Sequence Listing associated with this application is provided in text format in lieu of a paper copy and is hereby incorporated by reference into the specification. The name of the text file containing the Sequence Listing is HRVY_203_101_seqlist.txt. The text file is 56.7 KB, was created on Aug. 15, 2022, and is being submitted electronically via EFS-Web, concurrent with the filing of the specification.
Adeno-associated viruses (AAVs) are small, non-enveloped single-stranded DNA viruses discovered in 1960s as contaminants of adenovirus preps1,2. They induce limited host response and are not associated with any known disease, yet were found to be highly efficient at delivering DNA cargo to many tissues in multiple animal species3. AAVs are thus widely used as a gene transfer tool in basic research and in translational and clinical gene therapy4. Their increased use has increased demand on AAV manufacturing both in terms of the quality of the preparation and the quantity of the material.
Currently, for research and for some clinical purposes, AAV purification often relies on an ultracentrifugation step on an iodixanol or cesium chloride gradient5,6. This process is appealing for two reasons; one, it is serotype agnostic and little process optimization is needed for the various AAV products researchers seek to purify, and second, it remains one of the more efficient methods of separation of genome-containing (or ‘full’) capsids from empty or partially filled capsids. The process step however is difficult to scale, requires precise manual handling and may co-purify any contaminants that have the same sedimentation co-efficient as AAV7.
Liquid chromatography provides a more scalable, less laborious, and possibly more efficient purification method, particularly under high-performance liquid chromatography (HPLC) conditions as has been shown for the purification of proteins and small molecules8. For AAV, several chromatographic methods have been developed, most using AVB Sepharose affinity, cation exchange or anion exchange chromatography9-12. While these methods demonstrate the feasibility and efficiency of chromatographic purification of AAV, they also require substantial serotype-specific optimization and are thus not optimal for purification in a research setting, where many different serotypes need to be purified for different applications.
Recently, several AAV-binding resins have been commercially released, including AVB Sepharose High Performance (GE Healthcare) and POROS CaptureSelect AAV8, AAV9 and AAVX (Thermo Scientific). In the case of AVB, it was recently shown that affinity chromatography using AVB resin can efficiently purify AAV1, AAV2, AAV5, AAV6 and rh10 but requires serotype-specific optimization and fails to purify multiple other serotypes, including the broadly used AAV8 and AAV9 serotypes12,13. POROS CaptureSelect AAV8 and AAV9 resins bind and are recommended for purification of AAV8 and AAV9 respectively, but they are not compatible with other serotypes (POROS CaptureSelect product datasheet)10,12. POROS Captureselect AAVX is a resin consisting of a rigid 50 μm diameter crosslinked poly[styrene divinylbenzene] bead backbone, coated with cross-linked polyhydroxylated polymer, and linked to a camelid heavy-chain-only single-domain antibody fragment. The camelid antibody was raised against a conserved region of the AAV capsid, and the AAVX resin is marketed as a pan-AAV affinity resin capable of binding multiple different AAV serotypes (POROS CaptureSelect product datasheet)10. Nonetheless, there is still a need to develop a new single optimized process for highly efficient purification of a panel of highly divergent AAVs, including new engineered AAVs, which demonstrates an overall purification efficiency higher than other described methods, while still being simple to execute, low-cost, and minimally laborious.
The adeno-associated viral vector (AAV) provides a safe and efficient gene therapy platform with a number of approved products with marked therapeutic impact for patients. However, a major bottleneck in its development and commercialization remains the efficiency, cost, and scalability of AAV production. Chromatographic methods have the potential to allow purification at increased scales and lower cost but often require optimization specific to each serotype. It was recently discovered that by combining multiple innovations into a single optimized chromatography purification process, a panel of highly divergent AAVs could be purified with an overall efficiency higher than other described methods. Furthermore, AAVs purified utilizing this highly efficient, optimized chromatography purification process resulted in purified AAVs which demonstrate similar in vitro and in vivo bioactivity to AAVs purified using ultracentrifugation-based processes.
Disclosed herein, are methods of high efficiency purification of adeno-associated virus (AAV) particles comprising the steps of a) providing a cell lysate that comprises one or more AAV particles; b) contacting the cell lysate comprising the one or more AAV particles with a volume of chromatography resin medium comprising at least one ligand possessing a pan-AAV affinity, wherein said contacting induces binding of the one or more AAV particles to the chromatography resin medium and wherein the contacting is performed at a temperature of between approximately 20° C. to approximately 28° C. and/or both the cell lysate and the chromatography resin medium are allowed to come to a temperature between approximately 20° C. to approximately 28° C. previous to said contacting; and c) eluting the bound one or more AAV particles from the chromatography resin medium using a volume of an acidic elution buffer solution to provide one or more eluted volume fractions containing the one or more AAV particles; whereby purified AAV particles are obtained with an overall efficiency of at least 65% regardless of the serotype of the AAV purified, wherein the purity, yield and bioactivity of the AAV particles purified thereby are comparable to the purity, yield and bioactivity of iodixanol purified AAV particles, and wherein the method does not require modifications contingent on the AAV serotype being purified to obtain said efficiency.
In some embodiments, the contacting is performed at a temperature of between approximately 22° C. to 26° C. In some embodiments, the contacting is performed at a temperature of approximately 24° C. or approximately 21° C.
In some embodiments, both the cell lysate and the chromatography resin medium are allowed to come to a temperature between approximately 22° C. to approximately 26° C. prior to the contacting step. In some embodiments, both the cell lysate and the chromatography resin medium are allowed to come to a temperature of approximately 24° C. or approximately 21° prior to the contacting steps.
In some embodiments, the contacting is performed at a temperature of between approximately 22° C. to approximately 26° C. and both the cell lysate and the chromatography resin medium are allowed to come to a temperature between approximately 22° C. to approximately 26° C. prior to the contacting step. In some embodiments, the contacting is performed at a temperature of approximately 24° C. or approximately 21° C. and both the cell lysate and the chromatography resin medium are allowed to come to a temperature of approximately 24° C. or approximately 21° C. prior to the contacting step.
Also disclosed herein are methods of high efficiency purification of adeno-associated virus (AAV) particles comprising the steps of a) providing a cell lysate that comprises one or more AAV particles; b) contacting the cell lysate comprising the one or more AAV particles with a volume of chromatography resin medium comprising at least one ligand possessing a pan-AAV affinity, wherein said contacting induces binding of the one or more AAV particles to the chromatography resin medium; and c) eluting the bound one or more AAV particles from the chromatography resin medium using a volume of an acidic elution buffer solution to provide one or more eluted volume fractions containing the one or more AAV particles; whereby purified AAV particles are obtained with an overall efficiency of at least 65% regardless of the serotype of the AAV purified, wherein at least one of the method steps is carried out in the presence of a nonionic surfactant, wherein the purity, yield and bioactivity of the AAV particles purified thereby are comparable to the purity, yield and bioactivity of iodixanol purified AAV particles, wherein the method does not require modifications contingent on the AAV serotype being purified to obtain said efficiency.
In some embodiments, two or more steps of the method are carried out in the presence of the non-ionic surfactant. In other embodiments, at least three steps of the method are carried out in the presence of the non-ionic surfactant. In some embodiments, the non-ionic surfactant is a tri-block poly(ethylene oxide) (PEO)-poly(propylene oxide) (PPO)— poly(ethylene oxide) (PEO) copolymer. In some embodiments, the non-ionic surfactant is PLURONIC F-68.
Also disclosed herein are methods of high efficiency purification of adeno-associated virus (AAV) particles comprising the steps of a) providing a cell lysate that comprises one or more AAV particles; b) contacting the cell lysate comprising the one or more AAV particles with a volume of chromatography resin medium comprising at least one ligand possessing a pan-AAV affinity, wherein said contacting induces binding of the one or more AAV particles to the chromatography resin medium; c) eluting the bound one or more AAV particles from the chromatography resin medium using a volume of an acidic elution buffer solution to provide one or more eluted volume fractions containing the one or more AAV particles; and d) regenerating the chromatography resin medium comprising the at least one ligand possessing a pan-AAV affinity by contacting the medium with at least one acidic component, wherein contact with the at least one acidic component is carried out for a predetermined amount of time, whereby purified AAV particles are obtained with an overall efficiency of at least 65% regardless of the serotype of the AAV purified, wherein the purity, yield and bioactivity of the AAV particles purified thereby are comparable to the purity, yield and bioactivity of iodixanol purified AAV particles, and wherein the method does not require modifications contingent on the AAV serotype being purified to obtain said efficiency.
In some embodiments, the at least one acidic component comprises phosphoric acid and/or guanidine HCL. In some embodiments, the at least one acidic component comprises two acidic components which are each contacted with the chromatography resin concurrently or sequentially, and wherein the contact with each of the two acidic components is carried out for predetermined amounts of time. In some embodiments, the predetermined amount of time is 30 seconds to 24 hours, 1 minute to 12 hours, 5 minutes to 4 hours, 10 minutes to 1 hour, or 15 minutes to 30 minutes.
In some embodiments, each predetermined amount of time is at least 15 minutes. In some embodiments, the regeneration step is carried out by contacting the chromatography resin medium with 0.1M phosphoric acid for at least 15 minutes, followed or preceded by contacting the chromatography resin medium with 6M guanidine for at least 15 minutes. In some embodiments, the step of regeneration of the chromatography resin medium is performed a second time, a third time, a fourth time, a fifth time, a sixth time, a seventh time, an eighth time, a ninth time or ten or more times.
In some embodiments, the method comprises at least one repetition of steps a) through c). In some embodiments, the completion or repetition of the step of regeneration of the chromatography resin medium results in one or both of i) sustaining high efficiency purification during subsequent repetitions of steps a) through c) and ii) eliminating carry over contamination between repetitions of steps a) through c).
In some embodiments, the one or more AAV particles subjected to purification is selected from one or more AAV serotypes from the group consisting of AAV1, AAV2, AAV2-7m8, AAV-HSPG, AAV3, AAV4, AAV5, AAV6, AAV6.2, AAV7, AAV8, AAV9, Rh10, Rh61, Rh8, Rh32.33, VR-865, PHP.B and Anc80.
In some embodiments, the volume of acidic elution buffer solution comprises glycine, phosphoric acid or citric acid. In some embodiments, the volume of acidic elution buffer solution comprises glycine. In some embodiments, the pH of the acidic elution buffer solution is approximately 3.0 or less. In some embodiments, the pH of the acidic elution buffer solution is between about 2 to about 2.5.
In some embodiments, the chromatography resin medium comprising a ligand possessing a pan-AAV affinity comprises a cross-linked poly(styrene-divinylbenzene) bead coated with a cross-linked polyhydroxylated polymer. In some embodiments, the chromatography resin medium is linked to a ligand which comprises a camelid heavy-chain-only single domain antibody fragment. In some embodiments, the camelid antibody was raised against a conserved region of an AAV capsid. In some embodiments, the chromatography resin medium comprises one or more beads with a diameter of approximately 50 μm.
In some embodiments, the one or more AAV particles comprise a capsid which encapsulates vector DNA or is empty. In some embodiments, the method further comprises a downstream step of performing size exclusion or anion exchange chromatography on the purified one or more AAV particles thereby enriching the AAV particles which encapsulate said vector DNA or performing one or more upstream steps including one or more optimizing plasmid transfection ratios; utilizing vector plasmids that are full length or have minimal ITR deletion; using novel engineered ITRs; and using a transfection plasmid containing both the AAV cap and transgene in cis.
In some embodiments, the method further comprises a step of neutralizing the one or more eluted fractions containing the one or more AAV particles. In some embodiments, the step of neutralizing comprises addition of tris(hydroxymethyl)aminomethane hydrochloride (TRIS-HCL) to the one or more elution fractions.
In some embodiments, the method further comprises one or more washing steps prior to, after, or both prior to and after the elution step. In some embodiments, the one or more washing steps are carried out with a washing buffer solution comprising one or more components selected from the group consisting of tris-buffered saline (TB S), ethanol, guanidine HCL, phosphoric acid, glycine, Tris NaOH, water, a non-ionic surfactant, and NaCl.
In some embodiments, the chromatography resin medium linked to at least one ligand which possess pan-AAV affinity is packed into a column to provide a high performance liquid chromatography column. In some embodiments, the chromatography resin medium linked to at least one ligand which possess pan-AAV affinity is purchased pre-packed into a column. the chromatography resin medium linked to at least one ligand which possess pan-AAV affinity wherein the volume of chromatography resin medium is at least 0.1 mL, at least 0.5 mL, at least 1 mL, at least 2 mL, at least 3 mL, at least 4 mL, at least 5 mL, or at least 10 mL.
In some embodiments, a flow rate of one or both of the acidic elution buffer solution and the wash buffer solution through the chromatography resin medium during the elution or washing steps comprises a flow rate of no more than 5 mL/min, no more than 4 mL/min, no more than 3 mL/min, no more than 2 mL/min, no more than 1 mL/min, no more than 0.5 ml/min or no more than 0.1 ml/min. In some embodiments, a flow rate of one or both of the acidic elution buffer solution and the wash buffer solution through the chromatography resin medium during the elution or washing steps comprises a flow rate per minute of approximately an equal volume or less of the acidic elution buffer solution or wash buffer solution per volume of chromatography resin medium. In some embodiments, a flow rate of one or both of the acidic elution buffer solution and wash buffer solution is 0.5 mL/min to 1 mL/min. In some embodiments, the volume of the chromatography resin medium is approximately 1 mL. In some embodiments, the flow rate of one or both of the acidic elution buffer solution and wash buffer solution is approximately 1 mL/min. In some embodiments, the volume of the chromatography resin medium is approximately 1 mL.
In other embodiments, a direction of flow of the elution acidic buffer solution in an elution step is opposite to a direction of flow of the cell lysate through the chromatography resin medium in the contacting step, whereby an increased quantity of AAV particles are eluted from the chromatography resin medium compared to when the directions of flow in the elution and providing steps are the same.
In some embodiments, the method further comprises a step of capturing the at least one or more elution volume fractions. In some embodiments, the method further comprises a step of sterilizing the at least one or more elution volume fractions containing the purified one or more AAV vector particles. In some embodiments, the method further comprises the step of submitting the at least one or more elution volume fractions to a buffer exchange. In some embodiments, the buffer exchange occurs in an AMICON Stirred Cell concentrator or an AMICON Ultra-15 filter concentrator.
Also disclosed herein are methods of high efficiency purification of adeno-associated virus (AAV) particles comprising the steps of a) transfecting at least one cell with plasmid DNA comprising an AAV vector genome, one or more AAV capsid genes and one or more transacting helper genes; b) providing a cell lysate that comprises one or more AAV particles by lysing the transfected at least one cell in situ; c) contacting the cell lysate comprising the one or more AAV particles with a volume of chromatography resin medium comprising at least one ligand possessing a pan-AAV affinity, wherein said contacting induces binding of the one or more AAV particles to the chromatography resin medium; and d) eluting the bound one or more AAV particles from the chromatography resin medium using a volume of an acidic elution buffer solution to provide one or more eluted volume fractions containing the one or more AAV particles; whereby purified AAV particles are obtained with an overall efficiency of at least 65% regardless of the serotype of the AAV purified, wherein the purity, yield and bioactivity of the AAV particles purified thereby are comparable to the purity, yield and bioactivity of iodixanol purified AAV particles, wherein the method does not require modifications contingent on the AAV serotype being purified to obtain said efficiency and wherein at least one of the following is true: i) at least one of the method steps is carried out in the presence of a non ionic surfactant, ii) the contacting is performed at a temperature of between approximately 20° C. to approximately 28° C., iii) both the cell lysate and the chromatography resin medium are allowed to come to a temperature between approximately 20° C. to approximately 28° C. previous to said contacting, or iv) the method further comprises a step of regenerating the chromatography resin medium comprising the at least one ligand possessing a pan-AAV affinity by contacting the medium with at least one acidic component for a predetermined amount of time.
In some embodiments, the contacting is performed at a temperature of between approximately 22° C. to 26° C. In some embodiments, both the cell lysate and the chromatography resin medium are allowed to come to a temperature between approximately 22° C. to approximately 26° C. prior to the contacting step. In some embodiments, the contacting is performed at a temperature of approximately 24° C. or approximately 21° C. In some embodiments, both the cell lysate and the chromatography resin medium are allowed to come to a temperature of approximately 24° C. or approximately 21° prior to the contacting steps. In some embodiments, the contacting is performed at a temperature of between approximately 22° C. to approximately 26° C. and both the cell lysate and the chromatography resin medium are allowed to come to a temperature between approximately 22° C. to approximately 26° C. prior to the contacting step. In some embodiments, the contacting is performed at a temperature of approximately 24° C. or approximately 21° C. and both the cell lysate and the chromatography resin medium are allowed to come to a temperature of approximately 24° C. or approximately 21° C. prior to the contacting step. In some embodiments, the one or more AAV particles subjected to purification is selected from one or more AAV serotypes from the group consisting of AAV1, AAV2, AAV2-7m8, AAV-HSPG, AAV3, AAV4, AAV5, AAV6, AAV6.2, AAV7, AAV8, AAV9, Rh10, Rh61, Rh8, Rh32.33, VR-865, PHP.B and Anc80.
In some embodiments, the volume of acidic elution buffer solution comprises glycine, phosphoric acid or citric acid. In some embodiments, the volume of acidic elution buffer solution comprises glycine. In some embodiments, the pH of the acidic elution buffer solution is approximately 3.0 or less. In some embodiments, the pH of the acidic elution buffer solution is between about 2 to about 2.5.
In some embodiments, the chromatography resin medium comprising a ligand possessing a pan-AAV affinity comprises a cross-linked poly(styrene-divinylbenzene) bead coated with a cross-linked polyhydroxylated polymer. In some embodiments, the chromatography resin medium is linked to a ligand which comprises a camelid heavy-chain-only single domain antibody fragment. In some embodiments, the camelid antibody was raised against a conserved region of an AAV capsid. In some embodiments, the chromatography resin medium comprises one or more beads with a diameter of approximately 50 μm.
In some embodiments, the one or more AAV particles comprise a capsid which encapsulates vector DNA or which is empty. In some embodiments, the method further comprises one or more steps selected from a downstream step of performing size exclusion or anion exchange chromatography on the purified one or more AAV particles thereby enriching the AAV particles which encapsulate said vector DNA and performing one or more upstream steps to reduce AAV particles comprising an empty capsid including optimizing plasmid transfection ratios, utilizing vector plasmids that are full length or have minimal ITR deletion, using novel engineered ITRs, and using a transfection plasmid containing both the AAV cap and transgene in cis.
In some embodiments, two or more steps of the method are carried out in the presence of a non-ionic surfactant. In some embodiments, the non-ionic surfactant is a tri-block poly(ethylene oxide) (PEO)-poly(propylene oxide) (PPO)-poly(ethylene oxide) (PEO) copolymer. In some embodiments, the non-ionic surfactant is PLURONIC F-68. In some embodiments, the method further comprises a step of neutralizing the one or more eluted fractions containing the one or more AAV particles. In some embodiments, the step of neutralizing comprises addition of tris(hydroxymethyl)aminomethane hydrochloride (TRIS-HCL) to the one or more elution fractions. In some embodiments, the method further comprises one or more washing steps prior to, after, or both prior to and after the elution step. In some embodiments, the one or more washing steps are carried out with a washing buffer solution comprising one or more components selected from the group consisting of tris-buffered saline (TBS), ethanol, guanidine HCL, phosphoric acid, glycine, Tris NaOH, water, a non-ionic surfactant, and NaCl.
In some embodiments, the method further comprises a step of regenerating the chromatography resin medium comprising the at least one ligand possessing a pan-AAV affinity by contacting the medium with at least one acidic component, wherein contact with the at least one acidic component is carried out for a predetermined amount of time. In some embodiments, the at least one acidic component comprises phosphoric acid and/or guanidine HCL. In some embodiments, the at least one acidic component comprises two acidic components which are each contacted with the chromatography resin concurrently or sequentially, and wherein the contact with each of the two acidic components is carried out for predetermined amounts of time. In some embodiments, the predetermined amount of time is 30 seconds to 24 hours, 1 minute to 12 hours, 5 minutes to 4 hours, 10 minutes to 1 hour, or 15 minutes to 30 minutes. In some embodiments, each predetermined amount of time is at least 15 minutes. In some embodiments, the regeneration step is carried out by contacting the chromatography resin medium with 0.1M phosphoric acid for at least 15 minutes, followed or preceded by contacting the chromatography resin medium with 6M guanidine for at least 15 minutes. In some embodiments, the step of regeneration of the chromatography resin medium is performed a second time, a third time, a fourth time, a fifth time, a sixth time, a seventh time, an eighth time, a ninth time or ten or more times.
In some embodiments, the method comprises at least one repetition of steps a) through c). In some embodiments, the completion or repetition of the step of regeneration of the chromatography resin medium results in one or both of i) sustaining high efficiency purification during subsequent repetitions of steps a) through c) and ii) eliminating carry over contamination between repetitions of steps a) through c).
The method according to any one of claims 138-171, wherein the chromatography resin medium linked to at least one ligand which possess pan-AAV affinity is packed into a column to provide a high performance liquid chromatography column. In some embodiments, the chromatography resin medium linked to at least one ligand which possess pan-AAV affinity is purchased pre-packed into a column. the chromatography resin medium linked to at least one ligand which possess pan-AAV affinity wherein the volume of chromatography resin medium is at least 0.1 mL, at least 0.5 mL, at least 1 mL, at least 2 mL, at least 3 mL, at least 4 mL, at least 5 mL, or at least 10 mL.
In some embodiments, a flow rate of one or both of the acidic elution buffer solution and the wash buffer solution through the chromatography resin medium during the elution or washing steps comprises a flow rate of no more than 5 mL/min, no more than 4 mL/min, no more than 3 mL/min, no more than 2 mL/min, no more than 1 mL/min, no more than 0.5 ml/min or no more than 0.1 ml/min. In some embodiments, a flow rate of one or both of the acidic elution buffer solution and the wash buffer solution through the chromatography resin medium during the elution or washing steps comprises a flow rate per minute of approximately an equal volume or less of the acidic elution buffer solution or wash buffer solution per volume of chromatography resin medium. In some embodiments, a flow rate of one or both of the acidic elution buffer solution and wash buffer solution is 0.5 mL/min to 1 mL/min. In some embodiments, the volume of the chromatography resin medium is approximately 1 mL. In some embodiments, the flow rate of one or both of the acidic elution buffer solution and wash buffer solution is approximately 1 mL/min. In some embodiments, the volume of the chromatography resin medium is approximately 1 mL.
In some embodiments, a direction of flow of the elution acidic buffer solution in an elution step is opposite to a direction of flow of the cell lysate through the chromatography resin medium in the contacting step, whereby an increased quantity of AAV particles are eluted from the chromatography resin medium compared to when the directions of flow in the elution and providing steps are the same.
In some embodiments, the method further comprises a step of capturing the at least one or more elution volume fractions. In some embodiments, the method further comprises a step of sterilizing the at least one or more elution volume fractions containing the purified one or more AAV vector particles.
In some embodiments, the method further comprises the step of submitting the at least one or more elution volume fractions to a buffer exchange. In some embodiments, the buffer exchange occurs in an AMICON Stirred Cell concentrator or an AMICON Ultra-15 filter concentrator.
Also disclosed herein are particularly preferred methods of high efficiency purification of adeno-associated virus (AAV) particles comprising the steps of: a) seeding HEK293T cells onto a substrate which holds a Dulbecco's modified eagle medium (DMEM) containing 10% fetal bovine serum (FBS) and 1% mixture of penicillin G and streptomycin (penstrep) and allowing expansion of the cells until approximately 80% confluency is obtained; b) transfecting the HEK293T cells by contacting said cells with a composition that comprises DMEM, polyethylenimine, penstrep, and plasmid DNA comprising an AAV vector genome, one or more AAV capsid genes and one or more trans-acting helper genes; c) providing a clarified cell lysate that comprises one or more AAV particles by lysing the transfected HEK293T cells in situ utilizing TRITON-X 100, RNAse A, Turbonuclease and PLURONIC F68, subjecting the lysate to centrifugation at 4,000 g or higher and subsequently filtering a supernatant thus obtained by use of a 0.45 μm cellulose acetate/polyethersulfone membrane filter system; d) contacting the clarified cell lysate comprising the one or more AAV particles with a 1 mL volume of POROS CAPTURESELECT AAVX chromatography resin medium, wherein the contacting duration comprises no less than 1 minute, wherein the contacting is performed at a temperature of between approximately 21° C. to approximately 25° C. and/or both the cell lysate and the chromatography resin medium are allowed to come to a temperature between approximately 21° C. to approximately 25° C. previous to said contacting, and wherein said contacting induces binding of the one or more AAV particles to the chromatography resin medium; e) eluting the bound one or more AAV particles from the chromatography resin medium using a volume of a filtered acidic elution buffer solution having a pH between approximately 2.0 and approximately 2.5, to provide one or more eluted volume fractions containing the one or more AAV particles, wherein the filtered acidic elution buffer solution comprises 0.2M glycine and 0.01 v/v % PLURONIC F68 and wherein a flow direction of the acidic elution buffer solution through the chromatography resin medium is opposite a flow direction of the clarified cell lysate through the chromatography resin during the contacting step; f) optionally sterilizing the at least one or more elution volume fractions containing the purified one or more AAV particles utilizing a 0.2 μm polyethersulfone syringe filter; g) subjecting the one or more elution volume fractions containing the purified one or more AAV particles to buffer exchange using either AMICON UTRACEL 15 or AMICON Stirred Cell concentrators, wherein if a 50 or 100 kDA AMICON ULTRA 15 Centrifugal Filter device is used for buffer exchange, less than 1×1013 vg of AAV are subjected to buffer exchange therein to reduce sedimentation and loss; and h) regenerating the chromatography resin medium by contacting the chromatography resin medium with 0.1M phosphoric acid for at least 15 minutes, followed or preceded by contacting the chromatography resin medium with 6M guanidine for at least 15 minutes; whereby purified AAV particles are obtained with an overall efficiency of at least 65% regardless of the serotype of the AAV purified, wherein the purity, yield and bioactivity of the AAV particles purified thereby are comparable to the purity, yield and bioactivity of iodixanol purified AAV particles, wherein any plastic surface which comes into contact with the AAV particles during the method is first coated with a composition comprising PLURONIC F68, and wherein the method does not require modifications contingent on the AAV serotype being purified to obtain said efficiency.
The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawings will be provided by the Office upon request and payment of the necessary fee.
An increased demand for AAV production has led to the need to develop more versatile and scalable production methods. Chromatography has been considered a possible solution but its application to this problem has been hampered by the lack of resins or processes that can purify multiple AAV serotypes without individual optimization9-12.
The main advantages of chromatographic purification are its scalability to larger volumes and reduced requirement for hands-on time, which considerably eases AAV manufacturing. Chromatographic resins can be scaled to high volumes, which enables input of possibly unconcentrated large volumes of lysates. The process can also be automated and precisely controlled, monitored and quantified, which eases troubleshooting and provides rich data about the quality of the run. For these reasons, chromatography based methods have become the main workhorse of industrial AAV production, as well as industrial production of other biologics and small molecules8. It was discovered that AAVX affinity chromatography allows for purification of multiple AAV serotypes at multiple scales, is efficient, and results in virus of comparable purity and bioactivity to ultracentrifugation purified virus.
Disclosed herein, are methods of high efficiency purification of adeno-associated virus (AAV) particles comprising the steps of a) providing a cell lysate that comprises one or more AAV particles; b) contacting the cell lysate comprising the one or more AAV particles with a volume of chromatography resin medium comprising at least one ligand possessing a pan-AAV affinity, wherein said contacting induces binding of the one or more AAV particles to the chromatography resin medium and wherein the contacting is performed at a temperature of between approximately 20° C. to approximately 28° C. and/or both the cell lysate and the chromatography resin medium are allowed to come to a temperature between approximately 20° C. to approximately 28° C. previous to said contacting; and c) eluting the bound one or more AAV particles from the chromatography resin medium using a volume of an acidic elution buffer solution to provide one or more eluted volume fractions containing the one or more AAV particles; whereby purified AAV particles are obtained with an overall efficiency of at least 65% regardless of the serotype of the AAV purified, wherein the purity, yield and bioactivity of the AAV particles purified thereby are comparable to the purity, yield and bioactivity of iodixanol purified AAV particles, and wherein the method does not require modifications contingent on the AAV serotype being purified to obtain said efficiency.
In order to enhance the efficiency and bioactivity of the purified AAVs, one or more of the purification steps are performed at room temperature. For purposes of this invention, room temperature is defined as a temperature between approximately 20° C. and approximately 28° C. In some embodiments the contacting and elution steps are not carried out below a temperature of 20° C., 21° C., 22° C., 23° C., 24° C. or 25° C. or are not carried out above a temperature of 24° C., 25° C., 26° C., 27° C., 28° C., 29° C. or 30° C. In a preferred embodiment, the contacting or elution steps are performed at a temperature of approximately 21° C. to approximately 26° C., approximately 22° C. to approximately 25° C., or approximately 23° C. to approximately 24° C. In one preferred embodiment, either one or both of the contacting and elution steps are performed at a temperature of approximately 21° C., 23° C., or approximately 24° C.
In other embodiments, binding efficiency of the AAV particles within the cell lysate to the chromatography resin medium may be enhanced by allowing one or both of the cell lysate and chromatography resin medium to come to a temperature between approximately 21° C. to approximately 26° C., approximately 22° C. to approximately 25° C., or approximately 23° C. to approximately 24° C. In one preferred embodiment, either one or both of the cell lysate and chromatography resin medium are allowed to come to a temperature of approximately 21° C., 23° C., or approximately 24° C. In a particularly preferred embodiment, one or more steps of the method are performed at room temperature as defined herein and both the cell lysate and chromatography resin medium is allowed to attain room temperature prior to one or more steps of the method.
Also disclosed herein are methods of high efficiency purification of adeno-associated virus (AAV) particles comprising the steps of a) providing a cell lysate that comprises one or more AAV particles; b) contacting the cell lysate comprising the one or more AAV particles with a volume of chromatography resin medium comprising at least one ligand possessing a pan-AAV affinity, wherein said contacting induces binding of the one or more AAV particles to the chromatography resin medium; and c) eluting the bound one or more AAV particles from the chromatography resin medium using a volume of an acidic elution buffer solution to provide one or more eluted volume fractions containing the one or more AAV particles; whereby purified AAV particles are obtained with an overall efficiency of at least 65% regardless of the serotype of the AAV purified, wherein at least one of the method steps is carried out in the presence of a nonionic surfactant, wherein the purity, yield and bioactivity of the AAV particles purified thereby are comparable to the purity, yield and bioactivity of iodixanol purified AAV particles, wherein the method does not require modifications contingent on the AAV serotype being purified to obtain said efficiency.
In some embodiments, two or more steps, three or more steps, four or more steps, five or more steps or substantially all of the steps of the method may be performed in the presence of a non-ionic surfactant. In some embodiments, any surface which will come into contact with the AAV particles as described herein may be treated with a non-ionic surfactant to reduce the likelihood that the AAV particles adhere thereto. Such treatment may be performed by first diluting the non-ionic surfactant within a suitable carrier, solvent or diluent and spraying onto, submerging, wiping or soaking the substrate with the diluted non-ionic surfactant for a predetermined amount of time. In some embodiments, the treatment is a function of performing the steps of the method with buffer or other solutions which already contain the non-ionic surfactant. In some embodiments, the concentration of the non-ionic surfactant within the diluted solution is between 0.001% to 20%, between 0.005% to 10%, between 0.01% to 5% or between 0.5% and 3%. In preferred embodiments, the concentration of the non-ionic surfactant in a lysing solution is 0.001%, the concentration of the non-ionic surfactant in an elution buffer is 0.01%, the concentration of the non-ionic surfactant in a neutralization buffer is 0.1% and the concentration of the non-ionic surfactant in a final formulation buffer is 0.001%.
In some embodiments, the non-ionic surfactant is a tri-block copolymer. In still further embodiments, the non-ionic surfactant is a tri-block poly(ethylene oxide) (PEO)-poly(propylene oxide) (PPO)-poly(ethylene oxide) (PEO) copolymer. In some embodiments, the non-ionic surfactant is a commercially available pluronic polymer which shares compatibility with one or more other reagents disclosed throughout the disclosure. In a preferred embodiment, the non-ionic surfactant is PLURONIC F-68.
Also disclosed herein are methods of high efficiency purification of adeno-associated virus (AAV) particles comprising the steps of a) providing a cell lysate that comprises one or more AAV particles; b) contacting the cell lysate comprising the one or more AAV particles with a volume of chromatography resin medium comprising at least one ligand possessing a pan-AAV affinity, wherein said contacting induces binding of the one or more AAV particles to the chromatography resin medium; c) eluting the bound one or more AAV particles from the chromatography resin medium using a volume of an acidic elution buffer solution to provide one or more eluted volume fractions containing the one or more AAV particles; and d) regenerating the chromatography resin medium comprising the at least one ligand possessing a pan-AAV affinity by contacting the medium with at least one acidic component, wherein contact with the at least one acidic component is carried out for a predetermined amount of time, whereby purified AAV particles are obtained with an overall efficiency of at least 65% regardless of the serotype of the AAV purified, wherein the purity, yield and bioactivity of the AAV particles purified thereby are comparable to the purity, yield and bioactivity of iodixanol purified AAV particles, and wherein the method does not require modifications contingent on the AAV serotype being purified to obtain said efficiency.
In some embodiments, the at least one acidic component utilized in the step of regeneration of the chromatography resin medium comprises any suitable binary acid, oxyacid or carboxylic acid which are commercially available and which are suitable for contact with an antibody fragment without causing denaturation, unfolding or loss of its AAV capsid binding activity. In some embodiments the acid is a weak acid and comprises one or more of formic acid, phosphoric acid and/or guanidine HCL. In some embodiments, the at least one acidic component comprises two acidic components which are each contacted with the chromatography resin concurrently or sequentially, and wherein the contact with each of the two acidic components is carried out for predetermined amounts of time. In some embodiments, the predetermined amount of time is 30 seconds to 24 hours, 1 minute to 12 hours, 5 minutes to 4 hours, 10 minutes to 1 hour, or 15 minutes to 30 minutes.
In some embodiments, each predetermined amount of time is at least 15 minutes. In some embodiments, the regeneration step is carried out by contacting the chromatography resin medium with 0.1M phosphoric acid for at least 15 minutes, followed or preceded by contacting the chromatography resin medium with 6M guanidine for at least 15 minutes. In some embodiments, the step of regeneration of the chromatography resin medium is performed a second time, a third time, a fourth time, a fifth time, a sixth time, a seventh time, an eighth time, a ninth time or ten or more times.
It will be appreciated that one of the important objectives of the invention is to provide a purification platform and protocol to enable the efficient large scale purification of AAV particles. Thus, in other embodiments, and especially where it is not practical to scale up the volume of chromatography resin medium used in the method, the method of the invention comprises repetition of steps a) through c) in order to facilitate purification of large quantities of AAV particles. Such large scale purification may include purification of different batches of cell lysates, each batch of cell lysate containing a distinct AAV particle serotype. Alternatively, each batch of cell lysate utilized in a large scale purification process made containing cell lysate batches that comprise the same AAV particle serotype. In some embodiments, the step of regeneration of the chromatography resin medium is performed before a repetition of steps a) through c). In some embodiments, the completion or repetition of the step of regeneration of the chromatography resin medium results in one or both of i) sustaining high efficiency purification during subsequent repetitions of steps a) through c) and ii) eliminating carry over contamination between repetitions of steps a) through c).
As disclosed herein, one important and inventive aspect of the herein disclosed method is the ability to achieve highly efficient purification of widely divergent AAV serotypes, without further optimizations contingent on the serotype to be purified. In some embodiments, the AAV serotypes that can be efficiently purified through use of this method are not particularly limited and include both natural and synthetic AAV serotypes. In one embodiment, the one or more AAV serotypes selected for purification with the method are selected from the group consisting of AAV1, AAV2, AAV2-7m8, AAV-HSPG, AAV3, AAV4, AAV5, AAV6, AAV6.2, AAV7, AAV8, AAV9, Rh10, Rh61, Rh8, Rh32.33, VR-865, PHP.B and Anc80.
In some embodiments, the volume of acidic elution buffer solution comprises glycine, phosphoric acid or citric acid. In some embodiments, the volume of acidic elution buffer solution comprises glycine. In some embodiments, the glycine is present in a concentration of about 0.1M to about 2M, about 0.2M to about 1M or is present in a concentration of about 0.2M. In some embodiments, the pH of the acidic elution buffer solution is approximately 3.0 or less. In some embodiments, the pH of the acidic elution buffer solution is between about 2 to about 2.5. In some further embodiments, the acidic elution buffer solution comprises both glycine and a non-ionic surfactant. In still other embodiments, the nonionic surfactant is PLURONIC F-68. In a particularly preferred embodiment, the acidic elution buffer solution comprises 0.2M glycine, 0.01% PLURONIC F-68 and has a pH of between about 2 and about 2.5.
In some embodiments, the chromatography resin medium comprising a ligand possessing a pan-AAV affinity comprises a cross-linked poly(styrene-divinylbenzene) bead coated with a cross-linked polyhydroxylated polymer. In some embodiments, the chromatography resin medium is linked to a ligand which comprises a camelid heavy-chain-only single domain antibody fragment. In some embodiments, the camelid antibody was raised against a conserved region of an AAV capsid. In some embodiments, the chromatography resin medium comprises one or more beads with a diameter of about 30-70 μm, about 40-60 μm or approximately 50 μm. In a particularly preferred embodiment, the chromatography resin medium is POROS CAPTURESELECT AAVX resin available from Thermo Fisher in a prepacked or free form.
In some embodiments, the one or more purified AAV particles comprise capsids which are filled with vector DNA. In some embodiments, the one or more purified AAV particles comprise capsids which are empty.
Several reports have described empty capsid copurification to various degrees with affinity and other types of chromatography11,12,28 It was discovered that the percent of empty capsids in AAV9 and PHP.eB preps purified using AAVX affinity chromatography to be approximately 30% (
In some embodiments, where the presence of some level of empty capsids is tolerated, no additional step is performed to separate empty capsids from capsids which contain vector DNA. In some embodiments, the presence of empty capsids may not substantially change the outcome of gene transfer utilizing the purified AAV particles disclosed herein. Indeed, the data indicate an equivalent in vivo gene transfer efficacy across multiple organs, inclusion of empty capsids notwithstanding (
In some embodiments, however, maximal reduction of empty capsid content is desirable or required. Thus, in some embodiments, various upstream or downstream steps that reduce production of empty capsids or enrich for full capsids can be added. These include optimization of plasmid transfection ratios29; use of vector plasmids that are full length or with minimal ITR deletion29; use of novel engineered ITRs; use of a transfection plasmid containing both the AAV cap and transgene in cis29, or other methods which have been reported to reduce the fraction of empty capsids in the input lysate. In some embodiments, multiple different downstream steps to enrich for full capsids include utilizing, size exclusion, anion exchange, or other chromatographic methods9,10,12,30-37 which are included within the scope of this invention. In some embodiments, these can be added in series as additional steps to the process after the AAVX affinity binding step.
In some embodiments, the method further comprises a step of neutralizing the one or more eluted fractions containing the one or more AAV particles. In some embodiments, the step of neutralizing comprises addition of tris(hydroxymethyl)aminomethane hydrochloride (TRIS-HCL) to the one or more elution fractions. In some embodiments, the TRIS-HCL is added to one or more eluted fractions in combination with a non-ionic surfactant in a neutralization buffer. In some embodiments, the neutralization buffer has a pH of about 7 to about 9. In some preferred embodiments, the neutralization buffer has a pH of about 8. In a particularly preferred embodiment, the neutralization step comprises addition of a neutralization buffer comprising 1M TRIS-HCL and 0.1% PLURONIC F68 to the one or more eluted fractions containing the one or more AAV particles, wherein the neutralization buffer has a pH of about 8.
In some embodiments, the method further comprises one or more washing steps prior to, after, or both prior to and after the elution step. In some embodiments, the one or more washing steps are carried out with a washing buffer solution comprising one or more components selected from the group consisting of tris-buffered saline (TB S), ethanol, guanidine HCL, phosphoric acid, glycine, Tris, NaOH, water, a non-ionic surfactant, and NaCl. In some embodiments, the washing step is performed after the contacting step, but before the eluting step. In some embodiments, the wash buffer solution comprises ethanol. In some embodiments, the washing buffer comprises ethanol and TBS.
In some embodiments, the chromatography resin medium linked to at least one ligand which possess pan-AAV affinity is packed into a column to provide a high performance liquid chromatography column. In some embodiments, the chromatography resin medium linked to at least one ligand which possess pan-AAV affinity is purchased pre-packed into a column. In some embodiments, the volume of chromatography resin medium is at least 0.1 mL, at least 0.5 mL, at least 1 mL, at least 2 mL, at least 3 mL, at least 4 mL, at least 5 mL, or at least 10 mL. In some embodiments, the volume of chromatography resin medium is no more than 10 L, no more than 5 L, no more than 1 L, no more than 100 mL, no more than 10 mL, no more than 5 mL, no more than 2 mL, or no more than 1 mL. In a preferred embodiment, the volume of chromatography resin medium is approximately 1 mL.
In some embodiments, a flow rate of one or both of the acidic elution buffer solution and the wash buffer solution through the chromatography resin medium during the elution or washing steps comprises a flow rate of no more than 5 mL/min, no more than 4 mL/min, no more than 3 mL/min, no more than 2 mL/min, no more than 1 mL/min, no more than 0.5 ml/min or no more than 0.1 ml/min. In some embodiments, a flow rate of one or both of the acidic elution buffer solution and the wash buffer solution through the chromatography resin medium during the elution or washing steps comprises a flow rate per minute of approximately an equal volume or less of the acidic elution buffer solution or wash buffer solution per volume of chromatography resin medium. In some embodiments, a flow rate of one or both of the acidic elution buffer solution and the wash buffer solution is 0.5 mL/min to 1 mL/min. In some embodiments, the volume of the chromatography resin medium is approximately 1 mL. In some embodiments, the flow rate of one or both of the acidic elution buffer solution and wash buffer solution is approximately 1 mL/min. In some embodiments, the volume of the chromatography resin medium is approximately 1 mL and the flow rate of one or both of the acidic elution buffer solution and wash buffer solution is 1 mL/min. In some embodiments, the volume of the chromatography resin medium is approximately 1 mL and the flow rate of one or both of the acidic elution buffer solution and wash buffer solution is 0.5 mL/min. In some embodiments, the volume of the chromatography resin medium is approximately 1 mL and the flow rate of one or both of the acidic elution buffer solution and wash buffer solution is 0.25 mL/min.
In other embodiments, a direction of flow of the elution acidic buffer solution in an elution step is opposite to a direction of flow of the cell lysate through the chromatography resin medium in the contacting step, whereby an increased quantity of AAV particles are eluted from the chromatography resin medium compared to when the directions of flow in the elution and providing steps are the same. While not wishing to be bound by theory, it is believed that when the cell lysate is contacted in a first flow direction with chromatography resin medium that has been packed into a column, AAV particles in the cell lysate will bind quickly to the chromatography resin medium very close to the point of introduction of the cell lysate. Thus, it follows that if an elution buffer is introduced in the introduction point with the same direction of flow, AAV particles may rebind to the column before they can be eluted. On the contrary, when the elution buffer is introduced at a point distal to the cell lysate introduction point and an opposite direction of flow of the elution buffer is utilized, AAV particles released from the chromatography resin will encounter far less volume of chromatography resin medium, resulting in more AAV particle eluting during this step.
In some embodiments, the method further comprises a step of capturing the at least one or more elution volume fractions. In some embodiments, the step of capturing the at least one or more elution volume fractions includes collecting all of the elution volume fraction in a single container. In some embodiments, the step of capturing the at least one or more elution volume fractions includes collecting one or more of the elution volume fractions in separate container. In some embodiments, the elution volume fractions are subjected to qPCR to determine the quantity of vector DNA present in the elution volume fraction.
In some embodiments, the method further comprises a step of sterilizing the at least one or more elution volume fractions containing the purified one or more AAV vector particles. In some embodiments, the method comprises a further step of neutralizing the one or more elution volume fractions after collection. In some embodiments, the step of neutralizing comprises addition of tris(hydroxymethyl)aminomethane hydrochloride (TRIS-HCL) to the one or more elution fractions. In some embodiments, the TRIS-HCL is added to one or more eluted fractions in combination with a non-ionic surfactant in a neutralization buffer. In some embodiments, the neutralization buffer has a pH of about 7 to about 9. In some preferred embodiments, the neutralization buffer has a pH of about 8. In a particularly preferred embodiment, the neutralization step comprises addition of a neutralization buffer comprising 1M TRIS-HCL and 0.1% PLURONIC F68 to the one or more eluted fractions containing the one or more AAV particles, wherein the neutralization buffer has a pH of about 8. In some embodiments, the neutralized one or more elution volume fractions are sterilized via a polyethersulfone syringe or cap filter. In some embodiments, the polyethersulfone syringe or cap filter is a 0.22 μm filter.
In some embodiments, the method further comprises the step of submitting the at least one or more elution volume fractions to a buffer exchange. In some embodiments, the one or more elution volume fractions may be neutralized elution volume fraction. In some embodiments, the buffer exchange occurs in an AMICON Stirred Cell concentrator or an AMICON Ultra-15 filter concentrator. In some embodiments the elution volume fractions are submitted to buffer exchange and concentrated with a molecular weight cut-off of 50 kDa or 100 kDA. In some embodiments the buffer exchange and/or concentration occurs under influence of an inert gas. In some embodiments, the inert gas is nitrogen.
Also disclosed herein are methods of high efficiency purification of adeno-associated virus (AAV) particles comprising the steps of a) transfecting at least one cell with plasmid DNA comprising an AAV vector genome, one or more AAV capsid genes and one or more transacting helper genes; b) providing a cell lysate that comprises one or more AAV particles by lysing the transfected at least one cell in situ; c) contacting the cell lysate comprising the one or more AAV particles with a volume of chromatography resin medium comprising at least one ligand possessing a pan-AAV affinity, wherein said contacting induces binding of the one or more AAV particles to the chromatography resin medium; and d) eluting the bound one or more AAV particles from the chromatography resin medium using a volume of an acidic elution buffer solution to provide one or more eluted volume fractions containing the one or more AAV particles; whereby purified AAV particles are obtained with an overall efficiency of at least 65% regardless of the serotype of the AAV purified, wherein the purity, yield and bioactivity of the AAV particles purified thereby are comparable to the purity, yield and bioactivity of iodixanol purified AAV particles, wherein the method does not require modifications contingent on the AAV serotype being purified to obtain said efficiency and wherein at least one of the following is true: i) at least one of the method steps is carried out in the presence of a non ionic surfactant, ii) the contacting is performed at a temperature of between approximately 20° C. to approximately 28° C., iii) both the cell lysate and the chromatography resin medium are allowed to come to a temperature between approximately 20° C. to approximately 28° C. previous to said contacting, or iv) the method further comprises a step of regenerating the chromatography resin medium comprising the at least one ligand possessing a pan-AAV affinity by contacting the medium with at least one acidic component for a predetermined amount of time.
In some embodiments, prior to transfection, cells are initially seeded and subsequently expanded on a suitable substrate. Such a substrate is not particularly limited and may include any substrate which comprises a planar or non-planar horizontal surface and means for retaining a liquid and cells placed thereon. In some embodiments, the substrate is selected from one or more dishes having a desired capacity. In some embodiments, the dish is a dish with a 15 mL capacity. In some embodiments, the substrate is a hyperflask, a shaker flask or a CellSTACK cell culture chamber. In a particularly preferred embodiment, the substrate is a hyperflask. In some embodiments, the seeding and expansion of cells may be initiated on a first substrate and continued to desired confluency on a second substrate. In a preferred embodiment, cells are seeded and expanded on a dish until 80% confluency and are subsequently transferred to a hyperflask until 80% confluency is achieved. In some embodiments, a confluency of greater than 90% is avoided.
In a preferred embodiment, the substrate contains a cell growth medium. In some embodiments, the cell growth medium is not particularly limited and encompasses cell growth medium known to those skilled in the art. In a preferred embodiment, the cell growth medium comprises Dulbecco's Modified Eagle Medium. In some embodiments, the cell growth medium comprises DMEM, 10% fetal bovine serum (FBS) and 1% Pen/Strep. In some embodiments the cell growth medium has been sterilized, such as by filter sterilization. In some embodiments, the cell growth medium is warmed to approximately 37° C. prior to use. In some embodiments, the seeding and expansion of cells is carried out at an elevated temperature compared to room temperature. In some embodiments, the seeding and expansion of cells is carried out at approximately 37° C.
In some embodiments, the cells transfected by vector DNA are not particularly limited and include those cells known to a skilled artisan for this purpose, such as those which are highly transfectable. In some embodiments, the cells transfected by vector DNA is one selected from HeLa, HEK293, 293-T, sBHK and Sf9. In a preferred embodiment, the cell transfect by vector DNA is HEK293.
In some embodiments, the step of transfection comprises mixing DMEM with DNA. In some embodiments, the DNA comprises vector DNA, AAV capsid DNA and DNA of a helper plasmid. In some embodiments, the vector DNA, AAV capsid DNA and DNA of a helper plasmid are provided in a weight ratio of 1:1:2. In some embodiments, the helper plasmid is adeno-helper plasmid deltaF6. In some embodiments, the DMEM, vector DNA, AAV capsid DNA and DNA of a helper plasmid are mixed with PEIMax, and DMEM containing 1% PenStrep to provide a mixture for transfecting a cell, which mixture does not contain serum. In some embodiments, the mixture for transfecting a cell does no contain fetal bovine serum. In some embodiments, the transfection step includes mixing the DMEM, vector DNA, AAV capsid DNA and helper plasmid DNA, PEIMax with cells to be transfected, and is subsequently incubated for 3-5 days.
In some embodiments, the step of providing cell lysate comprises mixing a non-ionic detergent with one or more nucleases. In some embodiments, the one or more nucleases comprise Turbonuclease. In some embodiments, the non-ionic detergent comprises TRITON-X-100 and the nuclease comprises Turbonuclease. In some embodiments, the step of providing cell lysate is carried out in the presence of PLURONIC F68 at a temperature which is elevated compared to room temperature. In some embodiments, the step of providing cell lysate by in situ lysing is carried out at a temperature of approximately 37° C.
In order to enhance the efficiency and bioactivity of the purified AAVs, one or more of the providing, contacting and eluting steps are performed at room temperature. For purposes of this invention, room temperature is defined as a temperature between approximately 20° C. and approximately 28° C. In some embodiments the contacting and elution steps are not carried out below a temperature of 20° C., 21° C., 22° C., 23° C., 24° C. or 25° C. or are not carried out above a temperature of 24° C., 25° C., 26° C., 27° C., 28° C., 29° C. or 30° C. In a preferred embodiment, the contacting or elution steps are performed at a temperature of approximately 21° C. to approximately 26° C., approximately 22° C. to approximately 25° C., or approximately 23° C. to approximately 24° C. In one preferred embodiment, either one or both of the contacting and elution steps are performed at a temperature of approximately 21° C., 23° C., or approximately 24° C.
In other embodiments, binding efficiency of the AAV particles within the cell lysate to the chromatography resin medium may be enhanced by allowing one or both of the cell lysate and chromatography resin medium to come to a temperature between approximately 21° C. to approximately 26° C., approximately 22° C. to approximately 25° C., or approximately 23° C. to approximately 24° C. In one preferred embodiment, either one or both of the cell lysate and chromatography resin medium are allowed to come to a temperature of approximately 21° C., 23° C., or approximately 24° C. In a particularly preferred embodiment, one or more steps of the method are performed at room temperature as defined herein and both the cell lysate and chromatography resin medium is allowed to attain room temperature prior to one or more steps of the method.
In some embodiments, two or more steps, three or more steps, four or more steps, five or more steps or substantially all of the steps of the method may be performed in the presence of a non-ionic surfactant. In some embodiments, any surface which will come into contact with the AAV particles as described herein may be treated with a non-ionic surfactant to reduce the likelihood that the AAV particles adhere thereto. Such treatment may be performed by first diluting the non-ionic surfactant within a suitable carrier, solvent or diluent and spraying onto, submerging, wiping or soaking the substrate with the diluted non-ionic surfactant for a predetermined amount of time. In some embodiments, the treatment is a function of performing the steps of the method with buffer or other solutions which already contain the non-ionic surfactant. In some embodiments, the concentration of the non-ionic surfactant within the diluted solution is between 0.001% to 20%, between 0.005% to 10%, between 0.01% to 5% or between 0.5% and 3%. In preferred embodiments, the concentration of the non-ionic surfactant in a lysing solution is 0.001%, the concentration of the non-ionic surfactant in an elution buffer is 0.01%, the concentration of the non-ionic surfactant in a neutralization buffer is 0.1% and the concentration of the non-ionic surfactant in a final formulation buffer is 0.001%.
In some embodiments, the non-ionic surfactant is a tri-block copolymer. In still further embodiments, the non-ionic surfactant is a tri-block poly(ethylene oxide) (PEO)-poly(propylene oxide) (PPO)-poly(ethylene oxide) (PEO) copolymer. In some embodiments, the non-ionic surfactant is a commercially available pluronic polymer which shares compatibility with one or more other reagents disclosed throughout the disclosure. In a preferred embodiment, the non-ionic surfactant is PLURONIC F-68.
In some embodiments, the at least one acidic component utilized in the step of regeneration of the chromatography resin medium comprises any suitable binary acid, oxyacid or carboxylic acid which are commercially available and which are suitable for contact with an antibody fragment without causing denaturation, unfolding or loss of its AAV capsid binding activity. In some embodiments the acid is a weak acid and comprises one or more of formic acid, phosphoric acid and/or guanidine HCL. In some embodiments, the at least one acidic component comprises two acidic components which are each contacted with the chromatography resin medium concurrently or sequentially, and wherein the contact with each of the two acidic components is carried out for predetermined amounts of time. In some embodiments, the predetermined amount of time is 30 seconds to 24 hours, 1 minute to 12 hours, 5 minutes to 4 hours, 10 minutes to 1 hour, or 15 minutes to 30 minutes.
In some embodiments, each predetermined amount of time is at least 15 minutes. In some embodiments, the regeneration step is carried out by contacting the chromatography resin medium with 0.1M phosphoric acid for at least 15 minutes, followed or preceded by contacting the chromatography resin medium with 6M guanidine for at least 15 minutes. In some embodiments, the step of regeneration of the chromatography resin medium is performed a second time, a third time, a fourth time, a fifth time, a sixth time, a seventh time, an eighth time, a ninth time or ten or more times.
It will be appreciated that one of the important objectives of the invention is to provide a purification platform and protocol to enable the efficient large scale purification of AAV particles. Thus, in other embodiments, and especially where it is not practical to scale up the volume of chromatography resin medium used in the method, the method of the invention comprises repetition of at least steps b) through d) in order to facilitate purification of large quantities of AAV particles. In some embodiments, the method includes repetition of one or more of steps a) through d). Such large scale purification may include purification of different batches of cell lysates, each batch of cell lysate containing a distinct AAV particle serotype. Alternatively, each batch of cell lysate utilized in a large scale purification process can comprise cell lysate containing the same AAV particle serotype. In some embodiments, the step of regeneration of the chromatography resin medium is performed before a repetition of steps b) through d). In some embodiments, the completion or repetition of the step of regeneration of the chromatography resin medium results in one or both of i) sustaining high efficiency purification during subsequent repetitions of steps c) through d) and ii) eliminating carry over contamination between repetitions of steps c) through d).
As disclosed herein, one important and inventive aspect of the herein disclosed method is the ability to achieve highly efficient purification of widely divergent AAV serotypes, without further optimizations contingent on the serotype to be purified. In some embodiments, the AAV serotypes that can be efficiently purified through use of this method are not particularly limited and include both natural and synthetic AAV serotypes. In one embodiment, the one or more AAV serotypes selected for purification with the method are selected from the group consisting of AAV1, AAV2, AAV2-7m8, AAV-HSPG, AAV3, AAV4, AAV5, AAV6, AAV6.2, AAV7, AAV8, AAV9, Rh10, Rh61, Rh8, Rh32.33, VR-865, PHP.B and Anc80.
In some embodiments, the volume of acidic elution buffer solution comprises glycine, phosphoric acid or citric acid. In some embodiments, the volume of acidic elution buffer solution comprises glycine. In some embodiments, the glycine is present in a concentration of about 0.1M to about 2M, about 0.2M to about 1M or is present in a concentration of about 0.2M. In some embodiments, the pH of the acidic elution buffer solution is approximately 3.0 or less. In some embodiments, the pH of the acidic elution buffer solution is between about 2 to about 2.5. In some further embodiments, the acidic elution buffer solution comprises both glycine and a non-ionic surfactant. In still other embodiments, the nonionic surfactant is PLURONIC F-68. In a particularly preferred embodiment, the acidic elution buffer solution comprises 0.2M glycine, 0.01% PLURONIC F-68 and has a pH of between about 2 and about 2.5.
In some embodiments, the chromatography resin medium comprising a ligand possessing a pan-AAV affinity comprises a cross-linked poly(styrene-divinylbenzene) bead coated with a cross-linked polyhydroxylated polymer. In some embodiments, the chromatography resin medium is linked to a ligand which comprises a camelid heavy-chain-only single domain antibody fragment. In some embodiments, the camelid antibody was raised against a conserved region of an AAV capsid. In some embodiments, the chromatography resin medium comprises one or more beads with a diameter of about 30-70 μm, about 40-60 μm or approximately 50 μm. In a particularly preferred embodiment, the chromatography resin medium is POROS CAPTURESELECT AAVX resin available from Thermo Fisher in a prepacked or free form.
In some embodiments, the one or more purified AAV particles comprise capsids which are filled with vector DNA. In some embodiments, the one or more purified AAV particles comprise capsids which are empty.
Several reports have described empty capsid copurification to various degrees with affinity and other types of chromatography11,12,28 It was discovered that the percent of empty capsids in AAV9 and PHP.eB preps purified using AAVX affinity chromatography to be approximately 30% (
In some embodiments, where the presence of some level of empty capsids is tolerated, no additional step is performed to separate empty capsids from capsids which contain vector DNA. In some embodiments, the presence of empty capsids may not substantially change the outcome of gene transfer utilizing the purified AAV particles disclosed herein. Indeed, the data indicate an equivalent in vivo gene transfer efficacy across multiple organs, inclusion of empty capsids notwithstanding (
In some embodiments, however, maximal reduction of empty capsid content is desirable or required. Thus, in some embodiments, various upstream or downstream steps that reduce production of empty capsids or enrich for full capsids can be added. These include optimization of plasmid transfection ratios29; use of vector plasmids that are full length or with minimal ITR deletion29; use of novel engineered ITRs; use of a transfection plasmid containing both the AAV cap and transgene in cis29, or other methods which have been reported to reduce the fraction of empty capsids in the input lysate. In some embodiments, multiple different downstream steps to enrich for full capsids include utilizing, size exclusion, anion exchange, or other chromatographic methods9,10,12,30-37, which are included within the scope of this invention. In some embodiments, these can be added in series as additional steps to the process after the AAVX affinity binding step.
In some embodiments, the method further comprises a step of neutralizing the one or more eluted fractions containing the one or more AAV particles. In some embodiments, the step of neutralizing comprises addition of tris(hydroxymethyl)aminomethane hydrochloride (TRIS-HCL) to the one or more elution fractions. In some embodiments, the TRIS-HCL is added to one or more eluted fractions in combination with a non-ionic surfactant in a neutralization buffer. In some embodiments, the neutralization buffer has a pH of about 7 to about 9. In some preferred embodiments, the neutralization buffer has a pH of about 8. In a particularly preferred embodiment, the neutralization step comprises addition of a neutralization buffer comprising 1M TRIS-HCL and 0.1% PLURONIC F68 to the one or more eluted fractions containing the one or more AAV particles, wherein the neutralization buffer has a pH of about 8.
In some embodiments, the method further comprises one or more washing steps prior to, after, or both prior to and after the elution step. In some embodiments, the one or more washing steps are carried out with a washing buffer solution comprising one or more components selected from the group consisting of tris-buffered saline (TB S), ethanol, guanidine HCL, phosphoric acid, glycine, Tris, NaOH, water, a non-ionic surfactant, and NaCl. In some embodiments, the washing step is performed after the contacting step, but before the eluting step. In some embodiments, the wash buffer solution comprises ethanol. In some embodiments, the washing buffer comprises ethanol and TBS.
In some embodiments, the chromatography resin medium linked to at least one ligand which possess pan-AAV affinity is packed into a column to provide a high performance liquid chromatography column. In some embodiments, the chromatography resin medium linked to at least one ligand which possess pan-AAV affinity is purchased pre-packed into a column. In some embodiments, the volume of chromatography resin medium is at least 0.1 mL, at least 0.5 mL, at least 1 mL, at least 2 mL, at least 3 mL, at least 4 mL, at least 5 mL, or at least 10 mL. In some embodiments, the volume of chromatography resin medium is no more than 10 L, no more than 5 L, no more than 1 L, no more than 100 mL, no more than 10 mL, no more than 5 mL, no more than 2 mL, or no more than 1 mL. In a preferred embodiment, the volume of chromatography resin medium is approximately 1 mL.
In some embodiments, a flow rate of one or both of the acidic elution buffer solution and the wash buffer solution through the chromatography resin medium during the elution or washing steps comprises a flow rate of no more than 5 mL/min, no more than 4 mL/min, no more than 3 mL/min, no more than 2 mL/min, no more than 1 mL/min, no more than 0.5 ml/min or no more than 0.1 ml/min. In some embodiments, a flow rate of one or both of the acidic elution buffer solution and the wash buffer solution through the chromatography resin medium during the elution or washing steps comprises a flow rate per minute of approximately an equal volume or less of the acidic elution buffer solution or wash buffer solution per volume of chromatography resin medium. In some embodiments, a flow rate of one or both of the acidic elution buffer solution and the wash buffer solution is 0.5 mL/min to 1 mL/min. In some embodiments, the volume of the chromatography resin medium is approximately 1 mL. In some embodiments, the flow rate of one or both of the acidic elution buffer solution and wash buffer solution is approximately 1 mL/min. In some embodiments, the volume of the chromatography resin medium is approximately 1 mL and the flow rate of one or both of the acidic elution buffer solution and wash buffer solution is 1 mL/min. In some embodiments, the volume of the chromatography resin medium is approximately 1 mL and the flow rate of one or both of the acidic elution buffer solution and wash buffer solution is 0.5 mL/min. In some embodiments, the volume of the chromatography resin medium is approximately 1 mL and the flow rate of one or both of the acidic elution buffer solution and wash buffer solution is 0.25 mL/min.
In other embodiments, a direction of flow of the elution acidic buffer solution in an elution step is opposite to a direction of flow of the cell lysate through the chromatography resin medium in the contacting step, whereby an increased quantity of AAV particles are eluted from the chromatography resin medium compared to when the directions of flow in the elution and providing steps are the same. While not wishing to be bound by theory, it is believed that when the cell lysate is contacted in a first flow direction with chromatography resin medium that has been packed into a column, AAV particles in the cell lysate will bind quickly to the chromatography resin medium very close to the point of introduction of the cell lysate. Thus, it follows that if an elution buffer is introduced in the introduction point with the same direction of flow, AAV particles may rebind to the column before they can be eluted. On the contrary, when the elution buffer is introduced at a point distal to the cell lysate introduction point and an opposite direction of flow of the elution buffer is utilized, AAV particles released from the chromatography resin will encounter far less volume of chromatography resin medium, resulting in more AAV particle eluting during this step.
In some embodiments, the method further comprises a step of capturing the at least one or more elution volume fractions. In some embodiments, the step of capturing the at least one or more elution volume fractions includes collecting all of the elution volume fraction in a single container. In some embodiments, the step of capturing the at least one or more elution volume fractions includes collecting one or more of the elution volume fractions in separate container. In some embodiments, the elution volume fractions are subjected to qPCR to determine the quantity of vector DNA present in the elution volume fraction.
In some embodiments, the method further comprises a step of sterilizing the at least one or more elution volume fractions containing the purified one or more AAV vector particles. In some embodiments, the method comprises a further step of neutralizing the one or more elution volume fractions after collection. In some embodiments, the step of neutralizing comprises addition of tris(hydroxymethyl)aminomethane hydrochloride (TRIS-HCL) to the one or more elution fractions. In some embodiments, the TRIS-HCL is added to one or more eluted fractions in combination with a non-ionic surfactant in a neutralization buffer. In some embodiments, the neutralization buffer has a pH of about 7 to about 9. In some preferred embodiments, the neutralization buffer has a pH of about 8. In a particularly preferred embodiment, the neutralization step comprises addition of a neutralization buffer comprising 1M TRIS-HCL and 0.1% PLURONIC F68 to the one or more eluted fractions containing the one or more AAV particles, wherein the neutralization buffer has a pH of about 8. In some embodiments, the neutralized one or more elution volume fractions are sterilized via a polyethersulfone syringe or cap filter. In some embodiments, the polyethersulfone syringe or cap filter is a 0.22 μm filter.
In some embodiments, the method further comprises the step of submitting the at least one or more elution volume fractions to a buffer exchange. In some embodiments, the one or more elution volume fractions may be neutralized elution volume fraction. In some embodiments, the buffer exchange occurs in an AMICON Stirred Cell concentrator or an AMICON Ultra-15 filter concentrator. In some embodiments the elution volume fractions are submitted to buffer exchange and concentrated with a molecular weight cut-off of 50 kDa or 100 kDA. In some embodiments the buffer exchange and/or concentration occurs under influence of an inert gas. In some embodiments, the inert gas is nitrogen
Also disclosed herein are particularly preferred methods of high efficiency purification of adeno-associated virus (AAV) particles comprising the steps of: a) seeding HEK293T cells onto a substrate which holds a Dulbecco's modified eagle medium (DMEM) containing 10% fetal bovine serum (FBS) and 1% mixture of penicillin G and streptomycin (penstrep) and allowing expansion of the cells until approximately 80% confluency is obtained; b) transfecting the HEK293T cells by contacting said cells with a composition that comprises DMEM, polyethylenimine, penstrep, and plasmid DNA comprising an AAV vector genome, one or more AAV capsid genes and one or more trans-acting helper genes; c) providing a clarified cell lysate that comprises one or more AAV particles by lysing the transfected HEK293T cells in situ utilizing TRITON-X 100, RNAse A, Turbonuclease and PLURONIC F68, subjecting the lysate to centrifugation at 4,000 g or higher and subsequently filtering a supernatant thus obtained by use of a 0.45 μm cellulose acetate/polyethersulfone membrane filter system; d) contacting the clarified cell lysate comprising the one or more AAV particles with a 1 mL volume of POROS CAPTURESELECT AAVX chromatography resin medium, wherein the contacting duration comprises no less than 1 minute, wherein the contacting is performed at a temperature of between approximately 21° C. to approximately 25° C. and/or both the cell lysate and the chromatography resin medium are allowed to come to a temperature between approximately 21° C. to approximately 25° C. previous to said contacting, and wherein said contacting induces binding of the one or more AAV particles to the chromatography resin medium; e) eluting the bound one or more AAV particles from the chromatography resin medium using a volume of a filtered acidic elution buffer solution having a pH between approximately 2.0 and approximately 2.5, to provide one or more eluted volume fractions containing the one or more AAV particles, wherein the filtered acidic elution buffer solution comprises 0.2M glycine and 0.01 v/v % PLURONIC F68 and wherein a flow direction of the acidic elution buffer solution through the chromatography resin medium is opposite a flow direction of the clarified cell lysate through the chromatography resin during the contacting step; f) optionally sterilizing the at least one or more elution volume fractions containing the purified one or more AAV particles utilizing a 0.2 μm polyethersulfone syringe filter; g) subjecting the one or more elution volume fractions containing the purified one or more AAV particles to buffer exchange using either AMICON UTRACEL 15 or AMICON Stirred Cell concentrators, wherein if a 50 or 100 kDA AMICON ULTRA 15 Centrifugal Filter device is used for buffer exchange, less than 1×1013 vg of AAV are subjected to buffer exchange therein to reduce sedimentation and loss; and h) regenerating the chromatography resin medium by contacting the chromatography resin medium with 0.1M phosphoric acid for at least 15 minutes, followed or preceded by contacting the chromatography resin medium with 6M guanidine for at least 15 minutes; whereby purified AAV particles are obtained with an overall efficiency of at least 65% regardless of the serotype of the AAV purified, wherein the purity, yield and bioactivity of the AAV particles purified thereby are comparable to the purity, yield and bioactivity of iodixanol purified AAV particles, wherein any plastic surface which comes into contact with the AAV particles during the method is first coated with a composition comprising PLURONIC F68, and wherein the method does not require modifications contingent on the AAV serotype being purified to obtain said efficiency.
Using AAVX, an optimized and integrated purification process for preps of up to at least 1014 vector genomes was developed. The main bottlenecks to efficiency include efficient lysis and loss or sedimentation of AAV at the buffer exchange/formulation steps. In some embodiments, in situ lysis using detergents and nucleases as well as buffer exchange using AMICON Stirred Cells were used in order to mitigate these bottlenecks. These and other modifications increased process-wide yields from clarified lysate to purified preparation to an average of approximately 75%, while allowing resin re-use without loss of efficiency for at least 6 purification cycles (
The invention is further described by way of the following Examples.
On a small scale, a panel of AAV serotypes were tested to determine whether and which serotypes POROS CaptureSelect AAVX (subsequently denoted as AAVX) can bind. To this end, AAV serotypes AAV2, AAV2_HSPG, AAV4, AAV5, AAV6.2, AAV7, AAV8, AAV9, rh10, rh32.33, PHP.B, Anc80 and AAV7m81,14-23 were produced at a small scale. Crude lysates were incubated with the AAVX resin in a static binding assay (
Next, we aimed to determine whether AAVs could be purified with the AAVX resin via HPLC at the larger, hyperflask scale (cell growth surface area of 1720 cm2) from a volume of 560 mL, AAV2 and Anc80 preps based on a single hyperflask were purified on AAVX using HPLC. In short, the production and purification process consisted of triple transfection of adherent HEK293 cells, harvest and high salt lysis 3 days post-transfection, clarification of lysate by centrifugation and filtration, AAVX affinity chromatography at room temperature, 0.22 μm syringe filter sterilization followed by a final buffer exchange and concentration step using 50 kDa molecular weight cut-off filtration (Amicon Ultracel 15). Recovery in each of the different chromatography fractions was quantified by qPCR for DNAse-resistant vector genomes (
AAVX can be Regenerated for Re-Use without Loss of Efficiency or Carryover Contamination
Next, we aimed to determine whether HPLC with AAVX can also be used to purify small-scale preps, and whether resin can be re-used multiple times without contamination or loss of efficiency. Re-using resin is of interest because it decreases the cost and labour associated with AAV purification, and allows automatic back-to-back purification of multiple preps. We produced five different AAV1 preps at small scale, whereby the vectors of the 2nd to 5th AAV1 prep were identical except for a unique 100 bp DNA barcode region. We purified the preps consecutively from prep 1 to prep 5 using the same batch of resin, which was regenerated using 6M guanidine and TBS and 20% ethanol washes between runs. We then quantified the viral vector genomes in the input lysate, the flow-through and final elution via qPCR (
Using the same method as above, we also asked whether the addition of Pluronic F-68 to HPLC buffers increases purification efficiencies. Pluronic F-68 is a surfactant that has been shown to decrease AAV binding to surfaces including plasticware24,25. As HPLC contains long and narrow plastic tubing, we reasoned that addition of Pluronic F-68 may increase purification efficiency by reducing AAV binding to plastic. To test this hypothesis, we added Pluronic F-68 to HPLC buffers to the concentration of 0.1% vol/vol and repeated the experiment described in
We also aimed to determine whether purification is affected by temperature, as HPLC machines are commonly housed and run at 4° C. or 10° C. to improve protein stability. We found that decreasing temperature from room temperature (24° C.) to 10° C. increases the fraction of input AAV in the flow-through from less than 5% to 40%-50% for AAV9 and PHP.eB (
Next, we asked whether AAVX affinity chromatographic purification of AAV can be scaled to higher amounts of input virus (1014 vg or above). Our initial experiments demonstrated that this was feasible, however those results also indicated that applying for large scale purification the same process as that used for lower amounts of input virus (
1) In situ lysis using detergents and nucleases. Based on the protocol described by Florencio et al26 and our own observations, in situ lysis using detergents and nucleases is as efficient as separate lysis of the cell pellet, and may be more efficient than in situ lysis using hypertonic salt. To obtain one-step lysis and DNAse removal, we add RNAseA (4.4 μg/ml), Turbonuclease (2.5 U/mL), Triton-X (0.5% vol/vol) and Pluronic F-68 (0.001% vol/vol) to the hyperflask and incubate for 1 hour at 150 rpm shaking, 37° C. to aid lysis with mechanical forces (see Supplementary Protocol 1 for details). Here, Triton-X and RNAseA act as primary lysis agents, Turbonuclease acts to degrade plasmid DNA, while Pluronic F-68 serves to decrease potential AAV binding to plastics.
2) Addition of Pluronic F-68 to all buffers. Based on our observation that the addition of Pluronic F-68 does not reduce HPLC purification efficiencies (Fig. S2), and based on multiple anecdotal sources indicating that the coating of plastic and/or filter surfaces with surfactants may reduce protein binding, we add Pluronic F-68 at 0.01% vol/vol concentration to the elution buffer and incubate all plasticware that comes into contact with AAV with a Pluronic F-68 containing solution (FFB: 1×PBS, 172 mM NaCl, 0.001% Pluronic F-68) for approximately 15 min at room temperature. Additionally, pipette tips and serological pipettes are also coated prior to handling AAV.
3) Stringent resin cleaning with 0.1M phosphoric acid and 6M guanidine. While we observed no loss in AAV binding efficiencies with resin re-use at small scales with AAV1 (
4) Careful buffer exchange. Our analysis indicated substantial losses at the buffer exchange step (25%-50%—not shown). This can be caused by AAV binding to plastic/filter surfaces or overconcentration on the filter surface during buffer exchange, leading to sedimentation of AAV. To mitigate loss of AAV due to binding, we pre-treated all filters/plasticware with Pluronic F-68 as described above. To reduce vector loss due to overconcentration and precipitation, we switched to Amicon Stirred Cell concentrators, which allow for use of higher volumes and continuous mixing during concentration. Alternatively, we use Amicon Ultracel 15 concentrators with frequent (every 2 minutes of centrifugation) mixing and washing of the filter and do not exceed approximately 2×1013 vg of AAV per one concentrator.
The resulting process is summarized in
To determine whether HPLC purified virus is qualitatively and quantitatively comparable to iodixanol ultracentrifugation purified virus, we compared HPLC purified virus and iodixanol purified virus on purity, empty capsid content, in vitro bioactivity and in vivo bioactivity. Analysis by gel electrophoresis indicates that HPLC purified preps are comparable to iodixanol purified preps and consist mainly of the expected VP1-VP3 bands, with little-to-no unspecific bands present (
Finally, we compared in vivo bioactivity of HPLC and iodixanol purified viruses. We injected a total of 1011 vector genomes of self-complementary AAV9 carrying a Cbh-EGFP expression cassette retro-orbitally into 6-week-old wild-type male C57BL/6J mice. We euthanized mice 4 weeks post-injection and assayed AAV DNA levels and biodistribution as well as GFP expression in liver, quadriceps and brain. Transgene DNA, RNA and protein levels did not significantly differ between AAVX-HPLC and iodixanol purified viruses for any tissues (
All AAV vectors were produced in HEK293 cells via the triple plasmid transient transfection method as described previously 6. For small scale preps (
For hyperflask scale preps described in
For hyperscale preps described in
Iodixanol-ultracentrifugation purified preps were produced in the Gene Transfer Vector Core at Schepens Eye Research Institute. HEK 293 cells were seeded and transfected into hyperflasks, followed by benzonase (E8263 Sigma-Aldrich) treatment and high salt lysis as described above, then lysate clarification, concentration of the lysate using tangential-flow filtration, iodixanol gradient ultracentrifugation and buffer exchange for FFB (Final Formulation Buffer: 1×PBS, 172 mM NaCl, 0.001% Pluronic F-68).
AAV purification was performed using AAVX POROS CaptureSelect (ThermoFisher Scientific) resin bought as pre-packed 1 ml columns (Thermo Fisher A36652) or resin (Thermo Fisher A36741) with 6.6 mm×100 mm column (Glass, Omnifit, kinesis-USA) in an AKTA Pure 25 liter HPLC system (29018224 GE Life Sciences) containing an auxiliary sample pump S9 (29027745 GE LifeSciences). The machine was setup at room temperature and all purifications were performed at room temperature (approximately 24° C.), except for experiments described in
Lysate was clarified at most 1 day prior to loading onto the HPLC and warmed up to room temperature prior to loading. Lysate was loaded at a flow rate to resin volume ratio ensuring approximately 2 minute residence time in the resin, normally using 1 ml of resin (AAVX and a flow rate of 0.5 ml/min, or 4 ml resin with a flow rate of 2 ml/min. At least 1 ml of resin per one hyperflask was used; if preps from multiple hyperflasks were pooled, the volume of resin was increased accordingly.
For purifications using 1 ml of resin, the column containing bound AAV was then washed with 10 [CV] of 1×TBS, followed by washes of 5 [CV] of 2×TBS, 10 [CV] 20% ethanol and 10 [CV] 1×TBS wash. The bound AAV was eluted using a low-pH (pH 2.5 to 2.9) buffer of 0.2 M Glycine in 1×TBS, containing 0.1% vol/vol Pluronic F-68 at a rate of 1 ml/minute. Resin was then washed with 10 [CV] of 1×TBS regenerated with 15 [CV] 0.1M pH 1 phosphoric acid and 15 [CV] 6 M guanidine HCl at flow rate of 1 ml/min, and washed again with 10 [CV] 20% ethanol and 10 [CV] 1×TBS. Elution fractions were taken as 1 ml volumes per fraction. The eluted virus solution was neutralized by adding 1 M Tris-HCL (pH 8.0) at 1/10th of the fraction volume directly into the fraction collection tube prior to elution. Peak fractions based on UV (280 nm) absorption graphs were collected, filter sterilized using 0.2 μm PES syringe filters (Corning 431229), buffer exchanged using either Amicon Ultracel (Merck Millipore UFC910008) or Amicon Stirred Cell (Merck Millipore UFSC05001) concentrators with a molecular weight cut-off of 50 kDa or 100 kDa (UFC905008 EMD Millipore) prior to virus titration. For Amicon Stirred Cell concentrator, high-purity nitrogen gas (NI UHP80 Airgas) was used at 40-70 psi as a pressure source. All plasticware and tips were coated or incubated with FFB for approximately 15 minutes at room temperature prior to applying AAV containing solutions at any step of the purification process.
In brief, genomic titer was determined by a quantitative PCR (TaqMan, Life Technologies) as well as digital droplet PCR (ddPCR). For qPCR, real-time qPCR (7500 Real-Time PCR System; Applied Biosystems, Foster City, CA, USA) with EGFP-targeted primer-probes (AGCAAAGACCCCAACGAGAA (SEQ ID NO: 1), GGCGGCGGTCACGAA (SEQ ID NO: 2), 6FAM-CGCGATCACATGGTCCTGCTGG-TAMRA (SEQ ID NO: 3)) was used. Linearized CBA-EGFP DNA at a series of dilutions of known concentration as a standard was used. After 95° C. holding stage for 10 seconds, two-step PCR cycling stage was performed at 95° C. for 5 seconds, followed by 60° C. for 5 seconds for 40 cycles. Genomic vector titers were interpolated from the standard. qPCR was used to determine titers for experiments described in
For ddPCR, QX200 ddPCR system (Biorad) using the same EGFP-targeted primers-probes were used as above. ddPCR and titer estimation was performed as previously described in Sanmiguel et al.40. ddPCR was used to estimate titers for experiments described in
All materials and reagents used were purchased from Life Technologies. Equal vector genome of AAV were loaded on a NUPAGE 4-12% Bis-Tris polyacrylamide gel (Life Technologies, Grand Island, NJ) and subjected to electrophoresis at 150 V for 1 h and 30 min. For each AAV preparation, a volume corresponding to a titer of 1010 vg was mixed with 5 μl 4×NuPAGE lithium dodecyl sulfate (LDS) sample buffer and 1×PBS (21-031-CM, Corning) to 20 μl total volume and heat denatured at 70° C. for 5 min.
SYPRO Ruby Protein Gel Stain (ThermoFisher Scientific, Waltham, MA, USA) was applied per the manufacturer's protocol to visualize and analyse SDS-PAGE bands. In brief, the gel was fixed in 7% Glacial Acetic Acid, 50% methanol (ACS grade, Fisher Scientific) in ultra-pure water, for 15 minutes at 21° C. (room temperature) by gentle agitation. Fixation was repeated once more before gel was rinsed with ultra-pure water. Gel was stained with SYPRO Ruby as follows: 30 seconds microwave, 30 seconds agitation, 30 seconds microwave, 5 minutes agitation, 30 seconds microwave, 23 minutes agitation. Gel was rinsed with ultra-pure water and destained with 7% Glacial Acetic Acid, 10% methanol for 30 minutes at 21° C. (room temperature) by gentle agitation. Proteins stained with the dye were visualized with a 302 nm UV transilluminator (ChemiDoc XRS+Biorad).
Purified and formulated AAV from different preps was diluted to 1013 vg/ml and submitted for negative stain and transmission electron microscopy analysis at Harvard Medical School Electron Microscopy Core. In short, the sample is diluted in water and adsorbed onto a glow-discharged carbon or formvar/carbon coated grid. Once the specimen has been adsorbed on to the film surface, the excess liquid is blotted off using a filter paper (Whatman #1) and the grid is floated on a small drop (˜5 μl) of staining solution (most commonly 0.75% uranyl formate, 1% uranyl acetate or 1-2% PTA). After 20 seconds the excess stain is blotted off and the sample is air dried briefly before it is examined in the transmission electron microscope. At least two images were taken per prep at 30,000× magnification, and at least 200 virions were counted manually per image by two researchers blinded to the identity of the image, and empty and full ratios averaged between resulting counts. Due to the difficulty in confidently differentiating full and partially filled capsids using electron micrographs, virions were counted as empty and full only based on the criteria described in 39. On the minority of cases where a virion could not be confidently assigned to either (<1% capsids) the virion was not counted. Similarly, virions were not counted in areas of images, with image noise, artefacts, clumping, or other effects that obscure a clear classification of the virion type.
For
HEK293 cells were seeded at 2×105 cells/well and infected 24 hr later, in triplicate, with AAV at an MOI (multiplicity of infection) of 103 or 105 vg/cell in a 500-μl volume for AAV2 and Anc80 respectively. The media was replaced 24 hr post-infection with 1 ml of complete DMEM containing 10% (vol/vol) heat-inactivated fetal bovine serum (FBS), and 100 U/ml penicillin and 100 μg/ml streptomycin. Cells were then imaged using BioRad imaging system.
All animal procedures were performed with the approval of the Institutional Animal Care and Use Committee (IACUC) at Schepens Eye Research Institute. For assaying in vivo potency and transduction, self-complementary AAV9 carrying a Cbh-EGFP expression cassette was produced at hyperflask scale and purified with AAVX-HPLC or iodixanol ultracentrifugation, concentrated in FFB and stored at −80° C. until use. 6-week old male C57BL/6J mice were then injected retro-orbitally with a total dose of 1011 vector genomes (in 100 μl volume of FFB) per mouse. Mice were euthanized 4 weeks post-injection and brain, quadriceps and liver harvested. One part of each tissue was snap frozen in liquid nitrogen for analysis of viral DNA and GFP RNA and protein (see below). Another part of each tissue was fixed in PFA for later sectioning (see Imaging and image analysis).
Tissues were homogenized by disrupting 30 mg of tissue in 1 ml of RLT+buffer for DNA and RNA and 1 ml of RIPA buffer containing 1×Halt protease and phosphatase inhibitors for protein (78444 Thermo Fisher Sci). For disruption, samples, buffer and 1 mm Zirconia/Silica beads (11079110z Biospec) were loaded into XXtuff vials (330TX BioSpec) and disrupted using Mini Beadbeater 24 (112011 BioSpec) at max speed for 3 minutes. Vials were then placed on ice for 2-5 minutes for RNA and 1 hour for protein, centrifuged at 10 000 g for 3 min and supernatant used for further procedures.
For DNA/RNA, 700 μl of supernatant was loaded onto AllPrep DNA Mini Spin Columns and purified using AllPrep DNA/RNA/miRNA Universal Kit (80224 Qiagen) for quadriceps and Allprep DNA/RNA mini kit (80204 Qiagen) for brain and liver. Purification was performed on Qiacube Connect (9002864 Qiagen).
Total AAV copy number was assessed using GFP primers and linearized CBA-GFP plasmid dilution series as standard for AAV copy number (AGCAAAGACCCCAACGAGAA (SEQ ID NO: 1), GGCGGCGGTCACGAA (SEQ ID NO: 2), 6FAM-CGCGATCACATGGTCCTGCTGG-TAMRA (SEQ ID NO: 3)). Total genome copy number was estimated using RPII primers-probes (GTTTTCATCACTGTTCATGATGC (SEQ ID NO: 4), TCATGGGCATTACTATTCCTAC (SEQ ID NO: 5), probe: VIC-AGGACCAGCTTCTCTGCATTATCATCGTTGAAGAT-3IABkFQ (SEQ ID NO: 6)) along with a standard of gDNA dilution series of known concentration. AAV copy number per diploid genome was then calculated as
Efficiency and specificity of amplification for both primer-probe sets was previously established, and amplification was performed using Luna Universal Probe qPCR Master Mix (M3004 L NEB) at thermocycling conditions recommended by the manufacturer.
For quantification of GFP RNA expression, RNA extracted from tissues was first treated with DNAse (DNA-Free™ DNA Removal Kit AM1906, Thermo Fisher) and then reverse transcribed and amplified using Luna Universal Probe One-Step RT-qPCR Kit (E3006 L NEB) according to manufacturer's instructions. Primer-probe sets for GFP RNA (AGCAAAGACCCCAACGAGAA (SEQ ID NO: 1), GGCGGCGGTCACGAA (SEQ ID NO: 2), 6FAM-CGCGATCACATGGTCCTGCTGG-TAMRA (SEQ ID NO: 3)) and RPII RNA (GTTTTCATCACTGTTCATGATGC (SEQ ID NO: 4), AATCAATGCAGGTTTTGGCGATG (SEQ ID NO: 7), probe: VIC-AGGACCAGCTTCTCTGCATTATCATCGTTGAAGAT-3IABkFQ (SEQ ID NO: 6)) were used. Controls lacking reverse transcriptase were ran to preclude signal from DNA contamination. Expression of GFP RNA normalized to RPII RNA was then calculated as 2−(Ct
For quantification of GFP protein expression, protein lysate was first diluted 5× twice in fresh RIPA+Halt inhibitors buffer and all dilutions were assayed for total protein content using Pierce™ BCA Protein Assay Kit (23225 Thermo Fisher). For each tissue type, lysates were then diluted in RIPA+Halt inhibitors buffer to the concentration where they would be at the lower end of the linear range for GFP quantification using anti-GFP antibody ab290 (ab290 Abcam) on Wes (Protein Simple). Linear range for GFP quantification was previously determined by assaying GFP using 12-230 kDa Jess or Wes Separation Module (SM-W004 Protein Simple) on Wes with ab290 for dilutions ranging from 3 μg/μl to 0.03 μg/μl (linear range: liver <0.3 μg/μl, brain 0.3 μg/μl to 1.5 μg/μl, quadriceps 0.03 μg/μl to 1.3 μg/μl). Linear range for total protein was also previously determined by assaying total protein in the range of 4 μg/μl- to 0.1 μg/μl using Total Protein Detection Module (DM-TP01 Protein Simple) (linear range: <1 μg/μl for all tissues tested). GFP and total protein levels were then assayed and GFP and total protein quantified using Compass for SW 4.1 (Protein Simple). Finally, GFP was normalized to total protein to arrive at the final value.
Tissues were fixed in 1% PFA for 4 hours and then 4% PFA for 1 hour at room temperature (21° C.). Fixed tissues were then washed with 1×PBS three times for 5 min, placed in 30% sucrose for approximately 48 hours at 4° C., and frozen in OCT blocks by submersion into isopentane cooled by liquid nitrogen. Blocks were then sectioned at 12 μm thickness using iHisto cryosectioning service (iHisto, Inc.). Sections were kept at −80° C. until staining. Sections were blocked using Blocking buffer (10% Normal Goat Serum (NGS), 2% Bovine Serum Albumin (BSA), 0.1% Tween-20) for 1 hour, washed 3×5 min with PBS-T (PBS+0.1% Tween-20), stained with Tomato lectin at 10 μg/ml (DL-1177 Vector Laboratories) for 1 hour, washed 3×5 min with PBS-T, stained with DAPI for 5 min at 1:1000 stock concentration (D1306 Thermo Fisher), mounted for 15 minutes (H-1400 Vector Laboratories) and imaged for native GFP, tomato lectin and DAPI. All actions were performed at 21° C. in a dark room. Slides were imaged using a Zeiss Axio Observer D1 microscope (exposure times were set such that signal intensities from samples with the brightest signals would appear in the lower third of the histogram). Exposures were kept constant between all samples for all three colours imaged. For each tissue, two sections from the middle of the tissue were imaged, with 6-8 fields total imaged at 200× magnification.
Three images of different sites were then selected, all cells within the images circled for regions of interest (ROIs) and cell GFP mean fluorescence intensity quantified within ROIs in Fiji 41. Cells were circled conservatively to make sure only individual cells were circled. A total of 400-700 cells were quantified per animal, and mean fluorescence intensity values across different cells averaged to arrive at an overall liver GFP mean fluorescence intensity per animal.
To generate the phylogeny, first 19 representative AAV capsids were chosen, including an avian AAV (VR-865) for use as an outgroup for eventual tree rooting. The VP1 amino acid sequences from all of these different isolates were aligned through ClustalOmega42 as implemented on the EMBL-EBI webserver43. Substitutions models and parameters for an eventual maximum likelihood (ML) phylogenic analysis were evaluated by ProtTest344, and the best fitting model by the Aikake Information Criterion (AIC) was selected. The model best describing the set of AAV sequences was the Le & Gascuel model45, with a discrete Gamma distribution (5 categories) to model rate differences among sites within the alignment. This model was used to construct a ML phylogeny through MEGA X46, before being exported and visualized through phytools47. See Supplementary
All data was visualized, and statistical analysis was performed in GraphPad Prism (GraphPad). Specific statistical tests used are listed in figure legends for each test, and all tests were performed with default settings unless otherwise specified.
Approximately 1 month prior to the start of AAV production, ensure you have all the required reagents (below). Order any that are missing and produce DNA with endo-toxin free kits.
A thorough and detailed protocol for AAV titration using qPCR or ddPCR is described in Sanmiguel, J., Gao, G., & Vandenberghe, L. H. (2019). Quantitative and Digital Droplet-Based AAV Genome Titration. Adeno-Associated Virus Vectors, 51-83. doi:10.1007/978-1-4939-9139-6_4. We recommend performing AAV titrations based these protocols.
A single hyperflask in our hands consistently yields an average of 3×1013 vg of purified AAV with well producing transgenes such as CMV-GFP for both single stranded vectors and self-complementary vectors. While some transgenes or serotypes may inherently produce at lower yields, yields below 1×1013 vg per hyperflask likely indicate a technical issue somewhere in the process.
Elution UV peak height roughly correlates with AAV yield. A peak of approximately the height (given efficient packing of the column) of the loading UV plateau for a single hyperflask generally indicates a yield of 1-3×1013 vg. Elution peaks much lower than (or with a lower area under the curve) indicate inefficient AAV production or purification. When no or very low elution peak is present, it is recommended to troubleshoot before proceeding to buffer exchange to save time and resources.
Low elution peak or low final AAV yield
(on by default in the AAVX_HPLC_S1 protocol)?
Application step is selected. We recommend terminating the program, placing the Sample line into a separate tube of TBS, manually performing priming and purging, placing the line back into sample and re-starting the run.
For users with Akta Pure systems we highly recommend importing the AAVX_HPLC_S1 and System_CIP protocols to avoid unwanted errors.
This application claims the benefit of U.S. Provisional Application No. 63/324,618, filed on Mar. 28, 2022. The entire teachings of the above application(s) are incorporated herein by reference.
This invention was made with government support under grant awarded by National Institutes of Health. The government has certain rights in the invention.
| Number | Date | Country | |
|---|---|---|---|
| 63324618 | Mar 2022 | US |