Patent Application
20190309272
Breast cancer is the most common cancer diagnosed among women and the second leading cause of cancer death for women in the United States. Due to genetic variation in cancer cells, about 36.1% of breast cancers acquire a loss of function mutation to the tumor suppressor gene, TP53, yet few therapies have been developed for targeting the absence of TP53.
Assaying new therapies commonly uses a cell line, such as the MCF7 breast cancer cell line, to determine drug efficacy in vitro before moving to animal or human studies. Though advancements in genetic editing such as CRISPR-Cas9 can allow for accurate and precise engineering of genomic DNA, no known studies have focused on genetically modifying a cancer cell line to modify the TP53 gene for use in assaying new therapies.
The present disclosure is directed to genetically engineered cell lines which include a modification to knockout a portion of the TP53 gene. Embodiments disclosed herein provide aspects of the knockout cell line, methods for producing the knockout cell line, in vitro assays using the knockout cell line, and kits including the knockout cell line. In certain implementations, the embodiments can provide doctors and patients improved tools for determining a treatment or for comparing treatments for patients having tumors that include a TP53 mutation.
An example embodiment of the disclosure includes a knockout cell line composed of MCF7 breast cancer cells having decreased endogenous expression of at least one coding region in the tumor protein 53 (TP53) gene having a nucleotide sequence corresponding to Seq. ID No. 1. Generally, the cells of the knockout cell line include a genetic modification to remove or delete a portion of the TP53 gene which results in decreased endogenous expression of the at least one coding region.
In certain embodiments, the portion of the TP53 gene can includes one or more exons that encode a portion of the messenger RNA (mRNA) for producing the TP53 protein. Each of these exons includes a nucleotide sequence corresponding to continuous sequence of base pairs from Seq. ID No. 1 as shown in Table 2. Thus, the coding regions can include one or more of exons 1-11.
In some embodiments, the coding region of the TP53 gene can include part of one exon. For example, an embodiment of the disclosure can include a knockout cell line where each cell includes a modification to delete part of one exon from Seq. ID No. 1. As an example implementation, a knockout cell line of the disclosure can include removing at least part of exon 4 including the sequence: GGACGATATT GAACAATGGT TCACTGAAGA CCCAGGTCCA GATGAAGCTC CCAGAATGCC AGAGGCTGCT CCCCCCGTGG CCCCTGCACC AGCAGCTCCT ACACCGGCGG CCCCTGCACC AGCCCCCTCC TGGCCCCTGT CATCTTCTGT CCCTTCCCAG AAAACCTACC AGGGCAGCTA CGGTTTCC.
As used herein, each of exons on 1-11 include a nucleotide sequence from Seq. ID No. 1 that corresponds to a range of base numbers for each exon. For example, the nucleotide sequence for exon 1 comprises base numbers 1-162; the nucleotide sequence for exon 2 comprises base numbers 10917-11018; the nucleotide sequence for exon 3 comprises base numbers 11136-11157; the nucleotide sequence for exon 4 comprises base numbers 11267-11545; the nucleotide sequence for exon 5 comprises base numbers 12303-12486; the nucleotide sequence for exon 6 comprises base numbers 12568-12680; the nucleotide sequence for exon 7 comprises base numbers 13249-13358; the nucleotide sequence for exon 8 comprises base numbers 13702-13838; the nucleotide sequence for exon 9 comprises base numbers 13931-14004; the nucleotide sequence for exon 10 comprises base numbers 16824-16930; and the nucleotide sequence for exon 11 comprises base numbers 17849-19137.
An example embodiment of the disclosure can include a knockout cell line of MCF7 breast cancer cells that include a deletion of the nucleotide sequence for exon 4 from Seq. ID No. 1, the nucleotide sequence for exon 4 including: TCCC CCTTGCCGTC CCAAGCAATG GATGATTTGA TGCTGTCCCC GGACGATATT GAACAATGGT TCACTGAAGA CCCAGGTCCA GATGAAGCTC CCAGAATGCC AGAGGCTGCT CCCCCCGTGG CCCCTGCACC AGCAGCTCCT ACACCGGCGG CCCCTGCACC AGCCCCCTCC TGGCCCCTGT CATCTTCTGT CCCTTCCCAG AAAACCTACC AGGGCAGCTA CGGTTTCCGT CTGGGCTTCT TGCATTCTGG GACAGCCAAG TCTGTGACTT GCACG.
Another example embodiment of the disclosure includes a knockout cell line of MCF7 breast cancer cells that include a deletion of the nucleotide sequence for exon 10, the nucleotide sequence for exon 10 including: ATCCGTG GGCGTGAGCG CTTCGAGATG TTCCGAGAGC TGAATGAGGC CTTGGAACTC AAGGATGCCC AGGCTGGGAA GGAGCCAGGG GGGAGCAGGG CTCACTCCAG.
An embodiment of the disclosure can also include an in vitro assay for determining the efficacy of a treatment in breast cancer cells that include a TP53 gene mutation. In an example implementation, the method can include: providing the treatment to a group of cells derived from a knockout cell as exemplified in certain embodiments of the disclosure and measuring a result. In certain implementations of the invitro assay, measuring the result can include determining a quantitative measure of cell death. Alternatively or additionally, in some implementations providing the treatment can include administering a drug to the plurality of cells derived from the knockout cell line. Non-limiting examples of the drug can include one or more of the compounds listed in Table 2. Further, in certain implementations administering the drug can include administering: Nutlin3, Fluorouracil, Palbociclib, or combinations thereof.
In an example embodiment of the in vitro assay, determining the efficacy of the treatment can also include providing the treatment to a group of wild type MCF7 breast cancer cells and comparing the treatment between the wild type MCF7 breast cancer cells and the cells derived from the knock-out cell line. As an example implementation, comparing the treatment between the wild type MCF7 breast cancer cells and the cells derived from the knock-out cell line can include: determining a first quantitative measurement describing the number of live wild type MCF7 breast cancer cells included in the group of wild type MCF7 breast cancer cells to which the treatment was provided; determining a second quantitative measurement describing the number of live cells included in the plurality of cells derived from the knockout cell line to which the treatment was provided.
Another embodiment of the disclosure includes a method for producing a knockout cell line from a wild type cell line. In an example embodiment, the method can include deleting a portion of the TP53 gene in a cell derived from the wild type cell line by delivering a guide RNA to the cell. Generally, the portion of the TP53 gene may include the nucleotide sequence of one or more of exons 1-11, as shown in Table 2. As an example implementation, the wild type cell line can include human MCF7 breast cancer cells and the portion of the TP53 gene can include the nucleotide sequence for exon 4.
In certain embodiments, delivering the guide RNA to the cell can include delivering an expression cassette to the cell, wherein the expression cassette includes a DNA sequence for expressing the guide RNA. In some embodiments, delivering the guide RNA to the cell further includes delivering a second expression cassette to the cell, the second expression cassette includes a DNA sequence for expressing Cas9. Without being limited to delivering the guide RNA using an expression cassette, a method for producing a knockout cell line from a wild type cell line can include providing one or more guide RNAs to the wild type cell line, the guide RNAs having the nucleotide sequences: CCATTGTTCAATATCGTCCG, GACGGAAACCGTAGCTGCCC, and TGGTTATAGGATTCAACCGG.
A full and enabling disclosure of the present invention, including the best mode thereof to one skilled in the art, is set forth more particularly in the remainder of the specification, which includes reference to the accompanying figures, in which:
Repeat use of reference characters in the present specification and drawings is intended to represent the same or analogous features or elements of the present invention.
Reference now will be made to embodiments of the invention, one or more examples of which are set forth below. Each example is provided by way of an explanation of the invention, not as a limitation of the invention. In fact, it will be apparent to those skilled in the art that various modifications and variations can be made in the invention without departing from the scope or spirit of the invention. For instance, features illustrated or described as one embodiment can be used on another embodiment to yield still a further embodiment. Thus, it is intended that the present invention cover such modifications and variations as come within the scope of the appended claims and their equivalents. It is to be understood by one of ordinary skill in the art that the present discussion is a description of exemplary embodiments only and is not intended as limiting the broader aspects of the present invention, which broader aspects are embodied exemplary constructions.
The present disclosure is directed to genetically engineered cell lines which include a modification to knockout a portion of the TP53 gene. Embodiments disclosed herein provide aspects of the knockout cell line, methods for producing the knockout cell line, in vitro assays using the knockout cell line, and kits including the knockout cell line. In certain implementations, the embodiments can provide doctors and patients improved tools for determining a treatment or for comparing treatments for patients having tumors that include a TP53 mutation.
An example embodiment of the disclosure can include a knockout cell line composed of MCF7 breast cancer cells having decreased endogenous expression of at least one coding region in the TP53 gene. Generally, the cells of the knockout cell line include a genetic modification to remove or delete a portion of the TP53 gene which results in decreased endogenous expression.
In embodiments of the disclosure, the at least one coding region can include one or more of exons 4-10 in the TP53 gene. In some embodiments, the at least one coding region can include exon 4. In certain embodiments, the at least one coding region can include exon 4 and exon 5. In some embodiments, the at least one coding region can include all of exons 4-10.
For embodiments of the disclosure, the genetic modification can be applied to a native cell line (i.e., wild type). In an example implementation, the native cell line can include human MCF7 breast cancer cells, and an example embodiment can include a genetically modified MCF7 cell line having a genetic modification to remove or delete a portion of the TP53 gene. In another example implementation, the native cell line can include 600MPE, AU565, and/or BT-483. Generally, any cell line including a native TP53 gene can be genetically modified to produce a knockout cell line.
Several non-limiting examples of knockout cell lines disclosed herein include: an MCF7 cell line that includes a deletion of one or more of exons 4-10 of the TP53 gene; an AU565 cell line that includes a deletion of one or more of exons 4-5 of the TP53 gene; and a BT-483 cell line that includes a deletion of one or more exons 6-10 of the TP53 gene. These examples are provided for illustrative purposes to demonstrate how combinations of cell lines and genetic modifications may be produced using this disclosure.
Another example embodiment of the disclosure can include an in vitro assay for determining the efficacy of a treatment in cancer cells that include a TP53 gene mutation. In an example embodiment, the assay can include providing the treatment to a group of cells from a knockout cell line containing a TP53 gene mutation. In an implementation, the group of cells can be derived from any of the knockout cell lines disclosed herein (e.g., a MCF7 breast cancer cell having decreased endogenous expression of at least one coding region in the TP53 gene). During and/or after providing the treatment, the in vitro assay can further include measuring a result. In certain embodiments, measuring the result can include determining a quantitative measure of cell death (e.g., H&E staining). In some embodiments, the in vitro assay can also include providing the treatment to a group of cells from the native cell line (e.g., the MCF7 cell line). In these embodiments, the in vitro assay can also include comparing the treatment to the group of cells from the native cell line. As an example implementation, comparing the treatment to the cells from the native cell line can include determining a first quantitative measurement describing or approximating the number of live cells from the native cell line to which the treatment was provided, and determining a second quantitative measurement describing or approximating the number of live cells from the knockout cell line to which the treatment was provided. In some implementations, the first quantitative measurement and the second quantitative measurement can include a statistic, the statistic indicating if the first quantitative measurement is significantly different (e.g., higher or lower) compared to the second quantitative measurement.
For embodiments of the disclosure that include an in vitro assay, providing the treatment can include administering a drug to a group of cells from the knockout cell line. Generally, any drug can be used. Table 2 includes a list of example drugs; however, it should be understood that the list in Table 2 is not intended to be limiting and other drugs, both known and undiscovered, may be used in embodiments of the disclosure. Additionally, administering the drug can include administering one or more drugs, for example administering one or more of the drugs: Nutlin3, Fluorouracil, and Palbociclib.
A further embodiment can include a kit for assessing a treatment for a patient diagnosed with breast cancer. In an implementation, the kit can include an assay including a well-plate containing cells from a native cell line and knockout cells from a knockout cell line (the knockout cell line formed by deleting or inactivating a portion of the TP53 gene in the native cell line). In an example implementation, the cells from a native cell line can include MCF7 breast cancer cells and knockout cells can include cells derived from a knockout MCF7 cell line (including a genetic modification to one or more of exons 4-10 of the TP53 gene.) The kit can further include an indicator for measuring cell viability. In an example embodiment, the indicator can display a change in appearance (e.g., producing a color) when in contact with dead cells. Additionally, the change in appearance may be quantitative such that the intensity of the change in appearance can be related to the number of dead cells. The kit can also include the treatment (e.g., one or more drugs). In an implementation, the treatment can include Nutlin3, Fluorouracil, and Palbociclib
An additional embodiment of the disclosure includes a method for producing a knockout cell line from a native cell line, the method including deleting a portion of the TP53 gene in the native cell line. Generally, deleting a portion of the TP53 gene includes delivering a guide RNA to the native cell line and selecting for cells including the genetic modification. Example native cell lines may include: MCF7, 600MPE, AU565, and/or BT-483. Additionally, the portion of the TP53 gene can include at least one of exons 4-10.
In some implementations, delivering the guide RNA to the cell can include delivering an expression cassette to the cell, the expression cassette including a DNA sequence for expressing the guide RNA. In certain implementations, delivering the guide RNA to the cell can also include delivering a second expression cassette, including a DNA sequence expression Cas9. Several example guide RNAs for targeting the TP53 gene can include the sequences: CATTGTTCAATATCGTCCG, GACGGAAACCGTAGCTGCCC, and TGGTTATAGGATTCAACCGG.
To determine cells that have incorporated the genetic modification, a selection can be performed in some embodiments. In an example implementation, selecting for the genetically modified cell can include culturing the cells to which the guide RNA has been delivered in the presence of an agent. Exemplary agents can include any drugs to which cells derived from the native cell line are more sensitive compared to knockout cells, including a genetic modification to the TP53 gene. For example, a method for producing a TP53 knockout from the MCF7 cell line can include delivering a guide RNA to a group of cells derived from the native cell line and selecting for genetically modified cells by culturing the group of cells in the presence of Nutlin3.
Embodiments of the disclosure and examples described herein may be better understood with reference to the Sequence Listing filed with this disclosure. The Sequence Listing includes Seq ID No. 1, providing a nucleotide sequence for the TP53 gene for a Homo sapiens. Information regarding the sequence may be found from the NCBI database using the gene ID: ENSG00000141510 and transcript ID: ENST00000269305. The sequence listing also includes Seq ID No. 2 which provides an example knockout genetic sequence as observed in KO 5.6 examples. The sequence listing also includes Seq. ID No. 3 which provides an example knockout genetic sequence as observed in KO 3.4 examples.
Example 1 discusses various methods and provides exemplary embodiments that may be understood in conjunction with the Drawings and Description provided herein. The materials and conditions described in the example are demonstrative and are not meant to constrain the scope of the disclosure only to the materials and conditions used.
Human MCF7 breast adenocarcinoma cells (ATCC HTB-22) and their derivatives were maintained at 37° C., 5% CO2 in DMEM (Gibco, Cat. No. 11995-065) with 100 ug/mL penicillin & 100 ug/mL streptomycin (Sigma, Cat. No. P4333), 10% FBS, 50 mM Sodium pyruvate (Sigma, Cat. No. S8636), 1% GlutaMAX (ThermoFisher, Cat. No. 35050061), and 10 ug/mL insulin. MCF7 cells were passaged every 4 to 7 days to maintain sub-confluence. All cell lines were maintained in culture for a maximum of 30 passages.
Genetic Sequence TP53
The genetic sequence used for the TP53 gene is provided below using 1 letter base convention to represent the individual nucleotides (i.e., adenosine, A; guanosine, G; Cytidine, C; and thymidine, T.) The first nucleotide, base number 1, is G and the subsequent nucleotides increment by 1 base number thereon. The number appearing on the left margin represents the base number of the first nucleotide on the line. Additionally, the sequence is from a Homo sapiens (human.)
Exon 1 includes Seq. ID No. 1 base numbers: 1-162.
Exon 2 includes Seq. ID No. 1, base numbers: 10917-11018.
Exon 3 includes Seq. ID No. 1, base numbers: 11136-11157.
Exon 4 includes Seq. ID No. 1, base numbers: 11267-11545.
Exon 5 includes Seq. ID No. 1, base numbers: 12303-12486.
Exon 6 includes Seq. ID No. 1, base numbers: 12568-12680.
Exon 7 includes Seq. ID No. 1, base numbers: 13249-13358.
Exon 8 includes Seq. ID No. 1, base numbers: 13702-13838.
Exon 9 includes Seq. ID No. 1, base numbers: 13931-14004.
Exon 10 includes Seq. ID No. 1, base numbers: 16824-16930.
Exon 11 includes Seq. ID No. 1, base numbers: 17849-19137.
Table 1 includes the nucleotide sequences for Exons 1-11, which uses the base numbers with reference to Seq. ID No. 1 to determine the individual sequences.
TP53 Knock Out in MCF7 Cells with CRISPR Cas9
TP53 knockout MCF7 cells were generated as previously published [1]. Human codon-optimized Streptococcus pyogenes wild type Cas9 (Cas9-2A-GFP) was obtained by Addgene (Cat. No. 44719). Chimeric guide RNA expression cassettes with different sgRNAs (sgRNA1: CCATTGTTCAATATCGTCCG; sgRNA2: GACGGAAACCGTAGCTGCCC; sgRNA3: TGGTTATAGGATTCAACCGG) were ordered as gBlocks. These gBlocks were amplified by PCR using primers: gBlock_Amplifying_F: 5′-GTACAAAAAAGCAGGCTTTAAAGG-3′ and gBlock_Amplifying R: 5′-TAATGCCAACTTTGTACAAGAAAGC-3′. The PCR product was purified by Agencourt Ampure XP PCR Purification beads per the manufacturer's protocol (Beckman Coulter). One microgram of Cas9 plasmid and 0.3 μg of each gRNA gBlock (pair 1: sgRNA1 & sgRNA2; pair 2: sgRNA1 & sgRNA3) were cotransfected into MCF7 cells via Lipofectamine 3000 in a 6-well plate. Knockout cells created using the pair sgRNA1 & sgRNA2 were named KO5.6, and knockout cells created using the pair sgRNA1 & sgnRNA3 were named KO3.4. Knockout pools were cultured in 10 μM Nutlin-3a (SelleckChem) for 2 months, changing nutlin-3a treated media every 3 days and passaging cells every 6 to 8 days. Isogenic clones were isolated from the knockout and wild type pools via limiting dilution in a 96-well plate and incubated at 37° C. in a CO2 incubator for 15 days. Wild type clones were named Parental (PR).
DNA was isolated from each MCF7 wild type pool, knockout pool, and single cell clone following the Agencourt DNAdvance genomic DNA isolation kit. MCF7 wild type and KO5.6 cells were PCR amplified using primers: TP53_exon_4_F: 5′-CTGGTAAGGACAAGGGTTGG-3′ and TP53_exon_4_R: 5′-GCCAAAGGGTGAAGAGGAAT-3′. MCF7 KO3.4 cells were PCR amplified using primers: TP53_exon_4_F and TP53_Woke_R: 5′-ATTAGGCCCCTCCTTGAGAC-3′. Products were sent to Eton Bioscience Inc. who purified the PCR products and performed Sanger Sequencing.
Protein was extracted from cells using 2-Mercaptoethanol and Laemmli sample buffer (Bio Rad, Cat. No. 1610737). MCF7 wild type and knockout derivative proteins (10 μg) were separated on 4-12% gradient polyacrylamide gels via SDS-PAGE and transferred to PVDF membranes (Millipore). Primary antibody dilutions were 1:300 for TP53 and 1:500 for β-actin. Drug Screening
MCF7 wild type and knockout derivative pools were plated at a density of 5000 cells/well in polystyrene, flat-bottom 96-well plates. All 133 compounds from the NCI Approved oncology drugs set IV (Table 2, AOD-IV Drug) were dissolved in DMF or DMSO at 10 mM stocks. Cells were treated at concentrations from 156.25 nM to 10 μM for 10 days. DMSO or DMF vehicle was used as a negative control. After 10 days, resazurin (Sigma, Cat. No. R7017) was added to each well and incubated at 37° C. in a dark CO2 incubator for 4 to 6 hours. A microplate reader took optical measurements (ex: 535 nm/em: 585 nm). Drugs showing larger Area under the curve (AUC) differences based on fluorescence values between MCF7 TP53 wild type and knockout cell lines were selected and further characterized, notably: oxaliplatin, 5-fluorouracil, and palbociclib.
While certain embodiments of the disclosed subject matter have been described using specific terms, such description is for illustrative purposes only, and it is to be understood that changes and variations may be made without departing from the spirit or scope of the subject matter.
These and other modifications and variations to the present invention may be practiced by those of ordinary skill in the art, without departing from the spirit and scope of the present invention, which is more particularly set forth in the appended claims. In addition, it should be understood the aspects of the various embodiments may be interchanged both in whole or in part. Furthermore, those of ordinary skill in the art will appreciate that the foregoing description is by way of example only and is not intended to limit the invention further described in the appended claims.
This application claims filing benefit of U.S. Provisional Application Ser. No. 62/654,799, having a filing date of Apr. 9, 2018, which is incorporated herein by reference in its entirety.
This invention was made with Government support under Contract No. U01 CA158428, awarded by the National Institutes of Health (NIH). The Government has certain rights in the invention.
| Number | Date | Country | |
|---|---|---|---|
| 62654799 | Apr 2018 | US |
