Human .beta..sub.2 integrin .alpha. subunit

FIELD OF THE INVENTION
The present invention relates to the cloning and expression of nucleotide sequences encoding a novel human .beta..sub.2 integrin .alpha. subunit, designated .alpha..sub.d, which is structurally related to the known human .beta..sub.2 integrin .alpha. subunits, CD11a, CD11b and CD11c. The present invention also relates to nucleotide sequences isolated other species which show homology to human .alpha..sub.d encoding sequences.
BACKGROUND OF THE INVENTION
The integrins are a class of membrane-associated molecules which actively participate in cellular adhesion. Integrins are transmembrane heterodimers comprising an .alpha. subunit in noncovalent association with a .beta. subunit. To date, at least fourteen .alpha. subunits and eight .beta. subunits have been identified [reviewed in Springer, Nature 346:425-434 (1990)]. The .beta. subunits are generally capable of association with more than one .alpha. subunit and the heterodimers sharing a common .beta. subunit have been classified as subfamilies within the integrin population.
One class of human integrins, restricted to expression in white blood cells, is characterized by a common .beta..sub.2 subunit. As a result of this cell-specific expression, these integrins are commonly referred to as the leukocyte integrins, Leu-CAMs or leukointegrins. Because of the common .beta..sub.2 subunit, an alternative designation of this class is the .beta..sub.2 integrins. The .beta..sub.2 subunit (CD18) has previously been isolated in association with one of three distinct .alpha. subunits, CD11a, CD11b or CD11c. The isolation of a cDNA encoding human CD18 is described in Kishimoto, et al., Cell 48:681-690 (1987). In official WHO nomenclature, the heterodimeric proteins are referred to as CD11a/CD18, CD11b/CD18, and CD11c/CD18; in common nomenclature they are referred to as LFA-1, Mac-1 or Mol and p150,95 or LeuM5, respectively [Cobbold, et al., in Leukocyte Typing III, McMichael (ed), Oxford Press, p.788 (1987)]. The human .beta..sub.2 integrin .alpha. subunits CD11a, CD11b and CD11c have been demonstrated to migrate under reducing condition in electrophoresis with apparent molecular weights of approximately 180 kD, 155 kD and 150 kD, respectively, and DNAs encoding these subunits have been cloned [CD11a, Larson, et al., J. Cell Biol. 108:703-712 (1989); CD11b, Corbi, et al., J. Biol. Chem. 263:12403-12411 (1988) and CD11c, Corbi, et al. EMBO J. 6:4023-4028 (1987)]. Putative homologs of the human .beta..sub.2 integrin .alpha. and .beta. chains, defined by approximate similarity in molecular weight, have been variously identified in other species including monkeys and other primates [Letvin, et al., Blood 61:408-410 (1983)], mice [Sanchez-Madrid, et al., J. Exp. Med. 154:1517 (1981)], and dogs [Moore, et al., Tissue Antigens 36:211-220 (1990)].
The absolute molecular weights of presumed homologs from other species have been shown to vary significantly [see, e.g., Danilenko et al., Tissue Antigens 40:13-21 (1992)], and in the absence of sequence information, a definitive correlation between human integrin subunits and those identified in other species has not been possible. Moreover, variation in the number of members in a protein family has been observed between different species. Consider, for example, that more IgA isotypes have been isolated in rabbits than in humans [Burnett, et al., EMBO J. 8:4041-4047 (1989) and Schneiderman, et al., Proc. Natl. Acad. Sci.(USA) 86:7561-7565 (1989)]. Similarly, in humans, at least six variants of the metallothionine protein have been previously identified [Karin and Richards, Nature 299:797-802 (1982) and Varshney, et al., Mol. Cell. Biol. 6:26-37, (1986)], whereas in the mouse, only two such variants are in evidence [Searle, et al., Mol. Cell. Biol. 4:1221-1230 (1984)]. Therefore, existence of multiple members of a protein family in one species does not necessarily imply that corresponding family members exist in another species.
In the specific context of .beta..sub.2 integrins, in dogs it has been observed that the presumed canine .beta..sub.2 counterpart to the human CD18 is capable of dimer formation with as many as four potentially distinct .alpha. subunits [Danilenko, et al., supra]. Antibodies generated by immunizing mice with canine splenocytes resulted in monoclonal antibodies which immunoprecipitated proteins tentatively designated as canine homologs to human CD18, CD11a, CD11b and CD11c based mainly on similar, but not identical, molecular weights. Another anti-canine splenocyte antibody, Ca11.8H2, recognized and immunoprecipitated a fourth .alpha.-like canine subunit also capable of association with the .beta..sub.2 subunit, but having a unique molecular weight and restricted in expression to a subset of differentiated tissue macrophages. Antibodies generated by immunization of hamsters with murine dendritic cells resulted in two anti-integrin antibodies [Metlay, et al., J. Exp. Med. 171:1753-1771 (1990)]. One antibody, 2E6, immunoprecipitated a predominant heterodimer with subunits having approximate molecular weights of 180 kD and 90 kD in addition to minor bands in the molecular weight range of 150-160 kD. The second antibody, N418, precipitated another apparent heterodimer with subunits having approximate molecular weights of 150 kD and 90 Kd. Based on cellular adhesion blocking studies, it was hypothesized that antibody 2E6 recognized a murine counterpart to human CD18. While the molecular weight of the N418 antigen suggested recognition of a murine homolog to human CD11c/CD18, further analysis indicated that the murine antigen exhibited a tissue distribution pattern which was inconsistent with that observed for human CD11c/CD18.
The antigens recognized by the canine Ca11.8H2 antibody and the murine N418 antibody could represent a variant species (e.g., a glycosylation or splice variant) of a previously identified canine or murine .alpha. subunit. Alternatively, these antigens may represent unique canine and murine integrin .alpha. subunits. In the absence of specific information regarding primary structure, these alternatives cannot be distinguished.
In humans, CD11a/CD18 is expressed on all leukocytes. CD11b/CD18 and CD11c/CD18 are essentially restricted to expression on monocytes, granulocytes, macrophages and natural killer (NK) cells, but CD11c/CD18 is also detected on some B-cell types. In general, CD11a/CD18 predominates on lymphocytes, CD11b/CD18 on granulocytes and CD11c/CD18 on macrophages [see review, Arnaout, Blood 75:1037-1050 (1990)]. Expression of the .alpha. chains, however, is variable with regard to the state of activation and differentiation of the individual cell types [See review, Larson and Springer, Immunol. Rev. 114:181-217 (1990).]
The involvement of the .beta..sub.2 integrins in human immune and inflammatory responses has been demonstrated using monoclonal antibodies which are capable of blocking .beta..sub.2 integrin-associated cell adhesion. For example, Cd11a/CD18, CD11b/CD18 and CD11c/CD18 actively participate in natural killer (NK) cell binding to lymphoma and adenocarcinoma cells [Patarroyo, et al., J. Immunol. Rev. 114:67-108 (1990)], granulocyte accumulation [Nourshargh, et al., J. Immunol. 142:3193-3198 (1989)], granulocyte-independent plasma leakage [Arfors, et al., Blood 69:338-340 (1987)], chemotactic response of stimulated leukocytes [Arfors, et al., supra] and leukocyte adhesion to vascular endothelium [Price, et al., J. Immunol. 139:4174-4177 (1987) and Smith, et al., J. Clin. Invest. 83:2008-2017 (1989)]. The fundamental role of .beta..sub.2 integrins in immune and inflammatory responses is made apparent in the clinical syndrome referred to as leukocyte adhesion deficiency (LAD), wherein clinical manifestations include recurrent and often life threatening bacterial infections. LAD results from heterogeneous mutations in the .beta..sub.2 subunit [Kishimoto, et al., Cell 50:193-202 (1987)] and the severity of the disease state is proportional to the degree of the deficiency in .beta..sub.2 subunit expression. Formation of the complete integrin heterodimer is impaired by the .beta..sub.2 mutation [Kishimoto, et al., supra].
Interestingly, at least one antibody specific for CD18 has been shown to inhibit human immunodeficiency virus type-1 (HIV-1) syncytia formation in vitro, albeit the exact mechanism of this inhibition is unclear [Hildreth and Orentas, Science 244:1075-1078 (1989)]. This observation is consistent with the discovery that a principal counterreceptor of CD11a/CD18, ICAM-1, is also a surface receptor for the major group of rhinovirus serotypes [Greve, et al., Cell 56:839 (1989)].
The significance of .beta..sub.2 integrin binding activity in human immune and inflammatory responses underscores the necessity to develop a more complete understanding of this class of surface proteins. Identification of yet unknown members of this subfamily, as well as their counterreceptors, and the generation of monoclonal antibodies or other soluble factors which can alter biological activity of the .beta..sub.2 integrins will provide practical means for therapeutic intervention in .beta..sub.2 integrin-related immune and inflammatory responses.
BRIEF DESCRIPTION OF THE INVENTION
In one aspect, the present invention provides novel purified and isolated polynucleotides (e.g., DNA and RNA transcripts, both sense and antisense strands) encoding a novel human .beta..sub.2 integrin .alpha. subunit, .alpha..sub.d, and variants thereof (i.e., deletion, addition or substitution analogs) which possess binding and/or immunological properties inherent to .alpha..sub.d. Preferred DNA molecules of the invention include cDNA, genomic DNA and wholly or partially chemically synthesized DNA molecules. A presently preferred polynucleotide is the DNA as set forth in SEQ ID NO: 1, encoding the polypeptide of SEQ ID NO: 2. Also provided are recombinant plasmid and viral DNA constructions (expression constructs) which include .alpha..sub.d encoding sequences, wherein the .alpha..sub.d encoding sequence is operatively linked to a homologous or heterologous transcriptional regulatory element or elements.
Also provided by the present invention are isolated and purified mouse and rat polynucleotides which exhibit homology to polynucleotides encoding human .alpha..sub.d. A preferred mouse polynucleotide is set forth in SEQ ID NO: 45; a preferred rat polynucleotide is set forth in SEQ ID NO: 36.
As another aspect of the invention, prokaryotic or eukaryotic host cells transformed or transfected with DNA sequences of the invention are provided which express .alpha..sub.d polypeptide or variants thereof. Host cells of the invention are particularly useful for large scale production of .alpha..sub.d polypeptide, which can be isolated from either the host cell itself or from the medium in which the host cell is grown. Host cells which express .alpha..sub.d polypeptide on their extracellular membrane surface are also useful as immunogens in the production of .alpha..sub.d -specific antibodies. Preferably, host cells transfected with .alpha..sub.d will be cotransfected to express a .beta..sub.2 integrin subunit in order to allow surface expression of the heterodimer.
Also provided by the present invention are purified and isolated .alpha..sub.d polypeptides, fragments and variants thereof. Preferred .alpha..sub.d polypeptides are as set forth in SEQ ID NO: 2. Novel .alpha..sub.d products of the invention may be obtained as isolates from natural sources, but, along with .alpha..sub.d variant products, are preferably produced by recombinant procedures involving host cells of the invention. Completely glycosylated, partially glycosylated and wholly deglycosylated forms of the .alpha..sub.d polypeptide may be generated by varying the host cell selected for recombinant production and/or post-isolation processing. Variant .alpha..sub.d polypeptides of the invention may comprise water soluble and insoluble .alpha..sub.d polypeptides including analogs wherein one or more of the amino acids are deleted or replaced: (1) without loss, and preferably with enhancement, of one or more biological activities or immunological characteristics specific for .alpha..sub.d ; or (2) with specific disablement of a particular ligand/receptor binding or signalling function. Fusion polypeptides are also provided, wherein .alpha..sub.d amino acid sequences are expressed contiguously with amino acid sequences from other polypeptides. Such fusion polypeptides may possess modified biological, biochemical, and/or immunological properties in comparison to wild-type .alpha..sub.d. Analog polypeptides including additional amino acid (e.g., lysine or cysteine) residues that facilitate multimer formation are contemplated.
Also comprehended by the present invention are polypeptides and other non-peptide molecules which specifically bind to .alpha..sub.d. Preferred binding molecules include antibodies (e.g., monoclonal and polyclonal), counterreceptors (e.g., membrane-associated and soluble forms) and other ligands (e.g., naturally occurring or synthetic molecules), including those which competitively bind .alpha..sub.d in the presence of .alpha..sub.d monoclonal antibodies and/or specific counterreceptors. Binding molecules are useful for purification of .alpha..sub.d polypeptides and identifying cell types which express .alpha..sub.d. Binding molecules are also useful for modulating (i.e., inhibiting, blocking or stimulating) of in vivo binding and/or signal transduction activities of .alpha..sub.d.
Assays to identify .alpha..sub.d binding molecules are also provided, including immobilized ligand binding assays, solution binding assays, scintillation proximity assays, di-hybrid screening assays, and the like.
In vitro assays for identifying antibodies or other compounds that modulate the activity of .alpha..sub.d may involve, for example, immobilizing .alpha..sub.d or a natural ligand to which .alpha..sub.d binds, detectably labelling the nonimmobilized binding partner, incubating the binding partners together and determining the effect of a test compound on the amount of label bound wherein a reduction in the label bound in the presence of the test compound compared to the amount of label bound in the absence of the test compound indicates that the test agent is an inhibitor of .alpha..sub.d binding.
Another type of assay for identifying compounds that modulate the interaction between .alpha..sub.d and a ligand involves immobilizing .alpha..sub.d or a fragment thereof on a solid support coated (or impregnated with) a fluorescent agent, labelling the ligand with a compound capable of exciting the fluorescent agent, contacting the immobilized .alpha..sub.d with the labelled ligand in the presence and absence of a putative modulator compound, detecting light emission by the fluorescent agent, and identifying modulating compounds as those compounds that affect the emission of light by the fluorescent agent in comparison to the emission of light by the fluorescent agent in the absence of a modulating compound. Alternatively, the .alpha..sub.d ligand may be immobilized and .alpha..sub.d may be labelled in the assay.
Yet another method contemplated by the invention for identifying compounds that modulate the interaction between .alpha..sub.d and a ligand involves transforming or transfecting appropriate host cells with a DNA construct comprising a reporter gene under the control of a promoter regulated by a transcription factor having a DNA-binding domain and an activating domain, expressing in the host cells a first hybrid DNA sequence encoding a first fusion of part or all of .alpha..sub.d and either the DNA binding domain or the activating domain of the transcription factor, expressing in the host cells a second hybrid DNA sequence encoding part or all of the ligand and the DNA binding domain or activating domain of the transcription factor which is not incorporated in the first fusion, evaluating the effect of a putative modulating compound on the interaction between .alpha..sub.d and the ligand by detecting binding of the ligand to .alpha..sub.d in a particular host cell by measuring the production of reporter gene product in the host cell in the presence or absence of the putative modulator, and identifying modulating compounds as those compounds altering production of the reported gene product in comparison to production of the reporter gene product in the absence of the modulating compound. Presently preferred for use in the assay are the ADHI promoter, the lexA DNA binding domain, the GAL4 transactivation domain, the lacZ reporter gene, and a yeast host cell.
A modified version of the foregoing assay may be used in isolating a polynucleotide encoding a protein that binds to .alpha..sub.d by transforming or transfecting appropriate host cells with a DNA construct comprising a reporter gene under the control of a promoter regulated by a transcription factor having a DNA-binding domain and an activating domain, expressing in the host cells a first hybrid DNA sequence encoding a first fusion of part or all of .alpha..sub.d and either the DNA binding domain or the activating domain of the transcription factor, expressing in the host cells a library of second hybrid DNA sequences encoding second fusions of part or all of putative .alpha..sub.d binding proteins and the DNA binding domain or activating domain of the transcription factor which is not incorporated in the first fusion, detecting binding of an .alpha..sub.d binding protein to .alpha..sub.d in a particular host cell by detecting the production of reporter gene product in the host cell, and isolating second hybrid DNA sequences encoding .alpha..sub.d binding protein from the particular host cell.
Hybridoma cell lines which produce antibodies specific for .alpha..sub.d are also comprehended by the invention. Techniques for producing hybridomas which secrete monoclonal antibodies are well known in the art. Hybridoma cell lines may be generated after immunizing an animal with purified .alpha..sub.d, variants of .alpha..sub.d or cells which express .alpha..sub.d or a variant thereof on the extracellular membrane surface. Immunogen cell types include cells which express .alpha..sub.d in vivo, or transfected prokaryotic or eukaryotic cell lines which normally do not normally express .alpha..sub.d in vivo.
The value of the information contributed through the disclosure of the DNA and amino acid sequences of .alpha..sub.d is manifest. In one series of examples, the disclosed .alpha..sub.d CDNA sequence makes possible the isolation of the human .alpha..sub.d genomic DNA sequence, including transcriptional control elements for the genomic sequence. Identification of .alpha..sub.d allelic variants and heterologous species (e.g., rat or mouse) DNAs is also comprehended. Isolation of the human .alpha..sub.d genomic DNA and heterologous species DNAs can be accomplished by standard DNA/DNA hybridization techniques, under appropriately stringent conditions, using all or part of the .alpha..sub.d CDNA sequence as a probe to screen an appropriate library. Alternatively, polymerase chain reaction (PCR) using oligonucleotide primers that are designed based on the known CDNA sequence can be used to amplify and identify genomic .alpha..sub.d DNA sequences. Synthetic DNAs encoding the .alpha..sub.d polypeptide, including fragments and other variants thereof, may be produced by conventional synthesis methods.
DNA sequence information of the invention also makes possible the development, by homologous recombination or "knockout" strategies [see, e.g., Kapecchi, Science 244:1288-1292 (1989)], to produce rodents that fail to express a functional .alpha..sub.d polypeptide or that express a variant .alpha..sub.d polypeptide. Such rodents are useful as models for studying the activities of .alpha..sub.d and .alpha..sub.d modulators in vivo.
DNA and amino acid sequences of the invention also make possible the analysis of .alpha..sub.d epitopes which actively participate in counterreceptor binding as well as epitopes which may regulate, rather than actively participate in, binding. Identification of epitopes which may participate in transmembrane signal transduction is also comprehended by the invention.
DNA of the invention is also useful for the detection of cell types which express .alpha..sub.d polypeptide. Standard DNA/RNA hybridization techniques which utilize .alpha..sub.d DNA to detect .alpha..sub.d RNA may be used to determine the constitutive level of .alpha..sub.d transcription within a cell, as well as changes in the level of transcription in response to internal or external agents. Identification of agents which modify transcription and/or translation of .alpha..sub.d can, in turn, be assessed for potential therapeutic or prophylactic value. DNA of the invention also makes possible in situ hybridization of .alpha..sub.d DNA to cellular RNA to determine the cellular localization of .alpha..sub.d specific messages within complex cell populations and tissues.
DNA of the invention is also useful for identification of non-human polynucleotide sequences which display homology to human .alpha..sub.d sequences. Possession of non-human .alpha..sub.d DNA sequences permits development of animal models (including, for example, transgenic models) of the human system.
As another aspect of the invention, monoclonal or polyclonal antibodies specific for .alpha..sub.d may be employed in immunohistochemical analysis to localize .alpha..sub.d to subcellular compartments or individual cells within tissues. Immunohistochemical analyses of this type are particularly useful when used in combination with in situ hybridization to localize both .alpha..sub.d mRNA and polypeptide products of the .alpha..sub.d gene.
Identification of cell types which express .alpha..sub.d may have significant ramifications for development of therapeutic and prophylactic agents. It is anticipated that the products of the invention related to .alpha..sub.d can be employed in the treatment of diseases wherein macrophages are an essential element of the disease process.
For example, in BB rats which spontaneously develop type 1 or insulin dependent diabetes, macrophages have been documented as the predominant immune cell infiltrating the earliest detectable pancreatic lesions [Hanenberg, et al., Diabetologia 32:126-134 (1989)]. Non-specific removal of macrophages from the system prevents the onset of diabetes. It is therefore anticipated that .alpha..sub.d may play a significant role either in the initial sequestration of the macrophages at the lesion site and/or their subsequent destructive effector functions.
Similarly, the genesis of atherosclerotic lesions is thought to involve the participation of specialized lipid laden macrophages termed foam cells, potentially both as triggering and sustaining elements of lesion progression. Since one ligand of .alpha..sub.d, ICAM-R, is known to be expressed on activated endothelial cells at neovascularizing sites as might occur in certain types of nascent atherosclerotic lesions, it is anticipated that interactions mediated by .alpha..sub.d on macrophages may serve both to facilitate the initial sequestration of the cells within the nascent lesion and potentially to promote their activation.
Other diseases which involve activated macrophages as a central participant include, but are not limited to, multiple sclerosis, asthma, psoriasis, and rheumatoid arthritis.
Pharmaceutical compositions for treatment of these and other disease states are provided by the invention. Pharmaceutical compositions are designed for the purpose of inhibiting interaction between .alpha..sub.d and its ligand(s) and include various soluble and membrane-associated forms of .alpha..sub.d (comprising the entire .alpha..sub.d polypeptide, or fragments thereof, which actively participate in .alpha..sub.d binding), soluble and membrane-associated forms of .alpha..sub.d binding proteins (including antibodies, ligands, and the like), intracellular or extracellular modulators of .alpha..sub.d binding activity, and/or modulators of .alpha..sub.d and/or .alpha..sub.d -ligand polypeptide expression, including modulators of transcription, translation, posttranslational processing and/or intracellular transport. The invention also comprehends methods for treatment of disease states in which .alpha..sub.d binding is implicated, wherein a patient suffering from said disease state is provided an amount of a pharmaceutical composition of the invention sufficient to modulate levels of .alpha..sub.d binding. The method of treatment of the invention is applicable to disease states such as, but not limited to, type I diabetes, atherosclerosis, multiple sclerosis, asthma, psoriasis, and rheumatoid arthritis.

BRIEF DESCRIPTION OF THE DRAWING
Numerous other aspects and advantages of the present invention will be apparent upon consideration of the following description thereof, reference being made to the drawing wherein:
FIG. 1A through 1D comprises an alignment of the human amino acid sequences of CD11b (SEQ ID NO: 3), CD11c (SEQ ID NO: 4) and .alpha..sub.d (SEQ ID NO: 2).

DETAILED DESCRIPTION OF THE INVENTION
The present invention is illustrated by the following examples relating to the isolation of a cDNA clone encoding .alpha..sub.d from a human spleen cDNA library. More particularly, Example 1 illustrates the use of anti-canine .alpha..sub.TM1 antibody in an attempt to detect a homologous human protein. Example 2 details purification of canine .alpha..sub.TM1 and N-terminal sequencing of the polypeptide to design oligonucleotide primers for PCR amplification of the canine .alpha..sub.TM1 gene. Example 3 addresses large scale purification of canine .alpha..sub.TM1 for internal sequencing in order to design additional PCR primers. Example 4 describes use of the PCR and internal sequence primers to amplify a fragment of the canine .alpha..sub.TM1 gene. Example 5 addresses cloning of the human .alpha..sub.d -encoding cDNA sequence. Example 6 describes Northern blot hybridization analysis of human tissue and cells for expression of .alpha..sub.d mRNA. Example 7 details the construction of human .alpha..sub.d expression plasmids and transfection of COS cells with the resulting plasmids. Example 8 addresses ELISA analysis of .alpha..sub.d expression in transfected COS cells. Example 9 describes FACS analysis of COS cells transfected with human .alpha..sub.d expression plasmids. Example 10 addresses immunoprecipitation of CD18 in association with .alpha..sub.d in co-transfected COS cells. Example 11 relates to stable transfection of .alpha..sub.d expression constructs in Chinese hamster ovary cells. Example 12 addresses CD18-dependent binding of .alpha..sub.d to the intercellular adhesion molecule, ICAM-R. Example 13 describes scintillation proximity screening assays to identify inhibitors of .alpha..sub.d ligand/anti-ligand binding interactions. Example 14 addresses construction of expression plasmids which encode soluble forms of .alpha..sub.d. Example 15 relates to production of .alpha..sub.d -specific monoclonal antibodies. Example 16 describes isolation of rat cDNA sequences which show homology to human .alpha..sub.d gene sequences. Example 17 addresses isolation of mouse cDNA sequences which show homology to human .alpha..sub.d gene sequences. Example 18 relates to in situ hybridization analysis of various mouse tissues to determine tissues and cell specific expression of the putative mouse homolog to human .alpha..sub.d. Example 19 describes generation of expression constructs which encode the putative mouse homolog of human .alpha..sub.d . Example 20 addresses design of a "knockout" mouse wherein the gene encoding the putative mouse homolog of human .alpha..sub.d is disrupted.
EXAMPLE 1
Attempt to Detect a Human Homolog of Canine .alpha..sub.TM1
The monoclonal antibody Ca11.8H2 [Moore, et al., supra] specific for canine .alpha..sub.TM1 was tested for cross-reactivity on human peripheral blood leukocytes in an attempt to identify a human homolog of canine .alpha..sub.TM1. Cell preparations (typically 1.times.10.sup.6 cells) were incubated with undiluted hybridoma supernatant or a purified mouse IgG-negative control antibody (10 .mu.g/ml) on ice in the presence of 0.1% sodium azide. Monoclonal antibody binding was detected by subsequent incubation with FITC-conjugated horse anti-mouse IgG (Vector Laboratories, Burlingame, Calif.) at 6 .mu.g/ml. Stained cells were fixed with 2% w/v paraformaldehyde in phosphate buffered saline (PBS) and were analyzed with a Facstar Plus fluorescence-activated cell sorter (Becton Dickinson, Mountain View, Calif.). Typically, 10,000 cells were analyzed using logarithmic amplification for fluorescence intensity.
The results indicated that Ca11.8H2 did not cross-react with surface proteins expressed on human peripheral blood leukocytes, while the control cells, neoplastic canine peripheral blood lymphocytes, were essentially all positive for .alpha..sub.TM1.
Because the monoclonal antibody Ca11.8H2 specific for the canine .alpha. subunit did not cross react with a human homolog, isolation of canine .alpha..sub.TM1 DNA was deemed a necessary prerequisite to isolate a counterpart human gene if one existed.
EXAMPLE 2
Affinity Purification Of Canine .alpha..sub.TM1 For N-Terminal Sequencing
Canine .alpha..sub.TM1 was affinity purified in order to determine N-terminal amino acid sequences for oligonucleotide probe/primer design. Briefly, anti-.alpha..sub.TM1 monoclonal antibody Ca11.8H2 was coupled to Affigel 10 chromatographic resin (BioRad, Hercules, Calif.) and protein was isolated by specific antibody-protein interaction. Antibody was conjugated to the resin, according to the BioRad suggested protocol, at a concentration of approximately 5 mg antibody per ml of resin. Following the conjugation reaction, excess antibody was removed and the resin blocked with three volumes of 0.1M ethanolamine. The resin was then washed with thirty column volumes of phosphate buffered saline (PBS).
Twenty-five grams of a single dog spleen were homogenized in 250 ml of buffer containing 0.32M sucrose in 25 mM Tris-HCl, Ph 8.0, with protease inhibitors. Nuclei and cellular debris were pelleted with centrifugation at 1000 g for 15 minutes. Membranes were pelleted from the supernatant with centrifugation at 100,000 g for 30 minutes. The membrane pellet was resuspended in 200 ml lysis buffer (50 mM NaCl, 50 mM borate, pH 8.0, with 2 % NP-40) and incubated for 1 hour on ice. Insoluble material was then pelleted by centrifugation at 100,000 g for 60 minutes. Ten milliliters of the cleared lysate were transferred to a 15 ml polypropylene tube with 0.5 ml Call.8H2-conjugated Affigel 10 resin described above. The tube was incubated overnight at 4.degree. C. with rotation and the resin subsequently washed with 50 column volumes D-PBS. The resin was then transferred to a microfuge tube and boiled for ten minutes in 1 ml Laemmli (non-reducing) sample buffer containing 0.1M Tris-HCl, pH 6.8, 2% SDS, 20% glycerol and 0.002% bromophenol blue. The resin was pelleted by centrifugation and discarded; the supernatant was treated with 1/15 volume .beta.-mercaptoethanol (Sigma, St. Louis, Mo.) and run on a 7% polyacrylamide gel. The separated proteins were transferred to Immobilon PVDF membrane (Millipore, Bedford, Mass.) as follows.
The gels were washed once in deionized, Millipore-filtered water and equilibrated for 15-45 minutes in 10 mM 3-[cyclohexylamino]-1-propanesulfonic acid (CAPS) transfer buffer, pH 10.5, with 10% methanol. Immobilon membranes were moistened with methanol, rinsed with filtered water, and equilibrated for 15-30 minutes in CAPS transfer buffer. The initial transfer was carried out using a Biorad transfer apparatus at 70 volts for 3 hours. The Immobilon membrane was removed after transfer and stained in filtered 0.1% R250 Coomassie stain for 10 minutes. Membranes were destained in 50% methanol/10% acetic acid three times, ten minutes each time. After destaining, the membranes were washed in filtered water and air-dried.
Protein bands of approximately 150 kD, 95 kD, 50 kD and 30 kD were detected. Presumably the 50 kD and 30 kD bands resulted from antibody contamination. N-terminal sequencing was then attempted on both the 150 kD and 95 kD bands, but the 95 kD protein was blocked, preventing sequencing. The protein band of 150 kD was excised from the membrane and directly sequenced with an Applied Biosystems (Foster City, Calif.) Model 473A protein sequencer according to the manufacturer's instructions. The resulting amino acid sequence is set in SEQ ID NO: 5 using single letter amino acid designations.
FNLDVEEPMVFQ (SEQ ID NO: 5)
The identified sequence included the FNLD sequence characteristic of .alpha. subunits of the integrin family [Tamura, et al., J. Cell. Biol. 111:1593-1604 (1990)].
Primer Design and Attempt to Amplify Canine .alpha..sub.TM1 Sequences
From the N-terminal sequence information, three oligonucleotide probes were designed for hybridization: a) "Tommer," a fully degenerate oligonucleotide; b) "Patmer," a partially degenerate oligonucleotide; and c) "Guessmer," a nondegenerate oligonucleotide based on mammalian codon usage. These probes are set out below as SEQ ID NOS: 6, 7 and 8, respectively. Nucleic acid symbols are in accordance with 37 C.F.R. .sctn.1.882 for these and all other nucleotide sequences herein.
5'-TRYAAYYTGGAYGTNGAROARCCNATGGTNTTYCA-3' (SEQ ID NO: 6)
5'-TTCAACCTGGACGTGGAGGAGCCCATGGTGTTCCAA-3' (SEQ ID NO: 7)
5'-TTCAACCTGGACGTNGAASANCCCATGGTCTTCCAA-3' (SEQ ID NO: 8)
Based on sequencing dam, no relevant clones were detected using these oligonucleotides in several low stringency hybridizations to a canine spleen/peripheral blood macrophage cDNA library cloned into .lambda.ZAP (Stratagene, La Jolla, Calif.).
Four other oligonucleotide primers, designated 5'Deg, 5'Spec, 3'Deg and 3'Spec (as set out in SEQ ID NOS: 9, 10, 11 and 12, respectively, wherein Deg indicates degenerate and Spec indicates non-degenerate) were subsequently designed based on the deduced N-terminal sequence for attempts to amplify canine .alpha..sub.TM1 sequences by PCR from phage library DNA purified from plate lysates of the Stratagene library described above.
5'-TTYAAYYTNGAYGTNGARGARCC-3' (SEQ ID NO: 9)
5'-TTYAAYYTGGACGTNGAAGA-3' (SEQ ID NO: 10)
5'-TGRAANACCATNGGYTC-3' (SEQ ID NO: 11)
5'-TTGGAAGACCATNGGYTC-3' (SEQ ID NO: 12)
The .alpha..sub.TM1 oligonucleotide primers were paired with T3 or T7 vector primers, as set out in SEQ ID NOS: 13 and 14, respectively, which hybridize to sequences flanking the polylinker region in the Bluescript phagemid found in .lambda.ZAP.
5'-ATTAACCCTCACTAAAG-3' (SEQ ID NO: 13)
5'-AATACGACTCACTATAG-3' (SEQ ID NO: 14)
The PCR amplification was carried out in Taq buffer (Boehringer Mannheim, Indianapolis, Ind.) containing magnesium with 150 ng of library DNA, 1 .mu.g of each primer, 200 .mu.M dNTPs and 2.5 units Taq polymerase (Boehringer Mannheim) and the products were separated by electrophoresis on a 1% agarose gel in Tris-Acetate-EDTA (TAE) buffer with 0.25 .mu.g/ml ethidium bromide. DNA was transferred to a Hybond (Amersham, Arlington Heights, Ill.) membrane by wicking overnight in 10X SSPE. After transfer, the immobilized DNA was denatured with 0.5M NaOH with 0.6M NaCl, neutralized with 1.0M Tris-HCl, pH 8.0, in 1.5M NaCl, and washed with 2X SSPE before UV crosslinking with a Stratalinker (Stratagene) crosslinking apparatus. The membrane was incubated in prehybridization buffer (5X SSPE, 4X Denhardts, 0.8% SDS, 30% formamide) for 2 hr at 50.degree. C. with agitation.
Oligonucleotide probes 5'Deg, 5'Spec, 3'Deg and 3'Spec (SEQ ID NOS: 9, 10, 11 and 12, respectively) were labeled using a Boehringer Mannheim kinase buffer with 100-300 .mu.Ci .gamma.P.sup.32 -dATP and 1-3 units of polynucleotide kinase for 1-3 hr at 37.degree. C. Unincorporated label was removed with Sephadex G-25 fine (Pharmacia, Piscataway, N.J.) chromatography using 10 mM Tris-HCl, pH 8.0, 1 mM EDTA (TE) buffer and the flow-through added directly to the prehybridization solution. Membranes were probed for 16 hr at 42.degree. C. with agitation and washed repeatedly, with a final stringency wash of 1X SSPE/0.1% SDS at 50.degree. for 15 min. The blot was then exposed to Kodak X-Omat AR film for 1-4 hours at -80.degree. C.
The oligonucleotides 5'Deg, 5'Spec, 3'Deg and 3'Spec only hybridized to PCR products from the reactions in which they were used as primers and failed to hybridize as expected to PCR products from the reactions in which they were not used as primers. Thus, it was concluded that none of the PCR products were specific for .alpha..sub.TM1 because no product hybridized with all of the appropriate probes.
EXAMPLE 3
Large Scale Affinity Purification Of Canine .alpha..sub.TM1 For Internal Sequencing
In order to provide additional amino acid sequence for primer design, canine .alpha.TM.sub.1 was purified for internal sequencing. Three sections of frozen spleen (approximately 50 g each) and frozen cells from two partial spleens from adult dogs were used to generate protein for internal sequencing. Fifty grams of spleen were homogenized in 200-300 ml borate buffer with a Waring blender. The homogenized material was diluted with 1 volume of buffer containing 4 % NP-40, and the mixture then gently agitated for at least one hour. The resulting lysate was cleared of large debris by centrifugation at 2000 g for 20 rain, and then filtered through either a Coming (Coming, N.Y.) prefilter or a Coming 0.8 micron filter. The lysate was further clarified by filtration through the Corning 0.4 micron filter system.
Splenic lysate and the antibody-conjugated Affigel 10 resin described in Example 2 were combined at a 150:1 volume ratio in 100 ml aliquots and incubated overnight at 4.degree. C. with rocking. The lysate was removed after centrifugation at 1000 g for 5 minutes, combined with more antibody-conjugated Affigel 10 resin and incubated overnight as above. The absorbed resin aliquots were then combined and washed with 50 volumes D-PBS/0.1% Tween 20 and the resin transferred to a 50 ml Biorad column. Adsorbed protein was eluted from the resin with 3-5 volumes of 0.1M glycine (pH 2.5); fractions of approximately 900 .mu.l were collected and neutralized with 100 .mu.l 1M Tris buffer, pH 8.0. Aliquots of 15 .mu.l were removed from each fraction and boiled in an equal volume of 2X Laemmli sample buffer with 1/15 volume 1M dithiothreitol (DTT). These samples were electrophoresed on 8 % Novex (San Diego, Calif.) polyacrylamide gels and visualized either by Coomassie stain or by silver stain using a Daiichi kit (Enprotech, Natick, Mass.) according to the manufacturer's suggested protocol. Fractions which contained the largest amounts of protein were combined and concentrated by vacuum. The remaining solution was diluted by 50% with reducing Laemmli sample buffer and run on 1.5 mm 7% polyacrylamide gels in Tris-glycine/SDS buffer. Protein was transferred from the gels to Immobilon membrane by the procedure described in Example 2 using the Hoefer transfer apparatus.
The protein bands corresponding to canine .alpha..sub.TM1 were excised from 10 PVDF membranes and resulted in approximately 47 .mu.g total protein. The bands were destained in 4 ml 50% methanol for 5 minutes, air dried and cut into 1.times.2 mm pieces. The membrane pieces were submerged in 2 ml 95% acetone at 4.degree. C. for 30 minutes with occasional vortexing and then air dried.
Prior to proteolytic cleavage of the membrane bound protein, 3 mg of cyanogen bromide (CNBr) (Pierce, Rockford, Ill.) were dissolved in 1.25 ml 70% formic acid. This solution was then added to a tube containing the PVDF membrane pieces and the tube incubated in the dark at room temperature for 24 hours. The supernatant (S1) was then removed to another tube and the membrane pieces washed with 0.25 ml 70% formic acid. This supernatant (S2) was removed and added to the previous supernatant (S1). Two milliliters of Milli Q water were added to the combined supernatants (S1 and S2) and the solution lyophilized. The PVDF membrane pieces were dried under nitrogen and extracted again with 1.25 ml 60% acetonitrile, 0.1% tetrafluoroacetic acid (TFA) at 42.degree. C. for 17 hours. This supernatant (S3) was removed and the membrane pieces extracted again with 1.0 ml 80% acetonitrile with 0.08% TFA at 42.degree. C. for 1 hour. This supernatant (S4) was combined with the previous supernatants (S1 , S2 and S3) and vacuum dried.
The dried CNBr fragments were then dissolved in 63 .mu.l 8M urea, 0.4M NH.sub.4 HCO.sub.3. The fragments were reduced in 5 .mu.l 45 mM dithiothreitol (DTT) and subsequently incubated at 50.degree. C. for 15 minutes. The solution was then cooled to room temperature and the fragments alkylated by adding 5 .mu.l 100 mM iodoacetamide (Sigma, St. Louis, Mo.). Following a 15 minute incubation at room temperature, the sample was diluted with 187 .mu.l Milli Q water to a final urea concentration of 2.0M. Trypsin (Worthington, Freehold, N.J.) was then added at a ratio of 1:25 (w:w) of enzyme to protein and the protein digested for 24 hours at 37.degree. C. Digestion was terminated with addition of 30 .mu.l TFA.
The protein fragments were then separated with high performance liquid chromatography (HPLC) on a Waters 625 LC system (Millipore, Milford, Mass.) using a 2.1.times.250 mm, 5 micron Vydac C-18 column (Vydac, Hesperia, Calif.) equilibrated in 0.05% TFA and HPLC water (buffer A). The peptides were eluted with increasing concentration of 80% acetonitrile in 0.04% TFA (buffer B) with a gradient of 38-75% buffer B for 65-95 minutes and 75-98% buffer B for 95-105 minutes. Peptides were fractionated at a flow rate of 0.2 ml/minute and detected at 210 nm.
Following fractionation, the amino acid sequence of the peptides was analyzed by automated Edman degradation performed on an Applied Biosystems Model 437A protein sequencer using the manufacturer's standard cycles and the Model 610A Data Analysis software program, Version 1.2.1. All sequencing reagents were supplied by Applied Biosystems. The amino acid sequences of seven of the eight internal fragments are set out below wherein "X" indicates the identity of the amino acid was not certain.
VFQEXGAGFGQ (SEQ ID NO: 15)
LYDXVAATGLXQPI (SEQ ID NO: 16)
PLEYXDVIPQAE (SEQ ID NO: 17)
FQEGFSXVLX (SEQ ID NO: 18)
TSPTFIXMSQENVD (SEQ ID NO: 19)
LVVGAPLEVVAVXQTGR (SEQ ID NO: 20)
LDXKPXDTA (SEQ ID NO: 21)
Primer Design
One internal amino acid sequence (set out in SEQ ID NO: 22) obtained was then used to design a fully degenerate oligonucleotide primer, designated p4(R) as set out in SEQ ID NO: 23.
FGEQFSE (SEQ ID NO: 22)
5'-RAANCCYTCYTGRAAACTYTC-3' (SEQ ID NO: 23)
EXAMPLE 4
PCR Cloning Of A Canine .alpha..sub.TM1 Fragment
The 5' portion of the canine .alpha..sub.TM1 gene was amplified from double-stranded canine splenic cDNA by PCR.
A. Generation of Double Stranded Canine Spleen cDNA
One gram of frozen material from a juvenile dog spleen was ground in liquid nitrogen on dry ice and homogenized in 20 ml RNA-Stat 60 buffer (Tel-Test B, Inc, Friendswood, Tex.). Four ml chloroform were added, and the solution extracted by centrifugation at 12,000 g for 15 minutes. RNA was precipitated from the aqueous layer with 10 ml ethanol. Poly A.sup.+ RNA was then selected on Dynal Oligo dT Dynabeads (Dynal, Oslo, Norway). Five aliquots of 100 .mu.g total RNA were combined and diluted with an equal volume of 2X binding buffer (20 mM Tris-HCl, pH 7.5, 1.0M LiCl, 1 mM EDTA, 0.1% SDS). RNA was then incubated 5 minutes with the Oligo dT Dynabeads (1.0 ml or 5 mg beads for all the samples). Beads were washed with buffer containing 10 mM Tris-HCl, pH 7.5, 0.15M LiCl, 1 mM EDTA and 0.1% SDS, according to the manufacturer's suggested protocol prior to elution of poly A.sup.+ mRNA with 2 mM EDTA, pH 7.5. Double-stranded cDNA was then generated using the eluted poly A.sup.+ mRNA and the Boehringer Mannheim cDNA Synthesis Kit according to the manufacturer's suggested protocol.
B. Isolation of a Partial Canine .alpha..sub.TM1 cDNA
Oligonucleotide primers 5'Deg (SEQ ID NO: 9) and p4(R) (SEQ ID NO: 23) were employed in a standard PCR reaction using 150 ng double-stranded cDNA, 500 ng of each primer, 200 .mu.M dNTPs and 1.5 units Taq polymerase (Boehringer Mannheim) in Taq buffer (Boehringer Mannheim) with magnesium. The resulting products (1 .mu.l of the original reaction) were subjected to a second round of PCR with the same primers to increase product yield. This band was eluted from a 1% agarose gel onto Schleicher & Schuell (Keene, N.H.) NA45 paper in a buffer containing 10 mM Tris-HCl, pH 8, 1 mM EDTA, 1.5M NaCl at 65.degree. C., precipitated, and ligated into the pCR.TM.II vector (Invitrogen, San Diego, Calif.) using the TA cloning kit (Invitrogen) and the manufacturer's suggested protocol. The ligation mixture was transformed by electroporation into XL-1 Blue bacteria (Stratagene). One clone, 2.7, was determined to contain sequences corresponding to .alpha..sub.TM1 peptide sequences which were not utilized in design of the primers.
Sequencing was performed with an Applied Biosystems 373A DNA sequencer (Foster City, Calif.) with a Dye-deoxy terminator cycle sequence kit (ABI) in which fluorescent-labeled dNTPs were incorporated in an asymmetric PCR reaction [McCabe, "Production of Single Stranded DNA by Asymmetric PCR," in PCR Protocols: A Guide to Methods and Applications, Innis, et al. (eds.) pp. 76-83 Academic Press: New York (1990)] as follows. Samples were held at 96.degree. C. for 4 minutes and subjected to 25 cycles of the step sequence: 96.degree. C., for 15 seconds; 50.degree. C. for 1 second; 60.degree. C. for 4 minutes. Sequence data was automatically down-loaded into sample files on the computer that included chromatogram and text files. The sequence of the entire insert of clone 2.7 is set out in SEQ ID NO: 24.
Attempts to isolate the full length canine .alpha..sub.TM1 cDNA from the Stratagene library (as described in Example 2) were unsuccessful. Approximately 1.times.10.sup.6 phage plaques were screened by hybridization under low stringency conditions using 30% formamide with clone 2.7 as a probe, but no positive clones resulted. Attempts to amplify relevant sequences downstream from those represented in clone 2.7 using specific oligonucleotides derived from clone 2.7 or degenerate primers based on amino acid sequence from other peptide fragments paired with a degenerate oligonucleotide based on the conserved .alpha. subunit amino acid motif GFFKR [Tamura, et al., supra] were also unsuccessful.
EXAMPLE 5
Cloning Of A Putative Human Homolog Of Canine .alpha..sub.TM1
To attempt the isolation of a human sequence homologous to canine .alpha..sub.TM1 the approximately 1 kb canine .alpha..sub.TM1 fragment from clone 2.7 was used as a probe. The probe was generated by PCR under conditions described in Example 2 using NT2 (as set out in SEQ ID NO: 25) and p4(R) (SEQ ID NO: 23) primers.
5'-GTNTTYCARGARGAYGG-3' (SEQ ID NO: 25)
The PCR product was purified using the Qiagen (Chatsworth, Ga.) Quick Spin kit and the manufacturer's suggested protocol. The purified DNA (200 ng) was labeled with 200 .mu.Ci .alpha..sup.32 PdCTP using the Boehringer Mannheim Random Prime Labelling kit and the manufacturer's suggested protocol. Unincorporated isotope was removed with Sephadex G25 (fine) gravity chromatography. The probe was denatured with 0.2N NaOH and neutralized with 0.4M Tris-HCl, pH 8.0, before use.
Colony lifts on Hybond filters (Amersham) of a human spleen cDNA library in pCDNA/Amp (Invitrogen, San Diego, Calif.) were prepared. The filters were initially denatured and neutralized as described in Example 2 and subsequently incubated in a prehybridization solution (8 ml/filter) with 30% formamide at 50.degree. C. with gentle agitation for 2 hours. Labeled probe as described above was added to this solution and incubated with the filters for 14 hours at 42.degree. C. The filters were washed twice in 2X SSC/0.1% SDS at 37.degree. C. and twice in 2X SSC/0.1% SDS at 50.degree. C. Final stringency washes were 1X SSC/0.1% SDS, twice at 65.degree. C. (1X SSC is 150 mM NaCl, 15 mM sodium citrate, pH 7.0). Filters were exposed to Kodak X-Omat AR film for six hours with an intensifying screen. Colonies giving signals on duplicate lifts were streaked on LB medium with magnesium (LBM)/carbenicillin plates and incubated overnight at 37.degree. C. Resulting streaked colonies were lifted with Hybond filters and these filters were treated as above. The filters were hybridized under more stringent conditions with the 1 kb probe from clone 2.7, labeled as previously described, in a 50% formamide hybridization solution at 50.degree. C. for 3 hours. Probed filters were washed with a final stringency of 0.1 X SSC/0.1% SDS at 65 .degree. C. and exposed to Kodak X-Omar AR film for 2.5 hours at -80.degree. C. with an intensifying screen. Positive colonies were identified and cultured in LBM/carbenicillin medium overnight. DNA from the cultures was prepared using the Promega Wizard miniprep kit according to the manufacturer's suggested protocol and the resulting DNA was sequenced.
The initial screening resulted in 18 positive clones, while the secondary screening under more stringent hybridization conditions produced one positive clone which was designated 19A2. The DNA and deduced amino acid sequences of the human .alpha..sub.d clone 19A2 are set out in SEQ ID NOS: 1 and 2, respectively.
Characteristics Of The Human .alpha..sub.d cDNA and Predicted Polypeptide
Clone 19A2 encompasses the entire coding region for the mature protein, plus 48 bases (16 amino acid residues) of the 5' upstream signal sequence and 241 bases of 3' untranslated sequence which do not terminate in a polyadenylation sequence. The core molecular weight of the mature protein is predicted to be around 125 kD. The extracellular domain is predicted to encompass approximately amino acid residues 17 through 1108 of SEQ ID NO: 2. This extracellular region is contiguous with about a 20 amino acid region homologous to the human CD11c transmembrane region (residues 1109 through 1128 of SEQ ID NO: 2). The cytoplasmic domain comprises approximately 30 amino acids (about residues 1129 through 1161 of SEQ ID NO: 2). The protein also contains a region (around residues 150 through 352) of approximately 202 amino acids homologous to the I (insertion) domain common to CD11a, CD11b and CD11c [Larson and Springer, supra], .alpha..sub.E [Shaw, et al., J. Biol. Chem. 269:6016-6025 (1994)] and in VLA-1 and VLA-2, [Tamura, et al., supra]. The I domain in other integrins has been shown to participate in ICAM binding [Landis, et al., J. Cell. Biol. 120:1519-1527 (1993); Diamond, et al., J. Cell. Biol. 120:1031-1043 (1993)], suggesting that .alpha..sub.d may also bind members of the ICAM family of surface molecules. This region has not been demonstrated to exist in any other integrin subunits.
The deduced amino acid sequence of .alpha..sub.d shows approximately 36% identity to that of CD11a, approximately 60% identity to CD11b and approximately 66% identity to CD11c. An alignment of amino acid sequences for (CD11b SEQ ID NO: 3), CD11c (SEQ ID NO: 4) and .alpha..sub.d (SEQ ID NO: 2) is presented in FIG. 1.
The cytoplasmic domains of .alpha. subunits in .beta.2 integrins are typically distinct from one another within the same species, while individual .alpha. subunits show high degrees of homology across species boundaries. Consistent with these observations, the cytoplasmic region of .alpha..sub.d differs markedly from CD11a, CD11b, and CD11c except for a membrane proximal GFFKR amino acid sequence which has been shown to be conserved among all .alpha. integrins [Rojiani, et al., Biochemistry 30:9859-9866 (1991)]. Since the cytoplasmic tail region of integrins has been implicated in "inside out" signaling and in avidity regulation [Landis et al., supra], it is possible that .alpha..sub.d interacts with cytosolic molecules distinct from those interacting with CD11a, CD11b, and CD11c, and, as a result, participates in signaling pathways distinct from those involving other .beta. integrins.
The extracellular domain of .alpha..sub.d contains a conserved DGSGS amino acid sequence adjacent the I-domain; in CD11b, the DGSGS sequence is a metal-binding region required for ligand interaction [Michishita, et al. Cell 72:857-867 (1993)]. Three additional putative cation binding sites in CD11b and CD11c are conserved in the .alpha..sub.d sequence at amino acids 465-474, 518-527, and 592-600 in clone 19A2 (SEQ ID NO: 1 ). The .alpha..sub.d I-domain is 36%, 62%, and 57% identical to the corresponding regions in CD11a, CD11b, and CD11c, respectively, and the relatively low sequence homology in this region suggests that .alpha..sub.d may interact with a set of extracellular proteins distinct from proteins with which other known .beta. integrins interact. Alternatively, the affinity of .alpha..sub.d for known .beta..sub.2 integrin ligands, for example, ICAM-1, ICAM-2 and/or ICAM-R, may be distinct from that demonstrated for the other .beta. integrin/ICAM interactions. [See Example 12.]
EXAMPLE 6
Northern Analysis of Human .alpha..sub.d Expression in Tissues
In order to determine the relative level of expression and tissue specificity of .alpha..sub.d, Northern analysis was performed using fragments from clone 19A2 as probes. Approximately 10 .mu.g of total RNA from each of several human tissues or cultured cell lines were loaded on a formaldehyde agarose gel in the presence of 1 .mu.g of ethidium bromide. After electrophoresis at 100 V for 4 hr, the RNA was transferred to a nitrocellulose membrane (Schleicher & Schuell) by wicking in 10X SSC overnight. The membrane was baked 1.5 hr at 80.degree. C. under vacuum. Prehybridization solution containing 50% formamide in 3-(N-morpholino)propane sulfonic acid (MOPS) buffer was used to block the membrane for 3 hr at 42.degree. C. Fragments of clone 19A2 were labeled with the Boehringer Mannheim Random Prime kit according to the manufacturer's instructions including both .alpha.P.sup.32 dCTP and .alpha.P.sup.32 dTTP. Unincorporated label was removed on a Sephadex G25 column in TE buffer. The membrane was probed with 1.5.times.10.sup.6 counts per ml of prehybridization buffer. The blot was then washed successively with 2X SSC/0.1% SDS at room temperature, 2X SSC/0.1% SDS at 42.degree. C., 2X SSC/0.1% SDS at 50.degree. C., 1X SSC/0.1% SDS at 50.degree. C., 0.5X SSC/0.1% SDS at 50.degree. C. and 0.1X SSC/0.1% SDS at 50.degree. C. The blot was then exposed to film for 19 hr.
Hybridization using a BstXI fragment from clone 19A2 (corresponding to nucleotides 2011 to 3388 in SEQ ID NO: 1) revealed a weak signal in the approximately 5 kb range in liver, placenta, thymus, and tonsil total RNA. No signal was detected in kidney, brain or heart samples. The amount of RNA present in the kidney lane was minimal, as determined with ethidium bromide staining.
When using a second fragment of clone 19A2 (encompassing the region from bases 500 to 2100 in SEQ ID NO: 1), RNA transcripts of two different sizes were detected in a human multi-tissue Northern (MTN) blot using polyA.sup.+ RNA (Clontech). An approximately 6.5 kb band was observed in spleen and skeletal muscle, while a 4.5 kb band was detected in lung and peripheral blood leukocytes. The variation in sizes observed could be caused by tissue specific polyadenylation, cross reactivity of the probe with other integrin family members, or hybridization with alternatively spliced mRNAs.
Northern analysis using a third fragment from clone 19A2, spanning nucleotides 2000 to 3100 in SEQ ID NO: 1, gave results consistent with those using the other clone 19A2 fragments.
RNA from three myeloid lineage cell lines was also probed using the fragments corresponding to nucleotides 500 to 2100 and 2000 to 3100 in SEQ ID NO: 1. A THP-1 cell line, previously stimulated with PMA, gave a diffuse signal in the same size range (approximately 5.0 kb), with a slightly stronger intensity than the tissue signals. RNA from unstimulated and DMSO-stimulated HL-60 cells hybridized with the .alpha..sub.d probe at the same intensity as the tissue samples, however, PMA treatment seemed to increase the signal intensity. Since PMA and DMSO drive HL-60 cell differentiation toward monocyte/macrophage and granulocyte pathways, respectively, this result suggests enhanced .alpha..sub.d expression in monocyte/macrophage cell types. U937 cells expressed the .alpha..sub.d message and this signal did not increase with PMA stimulation. No band was detected in Molt, Daudi, H9, JY, or Jurkat cells.
EXAMPLE 7
Transient Expression of Human .alpha..sub.d Constructs
A. Generation of expression constructs
The human clone 19A2 lacks an initiating methionine codon and possibly some of the 5' signal sequence. Therefore, in order to generate a human expression plasmid containing 19A2 sequences, two different strategies were used. In the first, two plasmids were constructed in which signal peptide sequences derived from genes encoding either CD11b or CD11c were spliced into clone 19A2 to generate a chimeric .alpha..sub.d sequence. In the second approach, a third plasmid was constructed in which an adenosine base was added at position 0 in clone 19A2 to encode an initiating methionine.
The three plasmids contained different regions which encoded the 5' portion of the .alpha..sub.d sequence or the chimeric .alpha..sub.d sequence. The .alpha..sub.d region was PCR amplified (see conditions in Example 2) with a specific 3' primer BamRev (set out below in SEQ ID NO: 26) and one of three 5' primers. The three 5' primers contained in sequence: (1) identical nonspecific bases at positions 1-6 allowing for digestion, an EcoRI site from positions 7-12 and a consensus Kozak sequence from positions 13-18; (2) a portion of the CD11b (primer ER1B) or CD11c (primer ER1C) signal sequence, or an adenosine (primer ER1D); and (3) an additional 15-17 bases specifically overlapping 5' sequences from clone 19A2 to allow primer annealing. Primers ER1B, ER1C or ER1D are set out in SEQ ID NOS: 27, 28 or 29, respectively, where the initiating methionine codon is underlined and the EcoRI site is double underlined.
Primer BamRev (SEQ ID NO: 26)
5 '-CCACTGTCAGGATGCCCGTG-3'
Primer ER1B (SEQ ID NO: 27)
5'-A GTTACGAATTCGCCACCATGGCTCTACGGGTGCTTCTTCTG-3'
Primer ER1C (SEQ ID NO: 28)
5'-AGTTACGAATTCGCCACCATGACTCGGACTGTGCTTCTTCTG-3'
Primer ER1D (SEQ ID NO: 29)
5'-AGTTACGAATTCGCCACCATGACCTTCGGCACTGTG-3'
The resulting PCR product was digested with EcoRI and BamHI.
All three plasmids contained a common second .alpha..sub.d region (to be inserted immediately downstream from the 5' region described in the previous paragraph) including the 3' end of the .alpha..sub.d clone. The second .alpha..sub.d region, which extended from nucleotide 625 into the XbaI site in the vector 3' polylinker region of clone 19A2, was isolated by digestion of clone 19A2 with BamHI and XbaI.
Three ligation reactions were prepared in which the 3' .alpha..sub.d BamHI/XbaI fragment was ligated to one of the three 5' .alpha..sub.d EcoRI/BamHI fragments using Boehringer Mannheim ligase buffer and T4 ligase (1 unit per reaction). After a 4 hour incubation at 14.degree. C., an appropriate amount of vector pcDNA.3 (Invitrogen) digested with EcoRI and XbaI was added to each reaction with an additional unit of ligase. Reactions were allowed to continue for another 14 hours. One tenth of the reaction mixture was then transformed into competent XL-1 Blue cells. The resulting colonies were cultured and the DNA isolated as in Example 5. Digestion with EcoRI identified three clones which were positive for that restriction site, and thus, the engineered signal sequences. The clones were designated pATM.B1 (CD11b/.alpha..sub.d % from primer ER1B), pATM.C10 (CD11c/.alpha..sub.d, from primer ER1C) and pATM.D12 (adenosine/.alpha..sub.d from primer ER1d). The presence of the appropriate signal sequences in each clone was verified by nucleic acid sequencing.
B. Transfection of COS Cells
Expression from the .alpha..sub.d plasmids discussed above was effected by cotransfection of COS cells with the individual plasmids and a CD18 expression plasmid, pRC.CD18. As a positive control, COS cells were also co-transfected with the plasmid pRC.CD18 and a CD11a expression plasmid, pDC.CD11A.
Cells were passaged in culture medium (DMEM/10%FBS/penstrep) into 10 cm Corning tissue culture-treated petri dishes at 50% confluency 16 hours prior to transfection. Cells were removed from the plates with Versene buffer (0.5 mM NaEDTA in PBS) without trypsin for all procedures. Before transfection, the plates were washed once with serum-free DMEM. Fifteen micrograms of each plasmid were added to 5 ml transfection buffer (DMEM with 20 .mu.g/ml DEAE-Dextran and 0.5 mM chloroquine) on each plate. After 1.5 hours incubation at 37.degree. C., the cells were shocked for 1 minute with 5 ml DMEM/10% DMSO. This DMSO solution was then replaced with 10 ml/plate culture medium.
Resulting transfectants were analyzed by ELISA, FACS , and immunoprecipitation as described in Examples 8, 9, and 10.
EXAMPLE 8
ELISA Analysis of COS Transfectants
In order to determine if the COS cells co-transfected with CD18 expression plasmid pRC.CD 18 and an .alpha..sub.d plasmid expressed .alpha..sub.d on the cell surface in association with CD18, ELISAs were performed using primary antibodies raised against CD18 (e.g., TS1/18 purified from ATCC HB203). As a positive control, ELISAs were also performed on cells co-transfected with the CD18 expression plasmid and a CD11a expression plasmid, pDC.CD 11A. The primary antibodies in this control included CD18 antibodies and anti-CD11a antibodies (e.g., TS1/22 purified from ATCC HB202).
For ELISA, cells from each plate were removed with Versene buffer and transferred to a single 96-well flat-bottomed Corning tissue culture plate. Cells were allowed to incubate in culture media 2 days prior to assay. The plates were then washed twice with 150 .mu.l/well D-PBS/0.5% teleost skin gelatin (Sigma) solution. This buffer was used in all steps except during the development. All washes and incubations were performed at room temperature. The wells were blocked with gelatin solution for 1 hour. Primary antibodies were diluted to 10 .mu.g/ml in gelatin solution and 50 .mu.l were then added to each well. Triplicate wells were set up for each primary antibody. After 1 hour incubation, plates were washed 3X with 150 .mu.l/well gelatin solution. Secondary antibody (goat anti-mouse Ig/HRP-Fc specific [Jackson, West Grove, Pa.]) at a 1:3500 dilution was added at 50 .mu.l/well and plates were incubated for 1 hour. After three washes, plates were developed for 20 minutes with 100 .mu.l/well o-phenyldiamine (OPD) (Sigma) solution (1 mg/ml OPD in citrate buffer) before addition of 50 .mu.l/well 15% sulfuric acid.
Analysis of transfectants in the ELISA format with anti-CD18 specific antibodies revealed no significant expression above background in cells transfected only with the plasmid encoding CD18. Cells co-transfected with plasmid containing CD11a and CD18 showed an increase in expression over background when analyzed with CD18 specific antibodies or with reagents specific for CD11a. Further analysis of cells co-transfected with plasmids encoding CD18 and one of the .alpha..sub.d expression constructs (pATM.C10 or pATM.D12) revealed that cell surface expression of CD18 was rescued by concomitant expression of .alpha..sub.d. The increase in detectable CD18 expression in COS cells transfected with pATM.C10 or pATM.D12 was comparable to that observed in co-transfected CD11a/CD 18 positive control cells.
EXAMPLE 9
FACS Analysis of COS Transfectants
For FACS analysis, cells in petri dishes were fed with fresh culture medium the day after transfection and allowed to incubate 2 days prior to the assay. Transfectant cells were removed from the plates with 3 ml Versene, washed once with 5 ml FACS buffer (DMEM/2% FBS/0.2% sodium azide) and diluted to 500,000 cells/sample in 0.1 ml FACS buffer. Ten microliters of either 1 mg/ml FITC-conjugated CD18, CD11a, or CD11b specific antibodies (Becton Dickinson) or 800 .mu.g/ml CFSE-conjugated murine 23F2G (anti-CD18) (ATCC HB11081 ) were added to each sample. Samples were then incubated on ice for 45 minutes, washed 3X with 5 ml/wash FACS buffer and resuspended in 0.2 ml FACS buffer. Samples were processed on a Becton Dickinson FACscan and the data analyzed using Lysys II software (Becton Dickinson).
COS cells transfected with CD18 sequences only did not stain for CD18, CD11a or CD11b. When co-transfected with CD11a/CD18, about 15% of the cells stained with antibodies to CD11a or CD18. All cells transfected with CD18 and any .alpha..sub.d construct resulted in no detectable staining for CD11a and CD11b. The pATM.B1, pATM.C10 and pATM.D12 groups stained 4%, 13% and 8% positive for CD 18, respectively. Fluorescence of the positive population in the CD11a/CD18 group was 4-fold higher than background. In comparison, the co-transfection of .alpha..sub.d constructs with the CD18 construct produced a positive population that showed a 4- to 7-fold increase in fluorescence intensity over background.
EXAMPLE 10
Biotin-Labeled Immunoprecipitation of Human .alpha.d/CD18 Complexes from Co-transfected COS Cells
Immunoprecipitation was attempted on cells co-transfected with CD18 and each of the .alpha..sub.d expression plasmids separately described in Example 7 in order to determine if .alpha..sub.d could be isolated as part of the .alpha..beta. heterodimer complex characteristic of integrins.
Transfected cells (1-3.times.10.sup.8 cells/group) were removed from petri dishes with Versene buffer and washed 3 times in 50 ml/group D-PBS. Each sample was labeled with 2 mg Sulpho-NHS Biotin (Pierce, Rockford, Ill.) for 15 minutes at room temperature. The reaction was quenched by washing 3 times in 50 ml/sample cold D-PBS. Washed cells were resuspended in 1 ml lysis buffer (1% NP40,50mM Tris-HCl, pH 8.0, 0.2 M NaCl, 2 mM Ca.sup.++, 2 mM Mg.sup.++, and protease inhibitors) and incubated 15 minutes on ice. Insoluble material was pelleted by centrifugation at 10,000 g for 5 minutes, and the supernatant removed to fresh tubes. In order to remove material non-specifically reactive with mouse immunoglobulin, a pre-clearance step was initially performed. Twenty-five micrograms of mouse immunoglobulin (Cappel, West Chester, Pa.) was incubated with supernatants at 4.degree. C. After 2.5 hr, 100 .mu.l (25 .mu.g) rabbit anti-mouse Ig conjugated Sepharose (prepared from Protein A Sepharose 4B and rabbit anti-mouse IgG, both from Zymed, San Francisco, Calif.) was added to each sample; incubation was continued at 4.degree. C. with rocking for 16 hours. Sepharose beads were removed from the supernatants by centrifugation. After pre-clearance, the supernatants were then treated with 20 .mu.g anti-CD18 antibody (TS1.18) for 2 hours at 4.degree. C. Antibody/antigen complexes were isolated from supernatants by incubation with 100 .mu.l/sample rabbit anti-mouse/Protein A-sepharose preparation described above. Beads were washed 4 times with 10 mM HEPES, 0.2M NaCl, and 1% Triton-X 100. Washed beads were pelleted and boiled for 10 minutes in 20 .mu.l 2X Laemmli sample buffer with 2% .beta.-mercaptoethanol. Samples were centrifuged and run on an 8% prepoured Novex polyacrylamide gel (Novex) at 100 V for 30 minutes. Protein was transferred to nitrocellulose membranes (Schleicher & Schuell) in TBS-T buffer at 200 mAmps for 1 hour. Membranes were blocked for 2 hr with 3% BSA in TBS-T. Membranes were treated with 1:6000 dilution of Strep-avidin horse radish peroxidase (POD) (Boehringer Mannheim) for 1 hour, followed by 3 washes in TBS-T. The Amersham Enhanced Chemiluminescence kit was then used according to the manufacturer's instructions to develop the blot. The membrane was exposed to Hyperfilm MP (Amersham) for 0.5 to 2 minutes.
Immunoprecipitation of CD18 complexes from cells transfected with pRC.CD18 and either pATM.B1, pATM.C10 or pATM.D12 revealed surface expression of a heterodimeric species consisting of approximately 100 kD .beta. chain, consistent with the predicted size of CD18, and an .alpha. chain of approximately 150 kD, corresponding to .alpha..sub.d.
EXAMPLE 11
Stable Transfection of Human .alpha..sub.d in Chinese Hamster Ovary Cells
To determine whether .alpha..sub.d is expressed on the cell surface as a heterodimer in association with CD18, cDNAs encoding each chain were both transiently and stably transfected into a cell line lacking both .alpha..sub.d and CD18.
For these experiments, .alpha..sub.d cDNA was augmented with additional leader sequences and a Kozak consensus sequence, as described in Example 7, and subcloned into expression vector pcDNA3. The final construct, designated pATM.D 12, was co-transfected with a modified commercial vector, pDC1.CD 18 encoding human CD18 into dihydrofolate reductase (DHFR).sup.- Chinese hamster ovary (CHO) cells. The plasmid pDC1.CD 18 encodes a DHFR.sup.+ marker and transfectants can be selected using an appropriate nucleoside-deficient medium. The modifications which resulted in pDC1.CD18 are as follows.
The plasmid pRC/CMV (Invitrogen) is a mammalian expression vector with a cytomegalovirus promoter and ampicillin resistance marker gene. A DHFR gene from the plasmid pSC1190-DHFR was inserted into pRC/CMV 5' of the SV40 origin of replication. In addition, a polylinker from the 5' region of the plasmid pHF2G-DHF was ligated into the pRC/CMV/DHFR construct, 3' to the DHFR gene. CD18 encoding sequences are subsequently cloned into the resulting plasmid between the 5' flanking polylinker region and the bovine growth hormone poly A encoding region.
Surface expression of CD18 was analyzed by flow cytometry using the monoclonal antibody TS1/18. Heterodimer formation detected between .alpha..sub.d and CD18 in this cell line was consistent with the immunoprecipitation described in Example 10 with transient expression in COS cells.
EXAMPLE 12
Human .alpha..sub.d binds to ICAM-R in a CD 18-dependent fashion
In view of reports that demonstrate interactions between the leukocyte integrins and intercellular adhesion molecules (ICAMs) which mediate cell-cell contact [Hynes, Cell 69:11-25 (1992)], the ability of CHO cells expressing .alpha..sub.d /CD18 to bind ICAM-1, ICAM-R, or VCAM-1 was assessed by two methods.
In replicate assays, soluble ICAM-1, ICAM-R, or VCAM-1 IgG1 fusion proteins were immobilized on plastic and the ability of .alpha..sub.d /CD18 CHO transfected cells to bind the immobilized ligand was determined. Transfected cells were labeled internally with calcein, washed in binding buffer (RPMI with 1% BSA), and incubated in either buffer only (with or without 10 ng/ml PMA) or buffer with anti-CD18 monoclonal antibodies at 10 .mu.g/ml. Transfected cells were added to 96-well Immulon 4 microtiter plates previously coated with soluble ICAM-1/IgG1, ICAM-R/IgG1 or VCAM-1/IgG1 fusion protein, or bovine serum albumin (BSA) as a negative control. Design of the soluble forms of these adhesion molecules is described and fully disclosed in co-pending and co-owned U.S. patent application Ser. No. 08/102,852, filed Aug. 5, 1993. Wells were blocked with 1% BSA in PBS prior to addition of labeled cells. After washing the plates by immersion in PBS with 0.1% BSA for 20 minutes, total fluorescence remaining in each well was measured using a Cytofluor 2300 (Millipore, Milford, Mass.).
In experiments with immobilized ICAMs, .alpha..sub.d /CD18 co-transfectants consistently showed a 3-5 fold increase in binding to ICAM-R/IgG1 wells over BSA coated wells. The specificity and CD18-dependence of this binding was demonstrated by the inhibitory effects of anti-CD18 antibody TS1/18. The binding of cells transfected with CD11a/CD18 to ICAM-1/IgG1 wells was comparable to the binding observed with BSA coated wells. CD11a/CD18 transfected cells showed a 2-3 fold increase in binding to ICAM-1/IgG1 wells only following pretreatment with PMA. PMA treatment of .alpha..sub.d /CD 18 transfectants did not affect binding to ICAM-1/IgG1 or ICAM-R/IgG1 wells. No detectable binding of .alpha..sub.d /CD18 transfectants to VCAM-1/IgG1 wells was observed.
Binding of .alpha..sub.d /CD18-transfected cells to soluble ICAM-1/IgG1, ICAM-R/IgG1, or VCAM-1/IgG1 fusion proteins was determined by flow cytometry. Approximately one million .alpha..sub.d /CD18-transfected CHO cells (grown in spinner flasks for higher expression) per measurement were suspended in 100 .mu.l binding buffer (RPMI and 1% BSA) with or without 10 .mu.g/ml anti-CD18 antibody. After a 20 minute incubation at room temperature, the cells were washed in binding buffer and soluble ICAM-1/IgG1 or ICAM-R/IgG1 fusion protein was added to a final concentration of 5 .mu.g/ml. Binding was allowed to proceed for 30 minute at 37.degree. C., after which the cells were washed three times and resuspended in 100 .mu.l binding buffer containing FITC-conjugated sheep anti-human IgG1 at a 1:100 dilution. After a 30 minute incubation, samples were washed three times and suspended in 200 .mu.l binding buffer for analysis with a Becton Dickinson FACScan.
Approximately 40-50% of the .alpha..sub.d /CD18 transfectants indicated binding to ICAM-R/IgG1, but no binding to ICAM-1/IgG1 or VCAM-1/IgG1 proteins. Pretreatment of transfected cells with PMA has no effect on .alpha.d/CD18 binding to either ICAM-1/IgG1, ICAM-R/IgG1 or VCAM-1/IgG1, which was consistent with the immobilized adhesion assay. Binding by ICAM-R was reduced to background levels after treatment of .alpha..sub.d /CD18 transfectants with anti-CD18 antibody TS1/18.
The collective data from these two binding assays illustrate that .alpha..sub.d/CD 18 binds to ICAM-R and does so preferentially as compared to ICAM-1 and VCAM-1. The .alpha.d/CD18 binding preference for ICAM-R over ICAM-1 is opposite that observed with CD11a/CD18 and CD11b/CD18. Thus modulation of .alpha..sub.d /CD18 binding may be expected to selectively affect normal and pathologic immune function where ICAM-R plays a prominent role. Moreover, results of similar assays, in which antibodies immunospecific for various extracellular domains of ICAM-R were tested for their ability to inhibit binding of ICAM-R to .alpha..sub.d /CD18 transfectants, indicated that .alpha..sub.d /CD18 and CD11a/CD18 interact with different domains of ICAM-R.
The failure of CD11a/CD18 to bind ICAM-1/IgG1 or ICAM-R/IgG1 in solution suggests that the affinity of binding between CD11a/CD18 and ICAM-1 or ICAM-R is too low to permit binding in solution. Detection of .alpha..sub.d /CD18 binding to ICAM-R/IgG1, however, suggests an unusually high binding affinity.
EXAMPLE 13
Screening by Scintillation Proximity Assay
Specific inhibitors of binding between the .alpha..sub.d ligands of the present invention and their binding partners (.alpha..sub.d ligand/anti-ligand pair) may be determined by a variety of means, such as scintillation proximity assay techniques as generally described in U.S. Pat. No. 4,271,139, Hart and Greenwald, Mol. Immunol. 12:265-267 (1979), and Hart and Greenwald, J. Nuc. Med. 20:1062-1065 (1979), each of which is incorporated herein by reference.
Briefly, one member of the .alpha..sub.d ligand/anti-ligand pair is bound to a solid support. A fluorescent agent is also bound to the support. Alternatively, the fluorescent agent may be integrated into the solid support as described in U.S. Pat. No. 4,568,649, incorporated herein by reference. The non-support bound member of the .alpha..sub.d ligand/anti-ligand pair is labeled with a radioactive compound that emits radiation capable of exciting the fluorescent agent. When the ligand binds the radiolabeled anti-ligand, the label is brought sufficiently close to the support-bound fluorescer to excite the fluorescer and cause emission of light. When not bound, the label is generally too distant from the solid support to excite the fluorescent agent, and light emissions are low. The emitted light is measured and correlated with binding between the ligand and the anti-ligand. Addition of a binding inhibitor to the sample will decrease the fluorescent emission by keeping the radioactive label from being captured in the proximity of the solid support. Therefore, binding inhibitors may be identified by their effect on fluorescent emissions from the samples. Potential anti-ligands to .alpha..sub.d may also be identified by similar means.
EXAMPLE 14
Soluble Human .alpha..sub.d Expression Constructs
The expression of full-length, soluble human .alpha..sub.d /CD18 heterodimeric protein provides easily purified material for immunization and binding assays. The advantage of generating soluble protein is that it can be purified from supernatants rather than from cell lysates (as with full-length membrane-bound .alpha..sub.d /CD18); recovery in therefore improved and impurities reduced.
The soluble .alpha..sub.d expression plasmid was constructed as follows. A nucleotide fragment corresponding to the region from bases 0 to 3161 in SEQ ID NO: 1, cloned into plasmid pATM.D12, was isolated by digestion with HindIII and AatII. A PCR fragment corresponding to bases 3130 to 3390 in SEQ ID NO: 1, overlapping the HindIII/AatII fragment and containing an addition MluI restriction site at the 3' terminus, was amplified from pATM.D12 with primers sHAD.5 and sHAD.3 set out in SEQ ID NOS: 30 and 31, respectively.
TTGCTGACTGCCTGCAGTTC (SEQ ID NO: 30)
GTTCTGACGCGTAATGGCATTGTAGACCTCGTCTTC (SEQ ID NO: 31)
The PCR amplification product was digested with AatII and MluI and ligated to the HindIII/AatII fragment. The resulting product was ligated into HindIII/MluI-digested plasmid PDC.1s.
This construct is co-expressed with soluble CD18 in stably transfected CHO cells, and expression is detected by autoradiographic visualization of immunoprecipitated CD18 complexes derived from .sup.35 S-methionine labeled cells.
Soluble Human .alpha..sub.d I Domain Expression Constructs
It has previously been reported that the I domain in CD11a can be expressed as an independent structural unit that maintains ligand binding capabilities and antibody recognition [Randi and Hogg, J. Biol. Chem. 269:12395-12398 (1994); Zhout, et al., J. Biol. Chem. 269:17075-17079 (1994)]]. To generate a soluble fusion protein comprising the .alpha..sub.d I domain and human IgG4, the .alpha..sub.d I domain is amplified by PCR using primers designed to add flanking BamHI and XhoI restriction sites to facilitate subcloning. These primers are set out in SEQ ID NOS: 32 and 33 with restriction sites underlined.
ACGTATGCAGGATCCCATCAAGAGATGGACATCGCT (SEQ ID NO: 32)
ACTGCATGTCTCGAGGCTGAAGCCTTCTTGGGACATC (SEQ ID NO: 33)
The C nucleotide immediately 3' to the BamHI site in SEQ ID NO: 32 corresponds to nucleotide 435 in SEQ ID NO: 1; the G nucleotide 3' to the XhoI site in SEQ ID NO: 33 is complementary to nucleotide 1067 in SEQ ID NO: 1. The amplified I domain is digested with the appropriate enzymes, the purified fragment ligated into the mammalian expression vector pDCs and the prokaryotic expression vector pGEX-4T-3 (Pharmacia) and the I domain fragment sequenced. The fusion protein is then expressed in COS, CHO or E. coli cells transfected or transformed with an appropriate expression construct.
Given the affinity of .alpha..sub.d for ICAM-R, expression of the .alpha..sub.d I domain may be of sufficient affinity to be a useful inhibitor of cell adhesion in which .alpha..sub.d participates.
EXAMPLE 15
Production of Human .alpha..sub.d Monoclonal Antibodies
Transiently transfected cells from Example 7 were washed three times in Dulbecco's phosphate buffered saline (D-PBS) and injected at 5.times.10.sup.6 cells/mouse into Balb/c mice with 50 .mu.g/mouse muramyl dipeptidase (Sigma) in PBS. Mice were injected two more times in the same fashion at two week intervals. The pre-bleed and immunized serum from the mice were screened by FACS analysis as outlined in Example 9 and the spleen from the mouse with the highest reactivity to cells transfected with .alpha..sub.d /CD18 was fused. Hybridoma culture supernatants were then screened separately for lack of reactivity against COS cells transfected with CD11a/CD18 and for reactivity with cells cotransfected with an .alpha..sub.d expression plasmid and CD18.
This method resulted in no monoclonal antibodies.
As an alternative, monoclonal antibodies are generated as follows. Affinity purified .alpha..sub.d /CD 18 heterodimeric protein from detergent lysates of stably transfected CHP cells is used with 50 .mu.g/ml muramyl dipeptidase to immunize Balb/c mice as described above. Mice receive three immunizations before serum reactivity against .alpha..sub.d /CD18 is determined by immunoprecipitation of biotinylated complexes in the CHO transfectants. Hybridomas from positive animals are established according to standard protocols, after which hybridoma cultures are selected by flow cytometry using .alpha..sub.d /CD18 transfectants. CD11a/CD18 transfectants are utilized to control for CD18-only reactivity.
As another alternative for production of monoclonal antibodies, soluble .alpha..sub.d I domain IgG4 fusion protein is affinity purified from supernatant of stably transfected CHO cells and used to immunized Balb/c mice as described above. Hybridomas are established and supernatant from these hybridomas are screened by ELISA for reactivity against .alpha..sub.d I domain fusion protein. Positive cultures are then analyzed for reactivity with full length .alpha..sub.d /CD18 complexes expressed on CHO transfectants.
As another alternative for monoclonal antibody production, Balb/c mice undergo an immunization/immunosuppression protocol designed to reduce reactivity to CHO cell determinants on transfectants used for immunization. This protocol involves immunization with untransfected CHO cells and subsequent killing of CHO-reactive B-cell blasts with cyclophosphamide treatment. After three rounds of immunization and cyclophosphamide treatment are performed, the mice are immunized with .alpha..sub.d /CD18 CHO transfected cells as described above.
EXAMPLE 16
Isolation of Rat cDNA Clones
In view of the existence of both canine and human .alpha..sub.d integrins, attempts were made to isolate homologous genes in other species, including rat (this example) and mouse (Example 17, infra).
A partial sequence of a rat cDNA showing homology to the human .alpha..sub.d gene was obtained from a rat splenic .lambda.gt10 library (Clontech). The library was plated at 2.times.10.sup.4 pfu/plate onto 150 mm LBM/agar plates. The library was lifted onto Hybond membranes (Amersham), denatured 3 minutes, neutralized 3 minutes and washed 5 minutes with buffers as described in standard protocols [Sambrook, et al., Molecular Cloning: a laboratory manual, p.2.110]. The membranes were placed immediately into a Stratalinker (Stratagene) and the DNA crosslinked using the autocrosslinking setting. The membranes were prehybridized and hybridized in 30% or 50% formamide, for low and high stringency conditions, respectively. Membranes were initially screened with a .sup.32 P-labeled probe generated from the human .alpha..sub.d cDNA, corresponding to bases 500 to 2100 in clone 19A2 (SEQ ID NO: 1). The probe was labeled using Boehringer Mannheim's Random Prime Kit according to manufacturer's suggested protocol. Filters were washed with 2X SSC at 55.degree. C.
Two clones, designated 684.3 and 705.1, were identified which showed sequence homology to human .alpha..sub.d, human CD11b, and human CD11c. Both clones aligned to the human .alpha..sub.d gene in the 3' region of the gene, starting at base 1871 and extending to base 3012 for clone 684.3, and bases 1551 to 3367 for clone 705.1.
In order to isolate a more complete rat sequence which included the 5' region, the same library was rescreened using the same protocol as employed for the initial screening, but using a mouse probe generated from clone A1160 (See Example 17, infra). Single, isolated plaques were selected from the second screening and maintained as single clones on LBM/agar plates. Sequencing primers 434FL and 434FR (SEQ ID NOS: 34 and 35, respectively) were used in a standard PCR protocol to generate DNA for sequencing.
434FL (SEQ ID NO: 34)
TATAGACTGCTGGGTAGTCCCCAC
434FR (SEQ ID NO: 35)
TGAAGATTGGGGGTAAATACAGA
DNA from the PCR was purified using a Quick Spin Column (Qiagen) according to manufacturer's suggested protocol.
Two clones, designated 741.4 and 741.11, were identified which overlapped clones 684.3 and 705.1; in the overlapping regions, clones 741.1 and 741.11 were 100% homologous to clones 684.3 and 705.1. A composite rat cDNA having homology to the human .alpha..sub.d gene is set out in SEQ ID NO: 36; the predicted amino acid sequence is set forth in SEQ ID NO: 37.
Characteristics of the Rat cDNA and Amino Acid Sequences
Neither nucleic acid nor amino acid sequences have previously been reported for rat .alpha. subunits in .beta..sub.2 integrins. However sequence comparisons to reported human .beta..sub.2 integrin .alpha. subunits suggests that the isolated rat clone and its predicted amino acid sequence are most closely related to .alpha..sub.d nucleotide and amino acid sequences.
At the nucleic acid level, the isolated rat cDNA clone shows 80% identity in comparison to the human .alpha..sub.d cDNA; 68% identity in comparison to human CD11b; 70% identity in comparison to human CD11c; and 65% identity in comparison to mouse CD11b. No significant identity is found in comparison to human CD11a and to mouse CD11a.
At the amino acid level, the predicted rat polypeptide encoded by the isolated cDNA shows 70% identity in comparison to human .alpha..sub.d polypeptide; 28% identity in comparison to human CD11a; 58% identity in comparison to human CD11b; 61% identity in comparison to human CD11c; 28% identity in comparison to mouse CD11a; and 55% identity in comparison to mouse CD11b.
EXAMPLE 17
Isolation of Mouse cDNA Clones
Isolation of a mouse cDNA exhibiting homology to human .alpha..sub.d by cross-species hybridization was attempted with two PCR-generated probes: a 1.5 kb fragment corresponding to bases 522 to 2047 from human clone 19A2 (SEQ ID NO: 1), and a 1.0 kb rat fragment which corresponds to bases 1900 to 2900 in human clone 19A2 (SEQ ID NO: 1). The human probe was generated by PCR using primer pairs designated ATM-2 and 9-10.1 set out in SEQ ID NOS: 38 and 9, respectively; the rat probe was generated using primer pairs 434L and 434R, set out in SEQ ID NOS: 34 and 35, respectively. Samples were incubated at 4.degree. C. for 4 minutes and subjected to 30 cycles of the temperature step sequence: 4.degree. C.; 50.degree. C. 2 minutes; 72.degree. C., 4 minutes.
ATM-2 (SEQ ID NO: 38)
5'-GTCCAAGCTGTCATGGGCCAG-3'
9-10.1 (SEQ ID NO: 39)
5'-GTCCAGCAGACTGAAGAGCACGG-3'
The PCR products were purified using the Qiagen Quick Spin kit according to manufacturer's suggested protocol, and approximately 180 ng DNA was labeled with 200 .mu.Ci [.sup.32 P]-dCTP using a Boehringer Mannheim Random Primer Labeling kit according to manufacturer's suggested protocol. Unincorporated isotope was removed using a Centri-sep Spin Column (Princeton Separations, Adelphia, N.J.) according to manufacturer's suggested protocol. The probes were denatured with 0.2N NaOH and neutralized with 0.4M Tris-HCl, pH 8.0, before use.
A mouse thymic oligo dT-primed cDNA library in lambda ZAP II (Stratagene) was plated at approximately 30,000 plaques per 15 cm plate. Plaque lifts on nitrocellulose filters (Schleicher & Schuell, Keene, N.H.) were incubated at 50.degree. C. with agitation for 1 hour in a prehybridization solution (8 ml/lift) containing 30% formamide. Labeled human and rat probes were added to the prehybridization solution and incubation continued overnight at 50.degree. C. Filters were washed twice in 2X SSC/0.1% at room temperature, once in 2X SSC/0.1% SDS at 37.degree. C., and once in 2X SSC/0.1% SDS at 42.degree. C. Filters were exposed on Kodak X-Omat AR film at -80.degree. C. for 27 hours with an intensifying screen.
Four plaques giving positive signals on duplicate lifts were restreaked on LB medium with magnesium (LBM)/carbenicillin (100 mg/ml) plates and incubated overnight at 37.degree. C. The phage plaques were lifted with Hybond filters (Amersham), probed as in the initial screen, and exposed on Kodak X-Omat AR film for 24 hours at -80.degree. C. with an intensifying screen.
Twelve plaques giving positive signals were transferred into low Mg.sup.++ phage diluent containing 10 mM Tris-HCl and 1 mM MgCl.sub.2. Insert size was determined by PCR amplification using T3 and T7 primers (SEQ ID NOS: 13 and 14, respectively) and the following reaction conditions. Samples were incubated at 94.degree. C. for 4 minutes and subjected to 30 cycles of the temperature step sequence: 94.degree. C., for 15 seconds; 50.degree. C., for 30 seconds; and 72.degree. C. for 1 minute.
Six samples produced distinct bands that ranged in size from 300 bases to 1 kb. Phagemids were released via co-infection with helper phage and recircularized to generate Bluescript SK.sup.- (Stratagene). The resulting colonies were cultured in LBM/carbenicillin (100 mg/ml) overnight. DNA was isolated with a Promega Wizard miniprep kit (Madison, Wis.) according to manufacturer's suggested protocol. EcoRI restriction analysis of purified DNA confirmed the molecular weights which were detected using PCR. Insert DNA was sequenced with M13 and M13 reverse. 1 primers set out in SEQ ID NOS: 40 and 41, respectively.
5'-TGTAAAACGACGGCCAGT-3' (SEQ ID NO: 40)
5'-GGAAACAGCTATGACCATG-3' (SEQ ID NO: 41)
Sequencing was performed as described in Example 4.
Of the six clones, only two, designated 10.3-1 and 10.5-2, provided sequence information and were identical 600 bp fragments. The 600 bp sequence was 68% identical to a corresponding region of human .alpha..sub.d, 40% identical to human CD11a, 58% identical to human CD11c, and 54% identical to mouse CD11b. This 600 bp fragment was then utilized to isolate a more complete cDNA encoding a putative mouse .alpha..sub.d homolog.
A mouse splenic cDNA library (oligo dT.sup.- and random-primed) in lambda Zap II (Stratagene) was plated at 2.5.times.10.sup.4 phage/15 cm LBM plate. Plaques were lifted on Hybond nylon transfer membranes (Amersham), denatured with 0.5M NaOH/1.5M NaCl, neutralized with 0.5M Tris Base/1.5M NaCl/11.6 HCl, and washed in 2X SSC. The DNA was cross-linked to filters by ultraviolet irradiation.
Approximately 500,000 plaques were screened using probes 10.3-1 and 10.5-2 previously labeled as described supra. Probes were added to a prehybridization solution and incubated overnight at 50.degree. C. The filters were washed twice in 2X SSC/0.1% SDS at room temperature, once in 2X SSC/0.1% SDS at 37.degree. C., and once in 2X SSC/0.1% SDS at 42.degree. C. Filters were exposed on Kodak X-Omat AR film for 24 hours at -80.degree. C. with an intensifying screen. Fourteen plaques giving positive signals on duplicate lifts were subjected to a secondary screen identical to that for the initial screen except for additional final high stringency washes in 2X SSC/0.1% SDS at 50.degree. C., in 0.5X SSC/0.1% SDS at 50.degree. C., and at 55.degree. C. in 0.2X SSC/0.1% SDS. The filters were exposed on Kodak X-Omat AR film at -80.degree. C. for 13 hours with an intensifying screen.
Eighteen positive plaques were transferred into low Mg.sup.++ phage diluent and insert size determined by PCR amplification as described above. Seven of the samples gave single bands that ranged in size from 600 bp to 4 kb. EcoRI restriction analysis of purified DNA confirmed the sizes observed from PCR and the DNA was sequenced with primers M13 and M13 reverse. 1 (SEQ ID NOS: 40 and 41, respectively).
One clone designated B3800 contained a 4 kb insert which corresponded to a region 200 bases downstream of the 5' end of the human .alpha..sub.d 19A2 clone and includes 553 bases of a 3' untranslated region. Clone B3800 showed 77% identity to a corresponding region of human .alpha..sub.d, 44% identity to a corresponding region of human CD11a, 59% identity to a corresponding region of human CD11c, and 51% identity to a corresponding region of mouse CD11b. The second clone A1160 was a 1.2 kb insert which aligned to the 5' end of the coding region of human .alpha..sub.d approximately 12 nucleic acids downstream of the initiating methionine. Clone A1160 showed 75% identity to a corresponding region of human .alpha..sub.d, 46% identity to a corresponding region of human CD11a, 2% identity to a corresponding region of human CD11c, and 66% identity to a corresponding region of mouse CD11b.
Clone A1160, the fragment closer to the 5' end of human clone 19A2, is 1160 bases in length, and shares a region of overlap with clone B3800 starting at base 205 and continuing to base 1134. Clone A1160 has a 110-base insertion (bases 704-814 of clone A 1160) not present in the overlapping region of clone B3800. This insertion occurs at a probable exon-intron boundary [Fleming, et al., J. Immunol. 150:480-490 (1993)] and was removed before subsequent ligation of clones A1160 and B3800.
Rapid Amplification of 5' cDNA End of the Putative Mouse .alpha..sub.d Clone
RACE PCR [Frohman, "RACE: Rapid Amplification of cDNA Ends," in PCR Protocols: A Guide to Methods and Applications, Innis, et al. (eds.) pp. 28-38, Academic Press:New York (1990)] was used to obtain missing 5' sequences of the putative mouse .alpha..sub.d clone, including 5' untranslated sequence and initiating methionine. A mouse splenic RACE-Ready kit (Clontech, Palo Alto, Calif.) was used according to the manufacturer's suggested protocol. Two antisense, gene-specific primers (SEQ ID NOS: 42 and 43) were designed to perform primary and nested PCR.
A1160 RACE1-primary (SEQ ID NO: 42)
5'-GGACATGTTCACTGCCTCTAGG-3'
A1160 RACE2-nested (SEQ ID NO: 43)
5'-GGCGGACAGTCAGACGACTGTCCTG-3'
The primers, SEQ ID NOS: 42 and 43, correspond to regions starting 302 and 247 bases from the 5' end, respectively. PCR was performed as described, supra, using the 5' anchor primer (SEQ ID NO: 44) and mouse spleen cDNA supplied with the kit.
5' anchor primer (SEQ ID NO: 44)
CTGGTTCGGCCCACCTCTGAAGGTTCCAGAATCGATAG
Electrophoresis of the PCR product revealed a band approximately 280 bases in size, which was subcloned using a TA cloning kit (Invitrogen) according to manufacturer's suggested protocol. Ten resulting colonies were cultured, and the DNA isolated and sequenced. An additional 60 bases of 5' sequence were identified by this method, which correspond to bases 1 to 60 in SEQ ID NO: 45.
Characteristics of the Mouse cDNA and Predicted Amino Acid Sequence
A composite sequence of the mouse cDNA encoding a putative homolog of human .alpha..sub.d is set out in SEQ ID NO: 45. Although homology between the external domains of the human and mouse clones is high, homology between the cytoplasmic domains is only 30%. The observed variation may indicate C-terminal functional differences between the human and mouse proteins. Alternatively, the variation in the cytoplasmic domains may result from splice variation, or may indicate the existence of an additional .beta..sub.2 integrin gene(s).
At the amino acid level, the mouse cDNA predicts a protein (SEQ ID NO: 46) with 28% identity to mouse CD11a, 53% identity to mouse CD11b, 28% identity to human CD11a, 55% identity to human CD11b, 59% identity to human CD11c, and 70% identity to human .alpha..sub.d. Comparison of the amino acid sequences of the cytoplasmic domains of human .alpha..sub.d and the putative mouse homolog indicates regions of the same length, but having divergent primary structure. Similar sequence length in these regions suggests species variation rather than splice variant forms. In comparison to the predicted rat polypeptide, Example 16,supra, however, mouse and rat cytoplasmic domains show greater than 60% identity.
EXAMPLE 18
In situ hybridizations in Mouse
A single stranded 200 bp mRNA probe was generated from a DNA template, corresponding to nucleotides 3460 to 3707 in the cytoplasmic tail region of the murine cDNA, by in vitro RNA transcription incorporating 35S-UTP (Amersham).
Whole mouse embryos (harvested at days 11-18 after fertilization) and various mouse tissues, including spleen, kidney, liver, intestine, and thymus, were hybridized in situ with the radiolabeled single-stranded mRNA probe.
Tissues were sectioned at 6 .mu.m thickness, adhered to Vectabond (Vector Laboratories, Inc., Burlingame, Calif.) coated slides, and stored at -70.degree. C. Prior to use, slides were removed from -70.degree. C. and placed at 50.degree. C. for approximately 5 minutes. Sections were fixed in 4% paraformaldehyde for 20 minutes at 4.degree. C., dehydrated with an increasing ethanol gradient (70-95-100%) for 1 minute at 4.degree. C. at each concentration, and air dried for 30 minutes at room temperature. Sections were denatured for 2 minutes at 70.degree. C. in 70% formamide/2X SSC, rinsed twice in 2X SSC, dehydrated with the ethanol gradient described supra and air dried for 30 minutes. Hybridization was carried out overnight (12-16 hours) at 55.degree. C. in a solution containing .sup.35 S-labeled riboprobes at 6.times.10.sup.5 cpm/section and diethylpyrocarbonate (DEPC)-treated water to give a final concentration of 50% formamide, 0.3M NaCl, 20 mM Tris-HCl, pH 7.5, 10% dextran sulfate, 1X Denhardt's solution, 100 mM dithiothreitol (DTT) and 5 mM EDTA. After hybridization, sections were washed for 1 hour at room temperature in 4X SSC/10 mM DTT, 40 minutes at 60.degree. C. in 50% formamide/2X SSC/10 mM DTT, 30 minutes at room temperature in 2X SSC, and 30 minutes at room temperature in 0.1X SSC. The sections were dehydrated, air dried for 2 hours, coated with Kodak NTB2 photographic emulsion, air dried for 2 hours, developed (after storage at 4.degree. C. in complete darkness) and counter-stained with hematoxylin/eosin.
Spleen tissue showed a strong signal primarily in the red pulp. This pattern is consistent with that of tissue macrophage distribution in the spleen, but does not exclude other cell types.
EXAMPLE 19
Generation of Mouse Expression Constructs
In order to construct an expression plasmid including mouse cDNA sequences exhibiting homology to human .alpha..sub.d, inserts from clones A1160 and B3800 were ligated. Prior to this ligation, however, a 5' leader sequence, including an initiating methionine, was added to clone A1160. A primer designated "5' PCR leader" (SEQ ID NO: 47) was designed to contain: (1) identical nonspecific bases at positions 1-6 allowing for digestion; (2) a BamHI site (underlined in SEQ ID NO: 47) from positions 7-12 to facilitate subcloning into an expression vector; (3) a consensus Kozak sequence from positions 13-18, (4) a signal sequence including a codon for an initiating methionine (bold in SEQ ID NO: 47), and (5) an additional 31 bases of specifically overlapping 5' sequence from clone A1160 to allow primer annealing. A second primer designated "3' end frag" (SEQ ID NO: 48) was used with primer "5' PCR leader" to amplify the insert from clone A1160.
5' PCR leader (SEQ ID NO: 47)
5'-AGTTACGGATCCGGCACCATGACCTTCGGCACTGTGATCCTCCTGTGTG-3'
3' end flag (SEQ ID NO: 48)
5'-GCTGGACGATGGCATCCAC-3'
The resulting PCR product did not digest with BamHI, suggesting that an insufficient number of bases preceded the restriction site, prohibiting recognition by the enzyme. The length of the "tail" sequence preceding the BamHI site in the 5' primer (SEQ ID NO: 47) was increased and PCR was repeated on the amplification product from the first PCR. A 5' primer, designated mAD.5'.2 (SEQ ID NO: 49), was designed with additional nonspecific bases at positions 1-4 and an additional 20 bases specifically overlapping the previously employed "5' PCR leader" primer sequences.
mAD.5'.2 (SEQ ID NO: 49)
5'-GTAGAGTTACGGATCCGGCACCAT-3'
Primers "mAD.5'. 2" and "3' end frag" were used together in PCR with the product from the first amplification as template. A resulting secondary PCR product was subcloned into plasmid pCRtmII (Invitrogen) according to manufacturer's suggested protocol and transformed into competent Oneshot cells (Invitrogen). One clone containing the PCR product was identified by restriction enzyme analysis using BamHI and EcoRI and sequenced. After the sequence was verified, the insert was isolated by digestion with BamHI and EcoRI and gel purified.
The insert from clone B3800 was isolated by digestion with EcoRI and NotI, gel purified, and added to a ligation reaction which included the augmented A1160 BarnHI/EcoRI fragment. Ligation was allowed to proceed for 14 hours at 14.degree. C. Vector pcDNA.3 (Invitrogen), digested with BamHi and NotI, was added to the ligation reaction with additional ligase and the reaction was continued for another 12 hours. An aliquot of the reaction mixture was transformed into competent E. coli cells, the resulting colonies cultured, and one positive clone identified by PCR analysis with the primers 11.b-1/2FOR1 and 11.b-1/2REV11 (SEQ ID NOS: 50 and 51, respectively).
5'-GCAGCCAGCTTCGGACAGAC-3' (SEQ ID NO: 50)
5'-CCATGTCCACAGAACAGAGAG-3' (SEQ ID NO: 51)
These primers bridge the A1160 and B3800 fragments, therefore detection of an amplification product indicates the two fragments were ligated. The sequence of the positive clone was verified with the primers set out in SEQ ID NOS: 50 and 51, which amplify from base 100 to 1405 after the initiating methionine.
EXAMPLE 20
Construction of a Knock-out Mouse
In order to more accurately assess the immunological role of the protein encoded by the putative mouse .alpha..sub.d cDNA, a "knock-out" mouse is designed wherein the genomic DNA sequence encoding the putative .alpha..sub.d homolog is disrupted by homologous recombination. The significance of the protein encoded by the disrupted gene is thereby assessed by the absence of the encoded protein.
Design of such a mouse begins with construction of a plasmid containing sequences to be "knocked out" by homologous recombination events. A 750 base pair fragment of the mouse cDNA (corresponding to nucleotides 1985 to 2733 in SEQ ID NO: 45)was used to identify a mouse genomic sequence encoding the putative mouse .alpha..sub.d homolog from a .lambda.FIX library. Primary screening resulted in 14 positive plaques, seven of which were confirmed by secondary screening. Liquid lysates were obtained from two of the plaques giving the strongest signal and the .alpha. DNA was isolated by conventional methods. Restriction mapping and Southern analysis confirmed the authenticity of one clone, designated 14-1, and the insert DNA was isolated by digestion with NotI. This fragment was cloned into Bluescript SKII.sup.+.
In order to identify a restriction fragment of approximately 9 to 14 kb, a length reported to optimize the probability of homologous recombination events, Southern hybridization was performed with the 750 bp cDNA probe. Prior to hybridization, a restriction map was constructed for clone 14-1. A 12 kb fragment was identified as a possible candidate and this fragment was subcloned into pBluescript SKII.sup.+ in a position wherein the mouse DNA is flanked by thymidine kinase encoding cassettes.
A neomycin resistance (neo.sup.r) gene is then inserted into the resulting plasmid in a manner that interrupts the protein coding sequence of the genomic mouse DNA. The resulting plasmid therefore contains aneo.sup.r gene within the mouse genomic DNA sequences, all of which are positioned within a thymidine kinase encoding region. Plasmid construction in this manner is required to favor homologous recombination over random recombination [Chisaka, et al., Nature 355:516-520 (1992)].
Numerous modifications and variations in the invention as set forth in the above illustrative examples are expected to occur to those skilled in the art. Consequently only such limitations as appear in the appended claims should be placed on the invention.
__________________________________________________________________________SEQUENCE LISTING(1) GENERAL INFORMATION:(iii) NUMBER OF SEQUENCES: 51(2) INFORMATION FOR SEQ ID NO:1:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 3726 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: cDNA(ix) FEATURE: (A) NAME/KEY: CDS(B) LOCATION: 3..3485(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:TGACCTTCGGCACTGTGCTTCTTCTGAGTGTCCTGGCTTCTTATCAT47ThrPheGlyThrValLeuLeuLeuSerValLeuAlaSerTyrHis1 51015GGATTCAACCTGGATGTGGAGGAGCCTACGATCTTCCAGGAGGATGCA95GlyPheAsnLeuAspValGluGluProThrIlePheGlnGluAspAla 202530GGCGGCTTTGGGCAGAGCGTGGTGCAGTTCGGTGGATCTCGACTCGTG143GlyGlyPheGlyGlnSerValValGlnPheGlyGlySerArgLeuVal354045GTGGGAGCACCCCTGGAGGTGGTGGCGGCCAACCAGACGGGACGGCTG191ValGlyAlaProLeuGluValValAlaAlaAsnGlnThrGlyArgLeu505560TATGACTGCGCAGCTGCCACCGGCATGTGCCAGCCCATCCCGCTGCAC239TyrAspCysAlaAlaAlaThrGlyMetCysGlnProIleProLeuHis 657075ATCCGCCCTGAGGCCGTGAACATGTCCTTGGGCCTGACCCTGGCAGCC287IleArgProGluAlaValAsnMetSerLeuGlyLeuThrLeuAlaAla80 859095TCCACCAACGGCTCCCGGCTCCTGGCCTGTGGCCCGACCCTGCACAGA335SerThrAsnGlySerArgLeuLeuAlaCysGlyProThrLeuHisArg 100105110GTCTGTGGGGAGAACTCATACTCAAAGGGTTCCTGCCTCCTGCTGGGC383ValCysGlyGluAsnSerTyrSerLysGlySerCysLeuLeuLeuGly115120125TCGCGCTGGGAGATCATCCAGACAGTCCCCGACGCCACGCCAGAGTGT431SerArgTrpGluIleIleGlnThrValProAspAlaThrProGluCys130135140CCACATCAAGAGATGGACATCGTCTTCCTGATTGACGGCTCTGGAAGC479ProHisGlnGluMetAspIleValPheLeuIleAspGlySerGlySer 145150155ATTGACCAAAATGACTTTAACCAGATGAAGGGCTTTGTCCAAGCTGTC527IleAspGlnAsnAspPheAsnGlnMetLysGlyPheValGlnAlaVal160 165170175ATGGGCCAGTTTGAGGGCACTGACACCCTGTTTGCACTGATGCAGTAC575MetGlyGlnPheGluGlyThrAspThrLeuPheAlaLeuMetGlnTyr 180185190TCAAACCTCCTGAAGATCCACTTCACCTTCACCCAATTCCGGACCAGC623SerAsnLeuLeuLysIleHisPheThrPheThrGlnPheArgThrSer195200205CCGAGCCAGCAGAGCCTGGTGGATCCCATCGTCCAACTGAAAGGCCTG671ProSerGlnGlnSerLeuValAspProIleValGlnLeuLysGlyLeu210215220ACGTTCACGGCCACGGGCATCCTGACAGTGGTGACACAGCTATTTCAT719ThrPheThrAlaThrGlyIleLeuThrValValThrGlnLeuPheHis 225230235CATAAGAATGGGGCCCGAAAAAGTGCCAAGAAGATCCTCATTGTCATC767HisLysAsnGlyAlaArgLysSerAlaLysLysIleLeuIleValIle240 245250255ACAGATGGGCAGAAGTACAAAGACCCCCTGGAATACAGTGATGTCATC815ThrAspGlyGlnLysTyrLysAspProLeuGluTyrSerAspValIle 260265270CCCCAGGCAGAGAAGGCTGGCATCATCCGCTACGCTATCGGGGTGGGA863ProGlnAlaGluLysAlaGlyIleIleArgTyrAlaIleGlyValGly275280285CACGCTTTCCAGGGACCCACTGCCAGGCAGGAGCTGAATACCATCAGC911HisAlaPheGlnGlyProThrAlaArgGlnGluLeuAsnThrIleSer290295300TCAGCGCCTCCGCAGGACCACGTGTTCAAGGTGGACAACTTTGCAGCC959SerAlaProProGlnAspHisValPheLysValAspAsnPheAlaAla 305310315CTTGGCAGCATCCAGAAGCAGCTGCAGGAGAAGATCTATGCAGTTGAG1007LeuGlySerIleGlnLysGlnLeuGlnGluLysIleTyrAlaValGlu320 325330335GGAACCCAGTCCAGGGCAAGCAGCTCCTTCCAGCACGAGATGTCCCAA1055GlyThrGlnSerArgAlaSerSerSerPheGlnHisGluMetSerGln 340345350GAAGGCTTCAGCACAGCCCTCACAATGGATGGCCTCTTCCTGGGGGCT1103GluGlyPheSerThrAlaLeuThrMetAspGlyLeuPheLeuGlyAla355360365GTGGGGAGCTTTAGCTGGTCTGGAGGTGCCTTCCTGTATCCCCCAAAT1151ValGlySerPheSerTrpSerGlyGlyAlaPheLeuTyrProProAsn370375380ATGAGCCCCACCTTCATCAACATGTCTCAGGAGAATGTGGACATGAGG1199MetSerProThrPheIleAsnMetSerGlnGluAsnValAspMetArg 385390395GACTCTTACCTGGGTTACTCCACCGAGCTAGCCCTGTGGAAGGGGGTA1247AspSerTyrLeuGlyTyrSerThrGluLeuAlaLeuTrpLysGlyVal400 405410415CAGAACCTGGTCCTGGGGGCCCCCCGCTACCAGCATACCGGGAAGGCT1295GlnAsnLeuValLeuGlyAlaProArgTyrGlnHisThrGlyLysAla 420425430GTCATCTTCACCCAGGTGTCCAGGCAATGGAGGAAGAAGGCCGAAGTC1343ValIlePheThrGlnValSerArgGlnTrpArgLysLysAlaGluVal435440445ACAGGGACGCAGATCGGCTCCTACTTCGGGGCCTCCCTCTGCTCCGTG1391ThrGlyThrGlnIleGlySerTyrPheGlyAlaSerLeuCysSerVal450455460GATGTGGACAGCGATGGCAGCACCGACCTGATCCTCATTGGGGCCCCC1439AspValAspSerAspGlySerThrAspLeuIleLeuIleGlyAlaPro 465470475CATTACTATGAGCAGACCCGAGGGGGCCAGGTGTCCGTGTGTCCCTTG1487HisTyrTyrGluGlnThrArgGlyGlyGlnValSerValCysProLeu480 485490495CCTAGGGGGCAGAGGGTGCAGTGGCAGTGTGACGCTGTTCTCCGTGGT1535ProArgGlyGlnArgValGlnTrpGlnCysAspAlaValLeuArgGly 500505510GAGCAGGGCCACCCCTGGGGCCGCTTTGGGGCAGCCCTGACAGTGTTG1583GluGlnGlyHisProTrpGlyArgPheGlyAlaAlaLeuThrValLeu515520525GGGGATGTGAATGAGGACAAGCTGATAGACGTGGCCATTGGGGCCCCG1631GlyAspValAsnGluAspLysLeuIleAspValAlaIleGlyAlaPro530535540GGAGAGCAGGAGAACCGGGGTGCTGTCTACCTGTTTCACGGAGCCTCA1679GlyGluGlnGluAsnArgGlyAlaValTyrLeuPheHisGlyAlaSer 545550555GAATCCGGCATCAGCCCCTCCCACAGCCAGCGGATTGCCAGCTCCCAG1727GluSerGlyIleSerProSerHisSerGlnArgIleAlaSerSerGln560 565570575CTCTCCCCCAGGCTGCAGTATTTTGGGCAGGCGCTGAGTGGGGGTCAG1775LeuSerProArgLeuGlnTyrPheGlyGlnAlaLeuSerGlyGlyGln 580585590GACCTCACCCAGGATGGACTGATGGACCTGGCCGTGGGGGCCCGGGGC1823AspLeuThrGlnAspGlyLeuMetAspLeuAlaValGlyAlaArgGly595600605CAGGTGCTCCTGCTCAGGAGTCTGCCGGTGCTGAAAGTGGGGGTGGCC1871GlnValLeuLeuLeuArgSerLeuProValLeuLysValGlyValAla610615620ATGAGATTCAGCCCTGTGGAGGTGGCCAAGGCTGTGTACCGGTGCTGG1919MetArgPheSerProValGluValAlaLysAlaValTyrArgCysTrp 625630635GAAGAGAAGCCCAGTGCCCTGGAAGCTGGGGACGCCACCGTCTGTCTC1967GluGluLysProSerAlaLeuGluAlaGlyAspAlaThrValCysLeu640 645650655ACCATCCAGAAAAGCTCACTGGACCAGCTAGGTGACATCCAAAGCTCT2015ThrIleGlnLysSerSerLeuAspGlnLeuGlyAspIleGlnSerSer 660665670GTCAGGTTTGATCTGGCACTGGACCCAGGTCGTCTGACTTCTCGTGCC2063ValArgPheAspLeuAlaLeuAspProGlyArgLeuThrSerArgAla675680685ATTTTCAATGAAACCAAGAACCCCACTTTGACTCGAAGAAAAACCCTG2111IlePheAsnGluThrLysAsnProThrLeuThrArgArgLysThrLeu690695700GGACTGGGGATTCACTGTGAAACCCTGAAGCTGCTTTTGCCAGATTGT2159GlyLeuGlyIleHisCysGluThrLeuLysLeuLeuLeuProAspCys 705710715GTGGAGGATGTGGTGAGCCCCATCATTCTGCACCTCAACTTCTCACTG2207ValGluAspValValSerProIleIleLeuHisLeuAsnPheSerLeu720 725730735GTGAGAGAGCCCATCCCCTCCCCCCAGAACCTGCGTCCTGTGCTGGCC2255ValArgGluProIleProSerProGlnAsnLeuArgProValLeuAla 740745750GTGGGCTCACAAGACCTCTTCACTGCTTCTCTCCCCTTCGAGAAGAAC2303ValGlySerGlnAspLeuPheThrAlaSerLeuProPheGluLysAsn755760765TGTGGGCAAGATGGCCTCTGTGAAGGGGACCTGGGTGTCACCCTCAGC2351CysGlyGlnAspGlyLeuCysGluGlyAspLeuGlyValThrLeuSer770775780TTCTCAGGCCTGCAGACCCTGACCGTGGGGAGCTCCCTGGAGCTCAAC2399PheSerGlyLeuGlnThrLeuThrValGlySerSerLeuGluLeuAsn 785790795GTGATTGTGACTGTGTGGAACGCAGGTGAGGATTCCTACGGAACCGTG2447ValIleValThrValTrpAsnAlaGlyGluAspSerTyrGlyThrVal800 805810815GTCAGCCTCTACTATCCAGCAGGGCTGTCGCACCGACGGGTGTCAGGA2495ValSerLeuTyrTyrProAlaGlyLeuSerHisArgArgValSerGly 820825830GCCCAGAAGCAGCCCCATCAGAGTGCCCTGCGCCTGGCATGTGAGACA2543AlaGlnLysGlnProHisGlnSerAlaLeuArgLeuAlaCysGluThr835840845GTGCCCACTGAGGATGAGGGCCTAAGAAGCAGCCGCTGCAGTGTCAAC2591ValProThrGluAspGluGlyLeuArgSerSerArgCysSerValAsn850855860CACCCCATCTTCCATGAGGGCTCTAACGGCACCTTCATAGTCACATTC2639HisProIlePheHisGluGlySerAsnGlyThrPheIleValThrPhe 865870875GATGTCTCCTACAAGGCCACCCTGGGAGACAGGATGCTTATGAGGGCC2687AspValSerTyrLysAlaThrLeuGlyAspArgMetLeuMetArgAla880 885890895AGTGCAAGCAGTGAGAACAATAAGGCTTCAAGCAGCAAGGCCACCTTC2735SerAlaSerSerGluAsnAsnLysAlaSerSerSerLysAlaThrPhe 900905910CAGCTGGAGCTCCCGGTGAAGTATGCAGTCTACACCATGATCAGCAGG2783GlnLeuGluLeuProValLysTyrAlaValTyrThrMetIleSerArg915920925CAGGAAGAATCCACCAAGTACTTCAACTTTGCAACCTCCGATGAGAAG2831GlnGluGluSerThrLysTyrPheAsnPheAlaThrSerAspGluLys930935940AAAATGAAAGAGGCTGAGCATCGATACCGTGTGAATAACCTCAGCCAG2879LysMetLysGluAlaGluHisArgTyrArgValAsnAsnLeuSerGln 945950955CGAGATCTGGCCATCAGCATTAACTTCTGGGTTCCTGTCCTGCTGAAC2927ArgAspLeuAlaIleSerIleAsnPheTrpValProValLeuLeuAsn960 965970975GGGGTGGCTGTGTGGGATGTGGTCATGGAGGCCCCATCTCAGAGTCTC2975GlyValAlaValTrpAspValValMetGluAlaProSerGlnSerLeu 980985990CCCTGTGTTTCAGAGAGAAAACCTCCCCAGCATTCTGACTTCCTGACC3023ProCysValSerGluArgLysProProGlnHisSerAspPheLeuThr99510001005CAGATTTCAAGAAGTCCCATGCTGGACTGCTCCATTGCTGACTGCCTG3071GlnIleSerArgSerProMetLeuAspCysSerIleAlaAspCysLe u101010151020CAGTTCCGCTGTGACGTCCCCTCCTTCAGCGTCCAGGAGGAGCTGGAT3119GlnPheArgCysAspValProSerPheSerValGlnGluGluLeuAsp 102510301035TTCACCCTGAAGGGCAATCTCAGTTTCGGCTGGGTCCGCGAGACATTG3167PheThrLeuLysGlyAsnLeuSerPheGlyTrpValArgGluThrLeu1040 104510501055CAGAAGAAGGTGTTGGTCGTGAGTGTGGCTGAAATTACGTTCGACACA3215GlnLysLysValLeuValValSerValAlaGluIleThrPheAspThr106010651070TCCGTGTACTCCCAGCTTCCAGGACAGGAGGCATTTATGAGAGCTCAG3263SerValTyrSerGlnLeuProGlyGlnGluAlaPheMetArgAl aGln107510801085ATGGAGATGGTGCTAGAAGAAGACGAGGTCTACAATGCCATTCCCATC3311MetGluMetValLeuGluGluAspGluValTyrAsnAlaIleP roIle109010951100ATCATGGGCAGCTCTGTGGGGGCTCTGCTACTGCTGGCGCTCATCACA3359IleMetGlySerSerValGlyAlaLeuLeuLeuLeuAlaLeuIle Thr110511101115GCCACACTGTACAAGCTTGGCTTCTTCAAACGCCACTACAAGGAAATG3407AlaThrLeuTyrLysLeuGlyPhePheLysArgHisTyrLysGluMet1 120112511301135CTGGAGGACAAGCCTGAAGACACTGCCACATTCAGTGGGGACGATTTC3455LeuGluAspLysProGluAspThrAlaThrPheSerGlyAspAs pPhe114011451150AGCTGTGTGGCCCCAAATGTGCCTTTGTCCTAATAATCCACTTTCCTGTT3505SerCysValAlaProAsnValProLeuSer 11551160TATCTCTACCACTGTGGGCTGGACTTGCTTGCAACCATAAATCAACTTACATGGAAACAA3565CTTCTGCATAGATCTGCACTGGCCTAAGCAACCTACCAGGTGCTAAGCACCTTCTCGGAG3625AGATAGAGATTGTAATGT TTTTACATATCTGTCCATCTTTTTCAGCAATGACCCACTTTT3685TACAGAAGCAGGCATGGTGCCAGCATAAATTTTCATATGCT3726(2) INFORMATION FOR SEQ ID NO:2:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 1161 amino acids(B) TYPE: amino acid (D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:ThrPheGlyThrValLeuLeuLeuSerValLeuAlaSerTyrHisGly151015PheAsnLeuAspValGl uGluProThrIlePheGlnGluAspAlaGly202530GlyPheGlyGlnSerValValGlnPheGlyGlySerArgLeuValVal3540 45GlyAlaProLeuGluValValAlaAlaAsnGlnThrGlyArgLeuTyr505560AspCysAlaAlaAlaThrGlyMetCysGlnProIleProLeuHis Ile65707580ArgProGluAlaValAsnMetSerLeuGlyLeuThrLeuAlaAlaSer859095ThrAsnGlySerArgLeuLeuAlaCysGlyProThrLeuHisArgVal100105110CysGlyGluAsnSerTyrSerLysGlySerCysLeuLeuLeuGlySer 115120125ArgTrpGluIleIleGlnThrValProAspAlaThrProGluCysPro130135140HisGlnGluMetAspIleValPheLe uIleAspGlySerGlySerIle145150155160AspGlnAsnAspPheAsnGlnMetLysGlyPheValGlnAlaValMet165 170175GlyGlnPheGluGlyThrAspThrLeuPheAlaLeuMetGlnTyrSer180185190AsnLeuLeuLysIleHisPheThrPheThrGlnPhe ArgThrSerPro195200205SerGlnGlnSerLeuValAspProIleValGlnLeuLysGlyLeuThr210215220PheThrA laThrGlyIleLeuThrValValThrGlnLeuPheHisHis225230235240LysAsnGlyAlaArgLysSerAlaLysLysIleLeuIleValIleThr 245250255AspGlyGlnLysTyrLysAspProLeuGluTyrSerAspValIlePro260265270GlnAlaGluLysAlaGl yIleIleArgTyrAlaIleGlyValGlyHis275280285AlaPheGlnGlyProThrAlaArgGlnGluLeuAsnThrIleSerSer290295 300AlaProProGlnAspHisValPheLysValAspAsnPheAlaAlaLeu305310315320GlySerIleGlnLysGlnLeuGlnGluLysIleTyrAla ValGluGly325330335ThrGlnSerArgAlaSerSerSerPheGlnHisGluMetSerGlnGlu340345350GlyPheSerThrAlaLeuThrMetAspGlyLeuPheLeuGlyAlaVal355360365GlySerPheSerTrpSerGlyGlyAlaPheLeuTyrProProAsnMet370 375380SerProThrPheIleAsnMetSerGlnGluAsnValAspMetArgAsp385390395400SerTyrLeuGlyTyrSerTh rGluLeuAlaLeuTrpLysGlyValGln405410415AsnLeuValLeuGlyAlaProArgTyrGlnHisThrGlyLysAlaVal420 425430IlePheThrGlnValSerArgGlnTrpArgLysLysAlaGluValThr435440445GlyThrGlnIleGlySerTyrPheGlyAlaSerLeuCys SerValAsp450455460ValAspSerAspGlySerThrAspLeuIleLeuIleGlyAlaProHis465470475480T yrTyrGluGlnThrArgGlyGlyGlnValSerValCysProLeuPro485490495ArgGlyGlnArgValGlnTrpGlnCysAspAlaValLeuArgGlyGlu 500505510GlnGlyHisProTrpGlyArgPheGlyAlaAlaLeuThrValLeuGly515520525AspValAsnGluAspLysLe uIleAspValAlaIleGlyAlaProGly530535540GluGlnGluAsnArgGlyAlaValTyrLeuPheHisGlyAlaSerGlu545550555 560SerGlyIleSerProSerHisSerGlnArgIleAlaSerSerGlnLeu565570575SerProArgLeuGlnTyrPheGlyGlnAlaLeuSer GlyGlyGlnAsp580585590LeuThrGlnAspGlyLeuMetAspLeuAlaValGlyAlaArgGlyGln595600605V alLeuLeuLeuArgSerLeuProValLeuLysValGlyValAlaMet610615620ArgPheSerProValGluValAlaLysAlaValTyrArgCysTrpGlu625 630635640GluLysProSerAlaLeuGluAlaGlyAspAlaThrValCysLeuThr645650655IleGlnLysSerSerLe uAspGlnLeuGlyAspIleGlnSerSerVal660665670ArgPheAspLeuAlaLeuAspProGlyArgLeuThrSerArgAlaIle675680 685PheAsnGluThrLysAsnProThrLeuThrArgArgLysThrLeuGly690695700LeuGlyIleHisCysGluThrLeuLysLeuLeuLeuProAspCys Val705710715720GluAspValValSerProIleIleLeuHisLeuAsnPheSerLeuVal725730735ArgGluProIleProSerProGlnAsnLeuArgProValLeuAlaVal740745750GlySerGlnAspLeuPheThrAlaSerLeuProPheGluLysAsnCys 755760765GlyGlnAspGlyLeuCysGluGlyAspLeuGlyValThrLeuSerPhe770775780SerGlyLeuGlnThrLeuThrValGl ySerSerLeuGluLeuAsnVal785790795800IleValThrValTrpAsnAlaGlyGluAspSerTyrGlyThrValVal805 810815SerLeuTyrTyrProAlaGlyLeuSerHisArgArgValSerGlyAla820825830GlnLysGlnProHisGlnSerAlaLeuArgLeuAla CysGluThrVal835840845ProThrGluAspGluGlyLeuArgSerSerArgCysSerValAsnHis850855860ProIleP heHisGluGlySerAsnGlyThrPheIleValThrPheAsp865870875880ValSerTyrLysAlaThrLeuGlyAspArgMetLeuMetArgAlaSer 885890895AlaSerSerGluAsnAsnLysAlaSerSerSerLysAlaThrPheGln900905910LeuGluLeuProValLy sTyrAlaValTyrThrMetIleSerArgGln915920925GluGluSerThrLysTyrPheAsnPheAlaThrSerAspGluLysLys930935 940MetLysGluAlaGluHisArgTyrArgValAsnAsnLeuSerGlnArg945950955960AspLeuAlaIleSerIleAsnPheTrpValProValLeu LeuAsnGly965970975ValAlaValTrpAspValValMetGluAlaProSerGlnSerLeuPro980985990CysValSerGluArgLysProProGlnHisSerAspPheLeuThrGln99510001005IleSerArgSerProMetLeuAspCysSerIleAlaAspCysLeuGln1010 10151020PheArgCysAspValProSerPheSerValGlnGluGluLeuAspPhe1025103010351040ThrLeuLysGlyAsnLeu SerPheGlyTrpValArgGluThrLeuGln104510501055LysLysValLeuValValSerValAlaGluIleThrPheAspThrSer1060 10651070ValTyrSerGlnLeuProGlyGlnGluAlaPheMetArgAlaGlnMet107510801085GluMetValLeuGluGluAspGluValTyrAsnA laIleProIleIle109010951100MetGlySerSerValGlyAlaLeuLeuLeuLeuAlaLeuIleThrAla1105111011151 120ThrLeuTyrLysLeuGlyPhePheLysArgHisTyrLysGluMetLeu112511301135GluAspLysProGluAspThrAlaThrPheSerGlyAspAspPheSer114011451150CysValAlaProAsnValProLysSer11551160(2) INFORMATION FOR SEQ ID NO:3:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 1153 amino acids(B) TYPE: amino acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:MetAlaLeuArgValLeuLeuLeuThrAlaLeuThrLeuCysHisGly1510 15PheAsnLeuAspThrGluAsnAlaMetThrPheGlnGluAsnAlaArg202530GlyPheGlyGlnSerValValGlnLeuGlnGlySerArg ValValVal354045GlyAlaProGlnGluIleValAlaAlaAsnGlnArgGlySerLeuTyr505560 GlnCysAspTyrSerThrGlySerCysGluProIleArgLeuGlnVal65707580ProValGluAlaValAsnMetSerLeuGlyLeuSerLeuAl aAlaThr859095ThrSerProProGlnLeuLeuAlaCysGlyProThrValHisGlnThr100105 110CysSerGluAsnThrTyrValLysGlyLeuCysPheLeuPheGlySer115120125AsnLeuArgGlnGlnProGlnLysPheProGluAlaLe uArgGlyCys130135140ProGlnGluAspSerAspIleAlaPheLeuIleAspGlySerGlySer145150155 160IleIleProHisAspPheArgArgMetLysGluPheValSerThrVal165170175MetGluGlnLeuLysLysSerLysThrLeuP heSerLeuMetGlnTyr180185190SerGluGluPheArgIleHisPheThrPheLysGluPheGlnAsnAsn195200 205ProAsnProArgSerLeuValLysProIleThrGlnLeuLeuGlyArg210215220ThrHisThrAlaThrGlyIleArgLysValValArg GluLeuPheAsn225230235240IleThrAsnGlyAlaArgLysAsnAlaPheLysIleLeuValValIle245 250255ThrAspGlyGluLysPheGlyAspProLeuGlyTyrGluAspValIle260265270ProGluAlaAspArgGluGlyVal IleArgTyrValIleGlyValGly275280285AspAlaPheArgSerGluLysSerArgGlnGluLeuAsnThrIleAla290295 300SerLysProProArgAspHisValPheGlnValAsnAsnPheGluAla305310315320LeuLysThrIleGlnAsnGlnLe uArgGluLysIlePheAlaIleGlu325330335GlyThrGlnThrGlySerSerSerSerPheGluHisGluMetSerGln340 345350GluGlyPheSerAlaAlaIleThrSerAsnGlyProLeuLeuSerThr355360365ValGlySerTyrAspTrpA laGlyGlyValPheLeuTyrThrSerLys370375380GluLysSerThrPheIleAsnMetThrArgValAspSerAspMetAsn385390 395400AspAlaTyrLeuGlyTyrAlaAlaAlaIleIleLeuArgAsnArgVal405410415GlnSerLeuVal LeuGlyAlaProArgTyrGlnHisIleGlyLeuVal420425430AlaMetPheArgGlnAsnThrGlyMetTrpGluSerAsnAlaAsnVal43 5440445LysGlyThrGlnIleGlyAlaTyrPheGlyAlaSerLeuCysSerVal450455460AspValAspSerAsnGly SerThrAspLeuValLeuIleGlyAlaPro465470475480HisTyrTyrGluGlnThrArgGlyGlyGlnValSerValCysProLeu 485490495ProArgGlyGlnArgAlaArgTrpGlnCysAspAlaValLeuTyrGly500505510GluGl nGlyGlnProTrpGlyArgPheGlyAlaAlaLeuThrValLeu515520525GlyAspValAsnGlyAspLysLeuThrAspValAlaIleGlyAlaPro 530535540GlyGluGluAspAsnArgGlyAlaValTyrLeuPheHisGlyThrSer545550555560GlyS erGlyIleSerProSerHisSerGlnArgIleAlaGlySerLys565570575LeuSerProArgLeuGlnTyrPheGlyGlnSerLeuSerGlyGlyGln 580585590AspLeuThrMetAspGlyLeuValAspLeuThrValGlyAlaGlnGly595600605 HisValLeuLeuLeuArgSerGlnProValLeuArgValLysAlaIle610615620MetGluPheAsnProArgGluValAlaArgAsnValPheGluCysAsn62 5630635640AspGlnValValLysGlyLysGluAlaGlyGluValArgValCysLeu645650655HisValGlnLysSerThrArgAspArgLeuArgGluGlyGlnIleGln660665670SerValValThrTyrAspLeuAlaLeuAspSerGlyArgPro HisSer675680685ArgAlaValPheAsnGluThrLysAsnSerThrArgArgGlnThrGln690695700 ValLeuGlyLeuThrGlnThrCysGluThrLeuLysLeuGlnLeuPro705710715720AsnCysIleGluAspProValSerProIleValLeuArgLeu AsnPhe725730735SerLeuValGlyThrProLeuSerAlaPheGlyAsnLeuArgProVal740745 750LeuAlaGluAspAlaGlnArgLeuPheThrAlaLeuPheProPheGlu755760765LysAsnCysGlyAsnAspAsnIleCysGlnAspAspLe uSerIleThr770775780PheSerPheMetSerLeuAspCysLeuValValGlyGlyProArgGlu785790795 800PheAsnValThrValThrValArgAsnAspGlyGluAspSerTyrArg805810815ThrGlnValThrPhePhePheProLeuAspL euSerTyrArgLysVal820825830SerThrLeuGlnAsnGlnArgSerGlnArgSerTrpArgLeuAlaCys835840 845GluSerAlaSerSerThrGluValSerGlyAlaLeuLysSerThrSer850855860CysSerIleAsnHisProIlePheProGluAsnSer GluValThrPhe865870875880AsnIleThrPheAspValAspSerLysAlaSerLeuGlyAsnLysLeu885 890895LeuLeuLysAlaAsnValThrSerGluAsnAsnMetProArgThrAsn900905910LysThrGluPheGlnLeuGluLeu ProValLysTyrAlaValTyrMet915920925ValValThrSerHisGlyValSerThrLysTyrLeuAsnPheThrAla930935 940SerGluAsnThrSerArgValMetGlnHisGlnTyrGlnValSerAsn945950955960LeuGlyGlnArgSerLeuProIl eSerLeuValPheLeuValProVal965970975ArgLeuAsnGlnThrValIleTrpAspArgProGlnValThrPheSer980 985990GluAsnLeuSerSerThrCysHisThrLysGluArgLeuProSerHis99510001005SerAspPheLeuAlaGlu LeuArgLysAlaProValValAsnCysSer101010151020IleAlaValCysGlnArgIleGlnCysAspIleProPhePheGlyIle10251030 10351040GlnGluGluPheAsnAlaThrLeuLysGlyAsnLeuSerPheAspTrp104510501055TyrIleLys ThrSerHisAsnHisLeuLeuIleValSerThrAlaGlu106010651070IleLeuPheAsnAspSerValPheThrLeuLeuProGlyGlnGlyAla 107510801085PheValArgSerGlnThrGluThrLysValGluProPheGluValPro109010951100AsnProLeuPro LeuIleValGlySerSerValGlyGlyLeuLeuLeu1105111011151120LeuAlaLeuIleThrAlaAlaLeuTyrLysLeuGlyPhePheLysArg 112511301135GlnTyrLysAspMetMetSerGluGlyGlyProProGlyAlaGluPro114011451150 Gln(2) INFORMATION FOR SEQ ID NO:4:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 1163 amino acids(B) TYPE: amino acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:MetThrArgThrArgAlaAlaLeuLeuLeuPheThrAl aLeuAlaThr151015SerLeuGlyPheAsnLeuAspThrGluGluLeuThrAlaPheArgVal2025 30AspSerAlaGlyPheGlyAspSerValValGlnTyrAlaAsnSerTrp354045ValValValGlyAlaProGlnLysIleIleAlaAla AsnGlnIleGly505560GlyLeuTyrGlnCysGlyTyrSerThrGlyAlaCysGluProIleGly657075 80LeuGlnValProProGluAlaValAsnMetSerLeuGlyLeuSerLeu859095AlaSerThrThrSerProSerGlnLeuLeuAl aCysGlyProThrVal100105110HisHisGluCysGlyArgAsnMetTyrLeuThrGlyLeuCysPheLeu115120 125LeuGlyProThrGlnLeuThrGlnArgLeuProValSerArgGlnGlu130135140CysProArgGlnGluGlnAspIleValPheLeuIleA spGlySerGly145150155160SerIleSerSerArgAsnPheAlaThrMetMetAsnPheValArgAla165 170175ValIleSerGlnPheGlnArgProSerThrGlnPheSerLeuMetGln180185190PheSerAsnLysPheGlnThrHis PheThrPheGluGluPheArgArg195200205ThrSerAsnProLeuSerLeuLeuAlaSerValHisGlnLeuGlnGly210215 220PheThrTyrThrAlaThrAlaIleGlnAsnValValHisArgLeuPhe225230235240HisAlaSerTyrGlyAlaArgArg AspAlaIleLysIleLeuIleVal245250255IleThrAspGlyLysLysGluGlyAspSerLeuAspTyrLysAspVal260 265270IleProMetAlaAspAlaAlaGlyIleIleArgTyrAlaIleGlyVal275280285GlyLeuAlaPheGlnAsnAr gAsnSerTrpLysGluLeuAsnAspIle290295300AlaSerLysProSerGlnGluHisIlePheLysValGluAspPheAsp305310 315320AlaLeuLysAspIleGlnAsnGlnLeuLysGluLysIlePheAlaIle325330335GluGlyThrGluT hrIleSerSerSerSerPheGluLeuGluMetAla340345350GlnGluGlyPheSerAlaValPheThrProAspGlyProValLeuGly355 360365AlaValGlySerPheThrTrpSerGlyGlyAlaPheLeuTyrProPro370375380AsnMetSerProThrPhe IleAsnMetSerGlnGluAsnValAspMet385390395400ArgAspSerTyrLeuGlyTyrSerThrGluLeuAlaLeuTrpLysGly 405410415ValGlnSerLeuValLeuGlyAlaProArgTyrGlnHisIleGlyLys420425430AlaVal IlePheIleGlnValSerArgGlnTrpArgMetLysAlaGlu435440445ValIleGlyThrGlnIleGlySerTyrPheGlyAlaSerLeuCysSer4 50455460ValAspValAspThrAspGlySerThrAspLeuValLeuIleGlyAla465470475480ProHi sTyrTyrGluGlnThrArgGlyGlyGlnValSerValCysPro485490495LeuProArgGlyTrpArgArgTrpTrpCysAspAlaValLeuTyrGly 500505510GluGlnGlyHisProTrpGlyArgPheGlyAlaAlaLeuThrValLeu515520525G lyAspValAsnGlyAspLysLeuThrAspValValIleGlyAlaPro530535540GlyGluGluGluAsnArgGlyAlaValTyrLeuPheHisGlyValLeu545 550555560GlyProSerIleSerProSerHisSerGlnArgIleAlaGlySerGln565570575LeuSerSerArgLeuGlnTyrPheGlyGlnAlaLeuSerGlyGlyGln580585590AspLeuThrGlnAspGlyLeuValAspLeuAlaValGlyAlaA rgGly595600605GlnValLeuLeuLeuArgThrArgProValLeuTrpValGlyValSer610615620 MetGlnPheIleProAlaGluIleProArgSerAlaPheGluCysArg625630635640GluGlnValValSerGluGlnThrLeuValGlnSerAsnIle CysLeu645650655TyrIleAspLysArgSerLysAsnLeuLeuGlySerArgAspLeuGln660665 670SerSerValThrLeuAspLeuAlaLeuAlaProGlyArgLeuSerPro675680685ArgAlaIlePheGlnGluThrLysAsnArgSerLeuSer ArgValArg690695700ValLeuGlyLeuLysAlaHisCysGluAsnPheAsnLeuLeuLeuPro705710715 720SerCysValGluAspSerValIleProIleIleLeuArgLeuAsnPhe725730735ThrLeuValGlyLysProLeuLeuAlaPheAr gAsnLeuArgProMet740745750LeuAlaAlaLeuAlaGlnArgTyrPheThrAlaSerLeuProPheGlu755760 765LysAsnCysGlyAlaAspHisIleCysGlnAspAsnLeuGlyIleSer770775780PheSerPheProGlyLeuLysSerLeuLeuValGlyS erAsnLeuGlu785790795800LeuAsnAlaGluValMetValTrpAsnAspGlyGluAspSerTyrGly805 810815ThrThrIleThrPheSerHisProAlaGlyLeuSerTyrArgTyrVal820825830AlaGluGlyGlnLysGlnGlyGln LeuArgSerLeuHisLeuThrCys835840845CysSerAlaProValGlySerGlnGlyThrTrpSerThrSerCysArg850855 860IleAsnHisLeuIlePheArgGlyGlyAlaGlnIleThrPheLeuAla865870875880ThrPheAspValSerProLysAla ValGlyLeuAspArgLeuLeuLeu885890895IleAlaAsnValSerSerGluAsnAsnIleProArgThrSerLysThr900 905910IlePheGlnLeuGluLeuProValLysTyrAlaValTyrIleValVal915920925SerSerHisGluGlnPheTh rLysTyrLeuAsnPheSerGluSerGlu930935940GluLysGluSerHisValAlaMetHisArgTyrGlnValAsnAsnLeu945950 955960GlyGlnArgAspLeuProValSerIleAsnPheTrpValProValGlu965970975LeuAsnGlnGluA laValTrpMetAspValGluValSerHisProGln980985990AsnProSerLeuArgCysSerSerGluLysIleAlaProProAlaSer995 10001005AspPheLeuAlaHisIleGlnLysAsnProValLeuAspCysSerIle101010151020AlaGlyCysLeuArgPh eArgCysAspValProSerPheSerValGln1025103010351040GluGluLeuAspPheThrLeuLysGlyAsnLeuSerPheGlyTrpVal 104510501055ArgGlnIleLeuGlnLysLysValSerValValSerValAlaGluIle106010651070Il ePheAspThrSerValTyrSerGlnLeuProGlyGlnGluAlaPhe107510801085MetArgAlaGlnThrIleThrValLeuGluLysTyrLysValHisAsn 109010951100ProIleProLeuIleValGlySerSerIleGlyGlyLeuLeuLeuLeu1105111011151120 AlaLeuIleThrAlaValLeuTyrLysValGlyPhePheLysArgGln112511301135TyrLysGluMetMetGluGluAlaAsnGlyGlnIleAlaProGl uAsn114011451150GlyThrGlnThrProSerProProSerGluLys11551160(2) INFORMATION FOR SEQ ID NO:5:(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 12 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: peptide(xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:PheAsnLeuAspValGluGluProMetValPheGln1510(2) INFORMATION FOR SEQ ID NO:6: (i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 35 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA(xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:TTYAAYYTGGAYGTNGARGARCCNATGGTNTTYCA35(2) INFORMATION FOR SEQ ID NO:7:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 36 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA(xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:TTCAACCTGGACGTGGAGGAGCCCATGGTGTTCCAA36(2) INFORMATION FOR SEQ ID NO:8:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 36 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA(xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:TTCAACCTGGACGTNGAASANCCCATGGTCTTCCAA 36(2) INFORMATION FOR SEQ ID NO:9:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 23 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA(xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:TTYAAYYTNGAYGTNGARGARCC 23(2) INFORMATION FOR SEQ ID NO:10:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 20 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA(xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:TTYAAYYTGGACGTNGAAGA 20(2) INFORMATION FOR SEQ ID NO:11:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 17 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA(xi) SEQUENCE DESCRIPTION: SEQ ID NO:11:TGRAANACCATNGGYTC 17(2) INFORMATION FOR SEQ ID NO:12:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 18 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA(xi) SEQUENCE DESCRIPTION: SEQ ID NO:12:TTGGAAGACCATNGGYTC 18(2) INFORMATION FOR SEQ ID NO:13:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 17 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA(xi) SEQUENCE DESCRIPTION: SEQ ID NO:13:ATTAACCCTCAC TAAAG17(2) INFORMATION FOR SEQ ID NO:14:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 17 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA(xi) SEQUENCE DESCRIPTION: SEQ ID NO:14:AAT ACGACTCACTATAG17(2) INFORMATION FOR SEQ ID NO:15:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 11 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: peptide(xi) SEQUENCE DESCRIPTION: SEQ ID NO:15:ValPh eGlnGluXaaGlyAlaGlyPheGlyGln1510(2) INFORMATION FOR SEQ ID NO:16:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 14 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: peptide(xi) SEQUENCE DESCRIPTION: SEQ ID NO:16:LeuTyrAspXaaValAlaAlaThrGlyLeuXaaGlnProIle1510(2) INFORMATION FOR SEQ ID NO:17:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 12 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide(xi) SEQUENCE DESCRIPTION: SEQ ID NO:17:ProLeuGluTyrXaaAspValIleProGlnAlaGlu1510(2) INFORMATION FOR SEQ ID NO:18:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 10 amino acids(B) TYPE: amino acid (D) TOPOLOGY: linear(ii) MOLECULE TYPE: peptide(xi) SEQUENCE DESCRIPTION: SEQ ID NO:18:PheGlnGluGlyPheSerXaaValLeuXaa1510(2) INFORMATION FOR SEQ ID NO:19:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 14 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: peptide(xi) SEQUENCE DESCRIPTION: SEQ ID NO:19:ThrSerProThrPheIleXaaMetSerGlnGluAsnValAsp1510(2) INFORMATION FOR SEQ ID NO:20:(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 17 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: peptide(xi) SEQUENCE DESCRIPTION: SEQ ID NO:20:LeuValValGlyAlaProLeuGluValValAlaValXaaGlnThrGly1510 15Arg(2) INFORMATION FOR SEQ ID NO:21:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 9 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: peptide(xi) SEQUENCE DESCRIPTION: SEQ ID NO:21:LeuAspXaaLysProXaaAspThrAla1 5(2) INFORMATION FOR SEQ ID NO:22:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 7 amino acids(B) TYPE: amino acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: peptide(xi) SEQUENCE DESCRIPTION: SEQ ID NO:22:PheGlyGluGlnPheSerGlu1 5(2) INFORMATION FOR SEQ ID NO:23:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 21 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA(xi) SEQUENCE DESCRIPTION: SEQ ID NO:23:RAANCCYTCYTGRAAACTYTC 21(2) INFORMATION FOR SEQ ID NO:24:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 1006 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: cDNA(xi) SEQUENCE DESCRIPTION: SEQ ID NO:24:TTCAACCTGGACGTGGAGGAGCCCATGGTGTTCAAGAGGA TGGAGCTGGCTTTGGACAGA60GCGTGGCCCAGCTTGGCGGATCTAGACTCGTGGTGGGAGCCCCCCTGGAGGTGGTGGCGG120TCAACCAAACAGGAAGGTTGTATGACTGTGTGGCTGCCACTGGCCTTGTCAACCCATACC180CCTGCACACACCCC CAGATGCTGTGAACATGTCCCTGGGTCTGTCCCTGTCAGCCGCCGC240CAGTCGCCCCTGGCTGCTGGCCTGTGGCCCAACCATGCACAGAGCCTGTGGGGAGAATAT300GTATGCAGAAGGCTTTTGCCTCCTGTTGGACTCCCATCTGCAGACCATTTGGACAGTA CC360TGCTGCCCTACCAGAGTGTCCAAGTCAAGAGATGGACATTGTCTTCCTGATTGATGGTTC420TGGCAGTATGAGCAAAGTGACTTTAAACAAATGAAGGATTTGTGAGAGCTGTGATGGGAC480AGTTTGAGGGCACCCAAACCCTGTTCTCACTG ATACAGTATCCCACCTCCCTGAAGATCC540ACTTCACCTTCACGCAATTCCAGAGCAGCTGGAACCCTCTGAGCCTGGTGGATCCCATTG600TCCAACTGGACGGCCTGACATATACAGCCACGGGCATCCGGAAAGTGGTGGAGGAACTGT660TTCATAG TAAGAATGGGGCCCGTAAAAGTGCCAAGAAGATCCTCATTGTCATCACAGATG720GCAAAAATACAAAGACCCCCTGGAGTACGAGGACGTATCCCCAGGCAGAGAGAGCGGATC780ATCCGCTATGCCATTGGGGTGGGAGATGCTTTCTGGAAACCCAGTGCCAA GCAGGAGCTG840GACAACATTGGCTCAGAGCCGGCTCAGGACCATGTGTTCAGGGTGGACAACTTTGCAGCA900CTCAGCAGCATCCAGGAGCAGCTGCAGGAGAAGATCTTTGCACTCGAAGGAACCCAGTCG960ACGACAAGTAGCTCTTTCCAACATG AGATGTTCCAAGAAGGGTTCA1006(2) INFORMATION FOR SEQ ID NO:25:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 17 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA(xi) SEQUENCE DESCRIPTION: SEQ ID NO:25:GTNTTYCARGARGAYG G17(2) INFORMATION FOR SEQ ID NO:26:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 20 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA(xi) SEQUENCE DESCRIPTION: SEQ ID NO:26:CCACTGT CAGGATGCCCGTG20(2) INFORMATION FOR SEQ ID NO:27:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 42 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA(xi) SEQUENCE DESCRIPTION: SEQ ID NO:27:AGTTACGAATTCGCCACCATGGCTCTACGGGTGCTTCTTCTG42(2) INFORMATION FOR SEQ ID NO:28:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 42 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:28:AGTTACGAATTCGCCACCATGACTCGGACTGTGCTTCTTCTG42(2) INFORMATION FOR SEQ ID NO:29:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 36 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA(xi) SEQUENCE DESCRIPTION: SEQ ID NO:29:AGTTACGAATTCGCCACCATGACCTTCGGCACTGTG36(2) INFORMATION FOR SEQ ID NO:30:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 20 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA(xi) SEQUENCE DESCRIPTION: SEQ ID NO:30:TTGCTGACTGCCTGCAGTTC20(2) INFORMATION FOR SEQ ID NO:31:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 36 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single (D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA(xi) SEQUENCE DESCRIPTION: SEQ ID NO:31:GTTCTGACGCGTAATGGCATTGTAGACCTCGTCTTC36(2) INFORMATION FOR SEQ ID NO:32:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 36 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA(xi) SEQUENCE DESCRIPTION: SEQ ID NO:32:ACGTATGCAGGATCCCATCAAGAGATGGACATCGCT36(2) INFORMATION FOR SEQ ID NO:33:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 37 base pairs(B) TYPE: nucleic acid (C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA(xi) SEQUENCE DESCRIPTION: SEQ ID NO:33:ACTGCATGTCTCGAGGCTGAAGCCTTCTTGGGACATC37(2) INFORMATION FOR SEQ ID NO:34:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 24 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA(xi) SEQUENCE DESCRIPTION: SEQ ID NO:34:TATAGACTGCTGGGTAGTCCCCAC24(2) INFORMATION FOR SEQ ID NO:35:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 24 base pairs (B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA(xi) SEQUENCE DESCRIPTION: SEQ ID NO:35:TGAAGATTGGGGGTAAATAACAGA24(2) INFORMATION FOR SEQ ID NO:36:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 3528 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: cDNA(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: 1..3456(xi) SEQUENCE DESCRIPTION: SEQ ID NO:36:GGCTGGGCCCTGGCTTCCTGTCATGGGTCTAACCTGGATGTGGA GGAA48GlyTrpAlaLeuAlaSerCysHisGlySerAsnLeuAspValGluGlu151015CCCATCGTGTTCAGAGAGGATGCAGCCAGCTTTGGACAGAC TGTGGTG96ProIleValPheArgGluAspAlaAlaSerPheGlyGlnThrValVal202530CAGTTTGGTGGATCTCGACTCGTGGTGGGAGCCCCTCTGGA GGCGGTG144GlnPheGlyGlySerArgLeuValValGlyAlaProLeuGluAlaVal354045GCAGTCAACCAAACAGGACGGTTGTATGACTGTGCACCTGCCAC TGGC192AlaValAsnGlnThrGlyArgLeuTyrAspCysAlaProAlaThrGly505560ATGTGCCAGCCCATCGTACTGCGCAGTCCCCTAGAGGCAGTGAACATG 240MetCysGlnProIleValLeuArgSerProLeuGluAlaValAsnMet65707580TCCCTGGGCCTGTCTCTGGTGACTGCCACCAATAACGCCCAGTT GCTG288SerLeuGlyLeuSerLeuValThrAlaThrAsnAsnAlaGlnLeuLeu859095GCTTGTGGTCCAACTGCACAGAGAGCTTGTGTGAAGAACAT GTATGCG336AlaCysGlyProThrAlaGlnArgAlaCysValLysAsnMetTyrAla100105110AAAGGTTCCTGCCTCCTTCTCGGCTCCAGCTTGCAGTTCAT CCAGGCA384LysGlySerCysLeuLeuLeuGlySerSerLeuGlnPheIleGlnAla115120125GTCCCTGCCTCCATGCCAGAGTGTCCAAGACAAGAGATGGACAT TGCT432ValProAlaSerMetProGluCysProArgGlnGluMetAspIleAla130135140TTCCTGATTGATGGTTCTGGCAGCATTAACCAAAGGGACTTTGCCCAG 480PheLeuIleAspGlySerGlySerIleAsnGlnArgAspPheAlaGln145150155160ATGAAGGACTTTGTCAAAGCTTTGATGGGAGAGTTTGCGAGCAC CAGC528MetLysAspPheValLysAlaLeuMetGlyGluPheAlaSerThrSer165170175ACCTTGTTCTCCCTGATGCAATACTCGAACATCCTGAAGAC CCATTTT576ThrLeuPheSerLeuMetGlnTyrSerAsnIleLeuLysThrHisPhe180185190ACCTTCACTGAATTCAAGAACATCCTGGACCCTCAGAGCCT GGTGGAT624ThrPheThrGluPheLysAsnIleLeuAspProGlnSerLeuValAsp195200205CCCATTGTCCAGCTGCAAGGCCTGACCTACACAGCCACAGGCAT CCGG672ProIleValGlnLeuGlnGlyLeuThrTyrThrAlaThrGlyIleArg210215220ACAGTGATGGAAGAGCTATTTCATAGCAAGAATGGGTCCCGTAAAAGT 720ThrValMetGluGluLeuPheHisSerLysAsnGlySerArgLysSer225230235240GCCAAGAAGATCCTCCTTGTCATCACAGATGGGCAGAAATACAG AGAC768AlaLysLysIleLeuLeuValIleThrAspGlyGlnLysTyrArgAsp245250255CCCCTGGAGTATAGTGATGTCATTCCCGCCGCAGACAAAGC TGGCATC816ProLeuGluTyrSerAspValIleProAlaAlaAspLysAlaGlyIle260265270ATTCGTTATGCTATTGGGGTGGGAGATGCCTTCCAGGAGCC CACTGCC864IleArgTyrAlaIleGlyValGlyAspAlaPheGlnGluProThrAla275280285CTGAAGGAGCTGAACACCATTGGCTCAGCTCCCCCACAGGACCA CGTG912LeuLysGluLeuAsnThrIleGlySerAlaProProGlnAspHisVal290295300TTCAAGGTAGGCAACTTTGCAGCACTTCGCAGCATCCAGAGGCAACTT 960PheLysValGlyAsnPheAlaAlaLeuArgSerIleGlnArgGlnLeu305310315320CAGGAGAAAATCTTCGCCATTGAGGGAACTCAATCAAGGTCAAG TAGT1008GlnGluLysIlePheAlaIleGluGlyThrGlnSerArgSerSerSer325330335TCCTTTCAGCACGAGATGTCACAAGAAGGTTTCAGTTCAGC TCTCACA1056SerPheGlnHisGluMetSerGlnGluGlyPheSerSerAlaLeuThr340345350TCGGATGGACCCGTTCTGGGGGCCGYGGGAAGCTTCAGCTG GTCCGGA1104SerAspGlyProValLeuGlyAlaXaaGlySerPheSerTrpSerGly355360365GGTGCCTTCTTATATCCCCCAAATACGAGACCCACCTTTATCAA CATG1152GlyAlaPheLeuTyrProProAsnThrArgProThrPheIleAsnMet370375380TCTCAGGAGAATGTGGACATGAGAGACTCCTACCTGGGTTACTCCACC 1200SerGlnGluAsnValAspMetArgAspSerTyrLeuGlyTyrSerThr385390395400GCAGTGGCCTTTTGGAAGGGGGTTCACAGCCTGATCCTGGGGGC CCCG1248AlaValAlaPheTrpLysGlyValHisSerLeuIleLeuGlyAlaPro405410415CGTCACCAGCACACGGGGAAGGTTGTCATCTTTACCCAGGA AGCCAGG1296ArgHisGlnHisThrGlyLysValValIlePheThrGlnGluAlaArg420425430CATTGGAGGCCCAAGTCTGAAGTCAGAGGGACACAGATCGG CTCCTAC1344HisTrpArgProLysSerGluValArgGlyThrGlnIleGlySerTyr435440445TTCGGGGCCTCTCTCTGTTCTGTGGACGTGGATAGAGATGGCAG CACY1392PheGlyAlaSerLeuCysSerValAspValAspArgAspGlySerXaa450455460GACCTGGTCCTGATCGGAGCCCCCCATTACTATGAGCAGACCCGAGGG 1440AspLeuValLeuIleGlyAlaProHisTyrTyrGluGlnThrArgGly465470475480GGGCAGGTCTCAGTGTKCCCCGTGCCCGGTGTGAGGGGCAGGTG GCAG1488GlyGlnValSerValXaaProValProGlyValArgGlyArgTrpGln485490495TGTGAGGCCACCCTCCACGGGGAGCAGGRCCATCCTTGGGG CCGCTTT1536CysGluAlaThrLeuHisGlyGluGlnXaaHisProTrpGlyArgPhe500505510GGGGTGGCTCTGACAGTGCTGGGGGACGTAAACGGGGACAA TCTGGCA1584GlyValAlaLeuThrValLeuGlyAspValAsnGlyAspAsnLeuAla515520525GACGTGGCTATTGGTGCCCCTGGAGAGGAGGAGAGCAGAGGTGC TGTC1632AspValAlaIleGlyAlaProGlyGluGluGluSerArgGlyAlaVal530535540TACATATTTCATGGAGCCTCGAGACTGGAGATCATGCCCTCACCCAGC 1680TyrIlePheHisGlyAlaSerArgLeuGluIleMetProSerProSer545550555560CAGCGGGTCACTGGCTCCCAGCTCTCCCTGAGACTGCAGTATTT TGGG1728GlnArgValThrGlySerGlnLeuSerLeuArgLeuGlnTyrPheGly565570575CAGTCATTGAGTGGGGGTCAGGACCTTACACAGGATGGCCT GGTGGAC1776GlnSerLeuSerGlyGlyGlnAspLeuThrGlnAspGlyLeuValAsp580585590CTGGCCGTGGGAGCCCAGGGGCACGTACTGCTGCTCAGGAG TCTGCCT1824LeuAlaValGlyAlaGlnGlyHisValLeuLeuLeuArgSerLeuPro595600605CTGCTGAAAGTGGAGCTCTCCATAAGATTCGCCCCCATGGAGGT GGCA1872LeuLeuLysValGluLeuSerIleArgPheAlaProMetGluValAla610615620AAGGCTGTGTACCAGTGCTGGGAAAGGACTCCCACTGTCCTCGAAGCT 1920LysAlaValTyrGlnCysTrpGluArgThrProThrValLeuGluAla625630635640GGAGAGGCCACTGTCTGTCTCACTGTCCACAAAGGCTCACCTGA CCTG1968GlyGluAlaThrValCysLeuThrValHisLysGlySerProAspLeu645650655TTAGGTAATGTCCAAGGCTCTGTCAGGTATGATCTGGCGTT AGATCCG2016LeuGlyAsnValGlnGlySerValArgTyrAspLeuAlaLeuAspPro660665670GGCCGCCTGATTTCTCGTGCCATTTTTGATGAGACTAAGAA CTGCACT2064GlyArgLeuIleSerArgAlaIlePheAspGluThrLysAsnCysThr675680685TTGACGGGAAGGAAGACTCTGGGGCTTGGTGATCACTGCGAAAC AGTG2112LeuThrGlyArgLysThrLeuGlyLeuGlyAspHisCysGluThrVal690695700AAGCTGCTTTTGCCGGACTGTGTGGAAGATGCAGTGAGCCCTATCATC 2160LysLeuLeuLeuProAspCysValGluAspAlaValSerProIleIle705710715720CTGCGCCTCAACTTTTCCCTGGTGAGAGACTCTGCTTCACCCAG GAAC2208LeuArgLeuAsnPheSerLeuValArgAspSerAlaSerProArgAsn725730735CTGCATCCTGTGCTGGCTGTGGGCTCACAAGACCACATAAC TGCTTCT2256LeuHisProValLeuAlaValGlySerGlnAspHisIleThrAlaSer740745750CTGCCGTTTGAGAAGAACTGTAAGCAAGAACTCCTGTGTGA GGGGGAC2304LeuProPheGluLysAsnCysLysGlnGluLeuLeuCysGluGlyAsp755760765CTGGGCATCAGCTTTAACTTCTCAGGCCTGCAGGTCTTGGTGGT GGGA2352LeuGlyIleSerPheAsnPheSerGlyLeuGlnValLeuValValGly770775780GGCTCCCCAGAGCTCACTGTGACAGTCACTGTGTGGAATGAGGGTGAG 2400GlySerProGluLeuThrValThrValThrValTrpAsnGluGlyGlu785790795800GACAGCTATGGAACTTTAGTCAAGTTCTACTACCCAGCAGGGCT ATCT2448AspSerTyrGlyThrLeuValLysPheTyrTyrProAlaGlyLeuSer805810815TACCGACGGGTAACAGGGACTCAGCAACCTCATCAGTACCC ACTACGC2496TyrArgArgValThrGlyThrGlnGlnProHisGlnTyrProLeuArg820825830TTGGCCTGTGAGGCTGAGCCCGCTGCCCAGGAGGACCTGAG GAGCAGC2544LeuAlaCysGluAlaGluProAlaAlaGlnGluAspLeuArgSerSer835840845AGCTGTAGCATTAATCACCCCATCTTCCGAGAAGGTGCAAAGAC CACC2592SerCysSerIleAsnHisProIlePheArgGluGlyAlaLysThrThr850855860TTCATGATCACATTCGATGTCTCCTACAAGGCCTTCCTAGGAGACAGG 2640PheMetIleThrPheAspValSerTyrLysAlaPheLeuGlyAspArg865870875880TTGCTTCTGAGGGCCAAAGCCAGCAGTGAGAATAATAAGCCTGA TACC2688LeuLeuLeuArgAlaLysAlaSerSerGluAsnAsnLysProAspThr885890895AACAAGACTGCCTTCCAGCTGGAGCTCCCAGTGAAGTACAC CGTCTAT2736AsnLysThrAlaPheGlnLeuGluLeuProValLysTyrThrValTyr900905910ACCCTGATCAGTAGGCAAGAAGATTCCACCAACCATGTCAA CTTTTCA2784ThrLeuIleSerArgGlnGluAspSerThrAsnHisValAsnPheSer915920925TCTTCCCACGGGGGGAGAAGGCAAGAAGCCGCACATCGCTATCG TGTG2832SerSerHisGlyGlyArgArgGlnGluAlaAlaHisArgTyrArgVal930935940AATAACCTGAGTCCACTGAAGCTGGCCGTCAGAGTTAACTTCTGGGTC 2880AsnAsnLeuSerProLeuLysLeuAlaValArgValAsnPheTrpVal945950955960CCTGTCCTTCTGAACGGTGTGGCTGTGTGGGACGTGACTCTGAG CAGC2928ProValLeuLeuAsnGlyValAlaValTrpAspValThrLeuSerSer965970975CCAGCACAGGGTGTCTCCTGCGTGTCCCAGATGAAACCTCC TCAGAAT2976ProAlaGlnGlyValSerCysValSerGlnMetLysProProGlnAsn980985990CCCGACTTTCTGACCCAGATTCAGAGACGTTCTGTGCTGGA CTGCTCC3024ProAspPheLeuThrGlnIleGlnArgArgSerValLeuAspCysSer99510001005ATTGCTGACTGCCTGCACTCCCGCTGTGACATCCCCTCCTTGG ACATC3072IleAlaAspCysLeuHisSerArgCysAspIleProSerLeuAspIle101010151020CAGGATGAACTTGACTTCATTCTGAGGGGCAACCTCAGCTTCGGCTGG 3120GlnAspGluLeuAspPheIleLeuArgGlyAsnLeuSerPheGlyTrp1025103010351040GTCAGTCAGACATTGCAGGAAAAGGTGTTGCTTGTGAGTGAG GCTGAA3168ValSerGlnThrLeuGlnGluLysValLeuLeuValSerGluAlaGlu104510501055ATCACTTTCGACACATCTGTGTACTCCCAGCTGCCAGG ACAGGAGGCA3216IleThrPheAspThrSerValTyrSerGlnLeuProGlyGlnGluAla106010651070TTTCTGAGAGCCCAGGTGGAGACAACGTTAGAAGAAT ACGTGGTCTAT3264PheLeuArgAlaGlnValGluThrThrLeuGluGluTyrValValTyr107510801085GAGCCCATCTTCCTCGTGGCGGGCAGCTCGGTGGGAGGT CTGCTGTTA3312GluProIlePheLeuValAlaGlySerSerValGlyGlyLeuLeuLeu109010951100CTGGCTCTCATCACAGTGGTACTGTACAAGCTTGGCTYCTYCAAA CGT3360LeuAlaLeuIleThrValValLeuTyrLysLeuGlyXaaXaaLysArg1105111011151120CAGTACAAAGAAATGCTGGACGGCAAGGCTGCAGATCC TGTCACAGCC3408GlnTyrLysGluMetLeuAspGlyLysAlaAlaAspProValThrAla112511301135GGCCAGGCAGATTTCGGCTGTGAGACTCCTCCAT ATCTCGTGAGCTAGGAATC3463GlyGlnAlaAspPheGlyCysGluThrProProTyrLeuValSer114011451150CTCTCCTGCCTATCTCTGNAATGAAGATTGGTCCTGCCTATGAG TCTACTGGCATGGGAA3523CGAGT3528(2) INFORMATION FOR SEQ ID NO:37:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 1151 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:37:GlyTrpAlaLeuAlaSerCysHisGlySerAsnLeuAspValGluGlu151015ProIleValPheArgGluAspAlaAlaSerPheGlyGln ThrValVal202530GlnPheGlyGlySerArgLeuValValGlyAlaProLeuGluAlaVal354045AlaV alAsnGlnThrGlyArgLeuTyrAspCysAlaProAlaThrGly505560MetCysGlnProIleValLeuArgSerProLeuGluAlaValAsnMet657 07580SerLeuGlyLeuSerLeuValThrAlaThrAsnAsnAlaGlnLeuLeu859095AlaCysGlyProThrAlaGl nArgAlaCysValLysAsnMetTyrAla100105110LysGlySerCysLeuLeuLeuGlySerSerLeuGlnPheIleGlnAla115120 125ValProAlaSerMetProGluCysProArgGlnGluMetAspIleAla130135140PheLeuIleAspGlySerGlySerIleAsnGlnArgAspPheAlaGln145150155160MetLysAspPheValLysAlaLeuMetGlyGluPheAlaSerThrSer165170175T hrLeuPheSerLeuMetGlnTyrSerAsnIleLeuLysThrHisPhe180185190ThrPheThrGluPheLysAsnIleLeuAspProGlnSerLeuValAsp19 5200205ProIleValGlnLeuGlnGlyLeuThrTyrThrAlaThrGlyIleArg210215220ThrValMetGluGluLeuPheHisSerLy sAsnGlySerArgLysSer225230235240AlaLysLysIleLeuLeuValIleThrAspGlyGlnLysTyrArgAsp245250 255ProLeuGluTyrSerAspValIleProAlaAlaAspLysAlaGlyIle260265270IleArgTyrAlaIleGlyValGlyAspAlaPheGlnGlu ProThrAla275280285LeuLysGluLeuAsnThrIleGlySerAlaProProGlnAspHisVal290295300PheLysValG lyAsnPheAlaAlaLeuArgSerIleGlnArgGlnLeu305310315320GlnGluLysIlePheAlaIleGluGlyThrGlnSerArgSerSerSer 325330335SerPheGlnHisGluMetSerGlnGluGlyPheSerSerAlaLeuThr340345350SerAspGlyProValLeuGl yAlaXaaGlySerPheSerTrpSerGly355360365GlyAlaPheLeuTyrProProAsnThrArgProThrPheIleAsnMet370375 380SerGlnGluAsnValAspMetArgAspSerTyrLeuGlyTyrSerThr385390395400AlaValAlaPheTrpLysGlyValHisSerLeuIleLeuGly AlaPro405410415ArgHisGlnHisThrGlyLysValValIlePheThrGlnGluAlaArg420425430H isTrpArgProLysSerGluValArgGlyThrGlnIleGlySerTyr435440445PheGlyAlaSerLeuCysSerValAspValAspArgAspGlySerXaa450 455460AspLeuValLeuIleGlyAlaProHisTyrTyrGluGlnThrArgGly465470475480GlyGlnValSerValXaaProVa lProGlyValArgGlyArgTrpGln485490495CysGluAlaThrLeuHisGlyGluGlnXaaHisProTrpGlyArgPhe500505 510GlyValAlaLeuThrValLeuGlyAspValAsnGlyAspAsnLeuAla515520525AspValAlaIleGlyAlaProGlyGluGluGluSerArgGly AlaVal530535540TyrIlePheHisGlyAlaSerArgLeuGluIleMetProSerProSer545550555560GlnA rgValThrGlySerGlnLeuSerLeuArgLeuGlnTyrPheGly565570575GlnSerLeuSerGlyGlyGlnAspLeuThrGlnAspGlyLeuValAsp 580585590LeuAlaValGlyAlaGlnGlyHisValLeuLeuLeuArgSerLeuPro595600605LeuLeuLysValGluLeuSerIl eArgPheAlaProMetGluValAla610615620LysAlaValTyrGlnCysTrpGluArgThrProThrValLeuGluAla625630635 640GlyGluAlaThrValCysLeuThrValHisLysGlySerProAspLeu645650655LeuGlyAsnValGlnGlySerValArgTyrAspLeuAla LeuAspPro660665670GlyArgLeuIleSerArgAlaIlePheAspGluThrLysAsnCysThr675680685LeuT hrGlyArgLysThrLeuGlyLeuGlyAspHisCysGluThrVal690695700LysLeuLeuLeuProAspCysValGluAspAlaValSerProIleIle70571 0715720LeuArgLeuAsnPheSerLeuValArgAspSerAlaSerProArgAsn725730735LeuHisProValLeuAlaVa lGlySerGlnAspHisIleThrAlaSer740745750LeuProPheGluLysAsnCysLysGlnGluLeuLeuCysGluGlyAsp755760 765LeuGlyIleSerPheAsnPheSerGlyLeuGlnValLeuValValGly770775780GlySerProGluLeuThrValThrValThrValTrpAsnGluGlyGlu785790795800AspSerTyrGlyThrLeuValLysPheTyrTyrProAlaGlyLeuSer805810815T yrArgArgValThrGlyThrGlnGlnProHisGlnTyrProLeuArg820825830LeuAlaCysGluAlaGluProAlaAlaGlnGluAspLeuArgSerSer83 5840845SerCysSerIleAsnHisProIlePheArgGluGlyAlaLysThrThr850855860PheMetIleThrPheAspValSerTyrLy sAlaPheLeuGlyAspArg865870875880LeuLeuLeuArgAlaLysAlaSerSerGluAsnAsnLysProAspThr885890 895AsnLysThrAlaPheGlnLeuGluLeuProValLysTyrThrValTyr900905910ThrLeuIleSerArgGlnGluAspSerThrAsnHisVal AsnPheSer915920925SerSerHisGlyGlyArgArgGlnGluAlaAlaHisArgTyrArgVal930935940AsnAsnLeuS erProLeuLysLeuAlaValArgValAsnPheTrpVal945950955960ProValLeuLeuAsnGlyValAlaValTrpAspValThrLeuSerSer 965970975ProAlaGlnGlyValSerCysValSerGlnMetLysProProGlnAsn980985990ProAspPheLeuThrGlnIl eGlnArgArgSerValLeuAspCysSer99510001005IleAlaAspCysLeuHisSerArgCysAspIleProSerLeuAspIle10101015 1020GlnAspGluLeuAspPheIleLeuArgGlyAsnLeuSerPheGlyTrp1025103010351040ValSerGlnThrLeuGlnGluLysValLeuLeuValSer GluAlaGlu104510501055IleThrPheAspThrSerValTyrSerGlnLeuProGlyGlnGluAla106010651070PheLeuArgAlaGlnValGluThrThrLeuGluGluTyrValValTyr107510801085GluProIlePheLeuValAlaGlySerSerValGlyGlyLeuLeuLeu1090 10951100LeuAlaLeuIleThrValValLeuTyrLysLeuGlyXaaXaaLysArg1105111011151120GlnTyrLysGluMetLe uAspGlyLysAlaAlaAspProValThrAla112511301135GlyGlnAlaAspPheGlyCysGluThrProProTyrLeuValSer1140 11451150(2) INFORMATION FOR SEQ ID NO:38:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 21 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA(xi) SEQUENCE DESCRIPTION: SEQ ID NO:38:GTCCAAGCTGTCATGGGCCAG 21(2) INFORMATION FOR SEQ ID NO:39:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 23 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA(xi) SEQUENCE DESCRIPTION: SEQ ID NO:39:GTCCAGCAGACTGAAGAGCACGG 23(2) INFORMATION FOR SEQ ID NO:40:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 18 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA(xi) SEQUENCE DESCRIPTION: SEQ ID NO:40:TGTAAAACGACGGCC AGT18(2) INFORMATION FOR SEQ ID NO:41:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 19 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA(xi) SEQUENCE DESCRIPTION: SEQ ID NO:41:GGAAAC AGCTATGACCATG19(2) INFORMATION FOR SEQ ID NO:42:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 22 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA(xi) SEQUENCE DESCRIPTION: SEQ ID NO:42:GGACATGTTCACTGCCTCTAGG22(2) INFORMATION FOR SEQ ID NO:43:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 25 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:43:GGCGGACAGTCAGACGACTGTCCTG25(2) INFORMATION FOR SEQ ID NO:44:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 38 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA(xi) SEQUENCE DESCRIPTION: SEQ ID NO:44:CTGGTTCGGCCCACCTCTGAAGGTTCCAGAATCGATAG38(2) INFORMATION FOR SEQ ID NO:45:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 3519 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: cDNA(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: 52..3519(xi) SEQUENCE DESCRIPTION: SEQ ID NO:45:GCTTTCTGAAGGTTCCAGAATCGATAGTGAATTCGTGGGCACTGCTCAGATATGGTC57 MetValCGTGGAGTTGTGATCCTCCTGTGTGGCTGGGCCCTGGCTTCCTGTCAT105ArgGlyValValIleLeuLeuCysGly TrpAlaLeuAlaSerCysHis51015GGGTCTAACCTGGATGTGGAGAAGCCCGTCGTGTTCAAAGAGGATGCA153GlySerAsnLeuAspValGluLysProVal ValPheLysGluAspAla202530GCCAGCTTCGGACAGACTGTGGTGCAGTTTGGTGGATCTCGACTCGTG201AlaSerPheGlyGlnThrValValGlnPheGlyGly SerArgLeuVal35404550GTGGGAGCCCCTCTGGAGGCGGTGGCAGTCAACCAAACAGGACAGTCG249ValGlyAlaProLeuGluAlaValAlaVal AsnGlnThrGlyGlnSer556065TCTGACTGTCCGCCTGCCACTGGCGTGTGCCAGCCCATCTTACTGCAC297SerAspCysProProAlaThrGlyVal CysGlnProIleLeuLeuHis707580ATTCCCCTAGAGGCAGTGAACATGTCCCTGGGCCTGTCTCTGGTGGCT345IleProLeuGluAlaValAsnMetSer LeuGlyLeuSerLeuValAla859095GACACCAATAACTCCCAGTTGCTGGCTTGTGGTCCAACTGCACAGAGA393AspThrAsnAsnSerGlnLeuLeuAlaCys GlyProThrAlaGlnArg100105110GCTTGTGCAAAGAACATGTATGCAAAAGGTTCCTGCCTCCTTCTGGGC441AlaCysAlaLysAsnMetTyrAlaLysGlySerCys LeuLeuLeuGly115120125130TCCAGCTTGCAGTTCATCCAGGCAATCCCTGCTACCATGCCAGAGTGT489SerSerLeuGlnPheIleGlnAlaIlePro AlaThrMetProGluCys135140145CCAGGACAAGAGATGGACATTGCTTTCCTGATTGATGGCTCCGGCAGC537ProGlyGlnGluMetAspIleAlaPhe LeuIleAspGlySerGlySer150155160ATTGATCAAAGTGACTTTACCCAGATGAAGGACTTCGTCAAAGCTTTG585IleAspGlnSerAspPheThrGlnMet LysAspPheValLysAlaLeu165170175ATGGGCCAGTTGGCGAGCACCAGCACCTCGTTCTCCCTGATGCAATAC633MetGlyGlnLeuAlaSerThrSerThrSer PheSerLeuMetGlnTyr180185190TCAAACATCCTGAAGACTCATTTTACCTTCACGGAATTCAAGAGCAGC681SerAsnIleLeuLysThrHisPheThrPheThrGlu PheLysSerSer195200205210CTGAGCCCTCAGAGCCTGGTGGATGCCATCGTCCAGCTCCAAGGCCTG729LeuSerProGlnSerLeuValAspAlaIle ValGlnLeuGlnGlyLeu215220225ACGTACACAGCCTCGGGCATCCAGAAAGTGGTGAAAGAGCTATTTCAT777ThrTyrThrAlaSerGlyIleGlnLys ValValLysGluLeuPheHis230235240AGCAAGAATGGGGCCCGAAAAAGTGCCAAGAAGATACTAATTGTCATC825SerLysAsnGlyAlaArgLysSerAla LysLysIleLeuIleValIle245250255ACAGATGGGCAGAAATTCAGAGACCCCCTGGAGTATAGACATGTCATC873ThrAspGlyGlnLysPheArgAspProLeu GluTyrArgHisValIle260265270CCTGAAGCAGAGAAAGCTGGGATCATTCGCTATGCTATAGGGGTGGGA921ProGluAlaGluLysAlaGlyIleIleArgTyrAla IleGlyValGly275280285290GATGCCTTCCGGGAACCCACTGCCCTACAGGAGCTGAACACCATTGGC969AspAlaPheArgGluProThrAlaLeuGln GluLeuAsnThrIleGly295300305TCAGCTCCCTCGCAGGACCACGTGTTCAAGGTGGGCAATTTTGTAGCA1017SerAlaProSerGlnAspHisValPhe LysValGlyAsnPheValAla310315320CTTCGCAGCATCCAGCGGCAAATTCAGGAGAAAATCTTTGCCATTGAA1065LeuArgSerIleGlnArgGlnIleGln GluLysIlePheAlaIleGlu325330335GGAACCGAATCAAGGTCAAGTAGTTCCTTTCAGCACGAGATGTCACAA1113GlyThrGluSerArgSerSerSerSerPhe GlnHisGluMetSerGln340345350GAAGGTTTCAGCTCAGCTCTCTCAATGGATGGACCAGTTCTGGGGGCT1161GluGlyPheSerSerAlaLeuSerMetAspGlyPro ValLeuGlyAla355360365370GTGGGAGGCTTCAGCTGGTCTGGAGGTGCCTTCTTGTACCCCTCAAAT1209ValGlyGlyPheSerTrpSerGlyGlyAla PheLeuTyrProSerAsn375380385ATGAGATCCACCTTCATCAACATGTCTCAGGAGAACGAGGATATGAGG1257MetArgSerThrPheIleAsnMetSer GlnGluAsnGluAspMetArg390395400GACGCTTACCTGGGTTACTCCACCGCACTGGCCTTTTGGAAGGGGGTC1305AspAlaTyrLeuGlyTyrSerThrAla LeuAlaPheTrpLysGlyVal405410415CACAGCCTGATCCTGGGGGCCCCTCGCCACCAGCACACGGGGAAGGTT1353HisSerLeuIleLeuGlyAlaProArgHis GlnHisThrGlyLysVal420425430GTCATCTTTACCCAGGAATCCAGGCACTGGAGGCCCAAGTCTGAAGTC1401ValIlePheThrGlnGluSerArgHisTrpArgPro LysSerGluVal435440445450AGAGGGACACAGATCGGCTCCTACTTTGGGGCATCTCTCTGTTCTGTG1449ArgGlyThrGlnIleGlySerTyrPheGly AlaSerLeuCysSerVal455460465GACATGGATAGAGATGGCAGCACTGACCTGGTCCTGATTGGAGTCCCC1497AspMetAspArgAspGlySerThrAsp LeuValLeuIleGlyValPro470475480CATTACTATGAGCACACCCGAGGGGGGCAGGTGTCGGTGTGCCCCATG1545HisTyrTyrGluHisThrArgGlyGly GlnValSerValCysProMet485490495CCTGGTGTGAGGAGCAGGTGGCATTGTGGGACCACCCTCCATGGGGAG1593ProGlyValArgSerArgTrpHisCysGly ThrThrLeuHisGlyGlu500505510CAGGGCCATCCTTGGGGCCGCTTTGGGGCGGCTCTGACAGTGCTAGGG1641GlnGlyHisProTrpGlyArgPheGlyAlaAlaLeu ThrValLeuGly515520525530GACGTGAATGGGGACAGTCTGGCGGATGTGGCTATTGGTGCACCCGGA1689AspValAsnGlyAspSerLeuAlaAspVal AlaIleGlyAlaProGly535540545GAGGAGGAGAACAGAGGTGCTGTCTACATATTTCATGGAGCCTCGAGA1737GluGluGluAsnArgGlyAlaValTyr IlePheHisGlyAlaSerArg550555560CAGGACATCGCTCCCTCGCCTAGCCAGCGGGTCACTGGCTCCCAGCTC1785GlnAspIleAlaProSerProSerGln ArgValThrGlySerGlnLeu565570575TTCCTGAGGCTCCAATATTTTGGGCAGTCATTAAGTGGGGGTCAGGAC1833PheLeuArgLeuGlnTyrPheGlyGlnSer LeuSerGlyGlyGlnAsp580585590CTTACACAGGATGGCCTGGTGGACCTGGCCGTGGGAGCCCAGGGGCAC1881LeuThrGlnAspGlyLeuValAspLeuAlaValGly AlaGlnGlyHis595600605610GTGCTGCTGCTTAGGAGTCTGCCTTTGCTGAAAGTGGGGATCTCCATT1929ValLeuLeuLeuArgSerLeuProLeuLeu LysValGlyIleSerIle615620625AGATTTGCCCCCTCAGAGGTGGCAAAGACTGTGTACCAGTGCTGGGGA1977ArgPheAlaProSerGluValAlaLys ThrValTyrGlnCysTrpGly630635640AGGACTCCCACTGTCCTCGAAGCTGGAGAGGCCACCGTCTGTCTCACT2025ArgThrProThrValLeuGluAlaGly GluAlaThrValCysLeuThr645650655GTCCGCAAAGGTTCACCTGACCTGTTAGGTGATGTCCAAAGCTCTGTC2073ValArgLysGlySerProAspLeuLeuGly AspValGlnSerSerVal660665670AGGTATGATCTGGCGTTGGATCCGGGCCGTCTGATTTCTCGTGCCATT2121ArgTyrAspLeuAlaLeuAspProGlyArgLeuIle SerArgAlaIle675680685690TTTGATGAGACGAAGAACTGCACTTTGACCCGAAGGAAGACTCTGGGG2169PheAspGluThrLysAsnCysThrLeuThr ArgArgLysThrLeuGly695700705CTTGGTGATCACTGCGAAACAATGAAGCTGCTTTTGCCAGACTGTGTG2217LeuGlyAspHisCysGluThrMetLys LeuLeuLeuProAspCysVal710715720GAGGATGCAGTGACCCCTATCATCCTGCGCCTTAACTTATCCCTGGCA2265GluAspAlaValThrProIleIleLeu ArgLeuAsnLeuSerLeuAla725730735GGGGACTCTGCTCCATCCAGGAACCTTCGTCCTGTGCTGGCTGTGGGC2313GlyAspSerAlaProSerArgAsnLeuArg ProValLeuAlaValGly740745750TCACAAGACCATGTAACAGCTTCTTTCCCGTTTGAGAAGAACTGTGAG2361SerGlnAspHisValThrAlaSerPheProPheGlu LysAsnCysGlu755760765770GGGAACCTGGGCGTCAGCTTCAACTTCTCAGGCCTGCAGGTCTTGGAG2409GlyAsnLeuGlyValSerPheAsnPheSer GlyLeuGlnValLeuGlu775780785GTAGGAAGCTCCCCAGAGCTCACTGTGACAGTAACAGTTTGGAATGAG2457ValGlySerSerProGluLeuThrVal ThrValThrValTrpAsnGlu790795800GGTGAGGACAGCTATGGAACCTTAATCAAGTTCTACTACCCAGCAGAG2505GlyGluAspSerTyrGlyThrLeuIle LysPheTyrTyrProAlaGlu805810815CTATCTTACCGACGGGTGACAAGAGCCCAGCAACCTCATCCGTACCCA2553LeuSerTyrArgArgValThrArgAlaGln GlnProHisProTyrPro820825830CTACGCCTGGCATGTGAGGCTGAGCCCACGGGCCAGGAGAGCCTGAGG2601LeuArgLeuAlaCysGluAlaGluProThrGlyGln GluSerLeuArg835840845850AGCAGCAGCTGTAGCATCAATCACCCCATCTTCCGAGAAGGTGCCAAG2649SerSerSerCysSerIleAsnHisProIle PheArgGluGlyAlaLys855860865GCCACCTTCATGATCACATTTGATGTCTCCTACAAGGCCTTCCTGGGA2697AlaThrPheMetIleThrPheAspVal SerTyrLysAlaPheLeuGly870875880GACAGGTTGCTTCTGAGGGCCAGCGCAAGCAGTGAGAATAATAAGCCT2745AspArgLeuLeuLeuArgAlaSerAla SerSerGluAsnAsnLysPro885890895GAAACCAGCAAGACTGCCTTCCAGCTGGAGCTTCCGGTGAAGTACACG2793GluThrSerLysThrAlaPheGlnLeuGlu LeuProValLysTyrThr900905910GTCTATACCGTGATCAGTAGGCAGGAAGATTCTACCAAGCATTTCAAC2841ValTyrThrValIleSerArgGlnGluAspSerThr LysHisPheAsn915920925930TTCTCATCTTCCCACGGGGAGAGACAGAAAGAGGCCGAACATCGATAT2889PheSerSerSerHisGlyGluArgGlnLys GluAlaGluHisArgTyr935940945CGTGTGAATAACCTGAGTCCATTGACGCTGGCCATCAGCGTTAACTTC2937ArgValAsnAsnLeuSerProLeuThr LeuAlaIleSerValAsnPhe950955960TGGGTCCCCATCCTTCTGAATGGTGTGGCCGTGTGGGATGTGACTCTG2985TrpValProIleLeuLeuAsnGlyVal AlaValTrpAspValThrLeu965970975AGGAGCCCAGCACAGGGTGTCTCCTGTGTGTCACAGAGGGAACCTCCT3033ArgSerProAlaGlnGlyValSerCysVal SerGlnArgGluProPro980985990CAACATTCCGACCTTCTGACCCAGATCCAAGGACGCTCTGTGCTGGAC3081GlnHisSerAspLeuLeuThrGlnIleGlnGlyArg SerValLeuAsp995100010051010TGCGCCATCGCCGACTGCCTGCACCTCCGCTGTGACATCCCCTCCTTG3129CysAlaIleAlaAspCysLeuHisLeuArg CysAspIleProSerLeu101510201025GGCACCCTGGATGAGCTTGACTTCATTCTGAAGGGCAACCTCAGCTTC3177GlyThrLeuAspGluLeuAspPheIl eLeuLysGlyAsnLeuSerPhe103010351040GGCTGGATCAGTCAGACATTGCAGAAAAAGGTGTTGCTCCTGAGTGAG3225GlyTrpIleSerGlnThrLeuGlnL ysLysValLeuLeuLeuSerGlu104510501055GCTGAAATCACATTCAACACATCTGTGTATTCCCAGCTGCCGGGACAG3273AlaGluIleThrPheAsnThrSerVal TyrSerGlnLeuProGlyGln106010651070GAGGCATTTCTGAGAGCCCAGGTGTCAACGATGCTAGAAGAATACGTG3321GluAlaPheLeuArgAlaGlnValSerThrMet LeuGluGluTyrVal1075108010851090GTCTATGAGCCCGTCTTCCTCATGGTGTTCAGCTCAGTGGGAGGTCTG3369ValTyrGluProValPheLeuMetVa lPheSerSerValGlyGlyLeu109511001105CTGTTACTGGCTCTCATCACTGTGGCGCTGTACAAGCTTGGCTTCTTC3417LeuLeuLeuAlaLeuIleThrV alAlaLeuTyrLysLeuGlyPhePhe111011151120AAACGTCAGTATAAAGAGATGCTGGATCTACCATCTGCAGATCCTGAC3465LysArgGlnTyrLysGluMet LeuAspLeuProSerAlaAspProAsp112511301135CCAGCCGGCCAGGCAGATTCCAACCATGAGACTCCTCCACATCTCACG3513ProAlaGlyGlnAlaAspSerAsn HisGluThrProProHisLeuThr114011451150TCCTAG3519Ser1155(2) INFORMATION FOR SEQ ID NO:46:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 1155 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:46:MetValArgGlyValValIleLeuLeuCysGlyTrpAlaLeuAlaSer1510 15CysHisGlySerAsnLeuAspValGluLysProValValPheLysGlu202530AspAlaAlaSerPheGlyGlnThrValValGlnPheGlyGl ySerArg354045LeuValValGlyAlaProLeuGluAlaValAlaValAsnGlnThrGly505560GlnSerSerAsp CysProProAlaThrGlyValCysGlnProIleLeu65707580LeuHisIleProLeuGluAlaValAsnMetSerLeuGlyLeuSerLeu 859095ValAlaAspThrAsnAsnSerGlnLeuLeuAlaCysGlyProThrAla100105110GlnArgAlaCysAlaLysAsnM etTyrAlaLysGlySerCysLeuLeu115120125LeuGlySerSerLeuGlnPheIleGlnAlaIleProAlaThrMetPro130135 140GluCysProGlyGlnGluMetAspIleAlaPheLeuIleAspGlySer145150155160GlySerIleAspGlnSerAspPheThrGlnMetLysAspPheVa lLys165170175AlaLeuMetGlyGlnLeuAlaSerThrSerThrSerPheSerLeuMet180185190Gln TyrSerAsnIleLeuLysThrHisPheThrPheThrGluPheLys195200205SerSerLeuSerProGlnSerLeuValAspAlaIleValGlnLeuGln210 215220GlyLeuThrTyrThrAlaSerGlyIleGlnLysValValLysGluLeu225230235240PheHisSerLysAsnGlyAlaArgL ysSerAlaLysLysIleLeuIle245250255ValIleThrAspGlyGlnLysPheArgAspProLeuGluTyrArgHis260265 270ValIleProGluAlaGluLysAlaGlyIleIleArgTyrAlaIleGly275280285ValGlyAspAlaPheArgGluProThrAlaLeuGlnGluLeuAs nThr290295300IleGlySerAlaProSerGlnAspHisValPheLysValGlyAsnPhe305310315320ValAla LeuArgSerIleGlnArgGlnIleGlnGluLysIlePheAla325330335IleGluGlyThrGluSerArgSerSerSerSerPheGlnHisGluMet3 40345350SerGlnGluGlyPheSerSerAlaLeuSerMetAspGlyProValLeu355360365GlyAlaValGlyGlyPheSerTrpS erGlyGlyAlaPheLeuTyrPro370375380SerAsnMetArgSerThrPheIleAsnMetSerGlnGluAsnGluAsp385390395 400MetArgAspAlaTyrLeuGlyTyrSerThrAlaLeuAlaPheTrpLys405410415GlyValHisSerLeuIleLeuGlyAlaProArgHisGlnHi sThrGly420425430LysValValIlePheThrGlnGluSerArgHisTrpArgProLysSer435440445GluVal ArgGlyThrGlnIleGlySerTyrPheGlyAlaSerLeuCys450455460SerValAspMetAspArgAspGlySerThrAspLeuValLeuIleGly465470 475480ValProHisTyrTyrGluHisThrArgGlyGlyGlnValSerValCys485490495ProMetProGlyValArgSerA rgTrpHisCysGlyThrThrLeuHis500505510GlyGluGlnGlyHisProTrpGlyArgPheGlyAlaAlaLeuThrVal515520 525LeuGlyAspValAsnGlyAspSerLeuAlaAspValAlaIleGlyAla530535540ProGlyGluGluGluAsnArgGlyAlaValTyrIlePheHisGlyAla 545550555560SerArgGlnAspIleAlaProSerProSerGlnArgValThrGlySer565570575Gln LeuPheLeuArgLeuGlnTyrPheGlyGlnSerLeuSerGlyGly580585590GlnAspLeuThrGlnAspGlyLeuValAspLeuAlaValGlyAlaGln595 600605GlyHisValLeuLeuLeuArgSerLeuProLeuLeuLysValGlyIle610615620SerIleArgPheAlaProSerGluValAlaL ysThrValTyrGlnCys625630635640TrpGlyArgThrProThrValLeuGluAlaGlyGluAlaThrValCys645650 655LeuThrValArgLysGlySerProAspLeuLeuGlyAspValGlnSer660665670SerValArgTyrAspLeuAlaLeuAspProGlyArgLeuIl eSerArg675680685AlaIlePheAspGluThrLysAsnCysThrLeuThrArgArgLysThr690695700LeuGlyLeuGly AspHisCysGluThrMetLysLeuLeuLeuProAsp705710715720CysValGluAspAlaValThrProIleIleLeuArgLeuAsnLeuSer7 25730735LeuAlaGlyAspSerAlaProSerArgAsnLeuArgProValLeuAla740745750ValGlySerGlnAspHisValT hrAlaSerPheProPheGluLysAsn755760765CysGluGlyAsnLeuGlyValSerPheAsnPheSerGlyLeuGlnVal770775 780LeuGluValGlySerSerProGluLeuThrValThrValThrValTrp785790795800AsnGluGlyGluAspSerTyrGlyThrLeuIleLysPheTyrTy rPro805810815AlaGluLeuSerTyrArgArgValThrArgAlaGlnGlnProHisPro820825830Tyr ProLeuArgLeuAlaCysGluAlaGluProThrGlyGlnGluSer835840845LeuArgSerSerSerCysSerIleAsnHisProIlePheArgGluGly850 855860AlaLysAlaThrPheMetIleThrPheAspValSerTyrLysAlaPhe865870875880LeuGlyAspArgLeuLeuLeuArgA laSerAlaSerSerGluAsnAsn885890895LysProGluThrSerLysThrAlaPheGlnLeuGluLeuProValLys900905 910TyrThrValTyrThrValIleSerArgGlnGluAspSerThrLysHis915920925PheAsnPheSerSerSerHisGlyGluArgGlnLysGluAlaGl uHis930935940ArgTyrArgValAsnAsnLeuSerProLeuThrLeuAlaIleSerVal945950955960AsnPhe TrpValProIleLeuLeuAsnGlyValAlaValTrpAspVal965970975ThrLeuArgSerProAlaGlnGlyValSerCysValSerGlnArgGlu9 80985990ProProGlnHisSerAspLeuLeuThrGlnIleGlnGlyArgSerVal99510001005LeuAspCysAlaIleAlaAspCys LeuHisLeuArgCysAspIlePro101010151020SerLeuGlyThrLeuAspGluLeuAspPheIleLeuLysGlyAsnLeu102510301035 1040SerPheGlyTrpIleSerGlnThrLeuGlnLysLysValLeuLeuLeu104510501055SerGluAlaGluIleThrPheAsnThrSerValTyrSe rGlnLeuPro106010651070GlyGlnGluAlaPheLeuArgAlaGlnValSerThrMetLeuGluGlu107510801085Ty rValValTyrGluProValPheLeuMetValPheSerSerValGly109010951100GlyLeuLeuLeuLeuAlaLeuIleThrValAlaLeuTyrLysLeuGly1105 111011151120PhePheLysArgGlnTyrLysGluMetLeuAspLeuProSerAlaAsp112511301135ProAspProAlaGly GlnAlaAspSerAsnHisGluThrProProHis114011451150LeuThrSer1155(2) INFORMATION FOR SEQ ID NO:47:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 49 base pairs(B) TYPE: nucleic acid (C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA(xi) SEQUENCE DESCRIPTION: SEQ ID NO:47:AGTTACGGATCCGGCACCATGACCTTCGGCACTGTGATCCTCCTGTGTG49(2) INFORMATION FOR SEQ ID NO:48:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 19 base pairs (B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA(xi) SEQUENCE DESCRIPTION: SEQ ID NO:48:GCTGGACGATGGCATCCAC19(2) INFORMATION FOR SEQ ID NO:49:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 24 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA(xi) SEQUENCE DESCRIPTION: SEQ ID NO:49:GTAGAGTTACGGATCCGGCACCAT24(2) INFORMATION FOR SEQ ID NO:50:(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 20 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA(xi) SEQUENCE DESCRIPTION: SEQ ID NO:50:GCAGCCAGCTTCGGACAGAC20(2) INFORMATION FOR SEQ ID NO:51:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 21 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA(xi) SEQUENCE DESCRIPTION: SEQ ID NO:51:CCATGTCCACAGAACAGAGAG21

Number	Name	Date	Kind
4271139	Hart	Jun 1981
4568649	Bertoglio-Matte	Feb 1986

Human .beta..sub.2 integrin .alpha. subunit

Information

Patent Number

Date Filed

Date Issued

Inventors

Original Assignees

Examiners

Agents

CPC

US Classifications

Field of Search

US

International Classifications

Abstract

Description

Claims

Parent Case Info

US Referenced Citations (2)

Foreign Referenced Citations (1)

Non-Patent Literature Citations (42)

Continuation in Parts (1)