Patent Application
20090169503
Antiretroviral therapy (ART) to treat HIV has changed the outlook of HIV infection, since well-managed patients can remain free of symptoms for long periods. However, chronic use of the drugs leads to toxicities and virus resistance. Therapy must be continued indefinitely, since HIV (or SIV in macaques) remaining in pharmacological sanctuaries, rebounds rapidly upon treatment interruption
The administration of nucleic acid-based vaccines, including both naked DNA and viral-based vaccines, to individuals that have undergone ART has been suggested (see, e.g., WO01/08702, WO04/041997). Further, the administration of DNA vaccines in prime boost protocols has been suggested (see, e.g., US application no. 2004/033237; Hel et al., J. Immunol. 169:4778-4787, 2002; Barnett et al., AIDS Res. and Human Retroviruses Volume 14, Supplement 3, 1998, pp. S-299-S-309 and Girard et al., C R Acad. Sci. III 322:959-966, 1999 for reviews). DNA immunization, when used in a boosting protocol with modified vaccinia virus Ankara (MVA) or with a recombinant fowl pox virus (rFPV) in the macaque model, has been shown to induce CTL responses and antibody responses (see, e.g., Hanke et al, J. Virol. 73:7524-7532, 1999; Hanke et al., Immunol. Letters 66:177-181; Robinson et al., Nat. Med. 5:526-534, 1999), but no protection from a viral challenge was achieved in the immunized animals.
DNA immunization followed by administration of another highly attenuated poxvirus has also been tested for the ability to elicit IgG responses, but the interpretation of the results is hampered by the fact that serial challenges were performed (see, e.g., Fuller et al., Vaccine 15:924-926, 1997; Barnett et al., supra). In contrast, in a murine model of malaria, DNA vaccination used in conjunction with a recombinant vaccinia virus was promising in protecting from malaria infection (see, e.g., Sedegah et al., Proc. Natl. Acad. Sci. USA 95:7648-7653, 1998; Schneider et al., Nat. Med. 4:397-402, 1998).
Other prime boost strategies for the treatment of HIV infection are described in WO01/82964, WO04/041997. In these methods, immunogenicity of a recombinant poxvirus-based vaccine is enhanced by administering a nucleic acid, e.g., a DNA plasmid vaccine, to stimulate an immune response to the HIV antigens provided in the poxvirus vaccine, and thereby increase the ability of the recombinant pox virus, e.g., NYVAC or ALVAC, to expand a population of immune cells. Individuals who are treated with such a vaccine regimen may be at risk for infection with the virus or may have already been infected. Such protocols can control viremia for a period of time. However, these protocols rely on the use of DNA plasmid vaccines in conjunction with poxvirus vaccines. DNA plasmid vaccines by themselves have not been previously shown to have the ability to control viremia.
In contrast to intervention during early infection, results have been mixed in chronic infection, and most reports suggest that immune therapy during chronic infection was transiently effective, if at all, in controlling virus load and boosting immune response (see, e.g., Lori, et al., Science 290:1591-1593, 2000; Markowitz, et al., J Infect Dis 186:634-643, 2002; Tryniszewska, et al., J Immunol 169:5347-5357, 2002). Perhaps the most successful protocol reported is the therapeutic dendritic cell vaccination. Treatment of macaque and human APCs in vitro with immunogen and re-infusion in the absence of antiretroviral therapy (see, e.g., Lu, et al., Nat Med 9:27-32, 2003) resulted in long-lasting decrease in virus load. Several indications from the reported immunotherapy studies suggest that restoration of the immune system and perhaps more efficient immunization procedures may improve virus control.
DNA immunization plasmids have been developed that encode fusion proteins that contain a destabilizing amino acid sequence attached to a polypeptide sequence of interest; or that encode secreted fusion proteins, e.g., containing a secretory peptide attached to a polypeptide of interest (see. e.g., WO02/36806). Both of these types of plasmids exhibit increased immunogenicity of the polypeptide of interest that is comprised in the two types of fusion proteins. However, these DNA immunization plasmids have not been tested for their ability to control viremia in subjects that have undergone ART. It is highly desirable that additional methods of virus control and immune restoration are developed. This invention addresses this need.
The invention is based on the discovery of DNA vaccines for the treatment of retrovirus infection that are surprisingly effective at controlling viremia in primates that are receiving or will receive antiretroviral therapy (ART), either alone or in conjunction with other therapeutic vaccines. This vaccination can induce long-lasting virus-specific immune responses, and control viremia post-ART. DNA therapeutic vaccination appears surprisingly effective and, further, shows evidence of triggering a Th1 response with more prominent induction of cellular immune responses.
The invention thus provides a method of treating an individual, preferably a human, infected with a retrovirus, the method comprising: administering a DNA vaccine comprising an expression vector selected from the group consisting of a) an expression vector encoding a fusion protein comprising a degradation polypeptide linked to an immunogenic retrovirus polypeptide or b) an expression vector encoding a secreted fusion protein comprising a secretory polypeptide linked to an immunogenic retrovirus polypeptide; and administering antiretroviral therapy (ART); wherein administration of the DNA vaccine results in control of viremia upon cessation of ART. In preferred embodiments, the DNA vaccine is administered to an individual who is undergoing ART.
In some embodiments, an expression vector encoding a secreted polypeptide is administered in conjunction with an expression vector encoding a fusion polypeptide comprising a destabilizing sequence. In such an embodiment, the antigenic retroviral polypeptide in the secreted polypeptide is often a different antigen than the antigenic polypeptide that is linked to the destabilizing sequence.
In particular embodiments, the destabilizing sequence in the fusion polypeptides that are administered in vaccines can be selected from the group consisting of c-Mos aa1-35, cyclin B aa 10-95, β-catenin aa 19-44, and β-catenin aa 18-47. Often, the destabilizing sequence is β-catenin aa 18-47.
In some embodiments, the secretory polypeptide is MCP-3.
The antigenic polypeptides that can be incorporated into the fusion proteins can be from any retrovirus, e.g., HIV-1, HIV-2, HTLV, SIV, but are often from HIV-1. Most often, the immunogenic retrovirus polypeptide is from an HIV antigen, such as Gag, Env, Pol, Nef, Vpr, Vpu, Vif, Tat, or Rev. In some embodiments, the HIV antigen comprises linked epitopes from HIV antigens, e.g., HIV Gag, Pol, Tat, Rev, or Nef, linked in any order; or linked epitopes of HIV antigens, e.g., Tat, Rev, Env, or Nef, linked in any order. One or more of the HIV genes, e.g., Gag, Env, Pol, Nef, Vpr, Vpu, Vif, Tat, or Rev, is often engineered so that an inactive protein is produced. In some embodiments, the linked epitopes are fusion proteins, such as Gag/Pol fusion proteins. The HIV antigens can be administered in one or more expression vectors, For example, a Gag/Pol fusion protein can be encoded in one expression vector and an Env protein on another expression vector.
The vaccines of the invention can also be administered with a nucleic acid sequence encoding a co-stimulatory molecule, i.e., an adjuvant, such as IL-12 or IL-15. The nucleic acid sequence encoding the co-stimulatory molecule is most often administered at the same time as one or more of the expression vectors of the invention and at the same site. However, this need not necessarily be the case. The vectors may be administered at different sites and/or at different times.
In some embodiments, the expression vector is administered by intramuscular injection. The vaccine can be administered at a single site or multiple sites. Further, combinations of expression vectors can be administered. In some embodiments, an expression vector encoding a secreted fusion protein is administered at a site that is different from the site of administration of an expression vector encoding an antigenic fusion protein comprising a destabilizing polypeptide sequence.
In other embodiments, the method of the invention further comprises at least a second administration of the expression plasmid. Thus, multiple administrations of the same or different expression plasmids is contemplated in the invention.
The invention also provides a method of treating an individual undergoing antiretroviral therapy, the method comprising administering to the individual a DNA vaccine comprising an expression vector selected from the group consisting of a) an expression vector encoding a fusion protein comprising a degradation polypeptide linked to an immunogenic retrovirus polypeptide and/or b) an expression vector encoding a secreted fusion protein comprising a secretory polypeptide linked to an immunogenic retrovirus polypeptide; wherein administration of the DNA vaccine results in lower levels of viremia compared to viremia prior to ART administration upon cessation of ART. The vectors often comprise mutated retroviral genes, e.g., mutated HIV genes that express inactive proteins. For example, gag, pol, nef, tat, may be mutated to inactivate protein function. Such vectors can also be administered with vectors that encode native antigens (or native antigen epitopes) without modifications.
The nucleic acid constructs of the invention for treatment of retroviral infection, e.g., HIV, can be used in conjunction with other therapeutic treatments, including other nucleic acid-based vaccines, such as virus vectors, e.g., poxvirus vectors, retroviral vectors, e.g., lentiviral vectors, adenoviral vectors, adeno-associated viral vectors and the like. Further, other immunogenic formulations can be administered in conjunction with the constructs, including purified protein antigens or inactivated virus particles.
A “nucleic acid vaccine” or “DNA vaccine” refers to a vaccine that includes one or more expression vectors, preferably administered as purified DNA, which enters the cells in the body, and is expressed.
A “destabilizing amino acid sequence” or “destabilization sequence” as used herein refers to a sequence that targets a protein for degradation. Such sequences are well known in the art. Typically, the destabilizing sequence targets the protein to the ubiquitin proteosomal degradation pathway. Such sequences are well known in the art. Exemplary sequences are described, e.g., in WO 02/36806.
A “secretory polypeptide” as used herein refers to a polypeptide that comprises a secretion signal that is typically secreted. Typically, a “secretory polypeptide” that is comprised by a fusion protein is an immunostimulatory molecule such as a chemokine or cytokine.
“Viral load” is the amount of virus present in the blood of a patient. Viral load is also referred to as viral titer or viremia. Viral load can be measured in variety of standard ways. In preferred embodiments, the administration of the DNA constructs controls viremia and leads to a greater reduction in viral load.
A recurring problem in anti-retroviral therapy is the rebound in viremia when therapy ceases. This invention is based on the discovery that vectors that produce either secreted or intracellularly degraded antigens are surprisingly effective at controlling viremia when administered to ART-treated subjects. These vectors can be used for the treatment of retroviral infection, e.g., for the treatment of HIV infection.
The nucleic acid vaccines of the invention are typically administered as “naked” DNA, i.e., as plasmid-based vectors. Since the antigens expressed by these DNA vectors are also well expressed in other expression systems, such as recombinant virus vectors, other expression vector systems may also be used either alternatively, or in combination with DNA vectors. These include viral vector systems such as cytomegalovirus, herpes virus, adenovirus, and the like. Such viral vector systems are well known in the art. The constructs of the invention can thus also be administered in viral vectors where the retroviral antigens, e.g., the HIV antigens, are incorporated into the viral genetic material.
Expression vectors encoding a fusion protein comprising a destabilization sequence linked to the immunogenic protein are used in the invention. Such vectors are described, e.g., in WO02/36806. A variety of sequence elements have been found to confer short lifetime on cellular proteins. For example, the amino acid residues present in the N-terminus may destabilize a protein sequence. Another example of destabilizing sequences are so-called PEST sequences, which are abundant in the amino acids Pro, Asp, Glu, Ser, Thr (they need not be in a particular order), and can occur in internal positions in a protein sequence. A number of proteins reported to have PEST sequence elements are rapidly targeted to the 26S proteasome. A PEST sequence typically correlates with a) predicted surface exposed loops or turns and b) serine phosphorylation sites, e.g. the motif S/TP is the target site for cyclin dependent kinases.
Additional destabilization sequences relate to sequences present in the n-terminal region. In particular the rate of ubiquitination, which targets proteins for degradation by the 26S proteasome can be influence by the identity of the N-terminal residue of the protein. Thus, destabilization sequences can also comprise such N-terminal residues, “N-end rule” targeting (see, e.g., Tobery et al., J. Exp. Med. 185:909-920.)
Destabilizing sequences present in particular proteins are well known in the art. Exemplary destabilization sequences include c-myc aa 2-120; cyclin A aa 13-91; Cyclin B aa 13-91; IkBα aa 20-45; β-Catenin aa 9-44; β-Catenin aa 18-447, c-Jun aa1-67; and c-Mos aa1-35; and fragments and variants, of those segments that mediate destabilization. Such fragments can be identified using methodology well known in the art. For example, polypeptide half-life can be determined by a pulse-chase assay that detects the amount of polypeptide that is present over a time course using an antibody to the polypeptide, or to a tag linked to the polypeptide. Exemplary assays are described, e.g., in WO02/36806.
Expression Vectors that Encode Secreted Fusion Proteins
The vaccines of the invention (naked DNA or viral vector-based nucleic acid vaccines) can also encode fusion proteins that include a secretory polypeptide. In some embodiments, the secretory polypeptide is an immunostimulation molecule, such as a chemokine, cytokine, or lymphokine. Exemplary secretory polypeptides include immunostimulatory chemokines such as MCP-3 or IP-10, or cytokines such as GM-CSF, IL-4, or IL-2. Often, secretory fusion proteins employed in the methods here contain MCP-3 amino acid sequences to tissue plasminogen activator sequences. Constructs encoding secretory fusion proteins are disclosed, e.g., in WO02/36806.
Antigenic polypeptide sequences for provoking an immune response selective for a specific retroviral pathogen are known. With minor exceptions, the following discussion of HIV epitopes/immunogenic polypeptides is applicable to other retroviruses, e.g., SIV, except for the differences in sizes of the respective viral proteins. HIV antigens for a multitude of HIV-1 and HIV-2 isolates, including members of the various genetic subtypes of HIV, are known and reported (see, e.g., Myers et al., Los Alamos Database, Los Alamos National Laboratory, Los Alamos, N. Mex. (1992); the updated version of this data base is online and is incorporated herein by reference (http://hiv-web.lanl.gov/content/index)) and antigens derived from any of these isolates cam be used in the methods of this invention. Immunogenic proteins can be derived from any of the various HIV isolates, including any of the various envelope proteins such as gp120, gp160 and gp41; gag antigens such as p24gag and p55gag, as well as proteins derived from pol, tat, vif, rev, nef, vpr, vpu.
The expression constructs may also contain Rev-independent fragments of genes that retain the desired function (e.g., for antigenicity of Gag or Pol, particle formation (Gag) or enzymatic activity (Pol)), or may also contain Rev-independent variants that have been mutated such the encoded protein loses function. For example, the gene may be modified to mutate an active site of reverse transcriptase or integrase proteins. Rev-independent fragments of gag and env are described, for example, in WO01/46408 and U.S. Pat. Nos. 5,972,596 and 5,965,726. Typically, rev-independent HIV sequences that are modified to eliminate all enzymatic activities of the encoded proteins are used in the constructs of the invention.
A DNA vaccine of the invention can be administered as one or more constructs. For example, a vaccine can comprises an HIV antigen fusion protein where multiple HIV polypeptides, structural and/or regulatory polypeptides or immunogenic epitopes thereof, are administered in a single expression vectors. In other embodiments, the vaccines are administered as multiple expression vectors, or as one or more expression vectors encoding multiple expression units, e.g., discistronic expression vectors.
The vaccines are administered to retrovirus-infected individuals, typically HIV-1-infected humans, who are undergoing or have undergone ART therapy.
Antiviral retroviral treatment typically involves the use of two broad categories of therapeutics. They are reverse transcriptase inhibitors and protease inhibitors. There are two type of reverse transcriptase inhibitors: nucleoside analog reverse transcriptase inhibitors and non-nucleoside reverse transcriptase inhibitors. Both types of inhibitors block infection by blocking the activity of the HIV reverse transcriptase, the viral enzyme that translates HIV RNA into DNA which can later be incorporated into the host cell chromosomes.
Nucleoside and nucleotide analogs mimic natural nucleotides, molecules that act as the building blocks of DNA and RNA. Both nucleoside and nucleotide analogs must undergo phosphorylation by cellular enzymes to become active; however, a nucleotide analog is already partially phosphorylated and is one step closer to activation when it enters a cell. Following phosphorylation, the compounds compete with the natural nucleotides for incorporation by HIV's reverse transcriptase enzyme into newly synthesized viral DNA chains, resulting in chain termination.
Examples of anti-retroviral nucleoside analogs are: AZT, ddI, ddC, d4T, and 3TC. Combinations of different nucleoside analogs are also available, for example 3TC in combination with in combination withAZT and (Combivir).
Nonnucleoside reverse transcriptase inhibitors (NNRTIs) are a structurally and chemically dissimilar group of antiretroviral compounds. They are highly selective inhibitors of HIV-1 reverse transcriptase. At present these compounds do not affect other retroviral reverse transcriptase enzymes such as hepatitis viruses, herpes viruses, HIV-2, and mammalian enzyme systems. They are used effectively in triple-therapy regimes. Examples of NNRTIs are Delavirdine and Nevirapine which have been approved for clinical use in combination with nucleoside analogs for treatment of HIV-infected adults who experience clinical or immunologic deterioration. A detailed review can be found in “Nonnucleoside Reverse Transcriptase Inhibitors” AIDS Clinical Care (October 1997) Vol. 9, No. 10, p. 75.
Protease inhibitors are compositions that inhibit HIV protease, which is virally encoded and necessary for the infection process to proceed. Clinicians in the United States have a number of clinically effective proteases to use for treating HIV-infected persons. These include: SAQUINAVIR (Invirase); INDINAVIR (Crixivan); and RITONAVIR (Norvir).
In the methods of the invention, the nucleic acid vaccine is directly introduced into the cells of the individual receiving the vaccine regimen. This approach is described, for instance, in Wolff et. al., Science 247:1465 (1990) as well as U.S. Pat. Nos. 5,580,859; 5,589,466; 5,804,566; 5,739,118; 5,736,524; 5,679,647; and WO 98/04720. Examples of DNA-based delivery technologies include, “naked DNA”, facilitated (bupivicaine, polymers, peptide-mediated) delivery, and cationic lipid complexes or liposomes. The nucleic acids can be administered using ballistic delivery as described, for instance, in U.S. Pat. No. 5,204,253 or pressure (see, e.g., U.S. Pat. No. 5,922,687). Using this technique, particles comprised solely of DNA are administered, or in an alternative embodiment, the DNA can be adhered to particles, such as gold particles, for administration.
As is well known in the art, a large number of factors can influence the efficiency of expression of antigen genes and/or the immunogenicity of DNA vaccines. Examples of such factors include the reproducibility of inoculation, construction of the plasmid vector, choice of the promoter used to drive antigen gene expression and stability of the inserted gene in the plasmid. In some embodiments, nucleic acid-based vaccines comprising expression vectors of the invention are viral vectors in which the retroviral antigens for vaccination are included in the viral vector genome.
Any of the conventional vectors used for expression in eukaryotic cells may be used for directly introducing DNA into tissue. Expression vectors containing regulatory elements from eukaryotic viruses are typically used in eukaryotic expression vectors, e.g., CMV, viral LTRs and the like. Typical vectors include those with a human CMV promoter, no splice sites, and a bovine growth hormone polyA site. Exemplary vectors are described in the “Examples” section.
Therapeutic quantities of plasmid DNA can be produced for example, by fermentation in E. coli, followed by purification. Aliquots from the working cell bank are used to inoculate growth medium, and grown to saturation in shaker flasks or a bioreactor according to well known techniques. Plasmid DNA can be purified using standard bioseparation technologies such as solid phase anion-exchange resins. If required, supercoiled DNA can be isolated from the open circular and linear forms using gel electrophoresis or other methods.
Purified plasmid DNA can be prepared for injection using a variety of formulations. The simplest of these is reconstitution of lyophilized DNA in sterile phosphate-buffer saline (PBS). This approach, i.e., “naked DNA,” is particularly suitable for intramuscular (IM) or intradermal (ID) administration.
To assess a patient's immune system during and after treatment and to further evaluate the treatment regimen, various parameters can be measured. Measurements to evaluate vaccine response include: antibody measurements in the plasma, serum, or other body fluids; and analysis of in vitro cell proliferation in response to a specific antigen, indicating the function of CD4+ cells. Such assays are well known in the art. For example, for measuring CD4+ T cells, many laboratories measure absolute CD4+ T-cell levels in whole blood by a multi-platform, three-stage process. The CD4+ T-cell number is the product of three laboratory techniques: the white blood cell (WBC) count; the percentage of WBCs that are lymphocytes (differential); and the percentage of lymphocytes that are CD4+ T-cells. The last stage in the process of measuring the percentage of CD4+ T-lymphocytes in the whole-blood sample is referred to as “immunophenotyping by flow cytometry. Systems for measuring CD4+ cells are commercially available. For example Becton Dickenson's FACSCount System automatically measure absolutes CD4+, CD8+, and CD3+ T lymphocytes.
Other measurements of immune response include assessing CD8+ responses. These techniques are well known. CD8+ T-cell responses can be measured, for example, by using tetramer staining of fresh or cultured PBMC (see, e.g., Altman, et al., Proc. Natl. Acad. Sci. USA 90:10330, 1993; Altman, et al., Science 274:94, 1996), or γ-interferon release assays such as ELISPOT assays (see, e.g., Lalvani, et al., J. Exp. Med. 186:859, 1997; Dunbar, et al., Curr. Biol. 8:413, 1998; Murali-Krishna, et al., Immunity 8:177, 1998), or by using functional cytotoxicity assays.
Viremia is measured by assessing viral titer in a patient. There are a variety of methods of perform this. For example, plasma HIV RNA concentrations can be quantified by either target amplification methods (e.g., quantitative RT polymerase chain reaction [RT-PCR], Amplicor HIV Monitor assay, Roche Molecular Systems; or nucleic acid sequence-based amplification, [NASBA®], NucliSens™ HIV-1 QT assay, Organon Teknika) or signal amplification methods (e.g., branched DNA [bDNA], Quantiplex™ HIV RNA bDNA assay, Chiron Diagnostics). The bDNA signal amplification method amplifies the signal obtained from a captured HIV RNA target by using sequential oligonucleotide hybridization steps, whereas the RT-PCR and NASBA® assays use enzymatic methods to amplify the target HIV RNA into measurable amounts of nucleic acid product. Target HIV RNA sequences are quantitated by comparison with internal or external reference standards, depending upon the assay used.
Administration of vaccine constructs of the invention to individuals undergoing ART controls viremia, e.g., in periods when the patient may stop receiving ART. Controlling viremia refers to lowering of the plasma levels of virus to levels lower than those observed in the period of chronic infection prior to ART, usually to levels to levels one to two logs lower than the set point observed in the period of chronic infection prior to ART. Inclusion of the vaccine constructs described herein results in enhanced control of viremia in comparison to treatment protocols that do not comprise administration of optimized DNA vectors or that do not that encode fusion proteins comprising a destabilization signal/and or secreted fusion proteins.
To maximize the immunotherapeutic effects of DNA vaccines, alternative methods for formulating purified plasmid DNA may be desirable. A variety of methods have been described, and new techniques may become available. Cationic lipids can also be used in the formulation (see, e.g., as described by WO 93/24640; Mannino & Gould-Fogerite, BioTechniques 6(7): 682 (1988); U.S. Pat. No. 5,279,833; WO 91/06309; and Felgner, et al., Proc. Nat'l Acad. Sci. USA 84:7413 (1987). In addition, glycolipids, fusogenic liposomes, peptides and compounds referred to collectively as protective, interactive, non-condensing compounds (PINC) could also be complexed to purified plasmid DNA to influence variables such as stability, intramuscular dispersion, or trafficking to specific organs or cell types.
The administration procedure for DNA is not critical. Vaccine compositions (e.g., compositions containing the DNA expression vectors) can be formulated in accordance with standard techniques well known to those skilled in the pharmaceutical art. Such compositions can be administered in dosages and by techniques well known to those skilled in the medical arts taking into consideration such factors as the age, sex, weight, and condition of the particular patient, and the route of administration.
In therapeutic applications, the vaccines are administered to a patient in an amount sufficient to elicit a therapeutic effect, e.g., a CD8+, CD4+, and/or antibody response to the HIV-1 antigens encoded by the vaccines that at least partially arrests or slows symptoms and/or complications of HIV infection. An amount adequate to accomplish this is defined as “therapeutically effective dose.” Typically, a therapeutically effective dose results in control of virema upon release from ART, i.e., lower levels of viremia after ART cessation compared to viremia observed prior to ART administration. Amounts effective for this use will depend on, e.g., the particular composition of the vaccine regimen administered, the manner of administration, the stage and severity of the disease, the general state of health of the patient, and the judgment of the prescribing physician.
Suitable quantities of DNA vaccine, e.g., plasmid or naked DNA can be about 1 μg to about 100 mg, preferably 0.1 to 10 mg, but lower levels such as 1-10 μg can be employed. For example, an HIV DNA vaccine, e.g., naked DNA or polynucleotide in an aqueous carrier, can be injected into tissue, e.g., intramuscularly or intradermally, in amounts of from 10 μl per site to about 1 ml per site. The concentration of polynucleotide in the formulation is usually from about 0.1 μg/ml to about 20 mg/ml.
The vaccine may be delivered in a physiologically compatible solution such as sterile PBS in a volume of, e.g., one ml. The vaccines may also be lyophilized prior to delivery. As well known to those in the art, the dose may be proportional to weight.
The compositions included in the vaccine regimen can be administered alone, or can be co-administered or sequentially administered with other immunological, antigenic, vaccine, or therapeutic compositions. These include adjuvants, and chemical or biological agent given in combination with, or recombinantly fused to, an antigen to enhance immunogenicity of the antigen. Such other compositions can also include purified antigens from the immunodeficiency virus or a second recombinant vector system that expresses f such antigens and is thus able to produce additional therapeutic compositions. For examples, adjuvant compositions can include expression vectors encoding IL-12 or IL-15 or other biological response modifiers (e.g., cytokines or co-stimulating molecules, further discussed below). Again, co-administration is performed by taking into consideration such known factors as the age, sex, weight, and condition of the particular patient, and, the route of administration.
Compositions that may also be administered with the vaccines include other agents to potentiate or broaden the immune response, e.g., IL-2 or CD40 ligand, which can be administered at specified intervals of time, or continuously administered. For example, IL-2 can be administered in a broad range, e.g., from 10,000 to 1,000,000 or more units. Administration can occur continuously following vaccination.
The vaccines can additionally be complexed with other components such as peptides, polypeptides and carbohydrates for delivery. For example, expression vectors, i.e., nucleic acid vectors that are not contained within a viral particle, can be complexed to particles or beads that can be administered to an individual, for example, using a vaccine gun. Nucleic acid vaccines are administered by methods well known in the art as described in Donnelly et al. (Ann. Rev. Immunol. 15:617-648 (1997)); Felgner et al. (U.S. Pat. No. 5,580,859, issued Dec. 3, 1996); Felgner (U.S. Pat. No. 5,703,055, issued Dec. 30, 1997); and Carson et al. (U.S. Pat. No. 5,679,647, issued Oct. 21, 1997), each of which is incorporated herein by reference. One skilled in the art would know that the choice of a pharmaceutically acceptable carrier, including a physiologically acceptable compound, depends, for example, on the route of administration of the expression vector.
For example, naked DNA or polynucleotide in an aqueous carrier can be injected into tissue, such as muscle, in amounts of from 10 μl per site to about 1 ml per site. The concentration of polynucleotide in the formulation is from about 0.1 μg/ml to about 2 mg/ml.
Vaccines can be delivered via a variety of routes. Typical delivery routes include parenteral administration, e.g., intradermal, intramuscular or subcutaneous routes. Other routes include oral administration, intranasal, and intravaginal routes. In such compositions the nucleic acid vector can be in admixture with a suitable carrier, diluent, or excipient such as sterile water, physiological saline, glucose or the like.
The expression vectors of use for the invention can be delivered to the interstitial spaces of tissues of a patient (see, e.g., Felgner et al., U.S. Pat. Nos. 5,580,859, and 5,703,055). Administration of expression vectors of the invention to muscle is a particularly effective method of administration, including intradermal and subcutaneous injections and transdermal administration. Transdermal administration, such as by iontophoresis, is also an effective method to deliver expression vectors of the invention to muscle. Epidermal administration of expression vectors of the invention can also be employed. Epidermal administration involves mechanically or chemically irritating the outermost layer of epidermis to stimulate an immune response to the irritant (Carson et al., U.S. Pat. No. 5,679,647).
The vaccines can also be formulated for administration via the nasal passages. Formulations suitable for nasal administration, wherein the carrier is a solid, include a coarse powder having a particle size, for example, in the range of about 10 to about 500 microns which is administered in the manner in which snuff is taken, i.e., by rapid inhalation through the nasal passage from a container of the powder held close up to the nose. Suitable formulations wherein the carrier is a liquid for administration as, for example, nasal spray, nasal drops, or by aerosol administration by nebulizer, include aqueous or oily solutions of the active ingredient. For further discussions of nasal administration of AIDS-related vaccines, references are made to the following patents, U.S. Pat. Nos. 5,846,978, 5,663,169, 5,578,597, 5,502,060, 5,476,874, 5,413,999, 5,308,854, 5,192,668, and 5,187,074.
The vaccines can be incorporated, if desired, into liposomes, microspheres or other polymer matrices (see, e.g., Felgner et al., U.S. Pat. No. 5,703,055; Gregoriadis, Liposome Technology, Vols. I to III (2nd ed. 1993). Liposomes, for example, which consist of phospholipids or other lipids, are nontoxic, physiologically acceptable and metabolizable carriers that are relatively simple to make and administer. Liposomes include emulsions, foams, micelles, insoluble monolayers, liquid crystals, phospholipid dispersions, lamellar layers and the like.
Liposome carriers can serve to target a particular tissue or infected cells, as well as increase the half-life of the vaccine. In these preparations the vaccine to be delivered is incorporated as part of a liposome, alone or in conjunction with a molecule which binds to, e.g., a receptor prevalent among lymphoid cells, such as monoclonal antibodies which bind to the CD45 antigen, or with other therapeutic or immunogenic compositions. Thus, liposomes either filled or decorated with a desired immunogen of the invention can be directed to the site of lymphoid cells, where the liposomes then deliver the immunogen(s).
Liposomes for use in the invention are formed from standard vesicle-forming lipids, which generally include neutral and negatively charged phospholipids and a sterol, such as cholesterol. The selection of lipids is generally guided by consideration of, e.g., liposome size, acid lability and stability of the liposomes in the blood stream. A variety of methods are available for preparing liposomes, as described in, e.g., Szoka, et al., Ann. Rev. Biophys. Bioeng. 9:467 (1980), U.S. Pat. Nos. 4,235,871, 4,501,728, 4,837,028, and 5,019,369.
The following example shows the ability of DNA vaccination during antiretroviral therapy to decrease virus replication in macaques chronically infected with highly pathogenic SIVmac251. In this example, animals were treated with a combination of three drugs and vaccinated with combinations of vectors expressing SIV antigens. Vaccinated animals showed a boost in cellular immune responses. After release from therapy, the virus load and immune response of the immunized animals were compared to animals treated only with ART. The mean viral load for the 10 weeks before ART was compared to the mean virus load for the 13 weeks following ART termination. Vaccinated animals showed significant drops in viremia and persistence of cellular immune responses at high levels compared to controls, indicating a benefit from DNA therapeutic vaccination. The vaccine regimen and results were performed and analyzed as follows.
Thirty one Indian rhesus macaques (Macaca mulatta) in four groups were studied. All Rhesus macaques were infected with pathogenic SIVmac251 via the mucosal route. These groups were:
Group 1 (group v1), (n=9) previously naïve, infected animals received DNA vaccine during ART.
Group 2 (group v2), (n=6) previously vaccinated, infected animals also received DNA vaccine during ART.
Group 3 (group c1), (n=12) previously naïve infected animals received ART only.
Group 4, (group c2) (n=4) previously vaccinated, infected animals received ART only.
Animals in groups 1 and 3 were previously naïve, infected with SIVmac251. Animals in groups 2 and 4 were previously vaccinated with SIV DNA vectors, infected by SIVmac251 as part of another study and recycled for this immunotherapy study. Animals had been infected for period varying from 15 to 70 weeks prior to the start of antiretroviral treatment (ART). Animals were treated with a combination of three antiretroviral drugs effective against SIVmac (PMPA, stavudine, ddI) for approximately 20 weeks. Drug dosage was as follows: PMPA, 20 mg/kg SC SID; ddI, 5 mg/kg IV SID; Stavudine, 1.2 mg/kg PO BID.
The animals in groups 1 and 2 received in addition 3 or four DNA vaccinations, usually at week 8, 12, and 16 of treatment, as indicated in
Animals were vaccinated via the intramuscular route with a total of 8 mg of plasmids. DNAs were injected separately or in groups in PBS in several different sites. Animals 56 and 57 (group 1), and 920, 922, 923, 628 (group 2) received together with the SIV DNAs 2 mg of an IL-15 producing plasmid in citrate buffer containing bupivacaine. Animals 926 and 626 (group 2) received together with the SIV DNAs 2 mg of an IL-12 producing plasmid in citrate buffer containing bupivacaine. The bioactive IL-12 or IL-15 produced by these plasmids was included as a molecular adjuvant in an effort to further enhance the effects of DNA vaccination.
The animals were treated in smaller groups over a period of 3 years, as they became available from other studies. Of the 31 treated animals, eight were excluded from the primary statistical analysis. Five of these animals (3 in the vaccine group, 2 controls) were excluded because they did not control virus for at least ⅓ of the period during ART. The remaining three animals were excluded because they had undetectable viremia before ART initiation. The primary statistical analysis described herein was therefore performed in 23 animals, of which 12 received ART plus vaccination during therapy, and 11 received only ART and were used as the control group (Table 1,
Table 1 shows a list of the animals indicating the length of time of infection (median=24 weeks), ART treatment (median=20 weeks) and post-ART follow-up period (median=40 weeks), the types and amounts of DNA used, the number of immunizations and the animal haplotypes. All animals showed a benefit during ART by decreasing virus load to below the cut-off value for the assay for at least ⅓ of the time during ART. Animals were kept in ART for at least 20 weeks, except for some animals that showed signals of drug toxicities, for which ART was terminated earlier (965, 968, 926, 626). The animals were studied during and after ART by measuring viral loads in plasma and anti-SIV responses by Elispot and antibody assays. Viral load in plasma was monitored by analysis of RNA as described (Romano, et al., J. Virol. Methods 86:61-70, 2000; Suryanarayana, et al., AIDS Res Hum Retroviruses 14:183-189, 1998).
For statistical comparisons, the (log 10 transformed) average viremia during the 10 weeks immediately preceding ART and during the first 13 weeks of follow-up, available for all animals in the study, was determined. The change in average viremia was used as a measure of the effects of vaccination.
The comparison of the change in viremia for the vaccine and control groups is shown in
Five of the animals in the vaccine group (see Table 1, animals 920, 922, 923, 926 and 626) and three in the control group (animals 921, 924 and 925) were prophylactically vaccinated with SIV gag and env DNA vectors before SIV infection, as part of previous studies. To analyze any effects of the prophylactic DNA vaccination on immunotherapy outcome, the previously vaccinated animals in the vaccine and control groups were compared to the rest of the animals in their corresponding group. An interaction between the previous vaccination and only therapeutic vaccination was test for using 2-way analysis of variance. There was no evidence for interaction (P=0.97), suggesting that the benefit derived by therapeutic vaccination is not affected by previous prophylactic vaccination. Therefore, combining the previously vaccinated animals in the two groups of therapeutically vaccinated and controls, was appropriate. In addition, if only the animals without any previous treatment or prophylactic vaccination (7 vaccines and 8 controls) are considered, the results are also significant, indicating that therapeutic vaccination provides a benefit.
It is evident from
Immunological analysis was performed for 10/12 ART+DNA animals and 3/11 ART animals. This analysis showed induction of cellular and humoral immune responses after DNA vaccination. IFN-gamma production from PBMC stimulated by overlapping peptide pools (15 mers overlapping by 11) for gag and gp120env (
The mean and peak Elispot values for gag were compared using a Wilcoxon signed rank test during the first period of ART treatment prior to, and the period during therapeutic vaccination. There was an overall increase during therapeutic vaccination (median difference=255.8, 1st quartile=115.7 and 3rd quartile: 479.5); P-value=0.001. Similar trends were detected using peak measurements (P=0.001).
As shown in Table 1, some animals in this study received DNA vectors expressing biologically active macaque IL-12 or IL-15. This showed that the DNA vectors for these cytokines were safe for animals infected with SIV, since no adverse effects were observed. This is similar to the conclusions obtained in non-SIV infected animals, including neonate macaques. The levels of Elispot responses for the animals receiving IL-15 were similar. Comparison of the decrease in viremia for the animals receiving IL-15 DNA versus the animals that did not, showed no statistical differences (P=0.64 and P=0.79 for mean and peak gag responses, respectively). Since defects in IL-12 and IL-15 have been shown in HIV infected people, inclusion of IL-12 or IL-15 can be beneficial when used in therapeutic vaccination procedures.
The differences in virus load of all 31 treated animals without excluding any animal that completed the ART period, using the entire chronic and release period, was also analyzed. As in the analysis performed with the 23 animals, supra, there is no interaction between previous vaccination and just immunotherapy, allowing the combination of animals in two groups. The mean difference for vaccine was 0.97 and for the control group 0.26. The difference between groups was highly significant (P=0.002) using Wilcoxon rank sum test (data not shown).
For the above comparisons conducted ANCOVA (analysis of covariance) was also conducted adjusting for differences in chronic viral load between the groups. For all three analyses above of the 23 as well as the 31 animals, the vaccine group was different from control after adjusting for average log transformed chronic VL levels (P<0.001 for all analyses).
To verify that vaccination previous to SIV infection and enrollment in the exemplary therapeutic vaccination protocol described in this example did not affect the outcome of the study, an additional comparison excluding all previously vaccinated animals was conducted. Even upon exclusion of all animals that were vaccinated as part of previous studies before SIV infection and comparison of the 7 remaining vaccines (mean Difference in log 10 Virus Load (DVL)=1.10) to the naïve group (mean DVL=−0.07), the results were significant (P=0.002, using Wilcoxon rank sum test, data not shown).
Therefore, we conclude that DNA vaccination during ART resulted in virus control after release from ART for prolonged periods of time (months). The majority of the animals appear to benefit from this immunization, and the average benefit is estimated between 0.65 and 1 log 10decrease in virus load compared to the control group.
A number of alternative statistical analyses were run to verify that these results are not affected by treatment variations or exclusion criteria. These included additional viral load analyses using ANCOVA: For Area Under Curve (AUC) analyses: we compared differences in the standardized AUC (log scale) between chronic and release periods. These analyses were done using complete follow-up on each animal. For 23 animal analysis, we found highly significant differences between vaccinated and non-vaccinated animals (P=0.003). Also significant differences using 31 animals (P=0.007).
In summary, all the analyses show that, relative to the SIV infection period, post-therapy viral load is substantially lower in therapeutically DNA vaccinated animals compared with un-vaccinated animals. Chronically infected animals, unable to control viremia on their own, do so upon ART and DNA vaccination. A number of animals were able to fully suppress viremia close to the detection limits of the assay. These included both previously prophylactically vaccinated as well as naïve animals. ART alone did not give any evidence of permanent virus decrease, in agreement with data from several studies on Therapy Interruption in monkeys and humans.
The animals that were studied were of diverse background as shown by the haplotype data (Table 1) and were unable to suppress virus replication prior to treatment. The data presented herein above suggested that ART alone was not able to produce a lasting decrease in chronic virus loads after release, in agreement with other studies. The decrease in virus load seen in vaccinated animals suggests that ART and vaccination had an important positive effect on the immune system. Interestingly, the virus rebounds upon termination of ART, and it is further suppressed after some weeks, presumably by the immune system. In agreement with this, the cellular immune responses measured by ELISPOT agree with the notion that virus rebound leads to increased CTL activity and elimination of the infected cells. In several animals showing low virus loads high Elispot numbers against gag and env proteins were maintained. This is in contrast to the expected decrease in the level of immune responses upon a decrease in viremia, and suggests that the immune system of the therapeutically immunized animals has reached a different steady state. This observation is reflected in the negative correlation of viral load with Elispot values seen during the release period.
Not to be bound by theory, it may be hypothesized that the previously prophylactic vaccinated animals have a healthier immune system and could respond to the therapeutic vaccination more effectively than non-vaccinated animals. The analysis described in this example failed to show any significant difference between the two groups. Analysis of the animals that did not receive any vaccination prior to SIVmac251 infection (7 vaccines and 8 controls) resulted in the same conclusion, i.e., the vaccines showed a statistically significant drop in viremia compared to the controls. Therefore, the benefit of immunotherapy did not depend on previous prophylactic vaccination.
“Gag” refers to DNA sequences encoding the Gag protein, which generates components of the virion core; “Pro” denotes “protease”. The protease, reverse transcriptase, and integrase genes comprise the “pol” gene.
“MCP3” in these constructs denotes MCP-3 amino acids 33-109 linked to IP-10 secretory peptide (alternatively, it can be linked to its own natural secretory peptide or any other functional secretory signal, e.g., the tissue plasminogen activator (tPA) signal peptide; “CATE” denotes β-catenin aino acids 18-47.
In order to design “Gag-destabilized” constructs, a literature search for characterized sequences able to target proteins to the ubiquitin-proteasome degradation pathway gave the following, not necessarily representative, list:
c-Myc aa 2-120
Cyclin B aa 13-91 (*10-95 in vectors in examples herein)
IkBα aa20-45
β-Catenin aa 19-44 (aa18-47 in vectors in examples herein)
c-Jun aa 1-67
c-Mos aa 1-35
Exemplary 30 aa of β-catenin destabilization sequence (amino acids 18-47):
β-catenin (18-47) added at the N terminus of HIV antigens with initiator AUG Met:
In some embodiments, the gag p37 and p55 plasmids may have the same p37 and p55 gag sequences disclosed in the patents containing INS-gag sequences (see, e.g., U.S. Pat. No. 5,972,596 and U.S. Pat. No. 5,965,726).
Exemplary SIV constructs are provided below. All plasmids have CMV promoter and BGH poly adenylation signal, the kan resistant gene for growth in E. coli. The pol genes (protease, RT, int) are mutated to render them inactive. SIV inactivating mutations were analagous to the mutations in HIV pol set forth in
acattaccgccatgttgacattgattattgactagttattaatagtaatcaatacggggtcatta
gttcatagcccatatatggagttccgcgttacataacttacggtaaatggcccgcctggctgacc
gcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaataggga
ctttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtg
tatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgc
ccagtacatgaccttatgggactttcctacttggcagtacatctacgtattagtcatcgctatta
ccatggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgactcacggggattt
ccfaagtccaccccattgacgtcaatgggagtttgtttggcaccaaaatcaacgggactttccaa
aatgtcgtaacaactccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctat
ataagcagagctcgtttagtgaaccgtcagatcgcctggagacgccatccacgctgttttgacct
ccatagaagacaccgggaccgatccagcctccgcgggcgcgCGTCGACAGAGAGATGGGCGTGAG
CTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCG
CATTGTCTGAGTAGGTGTCATTCTATTCTGGGGGGTGGGGTGGGGCAGCACAGCAAGGGGGAGGA
TTGGGAAGACAATAGCAGGCATGCTGGGGATGCGGTGGGCTCTATGGGTACCCAGGTGCTGAAGA
ATTGACCCGGTTCCTCCTGGGCCAGAAAGAAGCAGGCACATCCCCTTCTCTGTGACACACCCTGT
CCACGCCCCTGGTTCTTAGTTCCAGCCCCACTCATAGGACACTCATAGCTCAGGAGGGCTCCGCC
TTCAATCCCACCCGCTAAAGTACTTGGAGCGGTCTCTCCCTCCCTCATCAGCCCACCAAACCAAA
CCTAGCCTCCAAGAGTGGGAAGAAATTAAAGCAAGATAGGCTATTAAGTGCAGAGGGAGAGAAAA
TGCCTCCAACATGTGAGGAAGTAATGAGAGAAATCATAGAATTTCTTCCGCTTCCTCGCTCACTG
In some embodiments, the sequences are modified, e.g., to inactivate the protein or to align to conserved epitopes, such as CTL epitopes, to generate conserve epitopes. Exemplary modified HIV proteins are shown in
The following terminology is used with reference to the exemplary HIV constructs, the sequences of which are provided herein. All the genes are expressed from the CMV promoter and have BHG polyadenylation signal using the same or similar vectors as described for SIV.
p37M1-10(gag) is the native N term portion of gag
CATEp37M1-10 is the CATE-p37gag fusion protein
MCP3p37M1-10 is the MCP3-p37gag fusion protein
CATEenv is the CATE-env fusion protein'
tPAenv is the tPA-env fusion
MCP3env is the MCP3env fusion
HIVgagpol is the gag-pol fusion protein
polNefTatVif is a fusion protein, all components are inactive—sequence comparisons for vif, tat, nef, and pol are shown in
The following provides exemplary HIV gene and protein sequences used in vaccine constructs of the invention.
The above examples are provided to illustrate the invention but not to limit its scope. Other variants of the invention will be readily apparent to one of ordinary skill in the art and are encompassed by the appended claims.
All publications, patents, accession numbers, and patent applications cited herein are hereby incorporated by reference for all purposes.
This application claims benefit of U.S. provisional application No. 60/586,539, filed Jul. 9, 2004, which application is incorporated by reference herein.
| Filing Document | Filing Date | Country | Kind | 371c Date |
|---|---|---|---|---|
| PCT/US2005/024498 | 7/11/2005 | WO | 00 | 12/1/2008 |
| Number | Date | Country | |
|---|---|---|---|
| 60586539 | Jul 2004 | US |
