (2007) Cell 131(5):861-72.
Once iPS cells are generated, they can be maintained as an iPS cell line. In some embodiments, for each patient, multiple iPSC lines are generated and characterized and then the best lines (e.g., the best 1, 2, 3 or more lines) are chosen.
Once iPSC are obtained or generated from a subject with a disease associated with nucleotide repeats, e.g., FXS, the cells or cell lines can be subjected to treatment with a combination of dCas9 and one or more guide RNAs (e.g., introduced by viral, e.g., lentiviral or adenoviral vectors) that leads to contraction of nucleotide repeats and subsequent alleviation of the abnormality caused by the expanded repeats, e.g., restoring the function of FMR1 gene by the contraction of CGG repeats.
The cells are provided with dCas9 and gRNAs for a time sufficient for the cells to restore the gene function by contraction of nucleotide repeats to occur, e.g., at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 days or longer. The cells can be provided with dCas9 and gRNAs via transfection methods known in the art and discussed elsewhere herein. For example, cells can be combined with exogenous nucleic acid sequence, e.g., to transiently express the reprogramming factors by transient transfection or to stably integrate into the genomes. Where the vectors are used viral vectors (e.g., lentiviral vector), transfection can include transducing the cells with viral particles (e.g., lentivirus). For episomal vector delivery, cells can be, e.g., electroporated, with reprogramming factors-expressing episomal vectors (e.g. using a commercially available or known method, e.g., AMAXA or NEON transfection system; Song et al., (2020) J Clin Invest. 130(2): 904-920; Meggis et al., (2016) Stem Cell Research 16: 128-132). In some embodiments, an RNP (RNA-Protein complex) can be used to deliver the dCas9 and gRNA to the cells, which can be repeated every 2-3 days.
The methods can include generating new clonal cell lines, e.g., from single cells, and determining the presence of restored disease-related gene (e.g. FMR1) function and reduced numbers of CGG repeats, and selecting clonal cell lines with restored gene function and reduced numbers of CGG repeats (e.g., fewer than 200, 100, 75, 80, or 50 CGG repeats). The presence of other spontaneous mutations can also be determined, e.g., using next generation sequencing to identify cells with oncogenic or other deleterious mutations. Once these cells with restored FMR1 gene function are generated, they can be maintained as an iPS cell line. In some embodiments, for each patient, multiple iPSC lines with restored FMR1 gene function are generated and characterized and then the best lines (e.g., the best 1, 2, 3 or more lines) are chosen.
The cells can be cultured in the presence of a catalytically inactive Cas9 protein, e.g., dCas9 or a variant thereof, and one or more guide RNAs that target the dCas9 to the repeat expansion region. A number of exemplary guide RNAs are provided in Table 1, above.
In some embodiments, the cells are maintained in the reactivation cocktail for a time sufficient for the cells to reactivate gene expression and for contraction of nucleotide repeats to occur, e.g., at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 days or longer. The methods can include generating new clonal cell lines, e.g., from single cells, and determining the presence of restored disease-related gene (e.g. FMR1) function, increased gene expression (e.g., of FMR1) and/or reduced numbers of repeats, and selecting clonal cell lines with increased gene expression (e.g., of FMR1) and reduced numbers of nucleotide repeats (e.g., CGG repeats (e.g., fewer than 200, 100, 75, 80, or 50 CGG repeats)). The presence of other spontaneous mutations can also be determined, e.g., using next generation sequencing to identify cells with oncogenic or other deleterious mutations. Once these corrected, e.g., FMR1 gene-reactivated, cells are generated, they can be maintained as an iPS cell line. In some embodiments, for each patient, multiple (e.g., FMR1-reactivated) iPSC lines are generated and characterized and then the best lines (e.g., the best 1, 2, 3 or more lines) are chosen.
The cells can be cultured in the presence of a reactivation cocktail with active factors comprising or consisting of:
A number of MEK inhibitors (which specifically inhibit mitogen-activated protein kinase kinase enzymes MEK1 and/or MEK2) are known in the art. For example, Trametinib (GSK1120212) has been used for the treatment of certain cancers. Other examples of MEK inhibitors include Selumetinib, MEK162, PD-325901, cobimetinib (XL518; [3,4-Difluoro-2-(2-fluoro-4-iodoanilino)phenyl] {3-hydroxy-3-[(2S)-piperidin-2-yl]azetidin-1-yl} methanone), CL-1040, and PD035901.
A number of small molecule inhibitors of ROCK1/2 are known in the art and can be used in the present methods and compositions including cyclohexanecarboxamides such as Y-27632 ((+)-(R)-trans-4-(1-aminoethyl)-N-(4-pyridyl)cyclohexanecarboxamide dihydrochloride) and Y-30131 ((+)-(R)-trans-4-(1-aminoethyl)-N-(1H-pyrrolo[2,3-b]pyridin-4-yl)cyclohexanecarboxamide dihydrochloride)(see Ishizaki et al., Mol Pharmacol. 2000 May; 57(5):976-83); dihydropyrimidinones and dihydropyrimidines, e.g., bicyclic dihydropyrimidine-carboxamides (such as those described in Sehon et al. J. Med. Chem., 2008, 51 (21): 6631-6634 and US2018/0170939); ureidobenzamides such as CAY10622 (3-[[[[[4-(aminocarbonyl) phenyl] amino] carbonyl]amino]methyl]-N-(1,2,3,4-tetrahydro-7-isoquinolinyl)-benzamide); Thiazovivin; GSK429286A; RKI-1447 (1-(3-Hydroxybenzyl)-3-(4-(pyridin-4-yl)thiazol-2-yl)urea); GSK180736A (GSK180736); Hydroxyfasudil (HA-1100); OXA 06; Y-39983; Netarsudil (AR-13324, see Lin et al., J Ocul Pharmacol Ther. 2018 Mar. 1; 34(1-2): 40-51, U.S. Pat. Nos. 8,450,344 and 8,394,826); GSK269962/GSK269962A; Fasudil (HA-1077, 1-(5-isoquinolinesulfonyl)-homopiperazine) and its derivatives such Ripasudil (K-115, 4-fluoro-5-[[(2S)-2-methyl-1,4-diazepan-1-yl]sulfonyl]isoquinoline; see WO1999/20620) and others that share the core structure of 5-(1,4-diazepan-1-ylsulfonyl)isoquinoline; KD025 (SLx-2119) and related compound and XD-4000 (see, e.g. Liao et al. 2007 J Cardiovasc Pharmacol 50:17-24; WO2010/104851 US 2012/0202793); SR 3677; AS 1892802; H-1152 ((S)-(+)-2-Methyl-1-[(4-methyl-5-isoquinolinyl)sulfonyl]homopiperazine, Ikenoya et al., J. Neurochem. 81:9, 2002; Sasaki et al., Pharmacol. Ther. 93:225, 2002); N-(4-Pyridyl)-N′-(2,4,6-trichlorophenyl)urea (Takami et al., Bioorg. Med. Chem. 12:2115, 2004); and 3-(4-Pyridyl)-1H-indole (Yarrow et al., Chem. Biol. 12:385, 2005); 3-[2-(aminomethyl)-5-[(pyridin-4-yl)carbamoyl]phenyl] benzoates including AMA0076 (compound 32, Boland et al., Bioorganic & Medicinal Chemistry Letters 23(23): 6442-6446 (2013)) TC-S 7001 and AT13148, and pharmaceutically acceptable salts thereof. Inhibitors with the scaffold 4-Phenyl-1H-pyrrolo [2,3-b] pyridine, including compound TS-f22, are described in Shen et al., Scientific Reports 5:16749 (2015). Other ROCK1/2 inhibitors include isoquinoline sulfonyl derivatives disclosed in WO 97/23222, Nature 389, 990-994 (1997) and WO 99/64011; heterocyclic amino derivatives disclosed in WO 01/56988; indazole derivatives disclosed in WO 02/100833; pyridylthiazole urea and other ROCK1/2 inhibitors as described in 20170049760; and quinazoline derivatives disclosed in WO 02/076976 and WO 02/076977; in WO02053143, p. 7, lines 1-5, EP1163910 A1, p. 3-6, WO02076976 A2, p. 4-9, preferably the compounds described on p. 10-13 and p. 14 lines 1-3, WO02/076977A2, the compounds I-VI of p. 4-5, WO03/082808, p. 3-p. 10 (until line 14), the indazole derivatives described in U.S. Pat. No. 7,563,906 B2, WO2005074643A2, p. 4-5 and the specific compounds of p. 10-11, WO2008015001, pages 4-6, EP1256574, claims 1-3, EP1270570, claims 1-4, and EP 1 550 660. These inhibitors are generally commercially available, e.g., from Santa Cruz Biotechnology, Selleck Chemicals, and Tocris, among others. For example, fasudil and Hydroxy fasudil are obtainable from Asahi Kasei Pharma Corp (Asano et al., J Pharmcol Exp Ther, 1987, 241(3): 1033-1040), Y-39983 is obtainable from Novartis/Senju (Fukiage et al., Biochem Biophys Res Commun, 2001, 288(2):296-300) and Y27632 is obtainable from Mitsubishi Pharma (Fu et al., FEBS Lett, 1998, 440(1-2):183-187). (S)-(+)-2-Methyl-1-[(4-methyl-5-isoquinolinyl) sulfonyl]homopiperazine], N-(4-Pyridyl)-N′-(2,4,6-trichlorophenyl) urea and 3-(4-Pyridyl)-1H-indole are also available at AXXORA (UK) Ltd and other suppliers. Protein or peptide inhibitor of ROCK1/2 are also known in the art, including inhibitors of ROCK1/2, e.g., a peptide consisting of 4-30 residues and exhibiting the sequence YSPS (SEQ ID NO:1), ERTYSPS (SEQ ID NO:2), or ERTYSPSTAVRS (SEQ ID NO:3)(see, e.g., US20170296617), or a kinase-defective mutant of ROCK1 or caspase 3 cleavage-resistant mutant of ROCK1 (e.g., as described in 2006/0142193). In some embodiments, the peptide further comprises one or more, e.g., all, D-amino acid residues.
A number of RAF inhibitors are known in the art and used clinically, e.g., for the treatment of cancers. Exemplary RAF inhibitors include: SB590885; GDC0879; Vemurafenib; Dabrafenib; LGX818; AZ628; LY3009120; TAK632; MLN2480 (TAK580); BGB659; BGB283; CCT196969; CCT241161; CCT3833 (BAL3833); PLX7904; PLX8394; HM95573; CEP32496 (also known as RXDX-105); LXH254; RAF709; and BI 882370. See, e.g., Karoulia et al., Nat Rev Cancer. 2017 November; 17(11): 676-691; Jinghua et al., Cancer Management and Research Volume 10:2289-2301 (2018).
Exemplary GSK3β inhibitors include CHIR-98023; CHIR-99021; CHIR-99030; Hymenialdisine; debromohymeialdisine; dibromocantherelline; Meridianine A; alsterpaullone; cazapaullone; Aloisine A; NSC 693868; (1H-Pyrazolo[3,4-b]quinoxalin-3-amine); Indirubin-3′-oxime; (Indirubin-3′-monoxime; 3-[1,3-Dihydro-3-(hydroxyimino)-2H-indol-2-ylidene]-1,3-dihydro-2H-indol-2-one); A 1070722; (1-(7-Methoxyquinolin-4-yl)-3-[6-(trifluoromethyl)pyridin-2-yl]urea); L803; L803-mts; TDZD8; NP00111; HMK-32; Manzamine A; Palinurin; Tricantin; IM-12; (3-(4-Fluorophenylethylamino)-1-methyl-4-(2-methyl-1H-indol-3-yl)-1H-pyrrole-2,5-dione); NP031112; NP00111; NP031115; VP 2.51; VP2.54; VP 3.16; and VP 3.35.
A number of Src inhibitors are known in the art, including WH4-023; Saracatinib (AZD0530); RK 24466; ENMD-2076; PRT062607 (P505-15) HCl; MG-47a; PP1; PP2; Src Inhibitor 1; and CCT196969. Other Src inhibitors include Dasatinib (e.g., Dasatinib hydrochloride or Dasatinib Monohydrate); Ponatinib (AP24534); Bosutinib (SKI-606); Pelitinib (EKB-569); Resveratrol; KX2-391 (Tirbanibulin); NVP-BHG712; PP121; MNS (3,4-Methylenedioxy-β-nitrostyrene); XL228; DGY-06-116; eCF506; 1-Naphthyl PP1(1-NA-PP1); AMG-47a; KX1-004; Myristic Acid; 7-Hydroxy-4-chromone; UM-164; Repotrectinib (TPX-0005); ON123300; SU6656; Doramapimod (BIRB 796); Dehydroabietic acid; Ginkgolic acid C17:1; AD80; and Quercetin. In some embodiments, a dual Lck/Src inhibitor is used.
In some embodiments, any of the treatments described herein are used in combination with an inhibitor of DNA methyltransferase (DNMT), e.g., DNMT1, DNMT3a/3b, etc. In some embodiments, the inhibitor of DNMT is RG 108, 5-azacytidine (also called “azacytidine”), decitabine (also called “5-Aza-2′-deoxycytidine”), Zebularine, procainamide, procaine, psammaplin A, sinefungin, temozolomide, OM173-alphaA, DNMT3A-binding protein, theaflavin 3,3′-digallate, 1-Hydrazinophthalazine, SGI-1027, hydralazine, NSC14778, Olsalazine, Nanaomycin, SID 49645275, Δ2-isoxazoline, epigallocatechin-3-gallate (EGCG), MG98, SGI-110, SGI-1027, SW155246, SW15524601, SW155246-2, or DZNep, an ASO targeting an DNMT, e.g. SEQ ID NO: 87, TCAAGTTGAGGCCAGAAGGA, or an siRNA targeting DNMT, optionally comprising SEQ ID NOs: 72-75. In some embodiments, an antisense oligonucleotide (ASO) comprises 12-50 nucleotides that binds to 12-50 consecutive nucleotides of a DNMT sequence. In some embodiments, an isolated antisense oligonucleotide (ASO) comprises at least one modification. In some embodiments, the at least one modification comprises one or more modified bonds or bases. In some embodiments, the modified bases comprise at least one ribonucleotide, at least one deoxyribonucleotide, or at least one bridged nucleotide, wherein the bridged nucleotide is a locked nucleic acid (LNA) nucleotide, a 2′-O-Ethyl (cEt) modified nucleotide, 2′-O-methoxy ethyl (MOE) nucleotide, or a 2′-O,4′-C-ethylene (ENA) modified nucleotide. In some embodiments, the modified bonds comprise phosphorothioate internucleotide linkages between at least two nucleotides, or between all nucleotides. In some embodiments, the ASO is a gapmer or mixer. In some embodiments, the ASO comprises unmodified deoxyribonucleosides in the center flanked by 5′ and 3′ terminal modified (e.g., bridged, locked) nucleosides. In some embodiments, comprises unmodified deoxyribonucleosides in the center flanked by 5′ and 3′ terminal modified (e.g., bridged, locked) nucleosides directs RNAse-H-mediated cleavage of a target DNMT transcript. In some embodiments, the locked nucleosides comprise a methylene bridge between the 2′-oxygen and the 4′-carbon. In some embodiments, there are 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 modified (e.g., bridged, locked) nucleosides at the 3′end. In some embodiments, there are 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 modified (e.g., bridged, locked) nucleosides at the 5′ end. In some embodiments, the modified nucleosides at the 3′ end and/or the 5′ end are 2′-O-methoxy ethyl (MOE) nucleotides. In some embodiments, the ASO comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 2′-MOE nucleosides at the 3′ end and/or 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 2′-MOE nucleosides at the 5′ end.
The FMR1-reactivated iPSC can be subject to differentiation to neuronal precursor cells prior to administration. A number of neuronal differentiation protocols are known in the art; see, e.g., Chambers et al., Nat Biotechnol 27(3): 275-80 (dual SMAD inhibition); WO 2020/237104 (dopaminergic neuronal precursors); Salimi et al., Mol Biol Rep. 2014 March; 41(3):1713-21; Gunhnlar et al., Molecular Psychiatry 23:1336-1344 (2018); Trilck et al., Methods Mol Biol. 2016; 1353:233-59; Zhang et al., Stem Cell Res Ther. 2018 Mar. 15; 9(1):67; D'Aiuto et al., Organogenesis. 2014; 10(4):365-77; Marton and Ioannidis, Stem Cells Translational Medicine 2019; 8:366-374; Bell et al. Bio-protocol 9(5): e3188 (2019). DOI: 10.21769/BioProtoc.3188; Bianchi et al., Stem Cell Research 32:126-134 (2018). In some embodiments, the cells are excitatory neuronal cells (e.g., FMRP function has been reported to be important for CA1 pyramidal neurons in hippocampus; see Sawicka et al., eLife 2019; 8:e46919 DOI: 10.7554/eLife.46919).
The invention is further described in the following examples, which do not limit the scope of the invention described in the claims.
The following materials and methods were used in the Examples below.
WCMC37 hES cells (Colak et al., 2014) and 848-iPS1 (Sheridan et al., 2011) were maintained in mTeSR media with Matrigel-treated plates. Cells were passaged either with Accutase or TrypLE Select (Gibco) by following the manufacturer's manual. Feeder cells from UV-irradiated drug resistant mouse embryonic fibroblasts were used for the RSeT (Stem Cell Technology) or 5i/L/A (Theunissen et al., 2014) media condition, and TrypLE Select or Accutase was treated in 5-10 minutes until the hPSC cells start to be detached by a gentle tapping without disturbing feeder cells. 5i/L/A medium was generated by following the protocol from Theunissen et al 2014 [10]. Briefly, 240 ml DMEM/F12 (Gibco 10565-042), 240 ml Neurobasal media (Gibco 21103049), 1 mM glutamine (Gibco), 1% nonessential amino acids (Gibco), penicillin-streptomycin (Gibco), 50 mg/ml BSA (cell culture grade) were combined and used as a basal media. The following components were freshly added to 48.5 ml of basal media: 0.5 ml N2 supplement (Gibco 17502048), 1 ml B27 supplement (Gibco 17504044), 20 ng/ml recombinant human LIF (Peprotech), 0.1 mM b-mercaptoethanol (Sigma), 10 ng/ml Activin A (Peprotech), and the following small molecules from Naive Stem Cell 5i inhibitor Set (Axon 5011): PD0325901 (1 mM), IM-12 (1 mM), SB590885 (0.5 mM), WH-4-023 (1 mM), and Y-27632 (10 mM). For the composition optimization, the same basal media was used with different small molecule combinations. 40 μm sieve was used to collect the detached cells to minimize feeder contamination after TrypLE Select or Accutase is neutralized by DMEM media containing 10% FBS and 25 mM HEPES pH 7.0.
Experimental conditions for small molecule treatments were optimized to minimize the toxicity while sustaining the effects of the small molecules. As the direct conversion from regular human ES/iPS media (mTeSR) to 5i/L/A media caused a massive cell death, we first adopted the hES/iPS cells in RSeT media with feeder condition and gradually introduced 5i media by using 50% mixture of RSeT and 5i/L/A media. While FMR1 gene expression was not significantly increased during the long-term cultivation in RSeT media, treating the FXS hES/iPS cells with 50% 5i media triggered a significant increase in FMR1 gene expression in 6 days (
Lentiviruses were produced by transfecting HEK293T cells with various dCas9-containing constructs or pgRNA constructs together with psPAX2 and pMD2.G-VSVG packaging vectors using Lipofectamine 3000 (Invitrogen). Fuw-dCas9-Tet1CD-P2A-BFP, Fuw-dCas9-dead Tet1CD-P2A-BFP, pgRNA-CGG and pgRNA-modified (for the backbone of the sgRNA construct) were gifts from Rudolf Jaenisch (Addgene plasmid #108245, #108246, #108248, #84477). pGH125 dCas9-Blast was a gift from Michael Bassik (Addgene plasmid #85417). Inducible dCas9 and dCas9-RNaseH1 plasmids were generated by modifying the pGH125 dCas9-Blast backbone (Addgene plasmid #85417). Briefly, EF1a promoter was swapped with TRE-tight Tet-responsive promoter of pTRE-Tight plasmid. The catalytic domain of human RNaseH1 (110-260 aa) was additionally subcloned into the 3′ end of dCas9 coding region as in-frame to create dCas9-RNaseH1 recombinant protein expressing cassette. Puromycin and Blasticidin are used for the selection markers of gRNA and dCas9-related constructs integration, respectively. Produced lentiviruses were further concentrated by Lenti-concentrator (Origene) and stored in Lenti-Stabilizer (Origene).
Repeat-PCR (RPT-PCR), an assay for detecting the very long CGG repeats at the FMR1 locus, was performed as described in Hayward et al (Hayward et al., 2016). Due to the extremely high GC content and repetitive nature of the long CGG repeats, regular PCR protocols cannot be used for analyzing the length of the CGG repeats on full mutation FMR1 locus. Briefly, 600 ng of genomic DNA was treated with HindIII in 50 mM Tris-Cl pH 8.8, 1.5 mM MgCl2, 22 mM (NH4)2SO4, 0.2% Triton X-100 overnight at 37° C. EcoNI was added to remove the RPT-PCR product from mouse feeder cells. HpaII, a methylation-sensitive enzyme, was additionally included in the half of the HindIII digestion mix for monitoring the methylation status of the target regions. RPT-PCR master mix containing 50 mM Tris-HCl (pH 8.8), 1.5 mM MgCl2, 22 mM (NH4)2SO4, 0.2% Triton X-100, 3.3 M betaine (Sigma, St. Louis, MO), 2.67% dimethyl sulfoxide, 0.27 mM dNTPs, 27 U/ml High-Fidelity Phusion DNA polymerase (New England Biolabs) and 0.67 μM of primers (Not-FraxC and Not-FraxR4 for FMR1) was prepared on ice. For the RPT-PCR reactions, 5 μl of the HindIII-digested genomic DNA was added to 15 μl of the PCR master mix on ice and mixed well before PCR reaction. The PCR was performed by following cycles: 98° C. for 3 minutes, 30×(98° C. for 30 seconds, 64° C. for 30 seconds, 72° C. for 210 seconds), and 72° C. for 10 minutes. Since the RPT-PCR product includes 269 base pair flanking regions, the number of CGG repeat length can be calculated by the following formula:
number of CGG repeat=(fragment size−269)/3.
RPT-PCR products were purified by using PCR purification kit (Qiagen) and the purified samples were further analyzed by High sensitivity DNA kit with Bioanalyzer 2100 (Agilent) to quantify the proportion of long and short CGG fragments. Estimated fragment size was calculated by the migration time to size conversion based on the ladder migration. Raw signal data was normalized by the average intensity between 300 bp to 3 kb. Box plots are drawn by R package to show the signal intensity distribution on the long (900-1100 bp: 210-277 CGG repeats) and short (400-600 bp: 44-110 CGG repeats) CGG repeat range.
R-loop formation (DNA-RNA hybrid) was monitored by DRIP. DRIP assay was performed by following the protocol from Loomis et al (Loomis et al., 2014) with slight modifications. Briefly, cell pellets were resuspended in 10 mM Tris-HCl, 10 mM EDTA, 100 mM NaCl pH 8, lysed with 0.5% SDS, and digested with 400 units of Proteinase K overnight at 37° C. Cell lysates were then extracted once with phenol pH 8 and twice with chloroform. DNA was precipitated with 1 volume of isopropanol and 300 mM sodium acetate, and the pellet was washed twice with 70% ethanol, and was resuspended in 10 mM Tris-HCl pH 8. Harvested nucleic acids (˜10 ug) were digested with EcoRI, HindIII, BsrGI, and XbaI (20 units each) overnight at 37° C. in NEBuffer 2. RNaseH1, which degrades RNA-DNA hybrid, was treated to test the specificity of the DRIP-qPCR signal and served as negative control. After that, samples were purified by phenol and chloroform extraction followed by precipitation in isopropanol. The pellet was washed twice with 70% ethanol. Air-dried pellets were resuspended in 10 mM Tris-HCl pH 7.5, 1 mM EDTA.
Digested nucleic acids (2-5 ug) were diluted in 450 μL of TE, and 10 μL was reserved as input for qPCR. 10×IP buffer was added for a final buffer concentration of 10 mM sodium phosphate, 140 mM sodium chloride, 0.05% Triton X-100, and 20 μL of S9.6 antibody was added and incubated at 4° C. for 2 hours. After the antibody incubation, Protein A/G magnetic beads were washed twice with 800 μL of 1×IP buffer for 5 minutes at room temperature and 40 μl of the beads were added to each sample and incubated for 2 hours at 4° C. Beads were washed three times with 700 μL 1×IP buffer for 10 minutes at room temperature. After the wash, the magnetic beads were resuspended in 250 μL of 1×IP buffer and incubated with 60 units of Proteinase K for 30 minutes at 50° C. Digested DRIP samples were purified by phenol/chloroform extraction and isopropanol precipitation. Pellets were resuspended in 80 μL of 10 mM Tris-HCl pH 8.0.
5 mC and 5 hmC levels on FMR1 locus were measured by qPCR assay with the pull down material of methylated DNA by antibody recognizing 5 mC (Active Motif monoclonal Ab clone 33D3) and 5 hmC (Active Motif polyclonal Ab #39769). Briefly, genomic DNA was purified from cultured cells by overnight Proteinase K treatment, followed by phenol-chloroform extraction and ethanol precipitation. DNA was fragmented using HindIII, EcoRI, BsrGI, and XbaI at 37 C overnight. We used 2-4 μg of fragmented DNA for a standard MeDIP assay. After denaturing by incubating at 95° C. for 10 min, the sample was immunoprecipitated for 2 h at 4° C. with 10 μl of monoclonal antibody against 5-methylcytidine ( ) in a final volume of 500 μl IP buffer (10 mM sodium phosphate (pH 7.0), 140 mM NaCl, 0.05% Triton X-100). We incubated the mixture with 30 μl of Dynabeads for 2 h at 4° C. and washed it three times with 700 μl of IP buffer. Beads were treated with proteinase K for 3 h at 56° C. and pull-downed methylated DNA was purified by phenol-chloroform extraction and ethanol precipitation. Pyrosequencing was performed by EpigenDx (ADS1451-FS2).
Harvested cells are fixed in 1% formaldehyde for 5 minutes at room temperature, and glycine was added to a final conc. of 0.125M and incubated for 5 minutes at room temperature to stop crosslinking. After washing twice with cold PBS, cross-linked cells were resuspended in Buffer 1 (50 mM HEPES-KOH PH 7.5, 150 mM NaCl, 1 mM EDTA pH 8.0, 0.5% NP40, 0.25% Triton X-100 with freshly added protease inhibitor cocktail (PIC)) and rotated at 4 C for 10 min. After spin-down at 1700 rcf for 5 min in 4 C, cells were resuspended in Buffer 2 (10 mM Tris-Cl pH 8.0, 200 mM NaCl, 5 mM EDTA pH 8.0, 2.5 mM EGTA pH 8.0 with freshly added PIC) and rotated on a wheel for 10 min at 4C. Finally, cells were incubated in Buffer 3 (10 mM Tris-Cl pH 8.0, 5 mM EDTA pH 8.0, 2.5 mM EGTA pH 8.0 with freshly added PIC) with RNase A and rotated on a wheel for 30 min at 37 C. After adding N-lauroyl sarcosine to final conc. 0.5%, samples were sonicated by using Covaris system with 15×19 mm tube, 5% duty cycle, intensity 140, and 200 burst per cycle for 10-15 min. Sonicated samples were centrifuged by 14000 rpm for 10 min in 4 C and supernatant was used for immunoprecipitation and input samples. For immunoprecipitation, equal volume of 2×IP buffer (2% Triton X-100, 300 mM NaCl, 30 mM Tris-HCl pH 8.0, 1×PIC) was added to the sonicated samples and 2-5 μg of antibody was added per IP and incubated o/n at 4 C on a rotating wheel. 40 μl of Protein G Dynabeads was washed twice with Buffer1 and added to each IP sample and incubated for 2 hrs at 4 C on a rotating wheel. Beads were washed 3 times with ½×RIPA-1 buffer (50 mM HEPES-KOH pH 7.5, 500 mM NaCl, 10 mM EDTA pH 8.0, 1% NP40, 0.5% Sodium Deoxycholate) and 3 times with RIPA-3 buffer (50 mM HEPES-KOH PH 7.5, 50 mM NaCl, 10 mM EDTA pH 8.0, 0.2% NP40) at 4 C for 5 min on a rotating wheel. Washed beads were resuspended to 200 μl TES buffer (50 mM Tris-Cl pH 8.0, 10 mM EDTA pH 8.0, and 1% SDS) and incubated at 65 C for 15 min. After spin down, 40 μg of Proteinase K was added to the supernatant and incubated in 65 C for 4 hrs to O/N for reversing the crosslinking. After phenol/chloroform extraction and ethanol precipitation with glycogen, resulted pellets were resuspended in dH2O and analyzed by qPCR assay with purified input samples.
RNAzol was treated to the collected cell pellets, and total RNA was extracted by following the manufacturer's manual. Reverse transcription reaction was performed by using QuantiTect (Qiagen). Reverse transcribed cDNA was used for quantitative PCR (qPCR) with 2×SyBr Green qPCR mix. GAPDH was used for normalization between samples. The list of primers and their sequences can be found in Supplemental Table S1.
Total whole cell extract was prepared by first lysing cells in Lysis buffer containing 50 mM Tris-Cl (pH 8.0), 150 mM NaCl, 1% Triton X-100, 0.5% sodium deoxycholate, and 0.1% SDS. Samples were quantified by Bradford assay for even loading. Serial dilutions of cell lysates were loaded on a NuPAGE 4-12% or BioRad 4-20% gradient SDS polyacrylamide gel, separated by electrophoresis, transferred to a PVDF membrane. After 1 hr blocking with 5% skim milk in PBST (1×PBS, and 0.1% Tween-20), the membrane was incubated with primary antibodies for overnight at 4° C. and then secondary antibodies (1:20,000) at room temperature for 30 min with 1% skim milk in PBST followed by two washing steps. Primary antibodies were used with the following dilutions-1:2000 for anti-FMRP 1c3 (Millipore-Sigma MAB2160), 1:5000 for anti-tubulin (Sigma-Aldrich T5201) and anti-GAPDH.
To degrade the nascent FMR1 transcript by RNase H1 activity, FMR1 ASO gapmer that has 10 bp 2′deoxy part (DNA) in the middle of 5 nt 2-methoxyethyl (2′ MOE) each side was used. FMR1-all-2MOE was used as a negative control which has the same sequence but the whole 20 nt sequence is 2′ MOE—no 2′deoxy part in the middle that triggers RNase H activity for gapmers. Control ASO is a scrambled gapmer ASO. For DNMT1, MSH2, and CSB (also known as ERCC6) knock-down, ON-TARGETplus human siRNA SmartPool (Dharmacon) sets were used. Lipofectamine 3000 was used for introducing ASOs (20 nM final conc.) and siRNAs (45-90 nM final conc.) into the cells the day after splitting every 3 days.
The whole transcriptome analysis was performed by making RNA-seq libraries from Poly(A) selected RNA samples using NEBNext Poly(A) mRNA Magnetic Isolation Module (#E7490) and NEBNext Ultra™ II Directional RNA Library Prep Kit for Illumina (#E7760S) by following the protocols from the manufacturer. DEseq2 (Love et al., 2014), featureCounts (Liao et al., 2014), and enhanced Volcano were used for analyzing the differentially expressed genes.
We conducted t-test for most of the statistical analysis if not specified. Statistical significance is indicated by the following notations: ns for P>0.05, * for P≤0.05, ** for P≤0.01, *** for P≤0.001, and **** for P≤0.0001.
To study FXS repeat contraction, we used two established models derived from FXS patients: (i) a human induced pluripotent stem cell (hiPSC) line from a FXS full mutation male (848-iPS1) (Sheridan et al., 2011), and (ii) a human embryonic stem cell (hESC) line outgrown from an IVF-cultured blastocyst with a FXS full mutation (WCMC37)(Colak et al., 2014). Using established repeat-PCR (RPT-PCR) assays for long CGG repeats (Hayward et al., 2016), we confirmed the lengths of CGG repeats in various FXS and WT hiPSCs (
To investigate in our system, we cultured FXS hESC and hiPSC in RSeT media, a modified commercial version of NHSM. We did not observe any significant FMR1 reactivation after growing the cells in RSeT (
The 5i media includes a combination of five compounds, including inhibitors of MEK, GSK3β, BRAF, ROCK, and SRC, and supports the expansion of viable OCT4−DPE−GFP+ human pluripotent cells after exogenous transcription factor expression has been removed (Theunissen, T. W., Powell, B. E., Wang, H., Mitalipova, M., Faddah, D. A., Reddy, J., Fan, Z. P., Maetzel, D., Ganz, K., Shi, L., et al. (2014). Systematic Identification of Culture Conditions for Induction and Maintenance of Naive Human Pluripotency. Cell Stem Cell 15, 524-526.).
Individuals with “pre-mutation” (PM) alleles have 50-200 CGG repeats but have either normal or considerably elevated mRNA levels (Tassone et al., 2007; Sheridan et al., 2011; Ludwig et al., 2014). Despite this, PM alleles do not have elevated FMRP protein (Primerano et al., 2002; Sheridan et al., 2011; Ludwig et al., 2014). To determine whether the protein was also restored in the 5i-treated cells, we performed Western blot analysis. The results showed FMRP production was restored to normal levels (
In wildtype cells, FMR1 expression is associated with low CGG repeat numbers and CpG hypomethylation. We asked if the CGG repeat numbers have changed in the reactivated FXS cells exposed to 5i. We derived single-cell clones from the FXS hESC and hiPSC lines to ensure that experiments were performed on cells initially carrying a homogeneous full mutation allele and silent FMR1 (
RPT-PCR analysis also revealed that reactivation was accompanied by DNA demethylation. We found that pre-treating genomic DNA with HpaII showed a progressive sensitivity to HpaII during FMR1 reactivation after day 9 when FMR1 was strongly activated (
To rule out clonal artifacts, we repeated the experiments using additional hiPSC clones as well as new hESC clones (
When FM cells were induced by 5i to contract to 50-200 repeat lengths, the sub-clones showed high-level mRNA expression consistent with levels observed in PM cell lines (
Given these results, we were curious about whether PM cells would also be responsive to 5i treatment, or whether the treatment is only effective in FM cells. We derived clones from a PM iPSC line, 131, and examined clone 131-1a which carried ˜150 CGG repeats. No obvious repeat contraction was observed after 27 days of 5i treatment (
As discussed above and depicted in
We tested which of the 5 inhibitors is responsible for reactivating FMR1. We treated 848-1c hiPSCs with a single inhibitor or various combinations of the 5 small molecules without changing other components of the base media. Critically, no single inhibitor alone was sufficient to trigger reactivation (
The loss of DNA methylation concurrent with CGG contraction raised the possibility that DNA demethylation may be involved mechanistically. We confirmed DNA demethylation using several orthogonal methods. MeDIP is an immunoprecipitation method that captures methylated DNA using 5-methyl-C (5 mC) antibodies. MeDIP showed a strong loss of DNA methylation in the FMR1 promoter following 5i treatment for 9 days, as compared to cells grown in RSeT (
We then tested if depleting DNMT1, the enzyme responsible for maintenance of CpG methylation, might trigger contraction and reactivation. Because treating with the DNA methylation inhibitor, decitabine, is toxic to hiPSCs, we used an RNAi to knock down DNMT1, treating 848-1c hiPSCs with either a DNMT1-specific siRNA or a control scramble siRNA (siCtrl) for 6 days in RSeT media. The DNMT1-specific siRNA from Dharmacon (catalog no.: L-004605-00-0005) which comprised the following four siRNAs:
The control non-targeting siRNA (also from Dharmacon catalog no.: D-001810-10-05) comprised the four following siRNAs:
Despite a partial knockdown of DNMT1, we observed no FMR1 reactivation (
To investigate additional molecular requirements for CGG contraction, we considered a published observation in which targeting TET1 demethylase to FMR1 yielded FMR1 reactivation (Liu et al., 2018). We designed experiments to target a TET1-tethered catalytically dead Cas9 (dCas9-Tet1) to FMR1 using CGG-specific gRNAs. In 848-1c cells grown in mTeSR, we observed a strong FMR1 reactivation in response to demethylation (
Although dCas9-Tet1-DEAD does not have a demethylase activity, the complex is targeted to FMR1 via the CGG gRNA (SEQ ID NO:1). We designed experiments to test the possibility that dCas9 would form a three-stranded nucleic acid structure known as an “R-loop” at the target site. R-loops comprise an annealed DNA:RNA hybrid and an associated unannealed single-stranded DNA. Previous studies using structural and single DNA molecule twitching analyses showed that CRISPR-Cas9 induces R-loop formation when bound to its target DNA (Szczelkun et al., 2014; Jiang et al., 2016; Jiang and Doudna, 2017). Catalytically dead Cas9 is also capable of forming R-loops (Szczelkun et al., 2014). When not properly cleared or shielded, R-loops can cause DNA breaks and genomic instability, resulting in the recruitment of the DNA repair machinery (Hegazy et al., 2020; Liu et al., 2020; Niehrs and Luke, 2020; Rinaldi et al., 2020). Notably, previous studies also suggested R-loops can form in the FMR1 locus of normal, PM, and FM FXS cells (Colak et al., 2014; Loomis et al., 2014).
Therefore, we examined if R-loops were induced by conditions leading to CGG contraction. To monitor R-loop formation, we performed DRIP (DNA-RNA hybrid immunoprecipitation) using the established S9.6 antibody that specifically recognizes RNA-DNA hybrids (Phillips et al., 2013). We found a significant enrichment of RNA-DNA hybrids was evident at FMR1 in 848-1c cells grown in 5i media for 6 days (
The sequences FMR1 gapmer ASO and the scrambled gapmer ASO used are as follows:
The * indicates a phosphorothioate bond, /52MOE indicates 5′end 2′MOE modified nucleotide, /32MOE indicates 3′end 2′MOE, and /12MOE indicates internal 2′MOE.
To further test the role of R-loops more directly, we introduced dCas9 without tethering Tet1 or Tet1-DEAD into 848-1c cells together with a CGG gRNA (gCGG). We transferred cells from mTeSR media to 5i media to determine whether dCas9+gCGG could accelerate the contraction associated with 5i treatment (
Significantly, treating for 6 days with dCas9+gCGG resulted in strong FMR1 gene reactivation to ˜50% of WT levels (
Because dCas9 by itself forms site-specific R-loops when targeted by specific gRNAs, we tested whether 5i was necessary at all. We repeated the experiment in mTeSR media without 5i (
Because CGG repeats appear in many other regions in the human genome, we designed FMR1-specific gRNAs to target dCas9 specifically to FMR1 by including unique sequences flanking the repeat (
The sequences used in these experiments are as follows:
Given that gNHG3 is FMR1-specific, we examined on- versus off-target gene expression changes in this cell line after exposure to dCas9+gNHG3 for 36 days. Intriguingly, relative to a gScr control, differential gene expression analysis of two biological replicates showed only one dominant change—FMR1 (
When not properly regulated, R-loops can cause DNA damage and trigger the DNA repair machinery (Rinaldi et al., 2020) and induce repeat instability (Lin et al., 2010; Freudenreich, 2018) (
We designed experiments to test if the observed CGG contraction induced by 5i invokes either DNA damage response. ChIP analysis showed that γ-H2AX, a histone mark for DNA damage response, was significantly elevated in 5i-treated cells at FMR1 locus (
In this application, amongst other things, we have identified methods of FMR1 gene editing without use of exogenous nucleases such as TALENS, zing-finger nucleases, and CRISPR-Cas9. We initially observed that MEK and BRAF inhibitors together elicit CGG repeat contraction and full gene reactivation in <12 days. While MEK and BRAF kinases belong to the same MAPK pathway, inhibiting either kinase alone could not elicit the response, which suggested that non-overlapping downstream targets of MEKi and BRAFi are likely to mediate the effect. We found FMR1 promoter de-methylation occurs contemporaneously with repeat contraction and gene reactivation. Perturbation analysis showed that DNA demethylation plays an important role in unlocking FMR1 silencing but is not sufficient in itself to produce the full effect. We then traced the mechanism to formation of site-specific R-loops in the FMR1 CGG repeat and attraction of the MSH2-dependent mismatch repair pathway. Interestingly, R-loops created by targeting dCas9 to FMR1 were sufficient to induce re-expression of FMRP, and disrupting R-loops by degrading target strand RNA abolished CGG contraction and gene reactivation. Thus, without being bound by theory, we conclude that R-loops are both necessary and sufficient to achieve reactivation. Reactivation results not only in the induction of FMR1 mRNA but also production of FMRP to normal or near-normal levels.
Without being bound by theory, we propose that a positive feedback cycle of DNA demethylation, de novo FMR1 transcription, R-loop formation, and DNA mismatch repair leads to progressive trinucleotide repeat contraction and restorative FMR1 expression (
To the limits of our detection, the method is surprisingly site-specific (
Treatment using 50:50 5i and RSET, or 50:50 3i and RSET, and even RG108 alone, gave good reactivation of the two genes flanking the DM1 CTG repeat (DMPK and SIX5;
There was an observable reactivation in DM1 cells as both DMPK mRNA and SIX5 mRNA increased, particularly following 12 days of treatment (
Experiments are conducted in PD cells to test the effect of the dCas9+gRNA on retracting nucleotide repeats. The PD cells are treated with dCas9+gRNA for 6, 12, and/or 18 days, after which the cells are assayed via RPT-PCR. The Purified RPT-PCR products are further analyzed by Bioanalyzer to monitor the changes in the length of GGC repeat fragments. The data is also analyzed to determine whether the dCas9+gRNA reactivate the NOTCH2NLC gene.
Experiments are conducted in PD cells to test the effect of the small molecule cocktails on retracting trinucleotide repeats. The PD cells are treated with combinations of small molecules for 6, 12, and/or 18 days, after which the cells are assayed via RPT-PCR. The Purified RPT-PCR products are further analyzed by Bioanalyzer to monitor the changes in the length of GGC repeat fragments. The data is analyzed to determine whether the (P+S) and (P+S+R) combinations reactivate the NOTCH2NLC gene.
It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.
This application claims the benefit of U.S. Provisional Patent Application Ser. No. 63/161,841, filed on Mar. 16, 2021, and 63/161,821, filed on Mar. 16, 2021. The entire contents of the foregoing are hereby incorporated by reference.
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/US2022/020631 | 3/16/2022 | WO |
| Number | Date | Country | |
|---|---|---|---|
| 63161841 | Mar 2021 | US | |
| 63161821 | Mar 2021 | US |
