Patent Application
20240252549
The present invention provides compositions and methods for enhancing transfection efficiency. In particular, the present invention provides compositions and methods that increase transfection efficiency of skin cells, including keratinocytes, which facilitates use of gene expression modifying technologies such as CRISPR-Cas technologies.
There are hundreds of genetically based skin disorders, including at least dozens that are single gene mutation based. Many are debilitating and significantly hinder quality of life. A direct approach to study and treat these conditions would be to use available tools to modify genetic expression of these mutations. Skin cells, however, have proved highly resistant to transfection. Keratinocytes (KCs), which make up 90% of skin cells, in particular, have shown extreme resistance to transfection in comparison to other cell types. The low level of transfection has limited the gene therapy applications for skin conditions, diseases, and disorders. There are many possible applications of gene therapy, or other treatments, that could moderate cell protein expression that could counter subsets of genetic mutation-based diseases and disorders, if efficient transfection of skin cells were available. Researchers have shown that KCs are candidates for genetic based treatments through transfection and use of gene therapy tools, including CRISPR-Cas technologies. A key challenge to further exploration and development of these gene therapy and related approaches has been the difficulty in transfecting skin cells, especially KCs. KCs have long been recognized as one of the most difficult cell types to transfect (12, 13), but the mechanisms behind this resistance have remained unknown. KCs are the major cellular constituent of the epidermis that has a critical role and acts as the primary interface between our body and external agents, such as bacteria and viruses.
The present invention provides compositions and methods for enhancing transfection efficiency. In particular, the present invention provides compositions and methods that increase transfection efficiency of skin cells, including keratinocytes, which facilitates use of gene expression modifying technologies such as CRISPR-Cas technologies.
In some embodiments, provided herein are methods comprising: contacting skin cells with one or more agents that regulate interferon kappa (IFNκ) expression in the skin cells to enhance transfection of the skin cells with one or more nucleic acid molecules. In some embodiments, the one or more agents comprise a JAK inhibitor (e.g., a JAK1 and/or JAK2 inhibitor). In some embodiments, following or concurrently with the agent contact, the cells are contacted with the one or more nucleic acid molecules to transfect the cells. In some embodiments, the nucleic acid molecules are complexed with one or more transfection reagents. Transfection reagents and systems include, but are not limited to, calcium phosphate, electroporation systems, lipofection system, microinjection systems, gene guns, impalefection systems, hydrostatic pressure systems, and the like. Transfection may be stable or transient. Transfected nucleic acid may be DNA or RNA or combinations thereof.
In some embodiments the one or more nucleic acid molecules to be transfected into the skin cells comprise one or more components of a CRISPR-Cas system. For example, in some embodiments, one or more vectors is transfected that encodes one or more components of a CRISPR-Cas system (e.g., a guide sequence, one or more protein components of the CRISPR-Cas system, a cargo sequence to be integrated into a genome or other nucleic acid present in the skin cell, etc.). In some embodiments, one or more components of a CRISPR-Cas system is provided as a protein or protein complex.
In some embodiments, the one or more nucleic acid molecules comprise components useful for, necessary for, of sufficient for gene therapy or genetic manipulation of a skin cell. For example, one or more transgenes may be provided to the skin cell in a manner that permits expression of the transgene in the skin cell. The transgene may be integrated into the skin cell genome or may be expressed episomally.
The invention is not limited by the nature of the mechanism of transgene delivery or nucleic acid editing. Such mechanisms include, but are not limited to, naked nucleic acid, CRISPR-Cas, Cre-lox, viral system delivery (e.g., retrovirus, adenovirus, herpes simplex, vaccinia, adeno-associated virus), electroporation, gene gun system, sonoporation, magnetofection, use of lipoplexes, use of dendrimers, use of inorganic nanoparticles, and the like.
In some embodiments, the nucleic acid delivered is a transgene, a mRNA, an siRNA, an antisense oligonucleotide, a guide RNA, or the like. A transgene may encode a regulatory molecule (e.g., regulatory protein), a therapeutic molecule, a diagnostic biomarker, or the like. An inserted genetic sequence may provide a regulatory sequence rather than encoding a molecule. For example, the inserted genetic sequence may provide a regulatory sequence (e.g., a promoter, enhancer, etc.) or provide a detectable biomarker (e.g., a unique barcode), a landing pad for facilitating further genetic manipulation, a cleavage site, information content (e.g., for genetic storage of data), or the like.
In some embodiments, a transgene is added to the cells where the transgene is involved in regulating a skin cell disease or condition. Skin diseases and conditions include, but are not limited to, acne, cold sores, blisters, hives, actinic keratosis, rosacea, carbuncles, allergies, eczema, psoriasis, cellulitis, measles, cancers (e.g., basal cell carcinoma, squamous cell carcinoma, melanoma), lupus, contact dermatitis, vitiligo, warts, chickenpox, seborrheic eczema, keratosis pilaris, ringworm, melasma, impetigo, wounds, infections (e.g., bacterial, viral, fungal), moles, candidiasis, athlete's foot, dermatomyositis, shingles, age spots, and the like. In some embodiments, symptoms include any one or more of raised bumps, rash, itchiness, scaliness, peeling, ulcers, open sores or lesions, dryness, cracking, discoloration, and loss of pigment, flushing. The technology finds use in research, therapeutic, and diagnostic methodologies.
In some embodiments, the transfection is used to correct or counteract a genetic anomaly responsible for a disease or condition. A wide variety of genetic profiles have been associated with skin disease (see e.g., DeStefano and Christiano, Cold Spring Harb. Perspect. Med. 4(10), 2014, “The Genetics of Human Skin Disease”; Sybert, “Genetic Skin Disorders”, 3 ed., Oxford University Press, 2017; Shinkuma, “Advances in Gene Therapy and their Application to Skin Diseases: A review”, J. Dermatol. Sci., S0923-1811, May 21, 2021); herein incorporated by reference in their entireties).
In some embodiments, the transfection is used for research purposes.
The invention is not limited by the nature of or the location of the skin cells. In some embodiments, the cells are keratinocytes. In some embodiments, the skin cells are melanocytes, Langerhans cells, or Merkel cells. In some embodiments, the cells are in vitro (e.g., in culture). In some embodiments, the cells are ex vivo. In some embodiments, the cells are in vivo. The cells may comprise a mixture of different types of skin cells and may comprises other cell types present in tissues containing skin cells (e.g., mast cells, vascular smooth muscle cells, fibroblasts, immune cells, neutrophils, T and B Lymphocytes, eosinophils, monocytes, and the like). The skin cells may be present in natural or synthetic skin tissues. The skin cells may be differentiated, cultured, harvested, printed, or otherwise collected or generated in any desired manner. The skin cells may be of human origin, or may be from other organism including, but not limited to, companion animals (e.g., dogs, cats, etc.), livestock (e.g., cattle, pigs, chickens, etc.), wildlife animals (e.g., lions, tigers, bears, dolphins, whales, wolves, etc.), mammals, birds, fish, horses, and the like.
Also provided herein are compositions of matter that are useful for, sufficient for, or necessary for the practice of the methods described herein. Compositions include, but are not limited to, kits (collections of materials packaged together in one or more containers and designed for use together), reactions mixtures (collections of materials combined together to perform one or more reactions), reagents, and systems (two or more components designed to work together, including, but not limited to reagents, cells, instruments, software, and the like). Compositions may include control reagents (e.g., positive and/or negative control reagents), which can include control cells, control transfection reagents, control nucleic acid molecules, and the like.
In some embodiments, the compositions comprise: one or more agents (e.g., JAK1 and/or JAK2 inhibitors), one or more transfection reagents, and one or more nucleic acid molecules to be transfected. In some embodiments, the one or more nucleic acid molecules comprises a vector. In some embodiments, the vector expresses one or more components of a CRISPR-Cas system. In some embodiments, the one or more nucleic acid molecules comprises a guide sequence. In some embodiments, the vector expresses one or more transgenes. In some embodiments, the composition further comprises one or more skin cells (e.g., keratinocytes).
JAK (Janus kinase) inhibitors include JAK1 and JAK2 inhibitors as well as inhibitors of other members of the Janus kinase family of enzymes (e.g., JAK3, TYK2). Such inhibitor include, but are not limited to, Ruxolitinib (trade names Jakafi/Jakavi) (JAK1/JAK2), Tofacitinib (trade names Xeljanz/Jakvinus, formerly known as tasocitinib and CP-690550) (JAK3), Oclacitinib (trade name Apoquel) (JAK1), Baricitinib (trade name Olumiant) (JAK1/JAK2), Peficitinib (ASP015K, JNJ-54781532; trade name Smyraf) (JAK3), Fedratinib (SAR302503; trade name Inrebic) (JAK2), Upadacitinib (trade name Rinvoq; ABT-494) (JAK1), Filgotinib (G-146034, GLPG-0634) (JAK1), Cerdulatinib (PRT062070) (dual SYK/JAK), Gandotinib (LY-2784544) (JAK2), Lestaurtinib (CEP-701) (JAK2), Momelotinib (GS-0387, CYT-387) (JAK1/JAK2), Pacritinib (SB1518) (JAK2), Abrocitinib (PF-04965842) (JAK1), Deucravacitinib (BMS-986165) (TYK2), Ruxolitinib cream (INCB018424) (JAK1/2), Cucurbitacin I (JSI-124), CHZ868 (JAK2), Tofacitinib, and Topical tofacitinib and ruxolitinib, as well as compounds described in U.S. Pat. Nos. 8,609,687, 8,637,526, 8,987,443, 9,422,300, 9,890,165, 10,023,577, 10,100,049, 10,435,428, 10,493,077, 10,617,690, 10,758,543, 10,786,507, and 10,968,222 and US Pat. Apln. Ser. Nos. 20210155621, 20210030672, and 20200190080, each of which is herein incorporated by reference in its entirety.
In some embodiments, provided here are uses of any of the above compositions are compositions described elsewhere herein. For example, in some embodiments, provided herein are uses of such compositions for transfecting a skin cell. In some embodiments, provided herein are uses of such compositions to study, prevent, or treat a disease or condition.
Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of embodiments described herein, some preferred methods, compositions, devices, and materials are described herein. However, before the present materials and methods are described, it is to be understood that this invention is not limited to the particular molecules, compositions, methodologies or protocols herein described, as these may vary in accordance with routine experimentation and optimization. It is also to be understood that the terminology used in the description is for the purpose of describing the particular versions or embodiments only, and is not intended to limit the scope of the embodiments described herein.
Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. However, in case of conflict, the present specification, including definitions, will control. Accordingly, in the context of the embodiments described herein, the following definitions apply.
The terms “overexpress” and “overexpression,” as used herein, refer to the expression of a gene beyond normal (or wild-type) levels, or to expression of a gene in a cell type or developmental stage or condition in which it normally is not expressed. Overexpression is also referred to in the art as “misexpression” and “ectopic expression.” A gene is overexpressed if the expression is increased by at least about 20% (e.g., 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, 100%, 200%, 300%, 500%, or more) as compared to a reference level, control, or wild-type expression level. Levels of expression can be determined according to any of many acceptable protocols known in the art that measure the abundance of encoding RNA (e.g., mRNA), such as quantitative or semi-quantitative polymerase chain reaction (PCR) or northern blot. In other embodiments applicable to protein-coding genes, the expression can be quantified in terms of amount of target protein detected, such as by western blot.
As used herein, the term “antibody” refers to a whole antibody molecule or a fragment thereof (e.g., fragments such as scFv, Fab, Fab′, and F(ab′)2), unless specified otherwise; an antibody may be a polyclonal or monoclonal antibody, a chimeric antibody, a humanized antibody, a human antibody, etc. In a native antibody, a heavy chain comprises a variable region, VH, and three constant regions, CH1, CH2, and CH3. The VH domain is at the amino-terminus of the heavy chain, and the CH3 domain is at the carboxy-terminus. In a native antibody, a light chain comprises a variable region, VL, and a constant region, CL. The variable region of the light chain is at the amino-terminus of the light chain. In a native antibody, the variable regions of each light/heavy chain pair typically form the antigen binding site. The constant regions are typically responsible for effector function.
As used herein, the terms “administration” and “administering” refer to the act of giving a drug, prodrug, therapeutic, or other agent to a subject or in vivo, in vitro, or ex vivo cells, tissues, and organs. Exemplary routes of administration to the human body can be through space under the arachnoid membrane of the brain or spinal cord (intrathecal), the eyes (ophthalmic), mouth (oral), skin (topical or transdermal), nose (nasal), lungs (inhalant), oral mucosa (buccal), ear, rectal, vaginal, by injection (e.g., intravenously, subcutaneously, intratumorally, intraperitoneally, etc.) and the like.
As used herein, the terms “co-administration” and “co-administering” refer to the administration of at least two agent(s) or therapies to a subject. In some embodiments, the co-administration of two or more agents or therapies is concurrent. In other embodiments, a first agent/therapy is administered prior to a second agent/therapy. Those of skill in the art understand that the formulations and/or routes of administration of the various agents or therapies used may vary. The appropriate dosage for co-administration can be readily determined by one skilled in the art. In some embodiments, when agents or therapies are co-administered, the respective agents or therapies are administered at lower dosages than appropriate for their administration alone. Thus, co-administration is especially desirable in embodiments where the co-administration of the agents or therapies lowers the requisite dosage of a potentially harmful (e.g., toxic) agent(s), and/or when co-administration of two or more agents results in sensitization of a subject to beneficial effects of one of the agents via co-administration of the other agent.
As used herein the term “transfection efficiency” refers to, for example, the percentage of target cells, within a population of target cells, that contain an introduced exogenous nucleic acid molecule. Transfection efficiency can be determined by transfecting a nucleic acid molecule encoding a reporter gene into a population of target cells and determining the percentage of cells having reporter activity. The term “transfection efficiency” also refers to the amount of gene product detected following transfection of the nucleic acid into the cell. This is determined, for example, by testing an entire cell population for the amount of gene product produced after a given incubation period. Thus, the term “transfection efficiency” involves assaying for the relative expression of the gene product encoded by the introduced nucleic acid.
The term “test compound” refers to any chemical entity, pharmaceutical, drug, and the like that can be used to treat or prevent a disease, illness, sickness, or disorder of bodily function. Test compounds comprise both known and potential therapeutic compounds. A test compound can be determined to be therapeutic by screening using the screening methods of the present invention (e.g., testing such a compound on a cell modified by a composition or method described herein). A “known therapeutic compound” refers to a therapeutic compound that has been shown (e.g., through animal trials or prior experience with administration to humans) to be effective in such treatment or prevention.
The term “effective amount” as used herein means that amount of active compound or pharmaceutical agent that elicits the biological or medicinal response in a cell, tissue, organ, system, animal, or human that is being sought by a researcher, veterinarian, medical doctor, or other clinician. In some embodiments, the effective amount is a “therapeutically effective amount” for the alleviation of the symptoms of the disease or condition being treated. In some embodiments, the effective amount is a “prophylactically effective amount” for prophylaxis of the symptoms of the disease or condition being prevented. The term also includes herein the amount of an agent sufficient to directly or indirectly inhibit a JAK kinase or IFNκ and thereby elicit a response being sought (e.g., an “inhibition effective amount”). In some embodiments, this amount is between 0.1 mg and 1000 mg per day, e.g., between 1 mg and 500 mg per day (between 1 mg and 200 mg per day), although the amounts may vary depending on the location and form of the cell being treated (e.g., in vitro, in vivo). Nucleic acid doses, provided by vector, for gene therapy, may be referred to by numbers of vector genomes per kilogram bodyweight (vg/kg) and may vary, for example, from 1×1012 to 1×1015.
The disclosure is predicated, at least in part, on the discovery that regulation of IFNκ (e.g., inhibition by contacting cells with a JAK1 and/or JAK2 inhibitor) makes skin cells (e.g., keratinocytes) more amenable to transfection and increases efficiency of transfection. Thus, provided herein are compositions and methods that facilitate transfection of skin cells that have historically been notoriously challenging to transfect.
To determine transfection resistance of keratinocytes (KCs), transfection efficiency was compared in human embryonic kidney-239T (HEK293T) cells, fibroblasts, and KCs. Transfection efficiency using liposome-based system, was greater than 60% in HEK-293T cells, compared to 7% in fibroblasts, and only 1% in keratinocytes (KCs) (
To determine if uptake of the CRISPR-Cas9 plasmid is defective in keratinocyte the uptake and stability of CRISPR-Cas9 GFP-tagged plasmids in KCs was measured at different timepoints after transfection. While CRISPR-Cas9 GFP+ was observed in approximately 6-8% of KCs at early timepoints this rapidly decreased over a period of 48 hours down to 1-2% (
Surprisingly, it was observed that CRISPR/Cas9 generated KOs in KCs have suppressed IFNK and ISG mRNA expression, and this was consistent across all KC KOs generated, irrespective of the gene target (
Keratinocyte expression of IFNκ is induced by CRISPR-Cas9 transfection, and IFNκ directly affects expression of APOBEC3 cytidine deaminases that in turn promote degradation of intracellular CRISPR-Cas9 plasmids. To determine if inhibiting type I IFN signaling affects CRISPR-Cas9 transfection efficacy IFNK and TYK2 KO KCs were used. Thus, a marked increase in transfection efficiency (indicated by increased GFP positivity) in both IFNK and TYK2 KO KCs was observed. Furthermore, the control KO KCs had increased transfection efficacy compared to WT KCs (
KCs constitute ˜90% of the cells in the epidermis (26). Given the constant onslaught of external agents and microbiota such as bacteria and viruses, KCs are highly active as a sentinel cells harboring a range of antimicrobial detectors and pattern recognition receptor for a wide range of viruses and bacteria (27). IFNκ is the predominant type I IFN expressed by KCs and is most prominently expressed in the basal layer of the epidermis (28). The role of this axis in anti-viral defenses can be best described in the context of human HPV infections, which are caused by a DNA virus. HPV infections classically involve the mid to upper layers of the epidermis (29), where HPV viral genome amplification occurs (30). Interestingly, HPV viruses antagonize the cGAS-STING-DNA-sensing pathway to facilitate infection (31). Here it is demonstrated that CRISPR, which is constituted out of a DNA segment containing short repetitions of bases sequences, activates the same type of anti-viral response through STING and identify cytidine deaminase APOBEC3G as a key regulator in controlling CRISPR transfection in KCs (
A surprising observation was that CRISPR KC KOs had permanent suppression of IFNκ mRNA expression and ISG response through IFNK promoter hypermethylation. Under normal physiologic conditions in the epidermis IFNκ expression shows a sharp cutoff in expression once KCs leave the basal layer of the epidermis (28), suggesting that IFNκ is actively turned off during the differentiation process. This coincides with increased expression of the DNA methyltransferase DNMT3B (
Few studies have looked at immunological processes that may interfere with CRISPR transfection. One obstacle has been the potential immunogenicity of the Cas proteins, particularly regarding pre-existing adaptive immunity to Streptococcus pyogenesis and Staphylococcus aureus (38-40). In terms of cellular mechanisms, CRISPR gene editing is more efficient in cells that have lost the function of the tumor suppressor p53 in retinal epithelial cells (41) and in human pluripotent stem cells (42). The use of CRISPR or other gene therapy approaches to correct various inherited disorders of the skin hold great promise. Provided herein are systems and methods that facilitate such approaches.
In some embodiments, cells, whether in vitro (e.g., in culture), ex vivo, or in vivo are contacted with an agent (e.g., a JAK1 and/or JAK2 inhibitor) to increase efficiency of transfection and then are either simultaneously or subsequently transfected with a desired nucleic acid molecule (e.g., a CRISPR-Cas system nucleic acid molecule). Any agent that is capable of inhibition may be used. Inhibitors may be small molecules, antibodies, proteins, peptides, nucleic acid molecules, or the like. In some embodiments, two or more different inhibitors are contacted to the cells. Inhibitors may be formulated as desired for the nature of the cell being treated. For example, inhibitors may be in solution for use in cell culture and formulated for appropriate for the desired administration route for in vivo uses (e.g., for topical administration, for systemic administration).
In some embodiments, a compound, a derivative thereof, or a pharmaceutically acceptable salt thereof, is administered in a pharmaceutically effective amount. In some embodiments, a compound, a derivative thereof, or a pharmaceutically acceptable salt thereof, is administered in a therapeutically effective dose. The dosage amount and frequency are selected to create an effective level of the compound without substantially harmful effects. When administered topically, orally, or intravenously, the dosage of the compound or related compounds will generally range from 0.001 to 10,000 mg/kg/day or dose (e.g., 0.01 to 1000 mg/kg/day or dose; 0.1 to 100 mg/kg/day or dose).
Methods of administering a pharmaceutically effective amount include, without limitation, administration in parenteral, oral, intraperitoneal, intranasal, topical, sublingual, rectal, and vaginal forms. Parenteral routes of administration include, for example, subcutaneous, intravenous, intramuscular, intrasternal injection, and infusion routes. In some embodiments, the compound, a derivative thereof, or a pharmaceutically acceptable salt thereof, is administered orally.
In some embodiments, a single dose of a compound or a related compound is administered to a cell, tissue, or subject. In other embodiments, multiple doses are administered over two or more time points, separated by hours, days, weeks, etc. In some embodiments, compounds are administered over a long period of time (e.g., chronically), for example, for a period of months or years (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or more months or years). In such embodiments, compounds may be taken on a regular scheduled basis (e.g., daily, weekly, etc.) for the duration of the extended period.
JAK (Janus kinase) inhibitors include JAK1 and JAK2 inhibitors as well as inhibitors of other members of the Janus kinase family of enzymes (e.g., JAK3, TYK2). Such inhibitor include, but are not limited to, Ruxolitinib (trade names Jakafi/Jakavi) (JAK1/JAK2), Tofacitinib (trade names Xeljanz/Jakvinus, formerly known as tasocitinib and CP-690550) (JAK3), Oclacitinib (trade name Apoquel) (JAK1), Baricitinib (trade name Olumiant) (JAK1/JAK2), Peficitinib (ASP015K, JNJ-54781532; trade name Smyraf) (JAK3), Fedratinib (SAR302503; trade name Inrebic) (JAK2), Upadacitinib (trade name Rinvoq; ABT-494) (JAK1), Filgotinib (G-146034, GLPG-0634) (JAK1), Cerdulatinib (PRT062070) (dual SYK/JAK), Gandotinib (LY-2784544) (JAK2), Lestaurtinib (CEP-701) (JAK2), Momelotinib (GS-0387, CYT-387) (JAK1/JAK2), Pacritinib (SB1518) (JAK2), Abrocitinib (PF-04965842) (JAK1), Deucravacitinib (BMS-986165) (TYK2), Ruxolitinib cream (INCB018424) (JAK1/2), Cucurbitacin I (JSI-124), CHZ868 (JAK2), Tofacitinib, and Topical tofacitinib and ruxolitinib, as well as compounds described in U.S. Pat. Nos. 8,609,687, 8,637,526, 8,987,443, 9,422,300, 9,890,165, 10,023,577, 10,100,049, 10,435,428, 10,493,077, 10,617,690, 10,758,543, 10,786,507, and 10,968,222 and US Pat. Pub. Nos. 20210155621, 20210030672, and 20200190080, each of which is herein incorporated by reference in its entirety.
In some embodiments, the nucleic acid that is transfected into the skin cells encodes a portion of or all of a CRISPR-Cas system (e.g., a CRISPR-Cas9 system). In some embodiments, the system encodes one or more Clustered Regularly Interspaced Short Palindromic Repeats associated (Cas) proteins (e.g., catalytically dead Cas9). In some embodiments, the system provides a guide RNA. The gRNA itself comprises a sequence complementary to one strand of the DNA target sequence and a scaffold sequence which binds and recruits Cas9 to the target DNA sequence.
The guide RNA (gRNA) may be a crRNA, crRNA/tracrRNA (or single guide RNA, sgRNA). The gRNA may be a non-naturally occurring gRNA. The terms “gRNA,” “guide RNA” and “guide sequence” may be used interchangeably throughout and refer to a nucleic acid comprising a sequence that determines the binding specificity of a Cas protein. A gRNA hybridizes to (complementary to, partially or completely) the DNA target sequence.
The gRNA or portion thereof that hybridizes to the target nucleic acid (a target site) may be any length necessary for selective hybridization. gRNAs or sgRNA(s) can be between about 5 and about 100 nucleotides long, or longer (e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59 60, 61, 62, 63, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 92, 93, 94, 95, 96, 97, 98, 99, or 100 nucleotides in length, or longer).
To facilitate gRNA design, many computational tools have been developed (See Prykhozhij et al. (PLoS ONE, 10(3): (2015)); Zhu et al. (PLoS ONE, 9(9) (2014)); Xiao et al. (Bioinformatics. January 21 (2014)); Heigwer et al. (Nat Methods, 11(2): 122-123 (2014)). Methods and tools for guide RNA design are discussed by Zhu (Frontiers in Biology, 10 (4) pp 289-296 (2015)), which is incorporated by reference herein. Additionally, there are many publicly available software tools that can be used to facilitate the design of sgRNA(s); including but not limited to, Genscript Interactive CRISPR gRNA Design Tool, WU-CRISPR, and Broad Institute GPP sgRNA Designer. There are also publicly available pre-designed gRNA sequences to target many genes and locations within the genomes of many species (human, mouse, rat, zebrafish, C. elegans), including but not limited to, IDT DNA Predesigned Alt-R CRISPR-Cas9 guide RNAs, Addgene Validated gRNA Target Sequences, and GenScript Genome-wide gRNA databases.
While Cas9 systems have been very well characterized, there are many of CRISPR-Cas system or similar systems that have been identified and characterized. The compositions and methods described herein find use with any of these systems.
Immortalized keratinocyte cell line, N/TERT1, was used with permission for generation of knock-out (KO) cell lines using non-homologous end joining via CRISPR/Cas9. This cell line has been shown to have normal differentiation characteristics in both monolayer and organotypic skin models (1). N/TERTs were grown in Keratinocyte-SFM medium (ThermoFisher #17005-042) supplemented with 30 μg/ml bovine pituitary extract, 0.2 ng/ml epidermal growth factor, and 0.3 mM calcium chloride (2).
CRISPR KO KCs were generated as previously described (3). In brief, Single-guide RNA (sgRNA) target sequence was developed using a web interface for CRISPR design (https://portals.broadinstitute.org/gpp/public/analysis-tools/sgrna-design). Synthetic sgRNA target sequences were inserted into a cloning backbone, pSpCas9 (BB)-2A-GFP (PX458) (Addgene plasmid #48138) and then cloned into competent E. coli (ThermoFisher #C737303). Proper insertion was validated by Sanger sequencing. The plasmid with proper insertion was then transfected into an immortalized KC line (N/TERTs) using the TransfeX transfection kit (ATCC #ACS4005) in presence or absence of JAK1/JAK2 inhibitor, baricitinib. GFP positive single cells were plated and then expanded. Cells were then genotyped and analyzed by Sanger sequencing.
DNMT1, DNMT3A and DNMT3B over expressing KCs were generated by lentiviral transductions of mammalian vector containing Myc-DDK-tagged human DNMT1 (NM_001130823, Origene), DNMT3A (NM_175629, Origene), and DNMT3B (NM_006892, Origene) respectively. HEK293T cells were used for viral packaging. Briefly, 10 μg of expression vector was mixed with equal concentration of packaging plasmid (TR30037, Origene) in 1 ml Opti-MEM medium (31985062, Invitrogen) and 30 μl turbofectin (TF8100, Origene), incubated at room temperature for 5 minutes. The obtained mixture was added to the HEK293T cells without dislodging the cells. Supernatants from infected HEK293T cells were harvested after 24 hours, filtered using 0.45 μm syringe filters, aliquoted and stored at −80 C or used immediately. 0.25×106 N/TERTs KCs were plated a day before transduction in serum and antibiotics-free medium. The next day, the cells were transduced at a multiplicity of infection of 0.5 along with 8 μg/ml of polybrene (TR-1003-G, Sigma Aldrich). 24 hours post-transfection, media was replaced with complete growth media. Cells were passaged the following day and the media containing puromycin was used from then on. Puromycin concentration for KCs was determined by performing a drug-kill curve. An empty mammalian expression vector containing Myc-DDK tag only (PS100001, Origene) was used as negative control for transduction experiments. Un-transduced cells were also treated with puromycin to observe complete cell death. Once all the cells in control wells were killed, limited dilution was performed to obtain single cells which were expanded, and the clones were verified for over expression by western blotting.
RNA Extraction, qRT-PCR and RNA-Sequencing (4):
RNA extraction, qRT-PCR and RNA-Sequencing were performed following the protocol published earlier (3). RNAs were isolated from cell cultures using Qiagen RNeasy plus kit (Cat #74136). qRT-PCR was performed on a 7900HT Fast Real-time PCR system (Applied Biosystems) with TaqMan Universal PCR Master Mix (ThermoFisher Scientific). Libraries for RNA-seq were generated from polyadenylated RNA and sequenced at six libraries per lane on the Illumina Genome Analyzer IIx. We used STAR to align RNA-seq reads to the human genome, using annotations of GENCODE as gene model. HTSeq was used to quantify gene expression levels; normalization and differential expression analysis were performed by DESeq2.
Single Cell RNA-Sequencing from Human Skin:
Generation of single cell suspensions for single cell RNA-sequencing (scRNA-seq) was performed as follows from normal human epidermis. Samples were incubated overnight in 0.4% dispase (Life Technologies) in Hank's Balanced Saline Solution (Gibco) at 4° C. Epidermis and dermis were separated. Epidermis was digested in 0.25% Trypsin-EDTA (Gibco) with 10 U/mL DNase I (Thermo Scientific) for 1 hour at 37° C., quenched with FBS (Atlanta Biologicals), and strained through a 70 μM mesh. Dermis was minced, digested in 0.2% Collagenase II (Life Technologies) and 0.2% Collagenase V (Sigma) in plain medium for 1.5 hours at 37° C., and strained through a 70 μM mesh. Epidermal and dermal cells were recombined, and libraries were constructed by the University of Michigan Advanced Genomics Core on the 10× Chromium system. Libraries were then sequenced on the Illumina NovaSeq 6000 sequencer to generate 151-bp paired end reads. Data processing including quality control, read alignment, and gene quantification was conducted using the 10× Cell Ranger software. Seurat was used for normalization, data integration, and clustering analysis (5). Clustered cells were mapped to corresponding cell types by matching cell cluster gene signatures with putative cell-type specific markers.
Single Cell ATAC-Sequencing from Human Skin:
Four mm skin biopsies were obtained from palm/hip from healthy individual. Biopsies were then incubated in 0.4% dispase overnight in order to separate the epidermis and dermis. After the separation, epidermis was transferred to 0.25% Trypsin-EDTA+10 unit/mL DNase mixture and incubated at 37° C. for 1 hr. Epidermis mixture was then quenched with FBS and precipitated by centrifugation. Cell pellets were then resuspended in PBS+0.04% BSA. Cell numbers were counted at this step for future dilution calculation. The nuclei isolation protocol was carried as described by 10× Genomics. Of note, cells obtained from epidermis were incubated in lysis buffer on ice for 7 min to achieve best lysis efficacy. The cell lysis efficacy was determined by Countess II FL Automated Cell Counter. The single cell ATACseq library was prepared by Advanced Genomics Core at University of Michigan. 10,000 nuclei/sample and 25,000 reads/nuclei were targeted, and the libraries were sequenced using NovaSeq SP 100 cycle flow cell. The raw data was first processed by the Chromium Single cell ATAC Software Suite (10× Genomics), and then analyzed using the Signac package in R. Briefly, the single cell ATACseq data go through a series of analyses including quality control, dimension reduction, clustering and integration with previously annotated single cell RNAseq data. DNA accessibility profile was then visualized in different cell types and samples.
Accell siRNA Knock Down:
N/TERTs KCs were plated in 96 well plate (30,000 cells/well) and incubated at 37° C. with 5% CO2 overnight. 100 μM accell siRNA (Dharmacon, APOBEC3A-E-017432-00-0005, APOBEC3B-E-017322-01-0005, APOBEC3G-E-013072-00-0005, APOBEC3H-E-019144-00-0005, DNASE1-E-016280-00-0005) was prepared in Ix siRNA buffer (Dharmacon #B-002000-UB-100). 1 μl of 100 μM siRNA was diluted with 100 μl accell delivery medium (Dharmacon #B-005000) for each well of 96 well plate. Growth medium was removed from the cells and 100 μl of the appropriate delivery mix with siRNA was added to each well and the plate was incubated at 37° C. with 5% CO2. Accell Non-targeting Control siRNA (Dharmacon #D-001910-01-05) was used as a negative control. After 72 hours, cells were harvested for RNA preparation. RNA isolation and qRT-PCR were as above.
Normal human epidermal KCs were isolated from a pool of neonatal foreskins (n=3) and grown using a J2-3T3 mouse fibroblasts as feeder layer as originally described by Rheinwald and Green (6). 3-D human epidermal raft cultures seeded in collagen hydrogels were prepared using three distinct donor pools as described previously (7) and grown at air-liquid interface for 12 days in E-Medium (DMEM/DMEM-F12 (1:1), 5% Fetal Bovine Serum, adenine (180 μM), Bovine pancreatic insulin (5 μg/ml), Human apo-transferrin (5 μg/ml), triiodothyronine (5 μg/ml), L-Glutamine (4 mM), Cholera toxin (10 ng/ml), Gentamicin (10 μg/ml), Amphotericin B (0.25 μg/ml)). After 9 days at an air-liquid-interface to allow for epidermal maturation, the RHEs were treated with 0.1% BSA/phosphate-buffered saline (Sigma Aldrich, St Louis, MO) as a vehicle control or 10.0 ng/ml TNF-α, IL-17A, IL-22 (R&D Systems, Minneapolis, MN) alone or as a combination for 72 h, harvested, and analyzed for changes in gene expression as described (8). Epidermal tissues were separated from the collagen scaffold and lysed in QIAzol for RNA isolation. RNA-seq and analysis were performed according methods mentioned above.
CRISPR plasmid (PX458, Addgene #48138) was transfected into KCs using Transfex transfection kit (ATCC #ACS-4005). Cells were then harvested at different time points (0 Hr, 6 Hrs, 12 Hrs, 24 Hrs and 48 Hrs) and washed with PBS three times to remove extracellular plasmid from the cells. Then DNA was then purified using the QIAamp DNA Blood Mini kit (Qiagen #51106). CRISPR plasmid specific primers (Px458-F: GGGCAGAGGAAGTCTGCTAA (SEQ ID NO: 1) and Px458-R: GGGAGGGGCAAACAACAGAT (SEQ ID NO: 2)) were used to perform qPCR with the DNAs isolated from the transfected KCs using SYBR Green PCR Master Mix (ThermoFisher #4309155) on the 7300 Real-time PCR system (Applied Biosystems).
Bisulfite treatment was performed on DNA isolated from wild type and CRISPR knock-out KCs using the EZ DNA methylation-Gold kit (Zymo Research #D5005) according to the vendor's recommendations. Bisulfite converted DNA was amplified with the following primers, IFNK-BS583 F9: TGTTGGGATGGATTATTTAGGTATT (SEQ ID NO: 3) and IFNK-BS-R9: TTCAACAAAAAAAATTTTCTCATTC (SEQ ID NO: 4). PCR products were cloned in pCR2.1-TOPO vector (ThermoFisher #K204040) and those clones were then subjected to sanger sequencing using M13Rev and T7 primers.
Total protein was isolated from cells using Pierce RIPA buffer (89900, ThermoFisher) with PMSF Protease Inhibitor (36978, Sigma) and run-on pre-cast gel (456-1094S, Bio-Rad). The membrane was blocked with 3% BSA and then probed by primary antibodies including p-IRF3 (ThermoFisher #PA536775), DNMT3B (Cell signaling #67259S) and β-Actin (A5441, Sigma), followed by secondary antibodies (anti-mouse or rabbit IgG, AP-linked Antibody, Cell Signaling), then washed for 3 times, and substrate added (45-000-947, Fisher Scientific). They were then imaged with (brand) chemiluminescent kit and imaged on iBright imager (ThermoFisher).
Formalin-fixed, paraffin-embedded tissue slides obtained from healthy individual were heated for 30 min at 60° C., rehydrated, and epitope retrieved with tris-EDTA (pH 6). Slides were blocked and incubated with primary antibodies against IFN-κ (Abnova #H00056832-M01), APOBEC3G (Abcam #Ab223704) and DNMT3B (Cell Signaling #67259S) overnight at 4° C. Slides were incubated with biotinylated secondary antibodies (biotinylated goat anti-rabbit IgG antibody, BA1000, Vector Laboratories; biotinylated horse anti-mouse IgG antibody, BA2000, Vector Laboratories) and then incubated with fluorochrome-conjugated streptavidin. Slides were prepared in mounting medium with 4′,6-diamidino-2-phenylindole (DAPI) (VECTASHIELD Antifade Mounting Medium with DAPI, H-1200, VECTOR). Images were acquired using inverted Zeiss microscope. Images presented are representative of at least three biologic replicates.
Preferred embodiments of this invention are described herein. Variations of those preferred embodiments may become apparent to those of ordinary skill in the art upon reading the foregoing description. The inventors expect skilled artisans to employ such variations as appropriate, and the inventors intend for the invention to be practiced otherwise than as specifically described herein. Accordingly, this invention includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law. Moreover, any combination of the above-described elements in all possible variations thereof is encompassed by the invention unless otherwise indicated herein or otherwise clearly contradicted by context.
The present application claims priority to U.S. Provisional Patent Application No. 63/211,173, filed Jun. 16, 2021, which is hereby incorporated by reference in its entirety.
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/US22/33733 | 6/16/2022 | WO |
| Number | Date | Country | |
|---|---|---|---|
| 63211173 | Jun 2021 | US |
