Patent Application
20220243184
The text of the computer readable sequence listing filed herewith, titled “38842-302_SEQUENCE-LISTING_ST25”, created Apr. 19, 2022, having a file size of 105,972 bytes, is hereby incorporated by reference in its entirety.
Genome engineering relies on molecular tools for targeted and specific modification of a genome to introduce insertions, deletions, and substitutions. While numerous advances have emerged over the last decade to enable programmable editing and deletion of bacterial and eukaryotic genomes, targeted genomic insertion remains an outstanding challenge.1 Integration of desired heterologous DNA into the genome needs to be precise, programmable, and efficient—three key parameters of any genome integration methodology. Currently available genome integration tools are limited by one or more of these factors. Recombinases such as Flp2 and Cre3 that mediate recombination at defined recognition sequences to integrate heterologous DNA have limited programmability.4,5 Site-specific nucleases such as CRISPR-associated (Cas) nucleases,6,7 zinc-finger nucleases (ZFNs),8 and transcription activator-like effector nucleases (TALENs)9 can be programmed to generate double-strand DNA breaks that are then repaired to incorporate a template DNA. However, this process relies on host homology-directed repair machinery, which is variable and often inefficient, especially as the size of the DNA insertion increases.10
Transposable elements are selfish genetic systems capable of integrating large pieces of DNA into both prokaryotic and eukaryotic genomes. Among various known transposable elements,11,12 the Himar1 transposon from the horn fly Haematobia irritans13 has been co-opted as a popular tool for insertional mutagenesis. The Himar1 transposon is mobilized by the Himar1 transposase, which like other Tel/mariner-family transposases, functions as a homodimer to bind the transposon DNA at the flanking inverted repeats, excise the transposon, and paste it into a random TA dinucleotide on a target DNA.13-16 Himar1 requires no host factors for transposition and functions in vitro,13 in bacteria,17 and in mammalian cells,18 and is capable of inserting transposons >7 kb in size.19 A hyperactive mutant of the transposase, Himar1C9, which contains two amino acid substitutions and increases transposition efficiency by 50-fold,20 has enabled the generation of transposon insertion mutant libraries for genetic screens in diverse microbes.21-23 However, because Himar1 transposons are inserted randomly into TA dinucleotides, their utility in targeted genome insertion applications has thus far been limited.
There has been great interest in harnessing the integration capabilities of transposases for genome editing. Synthetic approaches to increase the specificity of random transposon insertions aim to increase the affinity of the transposon or the transposase to specific DNA motifs. IS608, which is directed by base-pairing interactions between a transposon end and target DNA to insert 3′ to a tetranucleotide sequence, was shown to be targeted more specifically by increasing the length of the guide sequence in the transposon end.24 However, altering transposon flanking end sequences affects the physical structure and biochemical activity of the transposon, limiting the range of viable sequence alterations that can be made. Several studies have described fusing transposases to DNA-binding protein (DBP) domains to direct transposon insertions to specific loci. Fusing the Gal4 DNA-binding protein to Mos1 (a Tc1/mariner family member) and piggyBac transposases increased the frequency of integration sites near Gal4 recognition sites.25 Fusion of DNA-binding zinc-finger or transcription activator-like (TAL) effector proteins to piggyBac enabled integration into specified genomic loci in human cells.26-28 ISY100 transposase (also a Tc1/mariner family member) has been fused to a Zif268 Zinc-finger domain to increase specificity of transposon insertions to DNA adjacent to Zif268 binding sites.29
More recently, researchers have begun uniting the powerful integration abilities of transposases with precision targeting by RNA-guided Cas nucleases to achieve targeted transposon integration. In nature, CRISPR-associated Tn7-like transposases have been discovered in cyanobacteria30 and in Vibrio cholerae.31 In each of these studies, a Tn7-like transposase was found to be genetically encoded in close association with a CRISPR-Cas system. The RNA-guided Cas-effector complex was deficient in DNA cleavage but recruited the Tn7-like transposase protein subunits to insert transposons locally near its binding site, thereby enabling programmable insertions of transposons both in vitro and in vivo in Escherichia coli genomes. Other studies draw upon synthetic biology research showing that Cas nucleases can be repurposed as RNA-guided DNA-binding protein domains for manipulation of DNA sequences and gene expression at user-defined loci, in applications such as CRISPR interference (CRISPRi),32,33 CRISPR activation (CRISPRa),33,34 FokI-dCas9 dimeric nucleases,35,36 base editors,37,38 dCas9-targeted Gin serine recombinase,39 and targeted histone modifiers.40,41 Likewise, transposases that naturally insert transposons randomly can be fused to catalytically dead Cas9 (dCas9) for targeted transposition. A recent study showed that a synthetic Himar1 transposase-dCas9 fusion protein enabled directed transposition in cell-free reactions.42
Unless defined otherwise, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure pertains. Definitions of common terms and techniques in molecular biology may be found in Molecular Cloning: A Laboratory Manual, 2nd edition (1989) (Sambrook, Fritsch, and Maniatis); Molecular Cloning: A Laboratory Manual, 4th edition (2012) (Green and Sambrook); Current Protocols in Molecular Biology (1987) (F. M. Ausubel et al. eds.); the series Methods in Enzymology (Academic Press, Inc.): PCR 2: A Practical Approach (1995) (M. J. MacPherson, B. D. Hames, and G. R. Taylor eds.): Antibodies, A Laboratory Manual (1988) (Harlow and Lane, eds.): Antibodies A Laboratory Manual, 2nd edition 2013 (E. A. Greenfield ed.); Animal Cell Culture (1987) (R. I. Freshney, ed.); Benjamin Lewin, Genes IX, published by Jones and Bartlet, 2008 (ISBN 0763752223); Kendrew et al. (eds.), The Encyclopedia of Molecular Biology, published by Blackwell Science Ltd., 1994 (ISBN 0632021829); Robert A. Meyers (ed.), Molecular Biology and Biotechnology: a Comprehensive Desk Reference, published by VCH Publishers, Inc., 1995 (ISBN 9780471185710); Singleton et al., Dictionary of Microbiology and Molecular Biology 2nd ed., J. Wiley & Sons (New York, N.Y. 1994), March, Advanced Organic Chemistry Reactions, Mechanisms and Structure 4th ed., John Wiley & Sons (New York, N.Y. 1992); and Marten H. Hofker and Jan van Deursen, Transgenic Mouse Methods and Protocols, 2nd edition (2011).
As used herein, the singular forms “a”, “an”, and “the” include both singular and plural referents unless the context clearly dictates otherwise.
The terms “about” or “approximately” as used herein when referring to a measurable value such as a parameter, an amount, a temporal duration, and the like, are meant to encompass variations of and from the specified value, such as variations of +/−10% or less, +/−5% or less, +/−1% or less, and +/−0.1% or less of and from the specified value, insofar such variations are appropriate to perform in the disclosed invention. It is to be understood that the value to which the modifier “about” or “approximately” refers is itself also specifically, and preferably, disclosed.
The term “active fragment” as used herein with respect to amino acid sequences of polypeptides or proteins refers to a fragment of the referenced amino acid sequence, or defined variants thereof having a specified sequence identity, that exhibit the functional activity of the referenced amino acid sequence, or variants thereof. For example, an active fragment of a transposase enzyme encoded by SEQ ID NO:2 would be a fragment of this sequence that also exhibits transposase activity. An active fragment of a dCas9 protein would be a fragment that still associates with gRNA and binds to target DNA.
The terms “Cas” or “Cas protein”, as used herein their broadest sense, refer to a protein that associates with a gRNA and is guidable by the gRNA to a target nucleic acid. A “Cas enzyme” is a Cas protein that is able to cleave a target sequence (i.e. possesses nuclease activity). As is explained further herein, most embodiments utilize a Cas protein that has been mutated to lack catalytic activity (i.e. lack nuclease activity to cleave a target sequence).
As used herein, the term “Cas-transposase” refers to a fusion protein that comprises a Cas domain and a transposase domain. Typically, the Cas domain and transposase domain are fused via a linker.
The term “construct” or “gene construct” as used herein refers to a DNA sequence encoding a protein or RNA sequence that is associated with regulatory sequences which is inserted in the right orientation in a vector.
The term “effective amount,” as used herein, refers to an amount of a biologically active agent that is sufficient to elicit a desired biological response. For example, in some embodiments, an effective amount of a transposase may refer to the amount of the transposase that is sufficient to induce transposition at a target site specifically bound and recombined by the transposase. As will be appreciated by the skilled artisan, the effective amount of an agent, e.g., a nuclease, a transposase, a hybrid protein, a fusion protein, a protein dimer, a complex of a protein (or protein dimer) and a polynucleotide, or a polynucleotide, may vary depending on various factors as, for example, on the desired biological response, the specific allele, genome, target site, cell, or tissue being targeted, and the agent being used.
The term “engineered,” as used herein refers to a protein molecule, a nucleic acid, complex, substance, cell or entity that has been designed, produced, prepared, synthesized, and/or manufactured by a human. Accordingly, an engineered product is a product that does not occur in nature.
As used herein, the term “expression cassette” or “expression construct” refers to a unit cassette which includes a promoter and a polynucleotide encoding an expression product (polypeptide or RNA sequence), which is operably linked downstream of the promoter, to be capable of expressing the expression product. Various factors that can aid the efficient production of the expression product may be included inside or outside of the expression cassette. Conventionally, the expression cassette may include a promoter operably linked to the polynucleotide, a transcription termination signal, a ribosome-binding domain, and a translation termination signal. Specifically, the expression cassette may be in a form where the gene encoding the expression product is operably linked downstream of the promoter.
The term “fused” as used herein in reference to a protein refers to a connection of an end of a first protein domain with an end of second protein domain via a linker.
The term “guide RNA” or “gRNA” as used herein refers to an RNA molecule capable of directing a Cas enzyme to a target nucleic acid.
As used herein, the term “isolated” and the like means that the referenced material is free of components found in the natural environment in which the material is normally found. In particular, isolated biological material is free of cellular components. In the case of nucleic acid molecules, an isolated nucleic acid includes a PCR product, an isolated mRNA, a cDNA, an isolated genomic DNA, or a restriction fragment. In another embodiment, an isolated nucleic acid is preferably excised from the chromosome in which it may be found. Isolated nucleic acid molecules can be inserted into plasmids, cosmids, artificial chromosomes, and the like. Thus, in a specific embodiment, a recombinant nucleic acid is an isolated nucleic acid. An isolated protein may be associated with other proteins or nucleic acids, or both, with which it associates in the cell, or with cellular membranes if it is a membrane-associated protein. An isolated material may be, but need not be, purified.
The term “linker,” as used herein, refers to a chemical group or a molecule linking two adjacent molecules or moieties, e.g., a binding domain (e.g., dCas9) and a transposase domain (e.g., Himar). In some embodiments, a linker joins a nuclear localization signal (NLS) domain to another protein (e.g., a Cas9 protein or a transposase or a fusion thereof). In some embodiments, a linker joins a gRNA binding domain of an RNA-programmable nuclease and the catalytic domain of a transposase. In some embodiments, a linker joins a dCas9 and a transposase. Typically, the linker is positioned between, or flanked by, two groups, molecules, or other moieties and connected to each one via a covalent bond, thus connecting the two. In some embodiments, the linker is an amino acid or a plurality of amino acids (peptide linker). In some embodiments, the linker is an organic molecule, group, polymer, or chemical moiety. In some embodiments, the peptide linker is any stretch of amino acids having at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20, at least 25, at least 30, at least 40, at least 50, or more amino acids. In some embodiments, the peptide linker comprises repeats of the tri-peptide Gly-Gly-Ser, e.g., comprising the sequence (GGS)n, wherein n represents at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more repeats. In some embodiments, the linker comprises the sequence (GGS)6 (SEQ ID NO: 16). In some embodiments, the peptide linker is the 16 residue “XTEN” linker, or a variant thereof (See, e.g., the Examples; and Schellenberger et al. A recombinant polypeptide extends the in vivo half-life of peptides and proteins in a tunable manner. Nat. Biotechnol. 27, 1186-1190 (2009)). In another specific example, the linker implemented is an XTEN′ linker.
The term “mutation,” as used herein, refers to a substitution of a residue within a sequence, e.g., a nucleic acid or amino acid sequence, with another residue, or a deletion or insertion of one or more residues within a sequence. Mutations are typically described herein by identifying the original residue followed by the position of the residue within the sequence and by the identity of the newly substituted residue. Various methods for making the amino acid substitutions (mutations) provided herein are well known in the art, and are provided by, for example, Green and Sambrook, Molecular Cloning: A Laboratory Manual (4th ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (2012)).
“Nucleic acid” or “nucleic acid molecule” or “refers to deoxyribonucleotides or ribonucleotides and polymers thereof in either single- or double-stranded form. The nucleic acids herein may be flanked by natural regulatory (expression control) sequences, or may be associated with heterologous sequences, including promoters, internal ribosome entry sites (IRES) and other ribosome binding site sequences, enhancers, response elements, suppressors, signal sequences, polyadenylation sequences, introns, 5′- and 3′-non-coding regions, and the like. The term encompasses nucleic acids containing known nucleotide analogs or modified backbone residues or linkages, which are synthetic, naturally occurring, and non-naturally occurring, which have similar binding properties as the reference nucleic acid, and which are metabolized in a manner similar to the reference nucleotides. The nucleic acids may also be modified by many means known in the art. Non-limiting examples of such modifications include methylation, “caps”, substitution of one or more of the naturally occurring nucleotides with an analog, and internucleotide modifications such as, for example, those with uncharged linkages (e.g., methyl phosphonates, phosphotriesters, phosphoroamidates, and carbamates) and with charged linkages (e.g., phosphorothioates, and phosphorodithioates). Polynucleotides may contain one or more additional covalently linked moieties, such as, for example, proteins (e.g., nucleases, toxins, antibodies, signal peptides, and poly-L-lysine), intercalators (e.g., acridine, and psoralen), chelators (e.g., metals, radioactive metals, iron, and oxidative metals), and alkylators. The polynucleotides may be derivatized by formation of a methyl or ethyl phosphotriester or an alkyl phosphoramidate linkage. Modifications of the ribose-phosphate backbone may be done to facilitate the addition of labels, or to increase the stability and half-life of such molecules in physiological environments. Nucleic acid analogs can find use in the methods of the invention as well as mixtures of naturally occurring nucleic acids and analogs. Furthermore, the polynucleotides herein may also be modified with a label capable of providing a detectable signal, either directly or indirectly. Exemplary labels include radioisotopes, fluorescent molecules, and biotin.
The term “optional” or “optionally” means that the subsequent described event, circumstance or substituent may or may not occur, and that the description includes instances where the event or circumstance occurs and instances where it does not.
The term “origin of replication,” as used herein, refers to a nucleic acid sequence in a replicating nucleic acid molecule (e.g., a plasmid or a chromosome) at which replication is initiated.
As used herein, “payload sequence” relates to any nucleic acid sequence encoding a payload. A payload sequence is typically, but not necessarily, heterologous to the cell into which they are introduced.
As used herein, the term “payload” refers to a peptide, polypeptide, protein, DNA and/or RNA sequence. Examples of payloads include, but are not limited to, therapeutic proteins, RNA interfering molecules, selectable markers (positive or negative e.g. auxotrophy, prototrophy or antibiotic resistance), reporter (e.g. fluorophore), and/or or nucleic acid sequences involved in genetic manipulation such as guide RNA sequences. Examples of reporter genes is found in Thorn, Mol Biol Cell, 2017, 28:848-857 incorporated herein. Examples antibiotic resistance markers include, but are not limited to, genes that confer resistance to ampicillin, carbenicillin, chloramphenicol, hygromycin B, kanamycin, spectinomycin, or tetracyline. At certain locations herein, the terms “payload” and “cargo” are used interchangeably. Examples of auxotrophic and prototrophic markers are described in U.S. Pat. No. 9,243,253, incorporated herein.
A “polynucleotide” or “nucleotide sequence” or “nucleic acid sequence” is a series of nucleotide bases (also called “nucleotides”) in a nucleic acid, such as DNA and RNA, and means any chain of two or more nucleotides. A nucleotide sequence typically carries genetic information, including the information used by cellular machinery to make proteins and enzymes. These terms include double or single stranded genomic and cDNA, RNA, any synthetic and genetically manipulated polynucleotide, and both sense and anti-sense polynucleotide. This includes single- and double-stranded molecules, i.e., DNA-DNA, DNA-RNA and RNA-RNA hybrids, as well as “protein nucleic acids” (PNA) formed by conjugating bases to an amino acid backbone. This also includes nucleic acids containing modified bases, for example thio-uracil, thio-guanine and fluoro-uracil.
The term “polypeptide” or “amino acid sequence” as used herein means a compound of two or more amino acids linked by a peptide bond. “Polypeptide” is used herein interchangeably with the term “protein.”
The term “purified” and the like as used herein refers to material that has been isolated under conditions that reduce or eliminate unrelated materials, i.e., contaminants. For example, a purified protein is preferably substantially free of other proteins or nucleic acids with which it is associated in a cell and a purified nucleic acid molecule is preferably substantially free of proteins or other unrelated nucleic acid molecules with which it can be found within a cell. As used herein, the term “substantially free” is used operationally, in the context of analytical testing of the material. Preferably, purified material substantially free of contaminants is at least 50% pure; more preferably, at least 90% pure, and more preferably still at least 99% pure. Purity can be evaluated by chromatography, gel electrophoresis, immunoassay, composition analysis, biological assay, and other methods known in the art.
The term “RNA guide” as used herein refers to any RNA molecule that facilitates the targeting of a Cas protein described herein to a target nucleic acid. “RNA guides” include, but are not limited to, tracrRNAs, and crRNAs.
The term “sequence identity” or “identity,” as used herein in the context of two polynucleotides or polypeptides, refers to the residues in the sequences of the two molecules that are the same when aligned for maximum correspondence over a specified comparison window. As used herein, the term “percentage of sequence identity” or “% sequence identity” refers to the value determined by comparing two optimally aligned sequences (e.g., nucleic acid sequences or polypeptide sequences) of a molecule over a comparison window, wherein the portion of the sequence in the comparison window may comprise additions or deletions (i.e., gaps) as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions at which the identical nucleotide or amino acid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the comparison window, and multiplying the result by 100 to yield the percentage of sequence identity. A sequence that is identical at every position in comparison to a reference sequence is said to be 100% identical to the reference sequence, and vice-versa.
The terms “target nucleic acid,” as used herein in the context of transposase, refers to a nucleic acid molecule that comprises at least one target site of a given transposase. In the context of fusions comprising a (nuclease-inactivated) RNA-programmable nuclease and a transposase domain, a “target nucleic acid” refers to one or more nucleic acid molecule(s) that comprises at least one target site. Non-limiting examples include target nucleic acids in a plasmid, in a genome or in a cell. In a more specific example, the target nucleic acid is in a prokaryote cell genome or eukaryote cell genome.
The term “target site” as used herein refers to the sequence of the target nucleic acid recognized by a given transposon for insertion. In some embodiments, the target nucleic acid(s) comprises at least two, at least three, or at least four target sites. In certain preferred embodiments, the target nucleic acid is in a bacterial genome.
The terms “trans-activating crRNA” or “tracrRNA” as used herein refer to an RNA including a sequence that forms a structure required for a Cas nuclease to bind to a specified target nucleic acid.
As used herein, the term “transposase” refers to an enzyme that binds to specific inverted repeat sequences flanking a transposon and catalyzes its movement from location to location in a polynucleotide or genome by a cut-and-paste mechanism or a replicative transposition mechanism. Examples of transposases include Himar1 and Tn5.
As used herein, the term “transposon” refers to a DNA sequence that can change its position (‘jump’) within a polynucleotide or genome. Transposons are flanked at both 5′ and 3′ ends by a specific inverted repeat DNA sequence that is recognized by the corresponding transposase protein. In a specific example, a transposon is a class II transposon whose movement from one location to another is governed by the activity of a cut-and-paste transposase.
The term “mini-transposon” or “MT” refers to an engineered transposon that does not contain a gene encoding a transposase protein. Mini-transposons are unable to self-mobilize and instead rely on exogenous transposase protein for mobilization, such as Cas-transposase described herein, in contrast with many naturally-occurring transposons that encode their own transposase and are self-mobilizing. MTs may be engineered to include a payload sequence, such that the payload sequence is inserted into a target site, and may be expressed to produce a payload. An MT may be inserted without a payload sequence, typically for the purpose of disrupting expression of the target nucleic acid.
As used herein, “transposon end sequence(s)” refer to sequences that are recognized by and bound by a specific transposase protein to initiate movement of a transposon. Transposon end sequences are typically short (˜15-30 bp) inverted repeat sequences flanking DNA transposons (including mini-transposons) on 5′ and 3′ ends. The 5′ inverted repeat sequence is the reverse complement of the 3′ inverted repeat. When the transposon “jumps,” the inverted repeats move with the transposon.
The terms “vector”, “cloning vector” and “expression vector” mean the vehicle by which a DNA or RNA sequence (e.g. a gene construct) can be introduced into a cell, so as to transform the cell and promote expression (e.g. transcription and translation) of the introduced sequence or knockdown or disruption of the target nucleic. Vectors include, but are not limited to, cells, plasmids, phages, and viruses.
Reference throughout this specification to “some embodiments”, “an embodiment,” “an example embodiment,” means that a particular feature, structure or characteristic described in connection with the embodiment is included in at least one embodiment of the present invention. Thus, appearances of the phrases “in some embodiments,” “in an embodiment,” or “an example embodiment” in various places throughout this specification are not necessarily all referring to the same embodiment, but may. Furthermore, the particular features, structures or characteristics may be combined in any suitable manner, as would be apparent to a person skilled in the art from this disclosure, in one or more embodiments. Furthermore, while some embodiments described herein include some but not other features included in other embodiments, combinations of features of different embodiments are meant to be within the scope of the invention. For example, in the appended claims, any of the claimed embodiments can be used in any combination.
The recitation of numerical ranges by endpoints includes all numbers and fractions subsumed within the respective ranges, as well as the recited endpoints.
All publications, published patent documents, and patent applications cited herein are hereby incorporated by reference to the same extent as though each individual publication, published patent document, or patent application was specifically and individually indicated as being incorporated by reference.
Various embodiments are described hereinafter. It should be noted that the specific embodiments are not intended as an exhaustive description or as a limitation to the broader aspects discussed herein. One aspect described in conjunction with a particular embodiment is not necessarily limited to that embodiment and can be practiced with any other embodiment(s). Reference throughout this specification to “one embodiment”, “an embodiment,” “an example embodiment,” means that a particular feature, structure or characteristic described in connection with the embodiment is included in at least one embodiment of the present invention. Thus, appearances of the phrases “in one embodiment,” “in an embodiment,” or “an example embodiment” in various places throughout this specification are not necessarily all referring to the same embodiment, but may. Furthermore, the particular features, structures or characteristics may be combined in any suitable manner, as would be apparent to a person skilled in the art from this disclosure, in one or more embodiments. Furthermore, while some embodiments described herein include some but not other features included in other embodiments, combinations of features of different embodiments are meant to be within the scope of the invention. For example, in the appended claims, any of the claimed embodiments can be used in any combination.
Disclosed herein is a novel technology, Cas-Transposon (CasTn), which unites the DNA integration capability of the Himar1 transposase and the programmable genome targeting capability of dCas9 to enable site-directed transpositions at user-defined genetic loci. This gRNA-targeted Himar1-dCas9 fusion protein integrates mini-transposons carrying synthetic DNA payload sequences of interest into specific loci with nucleotide precision (
As set forth in the Examples, using cell-free in vitro assays, it has been demonstrated that the Himar-dCas9 fusion protein increased the frequency of transposon insertion at a single targeted TA dinucleotide by >300-fold compared to a random transposase, and that site-directed transposition is dependent on target choice while robust to log-fold variations in protein and DNA concentrations. It is also demonstrated that Himar-dCas9 mediates directed transposition into plasmids in Escherichia coli. This studies herein highlight CasTn as a new modality for host-independent, programmable, site-directed DNA insertions.
Certain embodiments described herein pertain to a fusion protein comprising a transposase fused to a Cas protein (Cas-transposase). Typically, the fusion protein is capable of site-directed transposon insertions at user-defined genetic loci.
In a primary example, the Cas protein of the fusion protein is catalytically inactive, and the transposase is Himar1 or Tn5. In a specific example, the transposase comprises a polypeptide sequence comprising at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity to the amino acid sequence of SEQ ID NO: 1 or active fragments thereof. In an alternative embodiment, the transposase comprises a polypeptide sequence comprising at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity to the amino acid sequence of SEQ ID NO: 5 or active fragments thereof.
In a specific embodiment, the Cas nuclease of Cas-transposase is Cas9. In a more specific example, the Cas9 nuclease is catalytically dead. In further specific example, the Cas9 nuclease comprises a polypeptide sequence comprising at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity to the amino acid sequence of SEQ ID NO:3.
In an exemplary embodiment, the fusion protein is Himar1-dCas9. The Himar1-dCas9 may further comprise a linker between the transposase and the Cas nuclease. In a specific example, the linker comprises a polypeptide sequence comprising at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity to the amino acid sequence of SEQ ID NO:6.
As is described a Cas protein is a protein that associates with a gRNA and is guidable by the gRNA to a target nucleic acid. The Cas protein may be able to cleave a target sequence (i.e. possess nuclease activity) or be mutated to lack catalytic activity (i.e. lack nuclease activity). Conventionally, the Cas enzyme directs cleavage of one or two strands at or near a target sequence, such as within the target sequence and/or within the complementary strand of the target sequence. For example, the Cas enzyme may direct cleavage of one or both strands within about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 50, 100, 200, 500, or more nucleotides from the first or last nucleotide of a target sequence. In certain embodiments, format on of a CRISPR complex results in cleavage (e.g., a cutting or nicking) of one or both strands in or near (e.g. within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 50, or more base pairs from) the target sequence. In some embodiments, the Cas enzyme lacks DNA strand cleavage activity.
The Cas enzyme may be a type II, type I, type III, type IV or type V CRISPR system enzyme. In some embodiments, the Cas enzyme is a Cas9 enzyme (also known as Csn1 and Csx12), preferably one mutated to lack catalytic activity. Non-limiting examples of the Cas9 enzyme include Cas9 derived from Streptococcus pyogenes (S. pyogenes), S. pneumoniae, Staphylococcus aureus, Neisseria meningitidis, Streptococcus thermophilus (S. thermophilus), or Treponema denticola. The Cas enzyme may also be derived from Corynebacter, Sutterella, Legionella, Treponema, Filifactor, Eubacterium, Streptococcus, Lactobacillus, Mycoplasma, Bacteroides, Flaviivola, Flavobacterium, Sphaerochaeta, Azospirillum, Gluconacetobacter, Neisseria, Roseburia, Parvibaculum, Staphylococcus, Nitratifractor, Mycoplasma and Campylobacter.
Non-limiting examples of the Cas enzymes also include Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, Cas10, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, homologs thereof, orthologs thereof, or modified versions thereof.
Wildtype or mutant Cas enzyme may be used. In some embodiments, the nucleotide sequence encoding the Cas9 enzyme is modified to alter the activity of the protein. The mutant Cas enzyme may lack the ability to cleave one or both strands of a target polynucleotide containing a target sequence. For example, an aspartate-to-alanine substitution (D10A) in the RuvC I catalytic domain of Cas9 from S. pyogenes converts Cas9 from a nuclease that cleaves both strands to a nickase (cleaves a single strand). Other examples of mutations that render Cas9 a nickase include, without limitation, D10A, H840A, N854A, N863A, and combinations thereof. In some embodiments, a Cas9 nickase may be used in combination with guide RNA(s), e.g., two guide RNAs, which target respectively sense and antisense strands of the DNA target.
Two or more catalytic domains of Cas9 (RuvC and/or HNH domains) may be mutated to produce a mutated Cas9 substantially lacking all DNA cleavage activity (a catalytically inactive Cas9). In some embodiments, a D10A mutation is combined with one or more of H840A, N854A, or N863A mutations to produce a Cas9 enzyme substantially lacking DNA cleavage activity (dead Cas 9 or dCas9). In some embodiments, a Cas enzyme is considered to substantially lack DNA cleavage activity when the DNA cleavage activity of the mutated enzyme is about or less than about 25%, 10%, 5%, 1%, 0.1%, 0.01%, or lower, compared to its non-mutated (wildtype) form. Other mutations may be useful; where the Cas9 or other Cas enzyme is from a species other than S. pyogenes, mutations in corresponding amino acids may be made to achieve similar effects.
The Cas protein can be introduced into a cell in the form of a DNA, mRNA or protein. The Cas protein may be engineered, chimeric, or isolated from an organism.
Another embodiment is a vector comprising one or more of the gRNA sequences and a nucleic acid sequence encoding a Cas-transposase. Alternatively, a sequence encoding a Cas-transposase may be provided in a vector separate from a vector encoding gRNA(s). In some embodiments, the vector comprises two or more Cas-transposase coding sequences operably linked to different promoters. In some embodiments, the host cell expresses one or more Cas-transposase(s) or gRNA(s).
Other embodiments relate to systems to transpose a mini-transposon at a target site of a target nucleic acid. In one embodiment, the system includes a nucleic acid sequence that encodes a fusion protein comprising a Cas domain and transposase domain fused via a linker, such as the Cas-transposase described herein. The system further includes at least one gRNA sequence complementary to a segment of the target nucleic acid, wherein the segment is adjacent to a target site for mini-transposon insertion. In addition, the system may comprise at least one mini-transposon that is inserted at the target site in conjunction with the transposase used.
In embodiments where disruption of expression of a gene is desired, the mini-transposon implemented need not be fused with a payload sequence. All that would be required is that the mini-transposon be inserted at the target site, where the target site is one where the insertion disrupts expression (i.e. transcription or translation) of the target nucleic acid.
In other embodiments where the delivery of a payload, such as in a cell, is desired, a first transposon end sequence is fused to the 5′ end of payload sequence and a second transposon end sequence is fused to a 3′ end of a payload sequence.
In one implementation, the system may be configured for cell-free insertion of a mini-transposon at the target site. In this implementation, the components of the system may be naked sequences, or associated with a vector. Also, in an alternative embodiment, the system does not require expression of a sequence encoding the fusion protein. This would typically be in cell free utilization, wherein the actual fusion protein (e.g. Cas-transposase) is provided along with the gRNA. In this embodiment, the gRNA may be preloaded onto Cas-transposase before being provided to the target nucleic acid.
Where the target nucleic acid is within a cell, the components of the system are generally, though not necessarily, packaged in a vector, which can be in the form of a number of different configurations. For example, the system may include a first plasmid harboring a nucleic acid sequence encoding a Cas-transposase, a second plasmid harboring a gRNA nucleic acid sequence and a third plasmid harboring a mini-transposon (with or without a payload sequence). Alternatively, a combination at least two components of the system may be packaged in a vector, with any remaining components packaged in a separate vector. The arrangement can be in any number of different configurations so long as the required components for insertion of the mini-transposon are provided to the target nucleic acid. Specific versions are further described in the Examples section below.
The system may also be designed to insert a mini-transposon in a target nucleic acid in a cell in vivo. In such instance, a vector suitable for in vivo administration would be utilized, including but not limited to a virus such as retroviruses, adenoviruses, adeno-associated viruses, herpes simplex virus, and the like. See Lundstrom, Viral Vectors in Gene Therapy, Diseases, 2018, 6(2):42. Alternatively, components of the system are administered to a subject via naked polynucleotides (e.g. naked DNA), or physical vehicles such as liposomes and nanoparticles. It is noted that the above approaches for inserting a transposon in a cell in vivo, may be applied to cells in vitro. See Nayerossadat et al., Adv Biomed Res, 2012; 1:27.
In one example, the gRNA of the system typically comprises 15-25 bp. The gRNA sequence is optimally designed to have a segment that hybridizes to the target nucleic acid at a location 3-50 bp from the target site. In a more specific example, the gRNA includes a segment that hybridizes 5-30 bp from the target site.
Examples of mini-transposons that may be utilized in the system include, but are not limited to, gene constructs flanked by inverted repeat sequences of the Himar1 transposon and Tn5 transposon. Examples of specific Himar1 mini-transposons are found in the Sequences section herein below. However, permittable variations of the transposon end sequences can be implemented so long as they facilitate transposition at a target site. Accordingly, examples of transposon end sequences include sequences having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity with SEQ ID NO: 9 or SEQ ID NO:12.
Another embodiment pertains to a method of inserting a mini-transposon into a target site of a target nucleic sequence. The target nucleic acid may be in a cell-free system or in a cell. The method involves providing the target nucleic acid sequence with a fusion protein having a Cas domain and a transposase domain (e.g. Cas-transposase), at least one gRNA sequence complementary to a segment of DNA sequence, wherein the segment is adjacent to a target site for transposon insertion, and, optionally, at least one mini-transposon, that may or may not be fused to a payload sequence. The method is conducted under conditions to allow for insertion of the mini-transposon into the target site. The Cas domain and transposase domains are optionally fused via a linker. As described above, the insertion of the transposon may be conducted in an in vitro cell free system, in vitro cell system, or in a cell in vivo.
In a related embodiment, a method of inserting a payload sequence into a target site of a target nucleic acid is disclosed. The method involves providing to the target nucleic acid (i) a fusion protein having a Cas domain and a transposase domain (e.g. Cas-transposase), (ii) at least one gRNA sequence complementary to a segment of a target nucleic acid, wherein the segment is adjacent to the target site to direct transposon insertion; and (iii) a payload sequence comprising a 5′ end and a 3′ end, wherein the payload sequence comprises a first transposon end sequence fused to the 5′ end and a second transposon end sequence fused to the 3′ end. The method is conducted under conditions to allow for insertion of the mini-transposon-payload construct into the target site.
The elements of the system or elements provided to the targeted nucleic acid in the method embodiments may be packaged in one or more vectors. For example, (i) the fusion protein (e.g. Cas-transposase), (ii) the at least one gRNA, and (iii) the at least one mini-transposon or mini-transposon-payload construct may be packaged into a single vector, such as a plasmid or viral vector. In an alternative embodiment, two of elements (i), (ii), and (iii) are packaged into a first vector and a third element is packaged into a second vector. In another alternative embodiment, each of elements (i), (ii), and (iii) are packaged into a first, second and third vector, respectively. In a specific embodiment, the target nucleic acid is a DNA sequence in a cell.
According to a further embodiment, disclosed is an expression cassette including a nucleic acid sequence comprising a first nucleic acid sequence encoding a transposase, a second nucleic acid sequence encoding a Cas nuclease, and a third nucleic acid sequence encoding a linker peptide positioned between the first sequence and second sequence. In a specific example, the transposase pertains to Himar1 transposase or a Tn5 transposase. The transposase may comprise a polypeptide sequence comprising at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity to the amino acid sequence of SEQ ID NO: 1 or 2, or active fragments thereof. According to another example, the transposase comprises a polypeptide sequence comprising at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity to the amino acid sequence of SEQ ID NO:4, or active fragments thereof. In a specific example, the Cas domain of the expression cassette is Cas9. As discussed above, the Cas domain typically will encode a catalytically dead Cas protein. In a specific embodiment, the Cas9 nuclease comprises a polypeptide sequence comprising at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity to the amino acid sequence of SEQ ID NO:6, or active fragments thereof.
In a specific example, the nucleic acid sequence encoding the linker comprises a polypeptide sequence comprising at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity to the amino acid sequence of SEQ ID NO:6.
In another example, a Cas-transposase with linker comprises a polypeptide sequence comprising at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity to the amino acid sequence of SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO: 7 or SEQ ID NO:8. In an alternate embodiment, SEQ ID NO:3 includes one or more of the following mutations: Y12A, Y12S, F31A, W119A, V120A, P121A, R122A, E123A, L124A, and any combination thereof. In another alternate embodiment, SEQ ID NO:5 includes one or more of the following mutations: M470_I476del, A471_I476del, S458A and any combination thereof.
In related embodiments, provided are system embodiments comprising an expression cassette as described herein and at least one gRNA sequence complementary to a segment of DNA sequence, wherein the segment is adjacent to a target site of a target nucleic acid. In a specific embodiment, the segment is 15-25 bp in length. Typically, segment is 3-50 bp from the target site, or more specifically, 5-30 bp from the target site. Similar to other system embodiments described herein, the system may further include at least one mini-transposon. Where payload delivery is desired, at least one mini-transposon is fused with a payload sequence. In a more specific embodiment, a first transposon end sequence is fused to the 5′ end of a payload sequence and a second transposon end sequence that is fused at the 3′ end of the payload sequence. The transposon end sequences may be inverted repeats of a himar1 transposon or Tn5 transposon. In a specific embodiment, the transposon end sequence includes a sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity with SEQ ID NO: 9, or the reverse complement thereof, or SEQ ID NO:12, or the reverse complement thereof. Typically, on a single strand nucleic acid sequence, the transposon end sequence on the 5′ end will be SEQ ID NO:9 or SEQ ID NO:12, and the transposon end sequence on the 3′ end reverse complement of SEQ ID NO:9 or SEQ ID NO:12, respectively.
Guide RNAs can be configured to have suitable lengths and distinct nucleic acid sequences to direct binding of a Cas-transposase adjacent to a target site of a target nucleic acid. In a specific example, the gRNA is configured to have a segment complementary to a location 3-50 bp from the target site. In a more specific example, the segment is complementary to a location 3-50 bp from the target site. Typically, the gRNA segment is 15-25 bp in length.
The gRNA is configured to bind to the Cas-transposase, which can be effectuated at different stages of the method. For example, the Cas-transposase may be pre-bound with gRNA prior to provision to target nucleic acid, which would typically be in the situation of an in vitro system. Alternatively, the Cas-transposase and gRNA are provided separately such as through expression by an expression cassette in a host cell and assembled within to allow the Cas-transposase to be guided to the target nucleic acid. Any guide sequence can be used in a gRNA, depending on the target nucleic acid. Considerations relevant to developing a gRNA include specificity, stability, and functionality. Specificity refers to the ability of a particular gRNA:Cas-transposase complex to bind to and/or cleave a desired target sequence, whereas little or no binding and/or cleavage of polynucleotides different in sequence and/or location from the desired target occurs. Thus, specificity refers to minimizing off-target effects of the gRNA:Cas-transposase complex. Stability refers to the ability of the gRNA to resist degradation by enzymes, such as nucleases, and other substances that exist in intracellular and extra-cellular environments. Further considerations relevant to developing a gRNA include transferability and immunostimulatory properties. Thus, gRNA are used that have efficient and titratable transferability into cells, especially into the nuclei of eukaryotic cells, and having minimal or no immunostimulatory properties in the transfected cells. Another important consideration for gRNA is to provide an effective means for delivering it into and maintaining it in the intended cell, tissue, bodily fluid or organism for a duration sufficient to allow the desired gRNA functionality.
As described in the Examples, the system and methods may implement more than one gRNA. For example, a first gRNA is configured to have a portion complementary to a segment of target nucleic acid sequence adjacent to a target site and a second gRNA configured to a have portion complementary to a segment of a target nucleic acid sequence adjacent to a target site. The first gRNA may bind to a segment on one strand of a double stranded DNA molecule, and the second gRNA may bind to a segment on the opposing strand of a double stranded DNA molecule.
Vectors may comprise a nucleic acid sequence into which a foreign nucleic acid sequence is inserted. A common way to insert one segment of nucleic acid sequence into another segment of a nucleic acid sequence involves the use of enzymes called restriction enzymes that cleave DNA at specific sites (specific groups of nucleotides) called restriction sites. A common type of vector is a “plasmid”, which generally is a self-contained molecule of double-stranded DNA, usually of bacterial origin, that can readily accept additional (foreign) DNA and which can readily introduced into a suitable cell. A plasmid vector often contains coding DNA and promoter DNA and has one or more restriction sites suitable for inserting foreign DNA. Coding DNA is a DNA sequence that encodes a particular amino acid sequence for a particular protein or enzyme. Promoter DNA is a DNA sequence which initiates, regulates, or otherwise mediates or controls the expression of the coding DNA. Promoter DNA and coding DNA may be from the same gene or from different genes, and may be from the same or different organisms. A large number of vectors, including plasmid and fungal vectors which replicate or exist episomally, have been described for replication and/or expression in a variety of eukaryotic and prokaryotic hosts. Non-limiting examples include pKK plasmids (Clonetech), pUC plasmids, pET plasmids (Novagen, Inc., Madison, Wis.), pRSET or pREP plasmids (Invitrogen, San Diego, Calif.), or pMAL plasmids (New England Biolabs, Beverly, Mass.), and many appropriate host cells, using methods disclosed or cited herein or otherwise known to those skilled in the relevant art. Recombinant cloning vectors will often include one or more replication systems for cloning or expression, one or more markers for selection in the host, e.g. antibiotic resistance, and one or more expression cassettes.
Typically, an expression cassette is engineered such that it can be inserted into a vector at defined restriction sites. The cassette restriction sites are designed to ensure insertion of the cassette in the proper reading frame. Generally, a foreign nucleic acid is inserted at one or more restriction sites of the vector sequence, and then is carried by the vector into a host cell along with the transmissible vector sequence.
In other embodiments, provided is a kit comprising a container and any number of system elements described above. For example, the kit may comprise a Cas-transposase, at least one gRNA and/or at least one mini-transposon or mini-transposon/payload sequence construct, disposed either individually or in some combination in a container. In some applications, one or more system elements may be provided in pre-measured single use amounts in individual, typically disposable, tubes or equivalent containers. The kits can also include packaging materials for holding the container or combination of containers. Typical packaging materials for such kits and systems include solid matrices (e.g., glass, plastic, paper, foil, micro-particles and the like) that hold the system elements in any of a variety of configurations (e.g., in a vial, microtiter plate well, microarray, and the like). The kits may further include instructions recorded in a tangible form for use of the components.
In further embodiments, CasTn technology is implemented in vitro for purposes of exome capture, in which specific exons of interest from a genome are sequenced using high-throughput sequencing platforms. Historically, selected exons were captured for sequencing via hybridization with DNA probes (Albert T J, Molla M N, Muzny D M et al. Direct selection of human genomic loci by microarray hybridization. Nature methods. 2007; 4:903-905. DOI: 10.1038/nmeth1111; Parla J S, Iossifov I, Grabill I et al. A comparative analysis of exome capture. Genome biology. 2011; 12:R97. DOI: 10.1186/gb-2011-12-9-r97). CasTn offers an alternative mechanism for generating exome capture sequencing libraries. A purified fusion Cas-transposase, a library of guide RNAs (gRNAs) targeting exons of interest, and mini-transposons containing sequencing adapter sequences could be mixed in vitro with genomic DNA to enable selective insertion of sequencing adapters at the targeted exons. Exons flanked by adapters can then be amplified into a sequencing library by PCR. The reagents for this protocol (fusion transposase, mini-transposons, gRNA library, and PCR primers) may be made commercially available as a kit. Users would also be able to easily customize their exome capture by using custom-designed gRNAs and/or gRNA libraries.
In other embodiments, utilizations for in vivo CasTn technology include metabolic engineering. By delivering the components of CasTn, including a fusion Cas-transposase protein, one or more gRNAs targeting an endogenous gene, and a mini-transposon, into a cell, one could actuate the deletion of the targeted endogenous gene. Furthermore, by including a new gene or gene cassette on the mini-transposon, one could perform a one-step substitution of one gene for another, enabling facile manipulation of metabolic synthesis pathways. There are several possible embodiments for such a technology. The Cas-transposase could be delivered into a cell as a purified protein (via electroporation or liposome transfection), or encoded on a non-replicative plasmid to maintain stability of inserted transposons. gRNAs could be delivered either as purified gRNAs, either separately or associated with the Cas-transposase protein, or encoded on an expression vector such as a non-replicative plasmid. The transposon would be delivered on a nucleic acid vector such as a plasmid.
Summary of Results
All E. coli strains were grown aerobically in LB Lennox broth at 37° C. with shaking, with antibiotics added at the following concentrations: carbenicillin (carb) 50 μg/mL, kanamycin (kan) 50 μg/mL, chloramphenicol (chlor) 20-34 μg/mL, and spectinomycin (spec) 240 μg/mL for S17 derivative strains and 60 μg/mL for non-S17 derivative strains. Supplements were added at the following concentrations: diaminopimelic acid (DAP) 50 μM, anhydrotetracycline (aTc) 1-100 ng/mL, and magnesium chloride (MgCl2) 20 mM.
Buffers used in the study were as follows. Protein resuspension buffer (PRB): 20 mM Tris-HCl pH 8.0, 10 mM imidazole, 300 mM NaCl, 10% v/v glycerol. One tablet of cOmplete™ Mini, EDTA-free Protease Inhibitor Cocktail (Roche) was dissolved in 10 mL buffer immediately before use. Protein wash buffer (PWB): 20 mM Tris-HCl pH 8.0, 30 mM imidazole, 500 mM NaCl, 10% v/v glycerol. Protein elution buffer (PEB): 20 mM Tris-HCl pH 8.0, 500 mM imidazole, 500 mM NaCl, 10% v/v glycerol. Dialysis buffer 1 (DB1): 25 mM Tris-HCl pH 7.6, 200 mM KCl, 10 mM MgCl2, 2 mM DTT, 10% v/v glycerol. Dialysis buffer 2 (DB2): 25 mM Tris-HCl pH 7.6, 200 mM KCl, 10 mM MgCl2, 0.5 mM DTT, 10% v/v glycerol. 10× Annealing buffer: 100 mM Tris-HCl pH 8.0, 1 M NaCl, 10 mM EDTA (pH 8.1).
The gene encoding fusion protein Himar1C9-XTEN-dCas9 (Himar-dCas9) was constructed from the hyperactive Himar1C9 transposase gene on plasmid pSAM-BT21 and the dCas9 gene from pdCas9-bacteria (Addgene plasmid #44249). Flexible peptide linker sequence XTEN35 was synthesized as a gBlock® (Integrated DNA Technologies). DNA sequences were polymerase chain reaction (PCR) amplified using Kapa Hifi Master Mix (Kapa Biosystems) and cloned into expression vectors using NEBuilder® HiFi DNA Assembly Master Mix (New England Biolabs). Himar-dCas9 and Himar1C9 genes were cloned into a C-terminal 6×His-tagged T7 expression vector (yielding plasmids pET-Himar-dCas9 and pET-Himar) for protein production and purification. Himar-dCas9, dCas9, and Himar1C9 genes were cloned into tet-inducible bacterial expression vectors (yielding plasmids pHdCas9, pdCas9-carb, and pHimar1C9, respectively) to assess protein function in vivo. Tet-inducible bacterial expression vectors for Himar-dCas9 that additionally feature constitutive gRNA expression cassettes were constructed to evaluate site-specificity of Himar-dCas9 in vivo: pHdCas9-gRNA1, pHdCas9-gRNA4, pHdCas9-gRNA5, pHdCas9-gRNA5-gRNA16 containing gRNA_1, gRNA_4, gRNA_5, and both gRNA_5 and gRNA_16, respectively. Himar-dCas9 was cloned into a mammalian expression vector with an N-terminal 3×FLAG tag and SV40 nuclear localization signal (pHdCas9-mammalian), and this mammalian variant of the Himar-dCas9 protein was purified from C-terminal 6×His-tagged expression vector pET-Himar-dCas9-mammalian. Plasmids used in this study are described in Table 1. All gRNAs used in this study are described in Table 2.
Measurement of Himar-dCas9 Gene Expression Knockdown in E. coli
Expression knockdown of mCherry in E. coli strain EcSC83 (MG1655 galK::mCherry-specR) was measured. Tet-inducible expression vectors pHdCas9-gRNA5-gRNA16 and pdCas9-gRNA5-gRNA16 were used to produce either Himar-dCas9 or dCas9 (a positive control) in each strain along with two gRNAs targeting mCherry. Expression knockdown of green fluorescent protein (GFP) encoded on the pTarget plasmid in the E. coli S17 strain was measured. Tet-inducible expression vectors (pHdCas9-gRNA1, pHdCas9-gRNA4, pHdCas9-gRNA5, pHdCas9 for negative control) were used to express Himar-dCas9 along with a GFP-targeting gRNA in S17 with pTarget.
Saturated overnight E. coli cultures were diluted 1:40 into fresh LB media containing aTc to induce Himar-dCas9 or dCas9 expression. Aliquots of induced cultures (200 μL) were grown with shaking on 96-well plates at 37° C. on a BioTek plate reader. Measurements of OD600 and mCherry (excitation 580 nm, emission 610 nm) and GFP (excitation 485 nm, emission 528 nm) fluorescence were taken 12 h post induction.
Measurement of Himar-dCas9 Transposase Activity in E. coli
Himar-dCas9 and Himar1C9 proteins were expressed in MG1655 E. coli from tet-inducible expression vectors pHdCas9 and pHimar1C9, respectively. These strains were conjugated with DAP-auxotrophic donor strain EcGT2 (S17 asd::mCherry-specR)45 containing transposon donor plasmid pHimar6, which has a 1.4 kb Himar1 mini-transposon containing a chlor resistance cassette and the R6K origin of replication, which does not replicate in MG1655.
Donor and recipient cultures were grown overnight at 37° C.; donors were grown in LB with DAP and kan, and recipients were grown in LB with carb. Donor culture (100 μL) was diluted in 4 mL fresh media. Recipient culture (100 μL) was diluted in 4 mL fresh media with 1 ng/mL aTc to induce transposase expression. Both cultures were grown for 5 h at 37° C. Donor and recipient cultures were centrifuged and re-suspended twice in phosphate-buffered saline (PBS) to wash the cells. Donor (109) and recipient (109) cells were mixed, pelleted, re-suspended in 20 μL PBS, and dropped onto LB agar with 1 ng/mL aTc. The cell droplets were dried at room temperature and then incubated for 2 h at 37° C. After conjugation, cells were scraped off, re-suspended in PBS, and plated±chlor (20 μg/mL) to select for recipient cells with an integrated transposon. Transposition rates were measured as the ratio of chlor-resistant colony-forming units (CFUs) to total CFUs.
His-tagged Himar-dCas9 was purified by nickel affinity chromatography from Rosetta2 cells (Novagen) bearing plasmid pET-Himar-dCas9 or pET-Himar-dCas9-mammalian. Saturated overnight culture (1 mL) grown in LB with chlor (34m/mL) and carb was diluted in 100 mL fresh media and grown to OD0.6-0.8 at 37° C. with shaking. Isopropyl β-d-1-thiogalactopyranoside (IPTG; 0.2 mM) was added to induce protein expression, and the flask was incubated for 16 h at 18° C. with shaking. The cells were pelleted by centrifugation at 7,197 g for 5 min at 4° C. and then re-suspended in 5 mL ice-cold PRB. Cells were lysed in an ice water bath using a Qsonica sonicator at 40% power for a total of 120 s in 20 s on/off intervals. The cell suspension was mixed by pipetting, and the sonication step was repeated. The lysate was centrifuged at 7,197 g for 10 min at 4° C. to pellet cell debris, and the cleared cell lysate was collected.
All subsequent steps were performed at 4° C. Ni-NTA agarose (1 mL; Qiagen) was added to a 15 mL polypropylene gravity flow column (Qiagen) and equilibrated with 5 mL of PRB. Cleared cell lysate was added to the column and incubated on a rotating platform for 30 min. The lysate was flowed through, and the nickel resin was washed with 50 mL PWB. The protein was eluted with PEB in five fractions of 0.5 mL each. Each elution fraction was analyzed by running an sodium dodecyl sulfate polyacrylamide gel electrophoresis. Elution fractions 2-4 were combined and dialyzed overnight in 500 mL DB1 using 10K MWCO Slide-A-Lyzer™ Dialysis Cassettes (Thermo Fisher Scientific). The protein was dialyzed again in 500 mL DB2 for 6 h. The dialyzed protein was quantified with the Qubit Protein Assay Kit (Thermo Fisher Scientific) and divided into single-use aliquots that were snap frozen in dry ice and ethanol and stored at −80° C. SDS-PAGE of purified Himar-dCas9 is shown in
C-terminal 6×His-tagged Himar1C9 was purified by nickel affinity chromatography from Rosetta2 cells (Novagen) bearing plasmid pET-Himar. Saturated overnight culture (1 mL) grown in LB with chlor (34m/mL) and carb was diluted in 100 mL fresh media and grown to OD0.9 at 37° C. with shaking. IPTG (0.5 mM) was added to induce protein expression, and the flask was incubated at 37° C. with shaking for 1 h. The cells were pelleted as described above, and the protein was purified using the His-Spin Protein Miniprep Kit (Zymo Research) according to the manufacturer's instructions, using the denaturing buffer protocol. The purified protein was dialyzed, frozen, and stored as described above. Purified Himar1C9 was used in control in vitro reactions along with commercially available purified dCas9 (Alt-R® S.p. dCas9 Protein V3; Integrated DNA Technologies).
The specificity and efficiency of transposition by purified Himar-dCas9 within in vitro reactions was characterized (
To set up in vitro reactions, frozen aliquots of Himar-dCas9 protein and gRNAs were thawed on ice. The protein was diluted to a 20× final concentration in DB2 buffer, and gRNAs were diluted to the same molarity in nuclease-free water. The diluted protein and gRNA were mixed in equal volumes and incubated at room temperature for 15 min. Transposon donor DNA, target plasmid DNA, and background DNA (if applicable) were mixed on ice with 10 μL 2× transposition buffer master mix and water to reach a volume of 18 μL. The protein/gRNA mixture (2 μL) was added last to the reaction. In reactions where the transposase/gRNA complex was preloaded onto the target plasmid, the target plasmid was mixed with protein and gRNA and incubated at 30° C. for 10 min, and donor DNA was added last. Transposition reactions were incubated for 3-72 h at 30-37° C. and then heat inactivated at 75° C. for 20 min. Transposition products were purified using magnetic beads46 and eluted in 45 μL nuclease-free water.
One method used to evaluate the specificity and efficiency of Himar-dCas9 within in vitro transposition reactions was a series of quantitative PCRs (qPCRs;
For in vitro transposition into pGT-B1 (target plasmid used in in vitro experiments), primers p433 and p415 were used for junction PCRs, and primers p828 and p829 were used for control PCRs. For in vitro transposition into pTarget (target plasmid used for in vivo bacteria experiments) or pZE41-eGFP (target plasmid used to test mammalian CasTn components in vitro), primers p898 and p415 were used for junction PCRs, and primers p899 and p900 were used for control PCRs. All qPCR primers used in this study are listed in Table 3.
To survey the distribution of transposition events performed by Himar-dCas9, transposon sequencing was performed on in vitro reaction products (
Dynabeads (2 μL) were used as a template for the final PCR using barcoded P5 and P7 primers and Q5 HiFi 2× Master Mix (NEB)+SYBR Green. Reactions were thermocycled using a Bio-Rad C1000 touch qPCR machine for 1 min at 98° C., followed by cycles of 98° C. denaturation for 10 s, 67° C. annealing for 15 s, and 72° C. extension for 20 s until the exponential phase. Equal amounts of DNA from all PCR reactions were combined into one sequencing library, which was purified and size selected for 145 bp products using the Select-a-Size Clean and Concentrator Kit (Zymo). The library was quantified with the Qubit dsDNA HS Assay Kit (Invitrogen) and combined at a ratio of 7:3 with PhiX sequencing control DNA. The library was sequenced using a MiSeq V2 50 Cycle Kit (Illumina) with custom read 1 and index 1 primers spiked into the standard read 1 and index 1 wells. Reads were mapped to the pGT-B1 plasmid using Bowtie 2.47
Oligonucleotides Adapter_T and Adapter_B were diluted to 100 μM in nuclease-free water. Ten microliters of each oligo was mixed with 2.5 μL water and 2.5 μL 10× annealing buffer. The mixture was heated to 95° C. and cooled at 0.1° C./s to 4° C. to yield 25 μL of 40 μM sequencing adapter, which was stored at −20° C.
Another method used to measure transposition specificity and efficiency was transformation of the reaction product DNA into competent E. coli and analyzing transposon inserts in individual transformants (
To assess the direction of transposon insertion into pGT-B1 plasmids, ElectroMAX™ Stbl4™ electrocompetent E. coli, which have lower rates of recombination, were transformed with DNA from in vitro transposition reactions as described above. We performed colony PCR on transformants using primer sets p771/p415 (amplifying “forward” transposon-target junctions) and p433/p415 (amplifying “reverse” junctions) to assess for directionality (
In Vivo Assays for Transposition into a Target Plasmid
S17 E. coli were sequentially electroporated with plasmid pTarget as a target plasmid and then one of several pHdCas9-gRNA plasmids (pHdCas9-gRNA1, pHdCas9-gRNA4, pHdCas9-gRNA5, or pHdCas9), which are bacterial expression vectors for Himar-dCas9 and a gRNA (
Minipreps from each transformation were evaluated by qPCR for junctions between the transposon from pHimar6 and the pTarget plasmid and by a transformation assay. qPCR assays for transposon-target plasmid junctions were performed as described above, using primers p898 and p415 and 10 ng miniprep DNA as PCR template. The control PCR to normalize for pTarget DNA input was performed with primers p899 and p900. In transformations, 150 ng plasmid DNA was electroporated into 10 μL MegaX electrocompetent cells diluted in 50 μL ice-cold distilled water. Cells were immediately recovered in 1 mL LB and incubated with shaking at 37° C. for 90 min. The cells were plated on LB agar with chlor (20 μg/mL) and spec (60 μg/mL) to select for pTarget plasmids containing a transposon from pHimar6. Colony PCR was performed using the primer set p898/p415 with KAPA2G Robust HotStart ReadyMix (Kapa Biosystems) to amplify transposon-pTarget junctions, which were analyzed by Sanger sequencing.
Chinese hamster ovary (CHO) cells were cultured in Ham's F-12K (Kaighn's) Medium (Thermo Fisher Scientific) with 10% fetal bovine serum and 1% penicillin-streptomycin. The eGFP+ CHO cell line was generated by transfection of plasmids pcDNA5/FRT/Hyg-eGFP and pOG44 into the Flp-In™-CHO cell line (Thermo Fisher Scientific) followed by selection in media with hygromycin (500m/mL). An eGFP−, mCherry+, puromycin-resistant site-specific transposition positive control cell line was generated by transfection of plasmids pcDNA5/FRT/Hyg-Himar and pOG44 into the Flp-In™-CHO cell line followed by selection in media with puromycin (10 μg/mL). Transfections were performed on cells at 70% confluence on six-well plates using 12 μL of Lipofectamine 2000 and 1,000 ng of each plasmid. Antibiotic selection was initiated 48 h after transfection. Polyclonal transfected cells were trypsinized and passaged for use in subsequent experiments.
The eGFP+ CHO cell line was transfected with a pHP plasmid (transposon donor and gRNA expression vector) and the pHdCas9-mammalian expression plasmid. Transfections were performed on cells at 70% confluence on six-well plates using 12 μL of Lipofectamine 2000 and 1,250 ng of each plasmid. In the transposition negative control, the pHP-M1-M2 plasmid was transfected without the pHdCas9-mammalian plasmid. Transfection efficiencies were 40-70% based on flow cytometry measurements of mCherry expression in cells 24 h post transfection of control plasmid pHP-on. Antibiotic selection with puromycin (10m/mL) was initiated 48 h after transfection. Cells from each transfection were trypsinized after 9 days of selection, and the whole volume was transferred into a single well of a 12-well plate and grown for four more days in puromycin media. During 13 days of antibiotic selection, the medium was changed every 24 h. Post-selection cells were trypsinized and diluted 1:5 in fresh media and analyzed on a Guava easyCyte flow cytometer (Millipore). Gates for mCherry and GFP fluorescence were set using mCherry−/eGFP− CHO cells, mCherry−/eGFP+ CHO cells, and mCherry+/eGFP− transposition positive control CHO cells.
Genomic DNA from trypsinized cells was extracted using the Wizard Genomic DNA Purification Kit (Promega) for PCR analysis. qPCR for transposon-gDNA junctions was performed as described above using primers p933 and p946. The control PCR to normalize for DNA input was performed using primers p931 and p932. Purified gDNA (10 ng per sample) was used as PCR template.
The design of the CasTn system leverages key insights from previous studies on Himar1 transposases and dCas9 fusion variants.7,20,29,32,34-36 The dCas9 protein is a well-characterized catalytically inactive Cas9 nuclease from Streptococcus pyogenes that contains the D10A and H840A amino acid substitutions7,32 and has been used as an RNA-guided DNA-binding protein for transcriptional modulation.32-34 Himar1C9 is a hyperactive Himar1 transposase variant that efficiently catalyzes transposition in diverse species and in vitro,20 highlighting its robust ability to integrate without host factors in a variety of cellular environments. The C-terminus of Himar1C9 was fused to the N-terminus of dCas9 using flexible protein linker XTEN35 (N-SGSETPGTSESATPES-C, SEQ ID NO: 52), as previous studies have described fusing other proteins to the N-terminus of dCas9 and to the C-terminus of mariner-family transposases.29,35,36
Because Himar1C9-dCas9 (Himar-dCas9) is a novel synthetic protein, it was verified that both the Himar1 and dCas9 components remained functional. To check that Himar-dCas9 was capable of binding a DNA target specified by a gRNA, Himar-dCas9 was expressed in an E. coli strain with a genomically integrated mCherry gene, along with two gRNAs targeting mCherry (gRNA_5 and gRNA_16 in Table 2). Knockdown of mCherry expression was observed, indicating that the DNA binding functionality of Himar-dCas9 was intact (
To establish and optimize parameters for site-directed transposition, an in vitro reporter system was developed to explore the transposition activity of Himar-dCas9. Purified Himar-dCas9 protein was mixed with transposon donor plasmid pHimar6 (containing a Himar1 mini-transposon with a chlor resistance gene), a transposon target pGT-B1 plasmid (containing a GFP gene), and one or more gRNAs targeted to various loci along GFP (
Using the in vitro reporter system, first assessed was how the orientation of the gRNA relative to the target TA dinucleotide affects the site specificity of transposition. gRNAs spaced 5-18 bp from a TA site, targeting either the template or non-template strand of GFP were tested (
To assess the distribution of transposon insertions around the target pGT-B1 plasmid, transposon sequencing was performed on transposition products resulting from three GFP-targeting gRNAs (gRNA_4, gRNA_8, and gRNA_12), a non-targeting gRNA, and no gRNA (
Given that mariner transposases dimerize in solution in the absence of DNA,50 it was hypothesized that Himar-dCas9 dimerizes spontaneously, and the active Himar1 dimer is guided to a gRNA-specific target locus by one of the dCas9 domains in the Himar-dCas9 dimer (
To assess the robustness of Himar-dCas9 to various experimental conditions and to determine the optimal parameters for site-directed transposition, different concentrations of (1) protein-gRNA complexes, (2) transposon donor plasmid (pHimar6) DNA, (3) target plasmid (pGT-B1) DNA, and (4) background off-target DNA within in vitro transposition reactions containing a single gRNA (gRNA_4) were explored. Also performed were in vitro reactions over different temperatures and reaction times.
Varying concentrations of Himar-dCas9/gRNA complexes, site-directed transposition by PCR in in vitro reactions was detected with at least 3 nM of Himar-dCas9/gRNA complexes, using 5 nM donor and 5 nM target plasmids (
Next, it was explored whether site-directed transposition was affected by DNA concentrations of the donor or target plasmids. Using 5 nM target plasmid DNA, transposition activity was robust across 0.05-5 nM of donor plasmid DNA, with greater rates of transposition at higher donor DNA concentrations (
It was also tested whether the gRNA-guided Himar-dCas9 could efficiently transpose into a targeted site in the presence of background DNA and whether the amount of transposition changed over longer reaction times. Up to 10×(by mass) more background E. coli genomic DNA than target plasmid DNA to was added to in vitro transposition reactions. Across different ratios of target-to-background DNA concentrations tested, Himar-dCas9 was able to locate the gRNA-targeted site and insert transposons with no observed loss of specificity or efficiency (
Together, these results highlight that Himar-dCas9/gRNA mediates site-directed transposon insertions across a range of experimental conditions, including physiologically relevant temperatures and reactant concentrations. In bacteria, 1 nM corresponds to approximately one molecule per cell, while in eukaryotic cells, 1 nM corresponds to approximately 1,000 molecules per cell.51 Targeted transposition was observed to occur at protein concentrations of 1-100 nM (1-100 molecules of protein per bacterium) and DNA concentrations of <1 to 10 nM (1-10 DNA copies per bacterium). In bacteria, these concentrations are physiologically achievable with low protein expression and with transposon donor/target DNA present as a single chromosomal copy or on a low/medium copy number plasmid. Notably, no experimentally upper limit of protein/DNA concentrations was found for effective site-directed transposition beyond the loss of specific targeting due to increased background transpositions. Nevertheless, the CasTn system can be used with different plasmid expression systems to modulate copy numbers of both protein and DNA.
Since Himar-dCas9 robustly facilitated site-directed transposon integration in vitro, the ability of Himar-dCas9 to mediate site-specific transposition in two in vivo systems in E. coli and in mammalian cells was tested. In the first system, a set of three plasmids were transformed into S17 E. coli: pTarget, which contains a GFP target gene; pHimar6, the transposon donor plasmid; and a tet-inducible expression vector for Himar-dCas9 and a gRNA (
It was first verified that the Himar-dCas9 system components functioned in vivo. By measuring transcriptional repression of GFP in E. coli containing pTarget and one of several Himar-dCas9/gRNA expression vectors, it was confirmed that gRNAs targeted Himar-dCas9 to the pTarget plasmid and determined the optimal concentration of aTc for inducing Himar-dCas9 expression (
In the in vivo assay, S17 E. coli containing pTarget, a Himar-dCas9/gRNA expression, and pHimar6 were grown on agar plates containing a saturating concentration of MgCl2 and 1 ng/mL aTc to induce expression of Himar-dCas9 while avoiding overproduction inhibition of Himar1C9.52 After 16 h of growth at 37° C., we analyzed the pooled plasmids from all colonies for site-specific transposon insertions. PCR for transposon-target plasmid junctions showed that gRNA_1 produced detectable site-specific transposon insertions into pTarget in three out of five independent replicates (
The site specificity of transposition was further evaluated by transforming the plasmid pools into E. coli and analyzing individual transformants by colony PCR and Sanger sequencing in order to confirm that Himar-dCas9 with gRNA_1 mediated precisely targeted transposon insertions into pTarget. In three out of four independent replicates with gRNA_1, transformations produced colonies with mostly or all site-specific transposition products (
In a second in vivo test system, the ability of Himar-dCas9 to mediate site-specific transposition into a genomic locus in CHO cells was tested. CHO cells containing a single-copy constitutively expressed genomic eGFP gene were transfected with two plasmids: one containing a Himar transposon and gRNA expression operons, and the other being a Himar-dCas9 expression vector (
The Himar transposon contained a promoterless puromycin resistance gene and mCherry gene, both of which would be inserted in-frame into the eGFP locus and expressed if targeted by Himar-dCas9 in the correct orientation (
Following transfection, cells with an integrated transposon using puromycin were selected. From each transfection of approximately 106 cells, About 20 colonies representing independent transposition events were obtained. Negative controls for transposition, which were transfected with only the transposon donor plasmid, did not produce viable cells, indicating clean selection against background plasmid integration events. All colonies from each transfection were pooled for analysis by flow cytometry and PCR for transposon-target junctions. Transfections with no gRNA resulted in few eGFP− cells, while some transfections with at least one gRNA (including the non-targeting gRNA) produced eGFP− cells (
E. coli in vivo assays
Unless otherwise stated, nucleic acid sequences in the text of this specification and SEQ ID number listing, are given, when read from left to right, in the 5′ to 3′ direction. One of skill in the art would be aware that a given DNA sequence is understood to define a corresponding RNA sequence which is identical to the DNA sequence except for replacement of the thymine (T) nucleotides of the DNA with uracil (U) nucleotides. Thus, providing a specific DNA sequence is understood to define the exact RNA equivalent. Also, a given first polynucleotide sequence, whether DNA or RNA, further defines the sequence of its exact complement (which can be DNA or RNA), a second polynucleotide that hybridizes perfectly to the first polynucleotide by forming Watson-Crick base-pairs. For DNA:DNA duplexes (hybridized strands), base-pairs are adenine:thymine or guanine:cytosine; for DNA:RNA duplexes, base-pairs are adenine:uracil or guanine:cytosine. Thus, the nucleotide sequence of a blunt-ended double-stranded polynucleotide that is perfectly hybridized (where there is “100% complementarity” between the strands or where the strands are “complementary”) is unambiguously defined by providing the nucleotide sequence of one strand, whether given as DNA or RNA.
ACAGGTTGGATGATAAGTCCCCGGTCTTCGTATGCCGTCTTCTGCTTGGCGCGCCC
ATCATCCAACCTGT
CTGTCTCTTATACACATCTCAACCATCATCGATGAATTTTCTCGGGTGTTCTCGCAT
ATGTGTATAAGAGACAG
Many modifications and variations of this invention can be made without departing from its spirit and scope, as will be apparent to those skilled in the art. The invention is defined by the terms of the appended claims, along with the full scope of equivalents to which such claims are entitled. The specific embodiments described herein, including the following examples, are offered by way of example only, and do not by their details limit the scope of the invention.
All references cited herein are incorporated by reference to the same extent as if each individual publication, database entry (e.g. Genbank sequences or GeneID entries), patent application, or patent, was specifically and individually indicated to be incorporated by reference. This statement of incorporation by reference is intended by Applicants, pursuant to 37 C.F.R. § 1.57(b)(1), to relate to each and every individual publication, database entry (e.g. Genbank sequences or GeneID entries), patent application, or patent, each of which is clearly identified in compliance with 37 C.F.R. § 1.57(b)(2), even if such citation is not immediately adjacent to a dedicated statement of incorporation by reference. The inclusion of dedicated statements of incorporation by reference, if any, within the specification does not in any way weaken this general statement of incorporation by reference. Citation of the references herein is not intended as an admission that the reference is pertinent prior art, nor does it constitute any admission as to the contents or date of these publications or documents.
The present invention is not to be limited in scope by the specific embodiments described herein. Indeed, various modifications of the invention in addition to those described herein will become apparent to those skilled in the art from the foregoing description and the accompanying figures. Such modifications are intended to fall within the scope of the appended claims.
The foregoing written specification is considered to be sufficient to enable one skilled in the art to practice the invention. Various modifications of the invention in addition to those shown and described herein will become apparent to those skilled in the art from the foregoing description and fall within the scope of the appended claims.
This application is a continuation of International Patent Application No. PCT/US2020/034538, filed May 26, 2020, which claims the benefit of U.S. Provisional Application Nos. 62/852,629 filed May 24, 2019, 62/946,201 filed Dec. 10, 2019, and 62/963,938 filed Jan. 21, 2020, the contents of each of which are herein incorporated by reference in its entirety.
| Number | Date | Country | |
|---|---|---|---|
| 62852629 | May 2019 | US | |
| 62946201 | Dec 2019 | US | |
| 62963938 | Jan 2020 | US |
| Number | Date | Country | |
|---|---|---|---|
| Parent | PCT/US2020/034538 | May 2020 | US |
| Child | 17533379 | US |
