Patent Application
20250163468
The present inventions provide systems and methods for engineering adeno-associated virus (AAV) to create covalently surface modified adeno-associated virus species using in vitro conjugation, and methods of purifying such covalently surface modified adeno-associated viruses from unconjugated retargeting molecule species.
This application contains a Sequence Listing which has been submitted electronically in .XML format and is hereby incorporated by reference in its entirety. The .XML copy, created on Nov. 8, 2024, is named “11547.xml” and is 334,915 bytes in size. The sequence listing contained in this .XML file is part of the specification and is hereby incorporated by reference herein in its entirety.
Adeno-associated virus (AAV) is a non-enveloped, single-stranded DNA virus and is used as a gene delivery vector for both research and therapeutics. Weitzman and Linden, Adeno-Associated Virus Biology (chapter 1), Meth. Molec. Biol. 807: 1-23 (2011). There are numerous AAV serotypes and variants thereof. AAV serotypes include, for example, AAV1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, rh74, as well as variants thereof. AAV serotypes share common properties, structure, and genomic sequence and organization. See, for example, Issa et al, Cells 12: 285 (2023); Goedeker et al., Ther. Adv. Neurol. Disord. 16: 1-7 (2023).
Gene transfer vectors based on AAV have demonstrated promise for human gene therapy based on their safety profile and potential to achieve long-term efficacy in animal models. Wang et al., Nature, 18: 358-78 (2019). A major challenge for advancing AAV-based therapies into clinical development is the difficulty and cost of producing sufficient quantities of AAV through transient methodologies. Additionally, recombinant AAVs containing genes of interest (GOIs), but lacking surface modifications, are currently being used in preventative and therapeutic capacities, such as in vaccines and in gene therapy. However, such AAVs have limited tissue specificity and a propensity to accumulate in the liver.
The wild type AAV genome includes a capsid gene referred to as “Cap” or “cap”. Cap in nature is translated to produce, via alternative start codons and transcript splicing, three size-variant structural proteins referred to as VP1 (about 90 kDa), VP2 (about 72 kDa) and VP3 (about 60 kDa). An AAV capsid contains 60 subunits total of the VP proteins. A ratio of 1:1:10 is considered the most typical ratio for VP1:VP2:VP3, with a stoichiometry of 5 VP1 subunits:5 VP2 subunits:50 VP3 subunits. However, there can be variation. Wömner et aL., Nature Communications 12:1642 (2021).
Recombinant AAV (rAAV) has been produced in HEK 293, HeLa BHK, human amniotic (for example, epithelial cells such as HAEpiC), CHO and Sf9 lines, for example. First generation rAAV was comprised of a GOI replacing the AAV Cap and Rep genes. The GOI would be flanked by AAV inverted terminal repeats (ITRs) so that the GOI could be packaged within an AAV capsid.
Covalently surface modified AAVs have been produced. See WO 2019/006046. However, there exists a need to address by-products, such as excess unconjugated retargeting molecule species, that will exist freely as contaminants. The present invention provides production and purification solutions.
Many potential gene therapy applications would benefit from cell/tissue-specific retargeting and detargeting that is beyond current AAV vector control capabilities. The current inventions advantageously employ covalently surface modified AAV for retargeting. Additionally, according to the inventions, mutations optionally can be introduced into the AAV Cap proteins to detarget tissues and organs, such as the liver.
The inventions provide methods of producing covalently surface modified adeno-associated virus (AAV) using in vitro conjugation, wherein the method comprises the steps of (1) combining recombinant AAV with retargeting molecules in a ratio selected to achieve a desired level of conjugation; and (II) incubating the AAV and retargeting molecules for a period of time and under conditions to achieve the desired level of conjugation. The recombinant AAV can obtained by (A) transfecting a cell with: (1) a plasmid comprising a gene of interest flanked by AAV inverted terminal repeats; (2) a plasmid comprising an AAV rep gene and an AAV cap gene; (3) a plasmid comprising AAV rep and cap genes and a polynucleotide sequence encoding a first member of a specific binding pair; and (4) a plasmid comprising adenovirus helper genes E4 and E2, and VA RNA; (B) culturing the transfected cell from step (A) to allow expression of plasmids (1) to (4) and assembly of proteins formed by the expression of plasmids (1) to (4); and (C) harvesting the recombinant AAV. The cell can be a mammalian cell, such as a human cell. Other viruses can be the source of helper polynucleotide sequences encoding helper products, such as herpes simplex virus (UL5, UL8, UL9, UL29, UL30, UL42 and UL52 polynucleotides), human papilloma virus (E1 or E1 carboxyl domain polynucleotides), bocavirus or baculovoirus.
The inventions also provide methods of producing covalently surface modified adeno-associated virus using in vitro conjugation, wherein the method comprises the steps of (1) combining recombinant AAV (rAAV) with retargeting molecules in a ratio selected to achieve a desired level of conjugation; (II) incubating the AAV and retargeting molecules for a period of time and under conditions to achieve the desired level of conjugation. The rAAV is obtained by (A) transfecting a cell with: (1) a plasmid comprising a gene of interest flanked by adeno-associated virus (AAV) inverted terminal repeats; (2) a plasmid comprising an AAV rep gene and an AAV cap gene; (3) a plasmid comprising AAV rep and cap genes and a polynucleotide sequence encoding a first member of a specific binding pair; and (4) a plasmid comprising one or more helper polynucleotide sequences; (B) culturing the transfected cell from step (A) to allow expression of plasmids (1) to (4) and assembly of proteins formed by the expression of plasmids (1) to (4); and (C) harvesting the recombinant AAV. The cell can be a mammalian cell, such as a human cell. The recombinant AAV can comprise a gene of interest. The recombinant AAV can comprise a recombinant capsid protein. The recombinant capsid protein can comprise an amino acid sequence of a first member of a specific binding pair, such as SpyTag. The retargeting molecule can be bound to a second cognate member of a specific binding pair, such as SpyCatcher or fragments/derivatives thereof. The retargeting molecule can be an Fc-containing protein, such as a monoclonal antibody, or an Fc-Fusion protein, or a monoclonal antibody fragment, or any molecule containing an antigen-binding region.
According to the methods of the inventions, the ratio of AAV with FM (First Member) to retargeting molecule with SCM (Second Cognate Member) is 1:20 or a greater ratio difference, for example about 1:30 to about 1:300, about 1:300 to about 1:1000 or about 1:30 to about 1:1000. The populations of FMs and SCMs can be homogenous or heterogeneous as long as the selected FMs can come in contact with appropriate SCMs so that binding can occur.
Preferred levels of molar ratios of AAV-FM to RM-SCM as follows: 1:20, 1:25, 1:30, 1:35, 1:40, 1:45, 1:50, 1:55, 1:60, 1:65, 1:70, 1:75, 1:80, 1:85, 1:90, 1:95, 1:100, 1:105, 1:110, 1:115, 1:120, 1:125, 1:130, 1:135, 1:140, 1:145, 1:150, 1:155, 1:160, 1:165, 1:170, 1:175, 1:180, 1:185, 1:190, 1:195, 1:200, 1:205, 1:210, 1:215, 1:220, 1:225, 1:230, 1:235, 1:240, 1:245, 1:250, 1:255, 1:260, 1:265, 1:270, 1:275, 1:280, 1:285, 1:290, 1:295, 1:300, 1:305, 1:310, 1:315, 1:320, 1:325, 1:330, 1:335, 1:340, 1:345, 1:350, 1:355, 1:360, 1:365, 1:370, 1:375, 1:380, 1:385, 1:390, 1:395, 1:400, 1:405, 1:410, 1:415, 1:420, 1:425, 1:430, 1:435, 1:440, 1:445, 1:450, 1:455, 1:460, 1:465, 1:470, 1:475, 1:480, 1:485, 1:490, 1:495, 1:500, 1:505, 1:510, 1:515, 1:520, 1:525, 1:530, 1:535, 1:540, 1:545, 1:550, 1:555, 1:560, 1:565, 1:570, 1:575, 1:580, 1:585, 1:590, 1:595, 1:600, 1:605, 1:610, 1:615, 1:620, 1:625, 1:630, 1:635, 1:640, 1:645, 1:650, 1:655, 1:660, 1:665, 1:670, 1:675, 1:680, 1:685, 1:690, 1:695, 1:700, 1:705, 1:710, 1:715, 1:720, 1:725, 1:730, 1:735, 1:740, 1:745, 1:750, 1:755, 1:760, 1:765, 1:770, 1:775, 1:780, 1:785, 1:790, 1:795, 1:800, 1:805, 1:810, 1:815, 1:820, 1:825, 1:830, 1:835, 1:840, 1:845, 1:850, 1:855, 1:860, 1:865, 1:870, 1:875, 1:880, 1:885, 1:890, 1:895, 1:900, 1:905, 1:910, 1:915, 1:920, 1:925, 1:930, 1:935, 1:940, 1:945, 1:950, 1:955, 1:960, 1:965, 1:970, 1:975, 1:980, 1:985, 1:990, 1:995, 1:1000, 1:>1000 or any ratio thereabout or therebetween.
More preferred ratios are: 1:30, 1:35, 1:40, 1:45, 1:50, 1:55, 1:60, 1:65, 1:70, 1:75, 1:80, 1:85, 1:90, 1:95, 1:100, 1:105, 1:110, 1:115, 1:120, 1:125, 1:130, 1:135, 1:140, 1:145, 1:150, 1:155, 1:160, 1:165, 1:170, 1:175, 1:180, 1:185, 1:190, 1:195, 1:200, 1:205, 1:210, 1:215, 1:220, 1:225, 1:230, 1:235, 1:240, 1:245, 1:250, 1:255, 1:260, 1:265, 1:270, 1:275, 1:280, 1:285, 1:290, 1:295, 1:300 or any ratio thereabout or therebetween.
The ratio of the plasmids comprising AAV rep and cap genes and a polynucleotide sequence encoding a first member of a specific binding pair to total plasmids comprising AAV rep and cap genes (termed “mosaicisms”) can include the following ratios and those thereabout or therebetween: 1/1, 1/1.1, 1/1.2, 1/1.3, 1/1.4, 1/1.5, 1/1.6, 1/1.7, 1/1.8, 1/1.9, 1/2, 1/2.1, 1/2.2, 1/2.3, 1/2.4, 1/2.5, 1/2.6, 1/2.7, 1/2.8, 1/2.9, 1/3, 1/3.1, 1/3.2, 1/3.3, 1/3.4, 1/3.5, 1/3.6, 1/3.7, 1/3.8, 1/3.9, 1/4, 1/4.1, 1/4.2, 1/4.3, 1/4.4, 1/4.5, 1/4.6, 1/4.7, 1/4.8, 1/4.9, 1/5, 1/5.1, 1/5.2, 1/5.3, 1/5.4, 1/5.5, 1/5.6, 1/5.7, 1/5.8, 1/5.9, 1/6, 1/6.1, 1/6.2, 1/6.3, 1/6.4, 1/6.5, 1/6.6, 1/6.7, 1/6.8, 1/6.9, 1/7, 1/7.1, 1/7.2, 1/7.3, 1/7.4, 1/7.5, 1/7.6, 1/7.7, 1/7.8, 1/7.9, 1/8, 1/8.1, 1/8.2, 1/8.3, 1/8.4, 1/8.5, 1/8.6, 1/8.7, 1/8.8, 1/8.9, 1/9, 1/9.1, 1/9.2, 1/9.3, 1/9.4, 1/9.5, 1/9.6, 1/9.7, 1/9.8, 1/9.9, 1/10, 1/10.1, 1/10.2, 1/10.3, 1/10.4, 1/10.5, 1/10.6, 1/10.7, 1/10.8, 1/10.9, 1/11, 1/11.1, 1/11.2, 1/11.3, 1/11.4, 1/11.5, 1/11.6, 1/11.7, 1/11.8, 1/11.9, 1/12, 1/12.1, 1/12.2, 1/12.3, 1/12.4, 1/12.5, 1/12.6, 1/12.7, 1/12.8, 1/12.9, 1/13, 1/13.1, 1/13.2, 1/13.3, 1/13.4, 1/13.5, 1/13.6, 1/13.7, 1/13.8, 1/13.9, 1/14, 1/14.1, 1/14.2, 1/14.3, 1/14.4, 1/14.5, 1/14.6, 1/14.7, 1/14.8, 1/14.9, 1/15, 1/15.1, 1/15.2, 1/15.3, 1/15.4, 1/15.5, 1/15.6, 1/15.7, 1/15.8, 1/15.9, 1/16, 1/16.1, 1/16.2, 1/16.3, 1/16.4, 1/16.5, 1/16.6, 1/16.7, 1/16.8, 1/16.9, 1/17, 1/17.1, 1/17.2, 1/17.3, 1/17.4, 1/17.5, 1/17.6, 1/17.7, 1/17.8, 1/17.9, 1/18, 1/18.1, 1/18.2, 1/18.3, 1/18.4, 1/18.5, 1/18.6, 1/18.7, 1/18.8, 1/18.9, 1/19, 11/9.1, 1/19.2, 1/19.3, 1/19.4, 1/91.5, 1/19.6, 1/19.7, 1/19.8, 1/19.9, 1/20, 1/21, 1/21.1, 1/21.2, 1/21.3, 1/21.4, 1/21.5, 1/21.6, 1/21.7, 1/21.8, 1/21.9, 1/22, 1/22.1, 1/22.2, 1/22.3, 1/22.4, 1/22.5, 1/22.6, 1/22.7, 1/22.8, 1/22.9, 1/23, 1/23.1, 1/23.2, 1/23.3, 1/23.4, 1/23.5, 1/23.6, 1/23.7, 1/23.8, 1/23.9, 1/24, 1/24.1, 1/24.2, 1/24.3, 1/24.4, 1/24.5, 1/24.6, 1/24.7, 1/24.8, 1/24.9, 1/25, 1/25.1, 1/25.2, 1/25.3, 1/25.4, 1/25.5, 1/25.6, 1/25.7, 1/25.8, 1/25.9, 1/26, 1/26.1, 1/26.2, 1/26.3, 1/26.4, 1/26.5, 1/26.6, 1/26.7, 1/26.8, 12/6.9, 1/27, 1/27.1, 1/27.2, 1/27.3, 1/27.4, 1/27.5, 1/27.6, 1/27.7, 1/27.8, 1/27.9, 1/28, 1/28.1, 1/28.2, 1/28.3, 1/28.4, 1/28.5, 1/28.6, 1/28.7, 1/28.8, 1/28.9, 1/29, 1/29.1, 1/29.2, 1/29.3, 1/29.4, 1/29.5, 1/29.6, 1/29.7, 1/29.8, 1/29.9, 1/30, 1/30.1, 1/30.2, 1/30.3, 1/30.4, 1/30.5, 1/30.6, 1/30.7, 1/30.8, 1/30.9, 1/31, 1/31.1, 1/31.2, 1/31.3, 1/31.4, 1/31.5, 1/31.6, 1/31.7, 1/31.8, 1/31.9, 1/32, 1/32.1, 1/32.2, 1/32.3, 1/32.4, 1/32.5, 1/32.6, 1/32.7, 1/32.8, 1/32.9, 1/33, 1/33.1, 1/33.2, 1/33.3, 1/33.4, 1/33.5, 1/33.6, 1/33.7, 1/33.8, 1/33.9, 1/34, 1/34.1, 1/34.2, 1/34.3, 1/34.4, 1/34.5, 1/34.6, 1/34.7, 1/34.8, 1/34.9, 1/35, 1/35.1, 1/35.2, 1/35.3, 1/35.4, 1/35.5, 1/35.6, 1/35.7, 1/35.8, 1/35.9, 1/36, 1/36.1, 1/36.2, 1/36.3, 1/36.4, 1/36.5, 1/36.6, 1/36.7, 1/36.8, 1/36.9, 1/37, 1/37.1, 1/37.2, 1/37.3, 1/37.4, 1/37.5, 1/37.6, 1/37.7, 1/37.8, 1/37.9, 1/38, 1/38.1, 1/38.2, 1/38.3, 1/38.4, 1/38.5, 1/38.6, 1/38.7, 1/38.8, 1/38.9, 1/39, 1/39.1, 1/39.2, 1/39.3, 1/39.4, 1/39.5, 1/39.6, 1/39.7, 1/39.8, 1/39.9, 1/40, 1/40.1, 1/40.2, 1/40.3, 1/40.4, 1/40.5, 1/40.6, 1/40.7, 1/40.8, 1/40.9, 1/41, 1/41.1, 1/41.2, 1/41.3, 1/41.4, 1/41.5, 1/41.6, 1/41.7, 1/41.8, 1/41.9, 1/42, 1/42.1, 1/42.2, 1/42.3, 1/42.4, 1/42.5, 1/42.6, 1/42.7, 1/42.8, 1/42.9, 1/43, 1/43.1, 1/43.2, 1/43.3, 1/43.4, 1/43.5, 1/43.6, 1/43.7, 1/43.8, 1/43.9, 1/44, 1/44.1, 1/44.2, 1/44.3, 1/44.4, 1/44.5, 1/44.6, 1/44.7, 1/44.8, 1/44.9, 1/45, 1/45.1, 1/45.2, 1/45.3, 1/45.4, 1/45.5, 1/45.6, 1/45.7, 1/45.8, 1/45.9, 1/46, 1/46.1, 1/46.2, 1/46.3, 1/46.4, 1/46.5, 1/46.6, 1/46.7, 1/46.8, 1/46.9, 1/47, 1/47.1, 1/47.2, 1/47.3, 1/47.4, 1/47.5, 1/47.6, 1/47.7, 1/47.8, 1/47.9, 1/48, 1/48.1, 1/48.2, 1/48.3, 1/48.4, 1/48.5, 1/48.6, 1/48.7, 1/48.8, 1/48.9, 1/49, 1/49.1, 1/49.2, 1/49.3, 1/49.4, 1/49.5, 1/49.6, 1/49.7, 1/49.8, 1/49.9, 1/50, 1/50.1, 1/50.2, 1/50.3, 1/50.4, 1/50.5, 1/50.6, 1/50.7, 1/50.8, 1/50.9, 1/51, 1/51.1, 1/51.2, 1/51.3, 1/51.4, 1/51.5, 1/51.6, 1/51.7, 1/51.8, 1/51.9, 1/52, 1/52.1, 1/52.2, 1/52.3, 1/52.4, 1/52.5, 1/52.6, 1/52.7, 1/52.8, 1/52.9, 1/53, 1/53.1, 1/53.2, 1/53.3, 1/53.4, 1/53.5, 1/53.6, 1/53.7, 1/53.8, 1/53.9, 1/54, 1/54.1, 1/54.2, 1/54.3, 1/54.4, 1/54.5, 1/54.6, 1/54.7, 1/54.8, 1/54.9, 1/55, 1/55.1, 1/55.2, 1/55.3, 1/55.4, 1/55.5, 1/55.6, 1/55.7, 1/55.8, 1/55.9, 1/56, 1/56.1, 1/56.2, 1/56.3, 1/56.4, 1/56.5, 1/56.6, 1/56.7, 1/56.8, 1/56.9, 1/57, 1/57.1, 1/57.2, 1/57.3, 1/57.4, 1/57.5, 1/57.6, 1/57.7, 1/57.8, 1/57.9, 1/58, 1/58.1, 1/58.2, 1/58.3, 1/58.4, 1/58.5, 1/58.6, 1/58.7, 1/58.8, 1/58.9, 1/59, 1/59.1, 1/59.2, 1/59.3, 1/59.4, 1/59.5, 1/59.6, 1/59.7, 1/59.8, 1/59.9 or 1/60.
Preferred mosaicisms are: 1/4, 1/4.1, 1/4.2, 1/4.3, 1/4.4, 1/4.5, 1/4.6, 1/4.7, 1/4.8, 1/4.9, 1/5, 1/5.1, 1/5.2, 1/5.3, 1/5.4, 1/5.5, 1/5.6, 1/5.7, 1/5.8, 1/5.9, 1/6, 1/6.1, 1/6.2, 1/6.3, 1/6.4, 1/6.5, 1/6.6, 1/6.7, 1/6.8, 1/6.9, 1/7, 1/7.1, 1/7.2, 1/7.3, 1/7.4, 1/7.5, 1/7.6, 1/7.7, 1/7.8, 1/7.9, 1/8, 1/8.1, 1/8.2, 1/8.3, 1/8.4, 1/8.5, 1/8.6, 1/8.7, 1/8.8, 1/8.9, 1/9, 1/9.1, 1/9.2, 1/9.3, 1/9.4, 1/9.5, 1/9.6, 1/9.7, 1/9.8, 1/9.9, 1/10, 1/10.1, 1/10.2, 1/10.3, 1/10.4, 1/10.5, 1/10.6, 1/10.7, 1/10.8, 1/10.9, 1/11, 1/11.1, 1/11.2, 1/11.3, 1/11.4, 1/11.5, 1/11.6, 1/11.7, 1/11.8, 1/11.9, 1/12, 1/12.1, 1/12.2, 1/12.3, 1/12.4, 1/12.5, 1/12.6, 1/12.7, 1/12.8, 1/12.9 or 1/13. More preferred mosaicisms are: 1/5, 1/5.1, 1/5.2, 1/5.3, 1/5.4, 1/5.5, 1/5.6, 1/5.7, 1/5.8, 1/5.9, 1/6, 1/6.1, 1/6.2, 1/6.3, 1/6.4, 1/6.5, 1/6.6, 1/6.7, 1/6.8, 1/6.9, 1/7, 1/7.1, 1/7.2, 1/7.3, 1/7.4, 1/7.5, 1/7.6, 1/7.7, 1/7.8, 1/7.9, 1/8, 1/8.1, 1/8.2, 1/8.3, 1/8.4, 1/8.5, 1/8.6, 1/8.7, 1/8.8, 1/8.9, 1/9, 1/9.1, 1/9.2, 1/9.3, 1/9.4, 1/9.5, 1/9.6, 1/9.7, 1/9.8, 1/9.9, 1/10, 1/10.1, 1/10.2, 1/10.3, 1/10.4, 1/10.5, 1/10.6, 1/10.7, 1/10.8, 1/10.9, 1/11, 1/11.1, 1/11.2, 1/11.3, 1/11.4, 1/11.5, 1/11.6, 1/11.7, 1/11.8, 1/11.9, or 1/12. Still more preferred mosaicisms are 1/7, 1/7.1, 1/7.2, 1/7.3, 1/7.4, 1/7.5, 1/7.6, 1/7.7, 1/7.8, 1/7.9, 1/8, 1/8.1, 1/8.2, 1/8.3, 1/8.4, 1/8.5, 1/8.6, 1/8.7, 1/8.8, 1/8.9, 1/9, 1/9.1, 1/9.2, 1/9.3, 1/9.4, 1/9.5, 1/9.6, 1/9.7, 1/9.8, 1/9.9, 1/10, 1/10.1, 1/10.2, 1/10.3, 1/10.4, 1/10.5, 1/10.6, 1/10.7, 1/10.8, 1/10.9, or 1/11. Ranges of mosaicisms can be 1/1 to 1/60. Preferred ranges of mosaicisms are 1/4 to 1/13; 1/5 to 1/12; 1/6 to 1/11, 1/7 to 1/10.5 or 1/7.5 to 1/10.
The incubating step can about 4 to 72 hours long. The (I) combining step can further comprise an additive, such as isopropyl alcohol (IPA), preferably at a concentration above 5%. IPA concentrations can be about 6%, 6.5%, 7%, 7.5%, 8%, 8.5%, 9%, 9.5%, 10%, 10.5%, 11%, 11.5%, 12%, 12.5%, 13%, 13.5%, 14%, 14.5%, 15%, 15.5%, 16%, 16.5%, 17%, 17.5%, 18%, 18.5%, 19%, 19.5%, 20%, 20.5%, 21%, 21.5%, 22%, 22.5%, 23%, 23.5%, 24%, 24.5%, 25% or more. Preferably, the concentration can be about 10% to 25%, more preferably 10% to 20%.
The inventions provide for a desired conjugation of a level of conjugation of at least 10%, at least 20%, at least 30%, and at least 40%. Preferred levels are at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or up to 100%, any of which can be considered complete depending on the purpose. More preferably, the desired level of conjugation typically will be about 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%.
Ranges of desired conjugation levels can be 10% to 100%, 20% to 99%, 30% to 99%, 40% to 99%, 50% to 99%, 60% to 99%, 70% to 99%, 80% to 99%, or 90% to 99%. Preferred ranges of desired conjugation levels can be 40% to 100%, 40% to 99%, 45% to 95%, 50% to 95%, 55% to 90%, 60% to 90%, 65% to 95%, 65% to 90%, 70% to 90%, 75% to 90%, 75% to 85%, 75% to 80%, or 80% to 85%, and any ranges made by combining these ranges, such as 65% to 85%, for example. More preferably, the range is 65% to 95%.
The helper polynucleotide sequences can encode adenovirus E4, adenovirus E2, and VA RNA, or be from another virus, such as herpes simplex virus (UL5, UL8, UL9, UL29, UL30, UL42 and UL52 polynucleotides), human papilloma virus (E1 or E1 carboxyl domain polynucleotides), bocavirus or baculovoirus.
The inventions also provide methods of separating a covalently surface modified adeno-associated virus (AAV) species from unconjugated retargeting molecule species, wherein the method comprises the steps of (a) providing a sample comprising the covalently surface modified adeno-associated virus species produced using in vitro conjugation; (b) subjecting the covalently surface modified adeno-associated virus to anion exchange media using a buffering agent and a salt to separate the covalently surface modified AAV species from retargeting molecule species to provide at least one fraction that is enriched in covalently surface modified AAV species; and (c) harvesting the enriched fraction comprising covalently surface modified AAV species with a defined level of covalent surface modifications. The buffering agent can be selected from the group consisting of Bis-Tris-Propane, Bis-Tris, Tris, Glycine, Bicine, Tricine, Acetate, Borate, Citrate, Carbonate, Phosphate, Formate, Sulfate, Succinic acid, Sulfonic acid and variants thereof (for example, MES, PIPES, HEPES, CHES, CAPS, MMS, PBMS), Diethanolamine, and Imidazole, and the salt is selected from the group consisting of NaCl, KCl, MgCl2, CaCl2), NH4Cl, Na2SO4, CaSO4, K2SO4, MgSO4, (NH4)2SO4, sodium citrate, and tetramethylammonium chloride (TMAC). The anion exchange media is selected from the group consisting of CIM QA, CIM DEAE, PRIMA T, Capto Q, Capto Q ImpRes, CAPTO DEAE, POROS HQ, POROS XQ, POROS PI, POROS D, Fractogel EMD TMAE, Fractogel EMD DEAE, Nuvia Q, Nuvia HP-Q, Sartobind STIC PA, Sartobind Q, Natrix Q. Enrichment can result in greater than 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or more of unconjugated retargeting molecule species being separated from the covalently surface modified AAV species. Enrichment can result in reducing the presence of unconjugated retargeting molecule species to undetectable levels.
The inventions further provide methods of separating a covalently surface modified adeno-associated virus (AAV) species from unconjugated retargeting molecule species, wherein the method comprises the steps of (a) providing a sample comprising the covalently surface modified adeno-associated virus species produced using an in vitro conjugation; (b) subjecting the covalently surface modified adeno-associated virus to cation exchange media using a buffering agent and a salt to separate the covalently surface modified AAV species from unconjugated retargeting molecule species to provide at least one fraction that is enriched in covalently surface modified AAV species; and (c) harvesting the enriched fraction comprising covalently surface modified AAV species. The cation exchange media can be selected from the group consisting of CIM SO3, Capto S, Capto S ImpRes, Capto S ImpAct, Capto SP, POROS HS, POROS XS, CM Sepharose, Nuvia S, Nuvia HR-Sartobind S, Natrix CH. Enrichment can result in greater than 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or more of unconjugated retargeting molecule species being separated from the covalently surface modified AAV species. Enrichment can result in reducing the presence of unconjugated retargeting molecule species to undetectable levels.
The inventions further provide methods of separating a covalently surface modified adeno-associated virus (AAV) species from unconjugated retargeting molecule species, wherein the method comprises the steps of (a) providing a sample comprising the covalently surface modified adeno-associated virus species produced using an in vitro conjugation; (b) subjecting the covalently surface modified adeno-associated virus to multimodal ion exchange using a buffering agent and a salt and an inorganic salt for loading and a low salt and low pH buffer for elution in order to separate the covalently surface modified AAV species from unconjugated retargeting molecule species to provide a fraction that is enriched in covalently surface modified AAV species; and (c) harvesting at least one enriched fraction comprising covalently surface modified AAV species. Enrichment can result in greater than 50%, 55%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or more of unconjugated retargeting molecule species being separated from the covalently surface modified AAV species. Enrichment can result in reducing the presence of unconjugated retargeting molecule species to undetectable levels.
The inventions further provide methods of separating a covalently surface modified adeno-associated virus (AAV) species from unconjugated retargeting molecule species, wherein the method comprises the steps of (a) providing a sample comprising the covalently surface modified adeno-associated virus species produced using an in vitro conjugation; (b) subjecting the covalently surface modified adeno-associated virus to multimodal binding and size separation bead chromatography using a multimodal buffer comprising in order to separate the covalently surface modified AAV species from unconjugated retargeting molecule species to provide a fraction that is enriched in covalently surface modified AAV species; and (c) harvesting the enriched fraction comprising covalently surface modified AAV species. The multimodal binding and size separation bead chromatography can be functionalized with an octyl amine that is hydrophobic and positively charged. The beads can comprise a matrix that provides size exclusion, and can be Capto™ Core 400 or Capto™ Core 700. Enrichment can result in greater than 50%, 55%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or more of unconjugated retargeting molecule species being separated from the covalently surface modified AAV species. Enrichment can result in reducing the presence of unconjugated retargeting molecule species to undetectable levels.
The inventions further provide methods of purifying the covalently surface modified AAV of the inventions described herein using approaches including improved depth filtration, improved tangential flow filtration (such as single-pass tangential flow filtration), improved affinity capture and improved ionic exchange chromatography.
The inventions further comprise covalently surface modified adeno-associated viruses (AAV) produced and/or purified by the methods.
The inventions also provide AAV preparations produced by any of the above the methods, and drug products made from the AAV preparations.
The inventions are amendable to use with all AAV serotypes and variants, including but not limited to AAV1, AAV2, AAV2quad(Y-F), AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV rh10, AAV rh39, AAV rh43, and AAV rh74.
Covalently surface modified adeno-associated viruses (AAV) made according to an example selected from the group consisting of Example 15, Example 16, Example 17, Example 18, Example 19, Example 20, Example 21, Example 22, Example 23, Example 24, Example 25, Example 26, Example 27, Example 28, Example 29, Example 30 and Example 31 also are provided, and can be produced using cells comprising at least one sequence set forth in an example selected from the group consisting of examples selected from the group consisting of Example 32, Example 33, Example 34, Example 35, Example 36, Example 37, Example 38 and Example 39.
AAV preparations comprising the covalently surface modified adeno-associated viruses and biologic drug products comprising the covalently surface modified adeno-associated virus also are provided.
The Figures (Fig. or Figs.) below depict schematic representations of aspects of the inventions and data from the inventions.
Optimum (often referred to as ‘complete’ since it is based on the desired purpose) conjugation occurs when a substantial portion, preferably a majority, of accessible first members of a specific binding pair are bound to second cognate members of the specific binding pair, which is the desired outcome. For example,
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the inventions belong.
The term “about” in the context of numerical values and ranges refers to values or ranges that approximate or are close to the recited values or ranges such that the invention can perform as intended, such as having a desired rate, amount, density, degree, increase, decrease, percentage, ratio, value, purity, pH, concentration, presence of a form or variant, temperature or amount of time, as is apparent from the teachings contained herein. For example, “about” can signify values either above or below the stated value in a range of approx. +/−10% or more or less depending on the ability to perform. Thus, this term encompasses values beyond those simply resulting from systematic error.
“Antibodies” (also referred to as “immunoglobulins”) are examples of proteins having multiple polypeptide chains and extensive post-translational modifications. The canonical immunoglobulin protein (for example, IgG) comprises four polypeptide chains—two light chains and two heavy chains. Each light chain is linked to one heavy chain via a cysteine disulfide bond, and the two heavy chains are bound to each other via two cysteine disulfide bonds. Immunoglobulins produced in mammalian systems are also glycosylated at various residues (for example, at asparagine residues) with various polysaccharides, and can differ from species to species, which may affect antigenicity for therapeutic antibodies. Butler and Spearman, “The choice of mammalian cell host and possibilities for glycosylation engineering”, Curr. Opin. Biotech. 30:107-112 (2014).
An antibody includes immunoglobulin molecules comprised of four polypeptide chains, two heavy (H) chains and two light (L) chains inter-connected by disulfide bonds. Each heavy chain comprises a heavy chain variable region (abbreviated herein as HCVR or VH) and a heavy chain constant region. The heavy chain constant region comprises three domains, CH1, CH2 and CH3. Each light chain comprises a light chain variable region (abbreviated herein as LCVR or VL) and a light chain constant region. The light chain constant region comprises one domain, CL. The VH and VL regions can be further subdivided into regions of hypervariability, termed complementarity determining regions (CDR), interspersed with regions that are more conserved, termed framework regions (FR). Each VH and VL is composed of three CDRs and four FRs, arranged from amino-terminus to carboxy-terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4 (heavy chain CDRs may be abbreviated as HCDR1, HCDR2 and HCDR3; light chain CDRs may be abbreviated as LCDRI, LCDR2 and LCDR3. The term “high affinity” antibody refers to those antibodies having a binding affinity to their target of at least 10-9 M, at least 10−10 M; at least 10−11 M; or at least 10−12 M, as measured by surface plasmon resonance, for example, BIACORE™ or solution-affinity ELISA.
The phrase “bispecific antibody” includes, but is not limited to, an antibody capable of selectively binding two or more epitopes, and can be used as retargeting molecules. In one approach, bispecific antibodies generally comprise two different heavy chains, with each heavy chain specifically binding a different epitope—either on two different molecules (for example, antigens) or on the same molecule (for example, on the same antigen). If a bispecific antibody is capable of selectively binding two different epitopes (a first epitope and a second epitope), the affinity of the first heavy chain for the first epitope will generally be at least one to two, three or four orders of magnitude lower than the affinity of the first heavy chain for the second epitope, and vice versa. The epitopes recognized by the bispecific antibody can be on the same or a different target (for example, on the same or a different protein). Bispecific antibodies can be made, for example, by combining heavy chains that recognize different epitopes of the same antigen. For example, nucleic acid sequences encoding heavy chain variable sequences that recognize different epitopes of the same antigen can be fused to nucleic acid sequences encoding different heavy chain constant regions, and such sequences can be expressed in a cell that expresses an immunoglobulin light chain. Predominantly, a bispecific antibody has two heavy chains each having three heavy chain CDRs, followed by (N-terminal to C-terminal) a CH1 domain, a hinge, a CH2 domain, and a CH3 domain, and an immunoglobulin light chain that either does not confer antigen-binding specificity but that can associate with each heavy chain, or that can associate with each heavy chain and that can bind one or more of the epitopes bound by the heavy chain antigen-binding regions, or that can associate with each heavy chain and enable binding or one or both of the heavy chains to one or both epitopes. In another approach, a bispecific antibody can be an antibody where there are alterations to one or both of the heavy chains on either the variable or constant region. For example, there can be a bispecific antibody where one of the heavy chains is joined, modified to include, or genetically fused to another molecule, such as a SpyCatcher protein or fragment/derivative thereof, while the other heavy chain is not .Techniques and components can be referenced in International Patent Publication Nos. WO2010/151792, WO2014/047231, WO2016/018740, WO2016/161010, WO2019/006046 and U.S. Pat. No. 8,586,713.
The term “components” refers to the constituent molecules needed to produce recombinant AAV, such as covalently surface modified adeno-associated viruses and includes, but is not limited to, promoters, polyadenylation signals, transgenes, polynucleotides encoding retargeting molecules, AAV cap genes, AAV rep genes, ITRs, helper polynucleotide sequence(s), polynucleotides encoding a first member of a specific binding pair and a second cognate member of a specific binding pair (for covalently surface modified AAV), as well as peptides encoded by the genes and polynucleotide sequences. Optional components include detargeting mutation sequences, introns, IRESs, RRSs, operators and enhancers.
The phrase “assembly of components” refers to components that assemble together by way of bonds, forces, interactions and/or attractions. Examples include the assembly of heavy and light chains to form antibodies, capsid proteins, and isopeptide bonds formed during conjugation of specific binding pairs.
The phrase “heavy chain,” or “immunoglobulin heavy chain” includes an immunoglobulin heavy chain constant region sequence from any organism, and unless otherwise specified includes a heavy chain variable domain. Heavy chain variable domains include three heavy chain CDRs and four FR regions, unless otherwise specified. Fragments of heavy chains include CDRs, CDRs and FRs, and combinations thereof. A typical heavy chain has, following the variable domain (from N-terminal to C-terminal), a CH1 domain, a hinge, a CH2 domain, and a CH3 domain. A functional fragment of a heavy chain includes a fragment that is capable of specifically recognizing an antigen (for example, recognizing the antigen with a KD in the micromolar, nanomolar, or picomolar range), that is capable of expressing and secreting from a cell, and that comprises at least one CDR.
The phrase “light chain” includes an immunoglobulin light chain constant region sequence from any organism, and unless otherwise specified includes human kappa and lambda light chains. Light chain variable (VL) domains typically include three light chain CDRs and four framework (FR) regions, unless otherwise specified. Generally, a full-length light chain includes, from amino terminus to carboxyl terminus, a VL domain that includes FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4, and a light chain constant domain. Light chains that can be used with these inventions include those, for example, that do not selectively bind either the first or second antigen selectively bound by the antigen-binding protein. Suitable light chains include those that can be identified by screening for the most commonly employed light chains in existing antibody libraries (wet libraries or in silico), where the light chains do not substantially interfere with the affinity and/or selectivity of the antigen-binding domains of the antigen-binding proteins. Suitable light chains include those that can bind one or both epitopes that are bound by the antigen-binding regions of the antigen-binding protein.
“Recombinase recognition sites” (RRS), also known as “heterospecific recombination sites,” are used in recombinase mediated cassette exchange (RMCE). Cre/Lox Dre/Rox, Vre/Vlox, SCre/Slox and FIp/Frt are suitable systems, for example. Suitable RRSs for use according to the inventions include Lox P, Lox 66, Lox 71, Lox 511, Lox 2272, Lox 2372, Lox 5171, Lox M2, Lox M3, lox M7 and Lox M11. These sites can be referred to generically as first (1), second (2), third (3), fourth (4), fifth (5), sixth (6), seventh (7), eighth (8), ninth (9), tenth (10), etc., as is apparent from the context of usage.
An “intron” is a section of DNA that is not protein encoding, and typically is located between “exons”, which encode protein regions. An intron is removed to form a mature messenger RNA, which is translated to form protein. Some introns are those that can affect the starting point of translation, and exemplars are the hCMV-IE intron (Human cytomegalovirus immediate early protein) and FMDV intron (Foot and Mouth Disease Virus).
“Intronic selection” refers to the optional use of recombinase recognition sites located in intronic regions to allow for integration of multiple cassettes to form a construct. See Published applications US 2019/0263937 A1 and US 2019/0233544 A1. For example, selection markers and reporter genes can be engineered to include introns with RRSs contained therein. Intronic selection can be used to create constructs sectionally. For instance, a large construct containing multiple cassettes can be created by using smaller, constituent constructs.
“Antibody derivatives and fragments” include, but are not limited to: antibody fragments (for example, Fab, ScFv-Fc, dAB-Fc, half antibodies and other combinations of heavy and/or light chains), multispecifics (for example, bispecifics, IgG-ScFv, IgG-dab, ScFV-Fc-ScFV, trispecifics).
The phrase “Fc-containing protein” includes antibodies, bispecific antibodies, antibody derivatives containing an Fc, antibody fragments containing an Fc, Fc-fusion proteins, immunoadhesins, and other binding proteins that comprise at least a functional portion of an immunoglobulin CH2 and CH3 region. A “functional portion” refers to a CH2 and CH3 region that can bind a Fc receptor (for example, an FcyR; or an FcRn, (neonatal Fc receptor), and/or that can participate in the activation of complement. If the CH2 and CH3 region contains deletions, substitutions, and/or insertions or other modifications that render it unable to bind any Fc receptor and also unable to activate complement, the CH2 and CH3 region is not functional. Fc-fusion proteins include, for example, Fc-fusion (N-terminal), Fc-fusion (C-terminal), mono-Fc-fusion and bispecific Fc-fusion proteins.
“Fc” stands for fragment crystallizable, and is often referred to as a fragment constant. Antibodies contain an Fc region that is made up of two identical protein sequences. IgG has heavy chains known as γ-chains. IgA has heavy chains known as α-chains, IgM has heavy chains known as μ-chains. IgD has heavy chains known as σ-chains. IgE has heavy chains known as ε-chains. In nature, Fc regions are the same in all antibodies of a given class and subclass in the same species. Human IgGs have four subclasses and share about 95% homology amongst the subclasses. In each subclass, the Fc sequences are the same. For example, human IgG1 antibodies will have the same Fc sequences. Likewise, IgG2 antibodies will have the same Fc sequences; IgG3 antibodies will have the same Fc sequences; and IgG4 antibodies will have the same Fc sequences. Alterations in the Fc region can create charge variation.
“Fc-fusion proteins” comprise part or all of two or more proteins, one of which is an Fc portion of an immunoglobulin molecule, that are not fused in their natural state. Fc-fusion proteins include Fc-Fusion (N-terminal), Fc-Fusion (C-terminal), Mono Fc-Fusion and Bi-specific Fc-Fusion. Preparation of fusion proteins comprising certain heterologous polypeptides fused to various portions of antibody-derived polypeptides (including the Fc domain) has been described, for example, by Ashkenazi et al., Proc. Natl. Acad. Sci. USA 88: 10535-39 (1991); Byrn et al., Nature 344:677-70, 1990; and Hollenbaugh et al., “Construction of Immunoglobulin Fusion Proteins”, in Current Protocols in Immunology, Suppl. 4, pages 10.19.1-10.19.11 (1992). “Receptor Fc-fusion proteins” comprise one or more of one or more extracellular domain(s) of a receptor coupled to an Fc moiety, which in some aspects comprise a hinge region followed by a CH2 and CH3 domain of an immunoglobulin. In some aspects, the Fc-fusion protein contains two or more distinct receptor chains that bind to a single or more than one ligand(s). Some receptor Fc-fusion proteins may contain ligand binding domains of multiple different receptors. Receptor Fc-fusion proteins are also referred to as “traps,” “trap molecules” or “trap proteins.” For example, such trap proteins include an IL-1 trap (for example, Rilonacept, which contains the IL-IRAcP ligand binding region fused to the IL-1 R1 extracellular region fused to Fc of hlgGI; see U.S. Pat. No. 6,927,044, or a VEGF Trap (for example, Aflibercept, which contains the Ig domain 2 of the VEGF receptor FItl fused to the Ig domain 3 of the VEGF receptor FIkl fused to Fc of hlgG1 See U.S. Pat. Nos. 7,087,411 and 7,279,159.
“Polynucleotide” includes a sequence of nucleotides covalently joined, and includes RNA and DNA. Oligonucleotides are considered shorter polynucleotides. Genes are DNA polynucleotides (polydeoxyribonucleic acid) that ultimately encode polypeptides, which are translated from RNA (polyribonucleic acid) that was typically transcribed from DNA. DNA polynucleotides also can encode RNA polynucleotides that is not translated, but rather function as RNA “products”. The type of polynucleotide (that is, DNA or RNA) is apparent from the context of the usage of the term. A polynucleotide referred to or identified by the polypeptide it encodes sets forth and covers all suitable sequences in accordance with codon degeneracy. Polynucleotides, including those disclosed herein, include percent identity sequences and homologous sequences when indicated.
“Polypeptide” or “peptide” refers to sequence(s) of amino acids covalently joined. Polypeptides include natural, semi-synthetic and synthetic proteins and protein fragments. “Polypeptide” and “protein” can be used interchangeably. Oligopeptides are considered shorter polypeptides.
A “gene of interest” (GOI) encodes a “protein of interest” or “polypeptide of interest” and optionally can include other associated sequences. The sequences can be natural, semi-synthetic or synthetic. Native sequences, mutant sequences and degenerate sequences can be GOIs. A gene of interest also can be referred to as a “transgene.”
A “nucleotide of interest” includes GOIs and sequences encoding non-translated RNAs/non-coding RNAs (such as, but not limited to, antisense RNA, micro RNA, small interfering RNA, catalytic RNA and ribozymes). NOIs and GOIs also can be referred to as “payloads.”
“Protein of interest” or “polypeptide of interest” (POI) can have any amino acid sequence, and includes any protein, polypeptide, or peptide that is desired to be expressed, typically for gene therapy purposes. Protein types can include, but are not limited to, receptors, fusion proteins, agonists, antagonists, activators, inhibitors, enzymes (such as those used in enzyme replacement therapy), factors and co-factors, repressors, activators, ligands, protein hormones, therapeutic proteins, suicide proteins, structural proteins, storage proteins, transport proteins, signal proteins, neurotransmitters and contractile proteins. Derivatives, components, domains, chains and fragments of the above also are included. The sequences can be natural, semi-synthetic or synthetic.
“Purification” in its various grammatical forms includes, but is not limited to, the use of one or more procedures such as depth filtration, tangential flow filtration, affinity capture, ionic exchange and the like.
The term “recombinant capsid protein” includes a capsid protein that has at least one mutation in comparison to the corresponding capsid protein of the wild-type virus, which wild-type may be a reference and/or control virus for comparative study. A recombinant capsid protein includes a capsid protein that comprises a heterologous amino acid sequence, which may be inserted into and/or displayed by the capsid protein. “Heterologous” in a general context means heterologous as compared to the virus, from which the capsid protein is derived. The inserted amino acids can simply be inserted between two given amino acids of the capsid protein. An insertion of amino acids can also go along with a deletion of given amino acids of the capsid protein at the site of insertion, for example, 1 or more capsid protein amino acids are substituted by 5 or more heterologous amino acids). An example of a heterologous amino acid sequence that can be inserted is a member of a specific binding pair, such SpyTag.
“Detargeting” refers to reducing or abolishing AAV natural preferential transduction, primarily of the liver, by mutating Cap proteins. For example, mutations in the galactose binding domain of VP1 assist in detargeting the liver. Other mutations include, but are not limited to, Cap mutations that alter heparin binding or sialic acid binding. These mutations are optional and can be referred to as “detargeting mutations.”
By way of example, different AAV serotypes are known to preferentially transduce the cells of different tissues. Tissue specificity is limited, and AAV is known to preferentially transduce the liver, which can be a safety and efficacy concern in some contexts. The inventions further provide mutations in the VP1 Protein of AAV9, for example, to lower the AAV preferential transduction of the liver. The AAV9 mutations include N272A and W503A substitutions, where alanine replaces both asparagine at position 272 of VP1 and tryptophan at position 503 of VP1. One or both of the mutations can be undertaken in the VP1 protein. Optionally, other amino acids, such as glutamic acid, serine or others, can be used instead of alanine for substitution. Additional detargeting mutation sites include, but are not limited to, N470, D271, and Y446. The inventions provide exemplary mutations for use with AAVs as follows, which for each serotype can be utilized singly or in combinations
These and others are set forth in the chart below:
Other mutations and detargeting approaches, such as variable loop swaps, are disclosed in publications or otherwise available See, for example, Shen et al., Molecular Therapy 15: 1955-62 (2007). These technologies can be used according to the inventions. Detargeting mutations are optional.
“Retargeting” or “redirecting” may include a situations in which the wildtype vector targets several cells within a tissue and/or several organs within an organism, which general targeting of the tissue or organs is reduced or abolished by provision of a retargeting molecule, which retargets the covalently surface modified AAV to a different, and optionally more specific cell in the tissue or a specific organ in the organism.
The term “retargeting molecule” (Rm) is a molecule useful for targeting an antigen, receptor protein, including glycoproteins, and/or ligand (“collectively targets”) found on the surface of a cell, referred to as a “target cell.” The retargeting molecule can be bound to a polypeptide that is part of a specific binding pair. For example, a retargeting molecule could be bound to SpyCatcher (or fragments/derivatives thereof) in order to utilize the SpyTag-SpyCatcher system. The retargeting molecule can target the cell that has the antigen, receptor and/or ligand that the retargeting molecule can bind to, and thereby direct a recombinant AAV to that cell. Fc-containing proteins, such as antibodies, monoclonal antibodies (including derivatives, fragments, half antibodies and other heavy chain and/or light chain combinations), multispecific antibodies (for example, bispecifics and trispecifics), IgG-ScFv, IgG-dab, ScFV-Fc-ScFV, Fc-fusion proteins, receptor-Fc fusion proteins, and trap proteins, are useful as retargeting molecules. Mini-trap proteins also can be used as retargeting molecules. In the literature, the phrase “targeting ligand” has been used for molecules that are useful for targeting. See Yan et al., Pharmaceutics 16: 248 (2024).
All human and non-human antibody classes can be used as retargeting molecules. IgA, IgD IgE, IgG and IgM can be used as retargeting molecules. IgG is a preferred class, and includes subclasses IgG1 (including IgG1A and IgG1 K), IgG2, IgG3, and IgG4. Further antibody types include a human antibody, a humanized antibody, a chimeric antibody, a monoclonal antibody, a multispecific antibody, a bispecific antibody, a trispecific antibody, an antigen binding antibody fragment, a single chain antibody, a diabody, triabody, tetrabody, Fab, F(ab′), F(ab′)2 and a half antibody.
“Specific binding pair”, also referred to a “protein:protein binding pair” and the like include two proteins (that is, a first member, such as a first polypeptide, and a second cognate member, such as a second polypeptide) that interact to form a covalent isopeptide bond under conditions that enable or facilitate isopeptide bond formation, wherein the term “cognate” refers to components that function together by to reacting together to form an isopeptide bond. Thus, two proteins that react together efficiently to form an isopeptide bond under conditions that enable or facilitate isopeptide bond formation can also be referred to as being a “complementary” pair of peptide linkers. Specific binding pairs capable of interacting to form a covalent isopeptide bond are reviewed in Veggiani et al. (2014) Trends Biotechnol. 32:506, and include, for example, peptide:peptide binding pairs such as SpyTag:SpyCatcher, SpyTag002:SpyCatcher002, SpyTag:KTag, isopeptag:pilin C, SnoopTag:SnoopCatcher and others. Spy Tag002:SpyCatcher002 and SpyTag003:SpyCatcher003 are different iterations of Spy Tag:Spy Catcher.
The term “isopeptide bond” refers to an amide bond between a carboxyl or carboxamide group and an amino group at least one of which is not derived from a protein main chain or alternatively viewed is not part of the protein backbone. An isopeptide bond may form within a single protein or may occur between two peptides or a peptide and a protein. Thus, an isopeptide bond may form intramolecularly within a single protein or intermolecularly, that is between two peptide/protein molecules, such as between two peptide linkers. Typically, an isopeptide bond may occur between a lysine residue and an asparagine, aspartic acid, glutamine, or glutamic acid residue or the terminal carboxyl group of the protein or peptide chain or may occur between the alpha-amino terminus of the protein or peptide chain and an asparagine, aspartic acid, glutamine or glutamic acid. Each residue of the pair involved in the isopeptide bond is referred to herein as a reactive residue. An isopeptide bond may form between a lysine residue and an asparagine residue or between a lysine residue and an aspartic acid residue. Particularly, isopeptide bonds can occur between the side chain amine of lysine and carboxamide group of asparagine or carboxyl group of an aspartate.
“Mosaicism” refers to the ratio of AAV cap sequence containing plasmids that also contain a sequence encoding a first member as compared to the cap plasmids without the first member sequence. Typically, a cap plasmid will contain both the AAV cap gene and the AAV rep gene. An example is plasmid pRC as taught herein. An example of a plasmid that also encodes a first member is pRC-SpyT as taught herein. Plasmid pRC-SpyT serves as an exemplar of a cap plasmid that comprises a nucleotide sequence of a first member.
For example, when 1/10 of all the pRC plasmids transfected are pRC-SpyT plasmids, the AAV capsid is expected to have an average of 6 SpyT, as 1/10 of the 60 viral proteins are expected to have a SpyT (1 pRC-SpyT/10 total cap-containing plasmids)×60=6). Similarly, a transfection ratio of 1/4 is expected to result in 15 SpyT per AAV capsid (1/4×60=15), and a transfection ratio of 1/30 is expected to result in 2 SpyT per AAV capsid (1/30×60=2), as the capsid is stoichiometrically assembled inside the cell using the available viral proteins. The ratio of pRC-SpyT to total pRC plasmids during transfection is referred to as the “mosaicism” of the AAV capsid, with “higher mosaicisms” such as 1/4 resulting in higher SpyT on the AAV capsids on average, and “lower mosaicisms” such as 1/30 resulting in fewer SpyT on the AAV capsids on average. Thus, where the ratio of pRC-FM to pRC plasmids is a larger fractional value, the mosaicism will be higher. As explained above, 1/4 is a larger fractional value than 1/30.
Mosaicisms can be selected by the person skilled in the art in view of the teachings contained herein. Mosaicisms can be ratios as set forth below and those thereabout and therebetween: 1/1, 1/1.1, 1/1.2, 1/1.3, 1/1.4, 1/1.5, 1/1.6, 1/1.7, 1/1.8, 1/1.9, 1/2, 1/2.1, 1/2.2, 1/2.3, 1/2.4, 1/2.5, 1/2.6, 1/2.7, 1/2.8, 1/2.9, 1/3, 1/3.1, 1/3.2, 1/3.3, 1/3.4, 1/3.5, 1/3.6, 1/3.7, 1/3.8, 1/3.9, 1/4, 1/4.1, 1/4.2, 1/4.3, 1/4.4, 1/4.5, 1/4.6, 1/4.7, 1/4.8, 1/4.9, 1/5, 1/5.1, 1/5.2, 1/5.3, 1/5.4, 1/5.5, 1/5.6, 1/5.7, 1/5.8, 1/5.9, 1/6, 1/6.1, 1/6.2, 1/6.3, 1/6.4, 1/6.5, 1/6.6, 1/6.7, 1/6.8, 1/6.9, 1/7, 1/7.1, 1/7.2, 1/7.3, 1/7.4, 1/7.5, 1/7.6, 1/7.7, 1/7.8, 1/7.9, 1/8, 1/8.1, 1/8.2, 1/8.3, 1/8.4, 1/8.5, 1/8.6, 1/8.7, 1/8.8, 1/8.9, 1/9, 1/9.1, 1/9.2, 1/9.3, 1/9.4, 1/9.5, 1/9.6, 1/9.7, 1/9.8, 1/9.9, 1/10, 1/10.1, 1/10.2, 1/10.3, 1/10.4, 1/10.5, 1/10.6, 1/10.7, 1/10.8, 1/10.9, 1/11, 1/11.1, 1/11.2, 1/11.3, 1/11.4, 1/11.5, 1/11.6, 1/11.7, 1/11.8, 1/11.9, 1/12, 1/12.1, 1/12.2, 1/12.3, 1/12.4, 1/12.5, 1/12.6, 1/12.7, 1/12.8, 1/12.9, 1/13, 1/13.1, 1/13.2, 1/13.3, 1/13.4, 1/13.5, 1/13.6, 1/13.7, 1/13.8, 1/13.9, 1/14, 1/14.1, 1/14.2, 1/14.3, 1/14.4, 1/14.5, 1/14.6, 1/14.7, 1/14.8, 1/14.9, 1/15, 1/15.1, 1/15.2, 1/15.3, 1/15.4, 1/15.5, 1/15.6, 1/15.7, 1/15.8, 1/15.9, 1/16, 1/16.1, 1/16.2, 1/16.3, 1/16.4, 1/16.5, 1/16.6, 1/16.7, 1/16.8, 1/16.9, 1/17, 1/17.1, 1/17.2, 1/17.3, 1/17.4, 1/17.5, 1/17.6, 1/17.7, 1/17.8, 1/17.9, 1/18, 1/18.1, 1/18.2, 1/18.3, 1/18.4, 1/18.5, 1/18.6, 1/18.7, 1/18.8, 1/18.9, 1/19, 11/9.1, 1/19.2, 1/19.3, 1/19.4, 1/91.5, 1/19.6, 1/19.7, 1/19.8, 1/19.9, 1/20, 1/21, 1/21.1, 1/21.2, 1/21.3, 1/21.4, 1/21.5, 1/21.6, 1/21.7, 1/21.8, 1/21.9, 1/22, 1/22.1, 1/22.2, 1/22.3, 1/22.4, 1/22.5, 1/22.6, 1/22.7, 1/22.8, 1/22.9, 1/23, 1/23.1, 1/23.2, 1/23.3, 1/23.4, 1/23.5, 1/23.6, 1/23.7, 1/23.8, 1/23.9, 1/24, 1/24.1, 1/24.2, 1/24.3, 1/24.4, 1/24.5, 1/24.6, 1/24.7, 1/24.8, 1/24.9, 1/25, 1/25.1, 1/25.2, 1/25.3, 1/25.4, 1/25.5, 1/25.6, 1/25.7, 1/25.8, 1/25.9, 1/26, 1/26.1, 1/26.2, 1/26.3, 1/26.4, 1/26.5, 1/26.6, 1/26.7, 1/26.8, 12/6.9, 1/27, 1/27.1, 1/27.2, 1/27.3, 1/27.4, 1/27.5, 1/27.6, 1/27.7, 1/27.8, 1/27.9, 1/28, 1/28.1, 1/28.2, 1/28.3, 1/28.4, 1/28.5, 1/28.6, 1/28.7, 1/28.8, 1/28.9, 1/29, 1/29.1, 1/29.2, 1/29.3, 1/29.4, 1/29.5, 1/29.6, 1/29.7, 1/29.8, 1/29.9 1/30, 1/30.1, 1/30.2, 1/30.3, 1/30.4, 1/30.5, 1/30.6, 1/30.7, 1/30.8, 1/30.9, 1/31, 1/31.1, 1/31.2, 1/31.3, 1/31.4, 1/31.5, 1/31.6, 1/31.7, 1/31.8, 1/31.9, 1/32, 1/32.1, 1/32.2, 1/32.3, 1/32.4, 1/32.5, 1/32.6, 1/32.7, 1/32.8, 1/32.9, 1/33, 1/33.1, 1/33.2, 1/33.3, 1/33.4, 1/33.5, 1/33.6, 1/33.7, 1/33.8, 1/33.9, 1/34, 1/34.1, 1/34.2, 1/34.3, 1/34.4, 1/34.5, 1/34.6, 1/34.7, 1/34.8, 1/34.9, 1/35, 1/35.1, 1/35.2, 1/35.3, 1/35.4, 1/35.5, 1/35.6, 1/35.7, 1/35.8, 1/35.9, 1/36, 1/36.1, 1/36.2, 1/36.3, 1/36.4, 1/36.5, 1/36.6, 1/36.7, 1/36.8, 1/36.9, 1/37, 1/37.1, 1/37.2, 1/37.3, 1/37.4, 1/37.5, 1/37.6, 1/37.7, 1/37.8, 1/37.9, 1/38, 1/38.1, 1/38.2, 1/38.3, 1/38.4, 1/38.5, 1/38.6, 1/38.7, 1/38.8, 1/38.9, 1/39, 1/39.1, 1/39.2, 1/39.3, 1/39.4, 1/39.5, 1/39.6, 1/39.7, 1/39.8, 1/39.9, 1/40, 1/40.1, 1/40.2, 1/40.3, 1/40.4, 1/40.5, 1/40.6, 1/40.7, 1/40.8, 1/40.9, 1/41, 1/41.1, 1/41.2, 1/41.3, 1/41.4, 1/41.5, 1/41.6, 1/41.7, 1/41.8, 1/41.9, 1/42, 1/42.1, 1/42.2, 1/42.3, 1/42.4, 1/42.5, 1/42.6, 1/42.7, 1/42.8, 1/42.9, 1/43, 1/43.1, 1/43.2, 1/43.3, 1/43.4, 1/43.5, 1/43.6, 1/43.7, 1/43.8, 1/43.9, 1/44, 1/44.1, 1/44.2, 1/44.3, 1/44.4, 1/44.5, 1/44.6, 1/44.7, 1/44.8, 1/44.9, 1/45, 1/45.1, 1/45.2, 1/45.3, 1/45.4, 1/45.5, 1/45.6, 1/45.7, 1/45.8, 1/45.9, 1/46, 1/46.1, 1/46.2, 1/46.3, 1/46.4, 1/46.5, 1/46.6, 1/46.7, 1/46.8, 1/46.9, 1/47, 1/47.1, 1/47.2, 1/47.3, 1/47.4, 1/47.5, 1/47.6, 1/47.7, 1/47.8, 1/47.9, 1/48, 1/48.1, 1/48.2, 1/48.3, 1/48.4, 1/48.5, 1/48.6, 1/48.7, 1/48.8, 1/48.9, 1/49, 1/49.1, 1/49.2, 1/49.3, 1/49.4, 1/49.5, 1/49.6, 1/49.7, 1/49.8, 1/49.9, 1/50, 1/50.1, 1/50.2, 1/50.3, 1/50.4, 1/50.5, 1/50.6, 1/50.7, 1/50.8, 1/50.9, 1/51, 1/51.1, 1/51.2, 1/51.3, 1/51.4, 1/51.5, 1/51.6, 1/51.7, 1/51.8, 1/51.9, 1/52, 1/52.1, 1/52.2, 1/52.3, 1/52.4, 1/52.5, 1/52.6, 1/52.7, 1/52.8, 1/52.9, 1/53, 1/53.1, 1/53.2, 1/53.3, 1/53.4, 1/53.5, 1/53.6, 1/53.7, 1/53.8, 1/53.9, 1/54, 1/54.1, 1/54.2, 1/54.3, 1/54.4, 1/54.5, 1/54.6, 1/54.7, 1/54.8, 1/54.9, 1/55, 1/55.1, 1/55.2, 1/55.3, 1/55.4, 1/55.5, 1/55.6, 1/55.7, 1/55.8, 1/55.9, 1/56, 1/56.1, 1/56.2, 1/56.3, 1/56.4, 1/56.5, 1/56.6, 1/56.7, 1/56.8, 1/56.9, 1/57, 1/57.1, 1/57.2, 1/57.3, 1/57.4, 1/57.5, 1/57.6, 1/57.7, 1/57.8, 1/57.9, 1/58, 1/58.1, 1/58.2, 1/58.3, 1/58.4, 1/58.5, 1/58.6, 1/58.7, 1/58.8, 1/58.9, 1/59, 1/59.1, 1/59.2, 1/59.3, 1/59.4, 1/59.5, 1/59.6, 1/59.7, 1/59.8, 1/59.9, or 1/60.
Ranges of ratios of 1/1 to 1/60 can be employed, and subranges as set forth below.
Preferred mosaicisms are:
1/4, 1/4.1, 1/4.2, 1/4.3, 1/4.4, 1/4.5, 1/4.6, 1/4.7, 1/4.8, 1/4.9, 1/5, 1/5.1, 1/5.2, 1/5.3, 1/5.4, 1/5.5, 1/5.6, 1/5.7, 1/5.8, 1/5.9, 1/6, 1/6.1, 1/6.2, 1/6.3, 1/6.4, 1/6.5, 1/6.6, 1/6.7, 1/6.8, 1/6.9, 1/7, 1/7.1, 1/7.2, 1/7.3, 1/7.4, 1/7.5, 1/7.6, 1/7.7, 1/7.8, 1/7.9, 1/8, 1/8.1, 1/8.2, 1/8.3, 1/8.4, 1/8.5, 1/8.6, 1/8.7, 1/8.8, 1/8.9, 1/9, 1/9.1, 1/9.2, 1/9.3, 1/9.4, 1/9.5, 1/9.6, 1/9.7, 1/9.8, 1/9.9, 1/10, 1/10.1, 1/10.2, 1/10.3, 1/10.4, 1/10.5, 1/10.6, 1/10.7, 1/10.8, 1/10.9, 1/11, 1/11.1, 1/11.2, 1/11.3, 1/11.4, 1/11.5, 1/11.6, 1/11.7, 1/11.8, 1/11.9, 1/12, 1/12.1, 1/12.2, 1/12.3, 1/12.4, 1/12.5, 1/12.6, 1/12.7, 1/12.8, 1/12.9 or 1/13.
More preferred mosaicisms are:
1/5, 1/5.1, 1/5.2, 1/5.3, 1/5.4, 1/5.5, 1/5.6, 1/5.7, 1/5.8, 1/5.9, 1/6, 1/6.1, 1/6.2, 1/6.3, 1/6.4, 1/6.5, 1/6.6, 1/6.7, 1/6.8, 1/6.9, 1/7, 1/7.1, 1/7.2, 1/7.3, 1/7.4, 1/7.5, 1/7.6, 1/7.7, 1/7.8, 1/7.9, 1/8, 1/8.1, 1/8.2, 1/8.3, 1/8.4, 1/8.5, 1/8.6, 1/8.7, 1/8.8, 1/8.9, 1/9, 1/9.1, 1/9.2, 1/9.3, 1/9.4, 1/9.5, 1/9.6, 1/9.7, 1/9.8, 1/9.9, 1/10, 1/10.1, 1/10.2, 1/10.3, 1/10.4, 1/10.5, 1/10.6, 1/10.7, 1/10.8, 1/10.9, 1/11, 1/11.1, 1/11.2, 1/11.3, 1/11.4, 1/11.5, 1/11.6, 1/11.7, 1/11.8, 1/11.9, or 1/12.
Still more preferred mosaicisms are:
1/7, 1/7.1, 1/7.2, 1/7.3, 1/7.4, 1/7.5, 1/7.6, 1/7.7, 1/7.8, 1/7.9, 1/8, 1/8.1, 1/8.2, 1/8.3, 1/8.4, 1/8.5, 1/8.6, 1/8.7, 1/8.8, 1/8.9, 1/9, 1/9.1, 1/9.2, 1/9.3, 1/9.4, 1/9.5, 1/9.6, 1/9.7, 1/9.8, 1/9.9, 1/10, 1/10.1, 1/10.2, 1/10.3, 1/10.4, 1/10.5, 1/10.6, 1/10.7, 1/10.8, 1/10.9, or 1/11.
Preferred ranges of ratios are 1/4 to 1/13; 1/5 to 1/12; 1/6 to 1/11, 1/7 to 1/10.5 or 1/7.5 to 1/10.
“Reporter proteins” as used herein, refers to any protein capable of generating directly or indirectly a detectable signal. Reporter proteins typically fluoresce, or catalyze a colorimetric, bioluminescence, or fluorescent reaction, and often are referred to as “color proteins,” “bioluminescent proteins” or “fluorescent proteins.” However, a reporter protein also can be non-enzymatic and non-fluorescent as long as it can be detected by another protein or moiety, such as a cell surface protein detected with a fluorescent ligand. A reporter protein also can be an inactive protein that is made functional through interaction with another protein that is fluorescent or catalyzes a reaction. Accordingly, any suitable reporter protein, as understood by one of skill in the art, could be used. The reporter protein can be selected from fluorescent protein, luciferase, alkaline phosphatase, β-galactosidase, β-lactamase, dihydrofolate reductase, ubiquitin, and variants thereof. Fluorescent proteins are useful for the recognition of gene cassettes that have or have not been successfully inserted and/or replaced, as the case may be. Fluid cytometry and fluorescence-activated cell sorting are suitable for detection. Examples of fluorescent proteins are well-known in the art, including, but not limited to Discosoma coral (DsRed), green fluorescent protein (GFP), enhanced green fluorescent protein (eGFP), cyano fluorescent protein (CFP), enhanced cyano fluorescent protein (eCFP), yellow fluorescent protein (YFP), enhanced yellow fluorescent protein (eYFP) and far-red fluorescent protein (e.g. mKate, mKate2, mPlum, mRaspberry or E2-crimson. See, for example, U.S. Pat. No. 9,816,110. Reporter proteins are encoded by polynucleotides, and are referred to herein as “reporter genes” or “reporter protein genes.” Reporter genes and proteins can be referred to generically as first (1), second (2), third (3), fourth (4), fifth (5), sixth (6), seventh (7), eighth (8), ninth (9), tenth (10), etc., as is apparent from the context of usage. Reporters can be considered a type of marker. “Color” or “fluorescent,” in their various grammatical forms, also can be used the more specifically refer to a reporter protein or gene. Where multiple plasmids are used in a transfection, the plasmids can collectively comprise the same reporter genes or different reporter genes.
“Selectable” or “selection” marker proteins include proteins conferring certain traits, including but not limited to drug resistance or other selective advantages. Selection markers can give the cell receiving the selectable marker gene resistance towards a certain toxin, drug, antibiotic or other compound and permit the cell to produce protein and propagate in the presence of the toxin, drug, antibiotic or other compound, and are often referred to as “positive selectable markers.” Suitable examples of antibiotic resistance markers include, but are not limited to, proteins that impart resistance to various antibiotics, such as kanamycin, spectinomycin, neomycin, gentamycin (G418), ampicillin, tetracycline, chloramphenicol, puromycin, hygromycin, zeocin, and/or blasticidin. There are other selectable markers, often referred to as “negative selectable markers,” which cause a cell to stop propagating, stop protein production and/or are lethal to the cell in the presence of the negative selectable marker proteins. Thymidine kinase and certain fusion proteins can serve as negative selectable markers, including but not limited to GyrB-PKR. See White et al., Biotechniques, 50: 303-309 (May 2011). Selectable marker proteins and corresponding genes can be referred to generically as first (1), second (2), third (3), fourth (4), fifth (5), sixth (6), seventh (7), eighth (8), ninth (9), tenth (10), etc., as is apparent from the context of usage. Where multiple plasmids are used in a transfection, the plasmids can collectively comprise the same selection marker genes or different selection marker genes.
The term “target cells” includes any cells in which expression of a nucleotide of interest is desired or tolerated. Preferably, target cells exhibit a “target,” such as a receptor, ligand, protein, including glycoproteins, and/or antigen, including complexes thereof, on their surface that allows the cell to be targeted. Exemplary targets are calcium voltage-gated channel auxiliary subunit gamma 1 (CACNG1), asialoglycoprotein receptor 1 (ASGR1), Fel d 1, ENTPD3, PTPRA, CD20, CD63 and Her2. Additional targets include GAB A, transferrin receptor, CD3, CD34, integrin, adipophilin, AIM-2, ALDHIAI, alpha-actinin-4, alpha-fetoprotein (“AFP”), ARTC1, B-RAF, BAGE-1, BCLX (L), BCR-ABL fusion protein b3a2, beta-catenin, BING-4, CA-125, CALCA, carcinoembryonic antigen (“CEA”), CASP-5, CASP-8, CD274, CD45, Cdc27, CDK12, CDK4, CDKN2A, CEA, CLPP, COA-1, CPSF, CSNKIAI, CTAGI, CTAG2, cyclin DI, Cyclin-AI, dek-can fusion protein, DKK1, EFTUD2, Elongation factor 2, ENAH (hMena), Ep-CAM, EpCAM, EphA3, epithelial tumor antigen (“ETA”), ETV6-AML1 fusion protein, EZH2, E6, E7, FGF5, FLT3-ITD, FN1, G250/MN/CAIX, GAGE-1,2,8, GAGE-3,4,5,6,7, GAS7, glypican-3, GnTV, gplOO/Pmel 17, GPNMB, HAUS3, Hepsin, HER-2/neu, HERV-K-MEL, HLA-A11, HLA-A2, HLA-DOB, hsp70-2, IDOI, IGF2B3, IL13Ralpha2, Intestinal carboxyl esterase, K-ras, Kallikrein 4, KIF20A, KK-LC-1, KKLC1, KM-HN-1, KMHN1 also known as CCDCl10, LAGE-1, LDLR-fucosyltransferase AS fusion protein, Lengsin, M-CSF, MAGE-A1, MAGE-A 10, MAGE-A12, MAGE-A2, MAGE-A3, MAGE-A4, MAGE-A6, MAGE-A9, MAGE-C1, MAGE-C2, malic enzyme, mammaglobin-A, MART2, MATN, MC1R, MCSP, mdm-2, ME1, Mel an-A/MART-1, Meloe, Midkine, MMP-2, MMP-7, MUC1, MUC5AC, mucin, MUM-1, MUM-2, MUM-3, Myosin, Myosin class I, N-raw, NA88-A, neo-PAP, NFYC, NY-BR-1, NY-ESO-I/LAGE-2, OA1, OGT, OS-9, P polypeptide, p53, PAP, PAX5, PBF, pml-RARalpha fusion protein, polymorphic epithelial mucin (“PEM”), PPP1 R3B, PRAME, PRDX5, PSA, PSMA, PTPRK, RAB 38/N Y-MEL-1, RAGE-1, RBAF600, RGS5, RhoC, R F43, RU2AS, SAGE, secernin 1, SIRT2, SNRPDi, SOX10, Sp17, SPA17, SSX-2, SSX-4, STEAPI, survivin, SYT-SSX1 or -SSX2 fusion protein, TAG-1, TAG-2, Telomerase, TGF-betaRII, TPBG, TRAG-3, Triosephosphate isomerase, TRP-1/gp75, TRP-2, TRP2-INT2, tyrosinase, tyrosinase (“TYR”), VEGF, WT1, XAGE-lb/GAGED2a, Kras, NY-ESOI, MAGE-A3, HPV E2, HPV E6, HPV E7, WT-1 antigen (in lymphoma and other solid tumors), ErbB receptors, Melan A [MARTI], gp 100, tyrosinase, TRP-1/gp 75, and TRP-2 (in melanoma); MAGE-1 and MAGE-3 (in bladder, head and neck, and non-small cell carcinoma); HPV EG and E7 proteins (in cervical cancer); Mucin [MUC-1](in breast, pancreas, colon, and prostate cancers); prostate-specific antigen [PSA](in prostate cancer); carcinoembryonic antigen [CEA](in colon, breast, and gastrointestinal cancers), and such shared tumor-specific antigens as MAGE-2, MAGE-4, MAGE-6, MAGE-10, MAGE-12, BAGE-1, CAGE-1,2,8, CAGE-3 TO 7, LAGE-1, NY-ESO-I/LAGE-2, NA-88, GnTV, TRP2-INT2, E6, E7, human glucagon receptor (hGCGR) and. I human ectonucleoside triphosphate diphosphohydrolase 3 (hENTPD3). Other targets can be selected by the person skilled in the art. See WO 2019/006046.
All numerical limits and ranges set forth herein include all numbers or values thereabout or there between of the numbers of the range or limit. The ranges and limits described herein expressly denominate and set forth all integers, decimals and fractional values defined and encompassed by the range or limit. Thus, a recitation of ranges of values herein are intended to serve as a way of referring individually to each separate value falling within the range, unless otherwise indicated herein, and each separate value is incorporated into the specification as if it were individually recited herein. All recited numbers or values expressly set forth and denominate all ranges created by the recited number or values.
The Spy:Tag:SpyCatcher system is used to engineer many covalently surface modified AAVs, and is used as an exemplar here.
In vitro conjugation reactions can occur when (1) AAV having SpyTag sequences in its capsid (“AAV-SpyTag”) and (2) SpyCatcher sequences bound to retargeting molecules (“SpyCatcher-Rm”), such as monoclonal antibodies (“SpyCatcher-Ab”) are mixed to allow formation of a joining isopeptide bond. Typically, the in vitro conjugation reaction is carried out after both the AAV-SpyTag and the SpyCatcher-Rm have been each separately and fully purified to remove contaminants, such as host cell proteins, which typically includes clarification, affinity capture chromatography, non-AAV viral inactivation, polishing chromatography, viral retentive filtration, and/or final formulation. However, following conjugation it is necessary to include an additional processing step to remove the unreacted SpyCatcher-Rm species to prevent them from being present in the final conjugated drug product. These challenges are met and overcome by the present inventions.
To achieve optimum conjugation (also referred to as “complete conjugation” depending on the purpose) of all available SpyTags on an AAV, such as AAV9, capsid surface with a SpyC-Rm species, reaction conditions should be optimized. Parameters affecting the speed and extent of the reaction are pH, temperature, reaction time, reactant concentration, and molar ratio of reactants. Suboptimal parameters can result in lower conjugation efficiency or degradative effects including aggregation or fragmentation of the AAV9-SpyT, SpyC-Rm, or conjugated AAV9-SpyT-SpyC-Rm species. Thus, there is a need to develop optimal reaction conditions as well as to be able to track the formation of conjugated species.
Another challenge is the variability in the AAV-SpyTag population in terms of the number of SpyTag peptides on the capsid. This is because AAV capsids are assembled stoichiometrically from 60 total subunits of viral proteins VP1, VP2 and VP3, and a subset of each of VP1, VP2 and VP3 proteins will have a SpyTag insertion. This leads to a distribution in the number of SpyTag-VP proteins present in each assembled capsid. The distribution of species can be either normal or non-normal. For example, if 1/10 of the VP proteins have SpyTag insertions, the assembled AAV molecules are expected to have a SpyTag on an estimated 60/10=6 VP proteins on average, but the actual number of SpyTags expressed can range from 0 to 20 or more. See
Thus, there are multiple species in the post-processing conjugation reaction mixture with significantly different size and charge characteristics which complicates purification: AAV-SpyTag is about 3700 kDa and each SpyCatcher-Ab, for example, is about 160 kDa (when the Ab is a monoclonal antibody), so a molecule with ten surface conjugations would be of size of about 5300 kDa.
Thus, there is a need to establish new approaches suitable for removal of unreacted SpyCatcher-Rm species. Challenges include making the methods applicable to removal of different SpyCatcher-Rm species (including but not limited to mAb, Fab, ScFv, bispecific mAb, trispecific mAb, Fc-fusion proteins and other Ab-related formats, such as half antibodies and other heavy chain and/or light chain combinations), which differ greatly in size, charge, isoelectric point (pI) and structure. A challenge with charge-based methods is that molecules with a high level of surface conjugation typically are more “Rm-like” in terms of their surface charge, and thus tend to co-elute with the SpyCatcher-Rm species in many different types of ion-exchange chromatography. Increasing similarity between the surface charge characteristics of conjugated AAV9-SpyT-SpyC-Rm to the unconjugated SpyC-Rm species is expected with increasing number of conjugations. This presents a significant purification challenge, as applying fractionation criteria to limit the presence of unreacted SpyCatcher-Rm in the elution pool would tend to lose the most heavily conjugated species as well, in addition to reducing the product yield. Thus, anion exchange chromatography methods, which are traditionally useful for AAV separations cannot be applied to this separation in a straightforward manner. Optimization of the ion-exchange process on different modalities (such as cation exchange or multimodal separations) and with different pH and salt conditions is useful to achieve partitioning between the free SpyC-Rm species and the conjugated AAV9-SpyT-SpyC-Rm species without significant co-elution.
Size-based methods would seem to be an option, particularly due to the apparently large difference in size between the conjugated AAV species (>3700 kDa) compared to the Ab species (<200 kDa). However, despite this difference, the tightly packed structure of AAV makes it very small compared to other viruses, and it has an effective radius of about 15 to 25 nm, while the SpyCatcher-Rm species are around 10-20 nm in radius. Thus, the difference in actual size is not very significant, leading to ineffectiveness of membrane-based separations on 100, 300 or 500 kDa membranes. Though large-scale size exclusion chromatography is a potential option, the method is difficult to scale due to very long column lengths and long processing times required. Other size-based chromatography resins developed for large-scale purification of viruses include CaptoCore400 and CaptoCore700 resins, but these cannot be directly used in AAV separations due to the small size of AAV (about 15-25 nm) compared to other viruses (such as Adenoviruses or Retroviruses which are greater than 60 nm). The small size of AAV makes it enter the pores of the resins, after which it can only be recovered in denatured form in the strip.
According to the inventions, buffers comprising at least one buffering agent, for example Bis-Tris-Propane, Bis-Tris, Tris, Glycine, Bicine, Tricine, Acetate, Borate, Citrate, Carbonate, Phosphate, Formate, Sulfate, Succinic acid, Sulfonic acid and variants thereof (for example, MES, PIPES, HEPES, CHES, CAPS, MMS, PBMS), Diethanolamine, or Imidazole can be used. Buffers also may comprise one or more organic or inorganic salts, such as NaCl, KCl, MgCl2, CaCl2), NH4Cl, Na2SO4, CaSO4, K2SO4, MgSO4, (NH4)2SO4, sodium citrate, and tetramethylammonium chloride (TMAC). The buffer may also comprise additives such as antibiotics and bacteriostatics (for example, sodium azide or AEBSF), protease inhibitors (for example E64), detergents and chaotropes (for example poloxamer, CHAPS, SDS, Triton, Tween, Urea), saturating agents (for example, bovine serum albumin), organic solvents (for example ethanol, isopropanol, acetonitrile), and other additives or excipients including chelatants, stabilizers, reducers (for example, DTT, TCEP, EDTA, Glycerol, Sucrose), and amino acids (for example, Histidine or Arginine).
The inventions are amenable to the use of anion exchange (AEX) media, which include monoliths, resins and membranes. AEX media includes AEX monoliths (for example, CIM QA, and CIM DEAE), AEX resins (for example, Capto Q, Capto Q ImpRes, CAPTO DEAE, POROS HQ, POROS XQ, POROS PI, POROS D, Fractogel EMD TMAE, Fractogel EMD DEAE, Nuvia Q, Nuvia HP-Q) and AEX membranes (for example, Sartobind STIC PA, Sartobind Q, Natrix Q).
The inventions also are amenable to the use of cation exchange (CEX) media, which include monoliths, resins and membranes. CEX media includes monoliths (for example CIM SO3), CEX resins (for example Capto S, Capto S ImpRes, Capto S ImpAct, Capto SP, POROS HS, POROS XS, CM Sepharose, Nuvia S, Nuvia HR-S), and CEX membranes (for example, Sartobind S, Natrix CH).
The inventions are amenable to the use of multimodal media, which includes monoliths and resins. Multimodal monoliths (for example PRIMA T, PRIMA S), multimodal resins (for example Capto Adhere, Capto MMC, CaptoCore400, Capto Adhere ImpRes, Capto MMC ImpRes, HEA HyperCel, PPA HyperCel, CMM HyperCel, MEP HyperCel, HA Ultrogel).
The inventions advantageously employ one or more “specific binding pairs,” also referred to as “protein:protein binding pairs.” An example is the SpyTag:SpyCatcher system. The SpyTag:SpyCatcher system was developed using the Streptococcus pyogenes second immunoglobulin-like collagen adhesion domain (CnaB2) from the fibronectin binding protein FbaB. An isopeptide bond can be formed spontaneously between the SpyTag protein and the SpyCatcher protein. The SpyCatcher peptide weighs about 15 kD. However, the SpyTag protein is only 13 amino acids long. The small size of the SpyTag protein makes it amenable for insertion into the AAV genome, which has a total packing capacity of only about 4.7 kilobases. These systems, such as SpyTag:SpyCatcher, allow a retargeting molecule to be bound to an AAV. See Examples 34, 35 and 36.
Other systems to facilitate retargeting include the SpyTag:SpyCatcher system is described in U.S. Pat. No. 9,547,003 and Zakeri et al. (2012) PNAS 109:E690-E697, is derived from the CnaB2 domain of the Streptococcus pyogenes fibronecting-binding protein FbaB. See WO 2019/006046.
SpyTag002:SpyCatcher002 system is described in Keeble et al (2017) Angew. Chem. Int. Ed. Engl 56:16521-25. See WO 2019/006046.
SpyTag003:Spy Catcher003 also has been created. Spy Tag002:SpyCatcher002 and SpyTag003:SpyCatcher003 are different iterations of Spy Tag:Spy Catcher.
The SnoopTag:SnoopCatcher system is described in Veggiani (2016) PNAS 113:1202-07. The D4 Ig-like domain of RrgA, an adhesion from Streptococcus pneumoniae, was split to form SnoopTag. Incubation of SnoopTag and SnoopCatcher results in a spontaneous isopeptide bond that is specific between the complementary proteins. Veggiani (2016), cited above. See WO 2019/006046.
The Isopeptag:Pilin-C specific binding pair was derived from the major pilin protein Spy0128 from Streptococcus pyogenes. (Zakeir and Howarth (2010) J. Am. Chem. Soc. 132:4526-27). See WO 2019/006046.
Other systems to facilitate retargeting can be based upon the splitting and engineering of RegA domain 4. These have led to SnoopTagJr:SnoopCatcher, DogTag:DogCatcher and Snoop Ligase. Other systems include Isopeptag:Pilin-N, SdyTg:SdyCatcher, Jo:In, 3kptTag: 3kptCatcher, 4oq1Taq/4oq1 Catcher, NGTag/Catcher, Rumtrunk/Mooncake, GalacTag, Cpe, Ececo, Corio and all others based upon isopeptide binding pairs or other covalent bonds.
Systems based upon truncated and/or other variations/derivatives have been developed to lessen the possibility of encountering neutralizing antibodies when the covalently surface modified AAV is administered to a subject. For example, the use of KTag (SEQ ID NO: 85) with SpyTag (SEQ ID NOS: 54 and 86) can be employed. The bonding between KTag and SpyTag can be undertaken using SpyLigase (SEQ ID NO: 61).
KTag is made by expressing the β-strand of CnaB2 containing a reactive Lys, which was separately expressed. (10 amino acids). SpyLigase (11 kDa) is based on SpyCatcher and made by removing amino acids from the β-strand that has the reactive Lys and using a circular permutation to replace amino acids from the C-terminus of CnaB2 with a Gly/Ser linker, which is followed by N-terminal CnaB2 amino acids. See Fierer et al., Proc. Nat'l Acad. Sci. 131577611.
Retargeting molecules (Rm) include Fc-containing proteins, such as antibodies and Fc-fusion proteins (including receptor Fc fusion proteins such as trap proteins). Fragments and derivatives of antibodies and Fc-fusion proteins also can be used as retargeting molecules.
All major antibody classes, namely IgG, IgA, IgM, IgD and IgE, can be used as retargeting molecules. IgG is a preferred class, and includes subclasses IgG1 (including IgG1λ and IgG1κ), IgG2, IgG3, and IgG4. Further antibody types include a human antibody, a humanized antibody, a chimeric antibody, a monoclonal antibody, a multispecific antibody, a bispecific antibody, a trispecific antibody, an antigen binding antibody fragment, a single chain antibody, a diabody, triabody or tetrabody, a Fab fragment or a F(ab′)2 fragment, an IgD antibody, an IgE antibody, an IgM antibody, an IgG antibody, an IgG1 antibody, an IgG2 antibody, an IgG3 antibody, or an IgG4 antibody.
Retargeting molecules bind to targets, which are antigens, receptors and/or ligands found on the surface of a target cell. Exemplary targets are calcium voltage-gated channel auxiliary subunit gamma 1 (CACNG1), asialoglycoprotein receptor 1 (ASGR1), Fel d 1, ENTPD3, PTPRA, CD20, CD63 and Her2. Additional targets include GAB A, transferrin. CD3, CD34, integrin, adipophilin, AIM-2, ALDHIAI, alpha-actinin-4, alpha-fetoprotein (“AFP”), ARTC1, B-RAF, BAGE-1, BCLX (L), BCR-ABL fusion protein b3a2, beta-catenin, BING-4, CA-125, CALCA, carcinoembryonic antigen (“CEA”), CASP-5, CASP-8, CD274, CD45, Cdc27, CDK12, CDK4, CDKN2A, CEA, CLPP, COA-1, CPSF, CSNKIAI, CTAGI, CTAG2, cyclin DI, Cyclin-AI, dek-can fusion protein, DKK1, EFTUD2, Elongation factor 2, ENAH (hMena), Ep-CAM, EpCAM, EphA3, epithelial tumor antigen (“ETA”), ETV6-AML1 fusion protein, EZH2, E6, E7, FGF5, FLT3-ITD, FN1, G250/MN/CAIX, GAGE-1,2,8, GAGE-3,4,5,6,7, GAS7, glypican-3, GnTV, gplOO/Pmel 17, GPNMB, HAUS3, Hepsin, HER-2/neu, HERV-K-MEL, HLA-A11, HLA-A2, HLA-DOB, hsp70-2, IDOI, IGF2B3, IL13Ralpha2, Intestinal carboxyl esterase, K-ras, Kallikrein 4, KIF20A, KK-LC-1, KKLC1, KM-HN-1, KMHN1 also known as CCDCl10, LAGE-1, LDLR-fucosyltransferase AS fusion protein, Lengsin, M-CSF, MAGE-A1, MAGE-A 10, MAGE-A12, MAGE-A2, MAGE-A3, MAGE-A4, MAGE-A6, MAGE-A9, MAGE-C1, MAGE-C2, malic enzyme, mammaglobin-A, MART2, MATN, MC1R, MCSP, mdm-2, ME1, Mel an-A/MART-1, Meloe, Midkine, MMP-2, MMP-7, MUC1, MUC5AC, mucin, MUM-1, MUM-2, MUM-3, Myosin, Myosin class I, N-raw, NA88-A, neo-PAP, NFYC, NY-BR-1, NY-ESO-I/LAGE-2, OA1, OGT, OS-9, P polypeptide, p53, PAP, PAX5, PBF, pml-RARalpha fusion protein, polymorphic epithelial mucin (“PEM”), PPP1 R3B, PRAME, PRDX5, PSA, PSMA, PTPRK, RAB 38/N Y-MEL-1, RAGE-1, RBAF600, RGS5, RhoC, R F43, RU2AS, SAGE, secernin 1, SIRT2, SNRPD1, SOX10, Spl7, SPA17, SSX-2, SSX-4, STEAPI, survivin, SYT-SSX1 or -SSX2 fusion protein, TAG-1, TAG-2, Telomerase, TGF-betaRll, TPBG, TRAG-3, Triosephosphate isomerase, TRP-1/gp75, TRP-2, TRP2-INT2, tyrosinase, tyrosinase (“TYR”), VEGF, WT1, XAGE-lb/GAGED2a, Kras, NY-ESOI, MAGE-A3, HPV E2, HPV E6, HPV E7, WT-1 antigen (in lymphoma and other solid tumors), ErbB receptors, Melan A [MARTI], gp 100, tyrosinase, TRP-1/gp 75, and TRP-2 (in melanoma); MAGE-1 and MAGE-3 (in bladder, head and neck, and non-small cell carcinoma); HPV EG and E7 proteins (in cervical cancer); Mucin [MUC-1](in breast, pancreas, colon, and prostate cancers); prostate-specific antigen [PSA](in prostate cancer); carcinoembryonic antigen [CEA](in colon, breast, and gastrointestinal cancers), and such shared tumor-specific antigens as MAGE-2, MAGE-4, MAGE-6, MAGE-10, MAGE-12, BAGE-1, CAGE-1,2,8, CAGE-3 TO 7, LAGE-1, NY-ESO-I/LAGE-2, NA-88, GnTV, TRP2-INT2, E6, E7, human glucagon receptor (hGCGR) and. I human ectonucleoside triphosphate diphosphohydrolase 3 (hENTPD3). Other targets can be selected by the person skilled in the art. See WO 2019/006046.
The inventions further provide mutations in the VP1 Protein to lower the AAV preferential transduction of the liver. For AAV9, preferred The mutations include N272A and W503A substitutions, where alanine replaces both asparagine at position 272 of VP1 and tryptophan at position 503 of VP1. One or both of the mutations can be undertaken in the VP1 protein. Optionally, other amino acids, such as glutamic acid, serine or others, can be used instead of alanine for substitution. Other detargeting mutation sites include, but are not limited to, N470, D271, and Y446.
The inventions provide exemplary mutations for use with AAVs as follows, which for each serotype can be utilized singly or in combinations
These and others are set forth in the chart below:
Other mutations and detargeting approaches, such as variable loop swaps, are disclosed in publications or otherwise available See, for example, Shen et al., Molecular Therapy 15: 1955-62 (2007). These technologies can be used according to the inventions. Detargeting mutations are optional.
The present inventions are amenable for production in mammalian cell culture. Exemplary cell lines are CHO, Per.C6 cells, Sp2/0 cells, HeLa and HEK293 cells. CHO cells include, but are not limited to, CHO-ori, CHO-K1, CHO-s, CHO-DHB11, CHO-DXB11, CHO-K1 SV, and mutants and variants thereof. HEK293 cells include, but are not limited, to HEK293, HEK293A, HEK293E, HEK293F, HEK293FT, HEK293FTM, HEK293H, HEK293MSR, HEK293S, HEK293SG, HEK293SGGD, HEK293T and mutants and variants thereof. Adherent HEK 293 cells also can be used for production of covalently surface modified AAV according to the inventions. HEK 293 suspension cultured cells were derived from HEK 293 adherent cells. See Maim et al., Scientific Reports 10: 18996 (2020). Other suitable cells include, but are not limited to BHK (baby hamster kidney) cells, HeLa cells and Human Amniotic cells, such as Human Amniotic Epithelial cells. Other cell types for production include insect cells, such as Sf9.
As described above,
Promoters that are functional in eukaryotic cells, such as AAV P5, CMV, lac, CAG, CAGG, and SV40 promoters, are provided where needed to initiate transcription, but are not shown. Additionally, internal ribosome entry sites (IRESs), recombinase recognition sites (RRSs), enhancers and operators optionally also can be included, but are not shown. For constructing plasmids having large polynucleotides, such as those encoding antibody chains, intronic selection can be employed, preferably with a second selection marker gene that is different from the first selection marker gene.
Reaction time for the conjugation should be an incubation of at least 0.5, 1, 1.5, 2, 2.5, 3, 3.5 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, 10, 10.5, 11, 11.5, 12, 12.5, 13, 13.5, 14, 14.5, 15, 15.5, 16, 16.5, 17, 17.5, 18, 18.5, 19, 19.5, 20, 20.5, 21, 21.5, 22, 22.5, 23, 23.5, 24, 24.5, 25, 25.5, 26, 26.5, 27, 27.5, 28, 28.5, 29, 2 9.5, 30, 30.5, 31, 31.5, 32, 32.5, 33, 33.5, 34, 34.5, 35, 35.5, 36, 36.5, 37, 37.5, 38, 38.5, 39, 39.5, 40, 40.5, 41, 41.5, 42, 42.5, 43, 43.5, 44, 44.5, 45, 45.5, 46, 46.5, 47, 47.5, 48, 48.5, 49, 49.5, 50, 50.5, 51, 51.5, 52, 52.5, 53, 54.5, 54, 54.5, 55, 55.5, 56, 56.5, 57, 57.5, 58, 58.5, 59, 59.5, 60, 60.5, 61, 61.5, 62, 62.5, 63, 63.5, 64, 64.5, 65, 65.5, 66, 66.5, 67, 67.5, 68, 68.5, 69, 69.5, 70, 70.5, 71, 71.5, 72 or more hours (4 to 72 hours or more). Reaction temperature should be about 4° C. to about 40° C., preferably room temperature (19° C. to 25° C., preferably about 22° C.). Molar ratio of the reactants, namely (AAV-first member) to (retargeting molecule-second cognate member) should be 1:20, 1:25 or preferably greater differences. Preferably, the molar ratio should be 1:30 to 1:1000 (includes all ratios there between) to maximize conjugation efficiency. Ratios of 1:30 to 1:300 (includes all ratios there between) are more preferred. See Example 12. Other parameters are set forth below in Table 2:
Significant molar excess of SpyCatcher-Rm is typically beneficial to ensure optimum conjugation of SpyTag-AAV species, where the molar excess can range from 20 to 1000-fold, preferably 30 to 300 fold, and most preferably 300 fold. The inventions provide for complete conjugation of first members of a specific binding pair are bound to second cognate members of the specific binding pair. The inventions provide for a desired conjugation of a level of conjugation of at least 10%, at least 20%, at least 30%, and at least 40%. Preferred levels are at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or up to 100%, any of which can be considered complete depending on the purpose. Optimal conjugation (also known as complete conjugation based on the purpose) is typically desired by the skilled person and preferably will be about 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%.
Ranges of desired conjugation levels can be 10% to 100%, 20% to 99%, 30% to 99%, 40% to 99%, 50% to 99%, 60% to 99%, 70% to 99%, 80% to 99%, or 90% to 99%. Preferred ranges of desired conjugation levels can be 40% to 100%, 40% to 99%, 45% to 95%, 50% to 95%, 55% to 90%, 60% to 90%, 65% to 95%, 65% to 90%, 70% to 90%, 75% to 90%, 75% to 85%, 75% to 80%, or 80% to 85%, and any ranges made by combining these ranges, such as 65% to 85%, for example. More preferably, the range is 65% to 95%.
The percentages of conjugation can be ascertained by a variety of separation techniques, including size exclusion chromatography (SEC) or asymmetrical flow field-flow fractionation (A4F). SEC and A4F would be combined with a detector, such as UV, fluorescence or a multi-angle light scattering (MALS) detector. Due to the molar excess of SpyCatcher-Rm, a significant amount of SpyCatcher-Rm will need to be removed following the conjugation reaction.
When starting the conjugation reaction, the AAV-SpyT (FM) should be added to the vessel prior to the SpyC (SCM)-RM. AAV-SpyT should be added first but not in ratio excess due to low concentration of AAV to Ab.
In order to drive the conjugation reaction to completion, it can be beneficial to provide the SpyC-RM in molar excess of the AAV-SpyT, where the excess can be up to 1000-fold. In such cases, once the conjugation reaction is completed, there will remain a significant amount of excess of unconjugated SpyCatcher-Rm following conjugation. This can be due to the SpyCatcher-Rm being added in molar excess to the number of available SpyTag binding sites on the AAV and/or due to incomplete reactions.
Additives can be included in the conjugation reaction to modify conditions and enhance conjugation efficiency. Additives include, but are not limited to, dimethylsulfoxide (DMSO), L-glutamic acid monosodium salt (L-glutamic acid), arginine, sorbitol, urea, isopropyl alcohol, (IPA) and sodium thiocyanate (NaSCN).
The inventions are further described by the following examples, which do not limit the inventions in any manner. The order of performance of the below examples can be altered or combined as determined by the person of skill in the art in view of the teachings and data contained herein.
The AAV serotype sequences and component sequence types used according to the inventions used in the Description, Summary, Examples and Figures are representative and not limiting. Any AAV serotype sequence and component sequence can be used according to the inventions. These include but are not limited to sequences for promoters, markers, specific binding pairs, helper proteins, AAV sequences (Cap, Rep and ITRs), retargeting molecules, detargeting mutations, IRESs, RRSs, introns, operators, enhancers and polydenylation signals.
In vitro conjugation can use a four plasmid transfection system (quad transfection) for cells to produce for rAAV comprising SpyTag. For example, the plasmids could be: (1) plasmid containing a GOI flanked by AAV inverted terminal repeats (pGOI); (2) plasmid containing AAV rep and cap genes (pRC); (3) plasmid containing AAV rep gene and cap gene with a polynucleotide encoding SpyTag peptide inserted in frame into the cap gene (pRC-SpyT); and (4) a plasmid comprising helper polynucleotide sequences, such as adenovirus helper genes, in a first bioreactor (pHELP). See
For retargeting molecules, such as antibodies, cells (for example, HEK 293) can be transfected with two plasmids, such as: plasmid encoding an antibody heavy chain sequence in frame with a SpyCatcher sequence and (2) a plasmid encoding an antibody light chain sequence in a second bioreactor. The cells will produce an antibody bound to SpyCatcher.
In addition to the use of monospecific monoclonal antibodies as retargeting molecules, antibody derivatives and fragments can also be employed as retargeting molecules. Antibody fragments and derivatives include, but are not limited to, Fab, ScFv-Fc, dAB-Fc, half antibodies bispecifics, tri-specifics, IgG-ScFv, IgG-dab, ScFV-Fc-ScFV and other combinations of heavy and/or light chains. Fc-fusion proteins, such as trap proteins, and well as mini-trap proteins also can be used a retargeting molecules.
Eukaryotic cells, preferably mammalian cells, such as human and rodent cells, can be used to produce the rAAV and the retargeting molecules, such as antibodies. The cell types can be the same or different. For example, rAAV can be produced in human cells, such as HEK 293 cells and retargeting molecules in rodent cells, such as CHO cells, and conversely rAAV can be produced in rodent cells (for example, CHO cells) and retargeting molecules in human cells (for example, HEK 293 cells). In other approaches, both rAAV and retargeting molecules can be both produced in human cells or both produced in rodent cells (for example, CHO cells), depending on the preference of the person skilled in the art. Insect cells such as Sf9 can alternatively be used for producing the rAAV, retargeting molecules, or both.
The rAAV and retargeting antibody produced as described above can each be purified by one or more of depth filtration, tangential flow filtration (TFF), affinity capture polishing, and viral retentive filtration. TFF is a generic term and includes, but is not limited to, ultrafiltration/diafiltration (UF/DF) and newer approaches such as single-pass tangential flow filtration (SPTFF).
Conventional TFF can be employed, which uses a batch approach and repeated cycling through the membrane to create a permeate and a retentate. Alternatively, single-pass TFF can be employed to allow for a continuous process. According to the inventions, TFF can advantageously employ permeate pumps to reduce TMP buildup and flux decline. Although not to be bound by any hypothesis or theory, it is believed that detergents, such as Tweens, build up on the retentate side of a TFF membrane and cause TMP buildup and flux decline. Single-Pass TFF units are available from Pall/Cytiva, Repligen and Millipore. Thereafter, the conjugation reaction can be undertaken between the rAAV and the retargeting antibody.
Optimal (complete) conjugation occurs when most available first members of a specific binding pair are bound to second cognate members of the specific binding pair. For example,
The inventions provide for Optimal conjugation (also referred to as complete conjugation) of first members of a specific binding pair are bound to second cognate members of the specific binding pair. Preferably, optimal conjugation (also known as complete conjugation based on the purpose of the skilled person) is typically desired and preferably will be about 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%.
Ranges of desired conjugation levels can be 10% to 100%, 20% to 99%, 30% to 99%, 40% to 99%, 50% to 99%, 60% to 99%, 70% to 99%, 80% to 99%, or 90% to 99%. Preferred ranges of desired conjugation levels can be 40% to 100%, 40% to 99%, 45% to 95%, 50% to 95%, 55% to 90%, 60% to 90%, 65% to 95%, 65% to 90%, 70% to 90%, 75% to 90%, 75% to 85%, 75% to 80%, or 80% to 85%, and any ranges made by combining these ranges, such as 65% to 85%, for example. More preferably, the range is 65% to 95%.
The percentages of conjugation can be ascertained by a variety of separation techniques, including size exclusion chromatography (SEC) or asymmetrical flow field-flow fractionation (A4F). SEC and A4F would be combined with a detector, such as UV, fluorescence, or a multi-angle light scattering (MALS) detector.
The data for the experiment of
Multimodal binding and size separation bead chromatography exchange to separate a covalently surface modified adeno-associated virus species from unconjugated antibody species. More specifically, the multimodal binding and size separation bead chromatography are functionalized with an octyl amine that is hydrophobic and positively charged, and also include a matrix that provides size exclusion, such as Capto™ Core 400 or Capto™ Core 700.
Covalently surface modified adeno-associated virus species are expected in the flow through and wash (FTW). Unconjugated antibody species are expected to enter resin and be bound tightly, and removed during the strip phase. Loading was 5×1013 to 1×1014 cp/ml beads over 3 minutes and room temperature.
The percentage of conjugated species is measured by relative peak area between the AAV9-SpyT peak at about 8.3 min RT and the conjugated species peaks at 6.5-8.0 RT on the size exclusion chromatograms, and tracked in the chart on the right. All batches reached 80% conjugation, but Batch 1 took 48 hours to reach 80% conjugation while Batches 2 and 3 took 24 hours.
Molar AAV:Ab (antibody with two SpyC, bispecific antibody with one SpyC, or Fab with one SpyC, as described above) ratios of 1:1, 1:6, 1:15, 1:30, 1:300 and 1:1000 were tested. The results showed that ratios of 1:30 to 1:1000 of AAV to Ab resulted in greater levels of conjugation. Table 5 below shows that ratios of 1:30 to 1:1000 of AAV to Ab also resulted in lower percentages of high molecular weight species, and that the use of antibodies with only one SpyC (
The MOI refers to the ratio of infectious agents (in this case, AAV9-SpyT-SpyC-Ab molecules) to target cells used in the assay. AAV particles are added to the cells in different amounts so that the transduction effect can be compared at different levels of infection, as there may be some levels where no signals are observed. The data in this figure shows results from the 4E4 and 2E5 MOI conditions on this transduction assay, showing that all conjugated viruses performed comparably at both these conditions regardless of antibody format or conjugation reaction pH.
Additional data is provided in Table 6.
The low endotoxin results show that the endotoxin is not confounding the results of cell-based assays (high endotoxin can be detrimental to cells). The data indicate that transduction efficiency post-conjugation was not significantly affected by different pH (5 or 8). However, a higher percentage of conjugation was achieved using pH 5 during the conjugation reaction.
Cell lysis is an early part of AAV production and purification. Detergents can be used to lyse cells to release proteins and viruses contained with the cell. Detergents to lyse cells are usually considered mild detergents and include: sodium dodecyl sulphate (SDS), NP-40, Tweens (for example 20 and 80), Tritons (for example X-100 and X-114), CHAPS, CHAPSO, Brij (for example, 35 and 58), Octyl thioglucoside, Octyl Glucoside, deoxycholate, and alkyl sulfates, for example.
Depth filtration typically follows lysis. Downstream processing starts with depth filtration/chromatographic clarification to remove cellular debris after cell lysis, which is followed by affinity capture and non-AAV viral inactivation. Next, polishing 1 and 2 occurs using ion exchange. This is followed by viral retentive filtration and then tangential flow filtration. Here, SpyC-mAb/Fab is formed, which also is depicted in
Next, unconjugated retargeting molecules (here mAb or Fab, are removed via chromatography, and then TFF for enrichment of the covalently surface modified AAV. Enrichment can result in greater than 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or more of unconjugated retargeting molecule species being separated from the covalently surface modified AAV species. Enrichment can result in reducing the presence of unconjugated retargeting molecule species to undetectable levels. The covalently surface modified AAV is schematically depicted in
An exemplary downstream protocol for a 500 L bioreactor would be as follows:
Table 7 below identifies titers and yields that would results in worst case for doses per batch. Table 8 below identifies titers and yields per batch under different parameters and conditions that would be expected.
1Assuming 50-fold excess of SpyC-mAb required
2Assuming systemic 1 × 1013 vg/kg dosing in 80 kg adults
1Assuming 300-fold excess of SpyC-mAb required
2Assuming systemic 5 × 1012 vg/kg dosing in 80 kg adults
The following additives were selected and tested to determine their effects on conjugation. The additives were selected due to potential effects on the charge or hydrophobicity of the reaction molecules or the ionic characteristics of the reaction mixture:
Isopropyl alcohol should preferably be added at a concentration above 5%. Concentrations include about 5.5%. 6%, 6.5%, 7%, 7.5%, 8%, 8.5%, 9%, 9.5%, 10%, 10.5%, 11%, 11.5%, 12%, 12.5%, 13%, 13.5%, 14%, 14.5%, 15%, 15.5%, 16%, 16.5%, 17%, 17.5%, 18%, 18.5%, 19%, 19.5%, 20%, 20.5%, 21%, 21.5%, 22%, 22.5%, 23%, 23.5%, 24%, 24.5%, 25% or more.
The following discussion concerns Covalently Surface Modified Adeno-Associated Viruses and uses AAV with the SpyTag-Spy-Catcher System and having monoclonal antibodies (or fragments or derivative thereof) as retargeting molecules (AAV-SpyT-SpyC-Ab) as an exemplar. Any specific binding pair (that is, a first member and second cognate member) can be used according to the inventions.
When producing AAV-SpyT-SpyC-Ab, three important aspects are (1) the number of SpyT (an exemplary FM) on the AAV capsid, which directly affects the number of SpyC-Abs that can be covalently attached to the AAV capsid, (2) the format of SpyC-Ab to be covalently attached. Formats include, but are not limited to (i) a mAb with two SpyC in the constant regions, (ii) an antibody with a single SpyC on a constant region (referred to as a “bispecific” here), (iii) a Fab with a single SpyC on the variable heavy chain, or (iv) other options (such as ScFv), and (3) the molar ratio of AAV to retargeting molecule during conjugation.
To further explain the first aspect, the number of SpyT (an example of a first member (FM)) on the AAV capsid can be modified by adjusting the ratio of the pRC and the pRC-SpyT plasmids that are co-transfected into the bioreactor along with the pGOI and pHelper plasmids. For example, when 1/10 of all the pRC plasmids transfected are pRC-SpyT plasmids, the AAV capsid is expected to have an average of 6 SpyT, as 1/10 of the 60 viral proteins are expected to have a SpyT (1/10×60=6). Similarly, a transfection ratio of 1/4 is expected to result in 15 SpyT per AAV capsid (1/4×60=15), and a transfection ratio of 1/30 is expected to result in 2 SpyT per AAV capsid (1/30×60=2), as the capsid is stoichiometrically assembled inside the cell using the available viral proteins. The ratio of pRC-SpyT to pRC plasmids during transfection is referred to as the “mosaicism” of the AAV capsid, with “higher mosaicisms” such as 1/4 resulting in higher SpyT on the AAV capsids on average, and “lower mosaicisms” such as 1/30 resulting in fewer SpyT on the AAV capsids on average. Thus, where the ratio of pRC-FM to pRC plasmids is a larger fractional value, the mosaicism will be higher. As explained above, 1/4 is a larger fractional value than 1/30.
It is desirable to optimize the mosaicism when producing AAV-SpyT-SpyC-Ab molecules. Firstly, it has shown that when an AAV has too many Abs conjugated on its surface, it can result in a negative impact on transduction efficiency and can lower the potency of the therapeutic (See Example 9 showing how higher levels of Ab conjugation resulted in lower transduction efficiency). However, since the capsid is stoichiometrically assembled, it is desirable for the mosaicism to not be too low in order to prevent the formation of a high proportion of AAV capsids without even a single SpyT, which prevents conjugation. For example, with a mosaicism of 1/10, it is difficult to achieve optimal (i.e., ‘complete’ conjugation), which suggests that there is a proportion of AAV capsids without any or without accessible SpyT sites. See, for example,
The second aspect requiring optimization is selecting the format of SpyC-Ab to be conjugated to the AAV capsids. There are advantages and disadvantages to various formats and a combination of in vitro and in vivo data can help to make the decision. For the mAb format, due to the presence of two SpyC, there is the potential for each SpyC to bind to a different AAV capsid, resulting in the formation of “daisy-chain” species such as AAV-SpyT-SpyC-mAb-SpyC-SpyT-AAV-, etc. These species have high molecular weight, are undesirable, and have been observed to form particularly when carrying out the in vitro conjugation reaction between AAV-SpyT and SpyC-mAb in a limiting molar ratio.
A way to avoid the formation of these species is to use a bispecific format with only one SpyC. However, due to the potential negative effect of high levels of surface conjugation on viral potency, the bispecific format also may not be ideal due to increasing the number of SpyC-Abs conjugated on the surface of each capsid. The Fab format may be beneficial to achieve higher levels of conjugation with maximum potency due to the small size of Fabs (˜50 kDa) compared to mAbs (˜150 kDa).
The third aspect for optimization is the molar ratio of AAV to Retargeting Molecule (for example, an antibody.
The bottom section of
The Batch TFF approach can take multiple days (for example, 2 days) due to the repeated cycling through the conventional TFF unit to achieve concentration prior to further purification. The SPTFF approach is a continuous approach, and is significantly faster than the Batch TFF approach, and can be performed in several hours, such as 3 to 5 hours. The SPTFF approach provides faster concentration, while minimizing sheer stress and damage to AAVs. The SPTFF approach also is amenable to the use of Process Analytical Technology (PAT) and automation.
For further comparison,
The cell lysis step, typically using a detergent such as Tween-20, typically takes up to about two hours, and is depicted as the same for both the Batch and the SPTFF (continuous) process. Following lysis, clarification takes about 1 hour. The processes then diverge at the TFF step.
For the Batch process, TFF takes about 3 hours per batch due to the repeated cycling. Not until a batch is complete can the concentrated biological material in a buffer be passed on the affinity capture, which takes about 2 to 3 hours per batch. Because multiple batches are required, the affinity chromatography is typically not completed until the next day.
For the Continuous process, clarification, SPTFF and affinity capture can take place substantially simultaneously. Biological material continuously flows to clarification (about 1 hour), SPTFF (about 1½ hours) and affinity capture (about 2 hours to 3 hour). Accordingly, when an early portion of biological material is in affinity capture, later portions of biological material are in SPTFF or clarification.
With Batch TFF, flux decline can be address by increasing processing time. However, with SPTFF immediate control is desired.
Advantages and Aspects of SPTFF include:
Viral genome to capsid percentage exhibited slightly more variation, and ranged from 11% to 17% full capsids. amongst the three capsid types.
The following examples provide teachings on how to produce covalently surface modified AAV of all serotypes using exemplary sequences according to the inventions. Pertinent polynucleotide and amino acid sequences are widely available in the published literature, and therefore the inventions are not limited to the polynucleotide and amino acid sequences set forth in the specification and the sequence listing.
The below examples set forth rAAV comprising VP1, VP2 and/or VP3 protein fused to a first member of a specific binding pair. The rAAV can be later conjugated to a retargeting molecule fused to a second cognate member of the specific binding pair. Use of SpyTag and SpyCatcher as specific binding pairs as disclosed herein provides teachings and data that is applicable to the use of other specific binding pairs, including fragments and derivative of specific binding pairs, disclosed herein or otherwise known in the field. Conjugation is disclosed throughout, and an exemplary overview can be found at
Covalently surface modified AAV1 can be made by transfecting a cell with plasmids as set forth below, followed by culturing the transfected cells and harvesting the resulting AAV, and then conjugating the resulting AAV with a second cognate member (SCM) that is fused to a retargeting molecule The first chart below uses SpyTag as the first member of a specific binding pair, and Adenovirus Helper Genes. Modifications can be undertaken as disclosed below:
(1) Plasmid pGOI can comprise one or more genes that are desired to be expressed in covalently surface modified AAV1.
(2) Plasmids pRC-FM can be modified for other specific binding pairs. The first member (FM) should be complementary to a second cognate member (SCM) that is fused to a retargeting molecule (for example, an antibody, as well derivatives and fragments thereof, and still other molecules). See Definitions and Description sections of the Detailed Description, the Figures and associated text for “retargeting” and “retargeting molecules”. The populations of FMs and SCMs can be homogenous or heterogeneous as long as the selected FMs can come in contact with appropriate SCMs so that binding can occur.
(3) Detargeting mutations are optional and can be undertaken as disclosed herein and in publications. See Definitions and Description sections of the Detailed Description, the Figures and associated text for “detargeting” and “detargeting mutations”.
(4) To lessen the possibility of encountering neutralizing antibodies when the covalently surface modified AAV is administered to a subject, KTag can be used as an SCM to bind with SpyTag (FM) (SEQ ID NOS: 54 and 86). KTag and SpyLigase are based upon SpyCatcher. KTag (SEQ ID NO: 85) has only 10 amino acids, which renders it less immunogenic. KTag can be bound to SpyTag in the presence of SpyLigase (SEQ ID NO: 61). The SpyLigase can be removed by subsequent purification, such as by chromatography and/or filtration so that the SpyLigase will not have an appreciable presence in the final drug substance.
(5) Preferred mosaicisms are as follows: 1/1, 1/1.1, 1/1.2, 1/1.3, 1/1.4, 1/1.5, 1/1.6, 1/1.7, 1/1.8, 1/1.9, 1/2, 1/2.1, 1/2.2, 1/2.3, 1/2.4, 1/2.5, 1/2.6, 1/2.7, 1/2.8, 1/2.9, 1/3, 1/3.1, 1/3.2, 1/3.3, 1/3.4, 1/3.5, 1/3.6, 1/3.7, 1/3.8, 1/3.9, 1/4, 1/4.1, 1/4.2, 1/4.3, 1/4.4, 1/4.5, 1/4.6, 1/4.7, 1/4.8, 1/4.9, 1/5, 1/5.1, 1/5.2, 1/5.3, 1/5.4, 1/5.5, 1/5.6, 1/5.7, 1/5.8, 1/5.9, 1/6, 1/6.1, 1/6.2, 1/6.3, 1/6.4, 1/6.5, 1/6.6, 1/6.7, 1/6.8, 1/6.9, 1/7, 1/7.1, 1/7.2, 1/7.3, 1/7.4, 1/7.5, 1/7.6, 1/7.7, 1/7.8, 1/7.9, 1/8, 1/8.1, 1/8.2, 1/8.3, 1/8.4, 1/8.5, 1/8.6, 1/8.7, 1/8.8, 1/8.9, 1/9, 1/9.1, 1/9.2, 1/9.3, 1/9.4, 1/9.5, 1/9.6, 1/9.7, 1/9.8, 1/9.9, 1/10, 1/10.1, 1/10.2, 1/10.3, 1/10.4, 1/10.5, 1/10.6, 1/10.7, 1/10.8, 1/10.9, 1/11, 1/11.1, 1/11.2, 1/11.3, 1/11.4, 1/11.5, 1/11.6, 1/11.7, 1/11.8, 1/11.9, 1/12, 1/12.1, 1/12.2, 1/12.3, 1/12.4, 1/12.5, 1/12.6, 1/12.7, 1/12.8, 1/12.9, 1/13, 1/13.1, 1/13.2, 1/13.3, 1/13.4, 1/13.5, 1/13.6, 1/13.7, 1/13.8, 1/13.9, 1/14, 1/14.1, 1/14.2, 1/14.3, 1/14.4, 1/14.5, 1/14.6, 1/14.7, 1/14.8, 1/14.9, 1/15, 1/15.1, 1/15.2, 1/15.3, 1/15.4, 1/15.5, 1/15.6, 1/15.7, 1/15.8, 1/15.9, 1/16, 1/16.1, 1/16.2, 1/16.3, 1/16.4, 1/16.5, 1/16.6, 1/16.7, 1/16.8, 1/16.9, 1/17, 1/17.1, 1/17.2, 1/17.3, 1/17.4, 1/17.5, 1/17.6, 1/17.7, 1/17.8, 1/17.9, 1/18, 1/18.1, 1/18.2, 1/18.3, 1/18.4, 1/18.5, 1/18.6, 1/18.7, 1/18.8, 1/18.9, 1/19, 11/9.1, 1/19.2, 1/19.3, 1/19.4, 1/91.5, 1/19.6, 1/19.7, 1/19.8, 1/19.9, 1/20, 1/21, 1/21.1, 1/21.2, 1/21.3, 1/21.4, 1/21.5, 1/21.6, 1/21.7, 1/21.8, 1/21.9, 1/22, 1/22.1, 1/22.2, 1/22.3, 1/22.4, 1/22.5, 1/22.6, 1/22.7, 1/22.8, 1/22.9, 1/23, 1/23.1, 1/23.2, 1/23.3, 1/23.4, 1/23.5, 1/23.6, 1/23.7, 1/23.8, 1/23.9, 1/24, 1/24.1, 1/24.2, 1/24.3, 1/24.4, 1/24.5, 1/24.6, 1/24.7, 1/24.8, 1/24.9, 1/25, 1/25.1, 1/25.2, 1/25.3, 1/25.4, 1/25.5, 1/25.6, 1/25.7, 1/25.8, 1/25.9, 1/26, 1/26.1, 1/26.2, 1/26.3, 1/26.4, 1/26.5, 1/26.6, 1/26.7, 1/26.8, 12/6.9, 1/27, 1/27.1, 1/27.2, 1/27.3, 1/27.4, 1/27.5, 1/27.6, 1/27.7, 1/27.8, 1/27.9, 1/28, 1/28.1, 1/28.2, 1/28.3, 1/28.4, 1/28.5, 1/28.6, 1/28.7, 1/28.8, 1/28.9, 1/29, 1/29.1, 1/29.2, 1/29.3, 1/29.4, 1/29.5, 1/29.6, 1/29.7, 1/29.8, 1/29.9, 1/30, 1/30.1, 1/30.2, 1/30.3, 1/30.4, 1/30.5, 1/30.6, 1/30.7, 1/30.8, 1/30.9, 1/31, 1/31.1, 1/31.2, 1/31.3, 1/31.4, 1/31.5, 1/31.6, 1/31.7, 1/31.8, 1/31.9, 1/32, 1/32.1, 1/32.2, 1/32.3, 1/32.4, 1/32.5, 1/32.6, 1/32.7, 1/32.8, 1/32.9, 1/33, 1/33.1, 1/33.2, 1/33.3, 1/33.4, 1/33.5, 1/33.6, 1/33.7, 1/33.8, 1/33.9, 1/34, 1/34.1, 1/34.2, 1/34.3, 1/34.4, 1/34.5, 1/34.6, 1/34.7, 1/34.8, 1/34.9, 1/35, 1/35.1, 1/35.2, 1/35.3, 1/35.4, 1/35.5, 1/35.6, 1/35.7, 1/35.8, 1/35.9, 1/36, 1/36.1, 1/36.2, 1/36.3, 1/36.4, 1/36.5, 1/36.6, 1/36.7, 1/36.8, 1/36.9, 1/37, 1/37.1, 1/37.2, 1/37.3, 1/37.4, 1/37.5, 1/37.6, 1/37.7, 1/37.8, 1/37.9, 1/38, 1/38.1, 1/38.2, 1/38.3, 1/38.4, 1/38.5, 1/38.6, 1/38.7, 1/38.8, 1/38.9, 1/39, 1/39.1, 1/39.2, 1/39.3, 1/39.4, 1/39.5, 1/39.6, 1/39.7, 1/39.8, 1/39.9, 1/40, 1/40.1, 1/40.2, 1/40.3, 1/40.4, 1/40.5, 1/40.6, 1/40.7, 1/40.8, 1/40.9, 1/41, 1/41.1, 1/41.2, 1/41.3, 1/41.4, 1/41.5, 1/41.6, 1/41.7, 1/41.8, 1/41.9, 1/42, 1/42.1, 1/42.2, 1/42.3, 1/42.4, 1/42.5, 1/42.6, 1/42.7, 1/42.8, 1/42.9, 1/43, 1/43.1, 1/43.2, 1/43.3, 1/43.4, 1/43.5, 1/43.6, 1/43.7, 1/43.8, 1/43.9, 1/44, 1/44.1, 1/44.2, 1/44.3, 1/44.4, 1/44.5, 1/44.6, 1/44.7, 1/44.8, 1/44.9, 1/45, 1/45.1, 1/45.2, 1/45.3, 1/45.4, 1/45.5, 1/45.6, 1/45.7, 1/45.8, 1/45.9, 1/46, 1/46.1, 1/46.2, 1/46.3, 1/46.4, 1/46.5, 1/46.6, 1/46.7, 1/46.8, 1/46.9, 1/47, 1/47.1, 1/47.2, 1/47.3, 1/47.4, 1/47.5, 1/47.6, 1/47.7, 1/47.8, 1/47.9, 1/48, 1/48.1, 1/48.2, 1/48.3, 1/48.4, 1/48.5, 1/48.6, 1/48.7, 1/48.8, 1/48.9, 1/49, 1/49.1, 1/49.2, 1/49.3, 1/49.4, 1/49.5, 1/49.6, 1/49.7, 1/49.8, 1/49.9, 1/50, 1/50.1, 1/50.2, 1/50.3, 1/50.4, 1/50.5, 1/50.6, 1/50.7, 1/50.8, 1/50.9, 1/51, 1/51.1, 1/51.2, 1/51.3, 1/51.4, 1/51.5, 1/51.6, 1/51.7, 1/51.8, 1/51.9, 1/52, 1/52.1, 1/52.2, 1/52.3, 1/52.4, 1/52.5, 1/52.6, 1/52.7, 1/52.8, 1/52.9, 1/53, 1/53.1, 1/53.2, 1/53.3, 1/53.4, 1/53.5, 1/53.6, 1/53.7, 1/53.8, 1/53.9, 1/54, 1/54.1, 1/54.2, 1/54.3, 1/54.4, 1/54.5, 1/54.6, 1/54.7, 1/54.8, 1/54.9, 1/55, 1/55.1, 1/55.2, 1/55.3, 1/55.4, 1/55.5, 1/55.6, 1/55.7, 1/55.8, 1/55.9, 1/56, 1/56.1, 1/56.2, 1/56.3, 1/56.4, 1/56.5, 1/56.6, 1/56.7, 1/56.8, 1/56.9, 1/57, 1/57.1, 1/57.2, 1/57.3, 1/57.4, 1/57.5, 1/57.6, 1/57.7, 1/57.8, 1/57.9, 1/58, 1/58.1, 1/58.2, 1/58.3, 1/58.4, 1/58.5, 1/58.6, 1/58.7, 1/58.8, 1/58.9, 1/59, 1/59.1, 1/59.2, 1/59.3, 1/59.4, 1/59.5, 1/59.6, 1/59.7, 1/59.8, 1/59.9, 1/60 or ratios thereabout or therebetween.
Ranges of ratios of 1/1 to 1/60 can be employed, and subranges as set forth below. More preferred mosaicisms are:
1/4, 1/4.1, 1/4.2, 1/4.3, 1/4.4, 1/4.5, 1/4.6, 1/4.7, 1/4.8, 1/4.9, 1/5, 1/5.1, 1/5.2, 1/5.3, 1/5.4, 1/5.5, 1/5.6, 1/5.7, 1/5.8, 1/5.9, 1/6, 1/6.1, 1/6.2, 1/6.3, 1/6.4, 1/6.5, 1/6.6, 1/6.7, 1/6.8, 1/6.9, 1/7, 1/7.1, 1/7.2, 1/7.3, 1/7.4, 1/7.5, 1/7.6, 1/7.7, 1/7.8, 1/7.9, 1/8, 1/8.1, 1/8.2, 1/8.3, 1/8.4, 1/8.5, 1/8.6, 1/8.7, 1/8.8, 1/8.9, 1/9, 1/9.1, 1/9.2, 1/9.3, 1/9.4, 1/9.5, 1/9.6, 1/9.7, 1/9.8, 1/9.9, 1/10, 1/10.1, 1/10.2, 1/10.3, 1/10.4, 1/10.5, 1/10.6, 1/10.7, 1/10.8, 1/10.9, 1/11, 1/11.1, 1/11.2, 1/11.3, 1/11.4, 1/11.5, 1/11.6, 1/11.7, 1/11.8, 1/11.9, 1/12, 1/12.1, 1/12.2, 1/12.3, 1/12.4, 1/12.5, 1/12.6, 1/12.7, 1/12.8, 1/12.9 or 1/13.
Further preferred mosaicisms are:
1/5, 1/5.1, 1/5.2, 1/5.3, 1/5.4, 1/5.5, 1/5.6, 1/5.7, 1/5.8, 1/5.9, 1/6, 1/6.1, 1/6.2, 1/6.3, 1/6.4, 1/6.5, 1/6.6, 1/6.7, 1/6.8, 1/6.9, 1/7, 1/7.1, 1/7.2, 1/7.3, 1/7.4, 1/7.5, 1/7.6, 1/7.7, 1/7.8, 1/7.9, 1/8, 1/8.1, 1/8.2, 1/8.3, 1/8.4, 1/8.5, 1/8.6, 1/8.7, 1/8.8, 1/8.9, 1/9, 1/9.1, 1/9.2, 1/9.3, 1/9.4, 1/9.5, 1/9.6, 1/9.7, 1/9.8, 1/9.9, 1/10, 1/10.1, 1/10.2, 1/10.3, 1/10.4, 1/10.5, 1/10.6, 1/10.7, 1/10.8, 1/10.9, 1/11, 1/11.1, 1/11.2, 1/11.3, 1/11.4, 1/11.5, 1/11.6, 1/11.7, 1/11.8, 1/11.9, or 1/12.
Still more preferred mosaicisms are:
1/7, 1/7.1, 1/7.2, 1/7.3, 1/7.4, 1/7.5, 1/7.6, 1/7.7, 1/7.8, 1/7.9, 1/8, 1/8.1, 1/8.2, 1/8.3, 1/8.4, 1/8.5, 1/8.6, 1/8.7, 1/8.8, 1/8.9, 1/9, 1/9.1, 1/9.2, 1/9.3, 1/9.4, 1/9.5, 1/9.6, 1/9.7, 1/9.8, 1/9.9, 1/10, 1/10.1, 1/10.2, 1/10.3, 1/10.4, 1/10.5, 1/10.6, 1/10.7, 1/10.8, 1/10.9, or 1/11.
Preferred ranges of mosaicisms are 1/4 to 1/13; 1/5 to 1/12; 1/6 to 1/11, 1/7 to 1/10.5. or 1/7.5 to 1/10.
(6) Preferred molar ratios of AAV-FM to SCM-RM are as follows: 1:20, 1:25, 1:30, 1:35, 1:40, 1:45, 1:50, 1:55, 1:60, 1:65, 1:70, 1:75, 1:80, 1:85, 1:90, 1:95, 1:100, 1:105, 1:110, 1:115, 1:120, 1:125, 1:130, 1:135, 1:140, 1:145, 1:150, 1:155, 1:160, 1:165, 1:170, 1:175, 1:180, 1:185, 1:190, 1:195, 1:200, 1:205, 1:210, 1:215, 1:220, 1:225, 1:230, 1:235, 1:240, 1:245, 1:250, 1:255, 1:260, 1:265, 1:270, 1:275, 1:280, 1:285, 1:290, 1:295, 1:300, 1:305, 1:310, 1:315, 1:320, 1:325, 1:330, 1:335, 1:340, 1:345, 1:350, 1:355, 1:360, 1:365, 1:370, 1:375, 1:380, 1:385, 1:390, 1:395, 1:400, 1:405, 1:410, 1:415, 1:420, 1:425, 1:430, 1:435, 1:440, 1:445, 1:450, 1:455, 1:460, 1:465, 1:470, 1:475, 1:480, 1:485, 1:490, 1:495, 1:500, 1:505, 1:510, 1:515, 1:520, 1:525, 1:530, 1:535, 1:540, 1:545, 1:550, 1:555, 1:560, 1:565, 1:570, 1:575, 1:580, 1:585, 1:590, 1:595, 1:600, 1:605, 1:610, 1:615, 1:620, 1:625, 1:630, 1:635, 1:640, 1:645, 1:650, 1:655, 1:660, 1:665, 1:670, 1:675, 1:680, 1:685, 1:690, 1:695, 1:700, 1:705, 1:710, 1:715, 1:720, 1:725, 1:730, 1:735, 1:740, 1:745, 1:750, 1:755, 1:760, 1:765, 1:770, 1:775, 1:780, 1:785, 1:790, 1:795, 1:800, 1:805, 1:810, 1:815, 1:820, 1:825, 1:830, 1:835, 1:840, 1:845, 1:850, 1:855, 1:860, 1:865, 1:870, 1:875, 1:880, 1:885, 1:890, 1:895, 1:900, 1:905, 1:910, 1:915, 1:920, 1:925, 1:930, 1:935, 1:940, 1:945, 1:950, 1:955, 1:960, 1:965, 1:970, 1:975, 1:980, 1:985, 1:990, 1:995, 1:1000, 1:>1000 or any ratio thereabout or therebetween.
More preferred ratios AAV-FM to SCM-RM are: 1:30, 1:35, 1:40, 1:45, 1:50, 1:55, 1:60, 1:65, 1:70, 1:75, 1:80, 1:85, 1:90, 1:95, 1:100, 1:105, 1:110, 1:115, 1:120, 1:125, 1:130, 1:135, 1:140, 1:145, 1:150, 1:155, 1:160, 1:165, 1:170, 1:175, 1:180, 1:185, 1:190, 1:195, 1:200, 1:205, 1:210, 1:215, 1:220, 1:225, 1:230, 1:235, 1:240, 1:245, 1:250, 1:255, 1:260, 1:265, 1:270, 1:275, 1:280, 1:285, 1:290, 1:295, 1:300 or any ratio thereabout or therebetween.
Preferred ranges of AAV-FM to SCM-RM are 1:20 to 1:1000, and more preferred ranges are: 1:30 to 1:100, 1:40 to 1:100, 1:50 to 1:100 1:60 to 1:100, 1:70 to 1:100, 1:80 to 1:100, 1:90:1:100, 1:30 to 1:150, 1:40 to 1:150, 1:50 to 1:150 1:60 to 1:150, 1:70 to 1:150, 1:80 to 1:150, 1:90 to :150, 1:100 to 1:150, 1:30 to 1:200, 1:40 to 1:200, 1:50 to 1:200 1:60 to 1:200, 1:70 to 1:200, 1:80 to 1:200, 1:90:1:200, 1:100 to 1:200, 1:30 to 1:250, 1:40 to 1:250, 1:50 to 1:250 1:60 to 1:250, 1:70 to 1:250, 1:80 to 1:250, 1:90 to :250, 1:100 to 1:250, 1:30 to 1:300, 1:40 to 1:300, 1:50 to 1:300 1:60 to 1:300, 1:70 to 1:300, 1:80 to 1:300, 1:90:1:300, or 1:100 to 1:300.
(7) The inventions provide for a desired conjugation of a level of conjugation of at least 10%, at least 20%, at least 30%, and at least 40%. Preferred levels are at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or up to 100%, any of which can be considered complete depending on the purpose. More preferably, the desired level of conjugation typically will be about 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%.
Ranges of desired conjugation levels can be 10% to 100%, 20% to 99%, 30% to 99%, 40% to 99%, 50% to 99%, 60% to 99%, 70% to 99%, 80% to 99%, or 90% to 99%. Preferred ranges of desired conjugation levels can be 40% to 100%, 40% to 99%, 45% to 95%, 50% to 95%, 55% to 90%, 60% to 90%, 65% to 95%, 65% to 85%, 65% to 90%, 70% to 90%, 75% to 90%, 75% to 85%, 75% to 80%, or 80% to 85%. More preferably, the range is 65% to 95%.
The second chart below cites to exemplary modifications to the above chart based upon the descriptions and sequence examples contained herein. Points 1-7 above also apply to the second chart below:
Covalently surface modified AAV2 can be made by transfecting a cell with plasmids as set forth below, followed by culturing the transfected cells and harvesting the resulting AAV, and then conjugating the resulting AAV with a second cognate member (SCM) that is fused to a retargeting molecule The first chart below uses SpyTag as the first member of a specific binding pair, and Adenovirus Helper Genes. Modifications can be undertaken as disclosed below:
(1) Plasmid pGOI can comprise one or more genes that are desired to be expressed in covalently surface modified AAV2.
(2) Plasmids pRC-FM can be modified for other specific binding pairs. The first member (FM) should be complementary to a second cognate member (SCM) that is fused to a retargeting molecule (for example, an antibody, as well derivatives and fragments thereof, and still other molecules). See Definitions and Description sections of the Detailed Description, the Figures and associated text for “retargeting” and “retargeting molecules”. The populations of FMs and SCMs can be homogenous or heterogeneous as long as the selected FMs can come in contact with appropriate SCMs so that binding can occur.
(3) Detargeting mutations are optional and can be undertaken as disclosed herein and in publications. See Definitions and Description sections of the Detailed Description, the Figures and associated text for “detargeting” and “detargeting mutations”.
(4) To lessen the possibility of encountering neutralizing antibodies when the covalently surface modified AAV is administered to a subject, KTag can be used as an SCM to bind with SpyTag (FM) (SEQ ID NOS: 54 and 86). KTag and SpyLigase are based upon SpyCatcher. KTag (SEQ ID NO: 85) has only 10 amino acids, which renders it less immunogenic. KTag can be bound to SpyTag in the presence of SpyLigase (SEQ ID NO: 61). The SpyLigase can be removed by subsequent purification, such as by chromatography and/or filtration so that the SpyLigase will not have an appreciable presence in the final drug substance.
(5) Preferred mosaicisms are as follows: 1/1, 1/1.1, 1/1.2, 1/1.3, 1/1.4, 1/1.5, 1/1.6, 1/1.7, 1/1.8, 1/1.9, 1/2, 1/2.1, 1/2.2, 1/2.3, 1/2.4, 1/2.5, 1/2.6, 1/2.7, 1/2.8, 1/2.9, 1/3, 1/3.1, 1/3.2, 1/3.3, 1/3.4, 1/3.5, 1/3.6, 1/3.7, 1/3.8, 1/3.9, 1/4, 1/4.1, 1/4.2, 1/4.3, 1/4.4, 1/4.5, 1/4.6, 1/4.7, 1/4.8, 1/4.9, 1/5, 1/5.1, 1/5.2, 1/5.3, 1/5.4, 1/5.5, 1/5.6, 1/5.7, 1/5.8, 1/5.9, 1/6, 1/6.1, 1/6.2, 1/6.3, 1/6.4, 1/6.5, 1/6.6, 1/6.7, 1/6.8, 1/6.9, 1/7, 1/7.1, 1/7.2, 1/7.3, 1/7.4, 1/7.5, 1/7.6, 1/7.7, 1/7.8, 1/7.9, 1/8, 1/8.1, 1/8.2, 1/8.3, 1/8.4, 1/8.5, 1/8.6, 1/8.7, 1/8.8, 1/8.9, 1/9, 1/9.1, 1/9.2, 1/9.3, 1/9.4, 1/9.5, 1/9.6, 1/9.7, 1/9.8, 1/9.9, 1/10, 1/10.1, 1/10.2, 1/10.3, 1/10.4, 1/10.5, 1/10.6, 1/10.7, 1/10.8, 1/10.9, 1/11, 1/11.1, 1/11.2, 1/11.3, 1/11.4, 1/11.5, 1/11.6, 1/11.7, 1/11.8, 1/11.9, 1/12, 1/12.1, 1/12.2, 1/12.3, 1/12.4, 1/12.5, 1/12.6, 1/12.7, 1/12.8, 1/12.9, 1/13, 1/13.1, 1/13.2, 1/13.3, 1/13.4, 1/13.5, 1/13.6, 1/13.7, 1/13.8, 1/13.9, 1/14, 1/14.1, 1/14.2, 1/14.3, 1/14.4, 1/14.5, 1/14.6, 1/14.7, 1/14.8, 1/14.9, 1/15, 1/15.1, 1/15.2, 1/15.3, 1/15.4, 1/15.5, 1/15.6, 1/15.7, 1/15.8, 1/15.9, 1/16, 1/16.1, 1/16.2, 1/16.3, 1/16.4, 1/16.5, 1/16.6, 1/16.7, 1/16.8, 1/16.9, 1/17, 1/17.1, 1/17.2, 1/17.3, 1/17.4, 1/17.5, 1/17.6, 1/17.7, 1/17.8, 1/17.9, 1/18, 1/18.1, 1/18.2, 1/18.3, 1/18.4, 1/18.5, 1/18.6, 1/18.7, 1/18.8, 1/18.9, 1/19, 11/9.1, 1/19.2, 1/19.3, 1/19.4, 1/91.5, 1/19.6, 1/19.7, 1/19.8, 1/19.9, 1/20, 1/21, 1/21.1, 1/21.2, 1/21.3, 1/21.4, 1/21.5, 1/21.6, 1/21.7, 1/21.8, 1/21.9, 1/22, 1/22.1, 1/22.2, 1/22.3, 1/22.4, 1/22.5, 1/22.6, 1/22.7, 1/22.8, 1/22.9, 1/23, 1/23.1, 1/23.2, 1/23.3, 1/23.4, 1/23.5, 1/23.6, 1/23.7, 1/23.8, 1/23.9, 1/24, 1/24.1, 1/24.2, 1/24.3, 1/24.4, 1/24.5, 1/24.6, 1/24.7, 1/24.8, 1/24.9, 1/25, 1/25.1, 1/25.2, 1/25.3, 1/25.4, 1/25.5, 1/25.6, 1/25.7, 1/25.8, 1/25.9, 1/26, 1/26.1, 1/26.2, 1/26.3, 1/26.4, 1/26.5, 1/26.6, 1/26.7, 1/26.8, 12/6.9, 1/27, 1/27.1, 1/27.2, 1/27.3, 1/27.4, 1/27.5, 1/27.6, 1/27.7, 1/27.8, 1/27.9, 1/28, 1/28.1, 1/28.2, 1/28.3, 1/28.4, 1/28.5, 1/28.6, 1/28.7, 1/28.8, 1/28.9, 1/29, 1/29.1, 1/29.2, 1/29.3, 1/29.4, 1/29.5, 1/29.6, 1/29.7, 1/29.8, 1/29.9, 1/30, 1/30.1, 1/30.2, 1/30.3, 1/30.4, 1/30.5, 1/30.6, 1/30.7, 1/30.8, 1/30.9, 1/31, 1/31.1, 1/31.2, 1/31.3, 1/31.4, 1/31.5, 1/31.6, 1/31.7, 1/31.8, 1/31.9, 1/32, 1/32.1, 1/32.2, 1/32.3, 1/32.4, 1/32.5, 1/32.6, 1/32.7, 1/32.8, 1/32.9, 1/33, 1/33.1, 1/33.2, 1/33.3, 1/33.4, 1/33.5, 1/33.6, 1/33.7, 1/33.8, 1/33.9, 1/34, 1/34.1, 1/34.2, 1/34.3, 1/34.4, 1/34.5, 1/34.6, 1/34.7, 1/34.8, 1/34.9, 1/35, 1/35.1, 1/35.2, 1/35.3, 1/35.4, 1/35.5, 1/35.6, 1/35.7, 1/35.8, 1/35.9, 1/36, 1/36.1, 1/36.2, 1/36.3, 1/36.4, 1/36.5, 1/36.6, 1/36.7, 1/36.8, 1/36.9, 1/37, 1/37.1, 1/37.2, 1/37.3, 1/37.4, 1/37.5, 1/37.6, 1/37.7, 1/37.8, 1/37.9, 1/38, 1/38.1, 1/38.2, 1/38.3, 1/38.4, 1/38.5, 1/38.6, 1/38.7, 1/38.8, 1/38.9, 1/39, 1/39.1, 1/39.2, 1/39.3, 1/39.4, 1/39.5, 1/39.6, 1/39.7, 1/39.8, 1/39.9, 1/40, 1/40.1, 1/40.2, 1/40.3, 1/40.4, 1/40.5, 1/40.6, 1/40.7, 1/40.8, 1/40.9, 1/41, 1/41.1, 1/41.2, 1/41.3, 1/41.4, 1/41.5, 1/41.6, 1/41.7, 1/41.8, 1/41.9, 1/42, 1/42.1, 1/42.2, 1/42.3, 1/42.4, 1/42.5, 1/42.6, 1/42.7, 1/42.8, 1/42.9, 1/43, 1/43.1, 1/43.2, 1/43.3, 1/43.4, 1/43.5, 1/43.6, 1/43.7, 1/43.8, 1/43.9, 1/44, 1/44.1, 1/44.2, 1/44.3, 1/44.4, 1/44.5, 1/44.6, 1/44.7, 1/44.8, 1/44.9, 1/45, 1/45.1, 1/45.2, 1/45.3, 1/45.4, 1/45.5, 1/45.6, 1/45.7, 1/45.8, 1/45.9, 1/46, 1/46.1, 1/46.2, 1/46.3, 1/46.4, 1/46.5, 1/46.6, 1/46.7, 1/46.8, 1/46.9, 1/47, 1/47.1, 1/47.2, 1/47.3, 1/47.4, 1/47.5, 1/47.6, 1/47.7, 1/47.8, 1/47.9, 1/48, 1/48.1, 1/48.2, 1/48.3, 1/48.4, 1/48.5, 1/48.6, 1/48.7, 1/48.8, 1/48.9, 1/49, 1/49.1, 1/49.2, 1/49.3, 1/49.4, 1/49.5, 1/49.6, 1/49.7, 1/49.8, 1/49.9, 1/50, 1/50.1, 1/50.2, 1/50.3, 1/50.4, 1/50.5, 1/50.6, 1/50.7, 1/50.8, 1/50.9, 1/51, 1/51.1, 1/51.2, 1/51.3, 1/51.4, 1/51.5, 1/51.6, 1/51.7, 1/51.8, 1/51.9, 1/52, 1/52.1, 1/52.2, 1/52.3, 1/52.4, 1/52.5, 1/52.6, 1/52.7, 1/52.8, 1/52.9, 1/53, 1/53.1, 1/53.2, 1/53.3, 1/53.4, 1/53.5, 1/53.6, 1/53.7, 1/53.8, 1/53.9, 1/54, 1/54.1, 1/54.2, 1/54.3, 1/54.4, 1/54.5, 1/54.6, 1/54.7, 1/54.8, 1/54.9, 1/55, 1/55.1, 1/55.2, 1/55.3, 1/55.4, 1/55.5, 1/55.6, 1/55.7, 1/55.8, 1/55.9, 1/56, 1/56.1, 1/56.2, 1/56.3, 1/56.4, 1/56.5, 1/56.6, 1/56.7, 1/56.8, 1/56.9, 1/57, 1/57.1, 1/57.2, 1/57.3, 1/57.4, 1/57.5, 1/57.6, 1/57.7, 1/57.8, 1/57.9, 1/58, 1/58.1, 1/58.2, 1/58.3, 1/58.4, 1/58.5, 1/58.6, 1/58.7, 1/58.8, 1/58.9, 1/59, 1/59.1, 1/59.2, 1/59.3, 1/59.4, 1/59.5, 1/59.6, 1/59.7, 1/59.8, 1/59.9, 1/60 or ratios thereabout or therebetween. Ranges of ratios of 1/1 to 1/60 can be employed, and subranges as set forth below.
More preferred mosaicisms are:
1/4, 1/4.1, 1/4.2, 1/4.3, 1/4.4, 1/4.5, 1/4.6, 1/4.7, 1/4.8, 1/4.9, 1/5, 1/5.1, 1/5.2, 1/5.3, 1/5.4, 1/5.5, 1/5.6, 1/5.7, 1/5.8, 1/5.9, 1/6, 1/6.1, 1/6.2, 1/6.3, 1/6.4, 1/6.5, 1/6.6, 1/6.7, 1/6.8, 1/6.9, 1/7, 1/7.1, 1/7.2, 1/7.3, 1/7.4, 1/7.5, 1/7.6, 1/7.7, 1/7.8, 1/7.9, 1/8, 1/8.1, 1/8.2, 1/8.3, 1/8.4, 1/8.5, 1/8.6, 1/8.7, 1/8.8, 1/8.9, 1/9, 1/9.1, 1/9.2, 1/9.3, 1/9.4, 1/9.5, 1/9.6, 1/9.7, 1/9.8, 1/9.9, 1/10, 1/10.1, 1/10.2, 1/10.3, 1/10.4, 1/10.5, 1/10.6, 1/10.7, 1/10.8, 1/10.9, 1/11, 1/11.1, 1/11.2, 1/11.3, 1/11.4, 1/11.5, 1/11.6, 1/11.7, 1/11.8, 1/11.9, 1/12, 1/12.1, 1/12.2, 1/12.3, 1/12.4, 1/12.5, 1/12.6, 1/12.7, 1/12.8, 1/12.9 or 1/13.
Further preferred mosaicisms are:
1/5, 1/5.1, 1/5.2, 1/5.3, 1/5.4, 1/5.5, 1/5.6, 1/5.7, 1/5.8, 1/5.9, 1/6, 1/6.1, 1/6.2, 1/6.3, 1/6.4, 1/6.5, 1/6.6, 1/6.7, 1/6.8, 1/6.9, 1/7, 1/7.1, 1/7.2, 1/7.3, 1/7.4, 1/7.5, 1/7.6, 1/7.7, 1/7.8, 1/7.9, 1/8, 1/8.1, 1/8.2, 1/8.3, 1/8.4, 1/8.5, 1/8.6, 1/8.7, 1/8.8, 1/8.9, 1/9, 1/9.1, 1/9.2, 1/9.3, 1/9.4, 1/9.5, 1/9.6, 1/9.7, 1/9.8, 1/9.9, 1/10, 1/10.1, 1/10.2, 1/10.3, 1/10.4, 1/10.5, 1/10.6, 1/10.7, 1/10.8, 1/10.9, 1/11, 1/11.1, 1/11.2, 1/11.3, 1/11.4, 1/11.5, 1/11.6, 1/11.7, 1/11.8, 1/11.9, or 1/12.
Still more preferred mosaicisms are:
1/7, 1/7.1, 1/7.2, 1/7.3, 1/7.4, 1/7.5, 1/7.6, 1/7.7, 1/7.8, 1/7.9, 1/8, 1/8.1, 1/8.2, 1/8.3, 1/8.4, 1/8.5, 1/8.6, 1/8.7, 1/8.8, 1/8.9, 1/9, 1/9.1, 1/9.2, 1/9.3, 1/9.4, 1/9.5, 1/9.6, 1/9.7, 1/9.8, 1/9.9, 1/10, 1/10.1, 1/10.2, 1/10.3, 1/10.4, 1/10.5, 1/10.6, 1/10.7, 1/10.8, 1/10.9, or 1/11.
Preferred ranges of mosaicisms are 1/4 to 1/13; 1/5 to 1/12; 1/6 to 1/11, 1/7 to 1/10.5. or 1/7.5 to 1/10.
(6) Preferred molar ratios of AAV-FM to SCM-RM are as follows: 1:20, 1:25, 1:30, 1:35, 1:40, 1:45, 1:50, 1:55, 1:60, 1:65, 1:70, 1:75, 1:80, 1:85, 1:90, 1:95, 1:100, 1:105, 1:110, 1:115, 1:120, 1:125, 1:130, 1:135, 1:140, 1:145, 1:150, 1:155, 1:160, 1:165, 1:170, 1:175, 1:180, 1:185, 1:190, 1:195, 1:200, 1:205, 1:210, 1:215, 1:220, 1:225, 1:230, 1:235, 1:240, 1:245, 1:250, 1:255, 1:260, 1:265, 1:270, 1:275, 1:280, 1:285, 1:290, 1:295, 1:300, 1:305, 1:310, 1:315, 1:320, 1:325, 1:330, 1:335, 1:340, 1:345, 1:350, 1:355, 1:360, 1:365, 1:370, 1:375, 1:380, 1:385, 1:390, 1:395, 1:400, 1:405, 1:410, 1:415, 1:420, 1:425, 1:430, 1:435, 1:440, 1:445, 1:450, 1:455, 1:460, 1:465, 1:470, 1:475, 1:480, 1:485, 1:490, 1:495, 1:500, 1:505, 1:510, 1:515, 1:520, 1:525, 1:530, 1:535, 1:540, 1:545, 1:550, 1:555, 1:560, 1:565, 1:570, 1:575, 1:580, 1:585, 1:590, 1:595, 1:600, 1:605, 1:610, 1:615, 1:620, 1:625, 1:630, 1:635, 1:640, 1:645, 1:650, 1:655, 1:660, 1:665, 1:670, 1:675, 1:680, 1:685, 1:690, 1:695, 1:700, 1:705, 1:710, 1:715, 1:720, 1:725, 1:730, 1:735, 1:740, 1:745, 1:750, 1:755, 1:760, 1:765, 1:770, 1:775, 1:780, 1:785, 1:790, 1:795, 1:800, 1:805, 1:810, 1:815, 1:820, 1:825, 1:830, 1:835, 1:840, 1:845, 1:850, 1:855, 1:860, 1:865, 1:870, 1:875, 1:880, 1:885, 1:890, 1:895, 1:900, 1:905, 1:910, 1:915, 1:920, 1:925, 1:930, 1:935, 1:940, 1:945, 1:950, 1:955, 1:960, 1:965, 1:970, 1:975, 1:980, 1:985, 1:990, 1:995, 1:1000, 1:>1000 or any ratio thereabout or therebetween.
More preferred ratios AAV-FM to SCM-RM are: 1:30, 1:35, 1:40, 1:45, 1:50, 1:55, 1:60, 1:65, 1:70, 1:75, 1:80, 1:85, 1:90, 1:95, 1:100, 1:105, 1:110, 1:115, 1:120, 1:125, 1:130, 1:135, 1:140, 1:145, 1:150, 1:155, 1:160, 1:165, 1:170, 1:175, 1:180, 1:185, 1:190, 1:195, 1:200, 1:205, 1:210, 1:215, 1:220, 1:225, 1:230, 1:235, 1:240, 1:245, 1:250, 1:255, 1:260, 1:265, 1:270, 1:275, 1:280, 1:285, 1:290, 1:295, 1:300 or any ratio thereabout or therebetween.
Preferred ranges of AAV-FM to SCM-RM are 1:20 to 1:1000, and more preferred ranges are: 1:30 to 1:100, 1:40 to 1:100, 1:50 to 1:100 1:60 to 1:100, 1:70 to 1:100, 1:80 to 1:100, 1:90:1:100, 1:30 to 1:150, 1:40 to 1:150, 1:50 to 1:150 1:60 to 1:150, 1:70 to 1:150, 1:80 to 1:150, 1:90 to :150, 1:100 to 1:150, 1:30 to 1:200, 1:40 to 1:200, 1:50 to 1:200 1:60 to 1:200, 1:70 to 1:200, 1:80 to 1:200, 1:90:1:200, 1:100 to 1:200, 1:30 to 1:250, 1:40 to 1:250, 1:50 to 1:250 1:60 to 1:250, 1:70 to 1:250, 1:80 to 1:250, 1:90 to :250, 1:100 to 1:250, 1:30 to 1:300, 1:40 to 1:300, 1:50 to 1:300 1:60 to 1:300, 1:70 to 1:300, 1:80 to 1:300, 1:90:1:300, or 1:100 to 1:300.
(7) The inventions provide for a desired conjugation of a level of conjugation of at least 10%, at least 20%, at least 30%, and at least 40%. Preferred levels are at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or up to 100%, any of which can be considered complete depending on the purpose. More preferably, the desired level of conjugation typically will be about 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%.
Ranges of desired conjugation levels can be 10% to 100%, 20% to 99%, 30% to 99%, 40% to 99%, 50% to 99%, 60% to 99%, 70% to 99%, 80% to 99%, or 90% to 99%. Preferred ranges of desired conjugation levels can be 40% to 100%, 40% to 99%, 45% to 95%, 50% to 95%, 55% to 90%, 60% to 90%, 65% to 95%, 65% to 85%, 65% to 90%, 70% to 90%, 75% to 90%, 75% to 85%, 75% to 80%, or 80% to 85%. More preferably, the range is 65% to 95%.
The second chart below cites to exemplary modifications to the above chart based upon the descriptions and sequence examples contained herein. Points 1-7 above also apply to the second chart below:
Variant AAV2 7m8: AAV2 7m8 (also referred to as AAV2.7m8) can be used and is characterized by a 10-amino acid peptide ‘LALGETTRPA’, referred to as ‘7m8’, inserted at position 588 of the AAV2 capsid protein sequence. (Dalkara, D., et al. “In vivo-directed evolution of a new adeno-associated virus for therapeutic outer retinal gene delivery from the vitreous. Sci. Transl. Med. 2013; 5: 189ra76.” Gene therapy restores vision in a canine model of childhood blindness. Nat Genet 28.1 (2001): 92-5).
Variant AAV2-4Y-F: AAV2 Quad Y-F can be used and is a modified AAV2 comprises a mutated AAV2 VP3 capsid protein comprising phenylalanines (F) at each of the positions corresponding to Y272, Y444, Y500, and Y730 in a wild type AAV2 VP3 capsid protein (Petrs-Silva, Hilda, et aL. “High-efficiency transduction of the mouse retina by tyrosine-mutant AAV serotype vectors.” Molecular therapy 17.3 (2009): 463-471).
Covalently surface modified AAV3 can be made by transfecting a cell with plasmids as set forth below, followed by culturing the transfected cells and harvesting the resulting AAV, and then conjugating the resulting AAV with a second cognate member (SCM) that is fused to a retargeting molecule The first chart below uses SpyTag as the first member of a specific binding pair, and Adenovirus Helper Genes. Modifications can be undertaken as disclosed below:
(1) Plasmid pGOI can comprise one or more genes that are desired to be expressed in covalently surface modified AAV3.
(2) Plasmids pRC-FM can be modified for other specific binding pairs. The first member (FM) should be complementary to a second cognate member (SCM) that is fused to a retargeting molecule (for example, an antibody, as well derivatives and fragments thereof, and still other molecules). See Definitions and Description sections of the Detailed Description, the Figures and associated text for “retargeting” and “retargeting molecules”. The populations of FMs and SCMs can be homogenous or heterogeneous as long as the selected FMs can come in contact with appropriate SCMs so that binding can occur.
(3) Detargeting mutations are optional and can be undertaken as disclosed herein and in publications. See Definitions and Description sections of the Detailed Description, the Figures and associated text for “detargeting” and “detargeting mutations”.
(4) To lessen the possibility of encountering neutralizing antibodies when the covalently surface modified AAV is administered to a subject, KTag can be used as an SCM to bind with SpyTag (FM) (SEQ ID NOS: 54 and 86). KTag and SpyLigase are based upon SpyCatcher. KTag (SEQ ID NO: 85) has only 10 amino acids, which renders it less immunogenic. KTag can be bound to SpyTag in the presence of SpyLigase (SEQ ID NO: 61). The SpyLigase can be removed by subsequent purification, such as by chromatography and/or filtration so that the SpyLigase will not have an appreciable presence in the final drug substance.
(5) Preferred mosaicisms are as follows: 1/1, 1/1.1, 1/1.2, 1/1.3, 1/1.4, 1/1.5, 1/1.6, 1/1.7, 1/1.8, 1/1.9, 1/2, 1/2.1, 1/2.2, 1/2.3, 1/2.4, 1/2.5, 1/2.6, 1/2.7, 1/2.8, 1/2.9, 1/3, 1/3.1, 1/3.2, 1/3.3, 1/3.4, 1/3.5, 1/3.6, 1/3.7, 1/3.8, 1/3.9, 1/4, 1/4.1, 1/4.2, 1/4.3, 1/4.4, 1/4.5, 1/4.6, 1/4.7, 1/4.8, 1/4.9, 1/5, 1/5.1, 1/5.2, 1/5.3, 1/5.4, 1/5.5, 1/5.6, 1/5.7, 1/5.8, 1/5.9, 1/6, 1/6.1, 1/6.2, 1/6.3, 1/6.4, 1/6.5, 1/6.6, 1/6.7, 1/6.8, 1/6.9, 1/7, 1/7.1, 1/7.2, 1/7.3, 1/7.4, 1/7.5, 1/7.6, 1/7.7, 1/7.8, 1/7.9, 1/8, 1/8.1, 1/8.2, 1/8.3, 1/8.4, 1/8.5, 1/8.6, 1/8.7, 1/8.8, 1/8.9, 1/9, 1/9.1, 1/9.2, 1/9.3, 1/9.4, 1/9.5, 1/9.6, 1/9.7, 1/9.8, 1/9.9, 1/10, 1/10.1, 1/10.2, 1/10.3, 1/10.4, 1/10.5, 1/10.6, 1/10.7, 1/10.8, 1/10.9, 1/11, 1/11.1, 1/11.2, 1/11.3, 1/11.4, 1/11.5, 1/11.6, 1/11.7, 1/11.8, 1/11.9, 1/12, 1/12.1, 1/12.2, 1/12.3, 1/12.4, 1/12.5, 1/12.6, 1/12.7, 1/12.8, 1/12.9, 1/13, 1/13.1, 1/13.2, 1/13.3, 1/13.4, 1/13.5, 1/13.6, 1/13.7, 1/13.8, 1/13.9, 1/14, 1/14.1, 1/14.2, 1/14.3, 1/14.4, 1/14.5, 1/14.6, 1/14.7, 1/14.8, 1/14.9, 1/15, 1/15.1, 1/15.2, 1/15.3, 1/15.4, 1/15.5, 1/15.6, 1/15.7, 1/15.8, 1/15.9, 1/16, 1/16.1, 1/16.2, 1/16.3, 1/16.4, 1/16.5, 1/16.6, 1/16.7, 1/16.8, 1/16.9, 1/17, 1/17.1, 1/17.2, 1/17.3, 1/17.4, 1/17.5, 1/17.6, 1/17.7, 1/17.8, 1/17.9, 1/18, 1/18.1, 1/18.2, 1/18.3, 1/18.4, 1/18.5, 1/18.6, 1/18.7, 1/18.8, 1/18.9, 1/19, 11/9.1, 1/19.2, 1/19.3, 1/19.4, 1/91.5, 1/19.6, 1/19.7, 1/19.8, 1/19.9, 1/20, 1/21, 1/21.1, 1/21.2, 1/21.3, 1/21.4, 1/21.5, 1/21.6, 1/21.7, 1/21.8, 1/21.9, 1/22, 1/22.1, 1/22.2, 1/22.3, 1/22.4, 1/22.5, 1/22.6, 1/22.7, 1/22.8, 1/22.9, 1/23, 1/23.1, 1/23.2, 1/23.3, 1/23.4, 1/23.5, 1/23.6, 1/23.7, 1/23.8, 1/23.9, 1/24, 1/24.1, 1/24.2, 1/24.3, 1/24.4, 1/24.5, 1/24.6, 1/24.7, 1/24.8, 1/24.9, 1/25, 1/25.1, 1/25.2, 1/25.3, 1/25.4, 1/25.5, 1/25.6, 1/25.7, 1/25.8, 1/25.9, 1/26, 1/26.1, 1/26.2, 1/26.3, 1/26.4, 1/26.5, 1/26.6, 1/26.7, 1/26.8, 12/6.9, 1/27, 1/27.1, 1/27.2, 1/27.3, 1/27.4, 1/27.5, 1/27.6, 1/27.7, 1/27.8, 1/27.9, 1/28, 1/28.1, 1/28.2, 1/28.3, 1/28.4, 1/28.5, 1/28.6, 1/28.7, 1/28.8, 1/28.9, 1/29, 1/29.1, 1/29.2, 1/29.3, 1/29.4, 1/29.5, 1/29.6, 1/29.7, 1/29.8, 1/29.9, 1/30, 1/30.1, 1/30.2, 1/30.3, 1/30.4, 1/30.5, 1/30.6, 1/30.7, 1/30.8, 1/30.9, 1/31, 1/31.1, 1/31.2, 1/31.3, 1/31.4, 1/31.5, 1/31.6, 1/31.7, 1/31.8, 1/31.9, 1/32, 1/32.1, 1/32.2, 1/32.3, 1/32.4, 1/32.5, 1/32.6, 1/32.7, 1/32.8, 1/32.9, 1/33, 1/33.1, 1/33.2, 1/33.3, 1/33.4, 1/33.5, 1/33.6, 1/33.7, 1/33.8, 1/33.9, 1/34, 1/34.1, 1/34.2, 1/34.3, 1/34.4, 1/34.5, 1/34.6, 1/34.7, 1/34.8, 1/34.9, 1/35, 1/35.1, 1/35.2, 1/35.3, 1/35.4, 1/35.5, 1/35.6, 1/35.7, 1/35.8, 1/35.9, 1/36, 1/36.1, 1/36.2, 1/36.3, 1/36.4, 1/36.5, 1/36.6, 1/36.7, 1/36.8, 1/36.9, 1/37, 1/37.1, 1/37.2, 1/37.3, 1/37.4, 1/37.5, 1/37.6, 1/37.7, 1/37.8, 1/37.9, 1/38, 1/38.1, 1/38.2, 1/38.3, 1/38.4, 1/38.5, 1/38.6, 1/38.7, 1/38.8, 1/38.9, 1/39, 1/39.1, 1/39.2, 1/39.3, 1/39.4, 1/39.5, 1/39.6, 1/39.7, 1/39.8, 1/39.9, 1/40, 1/40.1, 1/40.2, 1/40.3, 1/40.4, 1/40.5, 1/40.6, 1/40.7, 1/40.8, 1/40.9, 1/41, 1/41.1, 1/41.2, 1/41.3, 1/41.4, 1/41.5, 1/41.6, 1/41.7, 1/41.8, 1/41.9, 1/42, 1/42.1, 1/42.2, 1/42.3, 1/42.4, 1/42.5, 1/42.6, 1/42.7, 1/42.8, 1/42.9, 1/43, 1/43.1, 1/43.2, 1/43.3, 1/43.4, 1/43.5, 1/43.6, 1/43.7, 1/43.8, 1/43.9, 1/44, 1/44.1, 1/44.2, 1/44.3, 1/44.4, 1/44.5, 1/44.6, 1/44.7, 1/44.8, 1/44.9, 1/45, 1/45.1, 1/45.2, 1/45.3, 1/45.4, 1/45.5, 1/45.6, 1/45.7, 1/45.8, 1/45.9, 1/46, 1/46.1, 1/46.2, 1/46.3, 1/46.4, 1/46.5, 1/46.6, 1/46.7, 1/46.8, 1/46.9, 1/47, 1/47.1, 1/47.2, 1/47.3, 1/47.4, 1/47.5, 1/47.6, 1/47.7, 1/47.8, 1/47.9, 1/48, 1/48.1, 1/48.2, 1/48.3, 1/48.4, 1/48.5, 1/48.6, 1/48.7, 1/48.8, 1/48.9, 1/49, 1/49.1, 1/49.2, 1/49.3, 1/49.4, 1/49.5, 1/49.6, 1/49.7, 1/49.8, 1/49.9, 1/50, 1/50.1, 1/50.2, 1/50.3, 1/50.4, 1/50.5, 1/50.6, 1/50.7, 1/50.8, 1/50.9, 1/51, 1/51.1, 1/51.2, 1/51.3, 1/51.4, 1/51.5, 1/51.6, 1/51.7, 1/51.8, 1/51.9, 1/52, 1/52.1, 1/52.2, 1/52.3, 1/52.4, 1/52.5, 1/52.6, 1/52.7, 1/52.8, 1/52.9, 1/53, 1/53.1, 1/53.2, 1/53.3, 1/53.4, 1/53.5, 1/53.6, 1/53.7, 1/53.8, 1/53.9, 1/54, 1/54.1, 1/54.2, 1/54.3, 1/54.4, 1/54.5, 1/54.6, 1/54.7, 1/54.8, 1/54.9, 1/55, 1/55.1, 1/55.2, 1/55.3, 1/55.4, 1/55.5, 1/55.6, 1/55.7, 1/55.8, 1/55.9, 1/56, 1/56.1, 1/56.2, 1/56.3, 1/56.4, 1/56.5, 1/56.6, 1/56.7, 1/56.8, 1/56.9, 1/57, 1/57.1, 1/57.2, 1/57.3, 1/57.4, 1/57.5, 1/57.6, 1/57.7, 1/57.8, 1/57.9, 1/58, 1/58.1, 1/58.2, 1/58.3, 1/58.4, 1/58.5, 1/58.6, 1/58.7, 1/58.8, 1/58.9, 1/59, 1/59.1, 1/59.2, 1/59.3, 1/59.4, 1/59.5, 1/59.6, 1/59.7, 1/59.8, 1/59.9, 1/60 or ratios thereabout or therebetween. Ranges of ratios of 1/1 to 1/60 can be employed, and subranges as set forth below.
More preferred mosaicisms are:
1/4, 1/4.1, 1/4.2, 1/4.3, 1/4.4, 1/4.5, 1/4.6, 1/4.7, 1/4.8, 1/4.9, 1/5, 1/5.1, 1/5.2, 1/5.3, 1/5.4, 1/5.5, 1/5.6, 1/5.7, 1/5.8, 1/5.9, 1/6, 1/6.1, 1/6.2, 1/6.3, 1/6.4, 1/6.5, 1/6.6, 1/6.7, 1/6.8, 1/6.9, 1/7, 1/7.1, 1/7.2, 1/7.3, 1/7.4, 1/7.5, 1/7.6, 1/7.7, 1/7.8, 1/7.9, 1/8, 1/8.1, 1/8.2, 1/8.3, 1/8.4, 1/8.5, 1/8.6, 1/8.7, 1/8.8, 1/8.9, 1/9, 1/9.1, 1/9.2, 1/9.3, 1/9.4, 1/9.5, 1/9.6, 1/9.7, 1/9.8, 1/9.9, 1/10, 1/10.1, 1/10.2, 1/10.3, 1/10.4, 1/10.5, 1/10.6, 1/10.7, 1/10.8, 1/10.9, 1/11, 1/11.1, 1/11.2, 1/11.3, 1/11.4, 1/11.5, 1/11.6, 1/11.7, 1/11.8, 1/11.9, 1/12, 1/12.1, 1/12.2, 1/12.3, 1/12.4, 1/12.5, 1/12.6, 1/12.7, 1/12.8, 1/12.9 or 1/13.
Further preferred mosaicisms are:
1/5, 1/5.1, 1/5.2, 1/5.3, 1/5.4, 1/5.5, 1/5.6, 1/5.7, 1/5.8, 1/5.9, 1/6, 1/6.1, 1/6.2, 1/6.3, 1/6.4, 1/6.5, 1/6.6, 1/6.7, 1/6.8, 1/6.9, 1/7, 1/7.1, 1/7.2, 1/7.3, 1/7.4, 1/7.5, 1/7.6, 1/7.7, 1/7.8, 1/7.9, 1/8, 1/8.1, 1/8.2, 1/8.3, 1/8.4, 1/8.5, 1/8.6, 1/8.7, 1/8.8, 1/8.9, 1/9, 1/9.1, 1/9.2, 1/9.3, 1/9.4, 1/9.5, 1/9.6, 1/9.7, 1/9.8, 1/9.9, 1/10, 1/10.1, 1/10.2, 1/10.3, 1/10.4, 1/10.5, 1/10.6, 1/10.7, 1/10.8, 1/10.9, 1/11, 1/11.1, 1/11.2, 1/11.3, 1/11.4, 1/11.5, 1/11.6, 1/11.7, 1/11.8, 1/11.9, or 1/12.
Still more preferred mosaicisms are:
1/7, 1/7.1, 1/7.2, 1/7.3, 1/7.4, 1/7.5, 1/7.6, 1/7.7, 1/7.8, 1/7.9, 1/8, 1/8.1, 1/8.2, 1/8.3, 1/8.4, 1/8.5, 1/8.6, 1/8.7, 1/8.8, 1/8.9, 1/9, 1/9.1, 1/9.2, 1/9.3, 1/9.4, 1/9.5, 1/9.6, 1/9.7, 1/9.8, 1/9.9, 1/10, 1/10.1, 1/10.2, 1/10.3, 1/10.4, 1/10.5, 1/10.6, 1/10.7, 1/10.8, 1/10.9, or 1/11.
Preferred ranges of mosaicisms are 1/4 to 1/13; 1/5 to 1/12; 1/6 to 1/11, 1/7 to 1/10.5. or 1/7.5 to 1/10.
More preferred ratios AAV-FM to SCM-RM are: 1:30, 1:35, 1:40, 1:45, 1:50, 1:55, 1:60, 1:65, 1:70, 1:75, 1:80, 1:85, 1:90, 1:95, 1:100, 1:105, 1:110, 1:115, 1:120, 1:125, 1:130, 1:135, 1:140, 1:145, 1:150, 1:155, 1:160, 1:165, 1:170, 1:175, 1:180, 1:185, 1:190, 1:195, 1:200, 1:205, 1:210, 1:215, 1:220, 1:225, 1:230, 1:235, 1:240, 1:245, 1:250, 1:255, 1:260, 1:265, 1:270, 1:275, 1:280, 1:285, 1:290, 1:295, 1:300 or any ratio thereabout or therebetween.
Preferred ranges of AAV-FM to SCM-RM are 1:20 to 1:1000, and more preferred ranges are: 1:30 to 1:100, 1:40 to 1:100, 1:50 to 1:100 1:60 to 1:100, 1:70 to 1:100, 1:80 to 1:100, 1:90:1:100, 1:30 to 1:150, 1:40 to 1:150, 1:50 to 1:150 1:60 to 1:150, 1:70 to 1:150, 1:80 to 1:150, 1:90 to :150, 1:100 to 1:150, 1:30 to 1:200, 1:40 to 1:200, 1:50 to 1:200 1:60 to 1:200, 1:70 to 1:200, 1:80 to 1:200, 1:90:1:200, 1:100 to 1:200, 1:30 to 1:250, 1:40 to 1:250, 1:50 to 1:250 1:60 to 1:250, 1:70 to 1:250, 1:80 to 1:250, 1:90 to :250, 1:100 to 1:250, 1:30 to 1:300, 1:40 to 1:300, 1:50 to 1:300 1:60 to 1:300, 1:70 to 1:300, 1:80 to 1:300, 1:90:1:300, or 1:100 to 1:300.
(7) The inventions provide for a desired conjugation of a level of conjugation of at least 10%, at least 20%, at least 30%, and at least 40%. Preferred levels are at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or up to 100%, any of which can be considered complete depending on the purpose. More preferably, the desired level of conjugation typically will be about 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%.
Ranges of desired conjugation levels can be 10% to 100%, 20% to 99%, 30% to 99%, 40% to 99%, 50% to 99%, 60% to 99%, 70% to 99%, 80% to 99%, or 90% to 99%. Preferred ranges of desired conjugation levels can be 40% to 100%, 40% to 99%, 45% to 95%, 50% to 95%, 55% to 90%, 60% to 90%, 65% to 95%, 65% to 85%, 65% to 90%, 70% to 90%, 75% to 90%, 75% to 85%, 75% to 80%, or 80% to 85%. More preferably, the range is 65% to 95%.
The second chart below cites to exemplary modifications to the above chart based upon the descriptions and sequence examples contained herein. Points 1-7 above also apply to the second chart below:
Covalently surface modified AAV4 can be made by transfecting a cell with plasmids as set forth below, followed by culturing the transfected cells and harvesting the resulting AAV, and then conjugating the resulting AAV with a second cognate member (SCM) that is fused to a retargeting molecule The first chart below uses SpyTag as the first member of a specific binding pair, and Adenovirus Helper Genes. Modifications can be undertaken as disclosed below:
(1) Plasmid pGOI can comprise one or more genes that are desired to be expressed in covalently surface modified AAV4.
(2) Plasmids pRC-FM can be modified for other specific binding pairs. The first member (FM) should be complementary to a second cognate member (SCM) that is fused to a retargeting molecule (for example, an antibody, as well derivatives and fragments thereof, and still other molecules). See Definitions and Description sections of the Detailed Description, the Figures and associated text for “retargeting” and “retargeting molecules”. The populations of FMs and SCMs can be homogenous or heterogeneous as long as the selected FMs can come in contact with appropriate SCMs so that binding can occur.
(3) Detargeting mutations are optional and can be undertaken as disclosed herein and in publications. See Definitions and Description sections of the Detailed Description, the Figures and associated text for “detargeting” and “detargeting mutations”.
(4) To lessen the possibility of encountering neutralizing antibodies when the covalently surface modified AAV is administered to a subject, KTag can be used as an SCM to bind with SpyTag (FM) (SEQ ID NOS: 54 and 86). KTag and SpyLigase are based upon SpyCatcher. KTag (SEQ ID NO: 85) has only 10 amino acids, which renders it less immunogenic. KTag can be bound to SpyTag in the presence of SpyLigase (SEQ ID NO: 61). The SpyLigase can be removed by subsequent purification, such as by chromatography and/or filtration so that the SpyLigase will not have an appreciable presence in the final drug substance.
(5) Preferred mosaicisms are as follows: 1/1, 1/1.1, 1/1.2, 1/1.3, 1/1.4, 1/1.5, 1/1.6, 1/1.7, 1/1.8, 1/1.9, 1/2, 1/2.1, 1/2.2, 1/2.3, 1/2.4, 1/2.5, 1/2.6, 1/2.7, 1/2.8, 1/2.9, 1/3, 1/3.1, 1/3.2, 1/3.3, 1/3.4, 1/3.5, 1/3.6, 1/3.7, 1/3.8, 1/3.9, 1/4, 1/4.1, 1/4.2, 1/4.3, 1/4.4, 1/4.5, 1/4.6, 1/4.7, 1/4.8, 1/4.9, 1/5, 1/5.1, 1/5.2, 1/5.3, 1/5.4, 1/5.5, 1/5.6, 1/5.7, 1/5.8, 1/5.9, 1/6, 1/6.1, 1/6.2, 1/6.3, 1/6.4, 1/6.5, 1/6.6, 1/6.7, 1/6.8, 1/6.9, 1/7, 1/7.1, 1/7.2, 1/7.3, 1/7.4, 1/7.5, 1/7.6, 1/7.7, 1/7.8, 1/7.9, 1/8, 1/8.1, 1/8.2, 1/8.3, 1/8.4, 1/8.5, 1/8.6, 1/8.7, 1/8.8, 1/8.9, 1/9, 1/9.1, 1/9.2, 1/9.3, 1/9.4, 1/9.5, 1/9.6, 1/9.7, 1/9.8, 1/9.9, 1/10, 1/10.1, 1/10.2, 1/10.3, 1/10.4, 1/10.5, 1/10.6, 1/10.7, 1/10.8, 1/10.9, 1/11, 1/11.1, 1/11.2, 1/11.3, 1/11.4, 1/11.5, 1/11.6, 1/11.7, 1/11.8, 1/11.9, 1/12, 1/12.1, 1/12.2, 1/12.3, 1/12.4, 1/12.5, 1/12.6, 1/12.7, 1/12.8, 1/12.9, 1/13, 1/13.1, 1/13.2, 1/13.3, 1/13.4, 1/13.5, 1/13.6, 1/13.7, 1/13.8, 1/13.9, 1/14, 1/14.1, 1/14.2, 1/14.3, 1/14.4, 1/14.5, 1/14.6, 1/14.7, 1/14.8, 1/14.9, 1/15, 1/15.1, 1/15.2, 1/15.3, 1/15.4, 1/15.5, 1/15.6, 1/15.7, 1/15.8, 1/15.9, 1/16, 1/16.1, 1/16.2, 1/16.3, 1/16.4, 1/16.5, 1/16.6, 1/16.7, 1/16.8, 1/16.9, 1/17, 1/17.1, 1/17.2, 1/17.3, 1/17.4, 1/17.5, 1/17.6, 1/17.7, 1/17.8, 1/17.9, 1/18, 1/18.1, 1/18.2, 1/18.3, 1/18.4, 1/18.5, 1/18.6, 1/18.7, 1/18.8, 1/18.9, 1/19, 11/9.1, 1/19.2, 1/19.3, 1/19.4, 1/91.5, 1/19.6, 1/19.7, 1/19.8, 1/19.9, 1/20, 1/21, 1/21.1, 1/21.2, 1/21.3, 1/21.4, 1/21.5, 1/21.6, 1/21.7, 1/21.8, 1/21.9, 1/22, 1/22.1, 1/22.2, 1/22.3, 1/22.4, 1/22.5, 1/22.6, 1/22.7, 1/22.8, 1/22.9, 1/23, 1/23.1, 1/23.2, 1/23.3, 1/23.4, 1/23.5, 1/23.6, 1/23.7, 1/23.8, 1/23.9, 1/24, 1/24.1, 1/24.2, 1/24.3, 1/24.4, 1/24.5, 1/24.6, 1/24.7, 1/24.8, 1/24.9, 1/25, 1/25.1, 1/25.2, 1/25.3, 1/25.4, 1/25.5, 1/25.6, 1/25.7, 1/25.8, 1/25.9, 1/26, 1/26.1, 1/26.2, 1/26.3, 1/26.4, 1/26.5, 1/26.6, 1/26.7, 1/26.8, 12/6.9, 1/27, 1/27.1, 1/27.2, 1/27.3, 1/27.4, 1/27.5, 1/27.6, 1/27.7, 1/27.8, 1/27.9, 1/28, 1/28.1, 1/28.2, 1/28.3, 1/28.4, 1/28.5, 1/28.6, 1/28.7, 1/28.8, 1/28.9, 1/29, 1/29.1, 1/29.2, 1/29.3, 1/29.4, 1/29.5, 1/29.6, 1/29.7, 1/29.8, 1/29.9, 1/30, 1/30.1, 1/30.2, 1/30.3, 1/30.4, 1/30.5, 1/30.6, 1/30.7, 1/30.8, 1/30.9, 1/31, 1/31.1, 1/31.2, 1/31.3, 1/31.4, 1/31.5, 1/31.6, 1/31.7, 1/31.8, 1/31.9, 1/32, 1/32.1, 1/32.2, 1/32.3, 1/32.4, 1/32.5, 1/32.6, 1/32.7, 1/32.8, 1/32.9, 1/33, 1/33.1, 1/33.2, 1/33.3, 1/33.4, 1/33.5, 1/33.6, 1/33.7, 1/33.8, 1/33.9, 1/34, 1/34.1, 1/34.2, 1/34.3, 1/34.4, 1/34.5, 1/34.6, 1/34.7, 1/34.8, 1/34.9, 1/35, 1/35.1, 1/35.2, 1/35.3, 1/35.4, 1/35.5, 1/35.6, 1/35.7, 1/35.8, 1/35.9, 1/36, 1/36.1, 1/36.2, 1/36.3, 1/36.4, 1/36.5, 1/36.6, 1/36.7, 1/36.8, 1/36.9, 1/37, 1/37.1, 1/37.2, 1/37.3, 1/37.4, 1/37.5, 1/37.6, 1/37.7, 1/37.8, 1/37.9, 1/38, 1/38.1, 1/38.2, 1/38.3, 1/38.4, 1/38.5, 1/38.6, 1/38.7, 1/38.8, 1/38.9, 1/39, 1/39.1, 1/39.2, 1/39.3, 1/39.4, 1/39.5, 1/39.6, 1/39.7, 1/39.8, 1/39.9, 1/40, 1/40.1, 1/40.2, 1/40.3, 1/40.4, 1/40.5, 1/40.6, 1/40.7, 1/40.8, 1/40.9, 1/41, 1/41.1, 1/41.2, 1/41.3, 1/41.4, 1/41.5, 1/41.6, 1/41.7, 1/41.8, 1/41.9, 1/42, 1/42.1, 1/42.2, 1/42.3, 1/42.4, 1/42.5, 1/42.6, 1/42.7, 1/42.8, 1/42.9, 1/43, 1/43.1, 1/43.2, 1/43.3, 1/43.4, 1/43.5, 1/43.6, 1/43.7, 1/43.8, 1/43.9, 1/44, 1/44.1, 1/44.2, 1/44.3, 1/44.4, 1/44.5, 1/44.6, 1/44.7, 1/44.8, 1/44.9, 1/45, 1/45.1, 1/45.2, 1/45.3, 1/45.4, 1/45.5, 1/45.6, 1/45.7, 1/45.8, 1/45.9, 1/46, 1/46.1, 1/46.2, 1/46.3, 1/46.4, 1/46.5, 1/46.6, 1/46.7, 1/46.8, 1/46.9, 1/47, 1/47.1, 1/47.2, 1/47.3, 1/47.4, 1/47.5, 1/47.6, 1/47.7, 1/47.8, 1/47.9, 1/48, 1/48.1, 1/48.2, 1/48.3, 1/48.4, 1/48.5, 1/48.6, 1/48.7, 1/48.8, 1/48.9, 1/49, 1/49.1, 1/49.2, 1/49.3, 1/49.4, 1/49.5, 1/49.6, 1/49.7, 1/49.8, 1/49.9, 1/50, 1/50.1, 1/50.2, 1/50.3, 1/50.4, 1/50.5, 1/50.6, 1/50.7, 1/50.8, 1/50.9, 1/51, 1/51.1, 1/51.2, 1/51.3, 1/51.4, 1/51.5, 1/51.6, 1/51.7, 1/51.8, 1/51.9, 1/52, 1/52.1, 1/52.2, 1/52.3, 1/52.4, 1/52.5, 1/52.6, 1/52.7, 1/52.8, 1/52.9, 1/53, 1/53.1, 1/53.2, 1/53.3, 1/53.4, 1/53.5, 1/53.6, 1/53.7, 1/53.8, 1/53.9, 1/54, 1/54.1, 1/54.2, 1/54.3, 1/54.4, 1/54.5, 1/54.6, 1/54.7, 1/54.8, 1/54.9, 1/55, 1/55.1, 1/55.2, 1/55.3, 1/55.4, 1/55.5, 1/55.6, 1/55.7, 1/55.8, 1/55.9, 1/56, 1/56.1, 1/56.2, 1/56.3, 1/56.4, 1/56.5, 1/56.6, 1/56.7, 1/56.8, 1/56.9, 1/57, 1/57.1, 1/57.2, 1/57.3, 1/57.4, 1/57.5, 1/57.6, 1/57.7, 1/57.8, 1/57.9, 1/58, 1/58.1, 1/58.2, 1/58.3, 1/58.4, 1/58.5, 1/58.6, 1/58.7, 1/58.8, 1/58.9, 1/59, 1/59.1, 1/59.2, 1/59.3, 1/59.4, 1/59.5, 1/59.6, 1/59.7, 1/59.8, 1/59.9, 1/60 or ratios thereabout or therebetween. Ranges of ratios of 1/1 to 1/60 can be employed, and subranges as set forth below.
More preferred mosaicisms are:
1/4, 1/4.1, 1/4.2, 1/4.3, 1/4.4, 1/4.5, 1/4.6, 1/4.7, 1/4.8, 1/4.9, 1/5, 1/5.1, 1/5.2, 1/5.3, 1/5.4, 1/5.5, 1/5.6, 1/5.7, 1/5.8, 1/5.9, 1/6, 1/6.1, 1/6.2, 1/6.3, 1/6.4, 1/6.5, 1/6.6, 1/6.7, 1/6.8, 1/6.9, 1/7, 1/7.1, 1/7.2, 1/7.3, 1/7.4, 1/7.5, 1/7.6, 1/7.7, 1/7.8, 1/7.9, 1/8, 1/8.1, 1/8.2, 1/8.3, 1/8.4, 1/8.5, 1/8.6, 1/8.7, 1/8.8, 1/8.9, 1/9, 1/9.1, 1/9.2, 1/9.3, 1/9.4, 1/9.5, 1/9.6, 1/9.7, 1/9.8, 1/9.9, 1/10, 1/10.1, 1/10.2, 1/10.3, 1/10.4, 1/10.5, 1/10.6, 1/10.7, 1/10.8, 1/10.9, 1/11, 1/11.1, 1/11.2, 1/11.3, 1/11.4, 1/11.5, 1/11.6, 1/11.7, 1/11.8, 1/11.9, 1/12, 1/12.1, 1/12.2, 1/12.3, 1/12.4, 1/12.5, 1/12.6, 1/12.7, 1/12.8, 1/12.9 or 1/13.
Further preferred mosaicisms are:
1/5, 1/5.1, 1/5.2, 1/5.3, 1/5.4, 1/5.5, 1/5.6, 1/5.7, 1/5.8, 1/5.9, 1/6, 1/6.1, 1/6.2, 1/6.3, 1/6.4, 1/6.5, 1/6.6, 1/6.7, 1/6.8, 1/6.9, 1/7, 1/7.1, 1/7.2, 1/7.3, 1/7.4, 1/7.5, 1/7.6, 1/7.7, 1/7.8, 1/7.9, 1/8, 1/8.1, 1/8.2, 1/8.3, 1/8.4, 1/8.5, 1/8.6, 1/8.7, 1/8.8, 1/8.9, 1/9, 1/9.1, 1/9.2, 1/9.3, 1/9.4, 1/9.5, 1/9.6, 1/9.7, 1/9.8, 1/9.9, 1/10, 1/10.1, 1/10.2, 1/10.3, 1/10.4, 1/10.5, 1/10.6, 1/10.7, 1/10.8, 1/10.9, 1/11, 1/11.1, 1/11.2, 1/11.3, 1/11.4, 1/11.5, 1/11.6, 1/11.7, 1/11.8, 1/11.9, or 1/12.
Still more preferred mosaicisms are:
1/7, 1/7.1, 1/7.2, 1/7.3, 1/7.4, 1/7.5, 1/7.6, 1/7.7, 1/7.8, 1/7.9, 1/8, 1/8.1, 1/8.2, 1/8.3, 1/8.4, 1/8.5, 1/8.6, 1/8.7, 1/8.8, 1/8.9, 1/9, 1/9.1, 1/9.2, 1/9.3, 1/9.4, 1/9.5, 1/9.6, 1/9.7, 1/9.8, 1/9.9, 1/10, 1/10.1, 1/10.2, 1/10.3, 1/10.4, 1/10.5, 1/10.6, 1/10.7, 1/10.8, 1/10.9, or 1/11.
Preferred ranges of mosaicisms are 1/4 to 1/13; 1/5 to 1/12; 1/6 to 1/11, 1/7 to 1/10.5. or 1/7.5 to 1/10.
(6) Preferred molar ratios of AAV-FM to SCM-RM are as follows: 1:20, 1:25, 1:30, 1:35, 1:40, 1:45, 1:50, 1:55, 1:60, 1:65, 1:70, 1:75, 1:80, 1:85, 1:90, 1:95, 1:100, 1:105, 1:110, 1:115, 1:120, 1:125, 1:130, 1:135, 1:140, 1:145, 1:150, 1:155, 1:160, 1:165, 1:170, 1:175, 1:180, 1:185, 1:190, 1:195, 1:200, 1:205, 1:210, 1:215, 1:220, 1:225, 1:230, 1:235, 1:240, 1:245, 1:250, 1:255, 1:260, 1:265, 1:270, 1:275, 1:280, 1:285, 1:290, 1:295, 1:300, 1:305, 1:310, 1:315, 1:320, 1:325, 1:330, 1:335, 1:340, 1:345, 1:350, 1:355, 1:360, 1:365, 1:370, 1:375, 1:380, 1:385, 1:390, 1:395, 1:400, 1:405, 1:410, 1:415, 1:420, 1:425, 1:430, 1:435, 1:440, 1:445, 1:450, 1:455, 1:460, 1:465, 1:470, 1:475, 1:480, 1:485, 1:490, 1:495, 1:500, 1:505, 1:510, 1:515, 1:520, 1:525, 1:530, 1:535, 1:540, 1:545, 1:550, 1:555, 1:560, 1:565, 1:570, 1:575, 1:580, 1:585, 1:590, 1:595, 1:600, 1:605, 1:610, 1:615, 1:620, 1:625, 1:630, 1:635, 1:640, 1:645, 1:650, 1:655, 1:660, 1:665, 1:670, 1:675, 1:680, 1:685, 1:690, 1:695, 1:700, 1:705, 1:710, 1:715, 1:720, 1:725, 1:730, 1:735, 1:740, 1:745, 1:750, 1:755, 1:760, 1:765, 1:770, 1:775, 1:780, 1:785, 1:790, 1:795, 1:800, 1:805, 1:810, 1:815, 1:820, 1:825, 1:830, 1:835, 1:840, 1:845, 1:850, 1:855, 1:860, 1:865, 1:870, 1:875, 1:880, 1:885, 1:890, 1:895, 1:900, 1:905, 1:910, 1:915, 1:920, 1:925, 1:930, 1:935, 1:940, 1:945, 1:950, 1:955, 1:960, 1:965, 1:970, 1:975, 1:980, 1:985, 1:990, 1:995, 1:1000, 1:>1000 or any ratio thereabout or therebetween.
More preferred ratios AAV-FM to SCM-RM are: 1:30, 1:35, 1:40, 1:45, 1:50, 1:55, 1:60, 1:65, 1:70, 1:75, 1:80, 1:85, 1:90, 1:95, 1:100, 1:105, 1:110, 1:115, 1:120, 1:125, 1:130, 1:135, 1:140, 1:145, 1:150, 1:155, 1:160, 1:165, 1:170, 1:175, 1:180, 1:185, 1:190, 1:195, 1:200, 1:205, 1:210, 1:215, 1:220, 1:225, 1:230, 1:235, 1:240, 1:245, 1:250, 1:255, 1:260, 1:265, 1:270, 1:275, 1:280, 1:285, 1:290, 1:295, 1:300 or any ratio thereabout or therebetween.
Preferred ranges of AAV-FM to SCM-RM are 1:20 to 1:1000, and more preferred ranges are: 1:30 to 1:100, 1:40 to 1:100, 1:50 to 1:100 1:60 to 1:100, 1:70 to 1:100, 1:80 to 1:100, 1:90:1:100, 1:30 to 1:150, 1:40 to 1:150, 1:50 to 1:150 1:60 to 1:150, 1:70 to 1:150, 1:80 to 1:150, 1:90 to :150, 1:100 to 1:150, 1:30 to 1:200, 1:40 to 1:200, 1:50 to 1:200 1:60 to 1:200, 1:70 to 1:200, 1:80 to 1:200, 1:90:1:200, 1:100 to 1:200, 1:30 to 1:250, 1:40 to 1:250, 1:50 to 1:250 1:60 to 1:250, 1:70 to 1:250, 1:80 to 1:250, 1:90 to :250, 1:100 to 1:250, 1:30 to 1:300, 1:40 to 1:300, 1:50 to 1:300 1:60 to 1:300, 1:70 to 1:300, 1:80 to 1:300, 1:90:1:300, or 1:100 to 1:300.
(7) The inventions provide for a desired conjugation of a level of conjugation of at least 10%, at least 20%, at least 30%, and at least 40%. Preferred levels are at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or up to 100%, any of which can be considered complete depending on the purpose. More preferably, the desired level of conjugation typically will be about 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%.
Ranges of desired conjugation levels can be 10% to 100%, 20% to 99%, 30% to 99%, 40% to 99%, 50% to 99%, 60% to 99%, 70% to 99%, 80% to 99%, or 90% to 99%. Preferred ranges of desired conjugation levels can be 40% to 100%, 40% to 99%, 45% to 95%, 50% to 95%, 55% to 90%, 60% to 90%, 65% to 95%, 65% to 85%, 65% to 90%, 70% to 90%, 75% to 90%, 75% to 85%, 75% to 80%, or 80% to 85%. More preferably, the range is 65% to 95%.
The second chart below cites to exemplary modifications to the above chart based upon the descriptions and sequence examples contained herein. Points 1-7 above also apply to the second chart below:
Covalently surface modified AAV5 can be made by transfecting a cell with plasmids as set forth below, followed by culturing the transfected cells and harvesting the resulting AAV, and then conjugating the resulting AAV with a second cognate member (SCM) that is fused to a retargeting molecule The first chart below uses SpyTag as the first member of a specific binding pair, and Adenovirus Helper Genes. Modifications can be undertaken as disclosed below:
(1) Plasmid pGOI can comprise one or more genes that are desired to be expressed in covalently surface modified AAV5.
(2) Plasmids pRC-FM can be modified for other specific binding pairs. The first member (FM) should be complementary to a second cognate member (SCM) that is fused to a retargeting molecule (for example, an antibody, as well derivatives and fragments thereof, and still other molecules). See Definitions and Description sections of the Detailed Description, the Figures and associated text for “retargeting” and “retargeting molecules”. The populations of FMs and SCMs can be homogenous or heterogeneous as long as the selected FMs can come in contact with appropriate SCMs so that binding can occur.
(3) Detargeting mutations are optional and can be undertaken as disclosed herein and in publications. See Definitions and Description sections of the Detailed Description, the Figures and associated text for “detargeting” and “detargeting mutations”.
(4) To lessen the possibility of encountering neutralizing antibodies when the covalently surface modified AAV is administered to a subject, KTag can be used as an SCM to bind with SpyTag (FM) (SEQ ID NOS: 54 and 86). KTag and SpyLigase are based upon SpyCatcher. KTag (SEQ ID NO: 85) has only 10 amino acids, which renders it less immunogenic. KTag can be bound to SpyTag in the presence of SpyLigase (SEQ ID NO: 61). The SpyLigase can be removed by subsequent purification, such as by chromatography and/or filtration so that the SpyLigase will not have an appreciable presence in the final drug substance.
(5) Preferred mosaicisms are as follows: 1/1, 1/1.1, 1/1.2, 1/1.3, 1/1.4, 1/1.5, 1/1.6, 1/1.7, 1/1.8, 1/1.9, 1/2, 1/2.1, 1/2.2, 1/2.3, 1/2.4, 1/2.5, 1/2.6, 1/2.7, 1/2.8, 1/2.9, 1/3, 1/3.1, 1/3.2, 1/3.3, 1/3.4, 1/3.5, 1/3.6, 1/3.7, 1/3.8, 1/3.9, 1/4, 1/4.1, 1/4.2, 1/4.3, 1/4.4, 1/4.5, 1/4.6, 1/4.7, 1/4.8, 1/4.9, 1/5, 1/5.1, 1/5.2, 1/5.3, 1/5.4, 1/5.5, 1/5.6, 1/5.7, 1/5.8, 1/5.9, 1/6, 1/6.1, 1/6.2, 1/6.3, 1/6.4, 1/6.5, 1/6.6, 1/6.7, 1/6.8, 1/6.9, 1/7, 1/7.1, 1/7.2, 1/7.3, 1/7.4, 1/7.5, 1/7.6, 1/7.7, 1/7.8, 1/7.9, 1/8, 1/8.1, 1/8.2, 1/8.3, 1/8.4, 1/8.5, 1/8.6, 1/8.7, 1/8.8, 1/8.9, 1/9, 1/9.1, 1/9.2, 1/9.3, 1/9.4, 1/9.5, 1/9.6, 1/9.7, 1/9.8, 1/9.9, 1/10, 1/10.1, 1/10.2, 1/10.3, 1/10.4, 1/10.5, 1/10.6, 1/10.7, 1/10.8, 1/10.9, 1/11, 1/11.1, 1/11.2, 1/11.3, 1/11.4, 1/11.5, 1/11.6, 1/11.7, 1/11.8, 1/11.9, 1/12, 1/12.1, 1/12.2, 1/12.3, 1/12.4, 1/12.5, 1/12.6, 1/12.7, 1/12.8, 1/12.9, 1/13, 1/13.1, 1/13.2, 1/13.3, 1/13.4, 1/13.5, 1/13.6, 1/13.7, 1/13.8, 1/13.9, 1/14, 1/14.1, 1/14.2, 1/14.3, 1/14.4, 1/14.5, 1/14.6, 1/14.7, 1/14.8, 1/14.9, 1/15, 1/15.1, 1/15.2, 1/15.3, 1/15.4, 1/15.5, 1/15.6, 1/15.7, 1/15.8, 1/15.9, 1/16, 1/16.1, 1/16.2, 1/16.3, 1/16.4, 1/16.5, 1/16.6, 1/16.7, 1/16.8, 1/16.9, 1/17, 1/17.1, 1/17.2, 1/17.3, 1/17.4, 1/17.5, 1/17.6, 1/17.7, 1/17.8, 1/17.9, 1/18, 1/18.1, 1/18.2, 1/18.3, 1/18.4, 1/18.5, 1/18.6, 1/18.7, 1/18.8, 1/18.9, 1/19, 11/9.1, 1/19.2, 1/19.3, 1/19.4, 1/91.5, 1/19.6, 1/19.7, 1/19.8, 1/19.9, 1/20, 1/21, 1/21.1, 1/21.2, 1/21.3, 1/21.4, 1/21.5, 1/21.6, 1/21.7, 1/21.8, 1/21.9, 1/22, 1/22.1, 1/22.2, 1/22.3, 1/22.4, 1/22.5, 1/22.6, 1/22.7, 1/22.8, 1/22.9, 1/23, 1/23.1, 1/23.2, 1/23.3, 1/23.4, 1/23.5, 1/23.6, 1/23.7, 1/23.8, 1/23.9, 1/24, 1/24.1, 1/24.2, 1/24.3, 1/24.4, 1/24.5, 1/24.6, 1/24.7, 1/24.8, 1/24.9, 1/25, 1/25.1, 1/25.2, 1/25.3, 1/25.4, 1/25.5, 1/25.6, 1/25.7, 1/25.8, 1/25.9, 1/26, 1/26.1, 1/26.2, 1/26.3, 1/26.4, 1/26.5, 1/26.6, 1/26.7, 1/26.8, 12/6.9, 1/27, 1/27.1, 1/27.2, 1/27.3, 1/27.4, 1/27.5, 1/27.6, 1/27.7, 1/27.8, 1/27.9, 1/28, 1/28.1, 1/28.2, 1/28.3, 1/28.4, 1/28.5, 1/28.6, 1/28.7, 1/28.8, 1/28.9, 1/29, 1/29.1, 1/29.2, 1/29.3, 1/29.4, 1/29.5, 1/29.6, 1/29.7, 1/29.8, 1/29.9, 1/30, 1/30.1, 1/30.2, 1/30.3, 1/30.4, 1/30.5, 1/30.6, 1/30.7, 1/30.8, 1/30.9, 1/31, 1/31.1, 1/31.2, 1/31.3, 1/31.4, 1/31.5, 1/31.6, 1/31.7, 1/31.8, 1/31.9, 1/32, 1/32.1, 1/32.2, 1/32.3, 1/32.4, 1/32.5, 1/32.6, 1/32.7, 1/32.8, 1/32.9, 1/33, 1/33.1, 1/33.2, 1/33.3, 1/33.4, 1/33.5, 1/33.6, 1/33.7, 1/33.8, 1/33.9, 1/34, 1/34.1, 1/34.2, 1/34.3, 1/34.4, 1/34.5, 1/34.6, 1/34.7, 1/34.8, 1/34.9, 1/35, 1/35.1, 1/35.2, 1/35.3, 1/35.4, 1/35.5, 1/35.6, 1/35.7, 1/35.8, 1/35.9, 1/36, 1/36.1, 1/36.2, 1/36.3, 1/36.4, 1/36.5, 1/36.6, 1/36.7, 1/36.8, 1/36.9, 1/37, 1/37.1, 1/37.2, 1/37.3, 1/37.4, 1/37.5, 1/37.6, 1/37.7, 1/37.8, 1/37.9, 1/38, 1/38.1, 1/38.2, 1/38.3, 1/38.4, 1/38.5, 1/38.6, 1/38.7, 1/38.8, 1/38.9, 1/39, 1/39.1, 1/39.2, 1/39.3, 1/39.4, 1/39.5, 1/39.6, 1/39.7, 1/39.8, 1/39.9, 1/40, 1/40.1, 1/40.2, 1/40.3, 1/40.4, 1/40.5, 1/40.6, 1/40.7, 1/40.8, 1/40.9, 1/41, 1/41.1, 1/41.2, 1/41.3, 1/41.4, 1/41.5, 1/41.6, 1/41.7, 1/41.8, 1/41.9, 1/42, 1/42.1, 1/42.2, 1/42.3, 1/42.4, 1/42.5, 1/42.6, 1/42.7, 1/42.8, 1/42.9, 1/43, 1/43.1, 1/43.2, 1/43.3, 1/43.4, 1/43.5, 1/43.6, 1/43.7, 1/43.8, 1/43.9, 1/44, 1/44.1, 1/44.2, 1/44.3, 1/44.4, 1/44.5, 1/44.6, 1/44.7, 1/44.8, 1/44.9, 1/45, 1/45.1, 1/45.2, 1/45.3, 1/45.4, 1/45.5, 1/45.6, 1/45.7, 1/45.8, 1/45.9, 1/46, 1/46.1, 1/46.2, 1/46.3, 1/46.4, 1/46.5, 1/46.6, 1/46.7, 1/46.8, 1/46.9, 1/47, 1/47.1, 1/47.2, 1/47.3, 1/47.4, 1/47.5, 1/47.6, 1/47.7, 1/47.8, 1/47.9, 1/48, 1/48.1, 1/48.2, 1/48.3, 1/48.4, 1/48.5, 1/48.6, 1/48.7, 1/48.8, 1/48.9, 1/49, 1/49.1, 1/49.2, 1/49.3, 1/49.4, 1/49.5, 1/49.6, 1/49.7, 1/49.8, 1/49.9, 1/50, 1/50.1, 1/50.2, 1/50.3, 1/50.4, 1/50.5, 1/50.6, 1/50.7, 1/50.8, 1/50.9, 1/51, 1/51.1, 1/51.2, 1/51.3, 1/51.4, 1/51.5, 1/51.6, 1/51.7, 1/51.8, 1/51.9, 1/52, 1/52.1, 1/52.2, 1/52.3, 1/52.4, 1/52.5, 1/52.6, 1/52.7, 1/52.8, 1/52.9, 1/53, 1/53.1, 1/53.2, 1/53.3, 1/53.4, 1/53.5, 1/53.6, 1/53.7, 1/53.8, 1/53.9, 1/54, 1/54.1, 1/54.2, 1/54.3, 1/54.4, 1/54.5, 1/54.6, 1/54.7, 1/54.8, 1/54.9, 1/55, 1/55.1, 1/55.2, 1/55.3, 1/55.4, 1/55.5, 1/55.6, 1/55.7, 1/55.8, 1/55.9, 1/56, 1/56.1, 1/56.2, 1/56.3, 1/56.4, 1/56.5, 1/56.6, 1/56.7, 1/56.8, 1/56.9, 1/57, 1/57.1, 1/57.2, 1/57.3, 1/57.4, 1/57.5, 1/57.6, 1/57.7, 1/57.8, 1/57.9, 1/58, 1/58.1, 1/58.2, 1/58.3, 1/58.4, 1/58.5, 1/58.6, 1/58.7, 1/58.8, 1/58.9, 1/59, 1/59.1, 1/59.2, 1/59.3, 1/59.4, 1/59.5, 1/59.6, 1/59.7, 1/59.8, 1/59.9, 1/60 or ratios thereabout or therebetween. Ranges of ratios of 1/1 to 1/60 can be employed, and subranges as set forth below.
More preferred mosaicisms are: 1/4, 1/4.1, 1/4.2, 1/4.3, 1/4.4, 1/4.5, 1/4.6, 1/4.7, 1/4.8, 1/4.9, 1/5, 1/5.1, 1/5.2, 1/5.3, 1/5.4, 1/5.5, 1/5.6, 1/5.7, 1/5.8, 1/5.9, 1/6, 1/6.1, 1/6.2, 1/6.3, 1/6.4, 1/6.5, 1/6.6, 1/6.7, 1/6.8, 1/6.9, 1/7, 1/7.1, 1/7.2, 1/7.3, 1/7.4, 1/7.5, 1/7.6, 1/7.7, 1/7.8, 1/7.9, 1/8, 1/8.1, 1/8.2, 1/8.3, 1/8.4, 1/8.5, 1/8.6, 1/8.7, 1/8.8, 1/8.9, 1/9, 1/9.1, 1/9.2, 1/9.3, 1/9.4, 1/9.5, 1/9.6, 1/9.7, 1/9.8, 1/9.9, 1/10, 1/10.1, 1/10.2, 1/10.3, 1/10.4, 1/10.5, 1/10.6, 1/10.7, 1/10.8, 1/10.9, 1/11, 1/11.1, 1/11.2, 1/11.3, 1/11.4, 1/11.5, 1/11.6, 1/11.7, 1/11.8, 1/11.9, 1/12, 1/12.1, 1/12.2, 1/12.3, 1/12.4, 1/12.5, 1/12.6, 1/12.7, 1/12.8, 1/12.9 or 1/13.
Further preferred mosaicisms are:
1/5, 1/5.1, 1/5.2, 1/5.3, 1/5.4, 1/5.5, 1/5.6, 1/5.7, 1/5.8, 1/5.9, 1/6, 1/6.1, 1/6.2, 1/6.3, 1/6.4, 1/6.5, 1/6.6, 1/6.7, 1/6.8, 1/6.9, 1/7, 1/7.1, 1/7.2, 1/7.3, 1/7.4, 1/7.5, 1/7.6, 1/7.7, 1/7.8, 1/7.9, 1/8, 1/8.1, 1/8.2, 1/8.3, 1/8.4, 1/8.5, 1/8.6, 1/8.7, 1/8.8, 1/8.9, 1/9, 1/9.1, 1/9.2, 1/9.3, 1/9.4, 1/9.5, 1/9.6, 1/9.7, 1/9.8, 1/9.9, 1/10, 1/10.1, 1/10.2, 1/10.3, 1/10.4, 1/10.5, 1/10.6, 1/10.7, 1/10.8, 1/10.9, 1/11, 1/11.1, 1/11.2, 1/11.3, 1/11.4, 1/11.5, 1/11.6, 1/11.7, 1/11.8, 1/11.9, or 1/12.
Still more preferred mosaicisms are:
1/7, 1/7.1, 1/7.2, 1/7.3, 1/7.4, 1/7.5, 1/7.6, 1/7.7, 1/7.8, 1/7.9, 1/8, 1/8.1, 1/8.2, 1/8.3, 1/8.4, 1/8.5, 1/8.6, 1/8.7, 1/8.8, 1/8.9, 1/9, 1/9.1, 1/9.2, 1/9.3, 1/9.4, 1/9.5, 1/9.6, 1/9.7, 1/9.8, 1/9.9, 1/10, 1/10.1, 1/10.2, 1/10.3, 1/10.4, 1/10.5, 1/10.6, 1/10.7, 1/10.8, 1/10.9, or 1/11.
Preferred ranges of mosaicisms are 1/4 to 1/13; 1/5 to 1/12; 1/6 to 1/11, 1/7 to 1/10.5. or 1/7.5 to 1/10.
(6) Preferred molar ratios of AAV-FM to SCM-RM are as follows: 1:20, 1:25, 1:30, 1:35, 1:40, 1:45, 1:50, 1:55, 1:60, 1:65, 1:70, 1:75, 1:80, 1:85, 1:90, 1:95, 1:100, 1:105, 1:110, 1:115, 1:120, 1:125, 1:130, 1:135, 1:140, 1:145, 1:150, 1:155, 1:160, 1:165, 1:170, 1:175, 1:180, 1:185, 1:190, 1:195, 1:200, 1:205, 1:210, 1:215, 1:220, 1:225, 1:230, 1:235, 1:240, 1:245, 1:250, 1:255, 1:260, 1:265, 1:270, 1:275, 1:280, 1:285, 1:290, 1:295, 1:300, 1:305, 1:310, 1:315, 1:320, 1:325, 1:330, 1:335, 1:340, 1:345, 1:350, 1:355, 1:360, 1:365, 1:370, 1:375, 1:380, 1:385, 1:390, 1:395, 1:400, 1:405, 1:410, 1:415, 1:420, 1:425, 1:430, 1:435, 1:440, 1:445, 1:450, 1:455, 1:460, 1:465, 1:470, 1:475, 1:480, 1:485, 1:490, 1:495, 1:500, 1:505, 1:510, 1:515, 1:520, 1:525, 1:530, 1:535, 1:540, 1:545, 1:550, 1:555, 1:560, 1:565, 1:570, 1:575, 1:580, 1:585, 1:590, 1:595, 1:600, 1:605, 1:610, 1:615, 1:620, 1:625, 1:630, 1:635, 1:640, 1:645, 1:650, 1:655, 1:660, 1:665, 1:670, 1:675, 1:680, 1:685, 1:690, 1:695, 1:700, 1:705, 1:710, 1:715, 1:720, 1:725, 1:730, 1:735, 1:740, 1:745, 1:750, 1:755, 1:760, 1:765, 1:770, 1:775, 1:780, 1:785, 1:790, 1:795, 1:800, 1:805, 1:810, 1:815, 1:820, 1:825, 1:830, 1:835, 1:840, 1:845, 1:850, 1:855, 1:860, 1:865, 1:870, 1:875, 1:880, 1:885, 1:890, 1:895, 1:900, 1:905, 1:910, 1:915, 1:920, 1:925, 1:930, 1:935, 1:940, 1:945, 1:950, 1:955, 1:960, 1:965, 1:970, 1:975, 1:980, 1:985, 1:990, 1:995, 1:1000, 1:>1000 or any ratio thereabout or therebetween.
More preferred ratios AAV-FM to SCM-RM are: 1:30, 1:35, 1:40, 1:45, 1:50, 1:55, 1:60, 1:65, 1:70, 1:75, 1:80, 1:85, 1:90, 1:95, 1:100, 1:105, 1:110, 1:115, 1:120, 1:125, 1:130, 1:135, 1:140, 1:145, 1:150, 1:155, 1:160, 1:165, 1:170, 1:175, 1:180, 1:185, 1:190, 1:195, 1:200, 1:205, 1:210, 1:215, 1:220, 1:225, 1:230, 1:235, 1:240, 1:245, 1:250, 1:255, 1:260, 1:265, 1:270, 1:275, 1:280, 1:285, 1:290, 1:295, 1:300 or any ratio thereabout or therebetween.
Preferred ranges of AAV-FM to SCM-RM are 1:20 to 1:1000, and more preferred ranges are: 1:30 to 1:100, 1:40 to 1:100, 1:50 to 1:100 1:60 to 1:100, 1:70 to 1:100, 1:80 to 1:100, 1:90:1:100, 1:30 to 1:150, 1:40 to 1:150, 1:50 to 1:150 1:60 to 1:150, 1:70 to 1:150, 1:80 to 1:150, 1:90 to :150, 1:100 to 1:150, 1:30 to 1:200, 1:40 to 1:200, 1:50 to 1:200 1:60 to 1:200, 1:70 to 1:200, 1:80 to 1:200, 1:90:1:200, 1:100 to 1:200, 1:30 to 1:250, 1:40 to 1:250, 1:50 to 1:250 1:60 to 1:250, 1:70 to 1:250, 1:80 to 1:250, 1:90 to :250, 1:100 to 1:250, 1:30 to 1:300, 1:40 to 1:300, 1:50 to 1:300 1:60 to 1:300, 1:70 to 1:300, 1:80 to 1:300, 1:90:1:300, or 1:100 to 1:300.
(7) The inventions provide for a desired conjugation of a level of conjugation of at least 10%, at least 20%, at least 30%, and at least 40%. Preferred levels are at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or up to 100%, any of which can be considered complete depending on the purpose. More preferably, the desired level of conjugation typically will be about 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%.
Ranges of desired conjugation levels can be 10% to 100%, 20% to 99%, 30% to 99%, 40% to 99%, 50% to 99%, 60% to 99%, 70% to 99%, 80% to 99%, or 90% to 99%. Preferred ranges of desired conjugation levels can be 40% to 100%, 40% to 99%, 45% to 95%, 50% to 95%, 55% to 90%, 60% to 90%, 65% to 95%, 65% to 85%, 65% to 90%, 70% to 90%, 75% to 90%, 75% to 85%, 75% to 80%, or 80% to 85%. More preferably, the range is 65% to 95%.
The second chart below cites to exemplary modifications to the above chart based upon the descriptions and sequence examples contained herein. Points 1-7 above also apply to the second chart below:
Covalently surface modified AAV6 can be made by transfecting a cell with plasmids as set forth below, followed by culturing the transfected cells and harvesting the resulting AAV, and then conjugating the resulting AAV with a second cognate member (SCM) that is fused to a retargeting molecule The first chart below uses SpyTag as the first member of a specific binding pair, and Adenovirus Helper Genes. Modifications can be undertaken as disclosed below:
(1) Plasmid pGOI can comprise one or more genes that are desired to be expressed in covalently surface modified AAV6.
(2) Plasmids pRC-FM can be modified for other specific binding pairs. The first member (FM) should be complementary to a second cognate member (SCM) that is fused to a retargeting molecule (for example, an antibody, as well derivatives and fragments thereof, and still other molecules). See Definitions and Description sections of the Detailed Description, the Figures and associated text for “retargeting” and “retargeting molecules”. The populations of FMs and SCMs can be homogenous or heterogeneous as long as the selected FMs can come in contact with appropriate SCMs so that binding can occur.
(3) Detargeting mutations are optional and can be undertaken as disclosed herein and in publications. See, e.g., Definitions and Description sections of the Detailed Description, the Figures and associated text for “detargeting” and “detargeting mutations”.
(4) To lessen the possibility of encountering neutralizing antibodies when the covalently surface modified AAV is administered to a subject, KTag can be used as an SCM to bind with SpyTag (FM) (SEQ ID NOS: 54 and 86). KTag and SpyLigase are based upon SpyCatcher. KTag (SEQ ID NO: 85) has only 10 amino acids, which renders it less immunogenic. KTag can be bound to SpyTag in the presence of SpyLigase (SEQ ID NO: 61). The SpyLigase can be removed by subsequent purification, such as by chromatography and/or filtration so that the SpyLigase will not have an appreciable presence in the final drug substance.
(5) Preferred mosaicisms are as follows: 1/1, 1/1.1, 1/1.2, 1/1.3, 1/1.4, 1/1.5, 1/1.6, 1/1.7, 1/1.8, 1/1.9, 1/2, 1/2.1, 1/2.2, 1/2.3, 1/2.4, 1/2.5, 1/2.6, 1/2.7, 1/2.8, 1/2.9, 1/3, 1/3.1, 1/3.2, 1/3.3, 1/3.4, 1/3.5, 1/3.6, 1/3.7, 1/3.8, 1/3.9, 1/4, 1/4.1, 1/4.2, 1/4.3, 1/4.4, 1/4.5, 1/4.6, 1/4.7, 1/4.8, 1/4.9, 1/5, 1/5.1, 1/5.2, 1/5.3, 1/5.4, 1/5.5, 1/5.6, 1/5.7, 1/5.8, 1/5.9, 1/6, 1/6.1, 1/6.2, 1/6.3, 1/6.4, 1/6.5, 1/6.6, 1/6.7, 1/6.8, 1/6.9, 1/7, 1/7.1, 1/7.2, 1/7.3, 1/7.4, 1/7.5, 1/7.6, 1/7.7, 1/7.8, 1/7.9, 1/8, 1/8.1, 1/8.2, 1/8.3, 1/8.4, 1/8.5, 1/8.6, 1/8.7, 1/8.8, 1/8.9, 1/9, 1/9.1, 1/9.2, 1/9.3, 1/9.4, 1/9.5, 1/9.6, 1/9.7, 1/9.8, 1/9.9, 1/10, 1/10.1, 1/10.2, 1/10.3, 1/10.4, 1/10.5, 1/10.6, 1/10.7, 1/10.8, 1/10.9, 1/11, 1/11.1, 1/11.2, 1/11.3, 1/11.4, 1/11.5, 1/11.6, 1/11.7, 1/11.8, 1/11.9, 1/12, 1/12.1, 1/12.2, 1/12.3, 1/12.4, 1/12.5, 1/12.6, 1/12.7, 1/12.8, 1/12.9, 1/13, 1/13.1, 1/13.2, 1/13.3, 1/13.4, 1/13.5, 1/13.6, 1/13.7, 1/13.8, 1/13.9, 1/14, 1/14.1, 1/14.2, 1/14.3, 1/14.4, 1/14.5, 1/14.6, 1/14.7, 1/14.8, 1/14.9, 1/15, 1/15.1, 1/15.2, 1/15.3, 1/15.4, 1/15.5, 1/15.6, 1/15.7, 1/15.8, 1/15.9, 1/16, 1/16.1, 1/16.2, 1/16.3, 1/16.4, 1/16.5, 1/16.6, 1/16.7, 1/16.8, 1/16.9, 1/17, 1/17.1, 1/17.2, 1/17.3, 1/17.4, 1/17.5, 1/17.6, 1/17.7, 1/17.8, 1/17.9, 1/18, 1/18.1, 1/18.2, 1/18.3, 1/18.4, 1/18.5, 1/18.6, 1/18.7, 1/18.8, 1/18.9, 1/19, 11/9.1, 1/19.2, 1/19.3, 1/19.4, 1/91.5, 1/19.6, 1/19.7, 1/19.8, 1/19.9, 1/20, 1/21, 1/21.1, 1/21.2, 1/21.3, 1/21.4, 1/21.5, 1/21.6, 1/21.7, 1/21.8, 1/21.9, 1/22, 1/22.1, 1/22.2, 1/22.3, 1/22.4, 1/22.5, 1/22.6, 1/22.7, 1/22.8, 1/22.9, 1/23, 1/23.1, 1/23.2, 1/23.3, 1/23.4, 1/23.5, 1/23.6, 1/23.7, 1/23.8, 1/23.9, 1/24, 1/24.1, 1/24.2, 1/24.3, 1/24.4, 1/24.5, 1/24.6, 1/24.7, 1/24.8, 1/24.9, 1/25, 1/25.1, 1/25.2, 1/25.3, 1/25.4, 1/25.5, 1/25.6, 1/25.7, 1/25.8, 1/25.9, 1/26, 1/26.1, 1/26.2, 1/26.3, 1/26.4, 1/26.5, 1/26.6, 1/26.7, 1/26.8, 12/6.9, 1/27, 1/27.1, 1/27.2, 1/27.3, 1/27.4, 1/27.5, 1/27.6, 1/27.7, 1/27.8, 1/27.9, 1/28, 1/28.1, 1/28.2, 1/28.3, 1/28.4, 1/28.5, 1/28.6, 1/28.7, 1/28.8, 1/28.9, 1/29, 1/29.1, 1/29.2, 1/29.3, 1/29.4, 1/29.5, 1/29.6, 1/29.7, 1/29.8, 1/29.9, 1/30, 1/30.1, 1/30.2, 1/30.3, 1/30.4, 1/30.5, 1/30.6, 1/30.7, 1/30.8, 1/30.9, 1/31, 1/31.1, 1/31.2, 1/31.3, 1/31.4, 1/31.5, 1/31.6, 1/31.7, 1/31.8, 1/31.9, 1/32, 1/32.1, 1/32.2, 1/32.3, 1/32.4, 1/32.5, 1/32.6, 1/32.7, 1/32.8, 1/32.9, 1/33, 1/33.1, 1/33.2, 1/33.3, 1/33.4, 1/33.5, 1/33.6, 1/33.7, 1/33.8, 1/33.9, 1/34, 1/34.1, 1/34.2, 1/34.3, 1/34.4, 1/34.5, 1/34.6, 1/34.7, 1/34.8, 1/34.9, 1/35, 1/35.1, 1/35.2, 1/35.3, 1/35.4, 1/35.5, 1/35.6, 1/35.7, 1/35.8, 1/35.9, 1/36, 1/36.1, 1/36.2, 1/36.3, 1/36.4, 1/36.5, 1/36.6, 1/36.7, 1/36.8, 1/36.9, 1/37, 1/37.1, 1/37.2, 1/37.3, 1/37.4, 1/37.5, 1/37.6, 1/37.7, 1/37.8, 1/37.9, 1/38, 1/38.1, 1/38.2, 1/38.3, 1/38.4, 1/38.5, 1/38.6, 1/38.7, 1/38.8, 1/38.9, 1/39, 1/39.1, 1/39.2, 1/39.3, 1/39.4, 1/39.5, 1/39.6, 1/39.7, 1/39.8, 1/39.9, 1/40, 1/40.1, 1/40.2, 1/40.3, 1/40.4, 1/40.5, 1/40.6, 1/40.7, 1/40.8, 1/40.9, 1/41, 1/41.1, 1/41.2, 1/41.3, 1/41.4, 1/41.5, 1/41.6, 1/41.7, 1/41.8, 1/41.9, 1/42, 1/42.1, 1/42.2, 1/42.3, 1/42.4, 1/42.5, 1/42.6, 1/42.7, 1/42.8, 1/42.9, 1/43, 1/43.1, 1/43.2, 1/43.3, 1/43.4, 1/43.5, 1/43.6, 1/43.7, 1/43.8, 1/43.9, 1/44, 1/44.1, 1/44.2, 1/44.3, 1/44.4, 1/44.5, 1/44.6, 1/44.7, 1/44.8, 1/44.9, 1/45, 1/45.1, 1/45.2, 1/45.3, 1/45.4, 1/45.5, 1/45.6, 1/45.7, 1/45.8, 1/45.9, 1/46, 1/46.1, 1/46.2, 1/46.3, 1/46.4, 1/46.5, 1/46.6, 1/46.7, 1/46.8, 1/46.9, 1/47, 1/47.1, 1/47.2, 1/47.3, 1/47.4, 1/47.5, 1/47.6, 1/47.7, 1/47.8, 1/47.9, 1/48, 1/48.1, 1/48.2, 1/48.3, 1/48.4, 1/48.5, 1/48.6, 1/48.7, 1/48.8, 1/48.9, 1/49, 1/49.1, 1/49.2, 1/49.3, 1/49.4, 1/49.5, 1/49.6, 1/49.7, 1/49.8, 1/49.9, 1/50, 1/50.1, 1/50.2, 1/50.3, 1/50.4, 1/50.5, 1/50.6, 1/50.7, 1/50.8, 1/50.9, 1/51, 1/51.1, 1/51.2, 1/51.3, 1/51.4, 1/51.5, 1/51.6, 1/51.7, 1/51.8, 1/51.9, 1/52, 1/52.1, 1/52.2, 1/52.3, 1/52.4, 1/52.5, 1/52.6, 1/52.7, 1/52.8, 1/52.9, 1/53, 1/53.1, 1/53.2, 1/53.3, 1/53.4, 1/53.5, 1/53.6, 1/53.7, 1/53.8, 1/53.9, 1/54, 1/54.1, 1/54.2, 1/54.3, 1/54.4, 1/54.5, 1/54.6, 1/54.7, 1/54.8, 1/54.9, 1/55, 1/55.1, 1/55.2, 1/55.3, 1/55.4, 1/55.5, 1/55.6, 1/55.7, 1/55.8, 1/55.9, 1/56, 1/56.1, 1/56.2, 1/56.3, 1/56.4, 1/56.5, 1/56.6, 1/56.7, 1/56.8, 1/56.9, 1/57, 1/57.1, 1/57.2, 1/57.3, 1/57.4, 1/57.5, 1/57.6, 1/57.7, 1/57.8, 1/57.9, 1/58, 1/58.1, 1/58.2, 1/58.3, 1/58.4, 1/58.5, 1/58.6, 1/58.7, 1/58.8, 1/58.9, 1/59, 1/59.1, 1/59.2, 1/59.3, 1/59.4, 1/59.5, 1/59.6, 1/59.7, 1/59.8, 1/59.9, 1/60 or ratios thereabout or therebetween. Ranges of ratios of 1/1 to 1/60 can be employed, and subranges as set forth below.
More preferred mosaicisms are:
1/4, 1/4.1, 1/4.2, 1/4.3, 1/4.4, 1/4.5, 1/4.6, 1/4.7, 1/4.8, 1/4.9, 1/5, 1/5.1, 1/5.2, 1/5.3, 1/5.4, 1/5.5, 1/5.6, 1/5.7, 1/5.8, 1/5.9, 1/6, 1/6.1, 1/6.2, 1/6.3, 1/6.4, 1/6.5, 1/6.6, 1/6.7, 1/6.8, 1/6.9, 1/7, 1/7.1, 1/7.2, 1/7.3, 1/7.4, 1/7.5, 1/7.6, 1/7.7, 1/7.8, 1/7.9, 1/8, 1/8.1, 1/8.2, 1/8.3, 1/8.4, 1/8.5, 1/8.6, 1/8.7, 1/8.8, 1/8.9, 1/9, 1/9.1, 1/9.2, 1/9.3, 1/9.4, 1/9.5, 1/9.6, 1/9.7, 1/9.8, 1/9.9, 1/10, 1/10.1, 1/10.2, 1/10.3, 1/10.4, 1/10.5, 1/10.6, 1/10.7, 1/10.8, 1/10.9, 1/11, 1/11.1, 1/11.2, 1/11.3, 1/11.4, 1/11.5, 1/11.6, 1/11.7, 1/11.8, 1/11.9, 1/12, 1/12.1, 1/12.2, 1/12.3, 1/12.4, 1/12.5, 1/12.6, 1/12.7, 1/12.8, 1/12.9 or 1/13.
Further preferred mosaicisms are:
1/5, 1/5.1, 1/5.2, 1/5.3, 1/5.4, 1/5.5, 1/5.6, 1/5.7, 1/5.8, 1/5.9, 1/6, 1/6.1, 1/6.2, 1/6.3, 1/6.4, 1/6.5, 1/6.6, 1/6.7, 1/6.8, 1/6.9, 1/7, 1/7.1, 1/7.2, 1/7.3, 1/7.4, 1/7.5, 1/7.6, 1/7.7, 1/7.8, 1/7.9, 1/8, 1/8.1, 1/8.2, 1/8.3, 1/8.4, 1/8.5, 1/8.6, 1/8.7, 1/8.8, 1/8.9, 1/9, 1/9.1, 1/9.2, 1/9.3, 1/9.4, 1/9.5, 1/9.6, 1/9.7, 1/9.8, 1/9.9, 1/10, 1/10.1, 1/10.2, 1/10.3, 1/10.4, 1/10.5, 1/10.6, 1/10.7, 1/10.8, 1/10.9, 1/11, 1/11.1, 1/11.2, 1/11.3, 1/11.4, 1/11.5, 1/11.6, 1/11.7, 1/11.8, 1/11.9, or 1/12.
Still more preferred mosaicisms are:
1/7, 1/7.1, 1/7.2, 1/7.3, 1/7.4, 1/7.5, 1/7.6, 1/7.7, 1/7.8, 1/7.9, 1/8, 1/8.1, 1/8.2, 1/8.3, 1/8.4, 1/8.5, 1/8.6, 1/8.7, 1/8.8, 1/8.9, 1/9, 1/9.1, 1/9.2, 1/9.3, 1/9.4, 1/9.5, 1/9.6, 1/9.7, 1/9.8, 1/9.9, 1/10, 1/10.1, 1/10.2, 1/10.3, 1/10.4, 1/10.5, 1/10.6, 1/10.7, 1/10.8, 1/10.9, or 1/11.
Preferred ranges of mosaicisms are 1/4 to 1/13; 1/5 to 1/12; 1/6 to 1/11, 1/7 to 1/10.5. or 1/7.5 to 1/10.
(6) Preferred molar ratios of AAV-FM to SCM-RM are as follows: 1:20, 1:25, 1:30, 1:35, 1:40, 1:45, 1:50, 1:55, 1:60, 1:65, 1:70, 1:75, 1:80, 1:85, 1:90, 1:95, 1:100, 1:105, 1:110, 1:115, 1:120, 1:125, 1:130, 1:135, 1:140, 1:145, 1:150, 1:155, 1:160, 1:165, 1:170, 1:175, 1:180, 1:185, 1:190, 1:195, 1:200, 1:205, 1:210, 1:215, 1:220, 1:225, 1:230, 1:235, 1:240, 1:245, 1:250, 1:255, 1:260, 1:265, 1:270, 1:275, 1:280, 1:285, 1:290, 1:295, 1:300, 1:305, 1:310, 1:315, 1:320, 1:325, 1:330, 1:335, 1:340, 1:345, 1:350, 1:355, 1:360, 1:365, 1:370, 1:375, 1:380, 1:385, 1:390, 1:395, 1:400, 1:405, 1:410, 1:415, 1:420, 1:425, 1:430, 1:435, 1:440, 1:445, 1:450, 1:455, 1:460, 1:465, 1:470, 1:475, 1:480, 1:485, 1:490, 1:495, 1:500, 1:505, 1:510, 1:515, 1:520, 1:525, 1:530, 1:535, 1:540, 1:545, 1:550, 1:555, 1:560, 1:565, 1:570, 1:575, 1:580, 1:585, 1:590, 1:595, 1:600, 1:605, 1:610, 1:615, 1:620, 1:625, 1:630, 1:635, 1:640, 1:645, 1:650, 1:655, 1:660, 1:665, 1:670, 1:675, 1:680, 1:685, 1:690, 1:695, 1:700, 1:705, 1:710, 1:715, 1:720, 1:725, 1:730, 1:735, 1:740, 1:745, 1:750, 1:755, 1:760, 1:765, 1:770, 1:775, 1:780, 1:785, 1:790, 1:795, 1:800, 1:805, 1:810, 1:815, 1:820, 1:825, 1:830, 1:835, 1:840, 1:845, 1:850, 1:855, 1:860, 1:865, 1:870, 1:875, 1:880, 1:885, 1:890, 1:895, 1:900, 1:905, 1:910, 1:915, 1:920, 1:925, 1:930, 1:935, 1:940, 1:945, 1:950, 1:955, 1:960, 1:965, 1:970, 1:975, 1:980, 1:985, 1:990, 1:995, 1:1000, 1:>1000 or any ratio thereabout or therebetween.
More preferred ratios AAV-FM to SCM-RM are: 1:30, 1:35, 1:40, 1:45, 1:50, 1:55, 1:60, 1:65, 1:70, 1:75, 1:80, 1:85, 1:90, 1:95, 1:100, 1:105, 1:110, 1:115, 1:120, 1:125, 1:130, 1:135, 1:140, 1:145, 1:150, 1:155, 1:160, 1:165, 1:170, 1:175, 1:180, 1:185, 1:190, 1:195, 1:200, 1:205, 1:210, 1:215, 1:220, 1:225, 1:230, 1:235, 1:240, 1:245, 1:250, 1:255, 1:260, 1:265, 1:270, 1:275, 1:280, 1:285, 1:290, 1:295, 1:300 or any ratio thereabout or therebetween.
Preferred ranges of AAV-FM to SCM-RM are 1:20 to 1:1000, and more preferred ranges are: 1:30 to 1:100, 1:40 to 1:100, 1:50 to 1:100 1:60 to 1:100, 1:70 to 1:100, 1:80 to 1:100, 1:90:1:100, 1:30 to 1:150, 1:40 to 1:150, 1:50 to 1:150 1:60 to 1:150, 1:70 to 1:150, 1:80 to 1:150, 1:90 to :150, 1:100 to 1:150, 1:30 to 1:200, 1:40 to 1:200, 1:50 to 1:200 1:60 to 1:200, 1:70 to 1:200, 1:80 to 1:200, 1:90:1:200, 1:100 to 1:200, 1:30 to 1:250, 1:40 to 1:250, 1:50 to 1:250 1:60 to 1:250, 1:70 to 1:250, 1:80 to 1:250, 1:90 to :250, 1:100 to 1:250, 1:30 to 1:300, 1:40 to 1:300, 1:50 to 1:300 1:60 to 1:300, 1:70 to 1:300, 1:80 to 1:300, 1:90:1:300, or 1:100 to 1:300.
(7) The inventions provide for a desired conjugation of a level of conjugation of at least 10%, at least 20%, at least 30%, and at least 40%. Preferred levels are at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or up to 100%, any of which can be considered complete depending on the purpose. More preferably, the desired level of conjugation typically will be about 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%.
Ranges of desired conjugation levels can be 10% to 100%, 20% to 99%, 30% to 99%, 40% to 99%, 50% to 99%, 60% to 99%, 70% to 99%, 80% to 99%, or 90% to 99%. Preferred ranges of desired conjugation levels can be 40% to 100%, 40% to 99%, 45% to 95%, 50% to 95%, 55% to 90%, 60% to 90%, 65% to 95%, 65% to 85%, 65% to 90%, 70% to 90%, 75% to 90%, 75% to 85%, 75% to 80%, or 80% to 85%. More preferably, the range is 65% to 95%.
The second chart below cites to exemplary modifications to the above chart based upon the descriptions and sequence examples contained herein. Points 1-7 above also apply to the second chart below:
Covalently surface modified AAV 7 can be made by transfecting a cell with plasmids as set forth below, followed by culturing the transfected cells and harvesting the resulting AAV, and then conjugating the resulting AAV with a second cognate member (SCM) that is fused to a retargeting molecule The first chart below uses SpyTag as the first member of a specific binding pair, and Adenovirus Helper Genes. Modifications can be undertaken as disclosed below:
(1) Plasmid pGOI can comprise one or more genes that are desired to be expressed in covalently surface modified AAV7.
(2) Plasmids pRC-FM can be modified for other specific binding pairs. The first member (FM) should be complementary to a second cognate member (SCM) that is fused to a retargeting molecule (for example, an antibody, as well derivatives and fragments thereof, and still other molecules). See Definitions and Description sections of the Detailed Description, the Figures and associated text for “retargeting” and “retargeting molecules”. The populations of FMs and SCMs can be homogenous or heterogeneous as long as the selected FMs can come in contact with appropriate SCMs so that binding can occur.
(3) Detargeting mutations are optional and can be undertaken as disclosed herein and in publications. See Definitions and Description sections of the Detailed Description, the Figures and associated text for “detargeting” and “detargeting mutations”.
(4) To lessen the possibility of encountering neutralizing antibodies when the covalently surface modified AAV is administered to a subject, KTag can be used as an SCM to bind with SpyTag (FM) (SEQ ID NOS: 54 and 86). KTag and SpyLigase are based upon SpyCatcher. KTag (SEQ ID NO: 85) has only 10 amino acids, which renders it less immunogenic. KTag can be bound to SpyTag in the presence of SpyLigase (SEQ ID NO: 61). The SpyLigase can be removed by subsequent purification, such as by chromatography and/or filtration so that the SpyLigase will not have an appreciable presence in the final drug substance.
(5) Preferred mosaicisms are as follows: 1/1, 1/1.1, 1/1.2, 1/1.3, 1/1.4, 1/1.5, 1/1.6, 1/1.7, 1/1.8, 1/1.9, 1/2, 1/2.1, 1/2.2, 1/2.3, 1/2.4, 1/2.5, 1/2.6, 1/2.7, 1/2.8, 1/2.9, 1/3, 1/3.1, 1/3.2, 1/3.3, 1/3.4, 1/3.5, 1/3.6, 1/3.7, 1/3.8, 1/3.9, 1/4, 1/4.1, 1/4.2, 1/4.3, 1/4.4, 1/4.5, 1/4.6, 1/4.7, 1/4.8, 1/4.9, 1/5, 1/5.1, 1/5.2, 1/5.3, 1/5.4, 1/5.5, 1/5.6, 1/5.7, 1/5.8, 1/5.9, 1/6, 1/6.1, 1/6.2, 1/6.3, 1/6.4, 1/6.5, 1/6.6, 1/6.7, 1/6.8, 1/6.9, 1/7, 1/7.1, 1/7.2, 1/7.3, 1/7.4, 1/7.5, 1/7.6, 1/7.7, 1/7.8, 1/7.9, 1/8, 1/8.1, 1/8.2, 1/8.3, 1/8.4, 1/8.5, 1/8.6, 1/8.7, 1/8.8, 1/8.9, 1/9, 1/9.1, 1/9.2, 1/9.3, 1/9.4, 1/9.5, 1/9.6, 1/9.7, 1/9.8, 1/9.9, 1/10, 1/10.1, 1/10.2, 1/10.3, 1/10.4, 1/10.5, 1/10.6, 1/10.7, 1/10.8, 1/10.9, 1/11, 1/11.1, 1/11.2, 1/11.3, 1/11.4, 1/11.5, 1/11.6, 1/11.7, 1/11.8, 1/11.9, 1/12, 1/12.1, 1/12.2, 1/12.3, 1/12.4, 1/12.5, 1/12.6, 1/12.7, 1/12.8, 1/12.9, 1/13, 1/13.1, 1/13.2, 1/13.3, 1/13.4, 1/13.5, 1/13.6, 1/13.7, 1/13.8, 1/13.9, 1/14, 1/14.1, 1/14.2, 1/14.3, 1/14.4, 1/14.5, 1/14.6, 1/14.7, 1/14.8, 1/14.9, 1/15, 1/15.1, 1/15.2, 1/15.3, 1/15.4, 1/15.5, 1/15.6, 1/15.7, 1/15.8, 1/15.9, 1/16, 1/16.1, 1/16.2, 1/16.3, 1/16.4, 1/16.5, 1/16.6, 1/16.7, 1/16.8, 1/16.9, 1/17, 1/17.1, 1/17.2, 1/17.3, 1/17.4, 1/17.5, 1/17.6, 1/17.7, 1/17.8, 1/17.9, 1/18, 1/18.1, 1/18.2, 1/18.3, 1/18.4, 1/18.5, 1/18.6, 1/18.7, 1/18.8, 1/18.9, 1/19, 11/9.1, 1/19.2, 1/19.3, 1/19.4, 1/91.5, 1/19.6, 1/19.7, 1/19.8, 1/19.9, 1/20, 1/21, 1/21.1, 1/21.2, 1/21.3, 1/21.4, 1/21.5, 1/21.6, 1/21.7, 1/21.8, 1/21.9, 1/22, 1/22.1, 1/22.2, 1/22.3, 1/22.4, 1/22.5, 1/22.6, 1/22.7, 1/22.8, 1/22.9, 1/23, 1/23.1, 1/23.2, 1/23.3, 1/23.4, 1/23.5, 1/23.6, 1/23.7, 1/23.8, 1/23.9, 1/24, 1/24.1, 1/24.2, 1/24.3, 1/24.4, 1/24.5, 1/24.6, 1/24.7, 1/24.8, 1/24.9, 1/25, 1/25.1, 1/25.2, 1/25.3, 1/25.4, 1/25.5, 1/25.6, 1/25.7, 1/25.8, 1/25.9, 1/26, 1/26.1, 1/26.2, 1/26.3, 1/26.4, 1/26.5, 1/26.6, 1/26.7, 1/26.8, 12/6.9, 1/27, 1/27.1, 1/27.2, 1/27.3, 1/27.4, 1/27.5, 1/27.6, 1/27.7, 1/27.8, 1/27.9, 1/28, 1/28.1, 1/28.2, 1/28.3, 1/28.4, 1/28.5, 1/28.6, 1/28.7, 1/28.8, 1/28.9, 1/29, 1/29.1, 1/29.2, 1/29.3, 1/29.4, 1/29.5, 1/29.6, 1/29.7, 1/29.8, 1/29.9, 1/30, 1/30.1, 1/30.2, 1/30.3, 1/30.4, 1/30.5, 1/30.6, 1/30.7, 1/30.8, 1/30.9, 1/31, 1/31.1, 1/31.2, 1/31.3, 1/31.4, 1/31.5, 1/31.6, 1/31.7, 1/31.8, 1/31.9, 1/32, 1/32.1, 1/32.2, 1/32.3, 1/32.4, 1/32.5, 1/32.6, 1/32.7, 1/32.8, 1/32.9, 1/33, 1/33.1, 1/33.2, 1/33.3, 1/33.4, 1/33.5, 1/33.6, 1/33.7, 1/33.8, 1/33.9, 1/34, 1/34.1, 1/34.2, 1/34.3, 1/34.4, 1/34.5, 1/34.6, 1/34.7, 1/34.8, 1/34.9, 1/35, 1/35.1, 1/35.2, 1/35.3, 1/35.4, 1/35.5, 1/35.6, 1/35.7, 1/35.8, 1/35.9, 1/36, 1/36.1, 1/36.2, 1/36.3, 1/36.4, 1/36.5, 1/36.6, 1/36.7, 1/36.8, 1/36.9, 1/37, 1/37.1, 1/37.2, 1/37.3, 1/37.4, 1/37.5, 1/37.6, 1/37.7, 1/37.8, 1/37.9, 1/38, 1/38.1, 1/38.2, 1/38.3, 1/38.4, 1/38.5, 1/38.6, 1/38.7, 1/38.8, 1/38.9, 1/39, 1/39.1, 1/39.2, 1/39.3, 1/39.4, 1/39.5, 1/39.6, 1/39.7, 1/39.8, 1/39.9, 1/40, 1/40.1, 1/40.2, 1/40.3, 1/40.4, 1/40.5, 1/40.6, 1/40.7, 1/40.8, 1/40.9, 1/41, 1/41.1, 1/41.2, 1/41.3, 1/41.4, 1/41.5, 1/41.6, 1/41.7, 1/41.8, 1/41.9, 1/42, 1/42.1, 1/42.2, 1/42.3, 1/42.4, 1/42.5, 1/42.6, 1/42.7, 1/42.8, 1/42.9, 1/43, 1/43.1, 1/43.2, 1/43.3, 1/43.4, 1/43.5, 1/43.6, 1/43.7, 1/43.8, 1/43.9, 1/44, 1/44.1, 1/44.2, 1/44.3, 1/44.4, 1/44.5, 1/44.6, 1/44.7, 1/44.8, 1/44.9, 1/45, 1/45.1, 1/45.2, 1/45.3, 1/45.4, 1/45.5, 1/45.6, 1/45.7, 1/45.8, 1/45.9, 1/46, 1/46.1, 1/46.2, 1/46.3, 1/46.4, 1/46.5, 1/46.6, 1/46.7, 1/46.8, 1/46.9, 1/47, 1/47.1, 1/47.2, 1/47.3, 1/47.4, 1/47.5, 1/47.6, 1/47.7, 1/47.8, 1/47.9, 1/48, 1/48.1, 1/48.2, 1/48.3, 1/48.4, 1/48.5, 1/48.6, 1/48.7, 1/48.8, 1/48.9, 1/49, 1/49.1, 1/49.2, 1/49.3, 1/49.4, 1/49.5, 1/49.6, 1/49.7, 1/49.8, 1/49.9, 1/50, 1/50.1, 1/50.2, 1/50.3, 1/50.4, 1/50.5, 1/50.6, 1/50.7, 1/50.8, 1/50.9, 1/51, 1/51.1, 1/51.2, 1/51.3, 1/51.4, 1/51.5, 1/51.6, 1/51.7, 1/51.8, 1/51.9, 1/52, 1/52.1, 1/52.2, 1/52.3, 1/52.4, 1/52.5, 1/52.6, 1/52.7, 1/52.8, 1/52.9, 1/53, 1/53.1, 1/53.2, 1/53.3, 1/53.4, 1/53.5, 1/53.6, 1/53.7, 1/53.8, 1/53.9, 1/54, 1/54.1, 1/54.2, 1/54.3, 1/54.4, 1/54.5, 1/54.6, 1/54.7, 1/54.8, 1/54.9, 1/55, 1/55.1, 1/55.2, 1/55.3, 1/55.4, 1/55.5, 1/55.6, 1/55.7, 1/55.8, 1/55.9, 1/56, 1/56.1, 1/56.2, 1/56.3, 1/56.4, 1/56.5, 1/56.6, 1/56.7, 1/56.8, 1/56.9, 1/57, 1/57.1, 1/57.2, 1/57.3, 1/57.4, 1/57.5, 1/57.6, 1/57.7, 1/57.8, 1/57.9, 1/58, 1/58.1, 1/58.2, 1/58.3, 1/58.4, 1/58.5, 1/58.6, 1/58.7, 1/58.8, 1/58.9, 1/59, 1/59.1, 1/59.2, 1/59.3, 1/59.4, 1/59.5, 1/59.6, 1/59.7, 1/59.8, 1/59.9, 1/60 or ratios thereabout or therebetween. Ranges of ratios of 1/1 to 1/60 can be employed, and subranges as set forth below.
More preferred mosaicisms are:
1/4, 1/4.1, 1/4.2, 1/4.3, 1/4.4, 1/4.5, 1/4.6, 1/4.7, 1/4.8, 1/4.9, 1/5, 1/5.1, 1/5.2, 1/5.3, 1/5.4, 1/5.5, 1/5.6, 1/5.7, 1/5.8, 1/5.9, 1/6, 1/6.1, 1/6.2, 1/6.3, 1/6.4, 1/6.5, 1/6.6, 1/6.7, 1/6.8, 1/6.9, 1/7, 1/7.1, 1/7.2, 1/7.3, 1/7.4, 1/7.5, 1/7.6, 1/7.7, 1/7.8, 1/7.9, 1/8, 1/8.1, 1/8.2, 1/8.3, 1/8.4, 1/8.5, 1/8.6, 1/8.7, 1/8.8, 1/8.9, 1/9, 1/9.1, 1/9.2, 1/9.3, 1/9.4, 1/9.5, 1/9.6, 1/9.7, 1/9.8, 1/9.9, 1/10, 1/10.1, 1/10.2, 1/10.3, 1/10.4, 1/10.5, 1/10.6, 1/10.7, 1/10.8, 1/10.9, 1/11, 1/11.1, 1/11.2, 1/11.3, 1/11.4, 1/11.5, 1/11.6, 1/11.7, 1/11.8, 1/11.9, 1/12, 1/12.1, 1/12.2, 1/12.3, 1/12.4, 1/12.5, 1/12.6, 1/12.7, 1/12.8, 1/12.9 or 1/13.
Further preferred mosaicisms are:
1/5, 1/5.1, 1/5.2, 1/5.3, 1/5.4, 1/5.5, 1/5.6, 1/5.7, 1/5.8, 1/5.9, 1/6, 1/6.1, 1/6.2, 1/6.3, 1/6.4, 1/6.5, 1/6.6, 1/6.7, 1/6.8, 1/6.9, 1/7, 1/7.1, 1/7.2, 1/7.3, 1/7.4, 1/7.5, 1/7.6, 1/7.7, 1/7.8, 1/7.9, 1/8, 1/8.1, 1/8.2, 1/8.3, 1/8.4, 1/8.5, 1/8.6, 1/8.7, 1/8.8, 1/8.9, 1/9, 1/9.1, 1/9.2, 1/9.3, 1/9.4, 1/9.5, 1/9.6, 1/9.7, 1/9.8, 1/9.9, 1/10, 1/10.1, 1/10.2, 1/10.3, 1/10.4, 1/10.5, 1/10.6, 1/10.7, 1/10.8, 1/10.9, 1/11, 1/11.1, 1/11.2, 1/11.3, 1/11.4, 1/11.5, 1/11.6, 1/11.7, 1/11.8, 1/11.9, or 1/12.
Still more preferred mosaicisms are:
1/7, 1/7.1, 1/7.2, 1/7.3, 1/7.4, 1/7.5, 1/7.6, 1/7.7, 1/7.8, 1/7.9, 1/8, 1/8.1, 1/8.2, 1/8.3, 1/8.4, 1/8.5, 1/8.6, 1/8.7, 1/8.8, 1/8.9, 1/9, 1/9.1, 1/9.2, 1/9.3, 1/9.4, 1/9.5, 1/9.6, 1/9.7, 1/9.8, 1/9.9, 1/10, 1/10.1, 1/10.2, 1/10.3, 1/10.4, 1/10.5, 1/10.6, 1/10.7, 1/10.8, 1/10.9, or 1/11.
Preferred ranges of mosaicisms are 1/4 to 1/13; 1/5 to 1/12; 1/6 to 1/11, 1/7 to 1/10.5. or 1/7.5 to 1/10.
(6) Preferred molar ratios of AAV-FM to SCM-RM are as follows: 1:20, 1:25, 1:30, 1:35, 1:40, 1:45, 1:50, 1:55, 1:60, 1:65, 1:70, 1:75, 1:80, 1:85, 1:90, 1:95, 1:100, 1:105, 1:110, 1:115, 1:120, 1:125, 1:130, 1:135, 1:140, 1:145, 1:150, 1:155, 1:160, 1:165, 1:170, 1:175, 1:180, 1:185, 1:190, 1:195, 1:200, 1:205, 1:210, 1:215, 1:220, 1:225, 1:230, 1:235, 1:240, 1:245, 1:250, 1:255, 1:260, 1:265, 1:270, 1:275, 1:280, 1:285, 1:290, 1:295, 1:300, 1:305, 1:310, 1:315, 1:320, 1:325, 1:330, 1:335, 1:340, 1:345, 1:350, 1:355, 1:360, 1:365, 1:370, 1:375, 1:380, 1:385, 1:390, 1:395, 1:400, 1:405, 1:410, 1:415, 1:420, 1:425, 1:430, 1:435, 1:440, 1:445, 1:450, 1:455, 1:460, 1:465, 1:470, 1:475, 1:480, 1:485, 1:490, 1:495, 1:500, 1:505, 1:510, 1:515, 1:520, 1:525, 1:530, 1:535, 1:540, 1:545, 1:550, 1:555, 1:560, 1:565, 1:570, 1:575, 1:580, 1:585, 1:590, 1:595, 1:600, 1:605, 1:610, 1:615, 1:620, 1:625, 1:630, 1:635, 1:640, 1:645, 1:650, 1:655, 1:660, 1:665, 1:670, 1:675, 1:680, 1:685, 1:690, 1:695, 1:700, 1:705, 1:710, 1:715, 1:720, 1:725, 1:730, 1:735, 1:740, 1:745, 1:750, 1:755, 1:760, 1:765, 1:770, 1:775, 1:780, 1:785, 1:790, 1:795, 1:800, 1:805, 1:810, 1:815, 1:820, 1:825, 1:830, 1:835, 1:840, 1:845, 1:850, 1:855, 1:860, 1:865, 1:870, 1:875, 1:880, 1:885, 1:890, 1:895, 1:900, 1:905, 1:910, 1:915, 1:920, 1:925, 1:930, 1:935, 1:940, 1:945, 1:950, 1:955, 1:960, 1:965, 1:970, 1:975, 1:980, 1:985, 1:990, 1:995, 1:1000, 1:>1000 or any ratio thereabout or therebetween.
More preferred ratios AAV-FM to SCM-RM are: 1:30, 1:35, 1:40, 1:45, 1:50, 1:55, 1:60, 1:65, 1:70, 1:75, 1:80, 1:85, 1:90, 1:95, 1:100, 1:105, 1:110, 1:115, 1:120, 1:125, 1:130, 1:135, 1:140, 1:145, 1:150, 1:155, 1:160, 1:165, 1:170, 1:175, 1:180, 1:185, 1:190, 1:195, 1:200, 1:205, 1:210, 1:215, 1:220, 1:225, 1:230, 1:235, 1:240, 1:245, 1:250, 1:255, 1:260, 1:265, 1:270, 1:275, 1:280, 1:285, 1:290, 1:295, 1:300 or any ratio thereabout or therebetween
Preferred ranges of AAV-FM to SCM-RM are 1:20 to 1:1000, and more preferred ranges are: 1:30 to 1:100, 1:40 to 1:100, 1:50 to 1:100 1:60 to 1:100, 1:70 to 1:100, 1:80 to 1:100, 1:90:1:100, 1:30 to 1:150, 1:40 to 1:150, 1:50 to 1:150 1:60 to 1:150, 1:70 to 1:150, 1:80 to 1:150, 1:90 to :150, 1:100 to 1:150, 1:30 to 1:200, 1:40 to 1:200, 1:50 to 1:200 1:60 to 1:200, 1:70 to 1:200, 1:80 to 1:200, 1:90:1:200, 1:100 to 1:200, 1:30 to 1:250, 1:40 to 1:250, 1:50 to 1:250 1:60 to 1:250, 1:70 to 1:250, 1:80 to 1:250, 1:90 to :250, 1:100 to 1:250, 1:30 to 1:300, 1:40 to 1:300, 1:50 to 1:300 1:60 to 1:300, 1:70 to 1:300, 1:80 to 1:300, 1:90:1:300, or 1:100 to 1:300.
(7) The inventions provide for a desired conjugation of a level of conjugation of at least 10%, at least 20%, at least 30%, and at least 40%. Preferred levels are at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or up to 100%, any of which can be considered complete depending on the purpose. More preferably, the desired level of conjugation typically will be about 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%.
Ranges of desired conjugation levels can be 10% to 100%, 20% to 99%, 30% to 99%, 40% to 99%, 50% to 99%, 60% to 99%, 70% to 99%, 80% to 99%, or 90% to 99%. Preferred ranges of desired conjugation levels can be 40% to 100%, 40% to 99%, 45% to 95%, 50% to 95%, 55% to 90%, 60% to 90%, 65% to 95%, 65% to 85%, 65% to 90%, 70% to 90%, 75% to 90%, 75% to 85%, 75% to 80%, or 80% to 85%. More preferably, the range is 65% to 95%.
The second chart below cites to exemplary modifications to the above chart based upon the descriptions and sequence examples contained herein. Points 1-7 above also apply to the second chart below:
Covalently surface modified AAV8 can be made by transfecting a cell with plasmids as set forth below, followed by culturing the transfected cells and harvesting the resulting AAV, and then conjugating the resulting AAV with a second cognate member (SCM) that is fused to a retargeting molecule The first chart below uses SpyTag as the first member of a specific binding pair, and Adenovirus Helper Genes. Modifications can be undertaken as disclosed below:
(1) Plasmid pGOI can comprise one or more genes that are desired to be expressed in covalently surface modified AAV8.
(2) Plasmids pRC-FM can be modified for other specific binding pairs. The first member (FM) should be complementary to a second cognate member (SCM) that is fused to a retargeting molecule (for example, an antibody, as well derivatives and fragments thereof, and still other molecules). See Definitions and Description sections of the Detailed Description, the Figures and associated text for “retargeting” and “retargeting molecules”. The populations of FMs and SCMs can be homogenous or heterogeneous as long as the selected FMs can come in contact with appropriate SCMs so that binding can occur.
(3) Detargeting mutations are optional and can be undertaken as disclosed herein and in publications. See Definitions and Description sections of the Detailed Description, the Figures and associated text for “detargeting” and “detargeting mutations”.
(4) To lessen the possibility of encountering neutralizing antibodies when the covalently surface modified AAV is administered to a subject, KTag can be used as an SCM to bind with SpyTag (FM) (SEQ ID NOS: 54 and 86). KTag and SpyLigase are based upon SpyCatcher. KTag (SEQ ID NO: 85) has only 10 amino acids, which renders it less immunogenic. KTag can be bound to SpyTag in the presence of SpyLigase (SEQ ID NO: 61). The SpyLigase can be removed by subsequent purification, such as by chromatography and/or filtration so that the SpyLigase will not have an appreciable presence in the final drug substance.
(5) Preferred mosaicisms are as follows: 1/1, 1/1.1, 1/1.2, 1/1.3, 1/1.4, 1/1.5, 1/1.6, 1/1.7, 1/1.8, 1/1.9, 1/2, 1/2.1, 1/2.2, 1/2.3, 1/2.4, 1/2.5, 1/2.6, 1/2.7, 1/2.8, 1/2.9, 1/3, 1/3.1, 1/3.2, 1/3.3, 1/3.4, 1/3.5, 1/3.6, 1/3.7, 1/3.8, 1/3.9, 1/4, 1/4.1, 1/4.2, 1/4.3, 1/4.4, 1/4.5, 1/4.6, 1/4.7, 1/4.8, 1/4.9, 1/5, 1/5.1, 1/5.2, 1/5.3, 1/5.4, 1/5.5, 1/5.6, 1/5.7, 1/5.8, 1/5.9, 1/6, 1/6.1, 1/6.2, 1/6.3, 1/6.4, 1/6.5, 1/6.6, 1/6.7, 1/6.8, 1/6.9, 1/7, 1/7.1, 1/7.2, 1/7.3, 1/7.4, 1/7.5, 1/7.6, 1/7.7, 1/7.8, 1/7.9, 1/8, 1/8.1, 1/8.2, 1/8.3, 1/8.4, 1/8.5, 1/8.6, 1/8.7, 1/8.8, 1/8.9, 1/9, 1/9.1, 1/9.2, 1/9.3, 1/9.4, 1/9.5, 1/9.6, 1/9.7, 1/9.8, 1/9.9, 1/10, 1/10.1, 1/10.2, 1/10.3, 1/10.4, 1/10.5, 1/10.6, 1/10.7, 1/10.8, 1/10.9, 1/11, 1/11.1, 1/11.2, 1/11.3, 1/11.4, 1/11.5, 1/11.6, 1/11.7, 1/11.8, 1/11.9, 1/12, 1/12.1, 1/12.2, 1/12.3, 1/12.4, 1/12.5, 1/12.6, 1/12.7, 1/12.8, 1/12.9, 1/13, 1/13.1, 1/13.2, 1/13.3, 1/13.4, 1/13.5, 1/13.6, 1/13.7, 1/13.8, 1/13.9, 1/14, 1/14.1, 1/14.2, 1/14.3, 1/14.4, 1/14.5, 1/14.6, 1/14.7, 1/14.8, 1/14.9, 1/15, 1/15.1, 1/15.2, 1/15.3, 1/15.4, 1/15.5, 1/15.6, 1/15.7, 1/15.8, 1/15.9, 1/16, 1/16.1, 1/16.2, 1/16.3, 1/16.4, 1/16.5, 1/16.6, 1/16.7, 1/16.8, 1/16.9, 1/17, 1/17.1, 1/17.2, 1/17.3, 1/17.4, 1/17.5, 1/17.6, 1/17.7, 1/17.8, 1/17.9, 1/18, 1/18.1, 1/18.2, 1/18.3, 1/18.4, 1/18.5, 1/18.6, 1/18.7, 1/18.8, 1/18.9, 1/19, 11/9.1, 1/19.2, 1/19.3, 1/19.4, 1/91.5, 1/19.6, 1/19.7, 1/19.8, 1/19.9, 1/20, 1/21, 1/21.1, 1/21.2, 1/21.3, 1/21.4, 1/21.5, 1/21.6, 1/21.7, 1/21.8, 1/21.9, 1/22, 1/22.1, 1/22.2, 1/22.3, 1/22.4, 1/22.5, 1/22.6, 1/22.7, 1/22.8, 1/22.9, 1/23, 1/23.1, 1/23.2, 1/23.3, 1/23.4, 1/23.5, 1/23.6, 1/23.7, 1/23.8, 1/23.9, 1/24, 1/24.1, 1/24.2, 1/24.3, 1/24.4, 1/24.5, 1/24.6, 1/24.7, 1/24.8, 1/24.9, 1/25, 1/25.1, 1/25.2, 1/25.3, 1/25.4, 1/25.5, 1/25.6, 1/25.7, 1/25.8, 1/25.9, 1/26, 1/26.1, 1/26.2, 1/26.3, 1/26.4, 1/26.5, 1/26.6, 1/26.7, 1/26.8, 12/6.9, 1/27, 1/27.1, 1/27.2, 1/27.3, 1/27.4, 1/27.5, 1/27.6, 1/27.7, 1/27.8, 1/27.9, 1/28, 1/28.1, 1/28.2, 1/28.3, 1/28.4, 1/28.5, 1/28.6, 1/28.7, 1/28.8, 1/28.9, 1/29, 1/29.1, 1/29.2, 1/29.3, 1/29.4, 1/29.5, 1/29.6, 1/29.7, 1/29.8, 1/29.9, 1/30, 1/30.1, 1/30.2, 1/30.3, 1/30.4, 1/30.5, 1/30.6, 1/30.7, 1/30.8, 1/30.9, 1/31, 1/31.1, 1/31.2, 1/31.3, 1/31.4, 1/31.5, 1/31.6, 1/31.7, 1/31.8, 1/31.9, 1/32, 1/32.1, 1/32.2, 1/32.3, 1/32.4, 1/32.5, 1/32.6, 1/32.7, 1/32.8, 1/32.9, 1/33, 1/33.1, 1/33.2, 1/33.3, 1/33.4, 1/33.5, 1/33.6, 1/33.7, 1/33.8, 1/33.9, 1/34, 1/34.1, 1/34.2, 1/34.3, 1/34.4, 1/34.5, 1/34.6, 1/34.7, 1/34.8, 1/34.9, 1/35, 1/35.1, 1/35.2, 1/35.3, 1/35.4, 1/35.5, 1/35.6, 1/35.7, 1/35.8, 1/35.9, 1/36, 1/36.1, 1/36.2, 1/36.3, 1/36.4, 1/36.5, 1/36.6, 1/36.7, 1/36.8, 1/36.9, 1/37, 1/37.1, 1/37.2, 1/37.3, 1/37.4, 1/37.5, 1/37.6, 1/37.7, 1/37.8, 1/37.9, 1/38, 1/38.1, 1/38.2, 1/38.3, 1/38.4, 1/38.5, 1/38.6, 1/38.7, 1/38.8, 1/38.9, 1/39, 1/39.1, 1/39.2, 1/39.3, 1/39.4, 1/39.5, 1/39.6, 1/39.7, 1/39.8, 1/39.9, 1/40, 1/40.1, 1/40.2, 1/40.3, 1/40.4, 1/40.5, 1/40.6, 1/40.7, 1/40.8, 1/40.9, 1/41, 1/41.1, 1/41.2, 1/41.3, 1/41.4, 1/41.5, 1/41.6, 1/41.7, 1/41.8, 1/41.9, 1/42, 1/42.1, 1/42.2, 1/42.3, 1/42.4, 1/42.5, 1/42.6, 1/42.7, 1/42.8, 1/42.9, 1/43, 1/43.1, 1/43.2, 1/43.3, 1/43.4, 1/43.5, 1/43.6, 1/43.7, 1/43.8, 1/43.9, 1/44, 1/44.1, 1/44.2, 1/44.3, 1/44.4, 1/44.5, 1/44.6, 1/44.7, 1/44.8, 1/44.9, 1/45, 1/45.1, 1/45.2, 1/45.3, 1/45.4, 1/45.5, 1/45.6, 1/45.7, 1/45.8, 1/45.9, 1/46, 1/46.1, 1/46.2, 1/46.3, 1/46.4, 1/46.5, 1/46.6, 1/46.7, 1/46.8, 1/46.9, 1/47, 1/47.1, 1/47.2, 1/47.3, 1/47.4, 1/47.5, 1/47.6, 1/47.7, 1/47.8, 1/47.9, 1/48, 1/48.1, 1/48.2, 1/48.3, 1/48.4, 1/48.5, 1/48.6, 1/48.7, 1/48.8, 1/48.9, 1/49, 1/49.1, 1/49.2, 1/49.3, 1/49.4, 1/49.5, 1/49.6, 1/49.7, 1/49.8, 1/49.9, 1/50, 1/50.1, 1/50.2, 1/50.3, 1/50.4, 1/50.5, 1/50.6, 1/50.7, 1/50.8, 1/50.9, 1/51, 1/51.1, 1/51.2, 1/51.3, 1/51.4, 1/51.5, 1/51.6, 1/51.7, 1/51.8, 1/51.9, 1/52, 1/52.1, 1/52.2, 1/52.3, 1/52.4, 1/52.5, 1/52.6, 1/52.7, 1/52.8, 1/52.9, 1/53, 1/53.1, 1/53.2, 1/53.3, 1/53.4, 1/53.5, 1/53.6, 1/53.7, 1/53.8, 1/53.9, 1/54, 1/54.1, 1/54.2, 1/54.3, 1/54.4, 1/54.5, 1/54.6, 1/54.7, 1/54.8, 1/54.9, 1/55, 1/55.1, 1/55.2, 1/55.3, 1/55.4, 1/55.5, 1/55.6, 1/55.7, 1/55.8, 1/55.9, 1/56, 1/56.1, 1/56.2, 1/56.3, 1/56.4, 1/56.5, 1/56.6, 1/56.7, 1/56.8, 1/56.9, 1/57, 1/57.1, 1/57.2, 1/57.3, 1/57.4, 1/57.5, 1/57.6, 1/57.7, 1/57.8, 1/57.9, 1/58, 1/58.1, 1/58.2, 1/58.3, 1/58.4, 1/58.5, 1/58.6, 1/58.7, 1/58.8, 1/58.9, 1/59, 1/59.1, 1/59.2, 1/59.3, 1/59.4, 1/59.5, 1/59.6, 1/59.7, 1/59.8, 1/59.9, 1/60 or ratios thereabout or therebetween. Ranges of ratios of 1/1 to 1/60 can be employed, and subranges as set forth below.
More preferred mosaicisms are:
1/4, 1/4.1, 1/4.2, 1/4.3, 1/4.4, 1/4.5, 1/4.6, 1/4.7, 1/4.8, 1/4.9, 1/5, 1/5.1, 1/5.2, 1/5.3, 1/5.4, 1/5.5, 1/5.6, 1/5.7, 1/5.8, 1/5.9, 1/6, 1/6.1, 1/6.2, 1/6.3, 1/6.4, 1/6.5, 1/6.6, 1/6.7, 1/6.8, 1/6.9, 1/7, 1/7.1, 1/7.2, 1/7.3, 1/7.4, 1/7.5, 1/7.6, 1/7.7, 1/7.8, 1/7.9, 1/8, 1/8.1, 1/8.2, 1/8.3, 1/8.4, 1/8.5, 1/8.6, 1/8.7, 1/8.8, 1/8.9, 1/9, 1/9.1, 1/9.2, 1/9.3, 1/9.4, 1/9.5, 1/9.6, 1/9.7, 1/9.8, 1/9.9, 1/10, 1/10.1, 1/10.2, 1/10.3, 1/10.4, 1/10.5, 1/10.6, 1/10.7, 1/10.8, 1/10.9, 1/11, 1/11.1, 1/11.2, 1/11.3, 1/11.4, 1/11.5, 1/11.6, 1/11.7, 1/11.8, 1/11.9, 1/12, 1/12.1, 1/12.2, 1/12.3, 1/12.4, 1/12.5, 1/12.6, 1/12.7, 1/12.8, 1/12.9 or 1/13.
Further preferred mosaicisms are:
1/5, 1/5.1, 1/5.2, 1/5.3, 1/5.4, 1/5.5, 1/5.6, 1/5.7, 1/5.8, 1/5.9, 1/6, 1/6.1, 1/6.2, 1/6.3, 1/6.4, 1/6.5, 1/6.6, 1/6.7, 1/6.8, 1/6.9, 1/7, 1/7.1, 1/7.2, 1/7.3, 1/7.4, 1/7.5, 1/7.6, 1/7.7, 1/7.8, 1/7.9, 1/8, 1/8.1, 1/8.2, 1/8.3, 1/8.4, 1/8.5, 1/8.6, 1/8.7, 1/8.8, 1/8.9, 1/9, 1/9.1, 1/9.2, 1/9.3, 1/9.4, 1/9.5, 1/9.6, 1/9.7, 1/9.8, 1/9.9, 1/10, 1/10.1, 1/10.2, 1/10.3, 1/10.4, 1/10.5, 1/10.6, 1/10.7, 1/10.8, 1/10.9, 1/11, 1/11.1, 1/11.2, 1/11.3, 1/11.4, 1/11.5, 1/11.6, 1/11.7, 1/11.8, 1/11.9, or 1/12.
Still more preferred mosaicisms are:
1/7, 1/7.1, 1/7.2, 1/7.3, 1/7.4, 1/7.5, 1/7.6, 1/7.7, 1/7.8, 1/7.9, 1/8, 1/8.1, 1/8.2, 1/8.3, 1/8.4, 1/8.5, 1/8.6, 1/8.7, 1/8.8, 1/8.9, 1/9, 1/9.1, 1/9.2, 1/9.3, 1/9.4, 1/9.5, 1/9.6, 1/9.7, 1/9.8, 1/9.9, 1/10, 1/10.1, 1/10.2, 1/10.3, 1/10.4, 1/10.5, 1/10.6, 1/10.7, 1/10.8, 1/10.9, or 1/11.
Preferred ranges of mosaicisms are 1/4 to 1/13; 1/5 to 1/12; 1/6 to 1/11, 1/7 to 1/10.5. or 1/7.5 to 1/10.
(6) Preferred molar ratios of AAV-FM to SCM-RM are as follows: 1:20, 1:25, 1:30, 1:35, 1:40, 1:45, 1:50, 1:55, 1:60, 1:65, 1:70, 1:75, 1:80, 1:85, 1:90, 1:95, 1:100, 1:105, 1:110, 1:115, 1:120, 1:125, 1:130, 1:135, 1:140, 1:145, 1:150, 1:155, 1:160, 1:165, 1:170, 1:175, 1:180, 1:185, 1:190, 1:195, 1:200, 1:205, 1:210, 1:215, 1:220, 1:225, 1:230, 1:235, 1:240, 1:245, 1:250, 1:255, 1:260, 1:265, 1:270, 1:275, 1:280, 1:285, 1:290, 1:295, 1:300, 1:305, 1:310, 1:315, 1:320, 1:325, 1:330, 1:335, 1:340, 1:345, 1:350, 1:355, 1:360, 1:365, 1:370, 1:375, 1:380, 1:385, 1:390, 1:395, 1:400, 1:405, 1:410, 1:415, 1:420, 1:425, 1:430, 1:435, 1:440, 1:445, 1:450, 1:455, 1:460, 1:465, 1:470, 1:475, 1:480, 1:485, 1:490, 1:495, 1:500, 1:505, 1:510, 1:515, 1:520, 1:525, 1:530, 1:535, 1:540, 1:545, 1:550, 1:555, 1:560, 1:565, 1:570, 1:575, 1:580, 1:585, 1:590, 1:595, 1:600, 1:605, 1:610, 1:615, 1:620, 1:625, 1:630, 1:635, 1:640, 1:645, 1:650, 1:655, 1:660, 1:665, 1:670, 1:675, 1:680, 1:685, 1:690, 1:695, 1:700, 1:705, 1:710, 1:715, 1:720, 1:725, 1:730, 1:735, 1:740, 1:745, 1:750, 1:755, 1:760, 1:765, 1:770, 1:775, 1:780, 1:785, 1:790, 1:795, 1:800, 1:805, 1:810, 1:815, 1:820, 1:825, 1:830, 1:835, 1:840, 1:845, 1:850, 1:855, 1:860, 1:865, 1:870, 1:875, 1:880, 1:885, 1:890, 1:895, 1:900, 1:905, 1:910, 1:915, 1:920, 1:925, 1:930, 1:935, 1:940, 1:945, 1:950, 1:955, 1:960, 1:965, 1:970, 1:975, 1:980, 1:985, 1:990, 1:995, 1:1000, 1:>1000 or any ratio thereabout or therebetween.
More preferred ratios AAV-FM to SCM-RM are: 1:30, 1:35, 1:40, 1:45, 1:50, 1:55, 1:60, 1:65, 1:70, 1:75, 1:80, 1:85, 1:90, 1:95, 1:100, 1:105, 1:110, 1:115, 1:120, 1:125, 1:130, 1:135, 1:140, 1:145, 1:150, 1:155, 1:160, 1:165, 1:170, 1:175, 1:180, 1:185, 1:190, 1:195, 1:200, 1:205, 1:210, 1:215, 1:220, 1:225, 1:230, 1:235, 1:240, 1:245, 1:250, 1:255, 1:260, 1:265, 1:270, 1:275, 1:280, 1:285, 1:290, 1:295, 1:300 or any ratio thereabout or therebetween.
Preferred ranges of AAV-FM to SCM-RM are 1:20 to 1:1000, and more preferred ranges are: 1:30 to 1:100, 1:40 to 1:100, 1:50 to 1:100 1:60 to 1:100, 1:70 to 1:100, 1:80 to 1:100, 1:90:1:100, 1:30 to 1:150, 1:40 to 1:150, 1:50 to 1:150 1:60 to 1:150, 1:70 to 1:150, 1:80 to 1:150, 1:90 to :150, 1:100 to 1:150, 1:30 to 1:200, 1:40 to 1:200, 1:50 to 1:200 1:60 to 1:200, 1:70 to 1:200, 1:80 to 1:200, 1:90:1:200, 1:100 to 1:200, 1:30 to 1:250, 1:40 to 1:250, 1:50 to 1:250 1:60 to 1:250, 1:70 to 1:250, 1:80 to 1:250, 1:90 to :250, 1:100 to 1:250, 1:30 to 1:300, 1:40 to 1:300, 1:50 to 1:300 1:60 to 1:300, 1:70 to 1:300, 1:80 to 1:300, 1:90:1:300, or 1:100 to 1:300.
(7) The inventions provide for a desired conjugation of a level of conjugation of at least 10%, at least 20%, at least 30%, and at least 40%. Preferred levels are at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or up to 100%, any of which can be considered complete depending on the purpose. More preferably, the desired level of conjugation typically will be about 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%.
Ranges of desired conjugation levels can be 10% to 100%, 20% to 99%, 30% to 99%, 40% to 99%, 50% to 99%, 60% to 99%, 70% to 99%, 80% to 99%, or 90% to 99%. Preferred ranges of desired conjugation levels can be 40% to 100%, 40% to 99%, 45% to 95%, 50% to 95%, 55% to 90%, 60% to 90%, 65% to 95%, 65% to 85%, 65% to 90%, 70% to 90%, 75% to 90%, 75% to 85%, 75% to 80%, or 80% to 85%. More preferably, the range is 65% to 95%.
The second chart below cites to exemplary modifications to the above chart based upon the descriptions and sequence examples contained herein. Points 1-7 above also apply to the second chart below:
Covalently surface modified AAV9 can be made by transfecting a cell with plasmids as set forth below, followed by culturing the transfected cells and harvesting the resulting AAV, and then conjugating the resulting AAV with a second cognate member (SCM) that is fused to a retargeting molecule The first chart below uses SpyTag as the first member of a specific binding pair, and Adenovirus Helper Genes. Modifications can be undertaken as disclosed below:
(1) Plasmid pGOI can comprise one or more genes that are desired to be expressed in covalently surface modified AAV9.
(2) Plasmids pRC-FM can be modified for other specific binding pairs. The first member (FM) should be complementary to a second cognate member (SCM) that is fused to a retargeting molecule (for example, an antibody, as well derivatives and fragments thereof, and still other molecules). See Definitions and Description sections of the Detailed Description, the Figures and associated text for “retargeting” and “retargeting molecules”. The populations of FMs and SCMs can be homogenous or heterogeneous as long as the selected FMs can come in contact with appropriate SCMs so that binding can occur.
(3) Detargeting mutations are optional and can be undertaken as disclosed herein and in publications. See Definitions and Description sections of the Detailed Description, the Figures and associated text for “detargeting” and “detargeting mutations”.
(4) To lessen the possibility of encountering neutralizing antibodies when the covalently surface modified AAV is administered to a subject, KTag can be used as an SCM to bind with SpyTag (FM) (SEQ ID NOS: 54 and 86). KTag and SpyLigase are based upon SpyCatcher. KTag (SEQ ID NO: 85) has only 10 amino acids, which renders it less immunogenic. KTag can be bound to SpyTag in the presence of SpyLigase (SEQ ID NO: 61). The SpyLigase can be removed by subsequent purification, such as by chromatography and/or filtration so that the SpyLigase will not have an appreciable presence in the final drug substance.
(5) Preferred mosaicisms are as follows: 1/1, 1/1.1, 1/1.2, 1/1.3, 1/1.4, 1/1.5, 1/1.6, 1/1.7, 1/1.8, 1/1.9, 1/2, 1/2.1, 1/2.2, 1/2.3, 1/2.4, 1/2.5, 1/2.6, 1/2.7, 1/2.8, 1/2.9, 1/3, 1/3.1, 1/3.2, 1/3.3, 1/3.4, 1/3.5, 1/3.6, 1/3.7, 1/3.8, 1/3.9, 1/4, 1/4.1, 1/4.2, 1/4.3, 1/4.4, 1/4.5, 1/4.6, 1/4.7, 1/4.8, 1/4.9, 1/5, 1/5.1, 1/5.2, 1/5.3, 1/5.4, 1/5.5, 1/5.6, 1/5.7, 1/5.8, 1/5.9, 1/6, 1/6.1, 1/6.2, 1/6.3, 1/6.4, 1/6.5, 1/6.6, 1/6.7, 1/6.8, 1/6.9, 1/7, 1/7.1, 1/7.2, 1/7.3, 1/7.4, 1/7.5, 1/7.6, 1/7.7, 1/7.8, 1/7.9, 1/8, 1/8.1, 1/8.2, 1/8.3, 1/8.4, 1/8.5, 1/8.6, 1/8.7, 1/8.8, 1/8.9, 1/9, 1/9.1, 1/9.2, 1/9.3, 1/9.4, 1/9.5, 1/9.6, 1/9.7, 1/9.8, 1/9.9, 1/10, 1/10.1, 1/10.2, 1/10.3, 1/10.4, 1/10.5, 1/10.6, 1/10.7, 1/10.8, 1/10.9, 1/11, 1/11.1, 1/11.2, 1/11.3, 1/11.4, 1/11.5, 1/11.6, 1/11.7, 1/11.8, 1/11.9, 1/12, 1/12.1, 1/12.2, 1/12.3, 1/12.4, 1/12.5, 1/12.6, 1/12.7, 1/12.8, 1/12.9, 1/13, 1/13.1, 1/13.2, 1/13.3, 1/13.4, 1/13.5, 1/13.6, 1/13.7, 1/13.8, 1/13.9, 1/14, 1/14.1, 1/14.2, 1/14.3, 1/14.4, 1/14.5, 1/14.6, 1/14.7, 1/14.8, 1/14.9, 1/15, 1/15.1, 1/15.2, 1/15.3, 1/15.4, 1/15.5, 1/15.6, 1/15.7, 1/15.8, 1/15.9, 1/16, 1/16.1, 1/16.2, 1/16.3, 1/16.4, 1/16.5, 1/16.6, 1/16.7, 1/16.8, 1/16.9, 1/17, 1/17.1, 1/17.2, 1/17.3, 1/17.4, 1/17.5, 1/17.6, 1/17.7, 1/17.8, 1/17.9, 1/18, 1/18.1, 1/18.2, 1/18.3, 1/18.4, 1/18.5, 1/18.6, 1/18.7, 1/18.8, 1/18.9, 1/19, 11/9.1, 1/19.2, 1/19.3, 1/19.4, 1/91.5, 1/19.6, 1/19.7, 1/19.8, 1/19.9, 1/20, 1/21, 1/21.1, 1/21.2, 1/21.3, 1/21.4, 1/21.5, 1/21.6, 1/21.7, 1/21.8, 1/21.9, 1/22, 1/22.1, 1/22.2, 1/22.3, 1/22.4, 1/22.5, 1/22.6, 1/22.7, 1/22.8, 1/22.9, 1/23, 1/23.1, 1/23.2, 1/23.3, 1/23.4, 1/23.5, 1/23.6, 1/23.7, 1/23.8, 1/23.9, 1/24, 1/24.1, 1/24.2, 1/24.3, 1/24.4, 1/24.5, 1/24.6, 1/24.7, 1/24.8, 1/24.9, 1/25, 1/25.1, 1/25.2, 1/25.3, 1/25.4, 1/25.5, 1/25.6, 1/25.7, 1/25.8, 1/25.9, 1/26, 1/26.1, 1/26.2, 1/26.3, 1/26.4, 1/26.5, 1/26.6, 1/26.7, 1/26.8, 12/6.9, 1/27, 1/27.1, 1/27.2, 1/27.3, 1/27.4, 1/27.5, 1/27.6, 1/27.7, 1/27.8, 1/27.9, 1/28, 1/28.1, 1/28.2, 1/28.3, 1/28.4, 1/28.5, 1/28.6, 1/28.7, 1/28.8, 1/28.9, 1/29, 1/29.1, 1/29.2, 1/29.3, 1/29.4, 1/29.5, 1/29.6, 1/29.7, 1/29.8, 1/29.9, 1/30, 1/30.1, 1/30.2, 1/30.3, 1/30.4, 1/30.5, 1/30.6, 1/30.7, 1/30.8, 1/30.9, 1/31, 1/31.1, 1/31.2, 1/31.3, 1/31.4, 1/31.5, 1/31.6, 1/31.7, 1/31.8, 1/31.9, 1/32, 1/32.1, 1/32.2, 1/32.3, 1/32.4, 1/32.5, 1/32.6, 1/32.7, 1/32.8, 1/32.9, 1/33, 1/33.1, 1/33.2, 1/33.3, 1/33.4, 1/33.5, 1/33.6, 1/33.7, 1/33.8, 1/33.9, 1/34, 1/34.1, 1/34.2, 1/34.3, 1/34.4, 1/34.5, 1/34.6, 1/34.7, 1/34.8, 1/34.9, 1/35, 1/35.1, 1/35.2, 1/35.3, 1/35.4, 1/35.5, 1/35.6, 1/35.7, 1/35.8, 1/35.9, 1/36, 1/36.1, 1/36.2, 1/36.3, 1/36.4, 1/36.5, 1/36.6, 1/36.7, 1/36.8, 1/36.9, 1/37, 1/37.1, 1/37.2, 1/37.3, 1/37.4, 1/37.5, 1/37.6, 1/37.7, 1/37.8, 1/37.9, 1/38, 1/38.1, 1/38.2, 1/38.3, 1/38.4, 1/38.5, 1/38.6, 1/38.7, 1/38.8, 1/38.9, 1/39, 1/39.1, 1/39.2, 1/39.3, 1/39.4, 1/39.5, 1/39.6, 1/39.7, 1/39.8, 1/39.9, 1/40, 1/40.1, 1/40.2, 1/40.3, 1/40.4, 1/40.5, 1/40.6, 1/40.7, 1/40.8, 1/40.9, 1/41, 1/41.1, 1/41.2, 1/41.3, 1/41.4, 1/41.5, 1/41.6, 1/41.7, 1/41.8, 1/41.9, 1/42, 1/42.1, 1/42.2, 1/42.3, 1/42.4, 1/42.5, 1/42.6, 1/42.7, 1/42.8, 1/42.9, 1/43, 1/43.1, 1/43.2, 1/43.3, 1/43.4, 1/43.5, 1/43.6, 1/43.7, 1/43.8, 1/43.9, 1/44, 1/44.1, 1/44.2, 1/44.3, 1/44.4, 1/44.5, 1/44.6, 1/44.7, 1/44.8, 1/44.9, 1/45, 1/45.1, 1/45.2, 1/45.3, 1/45.4, 1/45.5, 1/45.6, 1/45.7, 1/45.8, 1/45.9, 1/46, 1/46.1, 1/46.2, 1/46.3, 1/46.4, 1/46.5, 1/46.6, 1/46.7, 1/46.8, 1/46.9, 1/47, 1/47.1, 1/47.2, 1/47.3, 1/47.4, 1/47.5, 1/47.6, 1/47.7, 1/47.8, 1/47.9, 1/48, 1/48.1, 1/48.2, 1/48.3, 1/48.4, 1/48.5, 1/48.6, 1/48.7, 1/48.8, 1/48.9, 1/49, 1/49.1, 1/49.2, 1/49.3, 1/49.4, 1/49.5, 1/49.6, 1/49.7, 1/49.8, 1/49.9, 1/50, 1/50.1, 1/50.2, 1/50.3, 1/50.4, 1/50.5, 1/50.6, 1/50.7, 1/50.8, 1/50.9, 1/51, 1/51.1, 1/51.2, 1/51.3, 1/51.4, 1/51.5, 1/51.6, 1/51.7, 1/51.8, 1/51.9, 1/52, 1/52.1, 1/52.2, 1/52.3, 1/52.4, 1/52.5, 1/52.6, 1/52.7, 1/52.8, 1/52.9, 1/53, 1/53.1, 1/53.2, 1/53.3, 1/53.4, 1/53.5, 1/53.6, 1/53.7, 1/53.8, 1/53.9, 1/54, 1/54.1, 1/54.2, 1/54.3, 1/54.4, 1/54.5, 1/54.6, 1/54.7, 1/54.8, 1/54.9, 1/55, 1/55.1, 1/55.2, 1/55.3, 1/55.4, 1/55.5, 1/55.6, 1/55.7, 1/55.8, 1/55.9, 1/56, 1/56.1, 1/56.2, 1/56.3, 1/56.4, 1/56.5, 1/56.6, 1/56.7, 1/56.8, 1/56.9, 1/57, 1/57.1, 1/57.2, 1/57.3, 1/57.4, 1/57.5, 1/57.6, 1/57.7, 1/57.8, 1/57.9, 1/58, 1/58.1, 1/58.2, 1/58.3, 1/58.4, 1/58.5, 1/58.6, 1/58.7, 1/58.8, 1/58.9, 1/59, 1/59.1, 1/59.2, 1/59.3, 1/59.4, 1/59.5, 1/59.6, 1/59.7, 1/59.8, 1/59.9, 1/60 or ratios thereabout or therebetween. Ranges of ratios of 1/1 to 1/60 can be employed, and subranges as set forth below.
More preferred mosaicisms are:
1/4, 1/4.1, 1/4.2, 1/4.3, 1/4.4, 1/4.5, 1/4.6, 1/4.7, 1/4.8, 1/4.9, 1/5, 1/5.1, 1/5.2, 1/5.3, 1/5.4, 1/5.5, 1/5.6, 1/5.7, 1/5.8, 1/5.9, 1/6, 1/6.1, 1/6.2, 1/6.3, 1/6.4, 1/6.5, 1/6.6, 1/6.7, 1/6.8, 1/6.9, 1/7, 1/7.1, 1/7.2, 1/7.3, 1/7.4, 1/7.5, 1/7.6, 1/7.7, 1/7.8, 1/7.9, 1/8, 1/8.1, 1/8.2, 1/8.3, 1/8.4, 1/8.5, 1/8.6, 1/8.7, 1/8.8, 1/8.9, 1/9, 1/9.1, 1/9.2, 1/9.3, 1/9.4, 1/9.5, 1/9.6, 1/9.7, 1/9.8, 1/9.9, 1/10, 1/10.1, 1/10.2, 1/10.3, 1/10.4, 1/10.5, 1/10.6, 1/10.7, 1/10.8, 1/10.9, 1/11, 1/11.1, 1/11.2, 1/11.3, 1/11.4, 1/11.5, 1/11.6, 1/11.7, 1/11.8, 1/11.9, 1/12, 1/12.1, 1/12.2, 1/12.3, 1/12.4, 1/12.5, 1/12.6, 1/12.7, 1/12.8, 1/12.9 or 1/13.
Further preferred mosaicisms are:
1/5, 1/5.1, 1/5.2, 1/5.3, 1/5.4, 1/5.5, 1/5.6, 1/5.7, 1/5.8, 1/5.9, 1/6, 1/6.1, 1/6.2, 1/6.3, 1/6.4, 1/6.5, 1/6.6, 1/6.7, 1/6.8, 1/6.9, 1/7, 1/7.1, 1/7.2, 1/7.3, 1/7.4, 1/7.5, 1/7.6, 1/7.7, 1/7.8, 1/7.9, 1/8, 1/8.1, 1/8.2, 1/8.3, 1/8.4, 1/8.5, 1/8.6, 1/8.7, 1/8.8, 1/8.9, 1/9, 1/9.1, 1/9.2, 1/9.3, 1/9.4, 1/9.5, 1/9.6, 1/9.7, 1/9.8, 1/9.9, 1/10, 1/10.1, 1/10.2, 1/10.3, 1/10.4, 1/10.5, 1/10.6, 1/10.7, 1/10.8, 1/10.9, 1/11, 1/11.1, 1/11.2, 1/11.3, 1/11.4, 1/11.5, 1/11.6, 1/11.7, 1/11.8, 1/11.9, or 1/12.
Still more preferred mosaicisms are:
1/7, 1/7.1, 1/7.2, 1/7.3, 1/7.4, 1/7.5, 1/7.6, 1/7.7, 1/7.8, 1/7.9, 1/8, 1/8.1, 1/8.2, 1/8.3, 1/8.4, 1/8.5, 1/8.6, 1/8.7, 1/8.8, 1/8.9, 1/9, 1/9.1, 1/9.2, 1/9.3, 1/9.4, 1/9.5, 1/9.6, 1/9.7, 1/9.8, 1/9.9, 1/10, 1/10.1, 1/10.2, 1/10.3, 1/10.4, 1/10.5, 1/10.6, 1/10.7, 1/10.8, 1/10.9, or 1/11.
Preferred ranges of mosaicisms are 1/4 to 1/13; 1/5 to 1/12; 1/6 to 1/11, 1/7 to 1/10.5. or 1/7.5 to 1/10.
(6) Preferred molar ratios of AAV-FM to SCM-RM are as follows: 1:20, 1:25, 1:30, 1:35, 1:40, 1:45, 1:50, 1:55, 1:60, 1:65, 1:70, 1:75, 1:80, 1:85, 1:90, 1:95, 1:100, 1:105, 1:110, 1:115, 1:120, 1:125, 1:130, 1:135, 1:140, 1:145, 1:150, 1:155, 1:160, 1:165, 1:170, 1:175, 1:180, 1:185, 1:190, 1:195, 1:200, 1:205, 1:210, 1:215, 1:220, 1:225, 1:230, 1:235, 1:240, 1:245, 1:250, 1:255, 1:260, 1:265, 1:270, 1:275, 1:280, 1:285, 1:290, 1:295, 1:300, 1:305, 1:310, 1:315, 1:320, 1:325, 1:330, 1:335, 1:340, 1:345, 1:350, 1:355, 1:360, 1:365, 1:370, 1:375, 1:380, 1:385, 1:390, 1:395, 1:400, 1:405, 1:410, 1:415, 1:420, 1:425, 1:430, 1:435, 1:440, 1:445, 1:450, 1:455, 1:460, 1:465, 1:470, 1:475, 1:480, 1:485, 1:490, 1:495, 1:500, 1:505, 1:510, 1:515, 1:520, 1:525, 1:530, 1:535, 1:540, 1:545, 1:550, 1:555, 1:560, 1:565, 1:570, 1:575, 1:580, 1:585, 1:590, 1:595, 1:600, 1:605, 1:610, 1:615, 1:620, 1:625, 1:630, 1:635, 1:640, 1:645, 1:650, 1:655, 1:660, 1:665, 1:670, 1:675, 1:680, 1:685, 1:690, 1:695, 1:700, 1:705, 1:710, 1:715, 1:720, 1:725, 1:730, 1:735, 1:740, 1:745, 1:750, 1:755, 1:760, 1:765, 1:770, 1:775, 1:780, 1:785, 1:790, 1:795, 1:800, 1:805, 1:810, 1:815, 1:820, 1:825, 1:830, 1:835, 1:840, 1:845, 1:850, 1:855, 1:860, 1:865, 1:870, 1:875, 1:880, 1:885, 1:890, 1:895, 1:900, 1:905, 1:910, 1:915, 1:920, 1:925, 1:930, 1:935, 1:940, 1:945, 1:950, 1:955, 1:960, 1:965, 1:970, 1:975, 1:980, 1:985, 1:990, 1:995, 1:1000, 1:>1000 or any ratio thereabout or therebetween.
More preferred ratios AAV-FM to SCM-RM are: 1:30, 1:35, 1:40, 1:45, 1:50, 1:55, 1:60, 1:65, 1:70, 1:75, 1:80, 1:85, 1:90, 1:95, 1:100, 1:105, 1:110, 1:115, 1:120, 1:125, 1:130, 1:135, 1:140, 1:145, 1:150, 1:155, 1:160, 1:165, 1:170, 1:175, 1:180, 1:185, 1:190, 1:195, 1:200, 1:205, 1:210, 1:215, 1:220, 1:225, 1:230, 1:235, 1:240, 1:245, 1:250, 1:255, 1:260, 1:265, 1:270, 1:275, 1:280, 1:285, 1:290, 1:295, 1:300 or any ratio thereabout or therebetween.
Preferred ranges of AAV-FM to SCM-RM are 1:20 to 1:1000, and more preferred ranges are: 1:30 to 1:100, 1:40 to 1:100, 1:50 to 1:100 1:60 to 1:100, 1:70 to 1:100, 1:80 to 1:100, 1:90:1:100, 1:30 to 1:150, 1:40 to 1:150, 1:50 to 1:150 1:60 to 1:150, 1:70 to 1:150, 1:80 to 1:150, 1:90 to :150, 1:100 to 1:150, 1:30 to 1:200, 1:40 to 1:200, 1:50 to 1:200 1:60 to 1:200, 1:70 to 1:200, 1:80 to 1:200, 1:90:1:200, 1:100 to 1:200, 1:30 to 1:250, 1:40 to 1:250, 1:50 to 1:250 1:60 to 1:250, 1:70 to 1:250, 1:80 to 1:250, 1:90 to :250, 1:100 to 1:250, 1:30 to 1:300, 1:40 to 1:300, 1:50 to 1:300 1:60 to 1:300, 1:70 to 1:300, 1:80 to 1:300, 1:90:1:300, or 1:100 to 1:300.
(7) The inventions provide for a desired conjugation of a level of conjugation of at least 10%, at least 20%, at least 30%, and at least 40%. Preferred levels are at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or up to 100%, any of which can be considered complete depending on the purpose. More preferably, the desired level of conjugation typically will be about 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%.
Ranges of desired conjugation levels can be 10% to 100%, 20% to 99%, 30% to 99%, 40% to 99%, 50% to 99%, 60% to 99%, 70% to 99%, 80% to 99%, or 90% to 99%. Preferred ranges of desired conjugation levels can be 40% to 100%, 40% to 99%, 45% to 95%, 50% to 95%, 55% to 90%, 60% to 90%, 65% to 95%, 65% to 85%, 65% to 90%, 70% to 90%, 75% to 90%, 75% to 85%, 75% to 80%, or 80% to 85%. More preferably, the range is 65% to 95%.
The second chart below cites to exemplary modifications to the above chart based upon the descriptions and sequence examples contained herein. Points 1-7 above also apply to the second chart below:
Covalently surface modified AAV10 can be made by transfecting a cell with plasmids as set forth below, followed by culturing the transfected cells and harvesting the resulting AAV, and then conjugating the resulting AAV with a second cognate member (SCM) that is fused to a retargeting molecule The first chart below uses SpyTag as the first member of a specific binding pair, and Adenovirus Helper Genes. Modifications can be undertaken as disclosed below:
(1) Plasmid pGOI can comprise one or more genes that are desired to be expressed in covalently surface modified AAV10.
(2) Plasmids pRC-FM can be modified for other specific binding pairs. The first member (FM) should be complementary to a second cognate member (SCM) that is fused to a retargeting molecule (for example, an antibody, as well derivatives and fragments thereof, and still other molecules). See Definitions and Description sections of the Detailed Description, the Figures and associated text for “retargeting” and “retargeting molecules”. The populations of FMs and SCMs can be homogenous or heterogeneous as long as the selected FMs can come in contact with appropriate SCMs so that binding can occur.
(3) Detargeting mutations are optional and can be undertaken as disclosed herein and in publications. See Definitions and Description sections of the Detailed Description, the Figures and associated text for “detargeting” and “detargeting mutations”.
(4) To lessen the possibility of encountering neutralizing antibodies when the covalently surface modified AAV is administered to a subject, KTag can be used as an SCM to bind with SpyTag (FM) (SEQ ID NOS: 54 and 86). KTag and SpyLigase are based upon SpyCatcher. KTag (SEQ ID NO: 85) has only 10 amino acids, which renders it less immunogenic. KTag can be bound to SpyTag in the presence of SpyLigase (SEQ ID NO: 61). The SpyLigase can be removed by subsequent purification, such as by chromatography and/or filtration so that the SpyLigase will not have an appreciable presence in the final drug substance.
(5) Preferred mosaicisms are as follows: 1/1, 1/1.1, 1/1.2, 1/1.3, 1/1.4, 1/1.5, 1/1.6, 1/1.7, 1/1.8, 1/1.9, 1/2, 1/2.1, 1/2.2, 1/2.3, 1/2.4, 1/2.5, 1/2.6, 1/2.7, 1/2.8, 1/2.9, 1/3, 1/3.1, 1/3.2, 1/3.3, 1/3.4, 1/3.5, 1/3.6, 1/3.7, 1/3.8, 1/3.9, 1/4, 1/4.1, 1/4.2, 1/4.3, 1/4.4, 1/4.5, 1/4.6, 1/4.7, 1/4.8, 1/4.9, 1/5, 1/5.1, 1/5.2, 1/5.3, 1/5.4, 1/5.5, 1/5.6, 1/5.7, 1/5.8, 1/5.9, 1/6, 1/6.1, 1/6.2, 1/6.3, 1/6.4, 1/6.5, 1/6.6, 1/6.7, 1/6.8, 1/6.9, 1/7, 1/7.1, 1/7.2, 1/7.3, 1/7.4, 1/7.5, 1/7.6, 1/7.7, 1/7.8, 1/7.9, 1/8, 1/8.1, 1/8.2, 1/8.3, 1/8.4, 1/8.5, 1/8.6, 1/8.7, 1/8.8, 1/8.9, 1/9, 1/9.1, 1/9.2, 1/9.3, 1/9.4, 1/9.5, 1/9.6, 1/9.7, 1/9.8, 1/9.9, 1/10, 1/10.1, 1/10.2, 1/10.3, 1/10.4, 1/10.5, 1/10.6, 1/10.7, 1/10.8, 1/10.9, 1/11, 1/11.1, 1/11.2, 1/11.3, 1/11.4, 1/11.5, 1/11.6, 1/11.7, 1/11.8, 1/11.9, 1/12, 1/12.1, 1/12.2, 1/12.3, 1/12.4, 1/12.5, 1/12.6, 1/12.7, 1/12.8, 1/12.9, 1/13, 1/13.1, 1/13.2, 1/13.3, 1/13.4, 1/13.5, 1/13.6, 1/13.7, 1/13.8, 1/13.9, 1/14, 1/14.1, 1/14.2, 1/14.3, 1/14.4, 1/14.5, 1/14.6, 1/14.7, 1/14.8, 1/14.9, 1/15, 1/15.1, 1/15.2, 1/15.3, 1/15.4, 1/15.5, 1/15.6, 1/15.7, 1/15.8, 1/15.9, 1/16, 1/16.1, 1/16.2, 1/16.3, 1/16.4, 1/16.5, 1/16.6, 1/16.7, 1/16.8, 1/16.9, 1/17, 1/17.1, 1/17.2, 1/17.3, 1/17.4, 1/17.5, 1/17.6, 1/17.7, 1/17.8, 1/17.9, 1/18, 1/18.1, 1/18.2, 1/18.3, 1/18.4, 1/18.5, 1/18.6, 1/18.7, 1/18.8, 1/18.9, 1/19, 11/9.1, 1/19.2, 1/19.3, 1/19.4, 1/91.5, 1/19.6, 1/19.7, 1/19.8, 1/19.9, 1/20, 1/21, 1/21.1, 1/21.2, 1/21.3, 1/21.4, 1/21.5, 1/21.6, 1/21.7, 1/21.8, 1/21.9, 1/22, 1/22.1, 1/22.2, 1/22.3, 1/22.4, 1/22.5, 1/22.6, 1/22.7, 1/22.8, 1/22.9, 1/23, 1/23.1, 1/23.2, 1/23.3, 1/23.4, 1/23.5, 1/23.6, 1/23.7, 1/23.8, 1/23.9, 1/24, 1/24.1, 1/24.2, 1/24.3, 1/24.4, 1/24.5, 1/24.6, 1/24.7, 1/24.8, 1/24.9, 1/25, 1/25.1, 1/25.2, 1/25.3, 1/25.4, 1/25.5, 1/25.6, 1/25.7, 1/25.8, 1/25.9, 1/26, 1/26.1, 1/26.2, 1/26.3, 1/26.4, 1/26.5, 1/26.6, 1/26.7, 1/26.8, 12/6.9, 1/27, 1/27.1, 1/27.2, 1/27.3, 1/27.4, 1/27.5, 1/27.6, 1/27.7, 1/27.8, 1/27.9, 1/28, 1/28.1, 1/28.2, 1/28.3, 1/28.4, 1/28.5, 1/28.6, 1/28.7, 1/28.8, 1/28.9, 1/29, 1/29.1, 1/29.2, 1/29.3, 1/29.4, 1/29.5, 1/29.6, 1/29.7, 1/29.8, 1/29.9, 1/30, 1/30.1, 1/30.2, 1/30.3, 1/30.4, 1/30.5, 1/30.6, 1/30.7, 1/30.8, 1/30.9, 1/31, 1/31.1, 1/31.2, 1/31.3, 1/31.4, 1/31.5, 1/31.6, 1/31.7, 1/31.8, 1/31.9, 1/32, 1/32.1, 1/32.2, 1/32.3, 1/32.4, 1/32.5, 1/32.6, 1/32.7, 1/32.8, 1/32.9, 1/33, 1/33.1, 1/33.2, 1/33.3, 1/33.4, 1/33.5, 1/33.6, 1/33.7, 1/33.8, 1/33.9, 1/34, 1/34.1, 1/34.2, 1/34.3, 1/34.4, 1/34.5, 1/34.6, 1/34.7, 1/34.8, 1/34.9, 1/35, 1/35.1, 1/35.2, 1/35.3, 1/35.4, 1/35.5, 1/35.6, 1/35.7, 1/35.8, 1/35.9, 1/36, 1/36.1, 1/36.2, 1/36.3, 1/36.4, 1/36.5, 1/36.6, 1/36.7, 1/36.8, 1/36.9, 1/37, 1/37.1, 1/37.2, 1/37.3, 1/37.4, 1/37.5, 1/37.6, 1/37.7, 1/37.8, 1/37.9, 1/38, 1/38.1, 1/38.2, 1/38.3, 1/38.4, 1/38.5, 1/38.6, 1/38.7, 1/38.8, 1/38.9, 1/39, 1/39.1, 1/39.2, 1/39.3, 1/39.4, 1/39.5, 1/39.6, 1/39.7, 1/39.8, 1/39.9, 1/40, 1/40.1, 1/40.2, 1/40.3, 1/40.4, 1/40.5, 1/40.6, 1/40.7, 1/40.8, 1/40.9, 1/41, 1/41.1, 1/41.2, 1/41.3, 1/41.4, 1/41.5, 1/41.6, 1/41.7, 1/41.8, 1/41.9, 1/42, 1/42.1, 1/42.2, 1/42.3, 1/42.4, 1/42.5, 1/42.6, 1/42.7, 1/42.8, 1/42.9, 1/43, 1/43.1, 1/43.2, 1/43.3, 1/43.4, 1/43.5, 1/43.6, 1/43.7, 1/43.8, 1/43.9, 1/44, 1/44.1, 1/44.2, 1/44.3, 1/44.4, 1/44.5, 1/44.6, 1/44.7, 1/44.8, 1/44.9, 1/45, 1/45.1, 1/45.2, 1/45.3, 1/45.4, 1/45.5, 1/45.6, 1/45.7, 1/45.8, 1/45.9, 1/46, 1/46.1, 1/46.2, 1/46.3, 1/46.4, 1/46.5, 1/46.6, 1/46.7, 1/46.8, 1/46.9, 1/47, 1/47.1, 1/47.2, 1/47.3, 1/47.4, 1/47.5, 1/47.6, 1/47.7, 1/47.8, 1/47.9, 1/48, 1/48.1, 1/48.2, 1/48.3, 1/48.4, 1/48.5, 1/48.6, 1/48.7, 1/48.8, 1/48.9, 1/49, 1/49.1, 1/49.2, 1/49.3, 1/49.4, 1/49.5, 1/49.6, 1/49.7, 1/49.8, 1/49.9, 1/50, 1/50.1, 1/50.2, 1/50.3, 1/50.4, 1/50.5, 1/50.6, 1/50.7, 1/50.8, 1/50.9, 1/51, 1/51.1, 1/51.2, 1/51.3, 1/51.4, 1/51.5, 1/51.6, 1/51.7, 1/51.8, 1/51.9, 1/52, 1/52.1, 1/52.2, 1/52.3, 1/52.4, 1/52.5, 1/52.6, 1/52.7, 1/52.8, 1/52.9, 1/53, 1/53.1, 1/53.2, 1/53.3, 1/53.4, 1/53.5, 1/53.6, 1/53.7, 1/53.8, 1/53.9, 1/54, 1/54.1, 1/54.2, 1/54.3, 1/54.4, 1/54.5, 1/54.6, 1/54.7, 1/54.8, 1/54.9, 1/55, 1/55.1, 1/55.2, 1/55.3, 1/55.4, 1/55.5, 1/55.6, 1/55.7, 1/55.8, 1/55.9, 1/56, 1/56.1, 1/56.2, 1/56.3, 1/56.4, 1/56.5, 1/56.6, 1/56.7, 1/56.8, 1/56.9, 1/57, 1/57.1, 1/57.2, 1/57.3, 1/57.4, 1/57.5, 1/57.6, 1/57.7, 1/57.8, 1/57.9, 1/58, 1/58.1, 1/58.2, 1/58.3, 1/58.4, 1/58.5, 1/58.6, 1/58.7, 1/58.8, 1/58.9, 1/59, 1/59.1, 1/59.2, 1/59.3, 1/59.4, 1/59.5, 1/59.6, 1/59.7, 1/59.8, 1/59.9, 1/60 or ratios thereabout or therebetween. Ranges of ratios of 1/1 to 1/60 can be employed, and subranges as set forth below.
More preferred mosaicisms are:
1/4, 1/4.1, 1/4.2, 1/4.3, 1/4.4, 1/4.5, 1/4.6, 1/4.7, 1/4.8, 1/4.9, 1/5, 1/5.1, 1/5.2, 1/5.3, 1/5.4, 1/5.5, 1/5.6, 1/5.7, 1/5.8, 1/5.9, 1/6, 1/6.1, 1/6.2, 1/6.3, 1/6.4, 1/6.5, 1/6.6, 1/6.7, 1/6.8, 1/6.9, 1/7, 1/7.1, 1/7.2, 1/7.3, 1/7.4, 1/7.5, 1/7.6, 1/7.7, 1/7.8, 1/7.9, 1/8, 1/8.1, 1/8.2, 1/8.3, 1/8.4, 1/8.5, 1/8.6, 1/8.7, 1/8.8, 1/8.9, 1/9, 1/9.1, 1/9.2, 1/9.3, 1/9.4, 1/9.5, 1/9.6, 1/9.7, 1/9.8, 1/9.9, 1/10, 1/10.1, 1/10.2, 1/10.3, 1/10.4, 1/10.5, 1/10.6, 1/10.7, 1/10.8, 1/10.9, 1/11, 1/11.1, 1/11.2, 1/11.3, 1/11.4, 1/11.5, 1/11.6, 1/11.7, 1/11.8, 1/11.9, 1/12, 1/12.1, 1/12.2, 1/12.3, 1/12.4, 1/12.5, 1/12.6, 1/12.7, 1/12.8, 1/12.9 or 1/13.
Further preferred mosaicisms are:
1/5, 1/5.1, 1/5.2, 1/5.3, 1/5.4, 1/5.5, 1/5.6, 1/5.7, 1/5.8, 1/5.9, 1/6, 1/6.1, 1/6.2, 1/6.3, 1/6.4, 1/6.5, 1/6.6, 1/6.7, 1/6.8, 1/6.9, 1/7, 1/7.1, 1/7.2, 1/7.3, 1/7.4, 1/7.5, 1/7.6, 1/7.7, 1/7.8, 1/7.9, 1/8, 1/8.1, 1/8.2, 1/8.3, 1/8.4, 1/8.5, 1/8.6, 1/8.7, 1/8.8, 1/8.9, 1/9, 1/9.1, 1/9.2, 1/9.3, 1/9.4, 1/9.5, 1/9.6, 1/9.7, 1/9.8, 1/9.9, 1/10, 1/10.1, 1/10.2, 1/10.3, 1/10.4, 1/10.5, 1/10.6, 1/10.7, 1/10.8, 1/10.9, 1/11, 1/11.1, 1/11.2, 1/11.3, 1/11.4, 1/11.5, 1/11.6, 1/11.7, 1/11.8, 1/11.9, or 1/12.
Still more preferred mosaicisms are:
1/7, 1/7.1, 1/7.2, 1/7.3, 1/7.4, 1/7.5, 1/7.6, 1/7.7, 1/7.8, 1/7.9, 1/8, 1/8.1, 1/8.2, 1/8.3, 1/8.4, 1/8.5, 1/8.6, 1/8.7, 1/8.8, 1/8.9, 1/9, 1/9.1, 1/9.2, 1/9.3, 1/9.4, 1/9.5, 1/9.6, 1/9.7, 1/9.8, 1/9.9, 1/10, 1/10.1, 1/10.2, 1/10.3, 1/10.4, 1/10.5, 1/10.6, 1/10.7, 1/10.8, 1/10.9, or 1/11.
Preferred ranges of mosaicisms are 1/4 to 1/13; 1/5 to 1/12; 1/6 to 1/11, 1/7 to 1/10.5. or 1/7.5 to 1/10.
(6) Preferred molar ratios of AAV-FM to SCM-RM are as follows: 1:20, 1:25, 1:30, 1:35, 1:40, 1:45, 1:50, 1:55, 1:60, 1:65, 1:70, 1:75, 1:80, 1:85, 1:90, 1:95, 1:100, 1:105, 1:110, 1:115, 1:120, 1:125, 1:130, 1:135, 1:140, 1:145, 1:150, 1:155, 1:160, 1:165, 1:170, 1:175, 1:180, 1:185, 1:190, 1:195, 1:200, 1:205, 1:210, 1:215, 1:220, 1:225, 1:230, 1:235, 1:240, 1:245, 1:250, 1:255, 1:260, 1:265, 1:270, 1:275, 1:280, 1:285, 1:290, 1:295, 1:300, 1:305, 1:310, 1:315, 1:320, 1:325, 1:330, 1:335, 1:340, 1:345, 1:350, 1:355, 1:360, 1:365, 1:370, 1:375, 1:380, 1:385, 1:390, 1:395, 1:400, 1:405, 1:410, 1:415, 1:420, 1:425, 1:430, 1:435, 1:440, 1:445, 1:450, 1:455, 1:460, 1:465, 1:470, 1:475, 1:480, 1:485, 1:490, 1:495, 1:500, 1:505, 1:510, 1:515, 1:520, 1:525, 1:530, 1:535, 1:540, 1:545, 1:550, 1:555, 1:560, 1:565, 1:570, 1:575, 1:580, 1:585, 1:590, 1:595, 1:600, 1:605, 1:610, 1:615, 1:620, 1:625, 1:630, 1:635, 1:640, 1:645, 1:650, 1:655, 1:660, 1:665, 1:670, 1:675, 1:680, 1:685, 1:690, 1:695, 1:700, 1:705, 1:710, 1:715, 1:720, 1:725, 1:730, 1:735, 1:740, 1:745, 1:750, 1:755, 1:760, 1:765, 1:770, 1:775, 1:780, 1:785, 1:790, 1:795, 1:800, 1:805, 1:810, 1:815, 1:820, 1:825, 1:830, 1:835, 1:840, 1:845, 1:850, 1:855, 1:860, 1:865, 1:870, 1:875, 1:880, 1:885, 1:890, 1:895, 1:900, 1:905, 1:910, 1:915, 1:920, 1:925, 1:930, 1:935, 1:940, 1:945, 1:950, 1:955, 1:960, 1:965, 1:970, 1:975, 1:980, 1:985, 1:990, 1:995, 1:1000, 1:>1000 or any ratio thereabout or therebetween.
More preferred ratios AAV-FM to SCM-RM are: 1:30, 1:35, 1:40, 1:45, 1:50, 1:55, 1:60, 1:65, 1:70, 1:75, 1:80, 1:85, 1:90, 1:95, 1:100, 1:105, 1:110, 1:115, 1:120, 1:125, 1:130, 1:135, 1:140, 1:145, 1:150, 1:155, 1:160, 1:165, 1:170, 1:175, 1:180, 1:185, 1:190, 1:195, 1:200, 1:205, 1:210, 1:215, 1:220, 1:225, 1:230, 1:235, 1:240, 1:245, 1:250, 1:255, 1:260, 1:265, 1:270, 1:275, 1:280, 1:285, 1:290, 1:295, 1:300 or any ratio thereabout or therebetween.
Preferred ranges of AAV-FM to SCM-RM are 1:20 to 1:1000, and more preferred ranges are: 1:30 to 1:100, 1:40 to 1:100, 1:50 to 1:100 1:60 to 1:100, 1:70 to 1:100, 1:80 to 1:100, 1:90:1:100, 1:30 to 1:150, 1:40 to 1:150, 1:50 to 1:150 1:60 to 1:150, 1:70 to 1:150, 1:80 to 1:150, 1:90 to :150, 1:100 to 1:150, 1:30 to 1:200, 1:40 to 1:200, 1:50 to 1:200 1:60 to 1:200, 1:70 to 1:200, 1:80 to 1:200, 1:90:1:200, 1:100 to 1:200, 1:30 to 1:250, 1:40 to 1:250, 1:50 to 1:250 1:60 to 1:250, 1:70 to 1:250, 1:80 to 1:250, 1:90 to :250, 1:100 to 1:250, 1:30 to 1:300, 1:40 to 1:300, 1:50 to 1:300 1:60 to 1:300, 1:70 to 1:300, 1:80 to 1:300, 1:90:1:300, or 1:100 to 1:300.
(7) The inventions provide for a desired conjugation of a level of conjugation of at least 10%, at least 20%, at least 30%, and at least 40%. Preferred levels are at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or up to 100%, any of which can be considered complete depending on the purpose. More preferably, the desired level of conjugation typically will be about 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%.
Ranges of desired conjugation levels can be 10% to 100%, 20% to 99%, 30% to 99%, 40% to 99%, 50% to 99%, 60% to 99%, 70% to 99%, 80% to 99%, or 90% to 99%. Preferred ranges of desired conjugation levels can be 40% to 100%, 40% to 99%, 45% to 95%, 50% to 95%, 55% to 90%, 60% to 90%, 65% to 95%, 65% to 85%, 65% to 90%, 70% to 90%, 75% to 90%, 75% to 85%, 75% to 80%, or 80% to 85%. More preferably, the range is 65% to 95%.
The second chart below cites to exemplary modifications to the above chart based upon the descriptions and sequence examples contained herein. Points 1-7 above also apply to the second chart below:
Covalently surface modified AAV11 can be made by transfecting a cell with plasmids as set forth below, followed by culturing the transfected cells and harvesting the resulting AAV, and then conjugating the resulting AAV with a second cognate member (SCM) that is fused to a retargeting molecule The first chart below uses SpyTag as the first member of a specific binding pair, and Adenovirus Helper Genes. Modifications can be undertaken as disclosed below:
(1) Plasmid pGOI can comprise one or more genes that are desired to be expressed in covalently surface modified AAV11.
(2) Plasmids pRC-FM can be modified for other specific binding pairs. The first member (FM) should be complementary to a second cognate member (SCM) that is fused to a retargeting molecule (for example, an antibody, as well derivatives and fragments thereof, and still other molecules). See Definitions and Description sections of the Detailed Description, the Figures and associated text for “retargeting” and “retargeting molecules”. The populations of FMs and SCMs can be homogenous or heterogeneous as long as the selected FMs can come in contact with appropriate SCMs so that binding can occur.
(3) Detargeting mutations are optional and can be undertaken as disclosed herein and in publications. See Definitions and Description sections of the Detailed Description, the Figures and associated text for “detargeting” and “detargeting mutations”.
(4) To lessen the possibility of encountering neutralizing antibodies when the covalently surface modified AAV is administered to a subject, KTag can be used as an SCM to bind with SpyTag (FM) (SEQ ID NOS: 54 and 86). KTag and SpyLigase are based upon SpyCatcher. KTag (SEQ ID NO: 85) has only 10 amino acids, which renders it less immunogenic. KTag can be bound to SpyTag in the presence of SpyLigase (SEQ ID NO: 61). The SpyLigase can be removed by subsequent purification, such as by chromatography and/or filtration so that the SpyLigase will not have an appreciable presence in the final drug substance.
(5) Preferred mosaicisms are as follows: 1/1, 1/1.1, 1/1.2, 1/1.3, 1/1.4, 1/1.5, 1/1.6, 1/1.7, 1/1.8, 1/1.9, 1/2, 1/2.1, 1/2.2, 1/2.3, 1/2.4, 1/2.5, 1/2.6, 1/2.7, 1/2.8, 1/2.9, 1/3, 1/3.1, 1/3.2, 1/3.3, 1/3.4, 1/3.5, 1/3.6, 1/3.7, 1/3.8, 1/3.9, 1/4, 1/4.1, 1/4.2, 1/4.3, 1/4.4, 1/4.5, 1/4.6, 1/4.7, 1/4.8, 1/4.9, 1/5, 1/5.1, 1/5.2, 1/5.3, 1/5.4, 1/5.5, 1/5.6, 1/5.7, 1/5.8, 1/5.9, 1/6, 1/6.1, 1/6.2, 1/6.3, 1/6.4, 1/6.5, 1/6.6, 1/6.7, 1/6.8, 1/6.9, 1/7, 1/7.1, 1/7.2, 1/7.3, 1/7.4, 1/7.5, 1/7.6, 1/7.7, 1/7.8, 1/7.9, 1/8, 1/8.1, 1/8.2, 1/8.3, 1/8.4, 1/8.5, 1/8.6, 1/8.7, 1/8.8, 1/8.9, 1/9, 1/9.1, 1/9.2, 1/9.3, 1/9.4, 1/9.5, 1/9.6, 1/9.7, 1/9.8, 1/9.9, 1/10, 1/10.1, 1/10.2, 1/10.3, 1/10.4, 1/10.5, 1/10.6, 1/10.7, 1/10.8, 1/10.9, 1/11, 1/11.1, 1/11.2, 1/11.3, 1/11.4, 1/11.5, 1/11.6, 1/11.7, 1/11.8, 1/11.9, 1/12, 1/12.1, 1/12.2, 1/12.3, 1/12.4, 1/12.5, 1/12.6, 1/12.7, 1/12.8, 1/12.9, 1/13, 1/13.1, 1/13.2, 1/13.3, 1/13.4, 1/13.5, 1/13.6, 1/13.7, 1/13.8, 1/13.9, 1/14, 1/14.1, 1/14.2, 1/14.3, 1/14.4, 1/14.5, 1/14.6, 1/14.7, 1/14.8, 1/14.9, 1/15, 1/15.1, 1/15.2, 1/15.3, 1/15.4, 1/15.5, 1/15.6, 1/15.7, 1/15.8, 1/15.9, 1/16, 1/16.1, 1/16.2, 1/16.3, 1/16.4, 1/16.5, 1/16.6, 1/16.7, 1/16.8, 1/16.9, 1/17, 1/17.1, 1/17.2, 1/17.3, 1/17.4, 1/17.5, 1/17.6, 1/17.7, 1/17.8, 1/17.9, 1/18, 1/18.1, 1/18.2, 1/18.3, 1/18.4, 1/18.5, 1/18.6, 1/18.7, 1/18.8, 1/18.9, 1/19, 11/9.1, 1/19.2, 1/19.3, 1/19.4, 1/91.5, 1/19.6, 1/19.7, 1/19.8, 1/19.9, 1/20, 1/21, 1/21.1, 1/21.2, 1/21.3, 1/21.4, 1/21.5, 1/21.6, 1/21.7, 1/21.8, 1/21.9, 1/22, 1/22.1, 1/22.2, 1/22.3, 1/22.4, 1/22.5, 1/22.6, 1/22.7, 1/22.8, 1/22.9, 1/23, 1/23.1, 1/23.2, 1/23.3, 1/23.4, 1/23.5, 1/23.6, 1/23.7, 1/23.8, 1/23.9, 1/24, 1/24.1, 1/24.2, 1/24.3, 1/24.4, 1/24.5, 1/24.6, 1/24.7, 1/24.8, 1/24.9, 1/25, 1/25.1, 1/25.2, 1/25.3, 1/25.4, 1/25.5, 1/25.6, 1/25.7, 1/25.8, 1/25.9, 1/26, 1/26.1, 1/26.2, 1/26.3, 1/26.4, 1/26.5, 1/26.6, 1/26.7, 1/26.8, 12/6.9, 1/27, 1/27.1, 1/27.2, 1/27.3, 1/27.4, 1/27.5, 1/27.6, 1/27.7, 1/27.8, 1/27.9, 1/28, 1/28.1, 1/28.2, 1/28.3, 1/28.4, 1/28.5, 1/28.6, 1/28.7, 1/28.8, 1/28.9, 1/29, 1/29.1, 1/29.2, 1/29.3, 1/29.4, 1/29.5, 1/29.6, 1/29.7, 1/29.8, 1/29.9, 1/30, 1/30.1, 1/30.2, 1/30.3, 1/30.4, 1/30.5, 1/30.6, 1/30.7, 1/30.8, 1/30.9, 1/31, 1/31.1, 1/31.2, 1/31.3, 1/31.4, 1/31.5, 1/31.6, 1/31.7, 1/31.8, 1/31.9, 1/32, 1/32.1, 1/32.2, 1/32.3, 1/32.4, 1/32.5, 1/32.6, 1/32.7, 1/32.8, 1/32.9, 1/33, 1/33.1, 1/33.2, 1/33.3, 1/33.4, 1/33.5, 1/33.6, 1/33.7, 1/33.8, 1/33.9, 1/34, 1/34.1, 1/34.2, 1/34.3, 1/34.4, 1/34.5, 1/34.6, 1/34.7, 1/34.8, 1/34.9, 1/35, 1/35.1, 1/35.2, 1/35.3, 1/35.4, 1/35.5, 1/35.6, 1/35.7, 1/35.8, 1/35.9, 1/36, 1/36.1, 1/36.2, 1/36.3, 1/36.4, 1/36.5, 1/36.6, 1/36.7, 1/36.8, 1/36.9, 1/37, 1/37.1, 1/37.2, 1/37.3, 1/37.4, 1/37.5, 1/37.6, 1/37.7, 1/37.8, 1/37.9, 1/38, 1/38.1, 1/38.2, 1/38.3, 1/38.4, 1/38.5, 1/38.6, 1/38.7, 1/38.8, 1/38.9, 1/39, 1/39.1, 1/39.2, 1/39.3, 1/39.4, 1/39.5, 1/39.6, 1/39.7, 1/39.8, 1/39.9, 1/40, 1/40.1, 1/40.2, 1/40.3, 1/40.4, 1/40.5, 1/40.6, 1/40.7, 1/40.8, 1/40.9, 1/41, 1/41.1, 1/41.2, 1/41.3, 1/41.4, 1/41.5, 1/41.6, 1/41.7, 1/41.8, 1/41.9, 1/42, 1/42.1, 1/42.2, 1/42.3, 1/42.4, 1/42.5, 1/42.6, 1/42.7, 1/42.8, 1/42.9, 1/43, 1/43.1, 1/43.2, 1/43.3, 1/43.4, 1/43.5, 1/43.6, 1/43.7, 1/43.8, 1/43.9, 1/44, 1/44.1, 1/44.2, 1/44.3, 1/44.4, 1/44.5, 1/44.6, 1/44.7, 1/44.8, 1/44.9, 1/45, 1/45.1, 1/45.2, 1/45.3, 1/45.4, 1/45.5, 1/45.6, 1/45.7, 1/45.8, 1/45.9, 1/46, 1/46.1, 1/46.2, 1/46.3, 1/46.4, 1/46.5, 1/46.6, 1/46.7, 1/46.8, 1/46.9, 1/47, 1/47.1, 1/47.2, 1/47.3, 1/47.4, 1/47.5, 1/47.6, 1/47.7, 1/47.8, 1/47.9, 1/48, 1/48.1, 1/48.2, 1/48.3, 1/48.4, 1/48.5, 1/48.6, 1/48.7, 1/48.8, 1/48.9, 1/49, 1/49.1, 1/49.2, 1/49.3, 1/49.4, 1/49.5, 1/49.6, 1/49.7, 1/49.8, 1/49.9, 1/50, 1/50.1, 1/50.2, 1/50.3, 1/50.4, 1/50.5, 1/50.6, 1/50.7, 1/50.8, 1/50.9, 1/51, 1/51.1, 1/51.2, 1/51.3, 1/51.4, 1/51.5, 1/51.6, 1/51.7, 1/51.8, 1/51.9, 1/52, 1/52.1, 1/52.2, 1/52.3, 1/52.4, 1/52.5, 1/52.6, 1/52.7, 1/52.8, 1/52.9, 1/53, 1/53.1, 1/53.2, 1/53.3, 1/53.4, 1/53.5, 1/53.6, 1/53.7, 1/53.8, 1/53.9, 1/54, 1/54.1, 1/54.2, 1/54.3, 1/54.4, 1/54.5, 1/54.6, 1/54.7, 1/54.8, 1/54.9, 1/55, 1/55.1, 1/55.2, 1/55.3, 1/55.4, 1/55.5, 1/55.6, 1/55.7, 1/55.8, 1/55.9, 1/56, 1/56.1, 1/56.2, 1/56.3, 1/56.4, 1/56.5, 1/56.6, 1/56.7, 1/56.8, 1/56.9, 1/57, 1/57.1, 1/57.2, 1/57.3, 1/57.4, 1/57.5, 1/57.6, 1/57.7, 1/57.8, 1/57.9, 1/58, 1/58.1, 1/58.2, 1/58.3, 1/58.4, 1/58.5, 1/58.6, 1/58.7, 1/58.8, 1/58.9, 1/59, 1/59.1, 1/59.2, 1/59.3, 1/59.4, 1/59.5, 1/59.6, 1/59.7, 1/59.8, 1/59.9, 1/60 or ratios thereabout or therebetween. Ranges of ratios of 1/1 to 1/60 can be employed, and subranges as set forth below.
More preferred mosaicisms are:
1/4, 1/4.1, 1/4.2, 1/4.3, 1/4.4, 1/4.5, 1/4.6, 1/4.7, 1/4.8, 1/4.9, 1/5, 1/5.1, 1/5.2, 1/5.3, 1/5.4, 1/5.5, 1/5.6, 1/5.7, 1/5.8, 1/5.9, 1/6, 1/6.1, 1/6.2, 1/6.3, 1/6.4, 1/6.5, 1/6.6, 1/6.7, 1/6.8, 1/6.9, 1/7, 1/7.1, 1/7.2, 1/7.3, 1/7.4, 1/7.5, 1/7.6, 1/7.7, 1/7.8, 1/7.9, 1/8, 1/8.1, 1/8.2, 1/8.3, 1/8.4, 1/8.5, 1/8.6, 1/8.7, 1/8.8, 1/8.9, 1/9, 1/9.1, 1/9.2, 1/9.3, 1/9.4, 1/9.5, 1/9.6, 1/9.7, 1/9.8, 1/9.9, 1/10, 1/10.1, 1/10.2, 1/10.3, 1/10.4, 1/10.5, 1/10.6, 1/10.7, 1/10.8, 1/10.9, 1/11, 1/11.1, 1/11.2, 1/11.3, 1/11.4, 1/11.5, 1/11.6, 1/11.7, 1/11.8, 1/11.9, 1/12, 1/12.1, 1/12.2, 1/12.3, 1/12.4, 1/12.5, 1/12.6, 1/12.7, 1/12.8, 1/12.9 or 1/13.
Further preferred mosaicisms are:
1/5, 1/5.1, 1/5.2, 1/5.3, 1/5.4, 1/5.5, 1/5.6, 1/5.7, 1/5.8, 1/5.9, 1/6, 1/6.1, 1/6.2, 1/6.3, 1/6.4, 1/6.5, 1/6.6, 1/6.7, 1/6.8, 1/6.9, 1/7, 1/7.1, 1/7.2, 1/7.3, 1/7.4, 1/7.5, 1/7.6, 1/7.7, 1/7.8, 1/7.9, 1/8, 1/8.1, 1/8.2, 1/8.3, 1/8.4, 1/8.5, 1/8.6, 1/8.7, 1/8.8, 1/8.9, 1/9, 1/9.1, 1/9.2, 1/9.3, 1/9.4, 1/9.5, 1/9.6, 1/9.7, 1/9.8, 1/9.9, 1/10, 1/10.1, 1/10.2, 1/10.3, 1/10.4, 1/10.5, 1/10.6, 1/10.7, 1/10.8, 1/10.9, 1/11, 1/11.1, 1/11.2, 1/11.3, 1/11.4, 1/11.5, 1/11.6, 1/11.7, 1/11.8, 1/11.9, or 1/12.
Still more preferred mosaicisms are:
1/7, 1/7.1, 1/7.2, 1/7.3, 1/7.4, 1/7.5, 1/7.6, 1/7.7, 1/7.8, 1/7.9, 1/8, 1/8.1, 1/8.2, 1/8.3, 1/8.4, 1/8.5, 1/8.6, 1/8.7, 1/8.8, 1/8.9, 1/9, 1/9.1, 1/9.2, 1/9.3, 1/9.4, 1/9.5, 1/9.6, 1/9.7, 1/9.8, 1/9.9, 1/10, 1/10.1, 1/10.2, 1/10.3, 1/10.4, 1/10.5, 1/10.6, 1/10.7, 1/10.8, 1/10.9, or 1/11.
Preferred ranges of mosaicisms are 1/4 to 1/13; 1/5 to 1/12; 1/6 to 1/11, 1/7 to 1/10.5. or 1/7.5 to 1/10.
(6) Preferred molar ratios of AAV-FM to SCM-RM are as follows: 1:20, 1:25, 1:30, 1:35, 1:40, 1:45, 1:50, 1:55, 1:60, 1:65, 1:70, 1:75, 1:80, 1:85, 1:90, 1:95, 1:100, 1:105, 1:110, 1:115, 1:120, 1:125, 1:130, 1:135, 1:140, 1:145, 1:150, 1:155, 1:160, 1:165, 1:170, 1:175, 1:180, 1:185, 1:190, 1:195, 1:200, 1:205, 1:210, 1:215, 1:220, 1:225, 1:230, 1:235, 1:240, 1:245, 1:250, 1:255, 1:260, 1:265, 1:270, 1:275, 1:280, 1:285, 1:290, 1:295, 1:300, 1:305, 1:310, 1:315, 1:320, 1:325, 1:330, 1:335, 1:340, 1:345, 1:350, 1:355, 1:360, 1:365, 1:370, 1:375, 1:380, 1:385, 1:390, 1:395, 1:400, 1:405, 1:410, 1:415, 1:420, 1:425, 1:430, 1:435, 1:440, 1:445, 1:450, 1:455, 1:460, 1:465, 1:470, 1:475, 1:480, 1:485, 1:490, 1:495, 1:500, 1:505, 1:510, 1:515, 1:520, 1:525, 1:530, 1:535, 1:540, 1:545, 1:550, 1:555, 1:560, 1:565, 1:570, 1:575, 1:580, 1:585, 1:590, 1:595, 1:600, 1:605, 1:610, 1:615, 1:620, 1:625, 1:630, 1:635, 1:640, 1:645, 1:650, 1:655, 1:660, 1:665, 1:670, 1:675, 1:680, 1:685, 1:690, 1:695, 1:700, 1:705, 1:710, 1:715, 1:720, 1:725, 1:730, 1:735, 1:740, 1:745, 1:750, 1:755, 1:760, 1:765, 1:770, 1:775, 1:780, 1:785, 1:790, 1:795, 1:800, 1:805, 1:810, 1:815, 1:820, 1:825, 1:830, 1:835, 1:840, 1:845, 1:850, 1:855, 1:860, 1:865, 1:870, 1:875, 1:880, 1:885, 1:890, 1:895, 1:900, 1:905, 1:910, 1:915, 1:920, 1:925, 1:930, 1:935, 1:940, 1:945, 1:950, 1:955, 1:960, 1:965, 1:970, 1:975, 1:980, 1:985, 1:990, 1:995, 1:1000, 1:>1000 or any ratio thereabout or therebetween.
More preferred ratios AAV-FM to SCM-RM are: 1:30, 1:35, 1:40, 1:45, 1:50, 1:55, 1:60, 1:65, 1:70, 1:75, 1:80, 1:85, 1:90, 1:95, 1:100, 1:105, 1:110, 1:115, 1:120, 1:125, 1:130, 1:135, 1:140, 1:145, 1:150, 1:155, 1:160, 1:165, 1:170, 1:175, 1:180, 1:185, 1:190, 1:195, 1:200, 1:205, 1:210, 1:215, 1:220, 1:225, 1:230, 1:235, 1:240, 1:245, 1:250, 1:255, 1:260, 1:265, 1:270, 1:275, 1:280, 1:285, 1:290, 1:295, 1:300 or any ratio thereabout or therebetween.
Preferred ranges of AAV-FM to SCM-RM are 1:20 to 1:1000, and more preferred ranges are: 1:30 to 1:100, 1:40 to 1:100, 1:50 to 1:100 1:60 to 1:100, 1:70 to 1:100, 1:80 to 1:100, 1:90:1:100, 1:30 to 1:150, 1:40 to 1:150, 1:50 to 1:150 1:60 to 1:150, 1:70 to 1:150, 1:80 to 1:150, 1:90 to :150, 1:100 to 1:150, 1:30 to 1:200, 1:40 to 1:200, 1:50 to 1:200 1:60 to 1:200, 1:70 to 1:200, 1:80 to 1:200, 1:90:1:200, 1:100 to 1:200, 1:30 to 1:250, 1:40 to 1:250, 1:50 to 1:250 1:60 to 1:250, 1:70 to 1:250, 1:80 to 1:250, 1:90 to :250, 1:100 to 1:250, 1:30 to 1:300, 1:40 to 1:300, 1:50 to 1:300 1:60 to 1:300, 1:70 to 1:300, 1:80 to 1:300, 1:90:1:300, or 1:100 to 1:300.
(7) The inventions provide for a desired conjugation of a level of conjugation of at least 10%, at least 20%, at least 30%, and at least 40%. Preferred levels are at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or up to 100%, any of which can be considered complete depending on the purpose. More preferably, the desired level of conjugation typically will be about 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%.
Ranges of desired conjugation levels can be 10% to 100%, 20% to 99%, 30% to 99%, 40% to 99%, 50% to 99%, 60% to 99%, 70% to 99%, 80% to 99%, or 90% to 99%. Preferred ranges of desired conjugation levels can be 40% to 100%, 40% to 99%, 45% to 95%, 50% to 95%, 55% to 90%, 60% to 90%, 65% to 95%, 65% to 85%, 65% to 90%, 70% to 90%, 75% to 90%, 75% to 85%, 75% to 80%, or 80% to 85%. More preferably, the range is 65% to 95%.
The second chart below cites to exemplary modifications to the above chart based upon the descriptions and sequence examples contained herein. Points 1-7 above also apply to the second chart below:
Covalently surface modified AAV12 can be made by transfecting a cell with plasmids as set forth below, followed by culturing the transfected cells and harvesting the resulting AAV, and then conjugating the resulting AAV with a second cognate member (SCM) that is fused to a retargeting molecule The first chart below uses SpyTag as the first member of a specific binding pair, and Adenovirus Helper Genes. Modifications can be undertaken as disclosed below:
(1) Plasmid pGOI can comprise one or more genes that are desired to be expressed in covalently surface modified AAV12.
(2) Plasmids pRC-FM can be modified for other specific binding pairs. The first member (FM) should be complementary to a second cognate member (SCM) that is fused to a retargeting molecule (for example, an antibody, as well derivatives and fragments thereof, and still other molecules). See Definitions and Description sections of the Detailed Description, the Figures and associated text for “retargeting” and “retargeting molecules”. The populations of FMs and SCMs can be homogenous or heterogeneous as long as the selected FMs can come in contact with appropriate SCMs so that binding can occur.
(3) Detargeting mutations are optional and can be undertaken as disclosed herein and in publications. See Definitions and Description sections of the Detailed Description, the Figures and associated text for “detargeting” and “detargeting mutations”.
(4) To lessen the possibility of encountering neutralizing antibodies when the covalently surface modified AAV is administered to a subject, KTag can be used as an SCM to bind with SpyTag (FM) (SEQ ID NOS: 54 and 86). KTag and SpyLigase are based upon SpyCatcher. KTag (SEQ ID NO: 85) has only 10 amino acids, which renders it less immunogenic. KTag can be bound to SpyTag in the presence of SpyLigase (SEQ ID NO: 61). The SpyLigase can be removed by subsequent purification, such as by chromatography and/or filtration so that the SpyLigase will not have an appreciable presence in the final drug substance.
(5) Preferred mosaicisms are as follows: 1/1, 1/1.1, 1/1.2, 1/1.3, 1/1.4, 1/1.5, 1/1.6, 1/1.7, 1/1.8, 1/1.9, 1/2, 1/2.1, 1/2.2, 1/2.3, 1/2.4, 1/2.5, 1/2.6, 1/2.7, 1/2.8, 1/2.9, 1/3, 1/3.1, 1/3.2, 1/3.3, 1/3.4, 1/3.5, 1/3.6, 1/3.7, 1/3.8, 1/3.9, 1/4, 1/4.1, 1/4.2, 1/4.3, 1/4.4, 1/4.5, 1/4.6, 1/4.7, 1/4.8, 1/4.9, 1/5, 1/5.1, 1/5.2, 1/5.3, 1/5.4, 1/5.5, 1/5.6, 1/5.7, 1/5.8, 1/5.9, 1/6, 1/6.1, 1/6.2, 1/6.3, 1/6.4, 1/6.5, 1/6.6, 1/6.7, 1/6.8, 1/6.9, 1/7, 1/7.1, 1/7.2, 1/7.3, 1/7.4, 1/7.5, 1/7.6, 1/7.7, 1/7.8, 1/7.9, 1/8, 1/8.1, 1/8.2, 1/8.3, 1/8.4, 1/8.5, 1/8.6, 1/8.7, 1/8.8, 1/8.9, 1/9, 1/9.1, 1/9.2, 1/9.3, 1/9.4, 1/9.5, 1/9.6, 1/9.7, 1/9.8, 1/9.9, 1/10, 1/10.1, 1/10.2, 1/10.3, 1/10.4, 1/10.5, 1/10.6, 1/10.7, 1/10.8, 1/10.9, 1/11, 1/11.1, 1/11.2, 1/11.3, 1/11.4, 1/11.5, 1/11.6, 1/11.7, 1/11.8, 1/11.9, 1/12, 1/12.1, 1/12.2, 1/12.3, 1/12.4, 1/12.5, 1/12.6, 1/12.7, 1/12.8, 1/12.9, 1/13, 1/13.1, 1/13.2, 1/13.3, 1/13.4, 1/13.5, 1/13.6, 1/13.7, 1/13.8, 1/13.9, 1/14, 1/14.1, 1/14.2, 1/14.3, 1/14.4, 1/14.5, 1/14.6, 1/14.7, 1/14.8, 1/14.9, 1/15, 1/15.1, 1/15.2, 1/15.3, 1/15.4, 1/15.5, 1/15.6, 1/15.7, 1/15.8, 1/15.9, 1/16, 1/16.1, 1/16.2, 1/16.3, 1/16.4, 1/16.5, 1/16.6, 1/16.7, 1/16.8, 1/16.9, 1/17, 1/17.1, 1/17.2, 1/17.3, 1/17.4, 1/17.5, 1/17.6, 1/17.7, 1/17.8, 1/17.9, 1/18, 1/18.1, 1/18.2, 1/18.3, 1/18.4, 1/18.5, 1/18.6, 1/18.7, 1/18.8, 1/18.9, 1/19, 11/9.1, 1/19.2, 1/19.3, 1/19.4, 1/91.5, 1/19.6, 1/19.7, 1/19.8, 1/19.9, 1/20, 1/21, 1/21.1, 1/21.2, 1/21.3, 1/21.4, 1/21.5, 1/21.6, 1/21.7, 1/21.8, 1/21.9, 1/22, 1/22.1, 1/22.2, 1/22.3, 1/22.4, 1/22.5, 1/22.6, 1/22.7, 1/22.8, 1/22.9, 1/23, 1/23.1, 1/23.2, 1/23.3, 1/23.4, 1/23.5, 1/23.6, 1/23.7, 1/23.8, 1/23.9, 1/24, 1/24.1, 1/24.2, 1/24.3, 1/24.4, 1/24.5, 1/24.6, 1/24.7, 1/24.8, 1/24.9, 1/25, 1/25.1, 1/25.2, 1/25.3, 1/25.4, 1/25.5, 1/25.6, 1/25.7, 1/25.8, 1/25.9, 1/26, 1/26.1, 1/26.2, 1/26.3, 1/26.4, 1/26.5, 1/26.6, 1/26.7, 1/26.8, 12/6.9, 1/27, 1/27.1, 1/27.2, 1/27.3, 1/27.4, 1/27.5, 1/27.6, 1/27.7, 1/27.8, 1/27.9, 1/28, 1/28.1, 1/28.2, 1/28.3, 1/28.4, 1/28.5, 1/28.6, 1/28.7, 1/28.8, 1/28.9, 1/29, 1/29.1, 1/29.2, 1/29.3, 1/29.4, 1/29.5, 1/29.6, 1/29.7, 1/29.8, 1/29.9, 1/30, 1/30.1, 1/30.2, 1/30.3, 1/30.4, 1/30.5, 1/30.6, 1/30.7, 1/30.8, 1/30.9, 1/31, 1/31.1, 1/31.2, 1/31.3, 1/31.4, 1/31.5, 1/31.6, 1/31.7, 1/31.8, 1/31.9, 1/32, 1/32.1, 1/32.2, 1/32.3, 1/32.4, 1/32.5, 1/32.6, 1/32.7, 1/32.8, 1/32.9, 1/33, 1/33.1, 1/33.2, 1/33.3, 1/33.4, 1/33.5, 1/33.6, 1/33.7, 1/33.8, 1/33.9, 1/34, 1/34.1, 1/34.2, 1/34.3, 1/34.4, 1/34.5, 1/34.6, 1/34.7, 1/34.8, 1/34.9, 1/35, 1/35.1, 1/35.2, 1/35.3, 1/35.4, 1/35.5, 1/35.6, 1/35.7, 1/35.8, 1/35.9, 1/36, 1/36.1, 1/36.2, 1/36.3, 1/36.4, 1/36.5, 1/36.6, 1/36.7, 1/36.8, 1/36.9, 1/37, 1/37.1, 1/37.2, 1/37.3, 1/37.4, 1/37.5, 1/37.6, 1/37.7, 1/37.8, 1/37.9, 1/38, 1/38.1, 1/38.2, 1/38.3, 1/38.4, 1/38.5, 1/38.6, 1/38.7, 1/38.8, 1/38.9, 1/39, 1/39.1, 1/39.2, 1/39.3, 1/39.4, 1/39.5, 1/39.6, 1/39.7, 1/39.8, 1/39.9, 1/40, 1/40.1, 1/40.2, 1/40.3, 1/40.4, 1/40.5, 1/40.6, 1/40.7, 1/40.8, 1/40.9, 1/41, 1/41.1, 1/41.2, 1/41.3, 1/41.4, 1/41.5, 1/41.6, 1/41.7, 1/41.8, 1/41.9, 1/42, 1/42.1, 1/42.2, 1/42.3, 1/42.4, 1/42.5, 1/42.6, 1/42.7, 1/42.8, 1/42.9, 1/43, 1/43.1, 1/43.2, 1/43.3, 1/43.4, 1/43.5, 1/43.6, 1/43.7, 1/43.8, 1/43.9, 1/44, 1/44.1, 1/44.2, 1/44.3, 1/44.4, 1/44.5, 1/44.6, 1/44.7, 1/44.8, 1/44.9, 1/45, 1/45.1, 1/45.2, 1/45.3, 1/45.4, 1/45.5, 1/45.6, 1/45.7, 1/45.8, 1/45.9, 1/46, 1/46.1, 1/46.2, 1/46.3, 1/46.4, 1/46.5, 1/46.6, 1/46.7, 1/46.8, 1/46.9, 1/47, 1/47.1, 1/47.2, 1/47.3, 1/47.4, 1/47.5, 1/47.6, 1/47.7, 1/47.8, 1/47.9, 1/48, 1/48.1, 1/48.2, 1/48.3, 1/48.4, 1/48.5, 1/48.6, 1/48.7, 1/48.8, 1/48.9, 1/49, 1/49.1, 1/49.2, 1/49.3, 1/49.4, 1/49.5, 1/49.6, 1/49.7, 1/49.8, 1/49.9, 1/50, 1/50.1, 1/50.2, 1/50.3, 1/50.4, 1/50.5, 1/50.6, 1/50.7, 1/50.8, 1/50.9, 1/51, 1/51.1, 1/51.2, 1/51.3, 1/51.4, 1/51.5, 1/51.6, 1/51.7, 1/51.8, 1/51.9, 1/52, 1/52.1, 1/52.2, 1/52.3, 1/52.4, 1/52.5, 1/52.6, 1/52.7, 1/52.8, 1/52.9, 1/53, 1/53.1, 1/53.2, 1/53.3, 1/53.4, 1/53.5, 1/53.6, 1/53.7, 1/53.8, 1/53.9, 1/54, 1/54.1, 1/54.2, 1/54.3, 1/54.4, 1/54.5, 1/54.6, 1/54.7, 1/54.8, 1/54.9, 1/55, 1/55.1, 1/55.2, 1/55.3, 1/55.4, 1/55.5, 1/55.6, 1/55.7, 1/55.8, 1/55.9, 1/56, 1/56.1, 1/56.2, 1/56.3, 1/56.4, 1/56.5, 1/56.6, 1/56.7, 1/56.8, 1/56.9, 1/57, 1/57.1, 1/57.2, 1/57.3, 1/57.4, 1/57.5, 1/57.6, 1/57.7, 1/57.8, 1/57.9, 1/58, 1/58.1, 1/58.2, 1/58.3, 1/58.4, 1/58.5, 1/58.6, 1/58.7, 1/58.8, 1/58.9, 1/59, 1/59.1, 1/59.2, 1/59.3, 1/59.4, 1/59.5, 1/59.6, 1/59.7, 1/59.8, 1/59.9, 1/60 or ratios thereabout or therebetween. Ranges of ratios of 1/1 to 1/60 can be employed, and subranges as set forth below.
More preferred mosaicisms are:
1/4, 1/4.1, 1/4.2, 1/4.3, 1/4.4, 1/4.5, 1/4.6, 1/4.7, 1/4.8, 1/4.9, 1/5, 1/5.1, 1/5.2, 1/5.3, 1/5.4, 1/5.5, 1/5.6, 1/5.7, 1/5.8, 1/5.9, 1/6, 1/6.1, 1/6.2, 1/6.3, 1/6.4, 1/6.5, 1/6.6, 1/6.7, 1/6.8, 1/6.9, 1/7, 1/7.1, 1/7.2, 1/7.3, 1/7.4, 1/7.5, 1/7.6, 1/7.7, 1/7.8, 1/7.9, 1/8, 1/8.1, 1/8.2, 1/8.3, 1/8.4, 1/8.5, 1/8.6, 1/8.7, 1/8.8, 1/8.9, 1/9, 1/9.1, 1/9.2, 1/9.3, 1/9.4, 1/9.5, 1/9.6, 1/9.7, 1/9.8, 1/9.9, 1/10, 1/10.1, 1/10.2, 1/10.3, 1/10.4, 1/10.5, 1/10.6, 1/10.7, 1/10.8, 1/10.9, 1/11, 1/11.1, 1/11.2, 1/11.3, 1/11.4, 1/11.5, 1/11.6, 1/11.7, 1/11.8, 1/11.9, 1/12, 1/12.1, 1/12.2, 1/12.3, 1/12.4, 1/12.5, 1/12.6, 1/12.7, 1/12.8, 1/12.9 or 1/13.
Further preferred mosaicisms are:
1/5, 1/5.1, 1/5.2, 1/5.3, 1/5.4, 1/5.5, 1/5.6, 1/5.7, 1/5.8, 1/5.9, 1/6, 1/6.1, 1/6.2, 1/6.3, 1/6.4, 1/6.5, 1/6.6, 1/6.7, 1/6.8, 1/6.9, 1/7, 1/7.1, 1/7.2, 1/7.3, 1/7.4, 1/7.5, 1/7.6, 1/7.7, 1/7.8, 1/7.9, 1/8, 1/8.1, 1/8.2, 1/8.3, 1/8.4, 1/8.5, 1/8.6, 1/8.7, 1/8.8, 1/8.9, 1/9, 1/9.1, 1/9.2, 1/9.3, 1/9.4, 1/9.5, 1/9.6, 1/9.7, 1/9.8, 1/9.9, 1/10, 1/10.1, 1/10.2, 1/10.3, 1/10.4, 1/10.5, 1/10.6, 1/10.7, 1/10.8, 1/10.9, 1/11, 1/11.1, 1/11.2, 1/11.3, 1/11.4, 1/11.5, 1/11.6, 1/11.7, 1/11.8, 1/11.9, or 1/12.
Still more preferred mosaicisms are:
1/7, 1/7.1, 1/7.2, 1/7.3, 1/7.4, 1/7.5, 1/7.6, 1/7.7, 1/7.8, 1/7.9, 1/8, 1/8.1, 1/8.2, 1/8.3, 1/8.4, 1/8.5, 1/8.6, 1/8.7, 1/8.8, 1/8.9, 1/9, 1/9.1, 1/9.2, 1/9.3, 1/9.4, 1/9.5, 1/9.6, 1/9.7, 1/9.8, 1/9.9, 1/10, 1/10.1, 1/10.2, 1/10.3, 1/10.4, 1/10.5, 1/10.6, 1/10.7, 1/10.8, 1/10.9, or 1/11.
Preferred ranges of mosaicisms are 1/4 to 1/13; 1/5 to 1/12; 1/6 to 1/11, 1/7 to 1/10.5. or 1/7.5 to 1/10.
(6) Preferred molar ratios of AAV-FM to SCM-RM are as follows: 1:20, 1:25, 1:30, 1:35, 1:40, 1:45, 1:50, 1:55, 1:60, 1:65, 1:70, 1:75, 1:80, 1:85, 1:90, 1:95, 1:100, 1:105, 1:110, 1:115, 1:120, 1:125, 1:130, 1:135, 1:140, 1:145, 1:150, 1:155, 1:160, 1:165, 1:170, 1:175, 1:180, 1:185, 1:190, 1:195, 1:200, 1:205, 1:210, 1:215, 1:220, 1:225, 1:230, 1:235, 1:240, 1:245, 1:250, 1:255, 1:260, 1:265, 1:270, 1:275, 1:280, 1:285, 1:290, 1:295, 1:300, 1:305, 1:310, 1:315, 1:320, 1:325, 1:330, 1:335, 1:340, 1:345, 1:350, 1:355, 1:360, 1:365, 1:370, 1:375, 1:380, 1:385, 1:390, 1:395, 1:400, 1:405, 1:410, 1:415, 1:420, 1:425, 1:430, 1:435, 1:440, 1:445, 1:450, 1:455, 1:460, 1:465, 1:470, 1:475, 1:480, 1:485, 1:490, 1:495, 1:500, 1:505, 1:510, 1:515, 1:520, 1:525, 1:530, 1:535, 1:540, 1:545, 1:550, 1:555, 1:560, 1:565, 1:570, 1:575, 1:580, 1:585, 1:590, 1:595, 1:600, 1:605, 1:610, 1:615, 1:620, 1:625, 1:630, 1:635, 1:640, 1:645, 1:650, 1:655, 1:660, 1:665, 1:670, 1:675, 1:680, 1:685, 1:690, 1:695, 1:700, 1:705, 1:710, 1:715, 1:720, 1:725, 1:730, 1:735, 1:740, 1:745, 1:750, 1:755, 1:760, 1:765, 1:770, 1:775, 1:780, 1:785, 1:790, 1:795, 1:800, 1:805, 1:810, 1:815, 1:820, 1:825, 1:830, 1:835, 1:840, 1:845, 1:850, 1:855, 1:860, 1:865, 1:870, 1:875, 1:880, 1:885, 1:890, 1:895, 1:900, 1:905, 1:910, 1:915, 1:920, 1:925, 1:930, 1:935, 1:940, 1:945, 1:950, 1:955, 1:960, 1:965, 1:970, 1:975, 1:980, 1:985, 1:990, 1:995, 1:1000, 1:>1000 or any ratio thereabout or therebetween.
More preferred ratios AAV-FM to SCM-RM are: 1:30, 1:35, 1:40, 1:45, 1:50, 1:55, 1:60, 1:65, 1:70, 1:75, 1:80, 1:85, 1:90, 1:95, 1:100, 1:105, 1:110, 1:115, 1:120, 1:125, 1:130, 1:135, 1:140, 1:145, 1:150, 1:155, 1:160, 1:165, 1:170, 1:175, 1:180, 1:185, 1:190, 1:195, 1:200, 1:205, 1:210, 1:215, 1:220, 1:225, 1:230, 1:235, 1:240, 1:245, 1:250, 1:255, 1:260, 1:265, 1:270, 1:275, 1:280, 1:285, 1:290, 1:295, 1:300 or any ratio thereabout or therebetween.
Preferred ranges of AAV-FM to SCM-RM are 1:20 to 1:1000, and more preferred ranges are: 1:30 to 1:100, 1:40 to 1:100, 1:50 to 1:100 1:60 to 1:100, 1:70 to 1:100, 1:80 to 1:100, 1:90:1:100, 1:30 to 1:150, 1:40 to 1:150, 1:50 to 1:150 1:60 to 1:150, 1:70 to 1:150, 1:80 to 1:150, 1:90 to :150, 1:100 to 1:150, 1:30 to 1:200, 1:40 to 1:200, 1:50 to 1:200 1:60 to 1:200, 1:70 to 1:200, 1:80 to 1:200, 1:90:1:200, 1:100 to 1:200, 1:30 to 1:250, 1:40 to 1:250, 1:50 to 1:250 1:60 to 1:250, 1:70 to 1:250, 1:80 to 1:250, 1:90 to :250, 1:100 to 1:250, 1:30 to 1:300, 1:40 to 1:300, 1:50 to 1:300 1:60 to 1:300, 1:70 to 1:300, 1:80 to 1:300, 1:90:1:300, or 1:100 to 1:300.
(7) The inventions provide for a desired conjugation of a level of conjugation of at least 10%, at least 20%, at least 30%, and at least 40%. Preferred levels are at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or up to 100%, any of which can be considered complete depending on the purpose. More preferably, the desired level of conjugation typically will be about 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%.
Ranges of desired conjugation levels can be 10% to 100%, 20% to 99%, 30% to 99%, 40% to 99%, 50% to 99%, 60% to 99%, 70% to 99%, 80% to 99%, or 90% to 99%. Preferred ranges of desired conjugation levels can be 40% to 100%, 40% to 99%, 45% to 95%, 50% to 95%, 55% to 90%, 60% to 90%, 65% to 95%, 65% to 85%, 65% to 90%, 70% to 90%, 75% to 90%, 75% to 85%, 75% to 80%, or 80% to 85%. More preferably, the range is 65% to 95%.
The second chart below cites to exemplary modifications to the above chart based upon the descriptions and sequence examples contained herein. Points 1-7 above also apply to the second chart below:
Covalently surface modified AAV13 can be made by transfecting a cell with plasmids as set forth below, followed by culturing the transfected cells and harvesting the resulting AAV, and then conjugating the resulting AAV with a second cognate member (SCM) that is fused to a retargeting molecule The first chart below uses SpyTag as the first member of a specific binding pair, and Adenovirus Helper Genes. Modifications can be undertaken as disclosed below:
(1) Plasmid pGOI can comprise one or more genes that are desired to be expressed in covalently surface modified AAV13.
(2) Plasmids pRC-FM can be modified for other specific binding pairs. The first member (FM) should be complementary to a second cognate member (SCM) that is fused to a retargeting molecule (for example, an antibody, as well derivatives and fragments thereof, and still other molecules). See Definitions and Description sections of the Detailed Description, the Figures and associated text for “retargeting” and “retargeting molecules”. The populations of FMs and SCMs can be homogenous or heterogeneous as long as the selected FMs can come in contact with appropriate SCMs so that binding can occur.
(3) Detargeting mutations are optional and can be undertaken as disclosed herein and in publications. See Definitions and Description sections of the Detailed Description, the Figures and associated text for “detargeting” and “detargeting mutations”.
(4) To lessen the possibility of encountering neutralizing antibodies when the covalently surface modified AAV is administered to a subject, KTag can be used as an SCM to bind with SpyTag (FM) (SEQ ID NOS: 54 and 86). KTag and SpyLigase are based upon SpyCatcher. KTag (SEQ ID NO: 85) has only 10 amino acids, which renders it less immunogenic. KTag can be bound to SpyTag in the presence of SpyLigase (SEQ ID NO: 61). The SpyLigase can be removed by subsequent purification, such as by chromatography and/or filtration so that the SpyLigase will not have an appreciable presence in the final drug substance.
(5) Preferred mosaicisms are as follows: 1/1, 1/1.1, 1/1.2, 1/1.3, 1/1.4, 1/1.5, 1/1.6, 1/1.7, 1/1.8, 1/1.9, 1/2, 1/2.1, 1/2.2, 1/2.3, 1/2.4, 1/2.5, 1/2.6, 1/2.7, 1/2.8, 1/2.9, 1/3, 1/3.1, 1/3.2, 1/3.3, 1/3.4, 1/3.5, 1/3.6, 1/3.7, 1/3.8, 1/3.9, 1/4, 1/4.1, 1/4.2, 1/4.3, 1/4.4, 1/4.5, 1/4.6, 1/4.7, 1/4.8, 1/4.9, 1/5, 1/5.1, 1/5.2, 1/5.3, 1/5.4, 1/5.5, 1/5.6, 1/5.7, 1/5.8, 1/5.9, 1/6, 1/6.1, 1/6.2, 1/6.3, 1/6.4, 1/6.5, 1/6.6, 1/6.7, 1/6.8, 1/6.9, 1/7, 1/7.1, 1/7.2, 1/7.3, 1/7.4, 1/7.5, 1/7.6, 1/7.7, 1/7.8, 1/7.9, 1/8, 1/8.1, 1/8.2, 1/8.3, 1/8.4, 1/8.5, 1/8.6, 1/8.7, 1/8.8, 1/8.9, 1/9, 1/9.1, 1/9.2, 1/9.3, 1/9.4, 1/9.5, 1/9.6, 1/9.7, 1/9.8, 1/9.9, 1/10, 1/10.1, 1/10.2, 1/10.3, 1/10.4, 1/10.5, 1/10.6, 1/10.7, 1/10.8, 1/10.9, 1/11, 1/11.1, 1/11.2, 1/11.3, 1/11.4, 1/11.5, 1/11.6, 1/11.7, 1/11.8, 1/11.9, 1/12, 1/12.1, 1/12.2, 1/12.3, 1/12.4, 1/12.5, 1/12.6, 1/12.7, 1/12.8, 1/12.9, 1/13, 1/13.1, 1/13.2, 1/13.3, 1/13.4, 1/13.5, 1/13.6, 1/13.7, 1/13.8, 1/13.9, 1/14, 1/14.1, 1/14.2, 1/14.3, 1/14.4, 1/14.5, 1/14.6, 1/14.7, 1/14.8, 1/14.9, 1/15, 1/15.1, 1/15.2, 1/15.3, 1/15.4, 1/15.5, 1/15.6, 1/15.7, 1/15.8, 1/15.9, 1/16, 1/16.1, 1/16.2, 1/16.3, 1/16.4, 1/16.5, 1/16.6, 1/16.7, 1/16.8, 1/16.9, 1/17, 1/17.1, 1/17.2, 1/17.3, 1/17.4, 1/17.5, 1/17.6, 1/17.7, 1/17.8, 1/17.9, 1/18, 1/18.1, 1/18.2, 1/18.3, 1/18.4, 1/18.5, 1/18.6, 1/18.7, 1/18.8, 1/18.9, 1/19, 11/9.1, 1/19.2, 1/19.3, 1/19.4, 1/91.5, 1/19.6, 1/19.7, 1/19.8, 1/19.9, 1/20, 1/21, 1/21.1, 1/21.2, 1/21.3, 1/21.4, 1/21.5, 1/21.6, 1/21.7, 1/21.8, 1/21.9, 1/22, 1/22.1, 1/22.2, 1/22.3, 1/22.4, 1/22.5, 1/22.6, 1/22.7, 1/22.8, 1/22.9, 1/23, 1/23.1, 1/23.2, 1/23.3, 1/23.4, 1/23.5, 1/23.6, 1/23.7, 1/23.8, 1/23.9, 1/24, 1/24.1, 1/24.2, 1/24.3, 1/24.4, 1/24.5, 1/24.6, 1/24.7, 1/24.8, 1/24.9, 1/25, 1/25.1, 1/25.2, 1/25.3, 1/25.4, 1/25.5, 1/25.6, 1/25.7, 1/25.8, 1/25.9, 1/26, 1/26.1, 1/26.2, 1/26.3, 1/26.4, 1/26.5, 1/26.6, 1/26.7, 1/26.8, 12/6.9, 1/27, 1/27.1, 1/27.2, 1/27.3, 1/27.4, 1/27.5, 1/27.6, 1/27.7, 1/27.8, 1/27.9, 1/28, 1/28.1, 1/28.2, 1/28.3, 1/28.4, 1/28.5, 1/28.6, 1/28.7, 1/28.8, 1/28.9, 1/29, 1/29.1, 1/29.2, 1/29.3, 1/29.4, 1/29.5, 1/29.6, 1/29.7, 1/29.8, 1/29.9, 1/30, 1/30.1, 1/30.2, 1/30.3, 1/30.4, 1/30.5, 1/30.6, 1/30.7, 1/30.8, 1/30.9, 1/31, 1/31.1, 1/31.2, 1/31.3, 1/31.4, 1/31.5, 1/31.6, 1/31.7, 1/31.8, 1/31.9, 1/32, 1/32.1, 1/32.2, 1/32.3, 1/32.4, 1/32.5, 1/32.6, 1/32.7, 1/32.8, 1/32.9, 1/33, 1/33.1, 1/33.2, 1/33.3, 1/33.4, 1/33.5, 1/33.6, 1/33.7, 1/33.8, 1/33.9, 1/34, 1/34.1, 1/34.2, 1/34.3, 1/34.4, 1/34.5, 1/34.6, 1/34.7, 1/34.8, 1/34.9, 1/35, 1/35.1, 1/35.2, 1/35.3, 1/35.4, 1/35.5, 1/35.6, 1/35.7, 1/35.8, 1/35.9, 1/36, 1/36.1, 1/36.2, 1/36.3, 1/36.4, 1/36.5, 1/36.6, 1/36.7, 1/36.8, 1/36.9, 1/37, 1/37.1, 1/37.2, 1/37.3, 1/37.4, 1/37.5, 1/37.6, 1/37.7, 1/37.8, 1/37.9, 1/38, 1/38.1, 1/38.2, 1/38.3, 1/38.4, 1/38.5, 1/38.6, 1/38.7, 1/38.8, 1/38.9, 1/39, 1/39.1, 1/39.2, 1/39.3, 1/39.4, 1/39.5, 1/39.6, 1/39.7, 1/39.8, 1/39.9, 1/40, 1/40.1, 1/40.2, 1/40.3, 1/40.4, 1/40.5, 1/40.6, 1/40.7, 1/40.8, 1/40.9, 1/41, 1/41.1, 1/41.2, 1/41.3, 1/41.4, 1/41.5, 1/41.6, 1/41.7, 1/41.8, 1/41.9, 1/42, 1/42.1, 1/42.2, 1/42.3, 1/42.4, 1/42.5, 1/42.6, 1/42.7, 1/42.8, 1/42.9, 1/43, 1/43.1, 1/43.2, 1/43.3, 1/43.4, 1/43.5, 1/43.6, 1/43.7, 1/43.8, 1/43.9, 1/44, 1/44.1, 1/44.2, 1/44.3, 1/44.4, 1/44.5, 1/44.6, 1/44.7, 1/44.8, 1/44.9, 1/45, 1/45.1, 1/45.2, 1/45.3, 1/45.4, 1/45.5, 1/45.6, 1/45.7, 1/45.8, 1/45.9, 1/46, 1/46.1, 1/46.2, 1/46.3, 1/46.4, 1/46.5, 1/46.6, 1/46.7, 1/46.8, 1/46.9, 1/47, 1/47.1, 1/47.2, 1/47.3, 1/47.4, 1/47.5, 1/47.6, 1/47.7, 1/47.8, 1/47.9, 1/48, 1/48.1, 1/48.2, 1/48.3, 1/48.4, 1/48.5, 1/48.6, 1/48.7, 1/48.8, 1/48.9, 1/49, 1/49.1, 1/49.2, 1/49.3, 1/49.4, 1/49.5, 1/49.6, 1/49.7, 1/49.8, 1/49.9, 1/50, 1/50.1, 1/50.2, 1/50.3, 1/50.4, 1/50.5, 1/50.6, 1/50.7, 1/50.8, 1/50.9, 1/51, 1/51.1, 1/51.2, 1/51.3, 1/51.4, 1/51.5, 1/51.6, 1/51.7, 1/51.8, 1/51.9, 1/52, 1/52.1, 1/52.2, 1/52.3, 1/52.4, 1/52.5, 1/52.6, 1/52.7, 1/52.8, 1/52.9, 1/53, 1/53.1, 1/53.2, 1/53.3, 1/53.4, 1/53.5, 1/53.6, 1/53.7, 1/53.8, 1/53.9, 1/54, 1/54.1, 1/54.2, 1/54.3, 1/54.4, 1/54.5, 1/54.6, 1/54.7, 1/54.8, 1/54.9, 1/55, 1/55.1, 1/55.2, 1/55.3, 1/55.4, 1/55.5, 1/55.6, 1/55.7, 1/55.8, 1/55.9, 1/56, 1/56.1, 1/56.2, 1/56.3, 1/56.4, 1/56.5, 1/56.6, 1/56.7, 1/56.8, 1/56.9, 1/57, 1/57.1, 1/57.2, 1/57.3, 1/57.4, 1/57.5, 1/57.6, 1/57.7, 1/57.8, 1/57.9, 1/58, 1/58.1, 1/58.2, 1/58.3, 1/58.4, 1/58.5, 1/58.6, 1/58.7, 1/58.8, 1/58.9, 1/59, 1/59.1, 1/59.2, 1/59.3, 1/59.4, 1/59.5, 1/59.6, 1/59.7, 1/59.8, 1/59.9, 1/60 or ratios thereabout or therebetween. Ranges of ratios of 1/1 to 1/60 can be employed, and subranges as set forth below.
More preferred mosaicisms are:
1/4, 1/4.1, 1/4.2, 1/4.3, 1/4.4, 1/4.5, 1/4.6, 1/4.7, 1/4.8, 1/4.9, 1/5, 1/5.1, 1/5.2, 1/5.3, 1/5.4, 1/5.5, 1/5.6, 1/5.7, 1/5.8, 1/5.9, 1/6, 1/6.1, 1/6.2, 1/6.3, 1/6.4, 1/6.5, 1/6.6, 1/6.7, 1/6.8, 1/6.9, 1/7, 1/7.1, 1/7.2, 1/7.3, 1/7.4, 1/7.5, 1/7.6, 1/7.7, 1/7.8, 1/7.9, 1/8, 1/8.1, 1/8.2, 1/8.3, 1/8.4, 1/8.5, 1/8.6, 1/8.7, 1/8.8, 1/8.9, 1/9, 1/9.1, 1/9.2, 1/9.3, 1/9.4, 1/9.5, 1/9.6, 1/9.7, 1/9.8, 1/9.9, 1/10, 1/10.1, 1/10.2, 1/10.3, 1/10.4, 1/10.5, 1/10.6, 1/10.7, 1/10.8, 1/10.9, 1/11, 1/11.1, 1/11.2, 1/11.3, 1/11.4, 1/11.5, 1/11.6, 1/11.7, 1/11.8, 1/11.9, 1/12, 1/12.1, 1/12.2, 1/12.3, 1/12.4, 1/12.5, 1/12.6, 1/12.7, 1/12.8, 1/12.9 or 1/13.
Further preferred mosaicisms are:
1/5, 1/5.1, 1/5.2, 1/5.3, 1/5.4, 1/5.5, 1/5.6, 1/5.7, 1/5.8, 1/5.9, 1/6, 1/6.1, 1/6.2, 1/6.3, 1/6.4, 1/6.5, 1/6.6, 1/6.7, 1/6.8, 1/6.9, 1/7, 1/7.1, 1/7.2, 1/7.3, 1/7.4, 1/7.5, 1/7.6, 1/7.7, 1/7.8, 1/7.9, 1/8, 1/8.1, 1/8.2, 1/8.3, 1/8.4, 1/8.5, 1/8.6, 1/8.7, 1/8.8, 1/8.9, 1/9, 1/9.1, 1/9.2, 1/9.3, 1/9.4, 1/9.5, 1/9.6, 1/9.7, 1/9.8, 1/9.9, 1/10, 1/10.1, 1/10.2, 1/10.3, 1/10.4, 1/10.5, 1/10.6, 1/10.7, 1/10.8, 1/10.9, 1/11, 1/11.1, 1/11.2, 1/11.3, 1/11.4, 1/11.5, 1/11.6, 1/11.7, 1/11.8, 1/11.9, or 1/12.
Still more preferred mosaicisms are:
1/7, 1/7.1, 1/7.2, 1/7.3, 1/7.4, 1/7.5, 1/7.6, 1/7.7, 1/7.8, 1/7.9, 1/8, 1/8.1, 1/8.2, 1/8.3, 1/8.4, 1/8.5, 1/8.6, 1/8.7, 1/8.8, 1/8.9, 1/9, 1/9.1, 1/9.2, 1/9.3, 1/9.4, 1/9.5, 1/9.6, 1/9.7, 1/9.8, 1/9.9, 1/10, 1/10.1, 1/10.2, 1/10.3, 1/10.4, 1/10.5, 1/10.6, 1/10.7, 1/10.8, 1/10.9, or 1/11.
Preferred ranges of mosaicisms are 1/4 to 1/13; 1/5 to 1/12; 1/6 to 1/11, 1/7 to 1/10.5. or 1/7.5 to 1/10.
(6) Preferred molar ratios of AAV-FM to SCM-RM are as follows: 1:20, 1:25, 1:30, 1:35, 1:40, 1:45, 1:50, 1:55, 1:60, 1:65, 1:70, 1:75, 1:80, 1:85, 1:90, 1:95, 1:100, 1:105, 1:110, 1:115, 1:120, 1:125, 1:130, 1:135, 1:140, 1:145, 1:150, 1:155, 1:160, 1:165, 1:170, 1:175, 1:180, 1:185, 1:190, 1:195, 1:200, 1:205, 1:210, 1:215, 1:220, 1:225, 1:230, 1:235, 1:240, 1:245, 1:250, 1:255, 1:260, 1:265, 1:270, 1:275, 1:280, 1:285, 1:290, 1:295, 1:300, 1:305, 1:310, 1:315, 1:320, 1:325, 1:330, 1:335, 1:340, 1:345, 1:350, 1:355, 1:360, 1:365, 1:370, 1:375, 1:380, 1:385, 1:390, 1:395, 1:400, 1:405, 1:410, 1:415, 1:420, 1:425, 1:430, 1:435, 1:440, 1:445, 1:450, 1:455, 1:460, 1:465, 1:470, 1:475, 1:480, 1:485, 1:490, 1:495, 1:500, 1:505, 1:510, 1:515, 1:520, 1:525, 1:530, 1:535, 1:540, 1:545, 1:550, 1:555, 1:560, 1:565, 1:570, 1:575, 1:580, 1:585, 1:590, 1:595, 1:600, 1:605, 1:610, 1:615, 1:620, 1:625, 1:630, 1:635, 1:640, 1:645, 1:650, 1:655, 1:660, 1:665, 1:670, 1:675, 1:680, 1:685, 1:690, 1:695, 1:700, 1:705, 1:710, 1:715, 1:720, 1:725, 1:730, 1:735, 1:740, 1:745, 1:750, 1:755, 1:760, 1:765, 1:770, 1:775, 1:780, 1:785, 1:790, 1:795, 1:800, 1:805, 1:810, 1:815, 1:820, 1:825, 1:830, 1:835, 1:840, 1:845, 1:850, 1:855, 1:860, 1:865, 1:870, 1:875, 1:880, 1:885, 1:890, 1:895, 1:900, 1:905, 1:910, 1:915, 1:920, 1:925, 1:930, 1:935, 1:940, 1:945, 1:950, 1:955, 1:960, 1:965, 1:970, 1:975, 1:980, 1:985, 1:990, 1:995, 1:1000, 1:>1000 or any ratio thereabout or therebetween.
More preferred ratios AAV-FM to SCM-RM are: 1:30, 1:35, 1:40, 1:45, 1:50, 1:55, 1:60, 1:65, 1:70, 1:75, 1:80, 1:85, 1:90, 1:95, 1:100, 1:105, 1:110, 1:115, 1:120, 1:125, 1:130, 1:135, 1:140, 1:145, 1:150, 1:155, 1:160, 1:165, 1:170, 1:175, 1:180, 1:185, 1:190, 1:195, 1:200, 1:205, 1:210, 1:215, 1:220, 1:225, 1:230, 1:235, 1:240, 1:245, 1:250, 1:255, 1:260, 1:265, 1:270, 1:275, 1:280, 1:285, 1:290, 1:295, 1:300 or any ratio thereabout or therebetween.
Preferred ranges of AAV-FM to SCM-RM are 1:20 to 1:1000, and more preferred ranges are: 1:30 to 1:100, 1:40 to 1:100, 1:50 to 1:100 1:60 to 1:100, 1:70 to 1:100, 1:80 to 1:100, 1:90:1:100, 1:30 to 1:150, 1:40 to 1:150, 1:50 to 1:150 1:60 to 1:150, 1:70 to 1:150, 1:80 to 1:150, 1:90 to :150, 1:100 to 1:150, 1:30 to 1:200, 1:40 to 1:200, 1:50 to 1:200 1:60 to 1:200, 1:70 to 1:200, 1:80 to 1:200, 1:90:1:200, 1:100 to 1:200, 1:30 to 1:250, 1:40 to 1:250, 1:50 to 1:250 1:60 to 1:250, 1:70 to 1:250, 1:80 to 1:250, 1:90 to :250, 1:100 to 1:250, 1:30 to 1:300, 1:40 to 1:300, 1:50 to 1:300 1:60 to 1:300, 1:70 to 1:300, 1:80 to 1:300, 1:90:1:300, or 1:100 to 1:300.
(7) The inventions provide for a desired conjugation of a level of conjugation of at least 10%, at least 20%, at least 30%, and at least 40%. Preferred levels are at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or up to 100%, any of which can be considered complete depending on the purpose. More preferably, the desired level of conjugation typically will be about 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%.
Ranges of desired conjugation levels can be 10% to 100%, 20% to 99%, 30% to 99%, 40% to 99%, 50% to 99%, 60% to 99%, 70% to 99%, 80% to 99%, or 90% to 99%. Preferred ranges of desired conjugation levels can be 40% to 100%, 40% to 99%, 45% to 95%, 50% to 95%, 55% to 90%, 60% to 90%, 65% to 95%, 65% to 85%, 65% to 90%, 70% to 90%, 75% to 90%, 75% to 85%, 75% to 80%, or 80% to 85%. More preferably, the range is 65% to 95%.
The second chart below cites to exemplary modifications to the above chart based upon the descriptions and sequence examples contained herein. Points 1-7 above also apply to the second chart below:
Covalently surface modified AAV rhp0 can be made by transfecting a cell with plasmids as set forth below, followed by culturing the transfected cells and harvesting the resulting AAV, and then conjugating the resulting AAV with a second cognate member (SCM) that is fused to a retargeting molecule The first chart below uses SpyTag as the first member of a specific binding pair, and Adenovirus Helper Genes. Modifications can be undertaken as disclosed below:
(1) Plasmid pGOI can comprise one or more genes that are desired to be expressed in covalently surface modified AAV rh10.
(2) Plasmids pRC-FM can be modified for other specific binding pairs. The first member (FM) should be complementary to a second cognate member (SCM) that is fused to a retargeting molecule (for example, an antibody, as well derivatives and fragments thereof, and still other molecules). See Definitions and Description sections of the Detailed Description, the Figures and associated text for “retargeting” and “retargeting molecules”. The populations of FMs and SCMs can be homogenous or heterogeneous as long as the selected FMs can come in contact with appropriate SCMs so that binding can occur.
(3) Detargeting mutations are optional and can be undertaken as disclosed herein and in publications. See Definitions and Description sections of the Detailed Description, the Figures and associated text for “detargeting” and “detargeting mutations”.
(4) To lessen the possibility of encountering neutralizing antibodies when the covalently surface modified AAV is administered to a subject, KTag can be used as an SCM to bind with SpyTag (FM) (SEQ ID NOS: 54 and 86). KTag and SpyLigase are based upon SpyCatcher. KTag (SEQ ID NO: 85) has only 10 amino acids, which renders it less immunogenic. KTag can be bound to SpyTag in the presence of SpyLigase (SEQ ID NO: 61). The SpyLigase can be removed by subsequent purification, such as by chromatography and/or filtration so that the SpyLigase will not have an appreciable presence in the final drug substance.
(5) Preferred mosaicisms are as follows: 1/1, 1/1.1, 1/1.2, 1/1.3, 1/1.4, 1/1.5, 1/1.6, 1/1.7, 1/1.8, 1/1.9, 1/2, 1/2.1, 1/2.2, 1/2.3, 1/2.4, 1/2.5, 1/2.6, 1/2.7, 1/2.8, 1/2.9, 1/3, 1/3.1, 1/3.2, 1/3.3, 1/3.4, 1/3.5, 1/3.6, 1/3.7, 1/3.8, 1/3.9, 1/4, 1/4.1, 1/4.2, 1/4.3, 1/4.4, 1/4.5, 1/4.6, 1/4.7, 1/4.8, 1/4.9, 1/5, 1/5.1, 1/5.2, 1/5.3, 1/5.4, 1/5.5, 1/5.6, 1/5.7, 1/5.8, 1/5.9, 1/6, 1/6.1, 1/6.2, 1/6.3, 1/6.4, 1/6.5, 1/6.6, 1/6.7, 1/6.8, 1/6.9, 1/7, 1/7.1, 1/7.2, 1/7.3, 1/7.4, 1/7.5, 1/7.6, 1/7.7, 1/7.8, 1/7.9, 1/8, 1/8.1, 1/8.2, 1/8.3, 1/8.4, 1/8.5, 1/8.6, 1/8.7, 1/8.8, 1/8.9, 1/9, 1/9.1, 1/9.2, 1/9.3, 1/9.4, 1/9.5, 1/9.6, 1/9.7, 1/9.8, 1/9.9, 1/10, 1/10.1, 1/10.2, 1/10.3, 1/10.4, 1/10.5, 1/10.6, 1/10.7, 1/10.8, 1/10.9, 1/11, 1/11.1, 1/11.2, 1/11.3, 1/11.4, 1/11.5, 1/11.6, 1/11.7, 1/11.8, 1/11.9, 1/12, 1/12.1, 1/12.2, 1/12.3, 1/12.4, 1/12.5, 1/12.6, 1/12.7, 1/12.8, 1/12.9, 1/13, 1/13.1, 1/13.2, 1/13.3, 1/13.4, 1/13.5, 1/13.6, 1/13.7, 1/13.8, 1/13.9, 1/14, 1/14.1, 1/14.2, 1/14.3, 1/14.4, 1/14.5, 1/14.6, 1/14.7, 1/14.8, 1/14.9, 1/15, 1/15.1, 1/15.2, 1/15.3, 1/15.4, 1/15.5, 1/15.6, 1/15.7, 1/15.8, 1/15.9, 1/16, 1/16.1, 1/16.2, 1/16.3, 1/16.4, 1/16.5, 1/16.6, 1/16.7, 1/16.8, 1/16.9, 1/17, 1/17.1, 1/17.2, 1/17.3, 1/17.4, 1/17.5, 1/17.6, 1/17.7, 1/17.8, 1/17.9, 1/18, 1/18.1, 1/18.2, 1/18.3, 1/18.4, 1/18.5, 1/18.6, 1/18.7, 1/18.8, 1/18.9, 1/19, 11/9.1, 1/19.2, 1/19.3, 1/19.4, 1/91.5, 1/19.6, 1/19.7, 1/19.8, 1/19.9, 1/20, 1/21, 1/21.1, 1/21.2, 1/21.3, 1/21.4, 1/21.5, 1/21.6, 1/21.7, 1/21.8, 1/21.9, 1/22, 1/22.1, 1/22.2, 1/22.3, 1/22.4, 1/22.5, 1/22.6, 1/22.7, 1/22.8, 1/22.9, 1/23, 1/23.1, 1/23.2, 1/23.3, 1/23.4, 1/23.5, 1/23.6, 1/23.7, 1/23.8, 1/23.9, 1/24, 1/24.1, 1/24.2, 1/24.3, 1/24.4, 1/24.5, 1/24.6, 1/24.7, 1/24.8, 1/24.9, 1/25, 1/25.1, 1/25.2, 1/25.3, 1/25.4, 1/25.5, 1/25.6, 1/25.7, 1/25.8, 1/25.9, 1/26, 1/26.1, 1/26.2, 1/26.3, 1/26.4, 1/26.5, 1/26.6, 1/26.7, 1/26.8, 12/6.9, 1/27, 1/27.1, 1/27.2, 1/27.3, 1/27.4, 1/27.5, 1/27.6, 1/27.7, 1/27.8, 1/27.9, 1/28, 1/28.1, 1/28.2, 1/28.3, 1/28.4, 1/28.5, 1/28.6, 1/28.7, 1/28.8, 1/28.9, 1/29, 1/29.1, 1/29.2, 1/29.3, 1/29.4, 1/29.5, 1/29.6, 1/29.7, 1/29.8, 1/29.9, 1/30, 1/30.1, 1/30.2, 1/30.3, 1/30.4, 1/30.5, 1/30.6, 1/30.7, 1/30.8, 1/30.9, 1/31, 1/31.1, 1/31.2, 1/31.3, 1/31.4, 1/31.5, 1/31.6, 1/31.7, 1/31.8, 1/31.9, 1/32, 1/32.1, 1/32.2, 1/32.3, 1/32.4, 1/32.5, 1/32.6, 1/32.7, 1/32.8, 1/32.9, 1/33, 1/33.1, 1/33.2, 1/33.3, 1/33.4, 1/33.5, 1/33.6, 1/33.7, 1/33.8, 1/33.9, 1/34, 1/34.1, 1/34.2, 1/34.3, 1/34.4, 1/34.5, 1/34.6, 1/34.7, 1/34.8, 1/34.9, 1/35, 1/35.1, 1/35.2, 1/35.3, 1/35.4, 1/35.5, 1/35.6, 1/35.7, 1/35.8, 1/35.9, 1/36, 1/36.1, 1/36.2, 1/36.3, 1/36.4, 1/36.5, 1/36.6, 1/36.7, 1/36.8, 1/36.9, 1/37, 1/37.1, 1/37.2, 1/37.3, 1/37.4, 1/37.5, 1/37.6, 1/37.7, 1/37.8, 1/37.9, 1/38, 1/38.1, 1/38.2, 1/38.3, 1/38.4, 1/38.5, 1/38.6, 1/38.7, 1/38.8, 1/38.9, 1/39, 1/39.1, 1/39.2, 1/39.3, 1/39.4, 1/39.5, 1/39.6, 1/39.7, 1/39.8, 1/39.9, 1/40, 1/40.1, 1/40.2, 1/40.3, 1/40.4, 1/40.5, 1/40.6, 1/40.7, 1/40.8, 1/40.9, 1/41, 1/41.1, 1/41.2, 1/41.3, 1/41.4, 1/41.5, 1/41.6, 1/41.7, 1/41.8, 1/41.9, 1/42, 1/42.1, 1/42.2, 1/42.3, 1/42.4, 1/42.5, 1/42.6, 1/42.7, 1/42.8, 1/42.9, 1/43, 1/43.1, 1/43.2, 1/43.3, 1/43.4, 1/43.5, 1/43.6, 1/43.7, 1/43.8, 1/43.9, 1/44, 1/44.1, 1/44.2, 1/44.3, 1/44.4, 1/44.5, 1/44.6, 1/44.7, 1/44.8, 1/44.9, 1/45, 1/45.1, 1/45.2, 1/45.3, 1/45.4, 1/45.5, 1/45.6, 1/45.7, 1/45.8, 1/45.9, 1/46, 1/46.1, 1/46.2, 1/46.3, 1/46.4, 1/46.5, 1/46.6, 1/46.7, 1/46.8, 1/46.9, 1/47, 1/47.1, 1/47.2, 1/47.3, 1/47.4, 1/47.5, 1/47.6, 1/47.7, 1/47.8, 1/47.9, 1/48, 1/48.1, 1/48.2, 1/48.3, 1/48.4, 1/48.5, 1/48.6, 1/48.7, 1/48.8, 1/48.9, 1/49, 1/49.1, 1/49.2, 1/49.3, 1/49.4, 1/49.5, 1/49.6, 1/49.7, 1/49.8, 1/49.9, 1/50, 1/50.1, 1/50.2, 1/50.3, 1/50.4, 1/50.5, 1/50.6, 1/50.7, 1/50.8, 1/50.9, 1/51, 1/51.1, 1/51.2, 1/51.3, 1/51.4, 1/51.5, 1/51.6, 1/51.7, 1/51.8, 1/51.9, 1/52, 1/52.1, 1/52.2, 1/52.3, 1/52.4, 1/52.5, 1/52.6, 1/52.7, 1/52.8, 1/52.9, 1/53, 1/53.1, 1/53.2, 1/53.3, 1/53.4, 1/53.5, 1/53.6, 1/53.7, 1/53.8, 1/53.9, 1/54, 1/54.1, 1/54.2, 1/54.3, 1/54.4, 1/54.5, 1/54.6, 1/54.7, 1/54.8, 1/54.9, 1/55, 1/55.1, 1/55.2, 1/55.3, 1/55.4, 1/55.5, 1/55.6, 1/55.7, 1/55.8, 1/55.9, 1/56, 1/56.1, 1/56.2, 1/56.3, 1/56.4, 1/56.5, 1/56.6, 1/56.7, 1/56.8, 1/56.9, 1/57, 1/57.1, 1/57.2, 1/57.3, 1/57.4, 1/57.5, 1/57.6, 1/57.7, 1/57.8, 1/57.9, 1/58, 1/58.1, 1/58.2, 1/58.3, 1/58.4, 1/58.5, 1/58.6, 1/58.7, 1/58.8, 1/58.9, 1/59, 1/59.1, 1/59.2, 1/59.3, 1/59.4, 1/59.5, 1/59.6, 1/59.7, 1/59.8, 1/59.9, 1/60 or ratios thereabout or therebetween. Ranges of ratios of 1/1 to 1/60 can be employed, and subranges as set forth below.
More preferred mosaicisms are:
1/4, 1/4.1, 1/4.2, 1/4.3, 1/4.4, 1/4.5, 1/4.6, 1/4.7, 1/4.8, 1/4.9, 1/5, 1/5.1, 1/5.2, 1/5.3, 1/5.4, 1/5.5, 1/5.6, 1/5.7, 1/5.8, 1/5.9, 1/6, 1/6.1, 1/6.2, 1/6.3, 1/6.4, 1/6.5, 1/6.6, 1/6.7, 1/6.8, 1/6.9, 1/7, 1/7.1, 1/7.2, 1/7.3, 1/7.4, 1/7.5, 1/7.6, 1/7.7, 1/7.8, 1/7.9, 1/8, 1/8.1, 1/8.2, 1/8.3, 1/8.4, 1/8.5, 1/8.6, 1/8.7, 1/8.8, 1/8.9, 1/9, 1/9.1, 1/9.2, 1/9.3, 1/9.4, 1/9.5, 1/9.6, 1/9.7, 1/9.8, 1/9.9, 1/10, 1/10.1, 1/10.2, 1/10.3, 1/10.4, 1/10.5, 1/10.6, 1/10.7, 1/10.8, 1/10.9, 1/11, 1/11.1, 1/11.2, 1/11.3, 1/11.4, 1/11.5, 1/11.6, 1/11.7, 1/11.8, 1/11.9, 1/12, 1/12.1, 1/12.2, 1/12.3, 1/12.4, 1/12.5, 1/12.6, 1/12.7, 1/12.8, 1/12.9 or 1/13.
Further preferred mosaicisms are:
1/5, 1/5.1, 1/5.2, 1/5.3, 1/5.4, 1/5.5, 1/5.6, 1/5.7, 1/5.8, 1/5.9, 1/6, 1/6.1, 1/6.2, 1/6.3, 1/6.4, 1/6.5, 1/6.6, 1/6.7, 1/6.8, 1/6.9, 1/7, 1/7.1, 1/7.2, 1/7.3, 1/7.4, 1/7.5, 1/7.6, 1/7.7, 1/7.8, 1/7.9, 1/8, 1/8.1, 1/8.2, 1/8.3, 1/8.4, 1/8.5, 1/8.6, 1/8.7, 1/8.8, 1/8.9, 1/9, 1/9.1, 1/9.2, 1/9.3, 1/9.4, 1/9.5, 1/9.6, 1/9.7, 1/9.8, 1/9.9, 1/10, 1/10.1, 1/10.2, 1/10.3, 1/10.4, 1/10.5, 1/10.6, 1/10.7, 1/10.8, 1/10.9, 1/11, 1/11.1, 1/11.2, 1/11.3, 1/11.4, 1/11.5, 1/11.6, 1/11.7, 1/11.8, 1/11.9, or 1/12.
Still more preferred mosaicisms are:
1/7, 1/7.1, 1/7.2, 1/7.3, 1/7.4, 1/7.5, 1/7.6, 1/7.7, 1/7.8, 1/7.9, 1/8, 1/8.1, 1/8.2, 1/8.3, 1/8.4, 1/8.5, 1/8.6, 1/8.7, 1/8.8, 1/8.9, 1/9, 1/9.1, 1/9.2, 1/9.3, 1/9.4, 1/9.5, 1/9.6, 1/9.7, 1/9.8, 1/9.9, 1/10, 1/10.1, 1/10.2, 1/10.3, 1/10.4, 1/10.5, 1/10.6, 1/10.7, 1/10.8, 1/10.9, or 1/11.
Preferred ranges of mosaicisms are 1/4 to 1/13; 1/5 to 1/12; 1/6 to 1/11, 1/7 to 1/10.5. or 1/7.5 to 1/10.
(6) Preferred molar ratios of AAV-FM to SCM-RM are as follows: 1:20, 1:25, 1:30, 1:35, 1:40, 1:45, 1:50, 1:55, 1:60, 1:65, 1:70, 1:75, 1:80, 1:85, 1:90, 1:95, 1:100, 1:105, 1:110, 1:115, 1:120, 1:125, 1:130, 1:135, 1:140, 1:145, 1:150, 1:155, 1:160, 1:165, 1:170, 1:175, 1:180, 1:185, 1:190, 1:195, 1:200, 1:205, 1:210, 1:215, 1:220, 1:225, 1:230, 1:235, 1:240, 1:245, 1:250, 1:255, 1:260, 1:265, 1:270, 1:275, 1:280, 1:285, 1:290, 1:295, 1:300, 1:305, 1:310, 1:315, 1:320, 1:325, 1:330, 1:335, 1:340, 1:345, 1:350, 1:355, 1:360, 1:365, 1:370, 1:375, 1:380, 1:385, 1:390, 1:395, 1:400, 1:405, 1:410, 1:415, 1:420, 1:425, 1:430, 1:435, 1:440, 1:445, 1:450, 1:455, 1:460, 1:465, 1:470, 1:475, 1:480, 1:485, 1:490, 1:495, 1:500, 1:505, 1:510, 1:515, 1:520, 1:525, 1:530, 1:535, 1:540, 1:545, 1:550, 1:555, 1:560, 1:565, 1:570, 1:575, 1:580, 1:585, 1:590, 1:595, 1:600, 1:605, 1:610, 1:615, 1:620, 1:625, 1:630, 1:635, 1:640, 1:645, 1:650, 1:655, 1:660, 1:665, 1:670, 1:675, 1:680, 1:685, 1:690, 1:695, 1:700, 1:705, 1:710, 1:715, 1:720, 1:725, 1:730, 1:735, 1:740, 1:745, 1:750, 1:755, 1:760, 1:765, 1:770, 1:775, 1:780, 1:785, 1:790, 1:795, 1:800, 1:805, 1:810, 1:815, 1:820, 1:825, 1:830, 1:835, 1:840, 1:845, 1:850, 1:855, 1:860, 1:865, 1:870, 1:875, 1:880, 1:885, 1:890, 1:895, 1:900, 1:905, 1:910, 1:915, 1:920, 1:925, 1:930, 1:935, 1:940, 1:945, 1:950, 1:955, 1:960, 1:965, 1:970, 1:975, 1:980, 1:985, 1:990, 1:995, 1:1000, 1:>1000 or any ratio thereabout or therebetween.
More preferred ratios AAV-FM to SCM-RM are: 1:30, 1:35, 1:40, 1:45, 1:50, 1:55, 1:60, 1:65, 1:70, 1:75, 1:80, 1:85, 1:90, 1:95, 1:100, 1:105, 1:110, 1:115, 1:120, 1:125, 1:130, 1:135, 1:140, 1:145, 1:150, 1:155, 1:160, 1:165, 1:170, 1:175, 1:180, 1:185, 1:190, 1:195, 1:200, 1:205, 1:210, 1:215, 1:220, 1:225, 1:230, 1:235, 1:240, 1:245, 1:250, 1:255, 1:260, 1:265, 1:270, 1:275, 1:280, 1:285, 1:290, 1:295, 1:300 or any ratio thereabout or therebetween.
Preferred ranges of AAV-FM to SCM-RM are 1:20 to 1:1000, and more preferred ranges are: 1:30 to 1:100, 1:40 to 1:100, 1:50 to 1:100 1:60 to 1:100, 1:70 to 1:100, 1:80 to 1:100, 1:90:1:100, 1:30 to 1:150, 1:40 to 1:150, 1:50 to 1:150 1:60 to 1:150, 1:70 to 1:150, 1:80 to 1:150, 1:90 to :150, 1:100 to 1:150, 1:30 to 1:200, 1:40 to 1:200, 1:50 to 1:200 1:60 to 1:200, 1:70 to 1:200, 1:80 to 1:200, 1:90:1:200, 1:100 to 1:200, 1:30 to 1:250, 1:40 to 1:250, 1:50 to 1:250 1:60 to 1:250, 1:70 to 1:250, 1:80 to 1:250, 1:90 to :250, 1:100 to 1:250, 1:30 to 1:300, 1:40 to 1:300, 1:50 to 1:300 1:60 to 1:300, 1:70 to 1:300, 1:80 to 1:300, 1:90:1:300, or 1:100 to 1:300.
(7) The inventions provide for a desired conjugation of a level of conjugation of at least 10%, at least 20%, at least 30%, and at least 40%. Preferred levels are at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or up to 100%, any of which can be considered complete depending on the purpose. More preferably, the desired level of conjugation typically will be about 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%.
Ranges of desired conjugation levels can be 10% to 100%, 20% to 99%, 30% to 99%, 40% to 99%, 50% to 99%, 60% to 99%, 70% to 99%, 80% to 99%, or 90% to 99%. Preferred ranges of desired conjugation levels can be 40% to 100%, 40% to 99%, 45% to 95%, 50% to 95%, 55% to 90%, 60% to 90%, 65% to 95%, 65% to 85%, 65% to 90%, 70% to 90%, 75% to 90%, 75% to 85%, 75% to 80%, or 80% to 85%. More preferably, the range is 65% to 95%.
The second chart below cites to exemplary modifications to the above chart based upon the descriptions and sequence examples contained herein. Points 1-7 above also apply to the second chart below:
Covalently surface modified AAV rh39 can be made by transfecting a cell with plasmids as set forth below, followed by culturing the transfected cells and harvesting the resulting AAV, and then conjugating the resulting AAV with a second cognate member (SCM) that is fused to a retargeting molecule The first chart below uses SpyTag as the first member of a specific binding pair, and Adenovirus Helper Genes. Modifications can be undertaken as disclosed below:
(1) Plasmid pGOI can comprise one or more genes that are desired to be expressed in covalently surface modified AAV rh39.
(2) Plasmids pRC-FM can be modified for other specific binding pairs. The first member (FM) should be complementary to a second cognate member (SCM) that is fused to a retargeting molecule (for example, an antibody, as well derivatives and fragments thereof, and still other molecules). See Definitions and Description sections of the Detailed Description, the Figures and associated text for “retargeting” and “retargeting molecules”. The populations of FMs and SCMs can be homogenous or heterogeneous as long as the selected FMs can come in contact with appropriate SCMs so that binding can occur.
(3) Detargeting mutations are optional and can be undertaken as disclosed herein and in publications. See Definitions and Description sections of the Detailed Description, the Figures and associated text for “detargeting” and “detargeting mutations”.
(4) To lessen the possibility of encountering neutralizing antibodies when the covalently surface modified AAV is administered to a subject, KTag can be used as an SCM to bind with SpyTag (FM) (SEQ ID NOS: 54 and 86). KTag and SpyLigase are based upon SpyCatcher. KTag (SEQ ID NO: 85) has only 10 amino acids, which renders it less immunogenic. KTag can be bound to SpyTag in the presence of SpyLigase (SEQ ID NO: 61). The SpyLigase can be removed by subsequent purification, such as by chromatography and/or filtration so that the SpyLigase will not have an appreciable presence in the final drug substance.
(5) Preferred mosaicisms are as follows: 1/1, 1/1.1, 1/1.2, 1/1.3, 1/1.4, 1/1.5, 1/1.6, 1/1.7, 1/1.8, 1/1.9, 1/2, 1/2.1, 1/2.2, 1/2.3, 1/2.4, 1/2.5, 1/2.6, 1/2.7, 1/2.8, 1/2.9, 1/3, 1/3.1, 1/3.2, 1/3.3, 1/3.4, 1/3.5, 1/3.6, 1/3.7, 1/3.8, 1/3.9, 1/4, 1/4.1, 1/4.2, 1/4.3, 1/4.4, 1/4.5, 1/4.6, 1/4.7, 1/4.8, 1/4.9, 1/5, 1/5.1, 1/5.2, 1/5.3, 1/5.4, 1/5.5, 1/5.6, 1/5.7, 1/5.8, 1/5.9, 1/6, 1/6.1, 1/6.2, 1/6.3, 1/6.4, 1/6.5, 1/6.6, 1/6.7, 1/6.8, 1/6.9, 1/7, 1/7.1, 1/7.2, 1/7.3, 1/7.4, 1/7.5, 1/7.6, 1/7.7, 1/7.8, 1/7.9, 1/8, 1/8.1, 1/8.2, 1/8.3, 1/8.4, 1/8.5, 1/8.6, 1/8.7, 1/8.8, 1/8.9, 1/9, 1/9.1, 1/9.2, 1/9.3, 1/9.4, 1/9.5, 1/9.6, 1/9.7, 1/9.8, 1/9.9, 1/10, 1/10.1, 1/10.2, 1/10.3, 1/10.4, 1/10.5, 1/10.6, 1/10.7, 1/10.8, 1/10.9, 1/11, 1/11.1, 1/11.2, 1/11.3, 1/11.4, 1/11.5, 1/11.6, 1/11.7, 1/11.8, 1/11.9, 1/12, 1/12.1, 1/12.2, 1/12.3, 1/12.4, 1/12.5, 1/12.6, 1/12.7, 1/12.8, 1/12.9, 1/13, 1/13.1, 1/13.2, 1/13.3, 1/13.4, 1/13.5, 1/13.6, 1/13.7, 1/13.8, 1/13.9, 1/14, 1/14.1, 1/14.2, 1/14.3, 1/14.4, 1/14.5, 1/14.6, 1/14.7, 1/14.8, 1/14.9, 1/15, 1/15.1, 1/15.2, 1/15.3, 1/15.4, 1/15.5, 1/15.6, 1/15.7, 1/15.8, 1/15.9, 1/16, 1/16.1, 1/16.2, 1/16.3, 1/16.4, 1/16.5, 1/16.6, 1/16.7, 1/16.8, 1/16.9, 1/17, 1/17.1, 1/17.2, 1/17.3, 1/17.4, 1/17.5, 1/17.6, 1/17.7, 1/17.8, 1/17.9, 1/18, 1/18.1, 1/18.2, 1/18.3, 1/18.4, 1/18.5, 1/18.6, 1/18.7, 1/18.8, 1/18.9, 1/19, 11/9.1, 1/19.2, 1/19.3, 1/19.4, 1/91.5, 1/19.6, 1/19.7, 1/19.8, 1/19.9, 1/20, 1/21, 1/21.1, 1/21.2, 1/21.3, 1/21.4, 1/21.5, 1/21.6, 1/21.7, 1/21.8, 1/21.9, 1/22, 1/22.1, 1/22.2, 1/22.3, 1/22.4, 1/22.5, 1/22.6, 1/22.7, 1/22.8, 1/22.9, 1/23, 1/23.1, 1/23.2, 1/23.3, 1/23.4, 1/23.5, 1/23.6, 1/23.7, 1/23.8, 1/23.9, 1/24, 1/24.1, 1/24.2, 1/24.3, 1/24.4, 1/24.5, 1/24.6, 1/24.7, 1/24.8, 1/24.9, 1/25, 1/25.1, 1/25.2, 1/25.3, 1/25.4, 1/25.5, 1/25.6, 1/25.7, 1/25.8, 1/25.9, 1/26, 1/26.1, 1/26.2, 1/26.3, 1/26.4, 1/26.5, 1/26.6, 1/26.7, 1/26.8, 12/6.9, 1/27, 1/27.1, 1/27.2, 1/27.3, 1/27.4, 1/27.5, 1/27.6, 1/27.7, 1/27.8, 1/27.9, 1/28, 1/28.1, 1/28.2, 1/28.3, 1/28.4, 1/28.5, 1/28.6, 1/28.7, 1/28.8, 1/28.9, 1/29, 1/29.1, 1/29.2, 1/29.3, 1/29.4, 1/29.5, 1/29.6, 1/29.7, 1/29.8, 1/29.9, 1/30, 1/30.1, 1/30.2, 1/30.3, 1/30.4, 1/30.5, 1/30.6, 1/30.7, 1/30.8, 1/30.9, 1/31, 1/31.1, 1/31.2, 1/31.3, 1/31.4, 1/31.5, 1/31.6, 1/31.7, 1/31.8, 1/31.9, 1/32, 1/32.1, 1/32.2, 1/32.3, 1/32.4, 1/32.5, 1/32.6, 1/32.7, 1/32.8, 1/32.9, 1/33, 1/33.1, 1/33.2, 1/33.3, 1/33.4, 1/33.5, 1/33.6, 1/33.7, 1/33.8, 1/33.9, 1/34, 1/34.1, 1/34.2, 1/34.3, 1/34.4, 1/34.5, 1/34.6, 1/34.7, 1/34.8, 1/34.9, 1/35, 1/35.1, 1/35.2, 1/35.3, 1/35.4, 1/35.5, 1/35.6, 1/35.7, 1/35.8, 1/35.9, 1/36, 1/36.1, 1/36.2, 1/36.3, 1/36.4, 1/36.5, 1/36.6, 1/36.7, 1/36.8, 1/36.9, 1/37, 1/37.1, 1/37.2, 1/37.3, 1/37.4, 1/37.5, 1/37.6, 1/37.7, 1/37.8, 1/37.9, 1/38, 1/38.1, 1/38.2, 1/38.3, 1/38.4, 1/38.5, 1/38.6, 1/38.7, 1/38.8, 1/38.9, 1/39, 1/39.1, 1/39.2, 1/39.3, 1/39.4, 1/39.5, 1/39.6, 1/39.7, 1/39.8, 1/39.9, 1/40, 1/40.1, 1/40.2, 1/40.3, 1/40.4, 1/40.5, 1/40.6, 1/40.7, 1/40.8, 1/40.9, 1/41, 1/41.1, 1/41.2, 1/41.3, 1/41.4, 1/41.5, 1/41.6, 1/41.7, 1/41.8, 1/41.9, 1/42, 1/42.1, 1/42.2, 1/42.3, 1/42.4, 1/42.5, 1/42.6, 1/42.7, 1/42.8, 1/42.9, 1/43, 1/43.1, 1/43.2, 1/43.3, 1/43.4, 1/43.5, 1/43.6, 1/43.7, 1/43.8, 1/43.9, 1/44, 1/44.1, 1/44.2, 1/44.3, 1/44.4, 1/44.5, 1/44.6, 1/44.7, 1/44.8, 1/44.9, 1/45, 1/45.1, 1/45.2, 1/45.3, 1/45.4, 1/45.5, 1/45.6, 1/45.7, 1/45.8, 1/45.9, 1/46, 1/46.1, 1/46.2, 1/46.3, 1/46.4, 1/46.5, 1/46.6, 1/46.7, 1/46.8, 1/46.9, 1/47, 1/47.1, 1/47.2, 1/47.3, 1/47.4, 1/47.5, 1/47.6, 1/47.7, 1/47.8, 1/47.9, 1/48, 1/48.1, 1/48.2, 1/48.3, 1/48.4, 1/48.5, 1/48.6, 1/48.7, 1/48.8, 1/48.9, 1/49, 1/49.1, 1/49.2, 1/49.3, 1/49.4, 1/49.5, 1/49.6, 1/49.7, 1/49.8, 1/49.9, 1/50, 1/50.1, 1/50.2, 1/50.3, 1/50.4, 1/50.5, 1/50.6, 1/50.7, 1/50.8, 1/50.9, 1/51, 1/51.1, 1/51.2, 1/51.3, 1/51.4, 1/51.5, 1/51.6, 1/51.7, 1/51.8, 1/51.9, 1/52, 1/52.1, 1/52.2, 1/52.3, 1/52.4, 1/52.5, 1/52.6, 1/52.7, 1/52.8, 1/52.9, 1/53, 1/53.1, 1/53.2, 1/53.3, 1/53.4, 1/53.5, 1/53.6, 1/53.7, 1/53.8, 1/53.9, 1/54, 1/54.1, 1/54.2, 1/54.3, 1/54.4, 1/54.5, 1/54.6, 1/54.7, 1/54.8, 1/54.9, 1/55, 1/55.1, 1/55.2, 1/55.3, 1/55.4, 1/55.5, 1/55.6, 1/55.7, 1/55.8, 1/55.9, 1/56, 1/56.1, 1/56.2, 1/56.3, 1/56.4, 1/56.5, 1/56.6, 1/56.7, 1/56.8, 1/56.9, 1/57, 1/57.1, 1/57.2, 1/57.3, 1/57.4, 1/57.5, 1/57.6, 1/57.7, 1/57.8, 1/57.9, 1/58, 1/58.1, 1/58.2, 1/58.3, 1/58.4, 1/58.5, 1/58.6, 1/58.7, 1/58.8, 1/58.9, 1/59, 1/59.1, 1/59.2, 1/59.3, 1/59.4, 1/59.5, 1/59.6, 1/59.7, 1/59.8, 1/59.9, 1/60 or ratios thereabout or therebetween. Ranges of ratios of 1/1 to 1/60 can be employed, and subranges as set forth below.
More preferred mosaicisms are:
1/4, 1/4.1, 1/4.2, 1/4.3, 1/4.4, 1/4.5, 1/4.6, 1/4.7, 1/4.8, 1/4.9, 1/5, 1/5.1, 1/5.2, 1/5.3, 1/5.4, 1/5.5, 1/5.6, 1/5.7, 1/5.8, 1/5.9, 1/6, 1/6.1, 1/6.2, 1/6.3, 1/6.4, 1/6.5, 1/6.6, 1/6.7, 1/6.8, 1/6.9, 1/7, 1/7.1, 1/7.2, 1/7.3, 1/7.4, 1/7.5, 1/7.6, 1/7.7, 1/7.8, 1/7.9, 1/8, 1/8.1, 1/8.2, 1/8.3, 1/8.4, 1/8.5, 1/8.6, 1/8.7, 1/8.8, 1/8.9, 1/9, 1/9.1, 1/9.2, 1/9.3, 1/9.4, 1/9.5, 1/9.6, 1/9.7, 1/9.8, 1/9.9, 1/10, 1/10.1, 1/10.2, 1/10.3, 1/10.4, 1/10.5, 1/10.6, 1/10.7, 1/10.8, 1/10.9, 1/11, 1/11.1, 1/11.2, 1/11.3, 1/11.4, 1/11.5, 1/11.6, 1/11.7, 1/11.8, 1/11.9, 1/12, 1/12.1, 1/12.2, 1/12.3, 1/12.4, 1/12.5, 1/12.6, 1/12.7, 1/12.8, 1/12.9 or 1/13.
Further preferred mosaicisms are:
1/5, 1/5.1, 1/5.2, 1/5.3, 1/5.4, 1/5.5, 1/5.6, 1/5.7, 1/5.8, 1/5.9, 1/6, 1/6.1, 1/6.2, 1/6.3, 1/6.4, 1/6.5, 1/6.6, 1/6.7, 1/6.8, 1/6.9, 1/7, 1/7.1, 1/7.2, 1/7.3, 1/7.4, 1/7.5, 1/7.6, 1/7.7, 1/7.8, 1/7.9, 1/8, 1/8.1, 1/8.2, 1/8.3, 1/8.4, 1/8.5, 1/8.6, 1/8.7, 1/8.8, 1/8.9, 1/9, 1/9.1, 1/9.2, 1/9.3, 1/9.4, 1/9.5, 1/9.6, 1/9.7, 1/9.8, 1/9.9, 1/10, 1/10.1, 1/10.2, 1/10.3, 1/10.4, 1/10.5, 1/10.6, 1/10.7, 1/10.8, 1/10.9, 1/11, 1/11.1, 1/11.2, 1/11.3, 1/11.4, 1/11.5, 1/11.6, 1/11.7, 1/11.8, 1/11.9, or 1/12.
Still more preferred mosaicisms are:
1/7, 1/7.1, 1/7.2, 1/7.3, 1/7.4, 1/7.5, 1/7.6, 1/7.7, 1/7.8, 1/7.9, 1/8, 1/8.1, 1/8.2, 1/8.3, 1/8.4, 1/8.5, 1/8.6, 1/8.7, 1/8.8, 1/8.9, 1/9, 1/9.1, 1/9.2, 1/9.3, 1/9.4, 1/9.5, 1/9.6, 1/9.7, 1/9.8, 1/9.9, 1/10, 1/10.1, 1/10.2, 1/10.3, 1/10.4, 1/10.5, 1/10.6, 1/10.7, 1/10.8, 1/10.9, or 1/11.
Preferred ranges of mosaicisms are 1/4 to 1/13; 1/5 to 1/12; 1/6 to 1/11, 1/7 to 1/10.5. or 1/7.5 to 1/10.
(6) Preferred molar ratios of AAV-FM to SCM-RM are as follows: 1:20, 1:25, 1:30, 1:35, 1:40, 1:45, 1:50, 1:55, 1:60, 1:65, 1:70, 1:75, 1:80, 1:85, 1:90, 1:95, 1:100, 1:105, 1:110, 1:115, 1:120, 1:125, 1:130, 1:135, 1:140, 1:145, 1:150, 1:155, 1:160, 1:165, 1:170, 1:175, 1:180, 1:185, 1:190, 1:195, 1:200, 1:205, 1:210, 1:215, 1:220, 1:225, 1:230, 1:235, 1:240, 1:245, 1:250, 1:255, 1:260, 1:265, 1:270, 1:275, 1:280, 1:285, 1:290, 1:295, 1:300, 1:305, 1:310, 1:315, 1:320, 1:325, 1:330, 1:335, 1:340, 1:345, 1:350, 1:355, 1:360, 1:365, 1:370, 1:375, 1:380, 1:385, 1:390, 1:395, 1:400, 1:405, 1:410, 1:415, 1:420, 1:425, 1:430, 1:435, 1:440, 1:445, 1:450, 1:455, 1:460, 1:465, 1:470, 1:475, 1:480, 1:485, 1:490, 1:495, 1:500, 1:505, 1:510, 1:515, 1:520, 1:525, 1:530, 1:535, 1:540, 1:545, 1:550, 1:555, 1:560, 1:565, 1:570, 1:575, 1:580, 1:585, 1:590, 1:595, 1:600, 1:605, 1:610, 1:615, 1:620, 1:625, 1:630, 1:635, 1:640, 1:645, 1:650, 1:655, 1:660, 1:665, 1:670, 1:675, 1:680, 1:685, 1:690, 1:695, 1:700, 1:705, 1:710, 1:715, 1:720, 1:725, 1:730, 1:735, 1:740, 1:745, 1:750, 1:755, 1:760, 1:765, 1:770, 1:775, 1:780, 1:785, 1:790, 1:795, 1:800, 1:805, 1:810, 1:815, 1:820, 1:825, 1:830, 1:835, 1:840, 1:845, 1:850, 1:855, 1:860, 1:865, 1:870, 1:875, 1:880, 1:885, 1:890, 1:895, 1:900, 1:905, 1:910, 1:915, 1:920, 1:925, 1:930, 1:935, 1:940, 1:945, 1:950, 1:955, 1:960, 1:965, 1:970, 1:975, 1:980, 1:985, 1:990, 1:995, 1:1000, 1:>1000 or any ratio thereabout or therebetween.
More preferred ratios AAV-FM to SCM-RM are: 1:30, 1:35, 1:40, 1:45, 1:50, 1:55, 1:60, 1:65, 1:70, 1:75, 1:80, 1:85, 1:90, 1:95, 1:100, 1:105, 1:110, 1:115, 1:120, 1:125, 1:130, 1:135, 1:140, 1:145, 1:150, 1:155, 1:160, 1:165, 1:170, 1:175, 1:180, 1:185, 1:190, 1:195, 1:200, 1:205, 1:210, 1:215, 1:220, 1:225, 1:230, 1:235, 1:240, 1:245, 1:250, 1:255, 1:260, 1:265, 1:270, 1:275, 1:280, 1:285, 1:290, 1:295, 1:300 or any ratio thereabout or therebetween.
Preferred ranges of AAV-FM to SCM-RM are 1:20 to 1:1000, and more preferred ranges are: 1:30 to 1:100, 1:40 to 1:100, 1:50 to 1:100 1:60 to 1:100, 1:70 to 1:100, 1:80 to 1:100, 1:90:1:100, 1:30 to 1:150, 1:40 to 1:150, 1:50 to 1:150 1:60 to 1:150, 1:70 to 1:150, 1:80 to 1:150, 1:90 to :150, 1:100 to 1:150, 1:30 to 1:200, 1:40 to 1:200, 1:50 to 1:200 1:60 to 1:200, 1:70 to 1:200, 1:80 to 1:200, 1:90:1:200, 1:100 to 1:200, 1:30 to 1:250, 1:40 to 1:250, 1:50 to 1:250 1:60 to 1:250, 1:70 to 1:250, 1:80 to 1:250, 1:90 to :250, 1:100 to 1:250, 1:30 to 1:300, 1:40 to 1:300, 1:50 to 1:300 1:60 to 1:300, 1:70 to 1:300, 1:80 to 1:300, 1:90:1:300, or 1:100 to 1:300.
(7) The inventions provide for a desired conjugation of a level of conjugation of at least 10%, at least 20%, at least 30%, and at least 40%. Preferred levels are at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or up to 100%, any of which can be considered complete depending on the purpose. More preferably, the desired level of conjugation typically will be about 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%.
Ranges of desired conjugation levels can be 10% to 100%, 20% to 99%, 30% to 99%, 40% to 99%, 50% to 99%, 60% to 99%, 70% to 99%, 80% to 99%, or 90% to 99%. Preferred ranges of desired conjugation levels can be 40% to 100%, 40% to 99%, 45% to 95%, 50% to 95%, 55% to 90%, 60% to 90%, 65% to 95%, 65% to 85%, 65% to 90%, 70% to 90%, 75% to 90%, 75% to 85%, 75% to 80%, or 80% to 85%. More preferably, the range is 65% to 95%.
The second chart below cites to exemplary modifications to the above chart based upon the descriptions and sequence examples contained herein. Points 1-7 above also apply to the second chart below:
Covalently surface modified AAV rh43 can be made by transfecting a cell with plasmids as set forth below, followed by culturing the transfected cells and harvesting the resulting AAV, and then conjugating the resulting AAV with a second cognate member (SCM) that is fused to a retargeting molecule The first chart below uses SpyTag as the first member of a specific binding pair, and Adenovirus Helper Genes. Modifications can be undertaken as disclosed below:
(1) Plasmid pGOI can comprise one or more genes that are desired to be expressed in covalently surface modified AAV rh43.
(2) Plasmids pRC-FM can be modified for other specific binding pairs. The first member (FM) should be complementary to a second cognate member (SCM) that is fused to a retargeting molecule (for example, an antibody, as well derivatives and fragments thereof, and still other molecules). See Definitions and Description sections of the Detailed Description, the Figures and associated text for “retargeting” and “retargeting molecules”. The populations of FMs and SCMs can be homogenous or heterogeneous as long as the selected FMs can come in contact with appropriate SCMs so that binding can occur.
(3) Detargeting mutations are optional and can be undertaken as disclosed herein and in publications. See Definitions and Description sections of the Detailed Description, the Figures and associated text for “detargeting” and “detargeting mutations”.
(4) To lessen the possibility of encountering neutralizing antibodies when the covalently surface modified AAV is administered to a subject, KTag can be used as an SCM to bind with SpyTag (FM) (SEQ ID NOS: 54 and 86). KTag and SpyLigase are based upon SpyCatcher. KTag (SEQ ID NO: 85) has only 10 amino acids, which renders it less immunogenic. KTag can be bound to SpyTag in the presence of SpyLigase (SEQ ID NO: 61). The SpyLigase can be removed by subsequent purification, such as by chromatography and/or filtration so that the SpyLigase will not have an appreciable presence in the final drug substance.
(5) Preferred mosaicisms are as follows: 1/1, 1/1.1, 1/1.2, 1/1.3, 1/1.4, 1/1.5, 1/1.6, 1/1.7, 1/1.8, 1/1.9, 1/2, 1/2.1, 1/2.2, 1/2.3, 1/2.4, 1/2.5, 1/2.6, 1/2.7, 1/2.8, 1/2.9, 1/3, 1/3.1, 1/3.2, 1/3.3, 1/3.4, 1/3.5, 1/3.6, 1/3.7, 1/3.8, 1/3.9, 1/4, 1/4.1, 1/4.2, 1/4.3, 1/4.4, 1/4.5, 1/4.6, 1/4.7, 1/4.8, 1/4.9, 1/5, 1/5.1, 1/5.2, 1/5.3, 1/5.4, 1/5.5, 1/5.6, 1/5.7, 1/5.8, 1/5.9, 1/6, 1/6.1, 1/6.2, 1/6.3, 1/6.4, 1/6.5, 1/6.6, 1/6.7, 1/6.8, 1/6.9, 1/7, 1/7.1, 1/7.2, 1/7.3, 1/7.4, 1/7.5, 1/7.6, 1/7.7, 1/7.8, 1/7.9, 1/8, 1/8.1, 1/8.2, 1/8.3, 1/8.4, 1/8.5, 1/8.6, 1/8.7, 1/8.8, 1/8.9, 1/9, 1/9.1, 1/9.2, 1/9.3, 1/9.4, 1/9.5, 1/9.6, 1/9.7, 1/9.8, 1/9.9, 1/10, 1/10.1, 1/10.2, 1/10.3, 1/10.4, 1/10.5, 1/10.6, 1/10.7, 1/10.8, 1/10.9, 1/11, 1/11.1, 1/11.2, 1/11.3, 1/11.4, 1/11.5, 1/11.6, 1/11.7, 1/11.8, 1/11.9, 1/12, 1/12.1, 1/12.2, 1/12.3, 1/12.4, 1/12.5, 1/12.6, 1/12.7, 1/12.8, 1/12.9, 1/13, 1/13.1, 1/13.2, 1/13.3, 1/13.4, 1/13.5, 1/13.6, 1/13.7, 1/13.8, 1/13.9, 1/14, 1/14.1, 1/14.2, 1/14.3, 1/14.4, 1/14.5, 1/14.6, 1/14.7, 1/14.8, 1/14.9, 1/15, 1/15.1, 1/15.2, 1/15.3, 1/15.4, 1/15.5, 1/15.6, 1/15.7, 1/15.8, 1/15.9, 1/16, 1/16.1, 1/16.2, 1/16.3, 1/16.4, 1/16.5, 1/16.6, 1/16.7, 1/16.8, 1/16.9, 1/17, 1/17.1, 1/17.2, 1/17.3, 1/17.4, 1/17.5, 1/17.6, 1/17.7, 1/17.8, 1/17.9, 1/18, 1/18.1, 1/18.2, 1/18.3, 1/18.4, 1/18.5, 1/18.6, 1/18.7, 1/18.8, 1/18.9, 1/19, 11/9.1, 1/19.2, 1/19.3, 1/19.4, 1/91.5, 1/19.6, 1/19.7, 1/19.8, 1/19.9, 1/20, 1/21, 1/21.1, 1/21.2, 1/21.3, 1/21.4, 1/21.5, 1/21.6, 1/21.7, 1/21.8, 1/21.9, 1/22, 1/22.1, 1/22.2, 1/22.3, 1/22.4, 1/22.5, 1/22.6, 1/22.7, 1/22.8, 1/22.9, 1/23, 1/23.1, 1/23.2, 1/23.3, 1/23.4, 1/23.5, 1/23.6, 1/23.7, 1/23.8, 1/23.9, 1/24, 1/24.1, 1/24.2, 1/24.3, 1/24.4, 1/24.5, 1/24.6, 1/24.7, 1/24.8, 1/24.9, 1/25, 1/25.1, 1/25.2, 1/25.3, 1/25.4, 1/25.5, 1/25.6, 1/25.7, 1/25.8, 1/25.9, 1/26, 1/26.1, 1/26.2, 1/26.3, 1/26.4, 1/26.5, 1/26.6, 1/26.7, 1/26.8, 12/6.9, 1/27, 1/27.1, 1/27.2, 1/27.3, 1/27.4, 1/27.5, 1/27.6, 1/27.7, 1/27.8, 1/27.9, 1/28, 1/28.1, 1/28.2, 1/28.3, 1/28.4, 1/28.5, 1/28.6, 1/28.7, 1/28.8, 1/28.9, 1/29, 1/29.1, 1/29.2, 1/29.3, 1/29.4, 1/29.5, 1/29.6, 1/29.7, 1/29.8, 1/29.9, 1/30, 1/30.1, 1/30.2, 1/30.3, 1/30.4, 1/30.5, 1/30.6, 1/30.7, 1/30.8, 1/30.9, 1/31, 1/31.1, 1/31.2, 1/31.3, 1/31.4, 1/31.5, 1/31.6, 1/31.7, 1/31.8, 1/31.9, 1/32, 1/32.1, 1/32.2, 1/32.3, 1/32.4, 1/32.5, 1/32.6, 1/32.7, 1/32.8, 1/32.9, 1/33, 1/33.1, 1/33.2, 1/33.3, 1/33.4, 1/33.5, 1/33.6, 1/33.7, 1/33.8, 1/33.9, 1/34, 1/34.1, 1/34.2, 1/34.3, 1/34.4, 1/34.5, 1/34.6, 1/34.7, 1/34.8, 1/34.9, 1/35, 1/35.1, 1/35.2, 1/35.3, 1/35.4, 1/35.5, 1/35.6, 1/35.7, 1/35.8, 1/35.9, 1/36, 1/36.1, 1/36.2, 1/36.3, 1/36.4, 1/36.5, 1/36.6, 1/36.7, 1/36.8, 1/36.9, 1/37, 1/37.1, 1/37.2, 1/37.3, 1/37.4, 1/37.5, 1/37.6, 1/37.7, 1/37.8, 1/37.9, 1/38, 1/38.1, 1/38.2, 1/38.3, 1/38.4, 1/38.5, 1/38.6, 1/38.7, 1/38.8, 1/38.9, 1/39, 1/39.1, 1/39.2, 1/39.3, 1/39.4, 1/39.5, 1/39.6, 1/39.7, 1/39.8, 1/39.9, 1/40, 1/40.1, 1/40.2, 1/40.3, 1/40.4, 1/40.5, 1/40.6, 1/40.7, 1/40.8, 1/40.9, 1/41, 1/41.1, 1/41.2, 1/41.3, 1/41.4, 1/41.5, 1/41.6, 1/41.7, 1/41.8, 1/41.9, 1/42, 1/42.1, 1/42.2, 1/42.3, 1/42.4, 1/42.5, 1/42.6, 1/42.7, 1/42.8, 1/42.9, 1/43, 1/43.1, 1/43.2, 1/43.3, 1/43.4, 1/43.5, 1/43.6, 1/43.7, 1/43.8, 1/43.9, 1/44, 1/44.1, 1/44.2, 1/44.3, 1/44.4, 1/44.5, 1/44.6, 1/44.7, 1/44.8, 1/44.9, 1/45, 1/45.1, 1/45.2, 1/45.3, 1/45.4, 1/45.5, 1/45.6, 1/45.7, 1/45.8, 1/45.9, 1/46, 1/46.1, 1/46.2, 1/46.3, 1/46.4, 1/46.5, 1/46.6, 1/46.7, 1/46.8, 1/46.9, 1/47, 1/47.1, 1/47.2, 1/47.3, 1/47.4, 1/47.5, 1/47.6, 1/47.7, 1/47.8, 1/47.9, 1/48, 1/48.1, 1/48.2, 1/48.3, 1/48.4, 1/48.5, 1/48.6, 1/48.7, 1/48.8, 1/48.9, 1/49, 1/49.1, 1/49.2, 1/49.3, 1/49.4, 1/49.5, 1/49.6, 1/49.7, 1/49.8, 1/49.9, 1/50, 1/50.1, 1/50.2, 1/50.3, 1/50.4, 1/50.5, 1/50.6, 1/50.7, 1/50.8, 1/50.9, 1/51, 1/51.1, 1/51.2, 1/51.3, 1/51.4, 1/51.5, 1/51.6, 1/51.7, 1/51.8, 1/51.9, 1/52, 1/52.1, 1/52.2, 1/52.3, 1/52.4, 1/52.5, 1/52.6, 1/52.7, 1/52.8, 1/52.9, 1/53, 1/53.1, 1/53.2, 1/53.3, 1/53.4, 1/53.5, 1/53.6, 1/53.7, 1/53.8, 1/53.9, 1/54, 1/54.1, 1/54.2, 1/54.3, 1/54.4, 1/54.5, 1/54.6, 1/54.7, 1/54.8, 1/54.9, 1/55, 1/55.1, 1/55.2, 1/55.3, 1/55.4, 1/55.5, 1/55.6, 1/55.7, 1/55.8, 1/55.9, 1/56, 1/56.1, 1/56.2, 1/56.3, 1/56.4, 1/56.5, 1/56.6, 1/56.7, 1/56.8, 1/56.9, 1/57, 1/57.1, 1/57.2, 1/57.3, 1/57.4, 1/57.5, 1/57.6, 1/57.7, 1/57.8, 1/57.9, 1/58, 1/58.1, 1/58.2, 1/58.3, 1/58.4, 1/58.5, 1/58.6, 1/58.7, 1/58.8, 1/58.9, 1/59, 1/59.1, 1/59.2, 1/59.3, 1/59.4, 1/59.5, 1/59.6, 1/59.7, 1/59.8, 1/59.9, 1/60 or ratios thereabout or therebetween. Ranges of ratios of 1/1 to 1/60 can be employed, and subranges as set forth below.
More preferred mosaicisms are:
1/4, 1/4.1, 1/4.2, 1/4.3, 1/4.4, 1/4.5, 1/4.6, 1/4.7, 1/4.8, 1/4.9, 1/5, 1/5.1, 1/5.2, 1/5.3, 1/5.4, 1/5.5, 1/5.6, 1/5.7, 1/5.8, 1/5.9, 1/6, 1/6.1, 1/6.2, 1/6.3, 1/6.4, 1/6.5, 1/6.6, 1/6.7, 1/6.8, 1/6.9, 1/7, 1/7.1, 1/7.2, 1/7.3, 1/7.4, 1/7.5, 1/7.6, 1/7.7, 1/7.8, 1/7.9, 1/8, 1/8.1, 1/8.2, 1/8.3, 1/8.4, 1/8.5, 1/8.6, 1/8.7, 1/8.8, 1/8.9, 1/9, 1/9.1, 1/9.2, 1/9.3, 1/9.4, 1/9.5, 1/9.6, 1/9.7, 1/9.8, 1/9.9, 1/10, 1/10.1, 1/10.2, 1/10.3, 1/10.4, 1/10.5, 1/10.6, 1/10.7, 1/10.8, 1/10.9, 1/11, 1/11.1, 1/11.2, 1/11.3, 1/11.4, 1/11.5, 1/11.6, 1/11.7, 1/11.8, 1/11.9, 1/12, 1/12.1, 1/12.2, 1/12.3, 1/12.4, 1/12.5, 1/12.6, 1/12.7, 1/12.8, 1/12.9 or 1/13.
Further preferred ratios mosaicisms are:
1/5, 1/5.1, 1/5.2, 1/5.3, 1/5.4, 1/5.5, 1/5.6, 1/5.7, 1/5.8, 1/5.9, 1/6, 1/6.1, 1/6.2, 1/6.3, 1/6.4, 1/6.5, 1/6.6, 1/6.7, 1/6.8, 1/6.9, 1/7, 1/7.1, 1/7.2, 1/7.3, 1/7.4, 1/7.5, 1/7.6, 1/7.7, 1/7.8, 1/7.9, 1/8, 1/8.1, 1/8.2, 1/8.3, 1/8.4, 1/8.5, 1/8.6, 1/8.7, 1/8.8, 1/8.9, 1/9, 1/9.1, 1/9.2, 1/9.3, 1/9.4, 1/9.5, 1/9.6, 1/9.7, 1/9.8, 1/9.9, 1/10, 1/10.1, 1/10.2, 1/10.3, 1/10.4, 1/10.5, 1/10.6, 1/10.7, 1/10.8, 1/10.9, 1/11, 1/11.1, 1/11.2, 1/11.3, 1/11.4, 1/11.5, 1/11.6, 1/11.7, 1/11.8, 1/11.9, or 1/12.
Still more preferred mosaicisms are:
1/7, 1/7.1, 1/7.2, 1/7.3, 1/7.4, 1/7.5, 1/7.6, 1/7.7, 1/7.8, 1/7.9, 1/8, 1/8.1, 1/8.2, 1/8.3, 1/8.4, 1/8.5, 1/8.6, 1/8.7, 1/8.8, 1/8.9, 1/9, 1/9.1, 1/9.2, 1/9.3, 1/9.4, 1/9.5, 1/9.6, 1/9.7, 1/9.8, 1/9.9, 1/10, 1/10.1, 1/10.2, 1/10.3, 1/10.4, 1/10.5, 1/10.6, 1/10.7, 1/10.8, 1/10.9, or 1/11.
Preferred ranges of mosaicisms are 1/4 to 1/13; 1/5 to 1/12; 1/6 to 1/11, 1/7 to 1/10.5. or 1/7.5 to 1/10.
(6) Preferred molar ratios of AAV-FM to SCM-RM are as follows: 1:20, 1:25, 1:30, 1:35, 1:40, 1:45, 1:50, 1:55, 1:60, 1:65, 1:70, 1:75, 1:80, 1:85, 1:90, 1:95, 1:100, 1:105, 1:110, 1:115, 1:120, 1:125, 1:130, 1:135, 1:140, 1:145, 1:150, 1:155, 1:160, 1:165, 1:170, 1:175, 1:180, 1:185, 1:190, 1:195, 1:200, 1:205, 1:210, 1:215, 1:220, 1:225, 1:230, 1:235, 1:240, 1:245, 1:250, 1:255, 1:260, 1:265, 1:270, 1:275, 1:280, 1:285, 1:290, 1:295, 1:300, 1:305, 1:310, 1:315, 1:320, 1:325, 1:330, 1:335, 1:340, 1:345, 1:350, 1:355, 1:360, 1:365, 1:370, 1:375, 1:380, 1:385, 1:390, 1:395, 1:400, 1:405, 1:410, 1:415, 1:420, 1:425, 1:430, 1:435, 1:440, 1:445, 1:450, 1:455, 1:460, 1:465, 1:470, 1:475, 1:480, 1:485, 1:490, 1:495, 1:500, 1:505, 1:510, 1:515, 1:520, 1:525, 1:530, 1:535, 1:540, 1:545, 1:550, 1:555, 1:560, 1:565, 1:570, 1:575, 1:580, 1:585, 1:590, 1:595, 1:600, 1:605, 1:610, 1:615, 1:620, 1:625, 1:630, 1:635, 1:640, 1:645, 1:650, 1:655, 1:660, 1:665, 1:670, 1:675, 1:680, 1:685, 1:690, 1:695, 1:700, 1:705, 1:710, 1:715, 1:720, 1:725, 1:730, 1:735, 1:740, 1:745, 1:750, 1:755, 1:760, 1:765, 1:770, 1:775, 1:780, 1:785, 1:790, 1:795, 1:800, 1:805, 1:810, 1:815, 1:820, 1:825, 1:830, 1:835, 1:840, 1:845, 1:850, 1:855, 1:860, 1:865, 1:870, 1:875, 1:880, 1:885, 1:890, 1:895, 1:900, 1:905, 1:910, 1:915, 1:920, 1:925, 1:930, 1:935, 1:940, 1:945, 1:950, 1:955, 1:960, 1:965, 1:970, 1:975, 1:980, 1:985, 1:990, 1:995, 1:1000, 1:>1000 or any ratio thereabout or therebetween.
More preferred ratios AAV-FM to SCM-RM are: 1:30, 1:35, 1:40, 1:45, 1:50, 1:55, 1:60, 1:65, 1:70, 1:75, 1:80, 1:85, 1:90, 1:95, 1:100, 1:105, 1:110, 1:115, 1:120, 1:125, 1:130, 1:135, 1:140, 1:145, 1:150, 1:155, 1:160, 1:165, 1:170, 1:175, 1:180, 1:185, 1:190, 1:195, 1:200, 1:205, 1:210, 1:215, 1:220, 1:225, 1:230, 1:235, 1:240, 1:245, 1:250, 1:255, 1:260, 1:265, 1:270, 1:275, 1:280, 1:285, 1:290, 1:295, 1:300 or any ratio thereabout or therebetween.
Preferred ranges of AAV-FM to SCM-RM are 1:20 to 1:1000, and more preferred ranges are: 1:30 to 1:100, 1:40 to 1:100, 1:50 to 1:100 1:60 to 1:100, 1:70 to 1:100, 1:80 to 1:100, 1:90:1:100, 1:30 to 1:150, 1:40 to 1:150, 1:50 to 1:150 1:60 to 1:150, 1:70 to 1:150, 1:80 to 1:150, 1:90 to :150, 1:100 to 1:150, 1:30 to 1:200, 1:40 to 1:200, 1:50 to 1:200 1:60 to 1:200, 1:70 to 1:200, 1:80 to 1:200, 1:90:1:200, 1:100 to 1:200, 1:30 to 1:250, 1:40 to 1:250, 1:50 to 1:250 1:60 to 1:250, 1:70 to 1:250, 1:80 to 1:250, 1:90 to :250, 1:100 to 1:250, 1:30 to 1:300, 1:40 to 1:300, 1:50 to 1:300 1:60 to 1:300, 1:70 to 1:300, 1:80 to 1:300, 1:90:1:300, or 1:100 to 1:300.
(7) The inventions provide for a desired conjugation of a level of conjugation of at least 10%, at least 20%, at least 30%, and at least 40%. Preferred levels are at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or up to 100%, any of which can be considered complete depending on the purpose. More preferably, the desired level of conjugation typically will be about 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%.
Ranges of desired conjugation levels can be 10% to 100%, 20% to 99%, 30% to 99%, 40% to 99%, 50% to 99%, 60% to 99%, 70% to 99%, 80% to 99%, or 90% to 99%. Preferred ranges of desired conjugation levels can be 40% to 100%, 40% to 99%, 45% to 95%, 50% to 95%, 55% to 90%, 60% to 90%, 65% to 95%, 65% to 85%, 65% to 90%, 70% to 90%, 75% to 90%, 75% to 85%, 75% to 80%, or 80% to 85%. More preferably, the range is 65% to 95%.
The second chart below cites to exemplary modifications to the above chart based upon the descriptions and sequence examples contained herein. Points 1-7 above also apply to the second chart below:
Covalently surface modified AAV rh74 can be made by transfecting a cell with plasmids as set forth below, followed by culturing the transfected cells and harvesting the resulting AAV, and then conjugating the resulting AAV with a second cognate member (SCM) that is fused to a retargeting molecule The first chart below uses SpyTag as the first member of a specific binding pair, and Adenovirus Helper Genes. Modifications can be undertaken as disclosed below:
(1) Plasmid pGOI can comprise one or more genes that are desired to be expressed in covalently surface modified AAV rh74.
(2) Plasmids pRC-FM can be modified for other specific binding pairs. The first member (FM) should be complementary to a second cognate member (SCM) that is fused to a retargeting molecule (for example, an antibody, as well derivatives and fragments thereof, and still other molecules). See Definitions and Description sections of the Detailed Description, the Figures and associated text for “retargeting” and “retargeting molecules”. The populations of FMs and SCMs can be homogenous or heterogeneous as long as the selected FMs can come in contact with appropriate SCMs so that binding can occur.
(3) Detargeting mutations are optional and can be undertaken as disclosed herein and in publications. See Definitions and Description sections of the Detailed Description, the Figures and associated text for “detargeting” and “detargeting mutations”.
(4) To lessen the possibility of encountering neutralizing antibodies when the covalently surface modified AAV is administered to a subject, KTag can be used as an SCM to bind with SpyTag (FM) (SEQ ID NOS: 54 and 86). KTag and SpyLigase are based upon SpyCatcher. KTag (SEQ ID NO: 85) has only 10 amino acids, which renders it less immunogenic. KTag can be bound to SpyTag in the presence of SpyLigase (SEQ ID NO: 61). The SpyLigase can be removed by subsequent purification, such as by chromatography and/or filtration so that the SpyLigase will not have an appreciable presence in the final drug substance.
(5) Preferred mosaicisms are as follows: 1/1, 1/1.1, 1/1.2, 1/1.3, 1/1.4, 1/1.5, 1/1.6, 1/1.7, 1/1.8, 1/1.9, 1/2, 1/2.1, 1/2.2, 1/2.3, 1/2.4, 1/2.5, 1/2.6, 1/2.7, 1/2.8, 1/2.9, 1/3, 1/3.1, 1/3.2, 1/3.3, 1/3.4, 1/3.5, 1/3.6, 1/3.7, 1/3.8, 1/3.9, 1/4, 1/4.1, 1/4.2, 1/4.3, 1/4.4, 1/4.5, 1/4.6, 1/4.7, 1/4.8, 1/4.9, 1/5, 1/5.1, 1/5.2, 1/5.3, 1/5.4, 1/5.5, 1/5.6, 1/5.7, 1/5.8, 1/5.9, 1/6, 1/6.1, 1/6.2, 1/6.3, 1/6.4, 1/6.5, 1/6.6, 1/6.7, 1/6.8, 1/6.9, 1/7, 1/7.1, 1/7.2, 1/7.3, 1/7.4, 1/7.5, 1/7.6, 1/7.7, 1/7.8, 1/7.9, 1/8, 1/8.1, 1/8.2, 1/8.3, 1/8.4, 1/8.5, 1/8.6, 1/8.7, 1/8.8, 1/8.9, 1/9, 1/9.1, 1/9.2, 1/9.3, 1/9.4, 1/9.5, 1/9.6, 1/9.7, 1/9.8, 1/9.9, 1/10, 1/10.1, 1/10.2, 1/10.3, 1/10.4, 1/10.5, 1/10.6, 1/10.7, 1/10.8, 1/10.9, 1/11, 1/11.1, 1/11.2, 1/11.3, 1/11.4, 1/11.5, 1/11.6, 1/11.7, 1/11.8, 1/11.9, 1/12, 1/12.1, 1/12.2, 1/12.3, 1/12.4, 1/12.5, 1/12.6, 1/12.7, 1/12.8, 1/12.9, 1/13, 1/13.1, 1/13.2, 1/13.3, 1/13.4, 1/13.5, 1/13.6, 1/13.7, 1/13.8, 1/13.9, 1/14, 1/14.1, 1/14.2, 1/14.3, 1/14.4, 1/14.5, 1/14.6, 1/14.7, 1/14.8, 1/14.9, 1/15, 1/15.1, 1/15.2, 1/15.3, 1/15.4, 1/15.5, 1/15.6, 1/15.7, 1/15.8, 1/15.9, 1/16, 1/16.1, 1/16.2, 1/16.3, 1/16.4, 1/16.5, 1/16.6, 1/16.7, 1/16.8, 1/16.9, 1/17, 1/17.1, 1/17.2, 1/17.3, 1/17.4, 1/17.5, 1/17.6, 1/17.7, 1/17.8, 1/17.9, 1/18, 1/18.1, 1/18.2, 1/18.3, 1/18.4, 1/18.5, 1/18.6, 1/18.7, 1/18.8, 1/18.9, 1/19, 11/9.1, 1/19.2, 1/19.3, 1/19.4, 1/91.5, 1/19.6, 1/19.7, 1/19.8, 1/19.9, 1/20, 1/21, 1/21.1, 1/21.2, 1/21.3, 1/21.4, 1/21.5, 1/21.6, 1/21.7, 1/21.8, 1/21.9, 1/22, 1/22.1, 1/22.2, 1/22.3, 1/22.4, 1/22.5, 1/22.6, 1/22.7, 1/22.8, 1/22.9, 1/23, 1/23.1, 1/23.2, 1/23.3, 1/23.4, 1/23.5, 1/23.6, 1/23.7, 1/23.8, 1/23.9, 1/24, 1/24.1, 1/24.2, 1/24.3, 1/24.4, 1/24.5, 1/24.6, 1/24.7, 1/24.8, 1/24.9, 1/25, 1/25.1, 1/25.2, 1/25.3, 1/25.4, 1/25.5, 1/25.6, 1/25.7, 1/25.8, 1/25.9, 1/26, 1/26.1, 1/26.2, 1/26.3, 1/26.4, 1/26.5, 1/26.6, 1/26.7, 1/26.8, 12/6.9, 1/27, 1/27.1, 1/27.2, 1/27.3, 1/27.4, 1/27.5, 1/27.6, 1/27.7, 1/27.8, 1/27.9, 1/28, 1/28.1, 1/28.2, 1/28.3, 1/28.4, 1/28.5, 1/28.6, 1/28.7, 1/28.8, 1/28.9, 1/29, 1/29.1, 1/29.2, 1/29.3, 1/29.4, 1/29.5, 1/29.6, 1/29.7, 1/29.8, 1/29.9, 1/30, 1/30.1, 1/30.2, 1/30.3, 1/30.4, 1/30.5, 1/30.6, 1/30.7, 1/30.8, 1/30.9, 1/31, 1/31.1, 1/31.2, 1/31.3, 1/31.4, 1/31.5, 1/31.6, 1/31.7, 1/31.8, 1/31.9, 1/32, 1/32.1, 1/32.2, 1/32.3, 1/32.4, 1/32.5, 1/32.6, 1/32.7, 1/32.8, 1/32.9, 1/33, 1/33.1, 1/33.2, 1/33.3, 1/33.4, 1/33.5, 1/33.6, 1/33.7, 1/33.8, 1/33.9, 1/34, 1/34.1, 1/34.2, 1/34.3, 1/34.4, 1/34.5, 1/34.6, 1/34.7, 1/34.8, 1/34.9, 1/35, 1/35.1, 1/35.2, 1/35.3, 1/35.4, 1/35.5, 1/35.6, 1/35.7, 1/35.8, 1/35.9, 1/36, 1/36.1, 1/36.2, 1/36.3, 1/36.4, 1/36.5, 1/36.6, 1/36.7, 1/36.8, 1/36.9, 1/37, 1/37.1, 1/37.2, 1/37.3, 1/37.4, 1/37.5, 1/37.6, 1/37.7, 1/37.8, 1/37.9, 1/38, 1/38.1, 1/38.2, 1/38.3, 1/38.4, 1/38.5, 1/38.6, 1/38.7, 1/38.8, 1/38.9, 1/39, 1/39.1, 1/39.2, 1/39.3, 1/39.4, 1/39.5, 1/39.6, 1/39.7, 1/39.8, 1/39.9, 1/40, 1/40.1, 1/40.2, 1/40.3, 1/40.4, 1/40.5, 1/40.6, 1/40.7, 1/40.8, 1/40.9, 1/41, 1/41.1, 1/41.2, 1/41.3, 1/41.4, 1/41.5, 1/41.6, 1/41.7, 1/41.8, 1/41.9, 1/42, 1/42.1, 1/42.2, 1/42.3, 1/42.4, 1/42.5, 1/42.6, 1/42.7, 1/42.8, 1/42.9, 1/43, 1/43.1, 1/43.2, 1/43.3, 1/43.4, 1/43.5, 1/43.6, 1/43.7, 1/43.8, 1/43.9, 1/44, 1/44.1, 1/44.2, 1/44.3, 1/44.4, 1/44.5, 1/44.6, 1/44.7, 1/44.8, 1/44.9, 1/45, 1/45.1, 1/45.2, 1/45.3, 1/45.4, 1/45.5, 1/45.6, 1/45.7, 1/45.8, 1/45.9, 1/46, 1/46.1, 1/46.2, 1/46.3, 1/46.4, 1/46.5, 1/46.6, 1/46.7, 1/46.8, 1/46.9, 1/47, 1/47.1, 1/47.2, 1/47.3, 1/47.4, 1/47.5, 1/47.6, 1/47.7, 1/47.8, 1/47.9, 1/48, 1/48.1, 1/48.2, 1/48.3, 1/48.4, 1/48.5, 1/48.6, 1/48.7, 1/48.8, 1/48.9, 1/49, 1/49.1, 1/49.2, 1/49.3, 1/49.4, 1/49.5, 1/49.6, 1/49.7, 1/49.8, 1/49.9, 1/50, 1/50.1, 1/50.2, 1/50.3, 1/50.4, 1/50.5, 1/50.6, 1/50.7, 1/50.8, 1/50.9, 1/51, 1/51.1, 1/51.2, 1/51.3, 1/51.4, 1/51.5, 1/51.6, 1/51.7, 1/51.8, 1/51.9, 1/52, 1/52.1, 1/52.2, 1/52.3, 1/52.4, 1/52.5, 1/52.6, 1/52.7, 1/52.8, 1/52.9, 1/53, 1/53.1, 1/53.2, 1/53.3, 1/53.4, 1/53.5, 1/53.6, 1/53.7, 1/53.8, 1/53.9, 1/54, 1/54.1, 1/54.2, 1/54.3, 1/54.4, 1/54.5, 1/54.6, 1/54.7, 1/54.8, 1/54.9, 1/55, 1/55.1, 1/55.2, 1/55.3, 1/55.4, 1/55.5, 1/55.6, 1/55.7, 1/55.8, 1/55.9, 1/56, 1/56.1, 1/56.2, 1/56.3, 1/56.4, 1/56.5, 1/56.6, 1/56.7, 1/56.8, 1/56.9, 1/57, 1/57.1, 1/57.2, 1/57.3, 1/57.4, 1/57.5, 1/57.6, 1/57.7, 1/57.8, 1/57.9, 1/58, 1/58.1, 1/58.2, 1/58.3, 1/58.4, 1/58.5, 1/58.6, 1/58.7, 1/58.8, 1/58.9, 1/59, 1/59.1, 1/59.2, 1/59.3, 1/59.4, 1/59.5, 1/59.6, 1/59.7, 1/59.8, 1/59.9, 1/60 or ratios thereabout or therebetween. Ranges of ratios of 1/1 to 1/60 can be employed, and subranges as set forth below.
More preferred mosaicisms are:
1/4, 1/4.1, 1/4.2, 1/4.3, 1/4.4, 1/4.5, 1/4.6, 1/4.7, 1/4.8, 1/4.9, 1/5, 1/5.1, 1/5.2, 1/5.3, 1/5.4, 1/5.5, 1/5.6, 1/5.7, 1/5.8, 1/5.9, 1/6, 1/6.1, 1/6.2, 1/6.3, 1/6.4, 1/6.5, 1/6.6, 1/6.7, 1/6.8, 1/6.9, 1/7, 1/7.1, 1/7.2, 1/7.3, 1/7.4, 1/7.5, 1/7.6, 1/7.7, 1/7.8, 1/7.9, 1/8, 1/8.1, 1/8.2, 1/8.3, 1/8.4, 1/8.5, 1/8.6, 1/8.7, 1/8.8, 1/8.9, 1/9, 1/9.1, 1/9.2, 1/9.3, 1/9.4, 1/9.5, 1/9.6, 1/9.7, 1/9.8, 1/9.9, 1/10, 1/10.1, 1/10.2, 1/10.3, 1/10.4, 1/10.5, 1/10.6, 1/10.7, 1/10.8, 1/10.9, 1/11, 1/11.1, 1/11.2, 1/11.3, 1/11.4, 1/11.5, 1/11.6, 1/11.7, 1/11.8, 1/11.9, 1/12, 1/12.1, 1/12.2, 1/12.3, 1/12.4, 1/12.5, 1/12.6, 1/12.7, 1/12.8, 1/12.9 or 1/13.
Further preferred mosaicisms are:
1/5, 1/5.1, 1/5.2, 1/5.3, 1/5.4, 1/5.5, 1/5.6, 1/5.7, 1/5.8, 1/5.9, 1/6, 1/6.1, 1/6.2, 1/6.3, 1/6.4, 1/6.5, 1/6.6, 1/6.7, 1/6.8, 1/6.9, 1/7, 1/7.1, 1/7.2, 1/7.3, 1/7.4, 1/7.5, 1/7.6, 1/7.7, 1/7.8, 1/7.9, 1/8, 1/8.1, 1/8.2, 1/8.3, 1/8.4, 1/8.5, 1/8.6, 1/8.7, 1/8.8, 1/8.9, 1/9, 1/9.1, 1/9.2, 1/9.3, 1/9.4, 1/9.5, 1/9.6, 1/9.7, 1/9.8, 1/9.9, 1/10, 1/10.1, 1/10.2, 1/10.3, 1/10.4, 1/10.5, 1/10.6, 1/10.7, 1/10.8, 1/10.9, 1/11, 1/11.1, 1/11.2, 1/11.3, 1/11.4, 1/11.5, 1/11.6, 1/11.7, 1/11.8, 1/11.9, or 1/12.
Still more preferred mosaicisms are:
1/7, 1/7.1, 1/7.2, 1/7.3, 1/7.4, 1/7.5, 1/7.6, 1/7.7, 1/7.8, 1/7.9, 1/8, 1/8.1, 1/8.2, 1/8.3, 1/8.4, 1/8.5, 1/8.6, 1/8.7, 1/8.8, 1/8.9, 1/9, 1/9.1, 1/9.2, 1/9.3, 1/9.4, 1/9.5, 1/9.6, 1/9.7, 1/9.8, 1/9.9, 1/10, 1/10.1, 1/10.2, 1/10.3, 1/10.4, 1/10.5, 1/10.6, 1/10.7, 1/10.8, 1/10.9, or 1/11.
Preferred ranges of mosaicisms are 1/4 to 1/13; 1/5 to 1/12; 1/6 to 1/11, 1/7 to 1/10.5. or 1/7.5 to 1/10.
(6) Preferred molar ratios of AAV-FM to SCM-RM are as follows: 1:20, 1:25, 1:30, 1:35, 1:40, 1:45, 1:50, 1:55, 1:60, 1:65, 1:70, 1:75, 1:80, 1:85, 1:90, 1:95, 1:100, 1:105, 1:110, 1:115, 1:120, 1:125, 1:130, 1:135, 1:140, 1:145, 1:150, 1:155, 1:160, 1:165, 1:170, 1:175, 1:180, 1:185, 1:190, 1:195, 1:200, 1:205, 1:210, 1:215, 1:220, 1:225, 1:230, 1:235, 1:240, 1:245, 1:250, 1:255, 1:260, 1:265, 1:270, 1:275, 1:280, 1:285, 1:290, 1:295, 1:300, 1:305, 1:310, 1:315, 1:320, 1:325, 1:330, 1:335, 1:340, 1:345, 1:350, 1:355, 1:360, 1:365, 1:370, 1:375, 1:380, 1:385, 1:390, 1:395, 1:400, 1:405, 1:410, 1:415, 1:420, 1:425, 1:430, 1:435, 1:440, 1:445, 1:450, 1:455, 1:460, 1:465, 1:470, 1:475, 1:480, 1:485, 1:490, 1:495, 1:500, 1:505, 1:510, 1:515, 1:520, 1:525, 1:530, 1:535, 1:540, 1:545, 1:550, 1:555, 1:560, 1:565, 1:570, 1:575, 1:580, 1:585, 1:590, 1:595, 1:600, 1:605, 1:610, 1:615, 1:620, 1:625, 1:630, 1:635, 1:640, 1:645, 1:650, 1:655, 1:660, 1:665, 1:670, 1:675, 1:680, 1:685, 1:690, 1:695, 1:700, 1:705, 1:710, 1:715, 1:720, 1:725, 1:730, 1:735, 1:740, 1:745, 1:750, 1:755, 1:760, 1:765, 1:770, 1:775, 1:780, 1:785, 1:790, 1:795, 1:800, 1:805, 1:810, 1:815, 1:820, 1:825, 1:830, 1:835, 1:840, 1:845, 1:850, 1:855, 1:860, 1:865, 1:870, 1:875, 1:880, 1:885, 1:890, 1:895, 1:900, 1:905, 1:910, 1:915, 1:920, 1:925, 1:930, 1:935, 1:940, 1:945, 1:950, 1:955, 1:960, 1:965, 1:970, 1:975, 1:980, 1:985, 1:990, 1:995, 1:1000, 1:>1000 or any ratio thereabout or therebetween.
More preferred ratios AAV-FM to SCM-RM are: 1:30, 1:35, 1:40, 1:45, 1:50, 1:55, 1:60, 1:65, 1:70, 1:75, 1:80, 1:85, 1:90, 1:95, 1:100, 1:105, 1:110, 1:115, 1:120, 1:125, 1:130, 1:135, 1:140, 1:145, 1:150, 1:155, 1:160, 1:165, 1:170, 1:175, 1:180, 1:185, 1:190, 1:195, 1:200, 1:205, 1:210, 1:215, 1:220, 1:225, 1:230, 1:235, 1:240, 1:245, 1:250, 1:255, 1:260, 1:265, 1:270, 1:275, 1:280, 1:285, 1:290, 1:295, 1:300 or any ratio thereabout or therebetween.
Preferred ranges of AAV-FM to SCM-RM are 1:20 to 1:1000, and more preferred ranges are: 1:30 to 1:100, 1:40 to 1:100, 1:50 to 1:100 1:60 to 1:100, 1:70 to 1:100, 1:80 to 1:100, 1:90:1:100, 1:30 to 1:150, 1:40 to 1:150, 1:50 to 1:150 1:60 to 1:150, 1:70 to 1:150, 1:80 to 1:150, 1:90 to :150, 1:100 to 1:150, 1:30 to 1:200, 1:40 to 1:200, 1:50 to 1:200 1:60 to 1:200, 1:70 to 1:200, 1:80 to 1:200, 1:90:1:200, 1:100 to 1:200, 1:30 to 1:250, 1:40 to 1:250, 1:50 to 1:250 1:60 to 1:250, 1:70 to 1:250, 1:80 to 1:250, 1:90 to :250, 1:100 to 1:250, 1:30 to 1:300, 1:40 to 1:300, 1:50 to 1:300 1:60 to 1:300, 1:70 to 1:300, 1:80 to 1:300, 1:90:1:300, or 1:100 to 1:300.
(7) The inventions provide for a desired conjugation of a level of conjugation of at least 10%, at least 20%, at least 30%, and at least 40%. Preferred levels are at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or up to 100%, any of which can be considered complete depending on the purpose. More preferably, the desired level of conjugation typically will be about 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%.
Ranges of desired conjugation levels can be 10% to 100%, 20% to 99%, 30% to 99%, 40% to 99%, 50% to 99%, 60% to 99%, 70% to 99%, 80% to 99%, or 90% to 99%. Preferred ranges of desired conjugation levels can be 40% to 100%, 40% to 99%, 45% to 95%, 50% to 95%, 55% to 90%, 60% to 90%, 65% to 95%, 65% to 85%, 65% to 90%, 70% to 90%, 75% to 90%, 75% to 85%, 75% to 80%, or 80% to 85%. More preferably, the range is 65% to 95%.
The second chart below cites to exemplary modifications to the above chart based upon the descriptions and sequence examples contained herein. Points 1-7 above also apply to the second chart below:
The following examples set forth exemplary sequences, which are optional for use and do not limit the inventions in any manner. Other AAV sequences, helper sequences, and Specific Binding Pair sequences are available and accessible. Gene of interest sequences and retargeting molecule sequences can be selected based upon the purpose of the covalently surface modified AAV and the cell/tissue to be targeted. Sequences that can be used according to the inventions are set for the below.
AAV Rep, Cap and ITR sequences are known in the art. The present inventions are amenable to all AAV serotypes. AAV sequences from various AAV serotypes are set forth below. Many of these sequences are available from the National Center for Biotechnology Information (NCBI).
Adenovirus (Ad) polynucleotides can be selected from any serotype, and representative polynucleotides are exemplified below.
GGGTATCATGGCGGACGACCGGGGTTCGAACCCCGGATCCGGCCGTCCGCCGTGATCCATGCGGTTACCGCCCGC
GTGTCGAACCCAGGTGTGCGACGTCAGACAACGGGGGAGCGCTCCTTTTGGCTTCCTTCCAGGCGCGGCGGCTGC
GCTCCCTGTAGCCGGAGGGTTATTTTCCAAGGGTTGAGTCGCAGGACCCCCGGTTCGAGTCTCGGGCCGGCCGGA
CTGCGGCGAACGGGGGTTTGCCTCCCCGTCATGCAAGACCCCGCTTGCAAATTCCTCCGGAAACAGGGACGAGCC
CCTTTTTTGCTTTTCCCAGATGCATCCGGTGCTGCGGCAGATGCGCCCCCCTCCTCAGCAGCGGCAAGAGCAAGA
Sequences can be found in one or more of these publications, for example, in WO2022/234276A1, WO2022129547A1, WO2011/098772, WO2016/193746, WO2018/197854, WO2018/189517 or Li et al., J. Mol. Biol. 426, 309-317 (2014); or can be designed or obtained by methods known in the art, for example, as described in Zakeri et al., 2012, and in Zakeri et al., 2010.
Additional binding pair proteins are reported. See, for example, WO2022/234276A1, WO2011/098772, WO2022129547A1, WO2016/193746, WO2018/197854, WO2018/189517 or Li et al., J. Mol. Biol. 426, 309-317 (2014).
Nucleotide and amino acid sequences for specific binding partners have been published or can be designed or obtained by methods known in the art, for example, as described in Zakeri et al., 2012, and in Zakeri et al., 2010 See, for example:
HSV polynucleotides can be selected from any serotype, and representative polynucleotides are exemplified below. Weindler and Heilbronn 1991 (Weindler, Friedrich W., and R.E.G I.N.E. Heilbronn. “A subset of herpes simplex virus replication genes provides helper functions for productive adeno-associated virus replication.” Journal of virology 65.5 (1991): 2476-2483); Ward et al. 2001 (Ward et al. Rep-dependent initiation of adeno-associated virus type 2 DNA replication by a herpes simplex virus type 1 replication complex in a reconstituted system. J. Virol. 2001; 75:10250-10258); Herpes Clément et al. 2009 (Clément, Nathalie, David R. Knop, and Barry J. Byrne. “Large-scale adeno-associated viral vector production using a herpesvirus-based system enables manufacturing for clinical studies.” Human gene therapy 20.8 (2009): 796-806); and Meier et al. 2020 (Meier, Anita F., Cornel Fraefel, and Michael Seyffert. “The Interplay between Adeno-Associated Virus and Its Helper Viruses.” Viruses 12.6 (2020)) disclose seven HSV replication genes (UL5, UL8, UL9, UL29, UL30, UL42, and UL52) that led to productive AAV replication, of which HSV-1 helicase-primase complex (HP; UL5/UL8/UL52) and the single-strand DNA binding protein ICP8 (gene UL29) is sufficient to restore AAV progeny production. HSV replication gene (UL5, UL8, UL52, UL29, UL9, UL30, and UL42) sequences as available at the GenBank are listed below:
HPV polynucleotides can be selected from any serotype, and representative polynucleotides are exemplified below. Meier et al. 2020; Cao et al. 2012 (Cao, M., et al. “HPV-16 E1, E2 and E6 each complement the Ad5 helper gene set, increasing rAAV2 and wt AAV2 production.” Gene therapy 19.4 (2012): 418-424); You et al. 2006 (You, Hong, et al. “Multiple human papillomavirus genes affect the adeno-associated virus life cycle.” Virology 344.2 (2006): 532-540); and Ogston et al. 2000 (Ogston, P.; Raj, K.; Beard, P. Productive Replication of Adeno-Associated Virus Can Occur in Human Papillomavirus Type 16 (HPV-16) Episome-Containing Keratinocytes and Is Augmented by the HPV-16 E2 Protein. J. Virol. 2000, 74, 3494-3504) disclose four HPV early genes E1, E2, E6 and E7, of which E1 shows the highest helping activity, E2 and E6 with intermediate helper activity and E7 with little effect or possibly a slight decrease in cap expression. The three HPV genes (E1, E2, and E6) are unable to stimulate significant rAAV replication in HEK293 cells when used alone. However, when used in conjunction (complementation) with the standard Ad5 helper gene set, E1, E2 and E6 are each capable of significantly boosting rAAV DNA replication and virus particle yield. HPV early gene (E1, E2, E6 and E7) sequences as disclosed at the GenBank are listed below:
Bocavirus polynucleotides can be selected from any serotype, and representative polynucleotides as disclosed at the GenBank are exemplified below. Meier et al 2020; Wang, Zekun, et al. 2017 (Wang, Zekun, et al. “Human bocavirus 1 is a novel helper for adeno-associated virus replication.” Journal of virology 91.18 (2017): 10-1128); Guido, Marcello, et al. 2016 (Guido, Marcello, et al. “Human bocavirus: current knowledge and future challenges.” World journal of gastroenterology 22.39 (2016): 8684); and Ning, Kang, et al. 2022 (Ning, Kang, et al. “The small nonstructural protein NP1 of human bocavirus 1 directly interacts with Ku70 and RPA70 and facilitates viral DNA replication.” PLoS pathogens 18.6 (2022): el 010578) disclose that human bocavirus 1 (HBoV1) NS2 (but not NS4), NP1, and BocaSR were required for AAV2 DNA replication and progeny virion formation. Novel small NS proteins (NS2, NS3 and NS4) have been identified in HBoV1, which contain the predictive domains of NS1 activities. HBoV1 expresses one large nonstructural protein (NS1), four small nonstructural proteins (NS2, NS3, NS4, and NP1), one small noncoding RNA (bocavirus-encoded small RNA, BocaSR), and three viral capsid proteins (VP1, VP2, and VP3) from a single precursor mRNA (pre-mRNA) via alternative splicing. NS1, NP1, and BocaSR are essential for DNA replication of HBoV1.
It is to be understood that the description, specific examples and data, while indicating exemplary aspects, are given by way of illustration and are not intended to limit the present inventions. Various changes and modifications within the present inventions, including combining aspects in whole and in part, will become apparent to the skilled artisan from the discussion, disclosure and data contained herein, and thus are considered part of the inventions.
This application claims priority to U.S. Application Ser. No. 63/713,916, filed Oct. 30, 2024; U.S. Application Ser. No. 63/691,544, filed Sep. 6, 2024; U.S. Application Ser. No. 63/654,478, filed May 31, 2024; U.S. Application Ser. No. 63/620,682, filed Jan. 12, 2024; U.S. Application Ser. No. 63/620,055, filed Jan. 11, 2024; and U.S. Application Ser. No. 63/601,611, filed Nov. 21, 2023. These applications are incorporated by reference in their entirety.
| Number | Date | Country | |
|---|---|---|---|
| 63713916 | Oct 2024 | US | |
| 63691544 | Sep 2024 | US | |
| 63654478 | May 2024 | US | |
| 63620682 | Jan 2024 | US | |
| 63620055 | Jan 2024 | US | |
| 63601611 | Nov 2023 | US |
