Patent Grant
11345912
The present invention relates to a method for in vitro selection of multivalent glycopeptides that mimic native glycosylated epitopes.
Antibody 2G12, isolated from an HIV positive individual, binds and neutralizes a broad range of HIV strains (Trkola et al., J. Virol. 70:1100-1108 (1996) and Binley et al., J. Virol. 78:13232-13252 (2004)) and provides sterilizing immunity against SHIV challenge in macaque models of infection (Mascola et al., Nat. Med. 6:207-210 (2000); Hessell et al., Nat. Med. 15:951-954 (2009); and Hessel et al., PLoS Pathog. 5:e1000433 (2009)). 2G12 recognizes an epitope comprised of 2-4 high mannose (Man9GlcNAc2) glycans on the surface of HIV envelope protein gp120 (Scanlan et al., J. Virol. 76:7306-7321 (2002); Calarese et al., Science 300:2065-2071 (2003); and Calarese et al. Proc. Natl. Acad. Sci. U.S.A. 102:13372-13377 (2005)) and glycopeptides which precisely mimic this glycan clustering and presentation may be useful as vaccines to “re-elicit” 2G12-like antibodies in vivo (Scanlan et al., Nature 446:1038-1045 (2007)). Glycans clustered on carbohydrate scaffolds (Ni et al., Bioconjugate Chem. 17:493-500 (2006)), peptide scaffolds (Joyce et al., Proc. Natl. Acad. Sci. U S. A. 105:15684-15689 (2008)), and protein scaffolds (Astronomo et al., J. Virol. 82:6359-6368 (2008)) as well as phage particles (Astronomo et al., Chem. Biol. 17:357-370 (2010)) and yeast (Luallen et al., J. Virol. 82:6447-6457 (2008); Luallen et al., J. Virol. 83:4861-4870 (2009); Agrawal-Gamse et al., J. Virol. 85:470-480 (2011); Ciobanu et al., Chem. Commun. 47:9321-9323 (2011); and Marradi et al., J. Mol. Biol. 410:798-810 (2011)) have been tested for this purpose, but with little success. In part, this may be due to the difficulty of designing structures in which the clustering of glycans faithfully mimics that of the 2G12 epitope on gp120. Indeed, most of these structures were recognized by 2G12 with orders of magnitude weaker affinity than was gp120, suggesting that they were not optimal mimics of the 2G12 epitope.
The directed evolution of glycopeptides has been of interest, given their relevance in both HIV and cancer vaccine design. Although many powerful methods are available for in vitro selection of peptides, comparatively little has yet been published on in vitro selection of glycopeptides. Recently phage display with chemically-modified phages enabled selection of peptide 5-mer sequences containing a single central mannose monosaccharide from ˜106 sequences (Arai et al., Bioorg. Med. Chem. Lett. 23:4940-4943 (2013)). In an alternative approach, a single mannose was chemically attached to the N-terminal position of a 7-mer phage-displayed library of ˜108 sequences, although selections with this library have not yet been reported (Ng et al., ACS Chem. Biol. 7:1482-1487 (2012)). Because carbohydrate epitopes of various pathogen (e.g., HIV) and cancer cells may contain multiple glycans (see Scanlan et al., J. Virol. 76:7306-7321 (2002); Calarese et al., Science 300:2065-2071 (2003); and Calarese et al. Proc. Natl. Acad. Sci. U.S.A. 102:13372-13377 (2005)), it is desirable that a selection method allow access to multivalent glycopeptides containing one or more glycans at variable positions, supported by a peptide framework.
More importantly, it is desirable for selected glycopeptides to exhibit high affinity binding to known carbohydrate-binding monoclonal antibodies or other targets used during selection. Such carbohydrate-binding monoclonal antibodies include antibodies known to neutralize pathogens and antibodies known to afford protection (i.e., cytotoxicity) against cancer cells.
The present invention is directed to overcoming these and other deficiencies in the art.
The invention relates to a method for selecting a glycopolypeptide that binds to a target protein. The method includes providing a pool of glycopolypeptides fused via puromycin linker to an encoding mRNA-cDNA duplex; combining the pool with a target protein to form a mixture; incubating the mixture for a period of time sufficient to allow the target protein to bind to one or more of the glycopolypeptides, thereby forming glycopolypeptide-target protein complexes; and isolating from the mixture the glycopolypeptide-target protein complexes, thereby identifying a plurality of selected glycopolypeptides.
As demonstrated by the accompanying Examples, the selection method disclosed herein allows for the generation of a pool of multivalent glycopeptides containing several glycans at variable positions, supported by a significant peptide framework. This selection method includes Click chemistry glycosylation of mRNA-displayed peptide libraries of 1013 sequences. The usefulness of this selection method is demonstrated for HIV antigen design, whereby multiple glycopolypeptides containing 3-5 high-mannose nonasaccharides were generated and these glycopolypeptides tightly recognize the broadly neutralizing HIV antibody 2G12. These glycopolypeptides bound to 2G12 with an affinity substantially the same as the affinity between 2G12 and HIV-1 gp120. Multiple glycopolypeptides exhibited Kg's below 5 nM, with the best binding glycopolypeptide having a KD as low as 500 pM. As a result, these glycopolypeptides adequately mimic the native gp120 epitope, and should therefore be useful as a vaccine to induce a neutralizing immune response against HIV-1.
The present invention relates to a method for in vitro selection of glycopeptides, which involves combining mRNA display with the incorporation of unnatural amino acids and “click” chemistry. Using this in vitro selection in combination with directed evolution of glycopeptides, it is possible to develop binding partners with any of a variety of target proteins, including epitope mimics that are bound tightly and specifically by carbohydrate-specific monoclonal antibodies.
Accordingly, the method for selecting a glycopolypeptide that binds to a target protein includes providing a pool of glycopolypeptides fused via puromycin linker to an encoding mRNA-cDNA duplex; combining the pool with a target protein to form a mixture; incubating the mixture for a period of time sufficient to allow any target protein to bind to one or more of the glycopolypeptides, thereby forming glycopolypeptide-target protein complexes; and isolating from the mixture the glycopolypeptide-target protein complexes, thereby identifying a plurality of selected glycopolypeptides. Multiple rounds of selection and regenerating mRNA-linked glycopolypeptide pools can be performed in the manner illustrated in
The provided pool of glycopolypeptides fused via puromycin linker to an encoding mRNA-cDNA duplex is preferably large enough to afford sufficient diversity so as to allow for selection of multiple, diverse glycopolypeptides that exhibit target protein binding capability. By way of example, the provided pool comprises about 1010 or greater, about 1011 or greater, about 1012 or greater, or about 1013 or greater glycopolypeptides fused via puromycin linker to an encoding mRNA-cDNA duplex.
Creation of the first pool is carried out by first generating a library of DNA duplexes of sufficient length to afford a glycopeptide pool of the desired complexity. Each DNA duplex includes a promoter sequence to allow for transcription, optionally an enhancer element sequence, a sequence containing a ribosomal binding site that affords in vitro translation of mRNA transcripts, an open reading frame region that affords sequence variety to generate glycopolypeptide diversity, and a downstream sequence that encodes, e.g., a His tag followed by a constant region that serves as the linker for puromycin. Any suitable promoter and enhancer sequences suitable for in vitro transcription can be used, and any suitable ribosomal binding sequence can be used. Sequence variation can be introduced using random diversity at each site or semi-random diversity at each site.
As shown in
Use of puromycin at the 3′ region of the mRNA transcript allows for mRNA-display of the translated polypeptide based on the physical linkage of the polypeptide to the mRNA that encoded it. Puromycin inhibits translation by mimicking the substrate of the ribosome—the 3′ end of an aminoacyl-tRNA. As ribosomes complete the translation of individual mRNAs to the corresponding peptides they encounter the 3′ puromycin. Because puromycin is chemically similar to the 3′ end of aminoacyl-tRNA, it is recognized by the peptidyl transfer center of the ribosome, which catalyzes the transfer of the nascent polypeptide to the modified tyrosine of puromycin. The mRNA is now covalently attached to the corresponding translated peptide via the puromycin, and the ribosomes are stalled. To promote the covalent attached (or fusion) of the translated polypeptide to the encoding mRNA strand, the reaction mixture is preferably exposed to KCl and Mg(OAc)2 and then maintained at a temperature below 0° C. for sufficient duration to yield the fused product. At this point, the initial pool or library mRNAs have now been translated and linked via puromycin to the peptides that they encode in a stable molecular conjugate referred to as an mRNA-peptide fusion.
To facilitate glycosylation of the translated polypeptide, translation of the mRNA strand is carried out using one or more modified amino acids comprising a reactive side chain. One exemplary amino acid is homopropargylglycine, which is efficiently recognized for incorporation into the polypeptide corresponding to the location of Met codons. Thus, for purposes of translation, homopropargylglycine constitutes a modified methionine. Homopropargylglycine can be prepared using the procedures of Shimizu et al., Nat Biotech 19:751-755 (2001); Josephson et al., J. Am. Chem. Soc. 127:11727-11735 (2005); Guillen et al., J. Am. Chem. Soc. 134:10469-10477 (2012); Shimizu et al., Methods Mol Biol. Vol. 607, p 11-21 (2010); and Ma et al., Ribosome Display and Related Technologies; Douthwaite, J. A., Jackson, R. H., Eds.; Springer New York: Methods Mol Biol. Vol. 805, p 367-390 (2012), which are hereby incorporated by reference in their entirety. Other exemplary amino acids are p-azido-phenylalanine and p-ethynyl-phenylalanine, which are efficiently recognized for incorporation into the polypeptide corresponding to the location of Phe codons when the PheRS A294G substrate is used (see Hartmann et al., PlosOne DOI 10.1371/journal.pone.0000972 (2007), which is hereby incorporated by reference in its entirety. Yet another exemplary amino acid is L-allyl glycine which is efficiently recognized for incorporation into the polypeptide corresponding to the location of Leu codons when the editing deficient LeuRS D345A substrate is used. With modified amino acylated-tRNAs introduced into the reaction mixture in the absence of one or more natural amino acylated-tRNAs, the modified amino acids are introduced into the polypeptide chain (Guillen et al., J. Am. Chem. Soc. 134:10469-10477 (2012), which is hereby incorporated by reference in its entirety).
The resulting translated polypeptide can include any number of amino acids, preferably between about 10 to about 80 amino acids, more preferably between about 15 and about 70 amino acids. In certain embodiments, the polypeptide can include about 20 amino acids, about 25 amino acids, about 30 amino acids, about 35 amino acids, about 40 amino acids, about 45 amino acids, about 50 amino acids, about 55 amino acids, about 60 amino acids, or about 65 amino acids. The polypeptide can include one or more of the modified amino acid residues, preferably between about 2 to about 10 of the modified amino acid residues. In certain embodiments, the polypeptide can include 2 to 5 modified amino acids, or 6 to 10 modified amino acids.
The modified amino acids can be located at adjacent positions (i.e., where one modified amino acid is linked via peptide bond to another modified amino acid) or at nonadjacent positions (i.e., where no two modified amino acids are linked via peptide bond to one another). In certain embodiments, the resulting polypeptide includes a plurality of modified amino acids, some of which are adjacent to one another and some of which are not adjacent to another modified amino acid.
After forming the mRNA-polypeptide fusion, the one or more monosaccharides or oligosaccharides are attached using appropriate click chemistry reactions, which include thiol-ene reactions (reaction of a thiol bond across an alkene or alkyne by either a free radical or ionic mechanism) (see, e.g., Hoyle et. al., Angew. Chem. Int. Ed. 49:1540-1573 (2010), which is hereby incorporated by reference in its entirety) as well as azide-alkyne cycloaddition reactions (reaction of an azido group with a terminal or internal alkyne) (see, e.g., Temme et al., Chem. Eur. J. 19:17291-17295 (2013) and Hong et al., Angew. Chem. Int. Ed. 48:9879-9883 (2009), which are hereby incorporated by reference in their entirety).
The monosaccharide or oligosaccharide to be linked to the modified amino acid(s) of the polypeptide can be any saccharide modified with a click chemistry reactive group (e.g., thiol, azide, alkyne or alkene). Suitable monosaccharides include, without limitation glucose, galactose, mannose, arabinose, fucose, rhamnose, sialic acid, and N-acetyl-glucosamine.
Suitable oligosaccharides include branched or unbranched oligosaccharide that include at least 3 saccharide moieties, typically from about 3 saccharide moieties up to about 20 saccharide moieties. The saccharide moieties include those identified as suitable monosaccharides.
Exemplary N-linked glycan structures include high mannose N-glycans present in the human lung:
where saccharide subunits include N-acetylglucosamine and mannose as shown (Walther et al., PLOS Pathogens 9(3):e1003223 (2013), which is hereby incorporated by reference in its entirety).
Exemplary N-linked glycan structures recognized by HIV broadly neutralizing antibodies (PGT151-PGT158) include multi-antennary complex-type N-glycans with terminal galactose with and without sialic acid residues:
where saccharide subunits include N-acetylglucosamine, mannose, galactose, sialic acid, and fucose as shown (Walther et al., PLOS Pathogens 9(3):e1003223 (2013) and Falkowska et al., Immunity 40(5): 657-6688 (2014), which are hereby incorporated by reference in their entirety).
Additional exemplary N-linked glycan structures include hybrid-type glycans recognized by HIV antibody PG16:
where saccharide subunits include N-acetylglucosamine, mannose, galactose, and sialic acid (Pancera et al., Nature Struct Mol Biol. 20(7): 804-13 (2013), which is hereby incorporated by reference in its entirety).
Derivatization of the monosaccharides and/or oligosaccharides to introduce the reactive azido, alkynyl, alkenyl, or thiol group can be achieved using known procedures. See, e.g., Hoyle et al., Angew. Chem. Int. Ed. 49:1540-1573 (2010); Temme et al., Chem. Eur. J. 19:17291-17295 (2013); Hong et al., Angew. Chem. Int. Ed. 48:9879-9883 (2009); MacPherson et al., Angew. Chem. Int. Ed. 50:11238-11242 (2011); Kolb et al., Angew. Chem. Int. Ed. 40:2004-2021 (2001); Rostovtsev et al., Angew. Chem. Int. Ed. 41:2596-2599 (2002); Gierlich et al., Org. Lett. 8:3639-3642 (2006); Gierlich et al., Chem. Eur. J. 13:9486-9494 (2007), each of which is hereby incorporated by reference in its entirety).
Additional exemplary modified oligosaccharides (suitable for click reaction) include the following:
where A is the mono- or oligosaccharide,
As an alternative to the above structures bearing an azide functional group, equivalent structures can be created with alkynyl, alkenyl, or thiol functional groups.
Tumor-associated carbohydrates (“TACAs”) can be linked to lipids such as gangliosides, or to proteins such as mucins. Exemplary glycolipid TACAs includes GM2, GD2, GD3, fucosyl-GM1, Globo-H, and Lewisy (Ley) and the glycoprotein TACAs include the truncated Tn-, TF and sialylated Tn (STn)-antigens as well as Globo-H and Ley (Buscas et al., Chem Commun (Camb). (36): 5335-49 (2009), which is hereby incorporated by reference in its entirety):
These structures can be derivatized to include an azido, alkynyl, alkenyl, or thiol group using the procedures identified above.
An exemplary GPI glycan includes the synthetic non-toxic malarial GPI glycan structure NH2—CH2—CH2—PO4-(Manα1-2)6Manα1-2Manα-6Manα1-4G1cNH2α1-6myo-inositol-1,2-cyclic-phosphate (Schofield et al., Nature 418(6899):785-9 (2002), which is hereby incorporated by reference in its entirety):
This structure can be derivatized to include an azido, alkynyl, alkenyl, or thiol group using the procedures identified above.
As a result of the click reaction between the modified amino acid and the modified monosaccharide or oligosaccharide, the glycopolypeptide contains a linker molecule between the polypeptide chain and the monosaccharide or oligosaccharide. Exemplary linker molecules include, without limitation:
(resulting from the azide-alkyne reaction) or
(resulting from the alkene/alkyne-thiol reaction), wherein each of R1 and R2 is optionally a direct link or independently selected from the group consisting of a linear or branched C1 to C18 hydrocarbon that is saturated or mono- or poly-unsaturated, optionally interrupted by one or more non-adjacent —O—, —C(═O)—, or —NR4—; a substituted or unsubstituted C3 to C10 cycloalkandiyl, a substituted or unsubstituted aryl diradical; a substituted or unsubstituted heteroaryl diradical; a monosaccharide diradical; or a disaccharide diradical; R3 is optional and can be —O—, —S—, or —NR4—; and R4 is H or a C1 to C10 alkyl.
Although flexible linkers may be used, the linker between the monosaccharide/oligosaccharide and the modified amino acid(s) of the glycopeptide preferably includes or more cyclic moieties which offer some rigidity to the resulting glycosyl group.
After recovering the glycopolypeptide-mRNA fusion, a reverse transcription reaction procedure is performed using the mRNA strand as a template to form a cDNA strand. After synthesis of the cDNA strand, the resulting product includes the glycopolypeptide linked to the mRNA-cDNA duplex via puromycin. Collectively, these structures constitute the first pool available for selection against a target molecule.
Exemplary target molecules suitable for selection include those that bind to glycosylated naturally occurring proteins, such as monoclonal antibodies that bind to glycosylated epitopes (i.e., carbohydrate-binding monoclonal antibodies). Suitable carbohydrate-binding monoclonal antibodies include those that are neutralizing against a pathogen, as well as those that are cytotoxic against a cancer cell.
Exemplary carbohydrate-binding neutralizing monoclonal antibodies include those that bind specifically to N-glycosylated HIV gp120 or N-glycosylated HSV-2 gD. Specific examples of these neutralizing monoclonal antibodies include, without limitation, 2G12, PG9, PG16, PGT121, PGT122, PGT123, PGT125, PGT126, PGT127, PGT128, PGT129, PGT130, PGT131, PGT135, PGT136, PGT137, PGT141, PGT142, PGT143, PGT144, PGT145, PGT151, PGT152, PGT153, PGT154, PGT155, PGT156, PGT157, PGT158, CH01, CH02, CH03, CH04, 10-1074, 10-996, 10-1146, 10-847, 10-1341, 10-1121, 10-1130, 10-410, 10-303, 10-259, 10-1369, and E317.
Exemplary carbohydrate-binding cytotoxic monoclonal antibodies include those that binds specifically to O-glycosylated cancer-specific human podoplanin; aberrantly O-glycosylated cancer-specific MUC1, aberrantly O-glycosylated cancer-specific Integrin α3β1, or N-glycosylated cancer-specific antigen RAAG12. Specific examples of these cytotoxic monoclonal antibodies include, without limitation, LpMab-2 (Kato et al., Sci Rep. 4:5924 (2014), which is hereby incorporated by reference in its entirety), 237 MAb (Brooks et al., PNAS 107(22):10056-10061 (2010), which is hereby incorporated by reference in its entirety), RAV12 (Loo et al., Mol. Cancer Ther. 6(3):856-65 (2007), which is hereby incorporated by reference in its entirety), BCMab1 (Clinical Cancer Research 20(15):4001 (2014), which is hereby incorporated by reference in its entirety), DF3 and 115D8 (Tang et al., Clin Vaccine Immunol. 17(12): 1903-1908 (2010), which is hereby incorporated by reference in its entirety), huHMFG1, HT186-B7, -D11 and -G2 sc-FVs (Thie et al., PLoS One 6(1): e15921 (2011), which is hereby incorporated by reference in its entirety), and GOD3-2C4 (Welinder et al. Glycobiol. 21(8):1097-107 (2011), which is hereby incorporated by reference in its entirety).
Selection of library members that bind to the target protein—in the case of the monoclonal antibodies, mimicking the native glycosyl-epitope to which the antibody binds—is carried out in liquid medium. Briefly, the library is introduced into the selection medium with the target protein. If the target protein is biotinylated, streptavidin-labeled magnetic beads can be used to recover library members that bind to the target protein. Alternatively, where the target protein is a monoclonal antibody, Protein A or Protein G-labeled magnetic beads can be used to recover library members that bind to the target monoclonal antibody. Regardless of the type of beads used, the beads can be magnetically isolated and washed with selection buffer. To elute the selected library members, the beads can be resuspended in selection buffer and then heated to disrupt the affinity binding between library member and target. Recovered supernatant contains the eluted library members.
Following recovery of the selected library members, PCR amplification is used to amplify the cDNA portion of the library member mRNA-cDNA duplexes. PCR using Taq DNA polymerase (Roche) is performed using forward and reverse primers, and the amplified DNAs can be purified and used to regenerate the next selection round. In certain embodiments, error prone PCR can be used to facilitate evolution of the library.
In regenerating the next select round, the transcription, puromycin linkage, translation, and reverse transcription steps described above are used to generate a next generation pool (i.e., the glycopolypeptides linked mRNA-cDNA duplex via puromycin).
Differences in the selection protocol can performed in subsequent rounds. For instance, the selection stringency can be increased to promote the selection of high affinity binding of pool members. In certain embodiments the temperature can be varied from about 18 to 22° C. in early rounds to temperatures greater than 22° C. or even greater than 27° C. (e.g., about 32° C. to about 42° C.) in later rounds. Any such variation in temperature can be used. In alternative embodiments the target protein concentration can be varied from about 25 to about 200 nM in early rounds, and reduced to about 10 to about 80 nM, or about 5 to about 25 nM in later rounds. Any such variation in target protein concentration can be used. In certain embodiments the duration of the selection step can also be reduced from about 10 to about 30 minutes in early rounds, to about 5 to about 20 minutes in later rounds. Any such variation in duration of the selection step can be used. In another embodiment, the introduction of competitor molecules for negative selection can be introduced in later rounds, including the introduction of free monosaccharides or oligosaccharides, the introduction of unglycosylated peptides (removing polypeptides which bind to target protein without being glycosylated), the introduction of unmodified magnetic beads, e.g., streptavidin, Protein A, or Protein G-conjugated beads (removing polypeptides or glycopolypeptides that bind directly to a solid support), or combinations thereof. Any number of negative selection steps can be employed. In yet another embodiment, the number and conditions of the wash steps can be made more stringent during later selection rounds.
In between rounds or after the final round, the individual, selected pool members can be sequenced and, thus, the polypeptide sequence identified. Having identified the polypeptide sequence, individual glycopolypeptides can be synthesized such that the molecule excludes the puromycin linker that links the polypeptide sequence to the mRNA transcript encoding the same. Polypeptide synthesis can be carried out using, e.g., standard peptide synthesis operations. These include both FMOC (9-Fluorenylmethyloxy-carbonyl) and tBoc (tert-Butyl oxy carbonyl) synthesis protocols that can be carried out on automated solid phase peptide synthesis instruments including the Applied Biosystems 431A, 433A synthesizers and Peptide Technologies Symphony or large scale Sonata or CEM Liberty automated solid phase peptide synthesizers. The modified amino acids can be substituted during solid phase synthesis to allow for glycosylation in the same manner as the selected glycopolypeptides.
The amino acids used during synthesis can be L amino acids, D amino acids, or a mixture of L and D amino acids. As noted above, the length of the glycopolypeptide can be any length, but preferably between about 10 to about 80 amino acids.
The glycopolypeptides of the present invention include one or more of the modified amino acid residues having a sidechain comprising a monosaccharide or an oligosaccharide, and the glycopolypeptide binds specifically to a carbohydrate-binding monoclonal antibody with an affinity of less than 100 nM.
In certain embodiments, the glycopolypeptide binds specifically to the carbohydrate-binding monoclonal antibody with an affinity (Kd) of less than 90 nM, 80 nM, 70 nM, 60 nM, 50 nM, 40 nM, 30 nM, 20 nM, 10 nM, 9 nM, 8 nM, 7 nM, 6 nM, 5 nM, 4 nM, 3 nM, 2 nM, or 1 nM.
In preferred embodiments, the glycopolypeptide binds specifically to the carbohydrate-binding monoclonal antibody with an affinity that is substantially the same as or lower than the affinity of the carbohydrate-binding monoclonal antibody to its naturally occurring binding partner. As used herein, an affinity that is “substantially the same” means that as Kd of glycopeptide for its target is less than 5×, less than 4×, less than 3×, less than 2×, or less than 1.5× Kd of the native binding partner to the monoclonal antibody. In certain embodiments, the glycopolypeptide binds specifically to the carbohydrate-binding monoclonal antibody with an affinity that is lower than the affinity of the carbohydrate-binding monoclonal antibody to its naturally occurring binding partner.
Exemplary neutralizing monoclonal antibodies and cytotoxic monoclonal antibodies are identified above. Using the selection protocol and the demonstrated results presented in the accompanying Examples, the present application demonstrates that glycopolypeptides that bind specifically to carbohydrate-binding monoclonal antibodies can be prepared and it is expected that these will display higher affinity for the monoclonal antibody than the monoclonal antibody has for its binding partner.
In certain embodiments, the carbohydrate-binding monoclonal antibody is HIV-1 neutralizing monoclonal antibody 2G12 and the glycopolypeptide includes the sequence XXSIPXYTY (SEQ ID NO: 2) where X is optional and can be any amino acid and X is the modified amino acid residue to which the oligosaccharide is linked. The oligosaccharide consists of a branched Man9 moiety, which is linked via the click chemistry linker to the modified amino acids (in one embodiment that modified amino acid is a modified methionine such as homopropargyl-glycine).
Exemplary glycopolypeptides containing the consensus sequence of SEQ ID NO: 2 above include, without limitation,
XDTLHLKQIGGXPNCITQQDVRXTSIPYTYTWP
XLLKXVDQSRLXPVPGIGVTLHXRSIPYSYLPI
XRSTLNSLEYRXQYATEDPRIRXASIPYTYWWP
XATKTNFKREKTXDNHVTDCRSIPWYTYRWLPN
XATRTNCKREKTXDNHVTIXRSIPWYTYRWLPN
XATKTSCKREKTXDNHVTIXRSIPWYTYRWLPN
XVLPTIISTNVNPFRXLSIPTYTYLXPITWGEI
XTSIPYTYLNRSLWTNYRVNSWSXSKNVNVXPL
XERPSLXCGLSXLTSGGTQSSVXRSIPFYTYWW
XATKTN KREKTXDNHVTIXRSIPWYTYRWLPN
XATKTN KREKTXDNHVTIXRSIPWYTYRWLPN
XRSIPWYTYRWLPN
XDTLHLKQIGGXPN ITQQDVRXTSIPYTYTWP
In certain embodiments, the carbohydrate-binding monoclonal antibody is HIV-1 neutralizing monoclonal antibody 2G12 but the glycopolypeptide does not contain the consensus sequence of XXSIPXYTY (SEQ ID NO: 2). Exemplary glycopolypeptides that do not contain the consensus include, without limitation:
XHPYNTSRTSAXXAALKXQVTDXYALALFHRIL
XSPHLPVLLCKXVLNDGRRIVQXSCELPXVRRS
XLXFIRIYPTRXQYVYHAPLLTXVRXSPTGPLI
XCYVTVIPAXNXPEARLGIVCHXPGIRRGKALY
XSPHLPVLL KXVLNDGRRIVQXS
ELPXVRRS
XXAALKXQVTDXYALALFHRIL
wherein X is the modified amino residue to which the oligosaccharide is linked, in one embodiment that modified amino acid is a modified methionine such as homopropargylglycine.
In certain embodiments, the glycopolypeptide contains from three to five modified amino acid residues having a sidechain including a branched oligosaccharide containing 9 mannose moieties, wherein the glycopolypeptide binds specifically to HIV-1 neutralizing monoclonal antibody 2G12 with an affinity that is substantially the same as or lower than the affinity of the 2G12 antibody to gp120. Antibody 2G12 binds to gp120 with an affinity (KD) of 5.8 nM (Hoorelbeke et al., J. FEBS Lett. 587:860-866 (2013), which is hereby incorporated by reference in its entirety).
More preferred glycopolypeptides are those that bind specifically to the 2G12 antibody with a Kd value that is lower than 5 nM. Exemplary members of this embodiment include, without limitation, the following sequences:
XLXFIRIYPTRXQYVYHAPLLTXVRXSPTGPLI
XHPYNTSRTSAXXAALKXQVTDXYALALFHRIL
XCYVTVIPAXNXPEARLGIVCHXPGIRRGKALY
XSPHLPVLLCKXVLNDGRRIVQXSCELPXVRRS
XLLKXVDQSRLXPVPGIGVTLHXRSIPYSYLPI
XDTLHLKQIGGXPNCITQQDVRXTSIPYTYTWP
XRSTLNSLEYRXQYATEDPRIRXASIPYTYWWP
XATKTNCKREKTXDNHVTIXRSIPWYTYRWLPN
XTSIPYTYLNRSLWTNYRVNSWSXSKNVNVXPL
XVLPTIISTNVNPFRXLSIPTYTYLXPITWGEI
XSPHLPVLL KXVLNDGRRIVQXS
ELPXVRRS
XATKTN KREKTXDNHVTDCRSIPWYTYRWLPN
XATKTN KREKTXDNHVTIXRSIPWYTYRWLPN
XXAALKXQVTDXYALALFHRIL
XDTLHLKQIGGXPN ITQQDVRXTSIPYTYTWP
wherein X is the modified amino residue to which the oligosaccharide is linked, and in one embodiment that modified amino acid is a modified methionine such as homopropargylglycine. Of these, SEQ ID NOs: 13 and 15 exhibit the highest affinity with a KD of about 500 to 600 pM.
A further aspect of the invention relates to an immunogenic conjugate that includes a glycopolypeptide of the invention covalently or non-covalently bound to an immunogenic carrier molecule. Exemplary immunogenic carrier molecule include, without limitation, bovine serum albumin, chicken egg ovalbumin, keyhole limpet hemocyanin, tetanus toxoid, diphtheria toxoid, thyroglobulin, a pneumococcal capsular polysaccharide, CRM 197, and a meningococcal outer membrane protein.
Any of a variety of conjugation methodologies can be utilized. See, e.g., Jennings et al., J. Immunol. 127:1011-8 (1981); Beuvery et al., Infect. Immun 40:39-45 (1993), each of which is hereby incorporated by reference in its entirety. In one approach terminal aldehyde groups can be generated through periodate oxidation, and the aldehydes are then reacted through reductive amination with free amino groups on the protein, mostly lysines, in the presence of sodium cyanoborohydride. In another approach, a carbodiimide reaction is performed to covalently link carboxylic groups to the lysine ε-amino groups on the carrier protein. The activation sites in this method are more random, compared to periodate activation.
A further aspect of the invention relates to a pharmaceutical composition that includes a pharmaceutically acceptable carrier and a glycopolypeptide or immunogenic conjugate of the invention.
Pharmaceutical compositions suitable for injectable or parental use (e.g., intravenous, intra-arterial, intramuscular, etc.) or intranasal use may include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In all cases, the form should be sterile and should be fluid to the extent that easy syringability exists. It should be stable under the conditions of manufacture and storage and should be preserved against the contaminating action of microorganisms, such as bacteria and fungi. Suitable adjuvants, carriers and/or excipients, include, but are not limited to sterile liquids, such as water, saline solutions, and oils, with or without the addition of a surfactant and other pharmaceutically and physiologically acceptable carriers. Illustrative oils are those of petroleum, animal, vegetable, or synthetic origin, for example, peanut oil, soybean oil, or mineral oil. In general, water, saline, aqueous dextrose and related sugar solutions, and glycols, such as propylene glycol or polyethylene glycol, are preferred liquid carriers, particularly for injectable solutions.
The pharmaceutical compositions of the present invention may also be administered directly to the airways in the form of an aerosol. For use as aerosols, the compositions of the present invention in the form of a solution or suspension may be packaged in a pressurized aerosol container together with suitable propellants, for example, hydrocarbon propellants like propane, butane, or isobutane with conventional adjuvants. The pharmaceutical compositions of the present invention also may be administered in a non-pressurized form such as in a nebulizer or atomizer. Formulations suitable for intranasal nebulization or bronchial aerosolization delivery are also known and can be used in the present invention (see Lu & Hickey, “Pulmonary Vaccine Delivery,” Exp Rev Vaccines 6(2):213-226 (2007) and Alpar et al., “Biodegradable Mucoadhesive Particulates for Nasal and Pulmonary Antigen and DNA Delivery,” Adv Drug Deliv Rev 57(3):411-30 (2005), which are hereby incorporated by reference in their entirety.
The pharmaceutical compositions of the present invention can also include an effective amount of a separate adjuvant. Suitable adjuvants for use in the present invention include, without limitation, aluminum hydroxide, aluminum phosphate, aluminum potassium sulfate, beryllium sulfate, silica, kaolin, carbon, water-in-oil emulsions, oil-in-water emulsions, muramyl dipeptide, bacterial endotoxin, lipid, Quil A, non-infective Bordetella pertussis, QS-21, monophosphoryl lipid A, an alpha-galactosylceramide derivative, or PamCys-type lipids.
The choice of an adjuvant depends on the stability of the immunogenic formulation containing the adjuvant, the route of administration, the dosing schedule, the efficacy of the adjuvant for the species being vaccinated, and, in humans, a pharmaceutically acceptable adjuvant is one that has been approved or is approvable for human administration by pertinent regulatory bodies. For example, alum, MPL or Incomplete Freund's adjuvant (Chang et al., Advanced Drug Delivery Reviews 32:173-186 (1998), which is hereby incorporated by reference in its entirety) alone or optionally all combinations thereof are suitable for human administration.
The pharmaceutical compositions can also include one or more additives or preservatives, or both.
Effective amounts of the glycopolypeptide may vary depending upon many different factors, including mode of administration, target site, physiological state of the patient, other medications administered, and whether treatment is prophylactic or therapeutic. Treatment dosages need to be titrated to optimize safety and efficacy. The amount of glycopolypeptide immunogen depends on whether adjuvant is also administered, with higher dosages being required in the absence of adjuvant. The amount of a glycopolypeptide immunogen for administration sometimes varies from 1-5 mg per patient and more usually from 5-1000 μg per injection for human administration.
The glycopolypeptides, immunogenic conjugates, and pharmaceutical compositions can be incorporated into a delivery vehicle to facilitate administration. Such delivery vehicles include, but are not limited to, biodegradable microspheres (M
The glycopolypeptides, immunogenic conjugates, and pharmaceutical compositions can be used to induce an immune response in an individual. The individual can be any mammal, particularly a human, although veterinary usage is also contemplated. This method is carried out by administering one of these active agents to an individual in a manner that is effective to induce an immune response against the glycopolypeptide. Because the glycopolypeptide mimics the native glycosylated epitope of a native target of the monoclonal antibody to which the glycopolypeptide was selected, certain glycopolypeptides can induce a carbohydrate-binding, neutralizing antibody response that is protective against a pathogen (e.g., viral or bacterial pathogen) and certain other glycopolypeptides can induce a carbohydrate-binding, cytotoxic antibody response against a cancer cell that expresses a glycosylated antigen.
For each of these embodiments, administration of the glycopolypeptides, immunogenic conjugates, and/or pharmaceutical compositions can be carried orally, parenterally, subcutaneously, intravenously, intramuscularly, intraperitoneally, by intranasal instillation, by implantation, by intracavitary or intravesical instillation, intraarterially, intralesionally, transdermally, intra- or peri-tumorally, by application to mucous membranes, or by inhalation. Administration of these agents can be repeated periodically.
Exemplary viruses include, without limitation, Calicivirus, Chikungunya virus, Cytomegalovirus, Dengue virus, Eastern Equine Encephalitis virus, Ebola virus, Epstein-Barr virus, Hantaan virus, Hepatitis A virus, Hepatitis B virus, Hepatitis C virus, Hepatitis D virus, Hepatitis E virus, Herpes simplex virus, Human Immunodeficiency virus (HIV-1 or HIV-2), Human Papillomavirus, Influenza virus, Japanese encephalitis virus, Junin virus, Lassa virus, Marburg virus, Measles virus, Metapneumovirus, Nipah virus, Newcastle disease virus, Norwalk virus, Parainfluenza virus, Poliovirus, Rabies virus, Respiratory Syncytial virus, Rift Valley Fever virus, Rotavirus, Rubella virus, Sendai virus, Severe Acute Respiratory Syndrome (SARS Co-V), Tick-borne Encephalitis virus, Varicella zoster virus, Venezuelan Equine Encephalitis virus, Yellow Fever virus, Western Equine Encephalitis virus, and West Nile virus.
The use of one or more of the glycopeptides according to SEQ ID Nos: 3-16 in an immunogenic conjugate or pharmaceutical composition is specifically contemplated for prophylactic or therapeutic treatment against HIV-1.
Exemplary bacteria include, without limitation, Bacillus anthracis, Bordetella pertussis B, Borrelia burgdorferi, Chlamydia trachomatis, Clostridium difficile, Clostridium tetani, Candida albicans, Corynebacterium diphtherias, Cryptococcus neoformans, Entamoeba histolytica, Escherichia coli, Francisella tularensis, Haemophilus influenzae (nontypeable), Helicobacter pylori, Histoplasma capsulatum, Moraxella catarrhalis, Mycobacterium leprae, Mycobacterium tuberculosis, Neisseria gonorrheae, Neisseria meningitides, Pseudomonas aeruginosa, Staphylococcus aureus, Methicillin-resistant Staphylococcus aureus, Streptococcus agalactiae, Streptococcus pneumoniae, Streptococcus pyogenes, and Yersinia pestis.
For prophylactic treatment against viral or bacterial infection, it is intended that the glycopolypeptides, immunogenic conjugates, and pharmaceutical compositions of the present invention can be administered prior to exposure of an individual to the virus or bacteria and that the resulting immune response can inhibit or reduce the severity of the viral or bacterial infection such that the virus or bacteria can be eliminated from the individual. The glycopolypeptides, immunogenic conjugates, and pharmaceutical compositions of the present invention can also be administered to an individual for therapeutic treatment. In accordance with one embodiment, it is intended that the composition(s) of the present invention can be administered to an individual who is already exposed to the virus or bacteria. The resulting enhanced immune response can reduce the duration or severity of the existing viral or bacterial infection, as well as minimize any harmful consequences of untreated viral or bacterial infections. The composition(s) can also be administered in combination other therapeutic anti-viral or anti-bacterial regimen. In asymptomatic patients, treatment can begin at any age (e.g., 10, 20, 30 years of age). Treatment typically entails multiple dosages over a period of time. Treatment can be monitored by assaying antibody, or activated T-cell or B-cell responses to the therapeutic agent over time. If the response falls, a booster dosage is indicated.
The glycopolypeptides, immunogenic conjugates, and pharmaceutical compositions that induce a cytotoxic antibody response against a cancer cell antigen can be used to treat solid tumors and blood cancers (leukemia or lymphoma) that are characterized by expression of 0-glycosylated cancer-specific human podoplanin; aberrantly O-glycosylated cancer-specific MUC1, aberrantly O-glycosylated cancer-specific integrin α3β1, or N-glycosylated cancer-specific antigen RAAG12.
Exemplary cancers that display one of the glycosylated cancer-specific antigen include colorectal cancer, gastric cancer, ovarian cancer, breast cancer, and pancreatic cancer, which display N-glycosylated RAAG12; squamous cell carcinoma, lung and esophageal carcinoma, testicular seminoma, malignant brain tumor, fibrosarcoma, malignant mesothelioma, bladder cancers, and testicular cancers that display O-glycosylated ppodoplanin; bladder cancers that display O-glycosylated integrin α3β1; breast cancer, ovarian cancer, lung cancer, pancreatic cancer, prostate cancer, and forms of leukemia that displays aberrantly O-glycosylated MUC1.
For cancer therapy, it is contemplated that the glycopolypeptides, immunogenic conjugates, and pharmaceutical compositions can be administered in combination with a chemotherapeutic agent, a radiation therapy, or alternative immunotherapeutic agent. The specific selection of chemotherapeutic agent, a radiation therapy, or alternative immunotherapeutic agent will depend on the type of cancer. These agents can also be administered in combination with surgical resection to remove cancerous tissue, with treatment being carried out before, after, or both before and after surgery.
For inducing the immune response, the amount of a glycopolypeptide for administration sometimes varies from 1 μg-5 mg per patient and more usually from 5-1500 μg per dose for human administration. Occasionally, a higher dose of 1-2 mg per injection is used. Typically about 10, 20, 50, or 100 μg is used for each human dose. The mass of glycopolypeptide immunogen also depends on the mass ratio of immunogenic epitope within the glycopolypeptide immunogen to the mass of glycopolypeptide immunogen as a whole. Typically, 10−3 to 10−5 micromoles of immunogenic epitope are used for each microgram of glycopolypeptide immunogen. The timing of injections can vary significantly from once a day, to once a year, to once a decade. On any given day that a dosage of glycopolypeptide immunogen is given, the dosage is greater than 1 μg/patient and usually greater than 10 μg/patient if adjuvant is also administered, and greater than 10 μg/patient and usually greater than 100 μg/patient in the absence of adjuvant. A typical regimen consists of an immunization followed by booster administration at time intervals, such as 6 week intervals. Another regimen consists of an immunization followed by booster injections 1, 2, and 12 months later. Another regimen entails an administration every two months for a prolonged period in excess of 12 months. Alternatively, booster injections can be on an irregular basis as indicated by monitoring of immune response.
In certain embodiments, multiple doses are given over a period of time, each using a different immunogenic oligonucleotide in an appropriate amount, as indicated above.
The glycopolypeptides of the invention can also be used to detect a neutralizing antibody in a patient sample (e.g., a serum sample). This method includes providing a glycopolypeptide of the invention, contacting the glycopolypeptide with a sample from an individual; and detecting whether the glycopolypeptide binds specifically to an antibody present in the sample, wherein the detection of the antibody is carried out using a label.
Exemplary labels include, without limitation, a radiolabel, fluorescent label, enzymatic label, chemiluminescent marker, biotinyl group, an epitope recognized by a secondary reporter, a magnetic agent, or a toxin.
The detection step is preferably carried using a suitable assay format. Exemplary assays include, without limitation, ELISA, radioimmunoassay, gel-diffusion precipitation reaction assay, immunodiffusion assay, agglutination assay, fluorescent immunoassay, immunoelectrophoresis assay, surface plasmon resonance assay, or biolayer interferometry assay. In certainly of these assay formats, a secondary antibody is used to label the antibody bound specifically to the glycopolypeptide. Depending on the type of assay, the glycopolypeptide can be in the solution phase or coupled to a solid surface.
The following examples are intended to illustrate practice of the invention, and are not intended to limit the scope of the claimed invention.
Proteins and ribosomes for PURE system translation: Hexa-histidine tagged IF1, IF2, IF3, EF-Tu, EF-G, EF-Ts, RF1, RF3, RRF, MTF, MetRS, GluRS, PheRS, AspRS, SerRS, ThrRS, ArgRS, GlnRS, IleRS, LeuRS, TrpRS, AsnRS, HisRS, TyrRS, ValRS, ProRS, AlaRS, CysRS, LysRS, and GlyRS were expressed in Escherichia coli BL21 Star (DE3) (Invitrogen) and purified as previously described (Shimizu et al., Nat Biotech 19:751-755 (2001); Josephson et al., J. Am. Chem. Soc. 127:11727-11735 (2005); Shimizu et al., Methods Mol Biol. Vol. 607, p 11-21 (2010); and Ma et al., Ribosome Display and Related Technologies; Douthwaite, J. A., Jackson, R. H., Eds.; Springer New York: Methods Mol Biol. Vol. 805, p 367-390 (2012), which are hereby incorporated by reference in their entirety). Ribosomes were prepared combining the previously described protocols (Shimizu et al., Methods Mol Biol. Vol. 607, p 11-21 (2010); Subtelny et al., J. Am. Chem. Soc. 130:6131-6136 (2008); and Ohashi et al., Biochem. Biophys. Res. Commun. 352:270-276 (2007), which are hereby incorporated by reference in their entirety) with some modifications. E. coli A19 was grown and harvested as previously described (Subtelny et al., J. Am. Chem. Soc. 130:6131-6136 (2008), which is hereby incorporated by reference in its entirety). The pelleted cells were washed with ˜300 mL of suspension buffer (10 mM HEPES-KOH, pH 7.6, 10 mM magnesium acetate, 50 mM KCl, 7 mM β-mercaptoethanol) and spun at 5,000 g for 15 min. The pelleted cells were lysed in suspension buffer using a bead-beater and the cleared lysate was obtained by centrifuge (Subtelny et al., J. Am. Chem. Soc. 130:6131-6136 (2008), which is hereby incorporated by reference in its entirety). The supernatant (˜20 mL) was mixed with the same volume of suspension buffer containing 3 M (NH4)2SO4 and centrifuged at 36,000 g for 30 min. The resulted supernatant was filtered through a 0.45 μm membrane and subjected to FPLC purification to yield ribosomes as previously described (Shimizu et al., Methods Mol Biol. Vol. 607, p 11-21 (2010) and Ohashi et al., Biochem. Biophys. Res. Commun. 352:270-276 (2007), which are hereby incorporated by reference in their entirety).
PURE system translation: The PURE translation system with homopropar-gylglycine instead of methionine was prepared as previously described (Shimizu et al., Nat Biotech 19:751-755 (2001); Josephson et al., J. Am. Chem. Soc. 127:11727-11735 (2005); Guillen et al., J. Am. Chem. Soc. 134:10469-10477 (2012); Shimizu et al., Methods Mol Biol. Vol. 607, p 11-21 (2010); Ma et al., Ribosome Display and Related Technologies; Douthwaite & Jackson, Eds.; Springer New York: Methods Mol Biol. Vol. 805, p 367-390 (2012), which are hereby incorporated by reference in their entirety) with slight modifications. The reaction contained 50 mM HEPES-KOH (pH 7.6), 12 mM magnesium acetate, 2 mM spermidine, 100 mM potassium glutamate, 1 mM dithiothreitol (DTT), 1X Complete ULTRA, EDTA-free (Roche), 1 mM ATP, 1 mM GTP, 20 mM creatine phosphate (Calbiochem), 0.01 mg/l 10-formyl-5,6,7,8-tetrahydrofolic acid, 0.04 ABS280 creatine kinase (Roche), 0.85 units/mL nucleoside 5′-diphosphate kinase from bovine liver (Sigma), 6.8 units/mL myokinase from rabbit muscle (Sigma), 100 units/mL inorganic pyrophosphatase, 48 AB 5260 tRNA from E. coli MRE 600 (Roche), 20 μg/mL MTF, 10 μg/mL IF1, 40 μg/mL IF2, 10 μg/mL IF3, 10 μg/mL EF-Tu, 50 μg/mL EF-Ts, 50 μg/mL EF-G, 10 μg/mL RF1, 10 μg/mL RF3, 10 μg/mL RRF, 0.66 μM MetRS, 0.23 μM GluRS, 0.027 μM PheRS, 0.21 μM AspRS, 0.45 μM SerRS, 0.011 μM ThrRS, 0.021 μM ArgRS, 0.27 μM GlnRS, 0.11 μM IleRS, 0.093 μM LeuRS, 0.23 μM TrpRS, 0.094 μM AsnRS, 0.21 μM HisRS, 0.18 μM TyrRS, 0.089 μM ValRS, 0.031 μM ProRS, 0.070 μM AlaRS, 0.41 μM CysRS, 0.18 μM LysRS, 0.024 μM GlyRS, 1.2 μM ribosomes, a mixture of 17 natural amino acids (3 mM each), with methionine-, cysteine-, and histidine-omitted and pre-adjusted pH to 7.6 with KOH, and 3 mM L-homopropargylglycine (Chiralix). To label the peptide radioisotopically, the reactions also contained L-[35S]-cysteine (Perkin Elmer) or [2,5-3H]-L-histidine (Moravek Biochemicals) in concentrations totaling 0.002-3 mM together with non-radioactive cysteine/histidine. These reactions were assembled on ice and initiated by the addition of mRNA (0.5-1.0 μM), followed by incubation at 37° C. for 1 h for mRNA display or 2 h for individual free peptide translation.
Click reaction: This optimized procedure was used in rounds 2-10 of selection, and in preparation of individual peptides for binding studies. Mang-azide was synthesized as previously described (Temme et al., Chem. Eur. J. 19:17291-17295 (2013), which is hereby incorporated by reference in its entirety). The click reaction was performed combining the previously described protocols (Temme et al., Chem. Eur. J. 19:17291-17295 (2013) and Hong et al., Angew. Chem. Int. Ed. 48:9879-9883 (2009), which are hereby incorporated by reference in their entirety) with some modifications. The dry pellets of peptides or fusions in 0.5 mL microcentrifuge tubes were redissolved in 2.5 μL of 200 mM HEPES-KOH (pH 7.6) and 10 mM aminoguanidine hemisulfate (mixture A). In the case of fusions, ˜0.05 (v/v) Triton X-100 was also added to the solution. 2.5 μL of a freshly-prepared solution of 2 mM CuSO4, 2 mM Tris(3-hydroxypropyltriazolyl methyl)amine (THPTA) ligand and 6 mM Man9-azide was transferred to a capless 0.5 mL microcentrifuge tube (mixture B). 3 μL of freshly-prepared solution of 2.5 mM Man9-azide and 0.83 mM THPTA was added to a capless 0.5 mL microcentrifuge tube (mixture C). Sodium-L-ascorbate (less than 10 mg) was transferred to a capless 0.5 mL microcentrifuge tube. Then, the microcentrifuge tubes containing mixtures A, B and C, and sodium-L-ascorbate were purged under argon flow in the following manner. The microcentrifuge tubes were carefully positioned at the bottom of a 25 mL two-neck pear (pointy-bottom) flask. Positive argon pressure was applied through one neck, while a rubber septum with a purge needle was used to vent the system from the other neck. After 1 h of efflux, the septum was removed and, under Ar efflux, a pipette was inserted into the flask to add mixture B to mixture A. The sodium ascorbate was dissolved in degassed H2O to a final concentration of 100 mM, and 0.5 μL was added to the tube containing mixtures A and B. After recapping followed by 15 min of Ar purge, the vent needle was removed to keep the system under positive pressure. After an additional 1 h and 15 min, mixture C and an additional 0.25 μL of 100 mM sodium ascorbate was added to the reaction. After recapping and another 15 min of Ar purge, the vent needle was removed. After an additional 75 min, the click reaction mixture was taken out from the flask and quenched with 1.25 μL of 10 mM EDTA (pH 8.0). At this point, the total reaction volume was reduced to −2-3 μL due to evaporation.
mRNA Display selection: The libraries of glycopeptide-mRNA-DNA fusions were prepared by modifying the previously described protocol to prepare the unnatural peptide-mRNA-DNA fusions with PURE system (Guillen et al., J. Am. Chem. Soc. 134:10469-10477 (2012), which is hereby incorporated by reference in its entirety). The fusions were radiolabeled with 35S-cysteine (rounds 1 and 2) or 3H-histidine (rounds 3-10), and the yields in various purification steps were monitored by liquid scintillation counting. During the procedure, the integrity of the fusion formation was checked (
Preparation of puromycin-linked mRNA in round 1: The puromycin-linked mRNA for selection round 1 was prepared as follows. The antisense strands of synthetic library DNA (the Fixed library: 5′-CTAGCTACCTATAGCCGGTGGTGATGGTGGTGATGACCCAGAGAACCGGAGCCN30 CATN30CATN30CATTTAGCTGTCCTCCTTACTAAAGTTAACCCTATAGTGAGTCGTATTA-3′(SEQ ID NO: 17) and the Variable library: 5′-CTAGCTACCTATAGCCGGTGGTGATG GTGATGGTGGCCTAAGCTACCGGAGCC(SNn)32CATTTAGCTGTCCTCCTTACTAAAGTTA ACCCTATAGTGAGT CGTATTA (SEQ ID NO: 18), where uppercase N is an equimolecular mixture of G, A, T and C; S is an equimolecular mixture of G or C; lowercase n is a mixture of 40% T, 20% A, 20% G, and 20% C) were purchased from W. M. Keck Biotechnology Resource Laboratory, Yale University. The regions involved in the open reading frame in the constant regions of the two libraries were designed to have identical amino acid sequence but were not identical in nucleotide usage, so that the libraries would be PCR-amplified with different primer sets.
The Fixed and Variable library DNAs purified by denaturing polyacrylamide gel electrophoresis (PAGE), 780 and 300 pmol, respectively, were transcribed in the presence of 1.2 eq. of the DNA containing T7 promotor sequence (5′-TAATACGACTCACTATAGGGTT AACTTT AG-3′) (SEQ ID NO: 19) using MEGAshortscript kit (Ambion). The transcripts were purified by denaturing 5% PAGE and photo-crosslinked with puromycin-containing oligonucleotide XL-PSO, XuagccggugA15ZZACCP, where X is C6 psoralen, lowercase nucleotides have 2′OMe, uppercase A and C are DNA, Z is Spacer 9 and P is puromycin (W.M. Keck Biotechnology Resource Laboratory, Yale University), by 365 nm UV irradiation as previously described (Kurz et al., Nucleic Acids Res. 28:e83 (2000) and Seelig, B. Nat. Protocols 6:540-552 (2011), which are hereby incorporated by reference in their entirety).
Translation to form alkynyl peptide-mRNA fusions in round 1: The radiolabeled alkynyl peptide-mRNA fusions for round 1 selection were produced as follows. The peptide-mRNA fusions were translated from 1 μM RNA, of which ˜50% was crosslinked with the puromycin-containing oligonucleotide XL-PSO, in 5.2 mL PURE system translation reactions containing [35S]-cysteine for 1 h at 37° C. Following translation, KCl and magnesium acetate was added to facilitate fusion formation (Liu et al., RNA-Ligand Interactions, Part B; Academic Press Inc: San Diego, Methods Enzymol. Vol. 318, p 268-293 (2000), which is hereby incorporated by reference in its entirety), incubated for a 15 min at room temperature, and frozen as previously described (Josephson et al., J. Am. Chem. Soc. 127:11727-11735 (2005) and Guillen et al., J. Am. Chem. Soc. 134:10469-10477 (2012), which are hereby incorporated by reference in their entirety).
Purification and cDNA synthesis of fusions in round 1: The mRNA-peptide fusions were captured on oligo(dT) cellulose (Ambion), washed as previously described (Seelig, B. Nat. Protocols 6:540-552 (2011), which is hereby incorporated by reference in its entirety), and eluted with 0.1% (v/v) Tween-20 followed by 0.22 μm-filtration and ethanol precipitation. The recovered library fusions were purified with Ni-NTA agarose (Qiagen) under a denaturing condition to remove mRNA not fused with peptide using a similar procedure as previously described (Guillen et al., J. Am. Chem. Soc. 134:10469-10477 (2012), which is hereby incorporated by reference in its entirety), and desalted by gel filtration using NAP-5 columns (GE Healthcare) with the gel filtration buffer (10 mM Tris-HCl, pH 7.5, 1 mM EDTA, pH 8.0, 5 mM β-mercaptoethanol, 0.2% (v/v) Triton X-100) according to the manufacturer's protocol. The fusions were pelleted by ethanol precipitation and cDNA was synthesized using Superscript III Reverse Transcriptase (Invitrogen) with RT primers (5′-T15GTGATGGTGGTGATGACCC AGAG-3′ (SEQ ID NO: 20) for the Fixed library, 5′-T15GTGATGGTGATGGTGGCCTAAGC-3′ (SEQ ID NO: 21) for the Variable library) in the presence of Superase-In (Ambion) and 0.1% (v/v) Triton X-100 according to the manufacturer's protocol. The reverse transcribed fusions were pelleted by ethanol precipitation.
Click glycosylation of fusions in round 1: In round 1, the click reaction of fusions was not yet optimized and had to be done twice to give the desired glycosylation efficiency. The first click reaction was done under Ar with a setting as described in the section of “Click reaction” but with slightly different conditions: The starting volume was ˜6 times larger, THPTA concentration was twice, and the addition of THPTA, Man9-azide and sodium ascorbate in the middle of the reaction was not carried out. Since some insoluble pellets were observed at this point, the pellets were collected after click reaction by centrifugation and purified with Ni-NTA agarose under denaturing condition as described above. The eluted fusions were combined with the saved soluble fractions and desalted by gel filtration and ethanol precipitation. The recovered fusions were re-subjected to glycosylation using a condition similar to the optimized protocol as described in the section entitled “Click reaction” and then ethanol-precipitated.
Selection in round 1: The pellets of glycosylated peptide-mRNA-cDNA fusions were redissolved in 500 μL of selection buffer (20 mM Tris-HCl, pH 7.5, 100 mM NaCl, 0.1% v/v Triton X-100). The Fixed and Variable library fusions (yields of 23.0 and 14.4 pmol, equivalent to 1.4×1013 and 0.86×1013 sequences, respectively) were individually incubated with 100 nM 2G12 (Polymun Scientific) in 500 μL of selection buffer at room temperature. 100 μL of 30 mg/mL Dynabeads Protein G magnetic beads (Invitrogen) in selection buffer was added to the mixture and kept suspended by tumbling for 20 min at room temperature to capture complexes. The beads were magnetically isolated and washed with 3×500 μL of selection buffer. To elute the 2G12-binding fusions, the beads were resuspended in 100 μL of selection buffer, heated at 70° C. for 30 min, chilled on ice for 5 min and incubated at room temperature for 10 min with tumbling. The supernatant was recovered and the beads were rinsed with 2×100 μL of selection buffer. These solutions were combined as an eluted fraction.
PCR amplification of cDNA of selected fusions in round: The cDNAs of eluted fractions were amplified by PCR using Taq DNA polymerase (Roche) with the forward primer (Library FP1 5′-TAATACGACTCACTATAGGGTTAACTTTAGTAAGGAGG-3′, SEQ ID NO: 22) and the reverse primer (5′-CTAGCTACCTATAGCCGGTGGTGATGGTGGTGA TGACCCAGAG-3′, SEQ ID NO: 23 for the Fixed library); 5′-CTAGCTACCTATAGCCGG TGGTGATGGTGATGGTGGCCTAAGC-3′, SEQ ID NO: 24 for the Variable library). The amplified DNAs were purified by phenol extraction and ethanol precipitation, and used for the transcription of the next selection round.
Modification of the procedures in rounds 2-10 and sequencing. The fusion preparation and purification procedures were repeated for 10 rounds except for the following changes. In rounds 3-10, the transcripts were purified using MEGAclear kit (Ambion) and crosslinked with XL-PSO. The puromycin-modified RNA was then purified with denaturing PAGE with the visualization of Gel Indicator RNA Staining Solution (Biodynamics Laboratory) and 0.5 μM was used in translation reaction in the presence of 3H-histidine. In rounds 2-10, the translation volume was reduced to 0.22-0.52 mL and purifications and following procedures were scaled accordingly. Ni-NTA agarose affinity purification was done only once after oligo(dT) cellulose purification, except in round 2, in which fusions after reverse transcription were re-purified with Ni-NTA agarose and desalted as described above. In round 2 and all subsequent rounds, the click reactions were done only once in the same or similar conditions as described in the “click reaction” section. In the selection parts, the essential differences of the conditions between selection rounds were as summarized in
Nuclease-digestion of library fusions: To monitor the number of glycans on the peptides in the fusions in every selection round, a part of the cDNA-RNA-glycopeptide fusions (0.05-1 pmol) was removed after the click reaction and desalted by ethanol precipitation in the presence of linear acrylamide carrier (Ambion). The recovered fusions were diluted in 6-7 μL of 200 mM ammonium acetate (pH 5.3) with 1 unit of nuclease P1 (Sigma), and incubated at 37° C. for 1 h to digest nucleic acids. Then, the solutions were neutralized with Tris buffer and analyzed by SDS-PAGE.
Preparation of individual peptides and glycopeptides: To generate peptides from individual clones, the plasmids were used as templates for PCR with primer sets (library FP1 and 5′-CTAGCTACCTATTTGTCATCGTCGTCTTTATAATCCCGGTGGTGATGGTGGTGA TGACCCAG-3′, SEQ ID NO: 25 for the Fixed library members or CTAGCTACCTATTTG TCATCGTCGTCTTTATAATCCCGGTGGTGATGGTGATGGTGGCCTAA-3′, SEQ ID NO: 26 for the Variable library members) and the PCR products were used for T7 transcription. The resulting mRNAs were purified by denaturing PAGE or MEGAclear kit (Ambion), and 1 μM RNA was used in PURE system translation (reaction volume of translation varied). Typically, 25 μL of translated reaction was diluted with 100 μL of binding buffer (50 mM Tris-HCl, pH 7.8, 300 mM NaCl, 5 mM β-mercaptoethanol) and 25 μL of Ni-NTA agarose suspension (Qiagen), and tumbled at room temperature for 1 h. The resins were transferred to 0.22 μm spin-filter rinsing with 100 μL of bind buffer, and washed with 3×200 μL of bind buffer and 2×200 μL of wash buffer (50 mM Tris-HCl, pH 7.8, 5 mM β-mercaptoethanol). The bound peptides were eluted with 2×25 μL of 0.1% TFA. The eluted peptides were analyzed by MALDI-TOF MS, using α-Cyano-4-hydroxycinnamic acid matrix (Sigma), with or without desalting with ZipTip C18 resin (Millipore). For calibration of MALDI-TOF-MS, at least two of the following standards, bovine insulin, E. coli thioredoxin and/or horse apomyoglobin were used. To quantitate peptide yields, the radioactivities were measured by liquid scintillation counting. For the click reaction, the translated and purified peptides were mixed with 0.1% (v/v) Triton X-100, and then dialyzed against H2O containing 0.1% (v/v) Triton X-100 using Slide-A-Lyzer MINI Dialysis Devices, 3.5K MWCO (Thermo Scientific) overnight to desalt. After dialysis, the peptides were divided into two portions: one was glycosylated via the click reaction, while the other was saved as a non-glycosylated peptide control. The peptides to be glycosylated (typically less than 5 pmol) were evaporated by speedvac in a 0.5 mL microcentrifuge tube for use in click glycosylation. Since the efficiency of the click reaction was not always high with round 10 winners, crude glycosylated peptides were subjected to 2G12 affinity purification to obtain the highest-clicked fraction, as follows. The glycosylated peptide (<4 pmol) was incubated with 100 nM 2G12 in selection buffer (40 μL) at room temp. The solution was then tumbled 30 min with 0.12 mg of equilibrated Dynabeads Protein G to capture 2G12-glycopeptide complex. Beads were then washed with 3×40 μL of selection buffer and resuspended in 10 μL of selection buffer. The resuspended beads were heated at 70° C. for 30 min to denature 2G12 and elute glycopeptides, chilled on ice for 5 min, and tumbled at room temperature for 10 min. The magnetically isolated supernatant was recovered and the beads were rinsed with 10 μL of selection buffer. The supernatant and the rinsed solution were combined as the purified glycopeptide fraction, and the yields were measured by liquid scintillation counting (the recovery of radioactivity was typically in a range of 25-55% of input radioactivity).
SDS-PAGE of nuclease-digested fusions and glycopeptides: Unless otherwise noted, SDS-PAGE of nuclease-digested fusions and glycopeptides was done as follows. A 4-20% gradient precast gel (Bio-Rad) was run using a rapid protocol (300 V for 16-20 min). Precision Plus Protein Dual Xtra Standards (Bio-Rad) were used as a molecular weight marker. To visualize the 35S-labeled peptides by autoradiography, gels were soaked in fixing solution (22.5% acetic acid and 5% ethanol) with shaking for 15 min, dried on filter paper, and exposed to a phosphorimager screen to analyze using Storm Phosphorimager (Amersham). To visualize the 35H-labeled peptides by fluorography, gels were treated with NAMP100 Amplify Fluorographic Reagent (GE Healthcare) according to the manufacture's protocol, then dried and exposed to X-ray films at −80° C.
Binding curve and KD determination of 2G12-glycopeptide interaction: For round 10 winners, 0.12-0.2 nM radioactive glycopeptides were incubated with 0, 0.25, 0.5, 1, 2, 4, 8, 16, 32 or 64 nM 2G12 in 40 μL of selection buffer at room temperature for 1 h. Then, the solution was added to 0.12 mg of pre-equilibrated Dynabeads Protein G and tumbled at room temperature for 30 min. The supernatant was removed and the beads were washed with 3×40 μL of selection buffer. The radioactivities of the supernatant and wash solutions were measured by liquid scintillation counting as unbound fractions. Since the direct usage of the captured glycopeptides on the beads in liquid scintillation counting partially suppressed the radioactivity detection in the case of 3H-label, the bound glycopeptides were eluted and separated from the beads in a following manner. The beads were resuspended in 40 μL of selection buffer, heated at 70° C. for 30 min to elute the bound glycopeptides, chilled on ice for 5 min, and tumbled at room temperature for 10 min. The supernatant was removed, and the beads were washed with 40 μL of selection buffer and resuspended in 40 μL of selection buffer. The radioactivities of these solutions and suspensions were measured by liquid scintillation counting separately and the values were combined as apparent bound fractions. The measured radioactivity of the fraction which bound to the beads without 2G12 (ranging from 0-6% of the total radioactivity in the assay) was subtracted as background from the radioactivity bound to the beads with 2G12, and the difference was divided by the total radioactivity to determine the percentages bound to 2G12. For glycosylated and non-glycosylated 7V8, the same procedure was done except for the following changes: the volume of each solution was reduced to 30 μL, 2 nM radioactive glycopeptide was incubated with 0, 3.125, 6.25, 12.5, 25, 50, or 100 nM 2G12, and 0.18 mg Dynabeads Protein G was used to capture 2G12. All experiments were done at least in triplicate. KDs were calculated as described in the footnote of Table 4 (below).
Analysis of competition of glycopeptides and gp120 or mannose for 2G12-binding and non glycosylated peptide binding to 2G12 of round 10 winners: The procedure was essentially same as described in the previous section with slight modification as follows. The volume of binding reaction was 20-30 μL and other volumes were also adjusted accordingly. 200 nM 2G12 in selection buffer was pre-mixed with or without 400 nM 6×His-tagged gp120(JRFL)(HIV-1) (Immune Technology) or 1 M mannose, and further mixed with the same volume of 0.4 nM radioactive glycopeptides or non-glycosylated peptides for binding reaction. The solutions were incubated at 37° C. for 30 min to equilibrate binding competition and then incubated at room temperature for 30 min to stabilize the complexes. Pre-equilibrated protein G magnetic beads were added to give a final concentration of 6 mg/mL. The separation of unbound fractions and bound fractions was done as described above, except that 0.5 M mannose was added to the washing solution in the case of mannose competition. All experiments were done 3× or more.
Preparation of synthetic peptide 10F2 (1): The unglycosylated peptide 10F2, fXHPYNTSRTSAXXAALKXQVTDXYALALFHRIL-GSGSGC(StBu)A, SEQ ID NO: 60 where f=formyl and X=homopropargylglycine, was prepared by Fmoc solid-phase peptide synthesis using Pentelute's recent rapid flow-based method (Simon et al., ChemBioChem Early View DOI: 10.1002/cbic.201300796 (2014) which is hereby incorporated by reference in its entirety). 76 mg (25 μmol scale) of trityl chemmatrix resin, loaded with 0.33 meq/g alanine by standard procedures (Chan et al., Fmoc Solid Phase Peptide Synthesis; Oxford University Press: Oxford, UK (2000), which is hereby incorporated by reference in its entirety), was subjected to 39 cycles of peptide coupling and Fmoc deprotection, with thermal heating to 60° C. (see Table 1 for detailed conditions).
Cysteine and histidine couplings were performed with a lower base concentration to avoid racemization and homopropargylglycine couplings were performed as batch reactions to conserve amino acid. After N-terminal formylationp-nitrophenyl formate, the peptide was cleaved and deprotected using cleavage cocktail B (87.5/5/5/2.5 TFA/water/Phenol/iPr3SiH), and the peptide was triturated four times with cold ether to afford 38 mg of crude solid. 5 mg of this was redissolved in 200 μL DMSO, diluted with 200 μL water, and purified by RP HPLC (Waters Symmetry 300 C4, 5 μm, 10×250 mm, 4 mL/min, 2-42% MeCN in H2O w/0.1% Formic Acid, over 60 min, retention time 52 min) to afford 1.5 mg of product, corresponding to an overall SPPS yield of 11% if the whole batch had been purified. LR ESI-MS: obs. average base peaks 868.79 [M+5H]5+, 1085.75 [M+4H]4+, 1447.23 [M+3H]3+, corresponding to 4338.9 obs. average mass, calc. average mass 4339.9.
The general coupling procedure follows Pentulute's procedure (Simon et al., ChemBioChem Early View DOI:10.1002/cbic.201300796 (2014), which is hereby incorporated by reference in its entirety) with modifications. After coupling and after Fmoc deprotection, the resin was washed with 20 ml of DMF at a flow rate of 10 ml/min. Fmoc deprotection was carried out at flow rate of 10 ml/min. Fmoc deprotection solution was 20% piperidine in DMF up until the coupling of aspartic acid, after which a solution of 19% piperidine/1% formic acid in DMF was used to prevent aspartimide formation.
Fmoc-Cys(StBu)-OH and Fmoc-HPG-OH were coupled outside of the reactor. Swelled resin was transferred to a 15 mL conical tube with a stir bar. 0.15 mmol amino acid and 0.15 mmol HATU were dissolved in 425 μL DMF, and 75 μL DIPEA was added just before adding to resin. The coupling reaction was allowed to take place under nitrogen for 10 minutes at 60° C. with stirring. After the reaction, the resin was transferred to the reactor for washing and Fmoc deprotection.
After peptide synthesis was complete, the N-terminus was formylated. The swelled resin was transferred to a 15 ml conical tube with a stir bar. 0.25 mmol 4-nitrophenylformate was dissolved in 632 μl DMF (0.33 M final). 125 μL DIPEA (0.86 M final) was added just before addition. Formylation was allowed to occur at 60° C. for 8 minutes while stirring under nitrogen. Next, the supernatant was removed, fresh reagents were added, and formylation was repeated. This was done again for a total of 3-8 minute periods. After the reaction, the resin was washed with DMF 5×10 ml and DCM 3×10 ml.
The peptide was cleaved from the resin with 10 ml of a cleavage cocktail B containing 87.5/5/5/2.5 TFA/phenol/water/TIPS. The resin and cocktail were tumbled at room temperature for 90 minutes. The resin was filtered and washed 3×4 ml DCM. The filtrate was concentrated by rotary evaporation and transferred to a 15 ml conical tube. The peptide was triturated with 5×10 ml cold ether to give 35 mg crude peptide.
4.5 mg of crude peptide was purified by HPLC on a Waters Symmetry300 C4 column (4.6×250 mm, 5 μm particle size) following a 98% A/2% B to 58% A/42% B gradient over 60 minutes with a flow rate of 4 ml/min, where solvent A is water/0.1% formic acid and solvent B is acetonitrile/0.1% formic acid.
Glycosylation of synthetic peptide 10F2: 10F2 peptide (0.6 mg, 0.14 μmol, 1 equiv.) and Man9-azide (1.5 mg, 0.97 μmol, 7.0 equiv.) were combined in a 0.5 mL Eppendorf tube by evaporation of stock solutions (tube A). A second tube was prepared, containing 9.8 μL (0.98 μmol, 3.0 equiv.) of a 100 mM solution of THPTA ligand and 9.0 μL (0.90 μmol, 2.8 equiv.) of a 100 mM solution of CuSO4 (tube B), and the tube was evaporated to dryness. Sodium ascorbate (3.0 mg, 15.2 μmol, 47 equiv.) was placed in a third tube (tube C). The three tubes were placed in a 2-neck pear (pointy-bottom) flask, and nitrogen atmosphere was established by cycles of vacuum and nitrogen refill. Under nitrogen efflux, 150 μL DMSO (degassed by freeze-pump-thaw) was added to dissolve the peptide and sugar in tube A, and 75 μL H2O (degassed by freeze-pump-thaw) was added to dissolve the contents of each of tubes B and C. The contents of tube B, and then tube C, were transferred by syringe to tube A. The resulting homogenous mixture was allowed to react under nitrogen atmosphere for 20 hours, at which time UPLC/MS analysis showed nearly complete conversion. The reaction was quenched by addition of TMEDA (1.5 μL, 3.22 μmol, 10 equiv.) and concentrated in vacuo. The residue was purified by RP-HPLC (same column and gradient method as for the unglycosylated 10F2 peptide, retention time 45 min) to afford pure glycopeptide 2. ESI-HRMS: obs. base peaks: 2058.0088 [M+6H]6+, 2469.4028 [M+5H]5+, 3086.7759 [M+4H]4+, deconvoluted mass 12334.962, calc. 12334.980±0.128.
Biotinylation of 10F2 glycopeptide and determination of 2G12 binding by BLI (BioLayer Interferometry): 200 μg 10F2 glycopeptide in 5.5 μL water was treated with 6.5 mL of 50 mM TCEP.HCl/1M Tris-HCl buffer, pH 7.8, under argon, using the same inert gas setup employed in the click procedure. After 4.5 h, the reaction mixture was injected into HPLC (Waters Symmetry, 300 C4, 5 μm, 4.6×250 mm, 1 mL/min, 2-42% over 60 min, retention time 46.8 min).
The 2G12 binding of the resulting biotinylated glycopeptide 3 was determined using a BLItz instrument (Fortebio). Biotin-10F2 was loaded (120 sec) onto a streptavidin biosensor as a 500 nM solution in Buffer 1 (20 mM Tris pH 7.5, 150 mM NaCl, 2 mM MgSO4, 0.20 mg/mL BSA, 0.02% Tween-20). The sensor was washed with Buffer 1 for 60 sec, after which time the net response due to loading was observed as 0.2 nm. The sensor was then equilibrated with Buffer 2 (20 mM Tris pH 7.5, 150 mM NaCl, 2 mM MgSO4, 2.0 mg/mL BSA, 0.1% v/v Tween-20) for 90 sec. 2G12 (prepared in Buffer 2) was associated at several concentrations (0.5, 1, 2, 4, 8, 16, 32 nM, in random order) for 600 sec, followed by dissociation into blank Buffer 2 for 600 sec. After each 2G12 dissociation, the sensor was regenerated to remove remaining 2G12 by treatment with buffer 3 (10 mM glycine-HCl, pH 2.5) for 120 sec, followed by 60 sec of wash with Buffer 1 and further washes to re-equilibrate the tip with Buffer 2. Throughout the experiment, the shake rate was set at 1800 rpm. The use of Buffer 2 (with high BSA) was important during association/dissociation to prevent nonspecific 2G12/streptavidin interactions, while Buffer 1 (low BSA) was required during loading of the glycopeptide to the sensor surface. To further correct for residual non-specific interactions, the data was referenced to a blank run using 0.5 nM 2G12 on a sensor containing no loaded peptide. The data was fit to a 1:1 binding model, yielding rate constants of k0=11.1±0.4×104M−1 s−1 and koff=1.51±0.02×10−4 s−1, corresponding to a KD of 1.37±0.02 nM (Table 2).
Two libraries of −33-mer peptides with glycosylation sites located either in “Fixed” or “Variable” locations were employed. The Fixed library (
These libraries of −1013 sequences were subjected in parallel to 10 rounds of selection for binding to 2G12. mRNA-displayed-glycopeptides were incubated with successively lower concentrations of 2G12, and bound complexes were retrieved from solution alternately with Protein A or Protein G magnetic beads. Bound fusions were eluted by heating, in which the gp120-binding activity of 2G12 was selectively inactivated without harming the nucleic acid tags (
By the end of round 7, library binding to 100 nM 2G12 had grown to a high level. However, an undesired trend toward very high multivalency was also observed throughout these room-temperature selection rounds. This can be seen by SDS-PAGE of the nuclease P1-digested library just prior to each selection round (
XYYLSVYPSYSXYFSSSYVVWPXPGHRLLIGLE
XXEHKLTXLPLXSTDIFLVLLXXFGTTITQVSL
XYLPDWXLKSLXLSKWRLPEXFXSPFXLELEIXS
XLTNITLQXSRXEILLWLHXHDLXXDLCRIXLRS
XVLTPTTKXXVXQSPXYFXRSNXLSKXYDYQRL
XXIXNSXRIDVXXSNFVHAKSTXVGQRHXGGVG
XSXTXQFSHFWXRHXWESXNRWXLARTXDTPID
XXCHCLPSHYXXLRFCPXTGSVXDXGLKRXVYH
XAKFDEXXAXLNXSRXSSYLXXLXTGRTWPH
XTFEXLPRSDSXRXLTXPXXEIRXYXIYRGYSNR
XSYSXSPRDPNXXIKFLXSRTXXRNPXNVIGSX
XHISTNCXPWRYWSIICXXPTWKTVHQXXKTKD
XCSRKXACLSRANLXRXRSXXKRRXTXNTSFTX
XIRXRTPTSRLXSTXRGXTXNXTSXITPRNDXI
XTPFTXAYXTRRKPXXFPIXEIRXKSRTPLXXGK
XKXNXRIWNPXXNNWSXDTASXLRLXSWXLNXX
XTSIXDNTXXLSVNXNRXKINRTLXXXXHXSTX
XCXKXYAPNXYDLXPXRXHWXPNVLXPLXSXRX
aOnly the sequence of the random region (position 1-33) is shown. All peptide sequences used in the 2G12-binding assay were followed by a linker, a His6-tag and a FLAG-tag (GSGSLGHHHHHHRDYKDDDDK, SEQ ID NO: 1) for purification and radiolabeling purposes.
One of these, peptide 7V8 (SEQ ID NO: 40), exhibited a KD of 17 nM for binding to 2G12 (see Table 4). Although this 2G12 recognition is tighter than that of most reported oligomannose clusters (Ni et al., Bioconjugate Chem. 17:493-500 (2006); Joyce et al., Proc. Natl. Acad. Sci. U.S.A. 105:15684-15689 (2008); Astronomo et al., J. Virol. 82:6359-6368 (2008); Astronomo et al., Chem. Biol. 17:357-370 (2010); Luallen et al., J. Virol. 82:6447-6457 (2008); Luallen et al., J. Virol. 83:4861-4870 (2009); Agrawal-Gamse et al., J. Virol. 85:470-480 (2011); Ciobanu et al., Chem. Commun. 47:9321-9323 (2011); Marradi et al., J. Mol. Biol. 410:798-810 (2011); Li et al., Org. Biomol. Chem. 1:3507-3513 (2003); Li et al., Org. Biomol. Chem. 2:483-488 (2004); Wang et al., Chem. Biol. 11:127-134 (2004); Krauss et al., J. Am. Chem. Soc. 129:11042-11044 (2007); Wang et al., Org. Biomol. Chem. 5:1529-1540 (2007); Wang et al., Proc. Natl. Acad. Sci. USA. 105:3690-3695 (2008); Gorska et al., Angew. Chem. Int. Ed. 48:7695-7700 (2009); Doores et al., Proc. Natl. Acad. Sci. U.S.A. 107:17107-17112 (2010); and Clark et al., Chem. Biol. 19:254-263 (2012), which are hereby incorporated by reference in their entirety). 6-10 glycans is far more than the 3 or 4 gp120 glycans thought to be involved in 2G12 binding (Scanlan et al., J. Virol. 76:7306-7321 (2002); Calarese et al., Science 300:2065-2071 (2003); and Calarese et al. Proc. Natl. Acad. Sci. U.S.A. 102:13372-13377 (2005), which are hereby incorporated by reference in their entirety). Moreover, none of the sequences obtained were replicates, indicating that the library had not yet converged to the best possible sequences. For this reason, selection was continued for additional rounds.
Given the high multivalency concerns, subsequent selection rounds were carried out at 37° C. because of a striking temperature effect observed in related studies with SELMA selection of glycosylated DNA libraries (Temme et al., J. Am. Chem. Soc. 136:1726-1729 (2014), which is hereby incorporated by reference in its entirety). In that work, increasing the temperature of the 2G12 selection step to 37° C. was found to dramatically favor sequences with lower multivalency and much stronger binding. After applying this modification to the next three rounds of glycopeptide selection, a parallel trend in the results was observed: low-valent binders—barely visible in the whole-library gel at the beginning of round 8—completely took over both libraries (
The selected round 10 glycopeptides are listed in Table 4, along with their measured binding affinity for 2G12.
XQTACPSPAFLXLSRSAHYFHAXHPTSAAPDIS
XIRXRTPTSRLXSTXRGXTXNXTSXITPRNDXI
XLXFIRIYPTRXQYVYHAPLLTXVRXSPTGPLI
XHPYNTSRTSAXXAALKXOVTDXYALALFHRIL
XCYVTVIPAXNXPEARLGIVCHXPGIRRGKALY
XSPHLPVLLCKXVLNDGRRIVQXSCELPXVRRS
XLLKXVDQSRLXPVPGIGVTLHXRSIPYSYLPI
XDTLHLKQIGGXPNCITQQDVRXTSIPYTYTWP
XRSTLNSLEYRXQYATEDPRIRXASIPYTYWWP
XATKTNCKREKTXDNHVTIXRSIPWYTYRWLPN
XTSIPYTYLNRSLWTNYRVNSWSXSKNVNVXPL
XVLPTIISTNVNPFRXLSIPTYTYLXPITWGEI
aOnly the sequence of the random region (position 1-33) is shown. All peptide sequences used in the 2G12-binding assay were preceded by an N-terminal formyl group and followed by a linker, a His6-tag and a FLAG-tag (GSGSLGHHHHHHRDYKDDDDK, SEQ ID NO: 1) for purification and radiolabeling purposes. “X” denotes potential Man9-glycosylation sites encoded by the AUG codon.
b,cIn the assay, the peptides were radiolabeled with either 35S-cysteine or 3H-histidine as described above, and incubated with various concentrations of 2G12, and 2G12-peptide complexes were isolated with magnetic protein G beads. Percentages of the fractions bound were calculated from radioactivity measured by liquid scintillation counting as described above. KD and Fmax were calculated by fitting Fbound = (Fmax [2G12])/(KD + [2G12]) to average data points. Errors reported are the standard error of the curve fit.
dNot Determined.
Sequencing of 24 clones from each library (Tables 4, 5) confirmed the low number of glycosylations (2 to 5) and revealed a high degree of sequence convergence.
XSPHLPVLLCKXVLNDGRRIVQXSCELPXVRRS
XHPYNTSRTSAXXAALKXQVTDXYALALFHRIL
XCYVTVIPAXNXPEARLGIVCHXPGIRRGKALY
XLXFIRIYPTRXQYVYHAPLLTXVRXSPTGPLI
XVRSAAVDTSPXTSSSQNAILLXFSYDVCLFDL
XIALTSNCYLNXGPRIFRYDVGLTQLCQGRRRS
XDTLHLKQIGGXPNCITQQDVRXTSIPYTYTWP
XDTLHLKQIGVXPNCITQQDVRXTSIPYTYTWP
XLLKXVDQSRLXPVPGIGVTLHXRSIPYSYLPI
XRSTLNSLEYRXQYATEDPRIRXASIPYTYWWP
XFSTANIYGAPXNTDXRLEHRQXKSIPYTYYWS
XERPSLXCGLSXLTSGGTQSSVXRSIPFYTYWW
XATKTNCKREKTXDNHVTIXRSIPWYTYRWLPN
XATKTNCKREKTIDNHVTIXRSIPWYTYRWLPN
XATKTNFKREKTXDNHVTIXRSIPWYTYRWLPN
XATRTNCKREKTXDNHVTIXRSIPWYTYRWLPN
XATKTSCKREKTXDNHVTIXRSIPWYTYRWLPN
X
TSIPYTYLNRSLWTNYRVNSWSXSKNVNVXPL
XVLPTIISTNVNPFRXLSIPTYTYLXPITWGEI
aConsensus sequences are in bold. 10F23, 10V14, 10V2, 10V6 and 10V11 contain a mutated amino acid from their potential parent sequences, 10F3 and 10V1, respectively.
Many repeat sequences were observed, as was a peptide consensus motif, XxSIP(−/x)YTY(L/xW)(−/x)P, where X denotes Man9-HPG and x denotes a variable amino acid. This motif was present in some clones from both libraries, and apparently arose from convergent evolution in multiple sequence families, as it is located sometimes early, sometimes late in the sequences. 10 glycopeptides were prepared without mRNA tags by in vitro translation without the puromycin linker (
To confirm that the results presented in Table 4 were not artifacts of ribosomal translation, glycopeptide 10F2 was chemically synthesized and characterized. The 2G12 binding affinity of glycopeptide 10F2 was confirmed using an alternate assay, BioLayer Interferometry, (“BLI”) (Abdiche et al., J. Anal. Biochem. 377:209-217 (2008), which is hereby incorporated by reference in its entirety). Pentelute's new Rapid Flow Solid Phase Peptide Synthesis method (Simon et al., ChemBioChem Early View DOI: 10.1002/cbic.201300796 (2014), which is hereby incorporated by reference in its entirety) in which activated amino acids are flowed through a thermally-heated reactor containing peptide synthesis resin, was used to prepare the 10F2 peptide. In this manner alkyne-containing peptide 1, in which the C-terminal His6 tag of the ribosomal peptide was replaced by an—StBu-protected cysteine, was obtained (
The 2G12 recognition observed for the Man9 glycopeptides obtained in the preceding Examples represents an enhancement of up to 360,000-fold compared with monovalent Man9 glycan (KD=180 μM) (Wang et al., Proc. Natl. Acad. Sci. U.S.A 105:3690-3695 (2008), which is hereby incorporated by reference in its entirety). Although Wang has prepared Man9 dendrimers which bind 2G12 with KD's down to 3.1 nM, that level of binding was achieved only with 9- and 27-mers, whereas 610 nM binding was observed with trivalent Man9 dendrimers. Taken together, these data indicate that the clustering and/or support of Man9 by neighboring elements in the glycopeptides obtained in the preceding Examples results in better mimicry of the 2G12 epitope than previous Man9 presentations. These evolved glycoclusters are extremely interesting candidates for in vivo immunogenicity studies.
The preceding Examples demonstrate the in vitro selection of multivalent glycopeptides from diverse libraries (˜1013 sequences). It has been shown that the use of higher temperature in the target binding step of selection favors glycopeptides with lower multivalency, an effect which parallels that which was observed in the SELMA selection of glycosylated DNAs (MacPherson et al., Angew. Chem. Int. Ed. 50:11238-11242 (2011); Temme et al., Chem. Eur. J. 19:17291-17295 (2013); and Temme et al., J. Am. Chem. Soc. 136:1726-1729 (2014), which are hereby incorporated by reference in their entirety). This approach can be used to design multivalent carbohydrate vaccines targeting additional HIV or cancer epitopes, as well as multivalent carbohydrate ligands for other lectins. The glycopeptides and other conjugates thus obtained will be useful tools in biological studies and for therapeutic applications.
One or more point mutations or truncations were introduced into several of the clones to assess their effects on 2G12 binding. The mutated sequences, generated according to the procedures described in the preceding Material & Methods section, are shown in Table 6 below.
XSPHLPVLLSKXVLNDGRRIVQXSSELPXVRRS
XATKTNSKREKTXDNHVTIXRSIPWYTYRWLPN
XATKTNAKREKTXDNHVTIXRSIPWYTYRWLPN
XRSIPWYTYRWLPN
X
XAALKXQVTDXYALALFHRIL
XPNCITQQDVRXTSIPYTYTWP
XVLNDGRRIVQXSCELPXVRRS
X
YVTVIPAXNXPEARLGIV
HXPGIRRGKALY
XDTLHLKQIGGXPN ITQQDVRXTSIPYTYTWP
aAll peptide sequences used in the 2G12-binding assay were preceded by an N-terminal formyl group and followed by a linker, a His6-tag and a FLAG-tag (GSGSLGHHHHHHRDYKDDDDK, SEQ ID NO: 1) for purification and radiolabeling purposes. “X” denotes potential Man9-glycosylation sites encoded by the AUG codon.
b,cIn the assay, the peptides were radiolabeled with either 35S-cysteine or 3H-histidine as noted above, and incubated with various concentrations of 2G12, and 2G12-peptide complexes were isolated with magnetic protein G beads. Percentages of the fractions bound were calculated from radioactivity measured by liquid scintillation counting as described above. KD and Fmax were calculated by fitting Fbound = (Fmax [2G12])/(KD + [2G12]) to average data points. Errors reported are the standard error of the curve fit.
d10V1-C7s and 10V1-C7A sequences were evaluated by a biolayer interferometry (BLI) assay, rather than the radioactive binding assay, and the material used was prepared synthetically rather than by ribosomal translation.
Based on these results, Cys residues can be mutated to Ser or Ala when the Cys residue is not involved in disulfide bond formation with a second Cys residue. Thus, Cys substitution is sequence dependent. This is confirmed by 10F12 as compared to 10F5 and 10F3, where Cys substitutions were tolerated in the latter but not the former.
Truncation is also feasible where the truncation either does not involve residues involved in forming the glycosylated epitope recognized by 2G12 or residues involved in stabilizing the structure of the glycopolypeptide. This is confirmed by 10F2-411 and 10V1-419, which still exhibit tight binding to 2G12.
Although preferred embodiments have been depicted and described in detail herein, it will be apparent to those skilled in the relevant art that various modifications, additions, substitutions, and the like can be made without departing from the spirit of the invention and these are therefore considered to be within the scope of the invention as defined in the claims which follow.
This application is a continuation of U.S. patent application Ser. No. 15/101,248, which is a national stage application under 35 U.S.C. § 371 of International Patent Application No. PCT/US2014/068186, filed Dec. 2, 2014, which claims the benefit of U.S. Provisional Patent Application Ser. No. 61/910,710, filed Dec. 2, 2013, which is hereby incorporated by reference in its entirety.
This invention was made with government support under RO1 A1090745 awarded by National Institutes of Health. The government has certain rights in the invention.
| Number | Name | Date | Kind |
|---|---|---|---|
| 20040091955 | Forster et al. | May 2004 | A1 |
| 20130116417 | Krauss et al. | May 2013 | A1 |
| Number | Date | Country |
|---|---|---|
| 2014189768 | Nov 2014 | WO |
| Entry |
|---|
| Roberts (Current Opinion in Chemical Biology 3:268-73) (Year: 1999). |
| International Search Report and Written Opinion for corresponding application No. PCT/US2014/068186, filed Dec. 2, 2014 (dated Mar. 5, 2015). |
| Ng et al., “Quantitative Synthesis of Genetically Encoded Glycopeptide Libraries Displayed on M13 Phage,” ACS Chem. Biol. 7(9):1482-1487 (2012). |
| Usui et al., “A Designed Glycopeptide Array for Characterization of Sugar-Binding Proteins Toward a Glycopepide Chip Technology,” Nanobiotechnol. 1(2):191-199 (2005). |
| Number | Date | Country | |
|---|---|---|---|
| 20200102555 A1 | Apr 2020 | US |
| Number | Date | Country | |
|---|---|---|---|
| 61910710 | Dec 2013 | US |
| Number | Date | Country | |
|---|---|---|---|
| Parent | 15101248 | US | |
| Child | 16711964 | US |
