The invention relates to mutation independent suppression and replacement of disease-causing mutant genes.
Many mutation-based diseases are more genetically diverse than can be predicted from clinical presentation. Some mutation-based diseases are Mendelian and involve the inheritance of a single mutant gene, others are polygenic or multifactorial and involve multiple genetic insults. In the case of some Mendelian disorders, many different mutations within the same gene can give rise to, or can predispose an individual to, a disease. Similarly, for some multifactorial disorders, many different mutations within one or more genes can predispose an individual to a disease or can act in an additive manner with other genetic and environmental influences to give rise to a disease. This mutational heterogeneity underlying the molecular etiologies of many diseases represents a significant barrier to the development of therapies for such diseases. Moreover, genetic strategies for suppressing and replacing a mutant protein face many challenges with regard to the effectiveness of the machinery used to deliver and regulate the expression of the suppressor and replacement nucleic acids in vivo. Therefore, a need exists for effective mutation-independent therapeutics that achieve effective suppression and replacement.
The invention relates to gene suppression and replacement. In particular, the invention relates to enhanced expression of suppression agents for suppressing gene expression in a cell and in vivo and of replacement nucleic acids that are not inhibited and/or are partially inhibited by the suppression agent. Expression vectors used to express the suppression agent(s) and replacement nucleic acids comprise regulatory elements to optimize expression of the suppression agent(s) and or replacement nucleic acids.
The invention embodies use of replacement genes using sequences to enhance expression of replacement genes from viral and or non-viral vectors. In a further aspect the invection relates to enhanced expression of suppression agent(s) and or replacement genes from viral or and non-viral vectors. In a further embodiment the invention relates to enhanced expression of suppression agent(s) and or replacement genes and or genes encoding neurotrophic factors from viral and or non-viral vectors.
In one aspect the invention relates to use of conserved sequences from retinal genes to enhance expression of suppression agent(s) and or replacement genes and or genes encoding neurotrophic factors. The use of such conserved sequences has been found to result in surprisingly efficient expression. In a particular aspect the invention relates to use of conserved sequences from retinal genes to enhance expression of suppression agent(s) and or replacement genes and or genes encoding neurotrophic factors from adeno associated virus (AAV) vectors. In another aspect the invention provides vectors for expression of suppression agent(s) and or replacement gene(s) and or genes encoding neurotrophic factors using regulatory sequences from retinal gene(s) and or non-retinal gene(s) and or ubiquitously expressing genes to enhance expression from vectors.
In one aspect, the invention provides vectors for expressing a suppression agent for a disease causing gene and/or a replacement nucleic acid that is not recognized or is partially recognized by the suppression agent.
In an embodiment, the vector comprises an enhancer sequence, such as, for example, a sequence of SEQ ID NOs: 402-413 or functional variants or equivalents thereof. In another embodiment, the vector comprises at least one regulatory element selected from the group consisting of a promoter, a stuffer, an insulator, a silencer, an intron sequence, a post translational regulatory element, a polyadenylation site, and a transcription factor binding site.
In another embodiment, the vector comprises at least one of conserved regions A through I from the rhodopsin gene, as represented by SEQ ID NOs: 92-99, or functional variant or equivalent thereof. In another embodiment, the vector comprises at least one transcription factor binding site sequence selected from the group consisting of SEQ ID NOs: 100-401, or functional variant or equivalent thereof.
The suppression agent may be a nucleic acid, protein, amino acid(s), antibody, aptamer, or any such agent that can bind to and inhibit a DNA, RNA, or protein. In an embodiment, the suppression agent is a siRNA selected from the group consisting of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35-67, 75, 77, 79, 81, 83, 85, and 414-421 or functional variant or equivalent thereof.
The replacement nucleic acid is not recognized or is recognized partially by the suppression effector, because its sequence has been altered such that it cannot bind or binds less efficiently to the suppression agent but still encodes a normal or enhanced gene product. In an embodiment, the replacement nucleic acid is a siRNA selected from the group consisting of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 68, 76, 78, 80, 82, 84, and 86, or functional variant or equivalent thereof.
In an embodiment, the invention provides vectors, such as viral vectors, that comprise a suppression agent and/or a replacement nucleic acid. For example, the vector comprises at least one suppression agent nucleotide sequence selected from the group consisting of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35-67, 75, 77, 79, 81, 83, and 85, or functional variant or equivalent thereof, and at least one replacement nucleic acid nucleotide sequence selected from the group consisting of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 68, 76, 78, 80, 82, 84, and 86, or functional variant or equivalent thereof.
In another aspect, the invention provides therapeutic compositions comprising at least one vector comprising at least one suppression agent nucleotide sequence selected from the group consisting of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35-67, 75, 77, 79, 81, 83, 85 and 414-421 or functional variant or equivalent thereof, and at least one replacement nucleic acid nucleotide sequence selected from the group consisting of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 68, 76, 78, 80, 82, 84, and 86, or functional variant or equivalent thereof. In an embodiment, the vector of the therapeutic composition further comprises a regulatory element selected from the group consisting of an enhancer, a promoter, a stuffer, an insulator, a silencer, an antirepressor, an intron sequence, a post translational regulatory element, a polyadenylation signal (e.g. minimal poly A), a conserved region A through I, and a transcription factor binding site.
In another aspect the invention provides suppression and replacement in conjunction with provision of a gene encoding a neurotrophic/neuroprotective factor(s).
In another aspect, the invention provides cells comprising the nucleic acids and vectors of the invention.
In another aspect, the invention provides transgenic animals comprising the nucleic acids and vectors of the invention.
In yet another aspect, the invention provides methods of suppressing the expression of a mutant gene and replacing expression of the mutant gene with a replacement nucleic acid, the method comprising administering to a mammal a therapeutic composition of the invention.
In yet another aspect, the invention provides methods of suppressing the expression of a mutant gene and replacing expression of the mutant gene with a replacement nucleic acid in conjunction with a gene encoding a neurotrophic/neuropeotective factor(s), the method comprising administering to a mammal a therapeutic composition of the invention.
The foregoing and other objects, features and advantages of the present invention, as well as the invention itself, will be more fully understood from the following description of preferred embodiments when read together with the accompanying drawings, in which:
The instant invention utilises efficient gene suppression in conjunction with gene replacement to overcome the challenge of mutational heterogeneity. The suppression agent does not necessarily target a mutation (although it can encompass the site of a mutation), but is rather mutation independent. Suppression can involve one or both alleles of an endogenous gene. In conjunction with suppression, a replacement gene is provided that has been modified such that the replacement gene is refractory or partially refractory to suppression. The invention uses the degeneracy of the genetic code to modify the replacement gene. Alteration of “wobble” bases makes it possible for replacement nucleic acids to escape suppression at least in part, but does not change the protein product expressed from the replacement nucleic acids. Alternatively, replacement genes are modified in such a way that they encode altered amino acids but still encode a functional or partially functional protein that does not lead to pathology (e.g., because the amino acid changes are silent mutations or polymorphisms). Replacement has been demonstrated using rhodopsin nucleic acids, however, other genes or combinations of genes can be made and used in the practice of the invention. In particular, the invention relates to modulating and optimizing the expression levels of the suppression agents and/or replacement nucleic acids using one or more of the untranslated regions (UTRs) of a gene, intronic sequences, the degeneracy of the genetic code and/or polymorphisms to alter the sequence of replacement nucleic acids such that they are refractory or partially refractory to suppression.
In one aspect, the invention provides methods for preparing and using a suppression agent and replacement nucleic acid. The suppression agent binds to a coding region of a mature RNA or DNA encoding a mutant allele and inhibits expression of the mutant allele. The replacement nucleic acid encodes a wild-type or non-disease causing allele and comprises at least one degenerate/wobble nucleotide that is altered so that the replacement nucleic acid is not suppressed, or is only partially suppressed, by the suppression of one or both alleles of a gene.
The invention provides for replacement genes using sequences to enhance expression of replacement genes from viral and or non-viral vectors. In particular the invention relates to enhanced expression of suppression agent(s) and or replacement genes from viral or and non-viral vectors. The invention relates to use of conserved sequences from retinal genes to enhance expression of suppression agent(s) and or replacement genes. In a particular aspect the invention relates to use of conserved sequences from retinal genes to enhance expression of suppression agent(s) and or replacement genes from adeno associated virus (AAV) vectors. In another aspect the invention provides vectors for expression of suppression agent(s) and or replacement gene(s) using regulatory sequences from retinal gene(s) and or non-retinal gene(s) and or ubiquitously expressing genes such as those provided in the Tables below to enhance expression from viral and non-viral vectors.
In another aspect, the invention provides a composition comprising a suppression agent that binds to the coding region of a mature and/or immature RNA or DNA encoding a mutant allele to inhibit expression of the mutant allele and a replacement nucleic acid that encodes a wild-type or non-disease causing allele and comprises at least one degenerate/wobble nucleotide that is altered so that the replacement nucleic acid is not suppressed, or is only partially suppressed, by the suppression agent.
In yet another aspect, the invention provides a kit comprising a suppression agent that suppresses the expression of a mature and or immature RNA or DNA encoding a mutant allele and a replacement nucleic acid that encodes a wild-type or non-disease causing allele that is not Suppressed, or is only partially suppressed, by the suppression agent and differs from the mutant allele in at least one degenerate/wobble nucleotide.
Suppression is achieved using a wide variety of molecular tools, such as, for example, RNA interference (RNAi) including non-coding RNAs such as small interfering RNA (siRNA), short hairpin RNA (shRNA), microRNAs (miRNA), or other nucleotide-based molecules. In an embodiment, siRNAs in the order of 14-27 nucleotides in length are used for gene suppression. ShRNAs can be used to express functional siRNAs intracellularly and to achieve suppression in vitro and in vivo. Other suppression molecules include, for example, sense and antisense nucleic acids (single or double stranded), ribozymes, peptides, DNAzymes, peptide nucleic acids (PNAs), triple helix forming oligonucleotides, antibodies, and aptamers and modified form(s) thereof directed to sequences in gene(s), RNA transcripts, or proteins.
In an embodiment, the invention relates to vector(s) for supplying an endogenously generated suppression agent, such as, for example, a dsRNA in the form of a short hairpin (shRNA) which can be processed intracellularly into siRNA. dsRNA may be locally or systemically delivered. Expression vectors are used to generate functional siRNAs in cells and in animals typically using polymerase III promoters to drive expression, although polymerase II promoters are also used. For example, miRNA structures can be used to express double stranded RNAs from polymerase II promoters to enable tissue specific expression of double stranded RNA or polymerase II promoters can be juxtaposed to shRNA sequences to be expressed.
Suppression agents may be modified to alter the potency of the suppression agent, the target affinity of the suppression agent, the safety profile of the suppression agent and/or the stability of the suppression agent, for example, to render them resistant or partially resistant to intracellular degradation. Modifications, such as phosphorothioates, for example, can be made to oligonucleotides to increase resistance to nuclease degradation, binding affinity and/or uptake. In addition, hydrophobization and bioconjugation enhances siRNA delivery and targeting (De Paula et al., RNA. 13(4):431-56, 2007) and siRNAs with ribo-difluorotoluyl nucleotides maintain gene silencing activity (Xia et al., ASC Chem. Biol. 1(3):176-83, (2006). siRNAs with amide-linked oligoribonucleosides have been generated which are more resistant to Si nuclease degradation (Iwase R et al. 2006 Nucleic Acids Symp Ser 50: 175-176). In addition, modification of siRNA at the 2′-sugar position and phosphodiester linkage confers improved serum stability without loss of efficacy (Choung et al., Biochem. Biophys. Res. Commun. 342(3):919-26, 2006). In one study, 2′-deoxy-2′-fluoro-beta-D-arabinonuclecic acid (FANA)-containing antisense oligonucleotides compared favourably to phosphorothioate oligonucleotides, 2′-O-methyl-RNA/DNA chimeric oligonucleotides and siRNAs in terms of suppression potency and resistance to degradation (Ferrari N et al. 2006 Ann N Y Acad Sci 1082: 91-102.)
Antisense and ribozyme suppression strategies have led to the reversal of a tumor phenotype by reducing expression of a gene product or by cleaving a mutant transcript at the site of the mutation (Carter and Lemoine Br. J. Cancer. 67(5):869-76, 1993; Lange et al., Leukemia. 6(11):1786-94, 1993; Valera et al., J. Biol. Chem. 269(46):28543-6, 1994; Dosaka-Akita et al., Am. J. Clin. Pathol. 102(5):660-4, 1994; Feng et al., Cancer Res. 55(10):2024-8, 1995; Quattrone et al., Cancer Res. 55(1):90-5, 1995; Lewin et al., Nat Med. 4(8):967-71, 1998). For example, neoplastic reversion was obtained using a ribozyme targeted to an H-ras mutation in bladder carcinoma cells (Feng et al., Cancer Res. 55(10):2024-8, 1995). Ribozymes have also been proposed as a means of both inhibiting gene expression of a mutant gene and of correcting the mutant by targeted trans-splicing (Sullenger and Cech Nature 371(6498):619-22, 1994; Jones et al., Nat. Med. 2(6):643-8, 1996). Ribozyme activity may be augmented by the use of, for example, non-specific nucleic acid binding proteins or facilitator oligonucleotides (Herschlag et al., Embo J. 13(12):2913-24, 1994; Jankowsky and Schwenzer Nucleic Acids Res. 24(3):423-9, 1996). Multitarget ribozymes (connected or shotgun) have been suggested as a means of improving efficiency of ribozymes for gene suppression (Ohkawa et al., Nucleic Acids Symp Ser. (29):121-2, 1993).
Triple helix approaches have also been investigated for sequence-specific gene suppression. Triplex forming oligonucleotides have been found in some cases to bind in a sequence-specific manner (Postel et al., Proc. Natl. Acad. Sci. U.S.A. 88(18):8227-31, 1991; Duval-Valentin et al., Proc. Natl. Acad. Sci. U.S.A. 89(2):504-8, 1992; Hardenbol and Van Dyke Proc. Natl. Acad. Sci. U.S.A. 93(7):2811-6, 1996; Porumb et al., Cancer Res. 56(3):515-22, 1996). Similarly, peptide nucleic acids have been shown to inhibit gene expression (Haney et al., Antisense Res. Dev. 1(4):307-17, 1991; Knudsen and Nielson Nucleic Acids Res. 24(3):494-500, 1996; Taylor et al., Arch. Surg. 132(11):1177-83, 1997). Minor groove binding polyamides can bind in a sequence-specific manner to DNA targets and hence may represent useful small molecules for future suppression at the DNA level (Trauger et al., Chem. Biol. 3(5):369-77, 1996). In addition, suppression has been obtained by interference at the protein level using dominant negative mutant peptides and antibodies (Herskowitz Nature 329(6136):219-22, 1987; Rimsky et al., Nature 341(6241):453-6, 1989; Wright et al., Proc. Natl. Acad. Sci. U.S.A. 86(9):3199-203, 1989). In some cases suppression strategies have lead to a reduction in RNA levels without a concomitant reduction in proteins, whereas in others, reductions in RNA have been mirrored by reductions in protein.
The diverse array of suppression strategies that can be employed includes the use of DNA and/or RNA aptamers that can be selected to target, for example, a protein of interest such as rhodopsin. In the case of age related macular degeneration (AMD), anti-VEGF aptamers have been generated and have been shown to provide clinical benefit in some AMD patients (Ulrich H, et al. Comb. Chem. High Throughput Screen 9: 619-632, 2006). Suppression and replacement using aptamers for suppression in conjunction with a modified replacement gene and encoded protein that is refractory or partially refractory to aptamer-based suppression could be used in the invention.
Recent evidence suggests that control of gene expression occurs endogenously in part by the activity of small non-coding RNAs, one broad category of which is termed microRNAs (miRNAs). miRNAs are expressed from polymerase II promoters, but can also be expressed from polymerase III promoters. miRNAs are processed intracellularly from larger transcripts to form small molecules approximately 20 nucleotides in length. miRNA structures can be used to express small double stranded RNAs and thus can be used to express the double stranded RNAs of the current invention.
Suppression targeted to coding sequence holds the advantage that such sequences are present in both precursor and mature RNAs, thereby enabling suppressor effectors to target all forms of RNA. A combined approach using a number of suppression effectors directed to multiple targets on an RNA or to multiple RNAs may also be used in the invention. As with suppression, multiple replacement nucleic acids can be used in the invention. For some disorders, it may be necessary to block expression of a disease allele completely to prevent disease symptoms whereas for others low levels of mutant protein may be tolerated. The invention can thus provide partial or complete suppression.
In one embodiment of the invention, suppressors are targeted to genes that are involved in the regulation of other genes. Suppression of these genes therefore may lead to up- or down-regulation of other genes.
In another embodiment, the invention relates to suppression of the expression of mutated genes that give rise to a dominant or deleterious effect or disease. A suppression effector may target either the disease allele or the normal allele. In another embodiment, the suppression effector targets both the disease allele and the normal allele.
In an embodiment of the invention, a replacement nucleic acid is provided that is altered at one or more degenerate or wobble bases from the endogenous wild type gene but that encodes the identical amino acids as the wild type or a non-disease causing gene. In another embodiment, the replacement nucleic acid encodes a beneficial replacement nucleic acid (e.g., a more active or stable product than that encoded by the wild-type gene). The replacement nucleic acid provides expression of a normal or non-disease causing protein product when required to ameliorate pathology associated with reduced levels of wild type protein. The same replacement nucleic acid can be used in conjunction with the suppression of many different disease mutations within a given gene. In addition, multiple replacement nucleic acids can be used in the invention.
Although the instant application provides numerous exemplary suppression agents and replacement nucleic acid sequences, these are only examples and other such sequences can be determined as described herein for the same targets or for any desired target. “Functional variant” includes any variant nucleic acid or other suppression agent that may have one or more nucleic acid substitutions but that does not have a materially different function than, or that can still hybridize under stringent hybridization conditions (0.2×SCC, 0.1% SDS) to, or that shares at least 70% identity, for example 80%, such as at least 90% or at least 95% sequence identity with the nucleic acid indicated.
In another embodiment of the invention, suppression effectors are targeted to the untranslated regions (either 5′UTR or 3′UTR) of at least one allele of a gene. In another embodiment of the invention replacement nucleic acids are provided that have been altered at the suppression site, such that replacement nucleic acids provide functional or partially functional protein and escape or partially escape from suppression by suppressors.
In another embodiment of the invention, suppression effectors are targeted to intronic sequences. In another embodiment, replacement nucleic acids are provided which have been altered at one or more nucleotides of the targeted site of the intron so that transcripts from the replacement nucleic acids escape or partially escape suppression by suppressors. In another embodiment the whole targeted intron may not be present in replacement nucleic acids.
In another embodiment of the invention, suppression effectors are targeted to polymorphic sites and at least one allele of the gene is suppressed or partially suppressed. In another embodiment, replacement nucleic acids are provided for the alternative polymorphic variant such that replacement nucleic acids encode functional or partially functional protein and escape or partially escape from suppression by suppressors.
In another embodiment of the invention the suppression agent and/or replacement nucleic acid is expressed from one or more promoter sequences. The invention provides promoter sequences that have been demonstrated to promote ubiquitous expression of nucleotides and/or promoters that have been demonstrated to exert tissue specific, temporal, inducible, and/or quantitative control of gene expression. The invention also provides enhancer sequences (Table 1) and/or post-translational regulatory elements and/or other regulatory elements and/or epigenetic elements that provide optimized expression of suppression agents and/or replacement nucleic acids.
In a particular embodiment, sequences that influence chromatin structure, such as but not exclusive to insulator, antirepressor, cis-acting modulators of nucleosome positioning and/or silencer elements, sometimes termed epigenetic elements, are used to modulate expression of suppression agents and/or replacement nucleic acids. Exemplary epigenetic elements such as insulator and antirepressor sequences are provided in Table 2. It is clear that chromatin structures influence gene expression, for example, chromatin structures influence the ability of the transcriptional machinery to access promoter and/or enhancer elements amongst other sequence motifs. The inclusion of sequences which influence chromatin structures in viral and/or non-viral vectors and/or administered in conjunction with suppression and/or replacement nucleic acids can be used to optimize expression of either or both suppressors and replacement nucleic acids. In addition, chemical entities which influence chromatin structures can be used to optimize expression such as histone deacetylase (HDAC) inhibitors and/or DNA methyl transferase inhibitors and/or histone methyl transferase inhibitors. Such entities can be supplied in the form of DNA and/or RNA and/or protein amongst other forms. Similarly attracting enzymes and/or supplying enzymes (in the form of DNA and/or RNA and or protein) involved in chromatin remodelling such as but not exclusive to histone acetyl transferases to nucleic acids to be expressed and their associated regulatory regions can be used to optimize expression of suppression and/or replacement nucleic acids.
In another embodiment, expression of a suppression agent and/or replacement nucleic acid is optimized to enable efficient suppression in conjunction with sufficient replacement. In an additional embodiment, suppression and/or replacement nucleic acids are provided with agents that aid vector transfection, transduction, and/or expression of suppression and replacement nucleic acids.
The invention circumvents the need for a specific therapy for every disease-causing mutation within a given gene. Notably, the invention has the advantage that the same suppression agents can be used to suppress many mutations in a gene. This is particularly relevant when any one of a large number of mutations within a single gene can cause disease pathology. The compositions and methods of the invention allow greater flexibility in choice of target sequence for suppression of expression of a disease allele. Furthermore, the compositions and methods of the invention allow greater flexibility in terms of controlling expression of the suppression and/or replacement of a given gene and or allele of a gene.
Suppression and replacement can be undertaken in conjunction with each other or separately. Suppression and replacement utilizing the degeneracy of the genetic code may be undertaken in test tubes, in cells, in animals, or in plants and may be used for experimental research (e.g., for the study of development or gene expression) or for therapeutic purposes. Suppression and replacement may be used in conjunction with agents to promote cell transfection or cell transduction such as, for example, lipids and polymers. Suppression and replacement may be provided to consumers in a kit.
The suppression and replacement agents of the invention can be delivered to a target cell and or tissue and or animal and or plant using ‘naked’ reagents such as DNA, RNA, peptides or other reagents. Alternatively viral and or non-viral vectors can be used with or without ‘naked’ reagents.
In an embodiment, suppression and/or replacement construct(s) can be delivered to a cell using an AAV2/5 recombinant virus, however, other viral and non-viral vectors, such as other AAV serotypes, adenovirus, herpes virus, SV40, HIV, SIV and other lentiviral vectors, RSV and non-viral vectors including naked DNA, plasmid vectors, peptide-guided gene delivery, terplex gene delivery systems, calcium phosphate nanoparticles, magnetic nanoparticles, colloidal microgels and/or the integrase system from bacteriophage phiC31 may be utilised in the invention, for example. Suppression and replacement components may be found on separate vectors or may be incorporated into the same vector. Viral vectors useful in the invention include, but are not limited to, those listed in Table 3. Non-viral vectors useful in the invention include, but are not limited to, those listed in Table 4. Cationic lipid-based non-viral vectors can include glycerol-based (e.g. DOTMA, DOTAP, DMRIE, DOSPA), non-glycerol-based (e.g. DOGS, DOTIM) and/or cholesterol-based cationic lipids (e.g. BGTC, CTAP; Karmali P P and Chaudhuri A 2006 Med Res Rev). Viral and non-viral vector delivery may be accompanied by other molecules such as cationic lipids and/or polymers and/or detergents and/or agents to alter pH, such as, for example, polyethelene glycol (PEG), to enhance cellular uptake of vectors and/or to enhance expression from vectors and/or to evade the immune system. For example, polycationic molecules have been generated to facilitate gene delivery including but not exclusive to cationic lipids, poly-amino acids, cationic block co-polymers, cyclodextrins amongst others. Pegylation of vectors with polyethelene glycol (PEG) can shield vectors from, for example, the extracellular environment. Vectors may be used in conjunction with agents to avoid or minimise cellular immune responses such as PEG or as a Polyplex with Poly(L-Lysine) Vector delivery may be undertaken using physical methodologies such as electroporation, nucleofection and/or ionotophoresis, either alone or in combination with molecules to enhance delivery. Vectors may be used in conjunction with agents to promote expression of suppression and/or replacement components incorporated into vectors, for example, using histone deacetylase inhibitors (HDAC) and/or DNA methyl transferase inhibitors and/or histone methyl transferase inhibitors to modulate chromatin structures thereby aiding expression. HDAC inhibitors include but are not exclusive to short chain fatty acids such as valproic acid and sodium butyrate, ketones, benzamides, cyclic and non-cyclic hydroxamates such as suberoyl anilide hydroxamic acids (SAHA), trichostatin A (TSA), cyclic peptides or tetrapeptides amongst others (Liu T et al. 2006 Cancer Treatment Reviews 32: 157-165). DNA methyl transfease inhibitors including, for example, 5-AC, decitabine and zebularine can be used to modulate chromatin structures. In addition, histone methyl transferase inhibitors can influence chromatin states, for example, BIX-01294 (diazepin-quinazolin-amine derivative). In addition, to the chemical entities referred to above, nucleic acids-based inhibitors can be used to suppress expression of proteins and/or non-coding RNAs involved in chromatin remodelling. In one embodiment of the invention vectors are optimized to specifically transduce target cell type(s) or target tissue type(s). Viral and/or non-viral vectors may be modified to target specific cell types and/or to prevent targeting of some cell types. For example, the inclusion of the capsid from AAV serotype 5 in an AAV2/5 hybrid virus facilitates transduction of photoreceptor cells. Similarly, for example, peptides may be included in viral vectors to facilitate targeting. Synthetic non-viral vectors can be modified to include ligands to facilitate targeting of vectors to specific cell and/or tissue types, for example, folate can be conjugated to liposomes to target tumour cells which over express the folate receptor (Hattori Y et al. 2005; Curr Drug Deliv 3: 243-52). In another embodiment of the invention, suppression and replacement vectors are designed to optimize the generation and/or production of vector, for example, to optimize viral titre and/or to optimize the number or type of nucleotides incorporated into vector(s). For example, vector genomes may be modified such that large transgenes may be incorporated into vectors, for example, ‘gutless’ adenovirus vectors have an increased capacity in terms of size than previous generations of adenovirus vectors. Components of vectors can be modified to optimize generation and production of vectors, for example, genes involved in replication of AAV can be modified to optimize replication and/or self complementary AAV vectors can be used to optimize rates of transgene expression. In an additional embodiment, vectors are designed to optimize suppression in conjunction with replacement, to enable optimal expression of all components of a therapeutic. For example, to optimize expression of both elements of suppression and replacement from a given vector, additional sequences can be included in the vector. For example, inclusion of nucleotides to separate the ITRs of AAV and the shRNA sequences of an RNAi-based suppression agent can result in optimisation of expression of the suppression component. Nucleotides encoding suppressors and/or replacement nucleic acids can be juxtaposed or separated from each other and/or can be in the same orientation or opposing orientations. In addition, the suppressor(s) can be 5′ and/or 3′ to the replacement nucleic acids. Nucleotides encoding suppressors and/or replacement nucleic acids can be juxtaposed to nucleotides comprising vector(s) or can be separated from nucleotides comprising vector(s). Nucleotides encoding suppressors and/or replacement nucleic acids may be cloned within the backbone of the plasmid used to generate AAV and or may be cloned between the AAV ITRs and not within the plasmid backbone of the plasmid, and/or may be cloned in a combination of these positions. Additional sequences, such as, for example, stuffer sequences can be included in vectors to optimize vector design. In addition, multiple suppressors and/or replacement nucleic acids may be used in one vector.
The list provided is not exhaustive; other viral vectors and derivatives, natural or synthesized could be used in the invention.
The list provided is not exhaustive. Other non-viral vectors and derivatives, natural or synthesized and other delivery methods could be used with the invention.
In an embodiment, the replacement nucleic acid encodes mammalian rhodopsin, collagen 1A1, collagen 1A2, collagen 7A1, or peripherin. In another embodiment, the replacement nucleic acid encodes a protein that has been mutated to cause an autosomal or X-linked dominant retinitis pigmentosa, such as those listed in Table 5. Suppression agents and replacement nucleic acids may be generated for one or more of these genes, for example.
elegans unc119
In an embodiment of the invention, suppression agents are siRNAs or shRNAs targeting human rhodopsin. Exemplary siRNAs and replacement rhodopsin sequences are provided in Table 6A.
TTACGGACCCCCTTGAATTAT
TTGAAACCCGAAGTGAATAAT
siRNA sequences 1-17 target the human rhodopsin coding sequence. siRNA sequences 18 and 19 target the human rhodopsin 5′UTR. siRNA sequences 20-35 target the human rhodopsin 3′UTR. siRNA sequences 36-49 target human rhodopsin intronic sequence. The sequence of the sense strand of the siRNA is given. Notably, siRNAs may also target a combination of these. For example, an siRNA target site may be in the 5′UTR and exon 1. Or an siRNA target site may be in the coding region and an intron. Or an siRNA target site may be in an exon and the 3′UTR. siRNA sequence 50 is an example of an siRNA that has a target site that spans Exon 3/intron 3 of the human rhodopsin gene. The site contains a known polymorphism in intron 3. If this site was used as an siRNA target, the replacement gene would have the wildtype base at the polymorphic site but degeneracy of the genetic code could be used to change other bases at the replacement site. The siRNA(s) may comprise all or part of the sequence provided. The sequences of replacement human rhodopsin nucleic acids over the target for siRNA-mediated suppression are provided for siRNA sequences 1-17. Replacement nucleic acids include at least one altered nucleotide(s) at degenerate position(s) over the siRNA target site (highlighted in bold print). Thus, replacement sequences here provide one of multiple replacement options. Some replacement constructs contain nucleotide changes in the coding sequence. These replacement constructs while altered in nucleotide sequence encode the same amino acids as the wild type rhodopsin protein. Other replacement constructs are altered at either silent or non-silent polymorphic sites. These replacement constructs encode wild type protein, with wild type function. For siRNAs targeting the UTRs or intronic sequence, no replacement constructs have been suggested because the number of base changes within the site is not limited to degenerate positions (as is the case for sequence coding for amino acids).
It is notable that suppression of a given gene such as rhodopsin may be evaluated in a variety of animal species. The siRNA sequences provided in Table 6B represent examples of RNAi sequences that are homologous between porcine and human rhodopsin. In some transgenic animal models the presence of the human transgene enables direct evaluation of sequences that target the human gene in that animal model. In other instances suppressor sequences may be chosen to maximise the homology between the human gene (for example, rhodopsin) and the endogenous gene in the animal under evaluation.
siRNA can be expressed in miR vectors using polymerase II promoters. For this purpose pcDNA6.2-GW/EmGFP-miR from Invitrogen is used where the cloned miR-155 gene is recombined in order to express the choice of siRNA. The antisense strand of the siRNA is kept intact followed by a modified terminal loop and the sense strand, which is modified by introducing a deletion of 2 central nucleotides in order to form an internal loop. See Catalogue no K4936-00, Block-IT, POLII, miR RNAi expression vector kits catalogue, Invitrogen, page 7 for figure showing the native miR-155 sequence and the converted sequence of siRNA-lacZ in the form of miR-lacZ.
Exemplary miRNA Sequences Targeting Human Rhodopsin:
In an embodiment of the invention, suppression agents and replacement genes are expressed in photoreceptor cells to alleviate disease pathology. In a further embodiment, replacement nucleic acids encode a gene which when mutated may cause retinal degeneration other than retinitis pigmentosa, for example, Stargarts Syndrome, glaucoma, cod-rod dystrophy, corneal dystrophy or Age-related Macular Degeneration (AMD) (Table 5).
In another aspect, the invention provides cells expressing a suppression effector such as a dsRNA, either transiently or stably, for experimental or therapeutic use. In an embodiment, the cells express an siRNA that targets rhodopsin. In another embodiment, the cells express a replacement nucleic acid expressing rhodopsin that is not targeted by the siRNA. In another embodiment, the cells comprise a vector encoding at least one or more siRNAs. In another embodiment, the cells comprise a vector encoding a replacement nucleic acid. In an additional embodiment, the cells comprise one or more vectors encoding siRNA(s) and replacement nucleic acid(s).
In another aspect, the invention provides transgenic animals and their experimental or therapeutic use. In an embodiment, the transgenic animal is a model for Retinitis Pigmentosa, for example, an animal with a mutation observed in humans such as the Pro23His and or Pro347ser mutations. In another embodiment, the transgenic animal expresses a dsRNA that targets human rhodopsin. In another embodiment, the transgenic animal expresses a replacement nucleic acid transgene that has been altered at one or more wobble position(s) such that it escapes suppression.
Suppression agents and replacement nucleic acids of the invention can be administered to cells, tissues, plants and/or animals, either separately or together. In yet another aspect administration of suppression agent and/or replacement nucleic acid may be systemic or local. In yet another aspect, administration of suppression agent and replacement nucleic acid may be used in conjunction with chemical and/or physical agents to aid administration. In another aspect, the invention provides methods for suppressing rhodopsin expression in an animal by intraocular (e.g., subretinal or intravitreal) injection of a suppression agent into the animal. In another aspect intraocular administration (e.g., subretinal injection, intravitreal) is used to administer a suppression agent and/or replacement nucleic acid to an animal. In another embodiment, ionthophoresis or electroporation is used to administer suppression agents and/or replacement nucleic acids. In another embodiment, suppression agents and/or replacement nucleic acids are administered using nanotechnology (Kawasaki and Player Nanomedicine 1(2):101-9, 2005; Silva Surg. Neurol. 67(2):113-6, 2007; Andrieu-Solar et al., Mol. Vis. 12:1334-47, 2006) or bacteria (Daudel et al., Expert Rev. Vaccines 6(1):97-110, 2007).
Suppression agents and replacement nucleic acids may be optimally combined with conserved regions A-I and/or transcription factor binding sites identified within conserved regions A-I and/or with enhancer elements and/or other regulatory elements (see Tables 1 and 2 above and Tables 9-12 below).
In one aspect of the invention, there is provided a vector for expression of a suppression agent for a disease causing gene and/or a replacement nucleic acid that is not recognized by the suppression agent, wherein the vector comprises at least one of the conserved regions selected from: conserved region B from the rhodopsin gene represented by SEQ ID NO: 93, or a variant or equivalent thereof; conserved region C from the rhodopsin gene represented by SEQ ID NO: 94, or a variant or equivalent thereof; conserved region F and G from the rhodopsin gene represented by SEQ ID NO: 97 or a variant or equivalent thereof; and conserved region A from the rhodopsin gene represented by SEQ ID NO: 92, or a variant or equivalent thereof. In a particular embodiment, the vector comprises at least one of the conserved regions selected from: conserved region B from the rhodopsin gene represented by SEQ ID NO: 93; conserved region C from the rhodopsin gene represented by SEQ ID NO: 94; conserved region F and G from the rhodopsin gene represented by SEQ ID NO: 97; and conserved region A from the rhodopsin gene represented by SEQ ID NO: 92.
In one embodiment of the invention the use of suppression and replacement constructs in combination with one or more factors to facilitate cell survival, cell viability and/or cell functioning is contemplated. In relation to neurons, a range of neurotrophic and/or neuroprotective factors may be used inter glia brain derived neurotrophic factor (BDNF), glial derived neurotrophic factor (GDNF), neurturin, ciliary derived neurotrophic factor (CNTF), nerve growth factor (NGF), fibroblast growth factors (FGF), insulin-like growth factors (IGF), pigment epithelium-derived factor (PEDG), hepatocyte growth factor (HGF), thyrotrophin releasing hormone (TRH) and rod derived cone viability factor (RDCVF) amongst others. There is substantial evidence in the literature that such factors may increase cell viability and/or cell survival for a range of cell types. For example, these factors have been shown to provide beneficial effects to a wide range of neuronal cell types including, for example, photoreceptors, when delivered either in protein or DNA forms (Buch et al., Mol. Ther., 2006; 14(5):700-709). The use of GDNF to augment gene-based therapies for recessive disease has been demonstrated in mice (Buch et al., Mol. Ther., 2006; 14(5):700-709). Genes encoding neurotrophic/neuroprotective factors may be expressed from general promoters such as the CBA promoter (Buch et al., Mol. Ther., 2006; 14(5):700-709) or from tissue specific promoters. Sequences to optimise expression of neurotrophic/neuroprotective factors such as those sequences identified in Tables 1, 2, 9-13 may be included in constructs.
Sequences of a number of exemplary neurotrophic factors are provided in
Constructs incorporating suppression and replacement and neurotrophic/neuroprotective factor(s) may be delivered using viral and/or non-viral vectors using art known methods (Andrieu-Soler et al., Mil. Vis., 2006; 12:1334-47). Naked DNA, lipids, polymers, nanoparticles, electrotransfer amongst other methods have been used to achieve gene/nucleotide delivery in cells and animals. For example, lentiviral vectors and/or adenoassociated viral (AAV) vectors may be used to deliver constructs incorporating the 3 components defined above (suppression, replacement and neurotrophism/neuroprotection). 3-component constructs in some instances may require vectors that have significant capacity in terms of size of DNA inserts. Many viral and non-viral vectors have been characterised that can facilitate large DNA fragments including inter alia lentiviral vectors and some of adenoassociated viral serotypes. For example, AAV serotype 2 capsid 5 vectors (AAV2/5) have been shown to accommodate 8-9 kilobases of DNA (Alberto Aurrichio; British Society of Gene Therapy, 2008). One or more components (suppression, replacement, neurotrophism/neuroprotection) may, for example, in the case of AAV be cloned between the AAV ITRS and or one or more components may be cloned into the backbone of the plasmid used to generate AAV.
While utilisation of a single vector to deliver 3-component constructs involving suppression and replacement and a neurotrophic/neuroprotective sequence to a cell, a tissue and or an animal is contemplated, the use of multiple vectors in combination to deliver all 3 components is also contemplated. The multivalent approach involving suppression, replacement and neuroprotection may involve the use of 1 or more vectors for delivery. In addition, the 3 components may be delivered using a combination of a vector or vectors incorporating DNA sequences together with RNA and or dsRNA and or protein. In the current invention, delivery of protein, of RNA encoding protein and/or of DNA encoding protein or a combination thereof to achieve delivery of all 3 components, suppression, replacement and neuroprotection, is contemplated.
In another embodiment of the invention the size of the backbone of the AAV plasmid vector is either increased or decreased so as to increase expression from the virus. For example, it has been described in the art that increasing the AAV virus backbone in size such that it is larger than the insert cloned within ITSI and ITS2 favours AAV packaging of the insert over packaging of the backbone, thereby increasing expression of DNA cloned within the ITR regions (Bennet et al., Reversal of visual defects in animal models of LCA within weeks of treatment with an optimized AAV. Molecular Therapy Vol. 15, supplement 1, s286).
In a further embodiment of the invention the size of the backbone is increased with a gene which is therapeutically beneficial driven by a promoter. In this embodiment a portion of packaged AAV consists of the backbone and hence a portion of AAV particles will express the gene encoded within the backbone. In one embodiment the therapeutically beneficial gene cloned in the backbone is a neurotrophic factor such GDNF, Neurturin or others.
While the invention can be used for dominant and or polygenic disorders, it may also be practised for recessive disorders. For example, the art describes that when treating the recessive disorder phenylketonuria (PKU) with replacement genes, endogenous protein expressed from mutant genes interfered with protein from replacement genes (Described in a thesis submitted to the University of Florida in partial fulfillment of the requirements for the degree of Doctor of Philosophy, by Catherine Elisabeth Charron, August 2005 and entitled “Gene therapy for phenylketonuria: dominant-negative interference in a recessive disease”). Thus, suppression and replacement constructs may be targeted to recessive disorders which like PKU require suppression and replacement.
Suppression and replacement technology provides a strategy that may be applicable to a wide range of genetic disorders including disorders characterized by either a recessive, dominant, polygenic, multifactorial or a dominant negative pathology. In a further embodiment of the invention conserved regions identified in the promoter region of mammalian rhodopsin genes and/or enhancer elements and/or other regulatory elements and/or epigenetic elements such as listed in Table 5 may be combined with suppressors targeting genes with mutations other than rhodopsin and providing replacement genes other than rhodopsin. Osteogenesis imperfecta, epidermolysis bullosa, autosomal dominant early onset Alzheimer's disease, autosomal dominant polycystic kidney disease, Rett syndrome, familial platelet disorder, dominant negative diabetes insipidus, autosomal dominant Stargardt like macular dystrophy, nemaline myopathy, familial pulmonary arterial hypertension, APC and p53 related cancers and several other disorders (OMIM) may potentially benefit from a suppression and replacement therapeutic approach. Triplet repeat disorders, 14 of which have been characterised to date, including Huntington's disease, spinocerebellar ataxia and myotonic dystrophy may benefit from a suppression and replacement approach. For each disorder, promoters of the endogenous gene or constitutive promoters or promotes from other genes, or inducible promoters may be used to express the suppression agent or replacement nucleic acid.
In another embodiment of the invention, promoter and/or enhancer elements and/or other regulatory elements and/or epigenetic elements may be combined with other promoters than rhodopsin in combination with suppression and/or replacement elements. For example, but not exclusively, promoter and enhancer elements can be combined with the COL1A1 and or COL1A2 and or COL7A1 and or Keratin 5 and or Keratin 14 and or peripherin and/or IMPDH1 promoters and/or genes. Depending upon the tissue in which the suppression agent and/or replacement nucleic acid is administered or active in vivo, tissue specific regulatory elements are used to enhance expression of the suppression agent and/or replacement nucleic acid.
The suppressors and/or replacement nucleic acids of the invention can be targeted to suppress and replace a gene where mutations in the gene can give rise, predispose or work in combination with other genetic factors and/or environmental factors to cause disease pathology. For example, in the case of dominant retinopathies the rhodopsin geen may be suppressed and replaced. For example, siRNAs targeting RHO-(NM—000539.2) can be designed and provided commercially. Likewise control siRNAs, for example, targeting EGFP (U57608) and or other reporter genes and or other non-targeting siRNAs can be designed and synthesized. siRNAs are chosen to target sequences which differed by at least one and preferable many more nucleotides from any known gene in mouse and human databases (http://www.ncbi.nlm.nih.gov/blast, BLASTN2.2.6, Altschul et al., Nuc Acids Res. 25: (17:3389-402, 1997). siRNAs can be cloned downstream of, for example, polymerase III promoters such as the H1 or U6 promoters to generate short hairpin RNAs (shRNAs; Brummelkamp et al., Science 296: (5567:505-3, 2001). Alternatively, polymerase II promoters which drive expression in many or all cell or tissue types including the CMV promoter, ubquitin promoter and or the β-actin promoter, for example, may be used to express shRNAs. Likewise tissue specific promoters such as the rhodopsin promoter, peripherin promoter and or enolase promoter amongst others may be used to express shRNAs. shRNA sequences can be cloned into vectors with a reporter gene to facilitate monitoring expression from vectors, for example, shRNAs can be cloned in pEGFP-1 amongst other plasmids (BD Biosciences, Clontech, Palo Alto, Calif.). Suppressors can be delivered to cells, tissues and or animals with or without replacement nucleic acids.
Replacement nucleic acids with nucleotide sequence changes over the target site for siRNA-mediated suppression, for example, at degenerative nucleotides can be generated by primer directed mutagenesis and cloned into vectors such as pcDNA3.1-(Invitrogen). Replacement nucleic acids may also be modified at the UTRs and or at polymorphic sites within the target gene. Ubiquitous promoters such as the CMV promoter and or the ubiquitin promoter and or the β-actin promoter amongst others can be used to drive expression of replacement nucleic acids. Alternatively, tissue specific promoters such as the rhodopsin promoter, peripherin promoter, Col1A1 promoter, Col1A2 promoter, Col1A7 promoter, Keratin promoters and/or the enolase promoter amongst others and/or inducible promoters such as a tetracycline responsive promoter can be used to drive expression of replacement nucleic acids. Replacement human rhodopsin nucleic acids which have been altered in nucleotide sequence at degenerate positions over siRNA target sites for example, replacement nucleic acids for siRNA sequences 1-17 are provided in Table 5. Replacement nucleic acids can be delivered to cells, tissues and or animals with or without suppressor agents.
Suppression and Replacement in Cells and Tissues
Promoter driven replacement nucleic acids such as rhodopsin nucleic acids and siRNAs and/or shRNAs targeting rhodopsin can be co-transfected into cells, for example, HeLa and or Cos-7 cells amongst other cell types using art known methods. For example, 24 hours post-transfection of suppressor agents and/or replacement nucleic acids, RNA and cytoplasmic protein can be isolated from cells using well established methodologies. Additionally, suppression and replacement can be evaluated in tissues. In the case of retinal genes, for example, organotypic retinal explant cultures from mouse or rat, for example, can be prepared and maintained using art known methods and suppressor agents and or replacement nucleic acids can be delivered to organotypic cultures. For example, electroporation can be used to deliver siRNA and/or shRNA constructs and/or shRNA constructs and replacement nucleic acids to retinal explants as described in Palfi et al., Hum. Mutat. 27(3):260-8, 2006. Subsequent to electroporation of retinal explants, retinas can be treated with trypsin to expedite dissociation of cells. Retinal cell sub-populations within the dissociated cell population which have a particular feature, for example, that express a reporter gene such as EGFP can be identified. One method of identification that can be invoked is FACS (Palfi et al., Hum. Mutat. 27(3):260-8, 2006). Levels of suppression and replacement of a target gene can be evaluated in FACS isolated cell populations. For example, suppression and/or suppression and replacement can be evaluated in electroporated EGFP positive cells from retinal explants.
Evaluation of Suppression and Replacement Using RNA Assays
Suppression and replacement can be evaluated in cells, tissues and/or animals using RNA assays including real time RT-PCR, northern blotting, RNA in situ hybridisation and or RNAse protection assays. RNA expression levels of suppressors and/or of endogenous genes and or replacement nucleic acids can be assessed by real time RT-PCR using, for example, a 7300 Real Time PCR System (Applied Biosystems, Foster City, Calif., USA) and using, for example, a QuantiTect SYBR Green RT-PCR kit (Qiagen Ltd). RT-PCR assays are undertaken using levels of expression of housekeeping controls such as β-actin or GAPDH, for example, for comparative purposes. Levels of RNA expression can be evaluated using sets of primers targeting the nucleic acids of interest including suppressors, target genes and/or replacements, for example, the following primers can be used for the evaluation of levels of expression of human rhodopsin, β-actin and GAPDH.
Expression of replacement constructs and/or shRNAs may be confirmed, for example, by Northern blotting. RNA may also be detected by in situ hybridisations using single stranded RNA probes that have been labelled with, for example, DIG. To evaluate levels of expression of suppression agents and/or replacement nucleic acids and/or endogenous target genes, RNase protections assays can be performed using art known methods, such as that described in the Ambion mirVana™ Probe and Marker kit manual (catalogue number 1554) and the Ambion RPAIII™ Ribonuclease protection assay kit manual (catalogue number 1414). For example, RNA probes approximately 15-25 nucleotides in length specific for transcripts from, for example, an endogenous target gene and/or a suppressor and/or a replacement nucleic acid can be synthesized. For example, RNA probes targeting mouse rhodopsin and/or human rhodopsin and/or suppression agents targeting rhodopsin and/or rhodopsin replacement nucleic acids can be synthesized using companies such as Sigma-Proligo or Ambion. RNA probes and size standards can be labelled to aid visualization after separation of samples on denaturing polyacrylamide gels. For example, RNA probes and Decade™ size marker (Ambion Inc) can be 5′ end-labelled with P32-γATP (GE Healthcare) using the mirVana™ probe and marker kit according to the manufacturer's protocol (Ambion Inc.). RNase protection assays can be performed using art known methods, for example, using the RPA III™ Ribonuclease Protection Assay Kit and the manufacturer's protocol (Ambion Inc.).
Expression of suppressors and/or replacement nucleic acids and/or endogenous genes can be undertaken and determined in cells, in tissues and or in animals using, for example, the assays and associated methodologies provided above.
Evaluation of Suppression and Replacement Using Protein Assays
Suppression and replacement can be evaluated in cells, tissues and/or animals using protein assays including ELISA, western blotting and immunocytochemistry assays. ELISAs can be undertaken to evaluate levels of suppression by assessing levels of expression of a target endogenous gene and/or can be used to evaluate levels expression of replacement nucleic acids—such proteins assays are well know in the art and methods are provided in, for example, Palfi et al., Hum. Mutat. 27(3):260-8, 2006. For example, in the case of retinal genes such as the rhodopsin gene, ELISA is undertaken using a rhodopsin primary antibody which is typically used in a diluted form, for example, using a 1/10-1/10000 dilution (but possibly outside of this range) of an antibody for the target protein. In addition, Western Blotting may be undertaken to determine relative quantities of a specific protein, for example rhodopsin. Briefly, protein samples are separated using SDS-PAGE and transferred to a membrane. The membrane is incubated with generic protein (for example milk proteins) to bind to “sticky” places on the membrane. A primary antibody is added to a solution which is able to bind to its specific protein and a secondary antibody-enzyme conjugate, which recognizes the primary antibody is added to find locations where the primary antibody bound.
In addition to the protein assays referred to above, assays using antibodies in conjunction with microscopy can be used to evaluate protein levels. For example, in the case of rhodopsin immunocytochemistry (for example, using a 1/10-1:1000 dilution of a primary rhodopsin antibody) and fluorescent microscopy can be carried out as has been documented in Kiang et al., 2005 Mol. Ther. 12(3):555-61, 2005. Immunocytochemistry can be undertaken on cells and/or tissues. In the case of the retina, various modes of sectioning can be implemented to evaluate retinal sections. For example, frozen sections, agar embedded sections and/or resin embedded sections can be used. To obtain thin sections, for example of the retina, epon embedding and semi-thin sectioning can be performed using art known methods such as those provided in McNally et al., Hum. Mol. Genet. 11(9):1005-16, 2002. Immunocytochemistry may be used to evaluate suppression of a target gene and or expression of replacement nucleic acids. Additionally, histological analyses can be used to evaluate the histological effect(s) associated with the administration of suppressors and or replacement nucleic acids. In animal models of retinal degenerations such as the rho−/−, rds, rhodopsin Pro23His, rhodopsin Pro2347Ser mice and others there is a degeneration of the photoreceptor cell layer over time. Histological analyses can be used to evaluate if this degeneration has been modulated subsequent to administration of suppression agents and/or replacement nucleic acids.
Delivery of Suppression and Replacement
Both non-viral and/or viral vectors can be used in the invention to deliver the suppression agents and/or replacement nucleic acids. For example, in the case of retina, recombinant adenoassociated virus (AAV) and more specifically AAV2/5 has previously been found to elicit efficient transduction of photoreceptopr cells. Other AAV serotypes may also be used to deliver to retina, for example, AAV2/2 elicits efficient delivery to the retinal pigment epithelium (RPE) as does AAV4. AAV vectors can be generated using protocols with and without helper virus. For example, a helper virus free protocol using a triple transfection approach is well documented (Xiao et al., J. Virol. 72(3):2224-32, 1998). Expression cassettes carrying suppression and/or replacement elements can be cloned into plasmids such as pAAV-MCS provided by Stratagene Inc. Suppressors and/or replacement nucleic acids are cloned between the inverted terminal repeats of AAV2 and transfected into 293 cells (Stratagene; ATACC cat no CRL-1573) with two other plasmids, hence the term triple transfection. For example, the pRep2/Cap5 plasmid (Hildinger et al., J. Virol. 75(13):6199-203, 2001) together with the pHelper plasmid (Stratagene), at, for example, a ratio of 1:1:2, can be used to generate AAV2/5 vectors. Virus can be generated using a variety of art known procedures including the method outlined below. For example, to generate virus fifty 150 mm plates of confluent HEK293 cells were transfected (50 μg DNA/plate) with polyethyleminine (Reed et al., J. Virol. Methods 138(1-2):85-98, 2006). 48 hrs post-transfection crude viral lysates were cleared (Auricchio et al., 2001) and purified by CsCl2 gradient centrifugation (Zolotukhin et al., Gene Ther. 6(6):973-85, 1999). The AAV containing fraction was dialyzed against PBS. Genomic titres, viral particles (vp/ml), were determined by quantitative real-time PCR using art known methods (Rohr et al., J. Virol. Methods 106(1):81-8, 2002). AAVs can be generated that contain, for example, either targeting shRNAs or control shRNAs and/or replacement nucleic acids such as rhodopsin and/or reporter nucleic acids such as EGFP and/or stuffer sequences and/or sequences aiding expression of suppression agents and/or replacement nucleic acids such as promoter and/or enhancer sequences and/or other regulatory sequences and/or epigenetic elements.
Administration of Suppression and Replacement Vectors
Animal models can be used to mirror human disorders. For example, animal models of human retinopathies or that express a human retinal gene have been generated, for example, rho−/− mice (Humphries et al., Nat. Genet. 15(2):216-9, 1997), NHR +/− mice (Olsson et al., Neuron 9(5):815-30, 1992), Pro23His mice (Olsson et al., Neuron 9(5):815-30, 1992), Pro347Ser mice (Li et al., Proc. Natl. Acad. Sci. U.S.A. 95(20):11933-8, 1998) and RHO-M mice (see below). Mice typically are maintained under specific pathogen free (SPF) housing conditions and in a controlled light environment. The suppression agents and/or replacement nucleic acids of the invention can be administered to animals either locally and/or systemically. Local administration can include direct injection to the target tissues and/or in the proximity of the target tissue as has been described in detail in the art in, for example, Xia et al. (ACS Chem. Biol. 1(3):176-83, 2004) delivered AAV vectors with shRNAs to brain to treat spinocerebellar ataxia. In the case of the retina, subretinal injection can be used to administer suppression agents and/or replacement nucleic acids according to the following procedure. For example, mice can be anaesthetised by intraperitoneal injection of Domitor and Ketalar (10 and 50 μg/g of body weight respectively). The pupils are dilated with phenylephrine and under local analgesia (amethocaine) a small puncture is made in the sclera. A micro-needle attached to a 10 μl syringe (Hamilton Company Europe) is inserted through the puncture to the subretinal space and 1-3 μl of vector is administered. For example, in the case of AAV 1-411 of a 1012-14 vp/ml AAV vector preparation in PBS is administered. A reverse anaesthetic (antisedan, 50 μg/g of body weight) can be applied by intraperitoneal injection post-delivery. Body temperature during the procedure is sustained using a homeothermic heating device. In addition newborn mice can be prepared for subretinal injection according to Matsuda and Cepko (Proc. Natl. Acad. Sci. U.S.A. 101(1):16-22, 2004).
Assay for Function
To evaluate if suppression and/or replacement modulates the function of a target tissue and/or cell type, one or more assays may be employed that are well described in the prior art. In the case of the retina, functional assays include but are not limited to electrophysiology, such as pattern electroretinogram (ERG), full field ERG, and visual evoked potentials. In addition, visual field assessments, color vision assessments, and pupilometry may be performed. For example, electroretinography can be used to evaluate the response of the retina to light. This can be performed using, for example, the following procedure or an adapted procedure. Animals can be dark-adapted overnight and prepared for ERG under dim red light. Pupils are dilated with 1% cyclopentalate and 2.5% phenylephrine. Animals are anesthetized with ketamine and xylazine (16 and 1.6 μg/10 g body weight respectively) injected intraperitoneally. Standardized flashes of light are presented to the animal, for example a mouse, in a Ganzfeld bowl. ERG responses are recorded simultaneously from both eyes by means of contact lens electrodes (Medical Workshop, Netherlands) using 1% amethocaine as topical anesthesia. Reference and ground electrodes are positioned subcutaneously, approximately one mm from the temporal canthus and anterior to the tail respectively. Responses are analysed using a RetiScan RetiPort electrophysiology unit (Roland Consulting Gmbh). The protocol is based on that approved by the International Clinical Standards Committee for human electroretinography. Rod-isolated responses are recorded using a dim white flash (−25 dB maximal intensity where maximal flash intensity was 3 candelas/m2/s) presented in the dark-adapted state. Maximal combined rod-cone responses to the maximal intensity flash are then recorded. Following a 10 minute light adaptation to a background illumination of 30 candelas/m2, cone-isolated responses are recorded to the maximal intensity flash presented initially as a single flash and subsequently as 10 Hz flickers. A-waves are measured from the baseline to the trough and b-waves from the baseline (in the case of rod-isolated responses) or from the a-wave to the trough.
The agents of the invention are administered in effective amounts. An effective amount is a dosage of the agent sufficient to provide a medically desirable result. An effective amount means that amount necessary to delay the onset of, inhibit the progression of or halt altogether the onset or progression of the particular condition or disease being treated. An effective amount may be an amount that reduces one or more signs or symptoms of the disease. When administered to a subject, effective amounts will depend, of course, on the particular condition being treated; the severity of the condition; individual patient parameters including age, physical condition, size and weight, concurrent treatment, frequency of treatment, and the mode of administration. These factors are well known to those of ordinary skill in the art and can be addressed with no more than routine experimentation.
Actual dosage levels of active ingredients in the pharmaceutical compositions of the invention can be varied to obtain an amount of the agent(s) that is effective to achieve the desired therapeutic response for a particular patient, compositions, and mode of administration. The selected dosage level depends upon the activity of the particular agent, the route of administration, the severity of the condition being treated, the condition, and prior medical history of the patient being treated. However, it is within the skill of the art to start doses of the agent(s) at levels lower than required to achieve the desired therapeutic effort and to gradually increase the dosage until the desired effect is achieved.
The agents and pharmaceutical compositions of the invention can be administered to a subject by any suitable route. For example, the compositions can be administered orally, including sublingually, rectally, parenterally, intracisternally, intravaginally, intraperitoneally, topically and transdermally (as by powders, ointments, or drops), bucally, or nasally. The term “parenteral” administration as used herein refers to modes of administration other than through the gastrointestinal tract, which include intravenous, intramuscular, intraperitoneal, intrasternal, intramammary, intraocular, retrobulbar, intrapulmonary, intrathecal, subcutaneous and intraarticular injection and infusion. Surgical implantation also is contemplated, including, for example, embedding a composition of the invention in the body such as, for example, in the brain, in the abdominal cavity, under the splenic capsule, brain, or in the cornea.
Agents of the present invention also can be administered in the form of liposomes. As is known in the art, liposomes generally are derived from phospholipids or other lipid substances. Liposomes are formed by mono- or multi-lamellar hydrated liquid crystals that are dispersed in an aqueous medium. Any nontoxic, physiologically acceptable, and metabolizable lipid capable of forming liposomes can be used. The present compositions in liposome form can contain, in addition to a compound of the present invention, stabilizers, preservatives, excipients, and the like. The preferred lipids are the phospholipids and the phosphatidyl cholines (lecithins), both natural and synthetic. Methods to form liposomes are known in the art. See, for example, Prescott, Ed., Methods in Cell Biology, Volume XIV, Academic Press, New York, N.Y. (1976), p. 33, et seq.
Dosage forms for topical administration of an agent of this invention include powders, sprays, ointments, and inhalants as described herein. The agent is mixed under sterile conditions with a pharmaceutically acceptable carrier and any needed preservatives, buffers, or propellants which may be required. Ophthalmic formulations, eye ointments, powders, and solutions also are contemplated as being within the scope of this invention.
Pharmaceutical compositions of the invention for parenteral injection comprise pharmaceutically acceptable sterile aqueous or nonaqueous solutions, dispersions, suspensions, or emulsions, as well as sterile powders for reconstitution into sterile injectable solutions or dispersions just prior to use. Examples of suitable aqueous and nonaqueous carriers, diluents, solvents, or vehicles include water ethanol, polyols (such as, glycerol, propylene glycol, polyethylene glycol, and the like), and suitable mixtures thereof, vegetable oils (such, as olive oil), and injectable organic esters such as ethyl oleate. Proper fluidity can be maintained, for example, by the use of coating materials such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants.
These compositions also can contain adjuvants such as preservatives, wetting agents, emulsifying agents, and dispersing agents. Prevention of the action of microorganisms can be ensured by the inclusion of various antibacterial and antifungal agents, for example, paraben, chlorobutanol, phenol sorbic acid, and the like. It also may be desirable to include isotonic agents such as sugars, sodium chloride, and the like. Prolonged absorption of the injectable pharmaceutical form can be brought about by the inclusion of agents which delay absorption, such as aluminum monostearate and gelatin.
In some cases, in order to prolong the effect of the agent, it is desirable to slow the absorption of the drug from subcutaneous or intramuscular injection. This result can be accomplished by the use of a liquid suspension of crystalline or amorphous materials with poor water solubility. The rate of absorption of the agent then depends upon its rate of dissolution which, in turn, may depend upon crystal size and crystalline form. Alternatively, delayed absorption of a parenterally administered drug from is accomplished by dissolving or suspending the agent in an oil vehicle.
Injectable depot forms are made by forming microencapsule matrices of the agent in biodegradable polymers such a polylactide-polyglycolide. Depending upon the ratio of agent to polymer and the nature of the particular polymer employed, the rate of agent release can be controlled. Examples of other biodegradable polymers include poly(orthoesters) and poly(anhydrides). Depot injectable formulations also are prepared by entrapping the drug in liposomes or microemulsions which are compatible with body tissue.
The injectable formulations can be sterilized, for example, by filtration through a bacterial- or viral-retaining filter, or by incorporating sterilizing agents in the form of sterile solid compositions which can be dissolved or dispersed in sterile water or other sterile injectable medium just prior to use.
The invention provides methods for oral administration of a pharmaceutical composition of the invention. Oral solid dosage forms are described generally in Remington's Pharmaceutical Sciences, 18th Ed., 1990 (Mack Publishing Co. Easton Pa. 18042) at Chapter 89. Solid dosage forms for oral administration include capsules, tablets, pills, powders, troches or lozenges, cachets, pellets, and granules. Also, liposomal or proteinoid encapsulation can be used to formulate the present compositions (as, for example, proteinoid microspheres reported in U.S. Pat. No. 4,925,673). Liposomal encapsulation may include liposomes that are derivatized with various polymers (e.g., U.S. Pat. No. 5,013,556). In general, the formulation includes an agent of the invention and inert ingredients which protect against degradation in the stomach and which permit release of the biologically active material in the intestine.
In such solid dosage forms, the agent is mixed with, or chemically modified to include, a least one inert, pharmaceutically acceptable excipient or carrier. The excipient or carrier preferably permits (a) inhibition of proteolysis, and (b) uptake into the blood stream from the stomach or intestine. In a most preferred embodiment, the excipient or carrier increases uptake of the agent, overall stability of the agent and/or circulation time of the agent in the body. Excipients and carriers include, for example, sodium citrate or dicalcium phosphate and/or (a) fillers or extenders such as starches, lactose, sucrose, glucose, cellulose, modified dextrans, mannitol, and silicic acid, as well as inorganic salts such as calcium triphosphate, magnesium carbonate and sodium chloride, and commercially available diluents such as FAST-FLO®, EMDEX®, STA-RX 1500®, EMCOMPRESS® and AVICEL®, (b) binders such as, for example, methylcellulose ethylcellulose, hydroxypropyhnethyl cellulose, carboxymethylcellulose, gums (e.g., alginates, acacia), gelatin, polyvinylpyrrolidone, and sucrose, (c) humectants, such as glycerol, (d) disintegrating agents, such as agar-agar, calcium carbonate, potato or tapioca starch, alginic acid, certain silicates, sodium carbonate, starch including the commercial disintegrant based on starch, EXPLOTAB®, sodium starch glycolate, AMBERLITE®, sodium carboxymethylcellulose, ultramylopectin, gelatin, orange peel, carboxymethyl cellulose, natural sponge, bentonite, insoluble cationic exchange resins, and powdered gums such as agar, karaya or tragacanth; (e) solution retarding agents such a paraffm, (f) absorption accelerators, such as quaternary ammonium compounds and fatty acids including oleic acid, linoleic acid, and linolenic acid (g) wetting agents, such as, for example, cetyl alcohol and glycerol monosterate, anionic detergent surfactants including sodium lauryl sulfate, dioctyl sodium sulfosuccinate, and dioctyl sodium sulfonate, cationic detergents, such as benzalkonium chloride or benzethonium chloride, nonionic detergents including lauromacrogol 400, polyoxyl 40 stearate, polyoxyethylene hydrogenated castor oil 10, 50 and 60, glycerol monostearate, polysorbate 40, 60, 65, and 80, sucrose fatty acid ester, methyl cellulose and carboxymethyl cellulose; (h) absorbents, such as kaolin and bentonite clay, (i) lubricants, such as talc, calcium sterate, magnesium stearate, solid polyethylene glycols, sodium lauryl sulfate, polytetrafluoroethylene (PTFE), liquid paraffin, vegetable oils, waxes, CARBOWAX® 4000, CARBOWAX® 6000, magnesium lauryl sulfate, and mixtures thereof; (j) glidants that improve the flow properties of the drug during formulation and aid rearrangement during compression that include starch, talc, pyrogenic silica, and hydrated silicoaluminate. In the case of capsules, tablets, and pills, the dosage form also can comprise buffering agents.
Solid compositions of a similar type also can be employed as fillers in soft and hard-filled gelatin capsules, using such excipients as lactose or milk sugar, as well as high molecular weight polyethylene glycols and the like.
The solid dosage forms of tablets, dragees, capsules, pills, and granules can be prepared with coatings and shells, such as enteric coatings and other coatings well known in the pharmaceutical formulating art. They optionally can contain opacifying agents and also can be of a composition that they release the active ingredients(s) only, or preferentially, in a part of the intestinal tract, optionally, in a delayed manner. Exemplary materials include polymers having pH sensitive solubility, such as the materials available as EUDRAGIT® Examples of embedding compositions which can be used include polymeric substances and waxes.
The active compounds also can be in micro-encapsulated form, if appropriate, with one or more of the above-mentioned excipients.
Liquid dosage forms for oral administration include pharmaceutically acceptable emulsions, solutions, suspensions, syrups, and elixirs. In addition to the active compounds, the liquid dosage forms can contain inert diluents commonly used in the art, such as, for example, water or other solvents, solubilizing agents and emulsifiers, such as ethyl alcohol, isopropyl alcohol ethyl carbonate ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, dimethyl formamide, oils (in particular, cottonseed, groundnut, corn, germ, olive, castor, and sesame oils), glycerol, tetrahydroflirfuryl alcohol, polyethylene glycols, fatty acid esters of sorbitan, and mixtures thereof.
Besides inert diluents, the oral compositions also can include adjuvants, such as wetting agents, emulsifying and suspending agents, sweetening, coloring, flavoring, and perfuming agents. Oral compositions can be formulated and further contain an edible product, such as a beverage.
Suspensions, in addition to the agent(s), can contain suspending agents such as, for example ethoxylated isostearyl alcohols, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar-agar, tragacanth, and mixtures thereof.
Also contemplated herein is pulmonary delivery of the agent(s) of the invention. The agent(s) is delivered to the lungs of a mammal while inhaling, thereby promoting the traversal of the lung epithelial lining to the blood stream. See, Adjei et al., Pharmaceutical Research 7:565-569 (1990); Adjei et al., International Journal of Pharmaceutics 63:135-144 (1990) (leuprolide acetate); Braquet et al., Journal of Cardiovascular Pharmacology 13 (supp1.5): s.143-146 (1989)(endothelin-1); Hubbard et al., Annals of Internal Medicine 3:206-212 (1989) (α1-antitrypsin); Smith et al., J. Clin. Invest. 84:1145-1146 (1989) (α1-proteinase); Oswein et al., “Aerosolization of Proteins,” Proceedings of Symposium on Respiratory Drug Delivery II, Keystone, Colo., March, 1990 (recombinant human growth hormone); Debs et al., The Journal of Immunology 140:3482-3488 (1988) (interferon-γ and tumor necrosis factor α) and Platz et al., U.S. Pat. No. 5,284,656 (granulocyte colony stimulating factor).
Contemplated for use in the practice of this invention are a wide range of mechanical devices designed for pulmonary delivery of therapeutic products, including, but not limited to, nebulizers, metered dose inhalers, and powder inhalers, all of which are familiar to those skilled in the art.
Some specific examples of commercially available devices suitable for the practice of the invention are the ULTRAVENT® nebulizer, manufactured by Mallinckrodt, Inc., St. Louis, Mo.; the ACORN II® nebulizer, manufactured by Marquest Medical Products, Englewood, Colo.; the VENTOL® metered dose inhaler, manufactured by Glaxo Inc., Research Triangle Park, N.C.; and the SPINHALER® powder inhaler, manufactured by Fisons Corp., Bedford, Mass.
All such devices require the use of formulations suitable for the dispensing of a agent(s) of the invention. Typically, each formulation is specific to the type of device employed and can involve the use of an appropriate propellant material, in addition to diluents, adjuvants, and/or carriers useful in therapy.
The composition is prepared in particulate form, preferably with an average particle size of less than 10 μm, and most preferably 0.5 to 5 μm, for most effective delivery to the distal lung.
Carriers include carbohydrates such as trehalose, mannitol, xylitol, sucrose, lactose, and sorbitol. Other ingredients for use in formulations may include lipids, such as DPPC, DOPE, DSPC and DOPC, natural or synthetic surfactants, polyethylene glycol (even apart from its use in derivatizing the inhibitor itself), dextrans, such as cyclodextran, bile salts, and other related enhancers, cellulose and cellulose derivatives, and amino acids.
Also, the use of liposomes, microcapsules or microspheres, inclusion complexes, or other types of carriers is contemplated.
Formulations suitable for use with a nebulizer, either jet or ultrasonic, typically comprise a compound of the invention dissolved in water at a concentration of about 0.1 to 25 mg of biologically active protein per mL of solution. The formulation also can include a buffer and a simple sugar (e.g., for protein stabilization and regulation of osmotic pressure). The nebulizer formulation also can contain a surfactant to reduce or prevent surface-induced aggregation of the inhibitor composition caused by atomization of the solution in forming the aerosol.
Formulations for use with a metered-dose inhaler device generally comprise a finely divided powder containing the agent suspended in a propellant with the aid of a surfactant. The propellant can be any conventional material employed for this purpose, such as a chlorofluorocarbon, a hydrochlorofluorocarbon, a hydrofluorocarbon, or a hydrocarbon, including trichlorofluoromethane, dichlorodifluoromethane, dichlorotetrafluoroethanol, and 1,1,1,2-tetrafluoroethane, or combinations thereof. Suitable surfactants include sorbitan trioleate and soya lecithin. Oleic acid also can be useful as a surfactant.
Formulations for dispensing from a powder inhaler device comprise a finely divided dry powder containing the agent and also can include a bulking agent, such as lactose, sorbitol, sucrose, mannitol, trehalose, or xylitol, in amounts which facilitate dispersal of the powder from the device, e.g., 50 to 90% by weight of the formulation.
Nasal delivery of the agent(s) and composition of the invention also is contemplated. Nasal delivery allows the passage of the agent or composition to the blood stream directly after administering the therapeutic product to the nose, without the necessity for deposition of the product in the lung. Formulations for nasal delivery include those with dextran or cyclodextran. Delivery via transport across other mucous membranes also is contemplated.
Compositions for rectal or vaginal administration are preferably suppositories which can be prepared by mixing the agent(s) of the invention with suitable nonirritating excipients or carriers, such as cocoa butter, polyethylene glycol, or suppository wax, which are solid at room temperature, but liquid at body temperature, and therefore melt in the rectum or vaginal cavity and release the active compound.
In order to facilitate delivery of the agent(s) across cell and/or nuclear membranes, compositions of relatively high hybrophobicity are preferred. The agent(s) can be modified in a manner which increases hydrophobicity, or the agent(s) can be encapsulated in hydrophobic carriers or solutions which result in increased hydrophobicity.
Practice of the invention will be still more fully understood from the following examples, which are presented herein for illustration only and should not be construed as limiting the invention in any way.
siRNAs targeting human rhodopsin were synthesized and evaluated for RNAi-mediated suppression (listed in Table 8). Suppression and replacement constructs with suppressors targeting the human rhodopsin mRNA sequence and replacement rhodopsin genes that escape suppression by the suppressor due to subtle changes in the sequence were subsequently designed. These changes, while enabling replacement nucleic acids to escape suppression at least in part, did not change the protein product expressed from the replacement genes. Short hairpin RNAs (shRNAs) were used to demonstrate suppression in vivo (
siRNAs were designed according to the method of Elbashir et al., Nature 411(6836):494-8, 2001, or by using the HiPerformance siRNA design algorithm (Qiagen Ltd. Crawley, UK). siRNA target sequences differed by at least 4 nucleotides from any non-rhodopsin sequences in mouse and human databases (http://www.ncbi.nlm.nih.gov/blast, BLAST2.2.6 (Altschul et al., Nucleic Acids Res. 25(17):3389-402, 1997). siBB, siQ1 and a non-targeting siRNA siNT (5′ UUCUCCGAACGUGUCACGU 3′; SEQ ID NO:75) or EGFP (U57608), siEGFP (nt 256-277) were initially cloned downstream of the H1 promoter using BglII/BamH1 and Hind III restriction sites to generate shRNAs and subsequently in pEGFP-1 (BD Biosciences, Clontech, Palo Alto, Calif.) using EcoRI and Hind III sites generating shBB-EGFP, shQ1-EGFP and shNT-EGFP (
AGCTGCGGTATAGATTATTA
Suppression of RHO in HeLa Cells
RNAi-mediated suppression of RHO was initially evaluated in HeLa cells. siRNAs targeting RHO were co-transfected with a CMV promoter-driven wild type RHO. Transfections were carried out three times in quadruplicate using lipofectamine 2000 to aid transfections (Gibco-BRL). Real time RT-PCRs, performed on RNAs extracted from transfected cells 24 hours post-transfection, demonstrated up to 87% suppression (p<0.01,
Long Term Suppression of RHO in Retinal Explants
To provide long term RHO suppression, siBB and siQ1 were cloned as shRNAs into an EGFP expressing vector (shBB-EGFP and shQ1-EGFP,
Long Term Suppression Using AAV Vectors
Long-term expression of therapies will be required for a progressive retinopathy such as adRP. To achieve long-term suppression in vivo, shBB-EGFP and the non-targeting shNT-EGFP were engineered into AAV vectors (AAV-shBB-EGFP and AAV-shNT-EGFP) (
The EGFP gene enabled viral transduction to be monitored. Three μl of AAV-shBB-EGFP (2×1012 vp/ml) or AAV-shNT-EGFP (3×1012 vp/ml) were subretinally injected into adult NHR+/− rho−/− mice. Two weeks post-injection two animals were sacrificed and expression of the 21 nucleotide shBB shown in two retinas using RNase protection (
Suppression in Transgenic Animals
A transgenic mouse expressing a sequence-modified RHO gene was generated (RHO-M). RHO-M+/− rho−/− were evaluated at two months of age for rescue of the retinal pathology present in rho−/− mice by histology (
AAV-Delivered Suppression and Replacement of Human RHO In Vivo
Having established shBB and shQ1 as potent suppressors and rBB and rQ1 as being refractory to their corresponding suppressors, shBB-rBB and shQ1-rQ1 were cloned into AAV vectors using the triple plasmid system detailed above and viruses containing both elements of the therapeutics were generated (AAV-shBB-rBB (also termed AAV-BB8) and AAV-shQ1-rQ1 (also termed AAV-Q1)) using the method detailed above. Three μl of AAV-shBB-rBB was subretinally injected into adult wild type rho+/+ mice (n=12) and replacement RHO mRNA expression confirmed by RT-PCR and RNase protection using RNA extracted 10 days post-injection (data not shown). To demonstrate that AAV-delivered rBB is translated into protein, 2 μl of a 1:1 mix of AAV-shBB-rBB and AAV-CMV-EGFP was subretinally injected into 10 day old rho−/− mice (n=6). Two weeks post-injection rhodopsin and EGFP protein expression were determined using fluorescent microscopy. Marked rhodopsin expression, overlapping with EGFP, was observed in transduced areas (
Subsequently, 1 μl of AAV-shBB-rBB or AAV-shQ1-rQ1 was subretinally injected into newborn Pro23His+/− rho+/− mice (n=10) that present with a retinal degeneration resulting in complete loss of photoreceptors by two weeks of age. In all animals one eye was injected with therapeutic virus (either AAV-shBB-rBB or AAV-shQ1-rQ1) and the other with a control virus (AAV-EGFP). The early onset and rapid nature of the retinopathy in young Pro23His pups precluded use of ERG as a readout for benefit. However, at ten days of age retinal histology was evaluated in semi-thin resin embedded sections cut at approximately 50 μm intervals throughout the central meridian of the eye (n=10). From each section approximately 40 measurements of ONL thickness were taken. Since only a part of the retina is transduced by a single subretinal injection of AAV (particularly in newborn pups), to identify the transduced area ONL measurements were ordered by thickness and the 15% highest and lowest values grouped for analysis. Lowest values represent thinnest ONL readings, most likely corresponding to peripheral areas of the retina and thus not in close proximity to injection sites. Highest values represent thickest ONL readings, most likely corresponding to central areas of the retina and thus in closer proximity to injection sites. Significant differences in ONL thickness between AAV-shBB-rBB- and AAV-EGFP-treated eyes were observed. The ONL of treated eyes was found to be approximately 33% (p<0.001) thicker than control injected counterparts for the highest value groupings (
RNAi-mediated suppression was evaluated in retinal tissue after sub-retinal injection of AAV vectors expressing either a suppressor targeting rhodopsin (AAV-shBB-EGFP, AAV-shCC-EGFP and AAV-shQ1-EGFP) or a non-targeting control (AAV-shNT-EGFP). Mice expressing a human rhodopsin replacement gene (referred to as RHO-M mice and detailed in the section on suppression in transgenic animals) were subretinally injected with AAV vectors (AAV2/5), containing shRNA sequences for BB, CC and Q1 and an EGFP reporter gene (AAV-shBB-EGFP, AAV-shCC-EGFP and AAV-shQ1-EGFP). The presence of the EGFP reporter gene enabled isolation of the population of retinal cells that are EGFP positive and therefore have received AAV using FACS to isolate these cell populations. AAV-delivered RNAi-mediated suppression with each suppressor (BB, CC and Q1) was evaluated using real-time RT-PCR in cell populations characterised by FACS and was compared to suppression obtained using AAV with non-targeting control shRNA sequences (AAV-shNT-EGFP). Significant rhodopsin suppression was obtained with BB and Q1 suppressors, however, significantly lower levels of suppression were obtained with the CC suppressor (
Expression of suppression and/or replacement vectors was optimized by including in the vectors sequences that enhanced and/or modulate expression levels at the RNA and/or protein level. A list of exemplary sequence elements is provided in Table 1, however, the enhancing and/or modulating elements of the invention are not exclusive to this list. For example, one or more of a promoter, a stuffer, an insulator, a silencer, a chromatin remodelling sequence, an intron sequence, a poly adenylation signal, a post translational regulatory element, and a transcription factor binding site can be included in suppression and/or replacement constructs to modulate expression of suppression and/or replacement components relating to the invention. Such elements and derivatives thereof can be used to modulate levels of expression, tissue specificity, timing of expression, and/or induction of expression. Table 9 provides some exemplary sequences that can be used to modulate expression of suppression and/or replacement constructs relating to the invention. The sequences provided are within conserved regions as evaluated by comparison of sequences from multiple species. At any one position a nucleotide may not be conserved between all species the sequences represent regions where overall there is a high degree of conservation. Such conserved sequences from any species such as human, mouse, rat, bacteria, virus and/or indeed a hybrid sequence from more than one species could be used in the invention.
CCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCG
In addition to adding enhancing and/or modulating elements to suppression and/or replacement vectors, the rhodopsin promoter was studied in detail. A comparison of rhodopsin genes present in different mammals resulted in identification of 9 highly conserved regions in the rhodopsin gene (conserved regions A though I, Sequence 1, Table 10). Regions A, B, C and D are in the rhodopsin promoter region, conserved region E is in intron 2 of the gene and conserved regions F, G, H and I are in the 3′ region.
The following sequence (Sequence 1; Table 10) shows the conserved regions within the mouse promoter human intronic and exonic and 3′ sequence. Notably, conserved sequences in the mouse promoter are nearly the same in the human rhodopsin promoter and it is contemplated that the human or other mammalian rhodopsin promoters and/or derivatives and/or hybrids thereof may be used in suppression and replacement constructs. Additionally, it is contemplated that other promoters could be combined with some or all of conserved regions A though I and used in suppression and/or replacement constructs, for example, other retinal promoter sequences may be used.
TATGATCATG CATGCTCTCT CTCCCACTAA ACATTTATTA ATGTGTTAGG cons reg A
ATTTCCATTA GCGCGTGCCT TGAACTGAAA TCATTTGCAT ATGGCTGGGA
AAAAGTGGGG TGAGGGAGGA AACAGTGCCA GCTCCCCAAC AGGCGTCAAT
CACAGTGACA GATCAGATGG TTTCTGGCTG GAGGCAGGGG GGCTGTCTGA
TTCTGAGGCT TAAGAGCTAT TAGCGTAGGT GACTCAGTCC CTAATCCTCC
CTCCACCTTG ACCTCATTAA CGCTGGTCTT AATCACCAAG CCAAGCTCCT cons reg C
TAAACTGCTA GTGGCCAACT CCCAGGCCCT GACACACATA CCTGCCCTGT
cttagaagcc aattaggccc tcagtttctg cagcggggat taatatgatt atgaacaccc
ccaatctccc agatgctgat tcagccagga gcttaggagg gggaggtcac tttataaggg
tctggggggg tcagaaccca gagtcatcca gctggagccc tgagtggctg agctcaggcc
ttcgcagcat tcttgggtgg gagcagccac gggtcagcca caagggccac agccatgaat
agaatccaag acatcccaac ccttcacctt ggctgtgccc ctaatcctca actaagctag
gcgcaaattc caatcctctt tggtctagta ccccgggggc agccccctct aaccttgggc
ctcagcagca ggggaggcca caccttccta gtgcaggtgg ccatattgtg gccccttgga
cacagccatc ccaccaggag cagcgcctgt gcagaatgaa cgaagtcaca taggctcctt conserved region F
aatttttttt ttttttttaa gaaataatta atgaggctcc tcactcacct gggacagcct
gaaaagtgtc ccagcttagg gataagtgtc tagcacagaa tggggcacac agtaggtgct conserved region G
taataaatgc tggatggatg caggaaggaa tggaggaatg aatgggaagg gagaacatat
gaagccatgc tcacccgccc acatttaatt aacagctgag tccctgatgt catccttact conserved region H
ggtattaacg gtggtgggtt ttgttgcttt cacactctat ccacaggata gattgaaact conserved region I
gccagcttcc acctgatccc tgaccctggg atggctggat tgagcaatga gcagagccaa
gcagcacaga gtcccctggg gctagaggtg gaggaggcag tcctgggaat gggaaaaacc
ccaactttgg ggtcatagag gcacaggtaa cccataaaac tgcaaacaag ctt
Conserved regions A through I and some sequence flanking the regions (5′ and 3′, were combined (Table 11, SEQ ID NO: 92 through SEQ ID NO: 99, Sequence 2). This sequence was analyzed using MatInspector Release Professional 7.4.1 to identify other regions that may be involved in transcriptional and/or translational control of rhodopsin gene expression. (A small portion of the Matinspector results are presented in Table 12). This table illustrates some sequences within conserved regions A through I that are thought to be involved in the transcription and/or translation and/or stability of rhodopsin. Some of these sequences, such as the CRX binding element in conserved region D and the TATA box in region G are known in the art. Others, such as the CRX binding region in E, are not. The complete set of results from MatInspector are presented in Table 13. 302 putative transcription binding sites and/or regulatory sequences were identified and some are highlighted in bold. On the basis of the conserved nature of regions A though I and the important transcription factor binding sites thought to be located within these regions, the constructs in
TGCTGATTCAGCCAGGAGGTACC
All these constructs contain transcription binding sites identified within conserved regions A though I.
Sequence 2: Conserved regions A through I in the rhodopsin gene are highlighted in bold below. The nucleotides of these sequences and a small section of 5′ and 3′ sequence surrounding conserved regions have been numbered 1-1600. This sequence was analysed with MatInspector and the nucleotide numbering system of sequence 2 (1-1600) relates to the nucleotide numbering system in Table 13.
CATGCTCTCT CTCCCACTAA ACATTTATTA ATGTGTTAGG
ATTTCCATTA GCGCGTGCCT TGAACTGAAA TCATTTGCAT
ATGGCTGGGA AAAAGTGGGG TGAGGGAGGA AACAGTGCCA
GCTCCCCAAC AGGCGTCAAT CACAGTGACA GATCAGATGG
TTCTGAGGCT TAAGAGCTAT TAGCGTAGGT GACTCAGTCC
CTAATCCTCC ATTCAATGCC 310
ACCTCATTAA CGCTGGTCTT AATCACCAAG CCAAGCTCCT
TAAACTGCTA GTGGCCAACT 410
taatatgatt atgaacaccc ccaatctccc agatgctgat tcagccagga gcttaggagg gggaggtcac
tttataaggg tctggggggg tcagaaccca gagtcatcca gctggagccc tgagtggctg agctcaggcc
ttcgcagcat tcttgggtgg gagcagccac gggtcagcca caagggccac agccatgaat ggcacagaag
actaagctag gcgcaaattc caatcctctt tggtctagta ccccgggggc agccccctct aaccttgggc
ctcagcagca ggggaggcca 850
tagcacagaa tggggcacac agtaggtgct taataaatgc tggatggatg caggaaggaa tggaggaatg
catccttact cgaagagctt agaaacaaag agtgggaaat 1330
ggtattaacg gtggtgggtt ttgttgcttt cacactctat ccacaggata gattgaaact gccagcttcc
acctgatccc tgaccctggg atggctggat tgagcaatga gcagagccaa gcagcacaga gtcccctggg
gctagaggtg gaggaggcag tcctgggaat gggaaaaacc ccaactttgg ggtcatagag 1600
Drosophila)
Drosophila)
Drosophila)
Drosophila)
Xenopus
Xenopus
Utilising the data from Examples 2 and 3, a suite of constructs are generated containing various shRNA suppressors and/or replacement rhodopsin nucleic acids enhanced with additional promoter sequences, known to be conserved between vertebrate species and various sequences known to enhance expression at RNA and/or protein levels.
Suppression and/or replacement constructs (
Further evaluation of suppression and replacement vectors was undertaken.
To explore efficacy of the suppression component of the suppression and replacement approach delivered using AAV, a variety of suppression only vectors were generated with an EGFP reporter gene (see
Adult RHO-347 transgenic mice carrying a dominant RHO mutation causing retinal degeneration akin to human RP, were subretinally injected with 2 ul of 2×1012 particle/ml of AAV-shNT (A) or AAV-shQ1 (B) vectors (
In addition,
As described, enhancer elements, conserved regions A through I and/or transcription factor binding sites and/or other regulatory elements and/or epigenetic elements may be combined to improve expression of replacement constructs (see
As described above, there is evidence from the prior art that neurotrophic/neuroprotective factors can improve cell viability and or cell functioning, the sequences encoding a number of these factors are provided in
AAV vectors generated to contain suppression, replacement and neurotrophic/neuroprotection components can be subretinally injected into wild type mice and or into mice with inherited retinal degenerations such as the RHO-347 and Pro23His mice described in the Examples above.
The contents of all cited references (including literature references, patents, patent applications, and websites) that maybe cited throughout this application are hereby expressly incorporated by reference. The practice of the present invention will employ, unless otherwise indicated, conventional techniques of molecular biology, which are well known in the art.
The invention may be embodied in other specific forms without departing from the spirit or essential characteristics thereof. The foregoing embodiments are therefore to be considered in all respects illustrative rather than limiting of the invention described herein. Scope of the invention is thus indicated by the appended claims rather than by the foregoing description, and all changes that come within the meaning and range of equivalency of the claims are therefore intended to be embraced herein.
This application is a 371 National Phase Entry Application of International Application No. PCT/GB2008/001310 filed Apr. 14, 2008, which designated the U.S., and which claims the benefit of priority under 35 U.S.C. §119(e) of U.S. Provisional No. 60/923,067 filed Apr. 12, 2007, the contents of which are incorporated herein by reference.
| Filing Document | Filing Date | Country | Kind | 371c Date |
|---|---|---|---|---|
| PCT/GB2008/001310 | 4/14/2008 | WO | 00 | 3/3/2010 |
| Publishing Document | Publishing Date | Country | Kind |
|---|---|---|---|
| WO2008/125846 | 10/23/2008 | WO | A |
| Number | Name | Date | Kind |
|---|---|---|---|
| 4748119 | Rich et al. | May 1988 | A |
| 6225291 | Lewin et al. | May 2001 | B1 |
| 7090864 | Pardridge | Aug 2006 | B2 |
| 20030097670 | Palczewski et al. | May 2003 | A1 |
| Number | Date | Country |
|---|---|---|
| WO 0024359 | May 2002 | WO |
| 2004020631 | Mar 2004 | WO |
| 2004022782 | Mar 2004 | WO |
| Number | Date | Country | |
|---|---|---|---|
| 20100190841 A1 | Jul 2010 | US |
| Number | Date | Country | |
|---|---|---|---|
| 60923067 | Apr 2007 | US |