Patent Application
20250027084
The instant application contains a Sequence Listing which has been submitted in XML format and is hereby incorporated by reference in its entirety. Said XML copy, created on May 24, 2024, is named 121384_0190_SL.xml and is 86,389 bytes.
The present disclosure relates generally to compositions and methods for inhibiting arginine-rich dipeptide repeat protein (R-DPR)-ribosomal RNA (rRNA) interaction. In particular, the present technology relates to administering a therapeutically effective amount of one or more compositions that inhibit R-DPR-rRNA interaction to a subject diagnosed with, or at risk for R-DPR-associated pathologies, e.g., amyotrophic lateral sclerosis or frontotemporal dementia.
In one aspect, the present disclosure provides a single-stranded RNA (ssRNA) construct comprising a sequence that is identical to the sequence of a fragment of a ribosomal RNA (rRNA) subunit selected from the group consisting of the 28S, 18S, and 5.8S subunits, or a fragment of the 5′ETS or ITS1 region of the 47S rRNA precursor, wherein the ssRNA construct comprises one or more modified nucleotides.
In some embodiments, the ssRNA construct comprises a sequence that is identical to the sequence of a fragment of the rRNA 28S subunit. In some embodiments, the fragment of the rRNA 28S subunit comprises all or part of the sequence of SEQ ID NO: 1. In some embodiments, the fragment of the rRNA 28S subunit includes nucleotides 2740 and 2820 of SEQ ID NO: 3.
In some embodiments, the ssRNA construct comprises a sequence that is identical to the sequence of a fragment of the rRNA 5.8S subunit. In some embodiments, the fragment of the rRNA 5.8S subunit comprises all or part of the sequence SEQ ID NO: 2.
In some embodiments, the fragment consists of up to 30 nucleotides.
In some embodiments, the modified nucleotides comprise one or more 2′-modified ribose sugars. In some embodiments, the modified nucleotides are 2′-O-alkyl nucleotides, 2′-deoxy-2′-fluoro nucleotides, 2′-deoxy nucleotides, 2′-H (deoxyribonucleotides), or a combination thereof. In some embodiments, the modified nucleotides are 2′-O-methyl nucleotides.
In some embodiments, the modified nucleotides are at the 5′ end and/or the 3′ end.
In some embodiments, the ssRNA construct comprises a structure of mGmGmUmCmUrCrCrArArGrGrUrGrArAmCmAmGmCmC (SEQ ID NO: 8).
In some embodiments, the ssRNA construct further comprises a covalently linked fluorophore.
In one aspect, the present disclosure provides a composition comprising any of the above ssRNA constructs, and a pharmaceutically acceptable carrier.
In another aspect, the present disclosure provides a method for treating or preventing amyotrophic lateral sclerosis or frontotemporal dementia in a subject thereof, comprising administering to the subject a therapeutically effective amount of an ssRNA construct that inhibits dipeptide repeat (DPR) protein-ribosomal RNA (rRNA) interaction, wherein the ssRNA construct comprises a sequence that is identical to the sequence of a fragment of a ribosomal RNA (rRNA) or a rRNA precursor.
In some embodiments, the subject harbors a heterozygous intronic hexanucleotide (GGGGCC)n repeat expansion in C9ORF72 (C9-HRE) gene. In some embodiments, the subject has an increased expression of one or more of poly-glycine-proline (polyGP), poly-glycine-alanine (polyGA), poly-glycine-arginine (polyGR), poly-proline-arginine (polyPR), and poly-proline-alanine (polyPA) as compared to that observed in a healthy subject. In some embodiments, the the subject has an increased expression of poly-GR and/or poly-PR.
In some embodiments, the subject exhibits one or more signs of impaired ribosomal homeostasis and function selected from the group consisting of a reduced total rRNA level, an increased nucleocytoplasmic (N/C) ratio of rRNA, or a decreased level of de novo protein translation as compared to that observed in a healthy subject.
In some embodiments, the the ssRNA comprises one or more modified nucleotides. In some embodiments, the modified nucleotides comprise 2′-modified ribose sugars. In some embodiments, the modified nucleotides are 2′-O-alkyl nucleotides, 2′-deoxy-2′-fluoro nucleotides, 2′-deoxy nucleotides, 2′-H (deoxyribonucleotides), or a combination thereof. In some embodiments, the modified nucleotides are 2′-O-methyl nucleotides.
Line bars indicating the energetic strength of the interactions of (GR)50 (SEQ ID NO: 17) in the “no GR-RPs interaction” region of the ribosome over time. Dashed line indicates the highest interaction energy achieved between (GR)50 (SEQ ID NO: 17) and 28S rRNA.
Various embodiments are described hereinafter. It should be noted that the specific embodiments are not intended as an exhaustive description or as a limitation to the broader aspects discussed herein. One aspect described in conjunction with a particular embodiment is not necessarily limited to that embodiment and can be practiced with any other embodiment(s).
In practicing the present methods, many conventional techniques in molecular biology, protein biochemistry, cell biology, immunology, microbiology and recombinant DNA are used. See, e.g., Sambrook and Russell eds. (2001) Molecular Cloning: A Laboratory Manual, 3rd edition; the series Ausubel et al. eds. (2007) Current Protocols in Molecular Biology; the series Methods in Enzymology (Academic Press, Inc., N.Y.); MacPherson et al. (1991) PCR 1: A Practical Approach (IRL Press at Oxford University Press); MacPherson et al. (1995) PCR 2: A Practical Approach; Harlow and Lane eds. (1999) Antibodies, A Laboratory Manual; Freshney (2005) Culture of Animal Cells: A Manual of Basic Technique, 5th edition; Gait ed. (1984) Oligonucleotide Synthesis; U.S. Pat. No. 4,683,195; Hames and Higgins eds. (1984) Nucleic Acid Hybridization; Anderson (1999) Nucleic Acid Hybridization; Hames and Higgins eds. (1984) Transcription and Translation; Immobilized Cells and Enzymes (IRL Press (1986)); Perbal (1984) A Practical Guide to Molecular Cloning; Miller and Calos eds. (1987) Gene Transfer Vectors for Mammalian Cells (Cold Spring Harbor Laboratory); Makrides ed. (2003) Gene Transfer and Expression in Mammalian Cells; Mayer and Walker eds. (1987) Immunochemical Methods in Cell and Molecular Biology (Academic Press, London); and Herzenberg et al. eds (1996) Weir's Handbook of Experimental Immunology. Methods to detect and measure levels of polypeptide gene expression products (i.e., gene translation level) are well-known in the art and include the use of polypeptide detection methods such as antibody detection and quantification techniques. (See also, Strachan & Read, Human Molecular Genetics, Second Edition. (John Wiley and Sons, Inc., NY, 1999)).
As used herein, “about” will be understood by persons of ordinary skill in the art and will vary to some extent depending upon the context in which it is used. If there are uses of the term which are not clear to persons of ordinary skill in the art, given the context in which it is used, “about” will mean up to plus or minus 10% of the particular term.
The use of the terms “a” and “an” and “the” and similar referents in the context of describing the elements (especially in the context of the following claims) are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context. Recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range, unless otherwise indicated herein, and each separate value is incorporated into the specification as if it were individually recited herein. All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g., “such as”) provided herein, is intended merely to better illuminate the embodiments and does not pose a limitation on the scope of the claims unless otherwise stated. No language in the specification should be construed as indicating any non-claimed element as essential.
As used herein, a “control” is an alternative sample used in an experiment for comparison purpose. A control can be “positive” or “negative.” For example, where the purpose of the experiment is to determine a correlation of the efficacy of a therapeutic agent for the treatment for a particular type of disease, a positive control (a compound or composition known to exhibit the desired therapeutic effect) and a negative control (a subject or a sample that does not receive the therapy or receives a placebo) are typically employed.
As used herein, “expression” includes one or more of the following: transcription of the gene into precursor mRNA; splicing and other processing of the precursor mRNA to produce mature mRNA; mRNA stability; translation of the mature mRNA into protein (including codon usage and tRNA availability); and glycosylation and/or other modifications of the translation product, if required for proper expression and function.
A “fragment” is a portion of an amino acid sequence or a polynucleotide which is identical in sequence to but shorter in length than a reference sequence. A fragment may comprise up to the entire length of the reference sequence, minus at least one nucleotide/amino acid residue. For example, a fragment may comprise from 5 to 1000 contiguous nucleotides or contiguous amino acid residues of a reference polynucleotide or reference polypeptide, respectively. In some embodiments, a fragment may comprise at least 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 contiguous amino acid residues of a reference peptide, respectively. Fragments may be preferentially selected from certain regions of a molecule. The term encompasses the full length polynucleotide or full length polypeptide.
“Homology” or “identity” or “similarity” refers to sequence similarity between two peptides or between two nucleic acid molecules. Homology can be determined by comparing a position in each sequence which may be aligned for purposes of comparison. When a position in the compared sequence is occupied by the same nucleobase or amino acid, then the molecules are homologous at that position. A degree of homology between sequences is a function of the number of matching or homologous positions shared by the sequences. A polynucleotide or polynucleotide region (or a polypeptide or polypeptide region) has a certain percentage (for example, at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99%) of “sequence identity” to another sequence means that, when aligned, that percentage of bases (or amino acids) are the same in comparing the two sequences. This alignment and the percent homology or sequence identity can be determined using software programs known in the art. In some embodiments, default parameters are used for alignment. One alignment program is BLAST, using default parameters. In particular, programs are BLASTN and BLASTP, using the following default parameters: Genetic code=standard; filter=none; strand=both; cutoff=60; expect=10; Matrix=BLOSUM62; Descriptions=50 sequences; sort by =HIGH SCORE; Databases=non-redundant, GenBank+EMBL+DDBJ+PDB+GenBank CDS translations+SwissProtein+SPupdate+PIR. Details of these programs can be found at the National Center for Biotechnology Information. Biologically equivalent polynucleotides are those having the specified percent homology and encoding a polypeptide having the same or similar biological activity. Two sequences are deemed “unrelated” or “non-homologous” if they share less than 40% identity, or less than 25% identity, with each other.
As used herein, the term “gene” means a segment of DNA that contains all the information for the regulated biosynthesis of an RNA product, including promoters, exons, introns, and other untranslated regions that control expression.
As used herein, “oligonucleotide” refers to a molecule that has a sequence of nucleic acid bases on a backbone comprised mainly of identical monomer units at defined intervals. The bases are arranged on the backbone in such a way that they can bind with a nucleic acid having a sequence of bases that are complementary to the bases of the oligonucleotide. The most common oligonucleotides have a backbone of sugar phosphate units. A distinction may be made between oligodeoxyribonucleotides that do not have a hydroxyl group at the 2′ position and oligoribonucleotides that have a hydroxyl group at the 2′ position. Oligonucleotides may also include derivatives, in which the hydrogen of the hydroxyl group is replaced with organic groups, e.g., an allyl group. One or more bases of the oligonucleotide may also be modified to include a phosphorothioate bond (e.g., one of the two oxygen atoms in the phosphate backbone which is not involved in the internucleotide bridge, is replaced by a sulfur atom) to increase resistance to nuclease degradation. The exact size of the oligonucleotide will depend on many factors, which in turn depend on the ultimate function or use of the oligonucleotide. The oligonucleotide may be generated in any manner, including, for example, chemical synthesis, DNA replication, restriction endonuclease digestion of plasmids or phage DNA, reverse transcription, PCR, or a combination thereof. The oligonucleotide may be modified e.g., by addition of a methyl group, a biotin or digoxigenin moiety, a fluorescent tag or by using radioactive nucleotides.
As used herein, the term “peptide” refers to a polymer of amino acid residues joined by amide linkages, which may optionally be chemically modified to achieve desired characteristics. The term “amino acid residue,” includes but is not limited to amino acid residues contained in the group consisting of alanine (Ala or A), cysteine (Cys or C), aspartic acid (Asp or D), glutamic acid (Glu or E), phenylalanine (Phe or F), glycine (Gly or G), histidine (His or H), isoleucine (Ile or I), lysine (Lys or K), leucine (Leu or L), methionine (Met or M), asparagine (Asn or N), proline (Pro or P), glutamine (Gln or Q), arginine (Arg or R), serine (Ser or S), threonine (Thr or T), valine (Val or V), tryptophan (Trp or W), and tyrosine (Tyr or Y) residues. The term “amino acid residue” also may include unnatural amino acids or residues contained in the group consisting of homocysteine, 2-Aminoadipic acid, N-Ethylasparagine, 3-Aminoadipic acid, Hydroxylysine, β-alanine, β-Amino-propionic acid, allo-Hydroxylysine acid, 2-Aminobutyric acid, 3-Hydroxyproline, 4-Aminobutyric acid, 4-Hydroxyproline, piperidinic acid, 6-Aminocaproic acid, Isodesmosine, 2-Aminoheptanoic acid, allo-Isoleucine, 2-Aminoisobutyric acid, N-Methylglycine, sarcosine, 3-Aminoisobutyric acid, N-Methylisoleucine, 2-Aminopimelic acid, 6-N-Methyllysine, 2,4-Diaminobutyric acid, N-Methylvaline, Desmosine, Norvaline, 2,2′-Diaminopimelic acid, Norleucine, 2,3-Diaminopropionic acid, Ornithine, and N-Ethylglycine. Typically, the amide linkages of the peptides are formed from an amino group of the backbone of one amino acid and a carboxyl group of the backbone of another amino acid.
By “pharmaceutically acceptable” is meant a material that is not biologically or otherwise undesirable, e.g., the material may be incorporated into a pharmaceutical composition administered to a patient without causing any undesirable biological effects or interacting in a deleterious manner with any of the other components of the composition in which it is contained. When the term “pharmaceutically acceptable” is used to refer to a pharmaceutical carrier or excipient, it is implied that the carrier or excipient has met the required standards of toxicological and manufacturing testing or that it is included on the Inactive Ingredient Guide prepared by the U.S. Food and Drug administration.
As used herein, “subject” refers to an animal, such as a mammal (including a human), that has been or will be the object of treatment, observation or experiment. “Subject” and “patient” may be used interchangeably, unless otherwise indicated. Mammals include, but are not limited to, mice, rodents, rats, simians, humans, farm animals, dogs, cats, sport animals, and pets. The methods described herein may be useful in human therapy and/or veterinary applications. In some embodiments, the subject is a mammal. In some embodiments, the subject is a human.
The terms “therapeutically effective amount” and “effective amount” are used interchangibly and refer to an amount of a compound that is sufficient to effect treatment as defined below, when administered to a patient (e.g., a human) in need of such treatment in one or more doses. The therapeutically effective amount will vary depending upon the patient, the disease being treated, the weight and/or age of the patient, the severity of the disease, or the manner of administration as determined by a qualified prescriber or caregiver.
The term “treatment” or “treating” means administering a compound disclosed herein for the purpose of: (i) delaying the onset of a disease, that is, causing the clinical symptoms of the disease not to develop or delaying the development thereof; (ii) inhibiting the disease, that is, arresting the development of clinical symptoms; and/or (iii) relieving the disease, that is, causing the regression of clinical symptoms or the severity thereof.
In one aspect, the present disclosure provides inhibitory single-stranded RNA (ssRNA) construct that inhibit dipeptide repeat (DPR) protein-ribosomal RNA (rRNA) interaction. In some embodiments, the inhibitory ssRNA comprise a sequence that is identical to the sequence of a fragment of a ribosomal RNA (rRNA) subunit selected from the group consisting of the 28S, 18S, and 5.8S subunits, or a fragment of the 5′ETS or ITS1 region of the 47S rRNA precursor, wherein the ssRNA construct comprises one or more modified nucleotides. For non-limiting examples, the sequences of human rRNA 28S, 18S, and 5.8S subunits, and the 5′ETS and ITS1 regions of the 47S rRNA, are provided below.
Human rRNA 18S subunit. NCBI Reference Sequence NR_145820.1, Homo sapiens RNA, 18S ribosomal N1 (RNA18SN1; SEQ ID NO: 4).
Human rRNA 5.8S subunit. NCBI Reference Sequence NR_145821.1 Homo sapiens RNA, 5.8S ribosomal N1 (RNA5-8SN1; SEQ ID NO: 5).
5′ETS region of human 47S rRNA. Nucleotides 1-3654 of NCBI Reference Sequence NR_145819.1 (RNA45SN1) (SEQ ID NO: 6):
ITS1 region of human 47S rRNA. Nucleotides 5524-6756 of NCBI Reference Sequence NR_145819.1 (RNA45SN1) (SEQ ID NO: 7):
In some embodiments, the ssRNA construct comprises a sequence that is identical to the sequence of a fragment of the rRNA 28S subunit. In some embodiments, the fragment of the rRNA 28S subunit comprises all or part of the sequence of TTGAAAATCCGGGGGAGAGGGTGTAAATCTCGCGCCGGGCCGTACCCATATC CGCAGCAGGTCTCCAAGGTGAACAGCCTC (SEQ ID NO: 1). In some embodiments, the fragment of the rRNA 28S subunit includes nucleotides 2740 and 2820 of NCBI Reference Sequence: NR_145822.1, Homo sapiens RNA, 28S ribosomal N1 (RNA28SN1; SEQ ID NO: 3). SEQ ID NO: 3 is listed below:
In some embodiments, the ssRNA construct comprises a sequence that is identical to the sequence of a fragment of the rRNA 5.8S subunit. In some embodiments, the fragment of the rRNA 5.8S subunit comprises all or part of the sequence ACTTCGAACGCACTTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAG CGTCGCTT (SEQ ID NO: 2).
In some embodiments, the ssRNA construct disclosed herein includes any form of a ssRNA having substantial homology to SEQ ID NO: 1 or SEQ ID NO: 2. In some embodiments, a ssRNA which is “substantially homologous” is about 50% homologous, more preferably about 70% homologous, even more preferably about 80% homologous, more preferably about 90% homologous, even more preferably, about 95% homologous, and even more preferably about 99% homologous to SEQ ID NO: 1 or SEQ ID NO:2.
In some embodiments, the fragment consists of up to 30 nucleotides. In some embodiments, the fragment consists of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides.
In some embodiments, the ssRNA construct comprise modified nucleotides. Modification may include but not limited to 2′-modification of the ribose sugars of the modified nucleotides. In some embodiments, the modified nucleotides are 2′-O-alkyl nucleotides, 2′-deoxy-2′-fluoro nucleotides, 2′-deoxy nucleotides, 2′-H (deoxyribonucleotides), or a combination thereof. In some embodiments, the modified nucleotides are 2′-O-methyl nucleotides. In some embodiments, the modified nucleotides are at the 5′ end and/or the 3′ end of the ssRNA construct. In a specific embodiment, the ssRNA construct comprises a structure of mGmGmUmCmUrCrCrArArGrGrUrGrArAmCmAmGmCmC (SEQ ID NO: 8).
In some embodiments, the ssRNA construct may further comprise a covalently or non-covalently linked fluorophore.
In some embodiments, the ssRNA construct is formulated as a pharmaceutically acceptable composition when combined with at least one pharmaceutically acceptable carrier and/or excipient.
One aspect of the present technology includes a method for treating or preventing a disease or condition characterized by elevated expression of dipeptide repeat proteins and/or the aggregates thereof as compared to that observed in a healthy subject in a subject thereof, comprising administering to the subject a therapeutically effective amount of a ssRNA construct that inhibits dipeptide repeat (DPR) protein-ribosomal RNA (rRNA) interaction, wherein the ssRNA construct comprises a sequence that is identical to the sequence of a fragment of a ribosomal RNA (rRNA) or a rRNA precursor. A disease or condition characterized by elevated expression of dipeptide repeat proteins and/or the aggregates may be but not limited to amyotrophic lateral sclerosis or frontotemporal dementia.
In some embodiments, the subject is diagnosed as having, suspected as having, or at risk of having a disease or condition characterized by elevated expression of dipeptide repeat proteins and/or the aggregates thereof as compared to that observed in a healthy subject (e.g., amyotrophic lateral sclerosis or frontotemporal dementia). The dipeptide repeat proteins may include one or more of poly-glycine-proline (polyGP), poly-glycine-alanine (polyGA), poly-glycine-arginine (polyGR), poly-proline-arginine (polyPR), and poly-proline-alanine (polyPA). In some embodiments, the subject has an increased expression of poly-GR and/or poly-PR.
In some embodiments, the subject harbors a heterozygous intronic hexanucleotide (GGGGCC)n repeat expansion in C9ORF72 (C9-HRE) gene. In some embodiments, the subject exhibits one or more signs of impaired ribosomal homeostasis and function selected from the group consisting of a reduced total rRNA level, an increased nucleocytoplasmic (N/C) ratio of rRNA, or a decreased level of de novo protein translation as compared to that observed in a healthy subject. Subjects suffering from a disease or condition characterized by elevated expression of dipeptide repeat proteins and/or the aggregates thereof (e.g., amyotrophic lateral sclerosis or frontotemporal dementia) can be identified by any or a combination of diagnostic or prognostic assays known in the art.
In some embodiments of the methods disclosed herein, the ssRNA comprises one or more modified nucleotides. In some embodiments, the modified nucleotides are at the 5′ end and/or the 3′ end of the ssRNA construct.
In some embodiments, the modified nucleotides comprise 2′-modified ribose sugars. In some embodiments, the modified nucleotides are 2′-O-alkyl nucleotides, 2′-deoxy-2′-fluoro nucleotides, 2′-deoxy nucleotides, 2′-H (deoxyribonucleotides), or a combination thereof. In some embodiments, the modified nucleotides are 2′-O-methyl nucleotides.
In some embodiments, the fragment consists of up to 30 nucleotides. In some embodiments, the fragment consists of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides.
In some embodiments, the ssRNA construct further comprises a covalently linked fluorophore.
In some embodiments, the ssRNA construct comprises a sequence that is identical to the sequence of a fragment of a ribosomal RNA (rRNA) subunit selected from the group consisting of the 28S, 18S, and 5.8S subunits, or a fragment of the 5′ETS or ITS1 region of the 47S rRNA precursor.
In some embodiments, the ssRNA construct comprises a sequence that is identical to the sequence of a fragment of the rRNA 28S subunit. In some embodiments, the fragment of the rRNA 28S subunit comprises all or part of the sequence of TTGAAAATCCGGGGGAGAGGGTGTAAATCTCGCGCCGGGCCGTACCCATATC CGCAGCAGGTCTCCAAGGTGAACAGCCTC (SEQ ID NO: 1). In some embodiments, the fragment of the rRNA 28S subunit includes nucleotides 2798 and 2818.
In some embodiments, the ssRNA construct comprises a sequence that is identical to the sequence of a fragment of the rRNA 5.8S subunit. In some embodiments, the fragment of the rRNA 5.8S subunit comprises all or part of the sequence ACTTCGAACGCACTTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAG CGTCGCTT (SEQ ID NO: 2).
In some embodiments, the ssRNA construct disclosed herein includes any form of a ssRNA having substantial homology to SEQ ID NO: 1 or SEQ ID NO: 2. In some embodiments, a ssRNA which is “substantially homologous” is about 50% homologous, more preferably about 70% homologous, even more preferably about 80% homologous, more preferably about 90% homologous, even more preferably, about 95% homologous, and even more preferably about 99% homologous to SEQ ID NO: 1 or SEQ ID NO:2.
In a specific embodiment, the ssRNA construct comprises a structure of mGmGmUmCmUrCrCrArArGrGrUrGrArAmCmAmGmCmC (SEQ ID NO: 8).
In some embodiments, the ssRNA construct inhibits polyGR-rRNA interaction.
In some embodiments, subjects with a disease or condition characterized by elevated expression of dipeptide repeat proteins and/or the aggregates thereof (e.g., amyotrophic lateral sclerosis or frontotemporal dementia) that are treated with the ssRNA construct will exhibit one or more signs of improved ribosomal homeostasis and function selected from the group consisting of a increased total rRNA level, a decreased nucleocytoplasmic (N/C) ratio of rRNA, or a increased level of de novo protein translation as compared to that observed prior to the treatment.
In some embodiments, the treatment with the ssRNA construct prevent, ameliorate, or delay the onset of one or more of the symptoms of amyotrophic lateral sclerosis selected from the group consisting of uscle twitches in the arm, leg, shoulder, or tongue; muscle cramps; tight and stiff muscles (spasticity); muscle weakness affecting an arm, a leg, the neck, or diaphragm; slurred and nasal speech; difficulty chewing or swallowing; and dicciculty moving, swallowing (dysphagia), speaking or forming words (dysarthria), or breathing (dyspnea).
In some embodiments, the treatment with the ssRNA construct prevent, ameliorate, or delay the onset of one or one more of the symptoms of frontotemporal dementia selected from the group consisting of behavior and/or dramatic personality changes, such as swearing, stealing, increased interest in sex, or a deterioration in personal hygiene habits; socially inappropriate, impulsive, or repetitive behaviors; impaired judgment; apathy; lack of empathy; decreased self awareness; loss of interest in normal daily activities; emotional withdrawal from others; loss of energy and motivation; inability to use or understand language (e.g., difficulty naming objects, expressing words, or understanding the meanings of words); hesitation when speaking; less frequent speech; distractibility; trouble planning and organizing; frequent mood changes; agitation; and increasing dependence.
In some embodiments, the ssRNA construct is administered orally, topically, intranasally, systemically, intravenously, subcutaneously, intraperitoneally, intradermally, intraocularly, iontophoretically, transmucosally, or intramuscularly.
In some embodiments, the method further comprises separately, sequentially or simultaneously administering one or more additional therapeutic agents to the subject. Nonlimiting examples of the additional therapeutic agents include C9-HRE antisense oligonucleotides (ASOs), antioxidants, or the combination thereof.
Another aspect of the present technology provides a method for inhibiting arginine-rich dipeptide repeat (R-DPR) protein-ribosomal RNA (rRNA) interaction in a cell or a subject, comprising administering to the cell or the subject a therapeutically effective amount of a ssRNA construct comprising a sequence that is identical to the sequence of a fragment of a ribosomal RNA (rRNA) or a rRNA precursor. The ssRNA construct may be any of the foregoing ssRNA constructs.
Another aspect of the present technology provides a method for restoring impaired ribosomal homeostasis and function associated with dipeptide repeat (DPR) protein expression, comprising administering to the subject a therapeutically effective amount of a ssRNA construct that inhibits arginine-rich dipeptide repeat (R-DPR) protein-ribosomal RNA (rRNA) interaction, wherein the ssRNA construct comprises a sequence that is identical to the sequence of a fragment of a ribosomal RNA (rRNA) or a rRNA precursor. The ssRNA construct may be any of the foregoing ssRNA constructs.
Another aspect of the present technology provides a method a method of determining whether a subject with amyotrophic lateral sclerosis or frontotemporal dementia is responding to treatment with a arginine-rich dipeptide repeat (R-DPR) protein-ribosomal RNA (rRNA) interaction inhibitor, comprising
Any method known to those in the art for contacting a cell, organ or tissue with a ssRNA may be employed. Suitable methods include in vitro, ex vivo, or in vivo methods. In vivo methods typically include the administration of the ssRNA construct to a mammal, suitably a human. When used in vivo for therapy, the ssRNA construct described herein are administered to the subject in effective amounts (i.e., amounts that have desired therapeutic effect). The dose and dosage regimen will depend upon the degree of the disease state of the subject, the characteristics of the particular ssRNA construct used, e.g., its therapeutic index, and the subject's history.
The effective amount may be determined during pre-clinical trials and clinical trials by methods familiar to physicians and clinicians. An effective amount of the ssRNA construct useful in the methods may be administered to a mammal in need thereof by any of a number of well-known methods for administering pharmaceutical compounds. The inhibitors may be administered systemically or locally.
The the ssRNA construct described herein can be incorporated into pharmaceutical compositions for administration, singly or in combination, to a subject for the treatment or prevention of amyotrophic lateral sclerosis or frontotemporal dementia. Such compositions typically include the active agent and a pharmaceutically acceptable carrier. As used herein the term “pharmaceutically acceptable carrier” includes saline, solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration. Supplementary active compounds can also be incorporated into the compositions.
Pharmaceutical compositions are typically formulated to be compatible with its intended route of administration. Examples of routes of administration include parenteral (e.g., intravenous, intradermal, intraperitoneal or subcutaneous), oral, inhalation, transdermal (topical), intraocular, iontophoretic, and transmucosal administration. Solutions or suspensions used for parenteral, intradermal, or subcutaneous application can include the following components: a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; buffers such as acetates, citrates or phosphates and agents for the adjustment of tonicity such as sodium chloride or dextrose. pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide. The parenteral preparation can be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic. For convenience of the patient or treating physician, the dosing formulation can be provided in a kit containing all necessary equipment (e.g., vials of drug, vials of diluent, syringes and needles) for a treatment course (e.g., 7 days of treatment).
Pharmaceutical compositions suitable for injections use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, CREMOPHOR EL™ (BASF, Parsippany, N.J.) or phosphate buffered saline (PBS). In all cases, a composition for parenteral administration must be sterile and should be fluid to the extent that easy syringability exists. It should be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi.
The pharmaceutical compositions having the ssRNA construct disclosed herein can include a carrier, which can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, and the like), and suitable mixtures thereof. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thiomerasol, and the like. Glutathione and other antioxidants can be included to prevent oxidation. In many cases, it will be advantageous to include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, or sodium chloride in the composition. Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent that delays absorption, for example, aluminum monostearate or gelatin.
Sterile injectable solutions can be prepared by incorporating the active compound in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle, which contains a basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, typical methods of preparation include vacuum drying and freeze drying, which can yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.
Oral compositions generally include an inert diluent or an edible carrier. For the purpose of oral therapeutic administration, the active compound can be incorporated with excipients and used in the form of tablets, troches, or capsules, e.g., gelatin capsules. Oral compositions can also be prepared using a fluid carrier for use as a mouthwash. Pharmaceutically compatible binding agents, and/or adjuvant materials can be included as part of the composition. The tablets, pills, capsules, troches and the like can contain any of the following ingredients, or compounds of a similar nature: a binder such as microcrystalline cellulose, gum tragacanth or gelatin; an excipient such as starch or lactose, a disintegrating agent such as alginic acid, Primogel, or corn starch; a lubricant such as magnesium stearate or Sterotes; a glidant such as colloidal silicon dioxide; a sweetening agent such as sucrose or saccharin; or a flavoring agent such as peppermint, methyl salicylate, or orange flavoring.
For administration by inhalation, the compounds can be delivered in the form of an aerosol spray from a pressurized container or dispenser, which contains a suitable propellant, e.g., a gas such as carbon dioxide, or a nebulizer. Such methods include those described in U.S. Pat. No. 6,468,798.
Systemic administration of a therapeutic compound as described herein can also be by transmucosal or transdermal means. For transmucosal or transdermal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art, and include, for example, for transmucosal administration, detergents, bile salts, and fusidic acid derivatives. Transmucosal administration can be accomplished through the use of nasal sprays. For transdermal administration, the active compounds are formulated into ointments, salves, gels, or creams as generally known in the art. In one embodiment, transdermal administration may be performed by iontophoresis.
A therapeutic agent can be formulated in a carrier system. The carrier can be a colloidal system. The colloidal system can be a liposome, a phospholipid bilayer vehicle. In one embodiment, the therapeutic agent is encapsulated in a liposome while maintaining the agent's structural integrity. One skilled in the art would appreciate that there are a variety of methods to prepare liposomes. (See Lichtenberg, et al., Methods Biochem. Anal., 33:337-462 (1988); Anselem, et al., Liposome Technology, CRC Press (1993)). Liposomal formulations can delay clearance and increase cellular uptake (See Reddy, Ann. Pharmacother., 34(7-8):915-923 (2000)). An active agent can also be loaded into a particle prepared from pharmaceutically acceptable ingredients including, but not limited to, soluble, insoluble, permeable, impermeable, biodegradable or gastroretentive polymers or liposomes. Such particles include, but are not limited to, nanoparticles, biodegradable nanoparticles, microparticles, biodegradable microparticles, nanospheres, biodegradable nanospheres, microspheres, biodegradable microspheres, capsules, emulsions, liposomes, micelles and viral vector systems.
The carrier can also be a polymer, e.g., a biodegradable, biocompatible polymer matrix. In one embodiment, the therapeutic agent can be embedded in the polymer matrix, while maintaining the agent's structural integrity. The polymer may be natural, such as polypeptides, proteins or polysaccharides, or synthetic, such as poly α-hydroxy acids. Examples include carriers made of, e.g., collagen, fibronectin, elastin, cellulose acetate, cellulose nitrate, polysaccharide, fibrin, gelatin, and combinations thereof. In one embodiment, the polymer is poly-lactic acid (PLA) or copoly lactic/glycolic acid (PGLA). The polymeric matrices can be prepared and isolated in a variety of forms and sizes, including microspheres and nanospheres. Polymer formulations can lead to prolonged duration of therapeutic effect. (See Reddy, Ann. Pharmacother., 34(7-8):915-923 (2000)). A polymer formulation for human growth hormone (hGH) has been used in clinical trials. (See Kozarich and Rich, Chemical Biology, 2:548-552 (1998)).
Examples of polymer microsphere sustained release formulations are described in PCT publication WO 99/15154 (Tracy, et al.), U.S. Pat. Nos. 5,674,534 and 5,716,644 (both to Zale, et al.), PCT publication WO 96/40073 (Zale, et al.), and PCT publication WO 00/38651 (Shah, et al.). U.S. Pat. Nos. 5,674,534 and 5,716,644 and PCT publication WO 96/40073 describe a polymeric matrix containing particles of erythropoietin that are stabilized against aggregation with a salt.
In some embodiments, the therapeutic compounds are prepared with carriers that will protect the therapeutic compounds against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Such formulations can be prepared using known techniques. The materials can also be obtained commercially, e.g., from Alza Corporation and Nova Pharmaceuticals, Inc. Liposomal suspensions (including liposomes targeted to specific cells with monoclonal antibodies to cell-specific antigens) can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, as described in U.S. Pat. No. 4,522,811.
The therapeutic compounds can also be formulated to enhance intracellular delivery. For example, liposomal delivery systems are known in the art, see, e.g., Chonn and Cullis, “Recent Advances in Liposome Drug Delivery Systems,” Current Opinion in Biotechnology 6:698-708 (1995); Weiner, “Liposomes for Protein Delivery: Selecting Manufacture and Development Processes,” Immunomethods, 4(3):201-9 (1994); and Gregoriadis, “Engineering Liposomes for Drug Delivery: Progress and Problems,” Trends Biotechnol., 13(12):527-37 (1995). Mizguchi, et al., Cancer Lett., 100:63-69 (1996), describes the use of fusogenic liposomes to deliver a protein to cells both in vivo and in vitro.
Dosage, toxicity and therapeutic efficacy of any therapeutic agent can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD50 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD50/ED50. Compounds that exhibit high therapeutic indices are advantageous. While compounds that exhibit toxic side effects may be used, care should be taken to design a delivery system that targets such compounds to the site of affected tissue in order to minimize potential damage to uninfected cells and, thereby, reduce side effects.
The data obtained from the cell culture assays and animal studies can be used in formulating a range of dosage for use in humans. The dosage of such compounds may be within a range of circulating concentrations that include the ED50 with little or no toxicity. The dosage may vary within this range depending upon the dosage form employed and the route of administration utilized. For any compound used in the methods, the therapeutically effective dose can be estimated initially from cell culture assays. A dose can be formulated in animal models to achieve a circulating plasma concentration range that includes the IC50 (i.e., the concentration of the test compound which achieves a half-maximal inhibition of symptoms) as determined in cell culture. Such information can be used to determine useful doses in humans accurately. Levels in plasma may be measured, for example, by high performance liquid chromatography.
Typically, an effective amount of the ssRNA construct disclosed herein sufficient for achieving a therapeutic or prophylactic effect, range from about 0.000001 mg per kilogram body weight per day to about 10,000 mg per kilogram body weight per day. Suitably, the dosage ranges are from about 0.0001 mg per kilogram body weight per day to about 100 mg per kilogram body weight per day. For example dosages can be 1 mg/kg body weight or 10 mg/kg body weight every day, every two days or every three days or within the range of 1-10 mg/kg every week, every two weeks or every three weeks. In one embodiment, a single dosage of the therapeutic compound ranges from 0.001-10,000 micrograms per kg body weight. In one embodiment, the ssRNA construct concentrations in a carrier range from 0.2 to 2000 micrograms per delivered milliliter. An exemplary treatment regime entails administration once per day or once a week. In therapeutic applications, a relatively high dosage at relatively short intervals is sometimes required until progression of the disease is reduced or terminated, or until the subject shows partial or complete amelioration of symptoms of disease. Thereafter, the patient can be administered a prophylactic regime.
In some embodiments, a therapeutically effective amount of the ssRNA construct may be defined as a concentration of inhibitor at the target tissue of 10−32 to 10−6 molar, e.g., approximately 10−7 molar. This concentration may be delivered by systemic doses of 0.001 to 100 mg/kg or equivalent dose by body surface area. The schedule of doses would be optimized to maintain the therapeutic concentration at the target tissue, such as by single daily or weekly administration, but also including continuous administration (e.g., parenteral infusion or transdermal application).
The skilled artisan will appreciate that certain factors may influence the dosage and timing required to effectively treat a subject, including but not limited to, the severity of the disease or disorder, previous treatments, the general health and/or age of the subject, and other diseases present. Moreover, treatment of a subject with a therapeutically effective amount of the therapeutic compositions described herein can include a single treatment or a series of treatments.
The mammal treated in accordance with the present methods can be any mammal, including, for example, farm animals, such as sheep, pigs, cows, and horses; pet animals, such as dogs and cats; laboratory animals, such as rats, mice and rabbits. In some embodiments, the mammal is a human.
The present disclosure also provides kits comprising any of the foregoing ssRNA construct. Optionally, the above described components of the kits of the present technology are packed in suitable containers and labeled for the prevention and/or treatment of amyotrophic lateral sclerosis or frontotemporal dementia.
The above-mentioned components may be stored in unit or multi-dose containers, for example, sealed ampoules, vials, bottles, syringes, and test tubes, as an aqueous, preferably sterile, solution or as a lyophilized, preferably sterile, formulation for reconstitution. The kit may further comprise a second container which holds a diluent suitable for diluting the pharmaceutical composition towards a higher volume. Suitable diluents include, but are not limited to, the pharmaceutically acceptable excipient of the pharmaceutical composition and a saline solution. Furthermore, the kit may comprise instructions for diluting the pharmaceutical composition and/or instructions for administering the pharmaceutical composition, whether diluted or not. The containers may be formed from a variety of materials such as glass or plastic and may have a sterile access port (for example, the container may be an intravenous solution bag or a vial having a stopper which may be pierced by a hypodermic injection needle). The kit may further comprise more containers comprising a pharmaceutically acceptable buffer, such as phosphate-buffered saline, Ringer's solution and dextrose solution. It may further include other materials desirable from a commercial and user standpoint, including other buffers, diluents, filters, needles, syringes, culture medium for one or more of the suitable hosts. The kits may optionally include instructions customarily included in commercial packages of therapeutic or diagnostic products, that contain information about, for example, the indications, usage, dosage, manufacture, administration, contraindications and/or warnings concerning the use of such therapeutic or diagnostic products.
The kit can also comprise, e.g., a buffering agent, a preservative or a stabilizing agent. The kit can also contain a control sample or a series of control samples, which can be assayed and compared to the test sample. Each component of the kit can be enclosed within an individual container and all of the various containers can be within a single package, along with instructions for interpreting the results of the assays performed using the kit. The kits of the present technology may contain a written product on or in the kit container. The written product describes how to use the reagents contained in the kit. In certain embodiments, the use of the reagents can be according to the methods of the present technology.
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this present invention belongs. Although any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present invention, representative illustrative methods and materials are described herein
All-Atoms Molecular Dynamics Simulations. Peptide structures were built in Avogadro (Hanwell et al., 2012) and the ribosome structure was obtained from Oryctolagus cuniculus (PDB ID: 5LZS) (Shao et al., 2016). All simulations were carried out in GROMACS 5.0.4. (Abraham et al., 2015) using Chemistry at Harvard Macromolecular Mechanics (CHARMM) force field for all-atomistic dynamic simulations that represent all the atoms of the system (Best et al., 2012; Brooks et al., 2009; Denning et al., 2011; MacKerell et al., 1998; MacKerell et al., 2000; Vanommeslaeghe et al., 2010). Force field has been widely used for simulation studies of proteins, peptides and nucleic acids (Babaian et al., 2020; Cook et al., 2020; Kognole and MacKerell, 2020; Suomivuori et al., 2020; Zhu et al., 2012). The experimental system was set up with a constant number of molecules, pressure and temperature, in a 100 mM NaCl environment with TIP3P water (Jorgensen et al., 1983). The simulation box size was set up allowing a margin of 2 nm at each side of the ribosome or of stretched DPR. DPRs simulations were done for 60 ns. Ribosome was simulated for 100 ns. Combined DPR-ribosome systems were set up placing the equilibrated DPR of 50 repeats close to the area of interest of the equilibrated ribosome and simulated for 60 ns. Molecular projections do not show the backbone nor the hydrogens which allows a better visualization of the molecular conformation and side chains. However, the multiple calculations took into account all the molecular components. All visualizations were rendered using Visual Molecular Dynamics (VMD) package (Humphrey et al., 1996).
The following analyses were also carried out using GROMCAS 5.0.4: Rg (radius of gyration)≈peptide extension≈1/folding.
SASA (solvent accessible surface area): Measure the exposure of the molecule to the solvent. AP=SASA(0)/SASA(i); is a normalization to show the tendency of the distinct DPRs to aggregate (AP=1. means fully soluble, AP>1 means aggregated).
RMSD (root mean square deviation) measures deviations in the structure with time respect to a reference structure (the initial conformation). Higher RMSD values involve bigger differences respect to the initial structure. Constant RMSD means stable structures and, hence, reaching a plateau is an indicative of equilibrated simulations.
RMSF (root mean square fluctuations) measures the fluctuations of atoms in nanometers respect to a reference structure in a given time range. Measured through 10 ns in the equilibrated region gives a value of the mobility of atoms. Lower RMSF involves lower mobility and, hence, higher stability of the selected atoms in the reference position.
Simulation Procedure. All the systems were minimized using steepest decent for 50000 steps or until forces on atoms converged below 1000 pN. The systems were equilibrated in NVT ensemble at 300 K for 100 ps, and then in NPT at 300 K and 1 atm for 1 ns, adding constrains in backbone atoms. Simulations were then run for the specified time (100 ns ribosomes and 60 ns DPRs and DPR-ribosome) systems in NPT ensemble. Equilibrations and simulations used 2 fs timestep and periodic boundary conditions in the three spatial coordinates. Verlet cut-off scheme was employed for non-bonded interactions with a cut-off radius of 1.2 nm (shifting van der Waals to zero from 1.0 nm) (Verlet, 1967) and Particle Mesh Ewald for long-range electrostatics (Darden et al., 1993). Temperature was controlled using velocity rescaling algorithm (TT=0.1 pS) (Bussi et al., 2007). Pressure was kept constant using Berendsen algorithm for the NPT equilibration (Berendsen et al., 1984) and Parrinello-Rahman in the simulations (both Tp=2 ps)(Parrinello and Rahman, 1981).
Coarse-Grained Molecular Dynamics Simulations. Aggregation propensities (AP) of the different DPRs were calculated from coarse-grained molecular dynamics simulations using the MARTINI force field (version 2.2) with coil input secondary structure (de Jong et al., 2013; Marrink et al., 2007; Monticelli et al., 2008). This model maps up to 4 heavy atoms to 1 bead in order to speed up the simulations. This force field has been previously employed to measure peptide AP (Frederix et al., 2015; Frederix et al., 2011). The result for each DPR is the average of two independent simulations at same concentration but different simulations size to account for size dependence. Systems were built with constant number of amino acids 1200 or 2400 in a cubic box of 17.1 nm or 21.6 nm of side, respectively. Final concentrations are 22, 11, 7 and 4 mM for 10, 20, 30 and 50 number of repeats, respectively. Simulation procedure. All systems were minimized using steepest descent for 5000 steps or until forces converged below 200 pN. The systems were equilibrated in NPT ensemble at 303 K and 1 atm for 1000 steps using sequentially 1, 5, 10 and 20 fs timestep. Aggregation simulations were then run for 5 μs in the same ensemble with periodic boundary conditions in the three spatial coordinates. A 1.1 nm cut-off was applied for non-bonded interactions using potential-shift for Lennard-Jones and reaction field, with a dielectric constant of 15, for electrostatics (de Jong et al., 2016). V-rescale and Berendsen algorithms were used to keep temperature (TT=1.0 ps) and pressure (Tp=6 ps), respectively, constant (Bussi et al., 2007).
Peptide synthesis. Peptides were synthesized via standard 9-fluorenyl methoxycarbonyl (Fmoc) solid-phase peptide chemistry on Wang resin using a CEM Liberty Blue automated microwave peptide synthesizer.
Automated coupling reactions were performed using 4 eq. of Fmoc-protected amino acid, 4 eq. of N,N′-diisopropylcarbodiimide (DIC), and 8 eq. of ethyl(hydroxyimino)cyanoacetate (Oxyma pure) and removal of Fmoc groups was achieved with 20% 4-methylpiperidine in DMF. Peptides were cleaved from the resin using standard solutions of 95% TFA, 2.5% water, 2.5% triisopropylsilane (TIS) and then precipitated with cold ether to yield the crude peptide product. The crude product was purified by preparative reverse-phase high-performance liquid chromatography (RP-HPLC) using a Phenomenex Kinetex column (C18 stationary phase, 5 μm, 100 Å pore size, 30×150 mm) on a Shimadzu model prominence modular HPLC system equipped with a DGU-20A5R degassing unit, two LC-20AP solvent delivery units, a SPD-M20A diode array detector and a FRC-10A fraction collector, using H2O/CH3CN gradient containing 0.1% CF3COOH (v/v) as an eluent at a flow rate of 25.0 mL/min.
Liquid Chromatography-Mass Spectrometry (LC-MS). Analytical RP-HPLC was performed at 40° C. using a Phenomenex Jupiter 4 μm Proteo 90 Å column (C12 stationary phase, 4 μm, 90 Å pore size, 1×150 mm) on an Agilent model 1200 Infinity Series binary LC gradient system, using H2O/CH3CN gradient containing 0.1% CF3COOH (v/v) as an eluent at a flow rate of 50 μL/min. Electrospray ionization mass (ESI-mass) spectrometry was performed in positive scan mode on an Agilent model 6510 Quadrupole Time-of-Flight LC/MS spectrometer using direct injection.
Optical Density measurements. Optical density (O.D.) measurements were performed on a BioTek model Cytation 3 cell imaging multi-mode reader.
Circular Dichroism (CD). CD spectra were recorded in a Jasco J-815 spectropolarimeter using quartz cells of 100 μm pathlength. Spectra were background subtracted and are the average of three scans using continuous scanning mode at a speed of 100 nm/min and standard sensitivity. Final spectra are normalized to concentration.
Fourier-transform infrared spectroscopy (FTIR). FTIR spectra were recorded on a Bruker Tensor 37 FTIR spectrometer. Spectra shown are the average of 25 scans with a resolution of 1 cm-1. Samples were prepared in deuterated water (D2O) to displace its vibrations from the region of interest. Liquid samples were placed between two CaF2 windows with 50 μm pathlength and background subtracted using the solvent. Solid FTIR was measured using attenuated total reflectance (ATR) module on lyophilized samples and using background subtraction to remove signals from atmospheric H2O and CO2.
RNA-dipeptide repeats binding assay. The RNA solutions were diluted with HEPES buffer ([phosphate]=200 μM) and incubated for 30 min at 25° C. A HEPES buffer solution of dipeptide repeats (10 mM) was then added to the RNA solutions, and the mixture was pipetted 30 times. 50 μL of these suspensions were put into triplicate wells of a 96-well plate, and their optical density at 600 nm were recorded.
Estimation of the content of phosphates in the RNA sample. The content of phosphates in the RNA sample was estimated based on assumptions that the RNA is 100% pure and its counter cation is sodium. Molecular weight of the RNA repeating unit (343.43 g/mol) was calculated by averaging the molecular weights of adenine (351.19 g/mol), guanine (367.19 g/mol), cytosine (327.17 g/mol) and uracil (328.15 g/mol). As the concentration of RNA was shown to be 5.4 μg/μL, the concentration of phosphates was therefore estimated to be 15.7 mM.
Cell cultures and DPR overexpression system. HEK-293FT cells were grown in DMEM (Corning) supplemented with Glutamax (Gibco) and 10% fetal bovine serum (FBS, Gibco). HEK-293FT cells were dissociated by incubating for 5 min with Trypsin-EDTA (Gibco) at 37° C. Cells were maintained at 37° C., 5% CO2 without antibiotics and tested on a monthly basis for mycoplasma.
For overexpression experiments, 40% confluent HEK-293 cells were transfected with HilyMax transfection reagent (Dojindo Molecular Technologies) according to manufacturer guidelines. Briefly, DNA was mixed with HilyMax (1 μg DNA:3 μL HilyMax ratio) in Opti-MEM medium (Gibco) and incubated for 15 min at room temperature (RT) before being added to cells. Cells were incubated with transfection mixture for 4 hrs at 37° C. and then media was replaced. Analyses made on transfected cells were performed 48 to 72 hrs after transfection. For overexpression experiments, 40% confluent HEK-293 cells were transfected with HilyMax transfection reagent (Dojindo Molecular Technologies) according to manufacturer guidelines. Briefly, DNA was mixed with HilyMax (1 μg DNA:3 μL HilyMax ratio) in Opti-MEM medium (Gibco) and incubated for 15 min at room temperature (RT) before being added to cells. Cells were incubated with transfection mixture for 4 hrs at 37° C. and then media was replaced. Analyses made on transfected cells were performed 48 to 72 hrs after transfection.
Plasmids. HEK-293 cells were transfected with the pcDNA3.1 plasmid containing GFP, (GP)×10-, or (GR)×50-GFP, in which alternative codons were used to generate DPRs without generating the (GGGGCC)n transcript. These constructs were made and kindly shared by Petrucelli's lab (Zhang et al., 2014).
CLIP-Seq. CLIP experiments were performed according to Huppertz et. al. (Methods. 2014 February; 65(3): 274-287. doi: 10.1016/j.ymeth.2013.10.011). Briefly, cells were crosslinked in a Spectroline UV crosslinker using 100 J/cm2 UVC (254 nm). Cells were lysed in 50 mM Tris-HCl pH 7.4, 150 mM NaCl, 1% NP-40, 0.5% sodium deoxycholate, 0.1% SDS with EDTA-free complete mini protease inhibitor cocktail (Roche) and 1 mM phenylmethylsulfonyl fluoride (PMSF). After sonicating on ice using a Branson sonifier, lysates were incubated with 4 U/ml Turbo DNase (Invitrogen) and 0.2 to 0.002 units/ml of RNase I (Invitrogen). Immunoprecipitation was performed by incubating the lysates with GFP-Trap Magnetic beads (Chromotek cat: gtd-10) for 1.5 hours at 4° C. Afterwards, beads were washed twice with high salt buffer (50 mM Tris-HCl pH 7.4, 1 M NaCl, 1% NP-40, 0.5% sodium deoxycholate, 0.1% SDS) and twice with PNK buffer (20 mM Tris-HCl pH 7.4, 10 mM MgCl2, 0.2% Tween-20). RNA 3′ ends were dephosphorylated with PNK as described (Huppertz et al.), followed by two washes each with high salt and PNK buffers. 3′ linker ligation was performed on beads overnight at 16° C. followed by two additional washes each with high salt and PNK buffer. After labeling with [γ-32P]-ATP and T4 RNA ligase, RNPs were resolved on NuPAGE 4-12% Bis-Tris gels (Invitrogen) run in NuPAGE MOPS-SDS running buffer (Invitrogen). After gel fractionation, RNPs were transferred to Amersham Protran 0.45 uM nitrocellulose membranes (Cytiva) and labeled complexes visualized using a storage phosphor screen and developed on a Typhoon FLA 9000 scanner. RNA-protein complexes of the expected size were excised from the nitrocellulose membranes, along with the same size region from GFP, GFP-(GP)10, or untransfected control experiments. Associated proteins were removed by digesting with 1 mg/ml proteinase K (Invitrogen) for 20 minutes at 37° C. in PK buffer (100 mM Tris-HCl pH7.4, 50 mM NaCl, 10 mM EDTA) followed by a second digestion for 20 minutes at 37° C. in the presence of 3.5 M urea. Afterwards, RNA was extracted with phenol chloroform and reverse transcription performed using Superscript III (Invitrogen) using the following primers: library 1 GPF—Rt1clip, GFP-(GR)50—Rt6clip; library 2 untransfected—Rt1clip, GFP-(GP)10—Rt6clip, GFP-(GR)50—Rt9clip. cDNA was size selected and circularized with Circligase II (Epicentre). Circularized cDNA was cut with BamHI and amplified using Accuprime Supermix I (Invitrogen). The PCR cycle number was optimized to prevent over amplification of the library. Amplified samples were sequenced on the Illumina MiSeq platform in single end read mode with 110 nt reads.
CLIP-Seq bioinformatics. For mapping to the whole genome, barcoded sequencing libraries were demultiplexed allowing 1 nt barcode mismatch, and adapter sequences and low-quality bases were filtered using iCount (version 2.0) (https://github.com/tomazc/iCount). Trimmed, single-end reads were aligned to the hg38 genome (Gencode V32) using Novoalign (version 4.03.03). Parameters for alignment included: score threshold (-t) set to 15.3, the minimum number of bases for alignment (-l) set to 20, the gap penalty (-x) set to 4, gap opening penalty (-g) set to 20, trimming step size (-s) set to 1, score difference (-R) set to 0 and multimapping reporting (-R) set to ALL. The quality of the sequenced libraries was assessed per sample using FastQC (version 0.11.5) https://www.bioinformatics.babraham.ac.uk/projects/fastqc/, FastQ Screen (version 2) (Wingett and Andrews, 2018) and samtools (version 1.13) (Li et al., 2009). Samples were deduplicated using UMI-tools (Smith et al., 2017), with multi-mapping detection. On average 5.33 unique UMIs were detected per position.
To determine the location of CLIP peaks, overlapping reads were collapsed to create a list of genomic regions using bedtools (version 2.30.0) (Quinlan and Hall, 2010). Peaks found within 50 nt of one another were combined to a single feature. Reads associated with CLIP peaks were counted using FeatureCounts (version 2.0.2) (Liao et al., 2014) with the following parameters: the number of reads supporting each exon-exon junction was included, the minimum number of overlapping bases in a read required for assignment as 1, and strand specific read counting was performed. Analysis was performed without multi-mapped reads (unique reads only) and with multi-mapped reads included (unique+multi-mapped reads). Multi-mapped reads were assigned a fractional count of 1/x, where x is the total number of alignments reported for the same read. CLIP peaks with >5 unique+fractional multi-mapped reads were annotated with overlapping genomic features. Protein coding and ncRNA features were identified from the Gencode hg38 V32 while ncRNA and repeat regions were identified from hg38/GRCh38 Repeatmasker annotations and rRNA annotations were identified from RefSeq GRCh38.p13 (GCF_000001405.39). Representative peaks with multiple annotations were initially examined manually to determine the correctness of the annotations. Based on this analysis, preference was given to annotations as follows: rRNA>ncRNA>protein coding: exon>repeat element>pseudogene>lncRNA: exon>antisense feature>protein coding: intronic>lncRNA: intronic>no feature.
To identify specific sites of RNA binding, MAnorm (version 1.1.4) (Shao et al., 2012) was used to identify enriched CLIP peaks in GFP-(GR)50 vs GFP samples. Default parameters were used except for the following: shift size for both inputs (--s1,--s2,) was set to 0 to keep the peak binding site at the 5′ end and the summit-to-summit distance cutoff for common peaks (-d) was set to 25 to ensure only overlapping peaks between samples were compared. 10,000 simulations (-n) were performed to test enrichment. CLIP peaks with a fold-change >2 and a p-value <0.05 were identified as significant binding events.
For mapping to the RNA45SN1 locus, PCR duplicates were removed by collapsing identical sequences using the FastX_collapser. PhiX spike in control reads were removed by mapping to Coliphage phi-X174, complete genome (NCBI Reference Sequence: NC_001422.1). The remaining reads were demultiplexed based on barcodes using FastX_splitter, then adapter and UMI sequences were removed with fastX_trimmer and fastX_clipper, respectively (Fastxtoolkit version 0.0.14) (http://hannonlab.cshl.edu/fastx_toolkit/). Bowtie2-build was used to generate a genomic index from the RNA45SN1 (NC_000021.9) sequence. Reads were mapped to this index using Bowtie2 (version 2.4.4) (http://bowtie-bio.sourceforge.net/bowtie2/index.shtml) with the -- very-sensitive-local option. Unmapped reads were extracted using Samtools-view. These unmapped reads were then mapped to the hg38 human genome using STAR. Reads mapping to 45S were counted based on the regions with which they overlapped. Bedtools intersect was used to count reads in the various regions. For precursor regions (5′ETS, ITS1, ITS2 and 3′ETS) reads with at least one nucleotide in these regions were counted. For mature rRNA regions (18S, 5.8S and 28S) only reads mapping entirely within these regions were counted. The percentage of reads mapping to each region were represented as a percentage of the total collapsed read number.
RNA immunoprecipitations (RIP) followed by detection of RNAs by Northern blot (NB) and RT-qPCR. HEK-293 cells expressing GFP- or GFP-(GR)50 were lysed in NET-2 (50 mM Tris pH 7.5, 150 mM NaCl, 2.5 mM MgCl2, 0.5% NP-40) and 1 mM phenylmethylsulfonyl fluoride (PMSF). After sonicating in a Bioruptor Plus on high (30 seconds on, 30 seconds off) for 1 minute at 4 C, lysates were sedimented at 16,000×g for 10 minutes. Cleared lysates were incubated with 25μ of GFP-Trap magnetic beads for 1.5 hours at 4 C with rotation. Beads were washed twice in NET-2, transferred to a fresh tube and washed two additional times. Beads were resuspended in 400 ul NET-2 and extracted with an equal volume of acid-phenol:chloroform (Invitrogen AM9722). After centrifugation at 16,000×g for 15 minutes, RNA was precipitated from the aqueous phase by adding 1/10th volume sodium acetate and 2.5 volumes 100% ethanol. After precipitation, RNA was fractionated in a 5% polyacrylamide/7M urea gel (to detect RNAs of less than 500 nts) or an 0.8% agarose/formaldehyde gel using the Tricine/Triethanolamine buffer system described by (Mansour and Pestov, 2013) to detect larger RNAs. RNA was transferred from polyacrylamide gels to Hybond-N (Cytiva) in 0.5×TBE for 16 hours at 150 mA. RNA was transferred from agarose gels to Hybond-N by capillary transfer overnight using 10×SSC (1.5 M NaCl, 150 mM sodium citrate pH 7). RNA was crosslinked to membranes using a Spectroline UV crosslinker and hybridized in modified (Church and Gilbert, 1984) hybridization buffer (1% BSA, 2 mM EDTA, 200 mM NaHlPO4 pH 7.2, 15% DI formamide, 7% SDS) using 5′-32P labeled oligonucleotides at 28 C. Northern probe sequences used in this study:
For RT-qPCR analyses, the RNA was reverse transcribed using the iSCRIPT cDNA Synthesis Kit (Bio-Rad) and qPCR was performed using iTaq Universal SYBR Green Supermix (biorad). Samples were run on a Bio-Rad CFX96 Real Time PCR System and analyzed using Maestro software (Bio-Rad).
Primer sequences used in this study:
Immunoprecipitation (IP) followed by western blot (WB) analysis. Cells were harvested in IP buffer (10 mM Hepes pH 7.6, 100 mM NaCl, 1 mM EDTA, 1 mM NaF, 2 mM Na3VO4, 1 mM DTT, 1 mM PMSF, 1% sodium deoxycholate, 10% glycerol, 0.1% SDS, 1% Triton X-100 and 1× protease inhibitor cocktail). Lysates were sonicated and protein concentrations determined with a BCA kit (Pierce). GFP and GFP-tagged proteins were immunoprecipitated from 1 mg of protein/sample with anti-GFP antibody (Abcam). Immunoprecipitation of the target antigen was performed using Dynabeads® Protein A (Novex, life technologies) following the manufacturer's protocol (www.thermofisher.com/document-connect/document-connect.html?url=https%3A%2F%2Fassets.thermofisher.com%2FTFS-Assets%2FLSG%2Fmanuals%2FDynabeadsProteinA_man.pdf&title=RHluYWJlYWRzI FByb3Rl aW4gQQ==). Eluted proteins were separated by SDS-PAGE followed by electrotransfer to a nitrocellulose membrane (Bio-Rad). The membranes were blocked in Tris-buffered saline (TBS, 50 mM Tris, 150 mM NaCl, HCl to pH 7.6)+0.1% Tween 20 (Bio-Rad)+5% non-fat dry milk (LabScientific) and incubated overnight at 4° C. with primary antibodies: GAPDH (rabbit, 1:1000, Cell Signaling), GFP (goat, 1:1000, Abcam), RPL7A (rabbit, 1:1000, Cell Signaling Technology). Primary antibodies were diluted in TBS+0.1% Tween+5% BSA (Calbiochem). After several washes in TBS+0.1% Tween, membranes were incubated with their corresponding secondary HRP-conjugated antibodies (1:5000, LI-COR Biotechnology). Protein signals were detected by a ChemiDoc™ XRS+ (Bio-Rad), using the SuperSignal West Pico chemiluminescent system (Thermo Scientific).
Immunocytochemistry. Cells were fixed with 4% paraformaldehyde for 20 min, washed with PBS and permeabilized/blocked for 1 h in PBS containing 10% normal donkey serum (Jackson ImmunoResearch) and 0.2% Triton. Samples were then incubated overnight at 4° C. with primary antibodies: puromycin (mouse, 1:5000, Millipore), rRNA (mouse, 1:1000, Novus Biologicals), fibrillarin (rabbit, 1:2000, Abcam), NPM1 (mouse, 1:500, Santa Cruz Biotechnology). The next day, PBS+0.1% Triton was applied for several washes. Samples were then incubated with the appropriate secondary antibodies conjugated to Alexa488, Alexa555 or Alexa647 fluorophores (1:500 to 1:1000 Molecular Probes) for 1 h at RT. Cell nuclei were labeled using Hoechst 33342 (Life Technologies) to stain DNA. Immunolabeled samples were blinded upon mounting for subsequent imaging analysis.
De novo protein translation analysis. For single-cell protein translation analysis, we utilized a puromycin-based method termed SUnSET (Schmidt et al., 2009) that labels newly synthesized proteins. In short, cell cultures were pulsed for 5-10 min with puromycin (20 μM) at 37° C. Cells were then fixed and immunocytochemistry with anti-puromycin antibody was carried out as described above.
rRNA bait design. We design 20 nucleotide RNA baits based on the (GR)50-interacting 28S rRNA sequence identified by CLIP-Seq (
Quantitative image acquisition and analysis. Images used for quantification were acquired at matched exposure times or laser settings and processed using identical settings. Quantifications were normalized within each respective experiment with n≥3 independent experiments unless otherwise specified in figure legends. Image acquisition for HEK-293 experiments was performed on a Leica DMI4000B laser scanning confocal microscope (Leica, Buffalo Grove, IL) or with Leica DMi8 microscope (Leica, Buffalo Grove, IL) using a C10600-ORCA-R2 digital CCD camera (Hamamatsu Photonics, Japan), and processed with Fiji. For high-resolution images and 3D reconstructions Nikon W1 Dual CAM spinning Disk and Imaris Cell Imaging software were used.
Quantification and statistical analysis. All statistical analyses were done with Prism 7 software (GraphPad Software). Individual values were usually displayed by dots in the graphs, and represent all values measured in the study. The sample size (n) of each specific experiment are provided in the results section and the statistical test performed for each specific experiment is defined in the corresponding figure legend. For each statistical analysis, we first tested whether sample data fit into Gaussian distribution using the D'Agostino-Pearson omnibus normality test. To compare two experimental conditions, either a student's t test (parametric) or a Mann-Whitney U test (non-parametric) was performed. To compare ≥3 experimental conditions, either a One-Way or Two-Way ANOVA followed by a Bonferroni post-hoc test (parametric) or a Kruskal-Wallis rank test followed by a two-stage linear step-up procedure of Benjamini, Krieger and Yekutieli (non-parametric) was performed.
To interrogate the role of RNA in DPR pathophysiology we first characterized the structural and chemical features of (R)-DPRs. We specifically examined the secondary structure of the R-rich, highly toxic poly-GR and poly-PR by all atoms molecular dynamics (MD) simulations using CHARMM force field (
We next asked how the number of repeats would impact the structure of the DPRs using MD simulations. Ramachandran plots of both GR and PR with 10 (SEQ ID NOS 50 and 53, respectively), 20 (SEQ ID NOS 51 and 16, respectively), 30 (SEQ ID NOS 52 and 9, respectively) and 50 (SEQ ID NOS 17 and 18, respectively) repeats showed the same secondary structure patterns, irrespective of length (
Previous studies have suggested that R-DPRs can bind to RNA molecules through ionic and cation-pi interactions (Boeynaems et al., 2017; Kanekura et al., 2016; White et al., 2019). Thus, we sought to assess whether the differential physicochemical properties of poly-GR and poly-PR DPRs would impact their binding to RNA molecules. We first incubated total human RNA with synthetic DPRs in vitro and measured optical density as an indicator of RNA-DPR interaction and aggregation (
We next sought to identify the RNAs bound by poly-GR in vivo. We focused our analysis on poly-GR since it is more abundant than poly-PR in C9-ALS/FTD patient tissue (Gendron et al., 2013; Gomez-Deza et al., 2015; Mackenzie et al., 2015; Mori et al., 2013), and its abundance has been associated with affected brain areas in patients (Saberi et al., 2018). We used cross-linking immunoprecipitation followed by high-throughput sequencing (CLIP-Seq) (Darnell et al., 2018) to identify targets of poly-GR on a transcriptome-wide scale. In CLIP-Seq, UV light is used to cross-link proteins to RNAs that are in direct contact in vivo. After immunoprecipitating the protein of interest and harsh washing to remove noncovalently associated RNA, cDNA is prepared from the cross-linked RNA and sequenced (
Human rDNA exists as hundreds of copies of tandem repeats on five chromosomes (Potapova and Gerton, 2019). Although these repeats are not included in the assembled hg38 genome, five complete rDNA sequences that exist outside these clusters are included (RNA45SN1-5). Additionally, the genome is littered with divergent and truncated rRNA sequences that do not code for bonafide rRNA (Lander et al., 2001). Thus, to simplify quantification of the rRNA-derived reads, we remapped data from the CLIP experiments to a single full-length rDNA sequence, the RNA45SN1 locus (NCBI Accession NR 146117.1). We found that 69% and 81% of the total reads aligned to rDNA for the GFP-(GR)50 libraries (
Since the production of mature rRNA involves a complex series of processing steps that occur almost entirely within nuclei, the GFP-(GR)50 CLIP peaks that we detected mapping to the 28S and 5.8S sites in the rDNA could be derived from nuclear precursors such as 47S, 45S, 30S, or 32S, and/or the mature cytoplasmic forms (5.8S, 28S) (
Collectively, these results demonstrate that poly-GR binds to multiple rRNA species, including precursors found in the nucleolus and mature RNAs found in both the nucleolus and within fully assembled cytoplasmic ribosomes (
The identification of rRNA as a binding partner for poly-GR in vivo is well aligned with previous mass spectrometry (MS)-based studies, that have consistently uncovered ribosomal proteins as GR interactors after immunoprecipitation (
Based on this converging evidence from proteomic and transcriptomic experiments we established an in-silico model and mapped one, of likely many regions that poly-GR can bind to, on the surface of the ribosome (
Collectively, our data indicate that the physicochemical properties of poly-GR promote strong interactions with RNA, while independent transcriptomic and proteomic analysis suggest that GR-DPR can interact with multiple ribosomal RNA species and protein subunits (
To test this hypothesis, we used the 28S rRNA sequence that was highly enriched in our CLIP-Seq experiments and designed an oligonucleotide RNA bait with 2′-O-methyl modifications in both the 5′ and 3′ ends to enhance its stability and binding properties (
We next interrogated the effects of the 28S bait on a neuronal model of poly-GR toxicity. We differentiated healthy control iPSCs into spinal motor neurons (MNs) using a well characterized protocol (Ziller et al., 2018), and transduced the cultures with a lentivirus expressing GFP or GFP-(GR)50. We used live cell imaging analysis to track individual neurons over the course of 90 days and found that poly-GR overexpressing MNs exhibited significantly reduced survival relative to GFP-expressing MNs (n=221 GFP MNs; and n=223 GFP-(GR)50 MNs; 8-10% reduction, p=0.0038) (
Lastly, to assess the ability of the rRNA bait molecule to ameliorate poly-GR toxicity in an intact nervous system in vivo, we utilized two Drosophila models of poly-GR overexpression (
The discovery of the C9-HRE as the most prevalent genetic driver of ALS/FTD has stimulated intense interest in deciphering the pathophysiology associated with this mutation. Several studies have shown that C9-DPR proteins have detrimental effects in cellular systems and model organisms (Choi et al., 2019; Freibaum et al., 2015; Hao et al., 2019; Hartmann et al., 2018; Jovicic et al., 2015; Kwon et al., 2014; Lee et al., 2016; Mizielinska et al., 2014b; Tao et al., 2015; Wen et al., 2014; Zhang et al., 2018b; Zhang et al., 2019). We combined computational and experimental approaches to better understand how the interaction of R-DPR proteins with RNA contributes to their toxicity. We found that poly-GR directly binds to multiple rRNA species in cells and impedes ribosomal homeostasis. We showcased the strength of the poly-GR/rRNA interaction by using a custom rRNA-based oligonucleotide, which prevented the malignant effects of poly-GR on ribosomal localization and function. These findings reinforce the importance of ribosomal impairment in C9-ALS/FTD and highlight a novel approach for protecting against R-DPR pathological mechanisms.
The characterization of the physicochemical features of poly-GR and poly-PR underscored a number of similarities, as well as critical structural differences that likely define their localization, molecular interaction profile and toxic potential. Poly-GR acquires a random coiled conformation, while poly-PR is highly enriched in β-sheets because of the higher rigidity of prolines compared to glycines. This secondary configuration confers a more stretched conformation, allowing more pronounced exposure of positive charges and a distinct adaptability to interact with complex molecular geometries such as the ones that are required during phase separation (Boeynaems et al., 2017; Flores et al., 2016; Jafarinia et al., 2020; Kanekura et al., 2018; Lee et al., 2016). While the particular size of native DPR proteins produced in physiological models remains unknown, our analysis suggests that their structural features are principally maintained irrespective of repeat number. This finding supports the notion that C9-HRE toxicity is threshold dependent and does not strongly correlate with repeat size (Cammack et al., 2019; Gendron et al., 2017; Gijselinck et al., 2016; Suh et al., 2015; van Blitterswijk et al., 2013).
Our work strongly suggests that poly-GR compromises ribosomal homeostasis and impedes the ability of ribosomes to mediate protein translation. While the precise mechanism of translation inhibition remains unclear, we specifically observed that poly-GR affected the subcellular distribution of rRNA, leading to a high N/C ratio. We hypothesize that this effect is likely the result of poly-GR binding to multiple rRNA species found in both the nucleus and the cytoplasm. This finding is well-aligned with previously described defects in ribosomal biogenesis in the nucleus and protein translation in the cytosol (Hartmann et al., 2018; Kwon et al., 2014; Lee et al., 2016; Moens et al., 2019; Wen et al., 2014; White et al., 2019; Zhang et al., 2018a). Although this rRNA shift could also be attributed to a previously described interaction of R-DPRs with nuclear pore proteins (Jovicic et al., 2015; Lee et al., 2016; Shi et al., 2017; Zhang et al., 2018b), the effects of these interactions on nucleocytoplasmic transport of rRNA-protein complexes remain unclear (Hayes et al., 2020; Vanneste et al., 2019; Zhang et al., 2018a).
CLIP-Seq analysis revealed that rRNA was the major RNA target of poly-GR in cells. While the potential for R-DPRs to interact with negatively charged molecules such as RNA had been established (Boeynaems et al., 2017; Boeynaems et al., 2019; Jafarinia et al., 2020; Kanekura et al., 2016; White et al., 2019), the identity of interacting RNAs in vivo was not known. The fact that rRNA was the predominant target correlates with the localization of ˜40% of all poly-GR in the nucleolus (
Research studies around the C9 mutation have highlighted the non-canonical translation of DPR proteins as a pathway that can be targeted therapeutically. While there are several efforts focused on identifying the molecular factors that specifically mediate the production of all DPR proteins (Cheng et al., 2018; Cheng et al., 2019; Green et al., 2017; Moens et al., 2019; Sonobe et al., 2018; Tabet et al., 2018; Westergard et al., 2019; Yamada et al., 2019), this may prove challenging. Alternatively, individual DPRs can be targeted by specific antibodies (Nguyen et al., 2020; Zhou et al., 2017), or as we propose here, by RNA oligonucleotides. The identification of a specific RNA target that natively interacts with poly-GR provided us with a unique opportunity to design a bait ribonucleotide molecule and assess its ability to protect cells by sequestering away poly-GR from its pathological interactions. Indeed, this molecule restored ribosomal homeostasis in (GR)50-transfected cells. While we did not evaluate the potential of the bait to block poly-PR associated defects, our computational models suggest it likely will (
The mitigating effects of RNA molecules have been recently explored in the context of other ALS/FTD model systems. Specifically, total RNA has been shown to alter the phase transition of C9 R-DPRs (Boeynaems et al., 2017; Boeynaems et al., 2019), as well as to alleviate some of the pathophysiological mechanisms associated with R-DPR overexpression (Hayes et al., 2020). Moreover, RNA oligonucleotides of known TDP-43 target sequences can prevent inclusions and rescue mutant TDP-43 neurotoxicity (Mann et al., 2019). Although more work is required to understand how the binding of the 28S rRNA bait to poly-GR alleviates its pathophysiology, the promising results we present here support the notion that using bait RNAs is not only useful to study RNA-protein interactions (Jazurek et al., 2016), but also to protect neurons from the detrimental effects of mutant or aberrant proteins (Odeh and Shorter, 2020).
This application is the U.S. National Stage of PCT/US2022/051249, which claims the benefit of the priority date of U.S. provisional application, 63/284,485, filed Nov. 30, 2021, the contents of which are incorporated herein by reference in their entirety.
This invention was made with government support under grant number NS104219 awarded by National Institutes of Health (NIH). The government has certain rights in the invention.
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/US2022/051249 | 11/29/2022 | WO |
| Number | Date | Country | |
|---|---|---|---|
| 63284485 | Nov 2021 | US |
