Human .beta..sub.2 integrin .alpha. subunit

Abstract

DNA encoding a novel human .beta..sub.2 integrin .alpha. subunit polypeptide, designated .alpha..sub.d, is disclosed along with methods and materials for production of the same by recombinant procedures. Binding molecules specific for .alpha..sub.d are also disclosed as useful for modulating the biological activities of .alpha..sub.d.

Description

FIELD OF THE INVENTION

The present invention relates to the cloning and expression of nucleotide sequences encoding a novel human .beta..sub.2 integrin .alpha. subunit, designated .alpha..sub.d, which is structurally related to the known human .beta..sub.2 integrin .alpha. subunits, CD11a, CD11b and CD11c.

BACKGROUND OF THE INVENTION

The integrins are a class of membrane-associated molecules which actively participate in cellular adhesion. Integrins are transmembrane heterodimers comprising an .alpha. subunit in noncovalent association with .beta. subunit. To date, at least fourteen .alpha. subunits and eight .beta. subunits have been identified [reviewed in Springer, Nature 346:425-434 (1990)]. The/ 62 subunits are generally capable of association with more than one .alpha. subunit and the heterodimers sharing a common .beta. subunit have been classified as subfamilies within the integrin population.

One class of human integrins, restricted to expression in white blood cells, is characterized by a common .beta..sub.2 subunit. As a result of this cell-specific expression, these integrins are commonly referred to as the leukocyte integrins, Leu-CAMs or leukointegrins. Because of the common .beta..sub.2 subunit, an alternative designation of this class is the .beta..sub.2 integrins. The .beta..sub.2 subunit (CD 18) has previously been isolated in association with one of three distinct .alpha. subunits, CD11a, CD11b or CD11c. The isolation of a cDNA encoding human CD18 is descibed in Kishimoto, et al., Cell 48:681-690 (1987). In official WHO nomenclature, the heterodimeric proteins are referred to as CD11a/CD18, CD11b/CD18, and CD11c/CD18; in common nomenclature they are referred to as LFA-1, Mac-1 or Mol and p150,95 or LeuM5, respectively [Cobbold, et al., in Leukocyte Typing III, McMichael (ed), Oxford Press, p.788 (1987)]. The human .beta. .sub.2 integrin .alpha. subunits CD11a, CD11b and CD11c have been demonstrated to migrate under reducing condition in electrophoresis with apparent molecular weights of approximately 180 kD, 155 kD and 150 kD, respectively, and DNAs encoding these subunits have been cloned [CD11a, Larson, et al., J. Cell Biol. 108:703-712 (1989); CD11b, Corbi, et al., J. Biol. Chem. 263:12403-12411 (1988) and CD11c, Corbi, et al. EMBO J. 6:4023-4028 (1987)]. Putative homologs of the human .beta..sub.2 integrin .alpha. and .beta. chains, defined by approximate similarity in molecular weight, have been variously identified in other species including monkeys and other primates [Letvin, et al., Blood 61:408-410 (1983)], mice [Sanchez-Madrid, et al., J.Exp. Med. 154:1517 (1981)], and dogs [Moore, et al., Tissue Antigens 36:211-220 (1990)].

The absolute molecular weights of presumed homologs from other species have been shown to vary significantly [see, e.g., Danilenko et al., Tissue Antigens 40:13-21 (1992)], and in the absence of sequence information, a definitive correlation between human integrin subunits and those identified in other species has not been possible. Moreover, variation in the number of members in a protein family has been observed between different species. Consider, for example, that more IgA isotypes have been isolated in rabbits than in humans [Burnett, et al., EMBO J. 8:4041-4047 (1989) and Schneiderman, et al., Proc. Natl. Acad. Sci.(USA) 86:7561-7565 (1989)]. Similarly, in humans, at least six variants of the metallothionine protein have been previously identified [Karin and Richards, Nature 299:797-802 (1982) and Varshney, et al., Mol. Cell. Biol. 6:26-37, (1986)], whereas in the mouse, only two such variants are in evidence [Searle, et al., Mol. Cell. Biol. 4:1221-1230 (1984)]. Therefore, existence of multiple members of a protein family in one species does not necessarily imply that corresponding family members exist in another species.

In the specific context of .beta..sub.2 integrins, in dogs it has been observed that the presumed canine .beta..sub.2 counterpart to the human CD 18 is capable of dimer formation with as many as four potentially distinct .alpha. subunits [Danilenko, et al., supra]. Antibodies generated by immunizing mice with canine splenocytes resulted in monoclonal antibodies which immunoprecipitated proteins tentatively designated as canine homologs to human CD18, CD11a, CD11b and CD11c based mainly on similar, but not identical, molecular weights. Another anti-canine splenocyte antibody, Ca11.8H2, recognized and immunoprecipitated a fourth .alpha.-like canine subunit also capable of association with the .beta..sub.2 subunit, but having a unique molecular weight and restricted in expression to a subset of differentiated tissue macrophages.

Antibodies generated by immunization of hamsters with murine dendritic cells resulted in two anti-integrin antibodies [Metlay, et al., J. Exp. Med. 171:1753-1771 (1990)]. One antibody, 2E6, immunoprecipitated a predominant heterodimer with subunits having approximate molecular weights of 180 kD and 90 kD in addition to minor bands in the molecular weight range of 150-160 kD. The second antibody, N418, precipitated another apparent heterodimer with subunits having approximate molecular weights of 150 kD and 90 kD. Based on cellular adhesion blocking studies, it was hypothesized that antibody 2E6 recognized a murine counterpart to human CD18. While the molecular weight of the N418 antigen suggested recognition of a murine homolog to human CD11c/CD 18, further analysis indicated that the murine antigen exhibited a tissue distribution pattern which was inconsistent with that observed for human CD 11c/CD 18.

The antigens recognized by the canine Ca11.8H2 antibody and the murine N418 antibody could represent a variant species (e.g., a glycosylation or splice variant) of a previously identified canine or murine .alpha. subunit. Alternatively, these antigens may represent Unique canine and murine integrin .alpha. subunits. In the absence of specific information regarding primary structure, these alternatives cannot be distinguished.

In humans, CD11aJCD18 is expressed on all leukocytes. CD11b/CD18 and CD11c/CD18 are essentially restricted to expression on monocytes, granulocytes, macrophages and natural killer (NK) cells, but CD11c/CD18 is also detected on some B-cell types. In general, CD11aJCD18 predominates on lymphocytes, CD11b/CD 18 on granulocytes and CD11c/CD 18 on macrophages [see review, Arnaout, Blood 75:1037-1050 (1990)]. Expression of the .alpha. chains, however, is variable with regard to the state of activation and differentiation of the individual cell types [See review, Larson and Springer, Immunol. Rev. 114:181-217 (1990).]

The involvement of the .beta..sub.2 integrins in human immune and inflammatory responses has been demonstrated using monoclonal antibodies which are capable of blocking .beta..sub.2 integrin-associated cell adhesion. For example, CD11a/CD18, CD11b/CD18 and CD11c/CD18 actively participate in natural killer (NK) cell binding to lymphoma and adenocarcinoma cells [Patarroyo, et al., Immunol. Rev. 114: 67-108 (1990) ], granulocyte accumulation [Nourshargh, et al., J. Immunol. 142:3193-3198 (1989)], granulocyte-independent plasma leakage [Arfors, et al., Blood 69:338-340 (1987)], chemotactic response of stimulated leukocytes [Arfors, et al., supra] and leukocyte adhesion to vascular endothelium [Price, et al., J. Immunol. 139:4174-4 177 (1987) and Smith, et al., J. Clin. Invest. 83:2008-2017 (1989)]. The fundamental role of .beta..sub.2 integrins in immune and inflammatory responses is made apparent in the clinical syndrome referred to as leukocyte adhesion deficiency (LAD), wherein clinical manifestations include recurrent and often life threatening bacterial infections. .LAD results from heterogeneous mutations in the .beta..sub.2 subunit [Kishimoto, et al., Cell 50:193-202 (1987)] and the severity of the disease state is proportional to the degree of the deficiency in .beta..sub.2 subunit expression. Formation of the complete integrin heterodimer is impaired by the .beta..sub.2 mutation [Kishimoto, et al., supra].

Interestingly, at least one antibody specific for CD18 has been shown to inhibit human immunodeficiency virus type-1 (HIV-1) syncytia formation in vitro, albeit the exact mechanism of this inhibition is unclear [Hildreth and Orentas, Science 244:1075-1078 (1989)]. This observation is consistent with the discovery that a principal counterreceptor of CD11a/CD18, ICAM-1, is also a surface receptor for the major group of rhinovirus serotypes [Greve, et al., Cell 56:839 (1989)].

The significance of .beta..sub.2 integrin binding activity in human immune and inflammatory responses underscores the necessity to develop a more complete understanding of this class of surface proteins. Identification of yet unknown members of this subfamily, as well as their counterreceptors, and the generation of monoclonal antibodies or other soluble factors which can alter biological activity of the .beta..sub.2 integrins will provide practical means for therapeutic intervention in .beta..sub.2 integrin-related immune and inflammatory responses.

BRIEF DESCRIPTION OF THE INVENTION

In one aspect, the present invention provides novel purified and isolated polynucleotides (e.g., DNA and RNA transcripts, both sense and anti-sense strands) encoding a novel human .beta..sub.2 integrin .alpha..sub.d subunit, .alpha. and variants thereof (i.e., deletion, addition or substitution analogs) which possess binding and/or immunological properties inherent to .alpha..sub.d. Preferred DNA molecules of the invention include cDNA, genomic DNA and wholly or partially chemically synthesized DNA molecules. A presently preferred polynucleotide is the DNA as set forth in SEQ ID NO: 1, encoding the polypeptide of SEQ ID NO: 2. Also provided are recombinant plasmid and viral DNA constructions (expression constructs) which include .alpha..sub.d encoding sequences, wherein the .alpha..sub.d encoding sequence is operatively linked to a homologous or heterologous transcriptional regulatory element or elements.

As another aspect of the invention, prokaryotic or eukaryotic host cells transformed or transfected with DNA sequences of the invention are provided which express .alpha..sub.d polypeptide or variants thereof. Host cells of the invention are particularly useful for large scale production of .alpha..sub.d polypeptide, which can be isolated from either the host cell itself or the medium in which the host cell is grown. Host cells which express .alpha..sub.d polypeptides on the extracellular membrane surface are also useful as immunogens in the production of .alpha..sub.d -specific antibodies. Preferably, host cells transfected with .alpha..sub.d will be co-transfected to express the .beta..sub.2 subunit in order to allow surface expression of the heterodimer.

Also provided by the present invention are purified and isolated .alpha..sub.d polypeptides, fragments and variants thereof. Preferred .alpha..sub.d polypeptides are as set forth in SEQ ID NO: 2. Novel .alpha..sub.d and .alpha..sub.d variant products of the invention may be obtained as isolates from natural sources, but are preferably produced by recombinant procedures involving host cells of the invention. Completely glycosylated, partially glycosylated and wholly de-glycosylated forms of the .alpha..sub.d polypeptide may be generated by varying the host cell selected for recombinant production and/or post-isolation processing. Variant .alpha..sub.d polypeptides of the invention may comprise water soluble and insoluble .alpha..sub.d polypeptides including analogs wherein one or more of the amino acids are deleted or replaced: (1) without loss, and preferably with enhancement, of one or more biological activities or immunological characteristics specific for .alpha..sub.d ; or (2) with specific disablement of a particular ligand/receptor binding or signalling function. Analog polypeptides including additional amino acid (e.g., lysine or cysteine) residues that facilitate multimer formation are contemplated.

Also comprehended by the present invention are polypeptides and other non-peptide molecules which specifically bind to .alpha..sub.d. Preferred binding molecules include antibodies (e.g., monoclonal and polyclonal), counterreceptors (e.g., membrane-associated and soluble forms) and other ligands (e.g., naturally occurring or synthetic molecules), including those which competitively bind .alpha..sub.d in the presence of .alpha..sub.d monoclonal antibodies and/or specific counterreceptors. Binding molecules are useful for purification of .alpha..sub.d polypeptides and identifying cell types which express .alpha..sub.d. Binding molecules are also useful for modulating (i.e., inhibiting, blocking or stimulating) of in vivo binding and/or signal transduction activities of .alpha..sub.d.

Hybridoma cell lines which produce antibodies specific for .alpha..sub.d are also comprehended by the invention. Techniques for producing hybridomas which secrete monoclonal antibodies are well known in the art. Hybridoma cell lines may be generated after immunizing an animal with purified .alpha..sub.d, variants of .alpha..sub.d or cells which express .alpha..sub.d or a variant thereof on the extracellular membrane surface. Immunogen cell types include cells which express .alpha..sub.d in vivo, or transfected prokaryotic or eukaryotic cell lines which normally do not normally express .alpha..sub.d in vivo.

The value of the information contributed through the disclosure of the DNA and amino acid sequences of .alpha..sub.d is manifest. In one series of examples, the disclosed .alpha..sub.d cDNA sequence makes possible the isolation of the human .alpha..sub.d genomic DNA sequence, including transcriptional control elements for the genomic sequence. Identification of .alpha..sub.d allelic variants and heterologous species (e.g., rat or mouse) DNAs is also comprehended. Isolation of the human .alpha..sub.d genomic DNA and heterologous species DNAs can be accomplished by standard DNA/DNA hybridization techniques, under appropriately stringent conditions, using all or part of the .alpha..sub.d cDNA sequence as a probe to screen an appropriate library. Alternatively, polymerase chain reaction (PCR) using oligonucleotide primers that are designed based on the known cDNA sequence can be used to amplify and identify genomic .alpha..sub.d DNA sequences. Synthetic DNAs encoding the .alpha..sub.d polypeptide, including fragments and other variants thereof, may be produced by conventional synthesis methods.

DNA sequence information of the invention also makes possible the development, by homologous recombination or "knockout" strategies [see, e.g., Kapecchi, Science 244:1288-1292 (1989)], to produce rodents that fail to express a functional .alpha..sub.d polypeptide or that express a variant .alpha..sub.d polypeptide. Such rodents are useful as models for studying the activities of .alpha..sub.d and .alpha..sub.d modulators in vivo.

DNA and amino acid sequences of the invention also make possible the analysis of .alpha..sub.d epitopes which actively participate in counterreceptor binding as well as epitopes which may regulate, rather than actively participate in, binding. Identification of epitopes which may participate in transmembrane signal transruction is also comprehended by the invention.

DNA of the invention is also useful for the detection of cell types which express .alpha..sub.d polypeptide. Standard DNA/RNA hybridization techniques which utilize .alpha..sub.d DNA to detect .alpha..sub.d RNA may be used to determine the constitutive level of .alpha..sub.d transcription within a cell, as well as changes in the level of transcription in response to internal or external agents. Identification of agents which modify transcription and/or translation of .alpha..sub.d can, in turn, be assessed for potential therapeutic or prophylactic value. DNA of the invention also makes possible in situ hybridization of .alpha..sub.d DNA to cellular RNA to determine the cellular localization of .alpha..sub.d specific messages within complex cell populations and tissues.

As another aspect of the invention, monoclonal or polyclonal antibodies specific for .alpha..sub.d may be employed in immunohistochemical analysis to localize .alpha..sub.d to subcellular compartments or individual cells within tissues. Immunohistochemical analyses of this type are particularly useful when used in combination with in situ hybridization to localize both .alpha..sub.d mRNA and polypeptide products of the .alpha..sub.d gene.

Identification of cell types which express .alpha..sub.d may have significant ramifications for development of .therapeutic and prophylactic agents. For example, if .alpha..sub.d is the homolog of the canine protein recognized by the antibody Ca11.8H2, the expression of which is restricted to tissue macrophages, recombinant human .alpha..sub.d may allow for design of drugs potentially useful to combat disease states such as atherosclerosis, multiple sclerosis and type I diabetes commonly associated with this cell type.

BRIEF DESCRIPTION OF THE DRAWING

Numerous other aspects and advantages of the present invention will be apparent upon consideration of the following description thereof, reference being made to the drawing wherein:

FIG. 1A through 1D comprises an alignment of the human amino acid sequences of CD11b (SEQ ID NO: 3), CD11c (SEQ ID NO: 4) and .alpha..sub.d (SEQ ID NO: 2).

DETAILED DESCRIPTION OF THE INVENTION

The present invention is illustrated by the following examples relating to the isolation of a cDNA clone encoding .alpha..sub.d from a human spleen cDNA library. More particularly, Example 1 illustrates the use of anti-canine .alpha..sub.TM1 antibody in an attempt to detect a homologous human protein. Example 2 details purification of canine .alpha..sub.TM1 and N-terminal sequencing of the polypeptide to design oligonucleotide primers for PCR amplification of the canine .alpha..sub.TM1 gene. Example 3 addresses large scale purification of canine .alpha..sub.TM1 for internal sequencing in order to design additional PCR primers. Example 4 describes use of the PCR and internal sequence primers to amplify a fragment of the canine .alpha..sub.TM1 gene. Example 5 addresses cloning of the human .alpha..sub.d -encoding cDNA sequence. Example 6 describes Northern blot hybridization analysis of human tissue and cells for expression of .alpha..sub.d mRNA. Example 7 details the construction of human .alpha..sub.d expression plasmids and transfection of COS cells with the resulting plasmids. Example 8 addresses ELISA analysis of .alpha..sub.d expression in transfected COS cells. Example 9 describes FACS analysis of COS cells transfected with human .alpha..sub.d expression plasmids. Example 10 addresses immunoprecipitation of CD 18 in association with .alpha..sub.d in co-transfected COS cells. Example 11 relates to production of .alpha..sub.d -specific monoclonal antibodies.

EXAMPLE 1

Attempt to Detect a Human Homolog of Canine .alpha..sub.TM1

The monoclonal antibody Ca11.8H2 [Moore, et al., supra] specific for canine .alpha..sub.TM1 was tested for cross-reactivity on human peripheral blood leukocytes in an attempt to identify a human homolog of canine .alpha..sub.TM1. Cell preparations (typically 1.times.10.sup.6 cells) were incubated with undiluted hybridoma supernatant or a purified mouse IgG-negative control antibody (10 .mu.g/ml) on ice in the presence of 0.1% sodium azide. Monoclonal antibody binding was detected by subsequent incubation with FITC-conjugated horse anti-mouse IgG (Vector Laboratories, Burlingame, Calif.) at 6 .mu.g/ml. Stained cells were fixed with 2 % w/v paraformaldehyde in phosphate buffered saline (PBS) and were analyzed with a Facstar Plus fluorescence-activated cell sorter (Becton Dickinson, Mountain View, Calif.). Typically, 10,000 cells were analyzed using logarithmic amplification for fluorescence intensity.

The results indicated that Ca11.8H2 did not cross-react with surface proteins expressed on human peripheral blood leukocytes, while the control cells, neoplastic canine peripheral blood lymphocytes, were essentially all positive for .alpha..sub.TM1.

Because the toonotional antibody Ca11.8H2 specific for the canine .alpha. subunit did not cross react with a human homolog, isolation of canine .alpha..sub.TM1 DNA was deemed a necessary prerequisite to isolate a counterpart human gene if one existed.

EXAMPLE 2

Affinity Purification Of Canine .alpha..sub.TM1 For N-Terminal Sequencing

Canine .alpha..sub.TM1 was affinity purified in order to determine N-terminal amino acid sequences for oligonucleotide probe/primer design. Briefly, anti-.alpha..sub.TM1 monoclonal antibody Ca11.8H2 was coupled to Affigel 10 chromatographic resin (BioRad, Hercules, Calif.) and protein was isolated by specific antibody-protein interaction. Antibody was conjugated to the resin, according to the BioRad suggested protocol, at a concentration of approximately 5 mg antibody per ml of resin. Following the conjugation reaction, excess antibody was removed and the resin blocked with three volumes of 0.1M ethanolamine. The resin was then washed with thirty column volumes of phosphate buffered saline (PBS).

Twenty-five grams of a single dog spleen were homogenized in 250 ml of buffer containing 0.32M sucrose in 25 mM Tris-HCl, pH 8.0, with protease inhibitors. Nuclei and cellular debris were pelleted with centrifugation at 1000 g for 15 minutes. Membranes were pelleted from the supernatant with centrifugation at 100,000 g for 30 minutes. The membrane pellet was resuspended in 200 ml lysis buffer (50 mM NaCl, 50 mM borate, pH 8.0, with 2 % NP-40) and incubated for 1 hour on ice. Insoluble material was then pelleted by centrifugation at 100,000 g for 60 minutes. Ten milliliters of the cleared lysate were transferred to a 15 ml polypropylene tube with 0.5 ml Ca11.8H2-conjugated Affigel 10 resin described above. The tube was incubated overnight at 4.degree. C. with rotation and the resin subsequently washed with 50 column volumes D-PBS. The resin was then transferred to a microfuge tube and boiled for ten minutes in 1 ml Laemmli (non-reducing) sample buffer containing 0.1M Tris-HCl, pH 6.8, 2% SDS, 20% glycerol and 0.002% bromophenol blue. The resin was pelleted by centrifugation and discarded; the supernatant was treated with 1/15 volume .beta.-mercaptoethanol (Sigma, St. Louis, Mo.) and run on a 7% polyacrylamide gel. The separated proteins were transferred to Immobilon PVDF membrane (Millipore, Bedford, Mass.) as follows.

The gels were washed once in deionized, Millipore-filtered water and equilibrated for 15-45 minutes in 10 mM 3-[cyclohexylamino]-1-propanesulfonic acid (CAPS) transfer buffer, pH 10.5, with 10% methanol. hnmobilon membranes were moistened with methanol, rinsed with filtered water, and equilibrated for 15-30 minutes in CAPS transfer buffer. The initial transfer was carried out using a Biorad transfer apparatus at 70 volts for 3 hours. The Immobilon membrane was removed after transfer and stained in filtered 0.1% R250 Coomassie stain for 10 minutes. Membranes were destained in 50% methanol/10% acetic acid three times, ten minutes each time. After desmining, the membranes were washed in filtered water and air-dried.

Protein bands of approximately 150 kD, 95 kD, 50 kD and 30 kD were detected. Presumably the 50 kD and 30 kD bands resulted from antibody contamination. N-terminal sequencing was then attempted on both the 150 kD and 95 kD bands, but the 95 kD protein was blocked, preventing sequencing. The protein band of 150 kD was excised from the membrane and directly sequenced with an Applied Biosystems (Foster City, Calif.) Model 473A protein sequencer according to the manufacturer's instructions. The resulting amino acid sequence is set in SEQ ID NO: 5 using single letter amino acid designations.

FNLDVEEPMVFQ (SEQ ID NO: 5) The identified sequence included the FNLD sequence characteristic of .alpha. subunits of the integrin family [Tamura, et al., J. Cell. Biol. 111:1593-1604 (1990)].

Primer Design and Attempt to Amplify Canine .alpha..sub.TM1 Sequences

From the N-terminal sequence information, three oligonucleotide probes were designed for hybridization: a) "Tommer," a fully degenerate oligonucleotide; b) "Patruer," a partially degenerate oligonucleotide; and c) "Guessruer," a nondegenerate oligonucleotide based on mammalian codon usage. These probes are set out below as SEQ ID NOS: 6, 7 and 8, respectively. Nucleic acid symbols are in accordance with 37 C.F.R. .sctn.1.882 for these and all other nucleotide sequences herein.

5 '-TTYAAYYTGGAYGTNGARGARCCNATGGTNTTYCA-3' (SEQ ID NO: 6) 5 '-TTCAACCTGGACGTGGAGGAGCCCATGGTGTTCCAA-3' (SEQ ID NO: 7) 5 '-TTCAACCTGGACGTNGAASANCCCATGGTCTTCCAA-3' (SEQ ID NO: 8)

Based on sequencing data, no relevant clones were detected using these oligonucleotides in several low stringency hybridizations to a canine spleen/peripheral blood macrophage cDNA library cloned into .lambda.ZAP (Stratagene, La Jolla, Calif.).

Four other oligonucleotide primers, designated 5'Deg, 5'Spec, 3'Deg and 3'Spec (asset out in SEQ ID NOS: 9, 10, 11 and 12, respectively, wherein Deg indicates degenerate and Spec indicates non-degenerate) were subsequently designed based on the deduced N-terminal sequence for attempts to amplify canine .alpha..sub.TM1 sequences by PCR from phage library DNA purified from plate lysates of the Stratagene library described above.

5 '-TTYAAYYTNGAYGTNGARGARCC-3' (SEQ ID NO: 9) 5'-TTYAAYYTGGACGTNGAAGA-3' (SEQ ID NO: 10) 5 '-TGRAANACCATNGGYTC-3' (SEQ ID NO: 11) 5 '-TTGGAAGACCATNGGYTC-3' (SEQ ID NO: 12)

The .alpha..sub.TM1 oligonucleotide primers were paired with T3 or T7 vector sequence primers, as set out in SEQ ID NOS: 13 and 14, respectively, which hybridize to sequences flanking the polylinker region in the Bluescript phagemid found in .lambda.ZAP.

5 '-ATTAACCCTCACTAAAG-3' (SEQ ID NO: 13) 5 '-AATACGACTCACTATAG-3' (SEQ ID NO: 14) The PCR amplification was carried out in Taq buffer (Boehringer Mannheim, Indianapolis, Ind.) containing magnesium with 150 ng of library DNA, 1 .mu.g of each primer, 200 .mu.M dNTPs and 2.5 units Taq polymerase (Boehringer Mannheim) and the products were separated by electrophoresis on a 1% agarose gel in Tris-Acetate-EDTA (TAE) buffer with 0.25 .mu.g/ml ethidium bromide. DNA was transferred to a Hybond (Amersham, Arlington, Heights, Ill.) membrane by wicking overnight in 10X SSPE. After transfer, the immobilized DNA was denatured with 0.5M NaOH with 0.6M NaCl, neutralized with 1.0M Tris-HCl, pH 8.0, in 1.5M NaCl, and washed with 2X SSPE before UV cross-linking with a Stratalinker (Stratagene) crosslinking apparatus. The membrane was incubated in prehybridization buffer (5X SSPE, 4X Denhardts, 0.8% SDS, 30% formamide) for 2 hr at 50.degree. C. with agitation.

Oligonucleotide probes 5 'Deg, 5 'Spec, 3 'Deg and 3'Spec (SEQ ID NOS: 9, 10, 11 and 12, respectively) were labeled using a Boehringer Mannheim kinase buffer with 100-300 .mu.Ci .gamma.P.sup.32 -dATP and 1-3 units of polynucleotide kinase for 1-3 hr at 37.degree. C. Unincorporated label was removed with Sephadex G-25 fine (Pharmacia, Piscataway, N.J.) chromatography using 10 mM Tris-HCl, pH 8.0, 1 mM EDTA (TE) buffer and the flow-through added directly to the prehybridization solution. Membranes were probed for 16 hr at 42.degree. C. with agitation and washed repeatedly, with a final stringency wash of 1X SSPE/0.1% SDS at 50.degree. for 15 min. The blot was then exposed to Kodak X-Omat AR film for 1-4 hours at -80.degree. C.

The oligonucleotides 5'Deg, 5'Spec, 3'Deg and 3'Spec only hybridized to PCR products from the reactions in which they were used as primers and failed to hybridize as expected to PCR products from the reactions in which they were not used as primers. Thus, it was concluded that none of the PCR products were specific for .alpha..sub.TM1 because no product hybridized with all of the appropriate probes.

EXAMPLE 3

Large Scale Affinity Purification Of Canine .alpha..sub.TM1 For Internal Sequencing

In order to provide additional amino acid sequence for primer design, canine .alpha..sub.TM1 was purified for internal sequencing. Three sections of frozen spleen (approximately 50 g each) and frozen cells from two partial spleens from adult dogs were used to generate protein for internal sequencing. Fifty grams of spleen were homogenized in 200-300 ml borate buffer with a Waring blender. The homogenized material was diluted with 1 volume of buffer containing 4 % NP-40, and the mixture then gently agitated for at least one hour. The resulting lysate was cleared of large debris by centrifugation at 2000 g for 20 rain, and then filtered through either a Corning (Coming, N.Y.) prefilter or a Corning 0.8 micron filter. The lysate was further clarified by filtration through the Corning 0.4 micron filter system.

Splenic lysate and the antibody-conjugated Affigel 10 resin described in Example 2 were combined at a 150:1 volume ratio in 100 ml aliquots and incubated overnight at 4.degree. C. with rocking. The lysate was removed after centrifugation at 1000 g for 5 minutes, combined with more antibody-conjugated Affigel 10 resin and incubated overnight as above. The absorbed resin aliquots were then combined and washed with 50 volumes D-PBS/0.19 Tween 20 and the resin transferred to a 50 ml Biorad column. Adsorbed protein was eluted from the resin with 3-5 volumes of 0.1M glycine (pH 2.5); fractions of approximately 900 .mu.l were collected and neutralized with 100 .mu.l 1M Tris buffer, pH 8.0. Aliquots of 15 .mu.l were removed from each fraction and boiled in an equal volume of 2X Laemmli sample buffer with 1/15 volume 1M dithiothreitol (DTT). These samples were electrophoresed on 8 9 Novex (San Diego, Calif.) polyacrylamide gels and visualized either by Coomassie stain or by silver stain using a Daiichi kit (Enprotech, Natick, Mass.) according to the manufacturer's suggested protocol. Fractions which contained the largest amounts of protein were combined and concentrated by vacuum. The remaining solution was diluted by 509 with reducing Laemmli sample buffer and run on 1.5 mm 79 polyacrylamide gels in Tris-glycine/SDS buffer. Protein was transferred from the gels to Immobilon membrane by the procedure described in Example 2 using the Hoefer transfer apparatus.

The protein bands corresponding to canine .alpha..sub.d1 were excised from 10 PVDF membranes and resulted in approximately 47 .mu.g total protein. The bands were destained in 4 ml 50% methanol for 5 minutes, air dried and cut into 1.times.2 mm pieces. The membrane pieces were submerged in 2 ml 95 9 acetone at 4.degree. C. for 30 minutes with occasional vortexing and then air dried.

Prior to proteolytic cleavage of the membrane bound protein, 3 mg of cyanogen bromide (CNBr) (Pierce, Rockford, Ill.) were dissolved in 1.25 ml 709 formic acid. This solution was then added to a tube containing the PVDF membrane pieces and the tube incubated in the dark at room temperature for 24 hours. The supernatant (S1) was then removed to another tube and the membrane pieces washed with 0.25 ml 70% formic acid. This supernatant (S2) was removed and added to the previous supernatant (S1). Two milliliters of Milli Q water were added to the combined supernatants (S1 and S2) and the solution lyophilized. The PVDF membrane pieces were dried under nitrogen and extracted again with 1.25 ml 60% acetonitrile, 0.1% tetrafluoroacetic acid (TFA) at 42.degree. C. for 17 hours. This supernatant (S3) was removed and the membrane pieces extracted again with 1.0 ml 80% acetonitrile with 0.08% TFA at 42.degree. C. for 1 hour. This supernatant (S4) was combined with the previous supernatants (S1, S2 and S3) and vacuum dried.

The dried CNBr fragments were then dissolved in 63 .mu.l 8M urea, 0.4M NH.sub.4 HCO.sub.3. The fragments were reduced in 5 .mu.l 45 mM dithiothreitol (DTT) and subsequently incubated at 50.degree. C. for 15 minutes. The solution was then cooled to room temperature and the fragments alkylated by adding 5 .mu.l 100 mM iodoacetamide (Sigma, St. Louis, Mo.). Following a 15 minute incubation at room temperature, the sample was diluted with 187 .mu.l Milli Q water to a final urea concentration of 2.0M. Trypsin (Worthington, Freehold, N.J.) was then added at a ratio of 1:25 (w:w) of enzyme to protein and the protein digested for 24 hours at 37.degree. C. Digestion was terminated with addition of 30 .mu.l TFA.

The protein fragments were then separated with high performance liquid chromatography (HPLC) on a Waters 625 LC system (Millipore, Milford, Mass.) using a 2.1.times.250 mm, 5 micron Vydac C-18 column (Vydac, Hesperia, Calif.) equilibrated in 0.05 % TFA and HPLC water (buffer A). The peptides were eluted with increasing concentration of 80% acetonitrile in 0.04 % TFA (buffer B) with a gradient of 38-75 % buffer B for 65-95 minutes and 75-98 % buffer B for 95-105 minutes. Peptides were fractionated at a flow rate of 0.2 ml/minute and detected at 210 nm.

Following fractionation, the amino acid sequence of the peptides was analyzed by automated Edman degradation performed on an Applied Biosystems Model 437A protein sequencer using the manufacturer's standard cycles and the Model 610A Data Analysis software program, Version 1.2.1. All sequencing reagents were supplied by Applied Biosystems. The amino acid sequences of seven of the eight internal fragments are set out below wherein "X" indicates the identity of the amino acid was not certain.

VFQEXGAGFGQ (SEQ ID NO: 15) LYDXVAATGLXQPI (SEQ ID NO: 16) PLEYXDVIPQAE (SEQ ID NO: 17) FQEGFSXVLX (SEQ ID NO: 18) TSPTFIXMSQENVD (SEQ ID NO: 19) LVVGAPLEVVAVXQTGR (SEQ ID NO: 20) LDXKPXDTA (SEQ ID NO: 21 )

Primer Design

One internal amino acid sequence (set out in SEQ ID NO: 22) obtained was then used to design a fully degenerate oligonucleotide primer, designated p4(R) as set out in SEQ ID NO: 23.

FGEQFSE (SEQ ID NO: 22) 5 '-RAANCCYTCYTGRAAACTYTC-3' (SEQ ID NO: 23)

EXAMPLE 4

PCR Cloning Of A Canine .alpha..sub.TM1 Fragment

The 5' portion of the canine .alpha..sub.TM1 gene was amplified from double-stranded canine splenic cDNA by PCR.

A. Generation of Double Stranded Canine Spleen cDNA

One gram of frozen material from a juvenile dog spleen was ground in liquid nitrogen on dry ice and homogenized in 20 ml RNA-Stat 60 buffer (Tel-Test B, Inc, Friendswood, Tex.). Four ml chloroform were added, and the solution extracted by centrifugation at 12,000 g for 15 minutes. RNA was precipitated from the aqueous layer with 10 ml ethanol. Poly A.sup.+ RNA was then selected on Dynal Oligo dT Dynabeads (Dynal, Oslo, Norway). Five aliquots of 100 .mu.g total RNA were combined and diluted with an equal volume of 2X binding buffer (20 mM Tris-HCl, pH 7.5, 1.0M LiCl, 1 mM EDTA, 0.1% SDS). RNA was then incubated 5 minutes with the Oligo dT Dynabeads (1.0 ml or 5 mg beads for all the samples). Beads were washed with buffer containing 10 mM Tris-HCl, pH 7.5, 0.15M LiCl, 1 mM EDTA and 0.1% SDS, according to the manufacturer's suggested protocol prior to elution of poly A.sup.+ mRNA with 2 mM EDTA, pH 7.5. Double-stranded eDNA was then generated using the eluted poly A.sup.+ mRNA and the Boehfinger Mannhelm eDNA Synthesis Kit according to the manufacturer's suggested protocol.

B. Isolation of a Partial Canine .alpha..sub.TM1 CDNA

Oligonucleotide primers 5 'Deg (SEQ ID NO: 9) and p4(R) (SEQ ID NO: 23) were employed in a standard PCR reaction using 150 ng double-stranded cDNA, 500 ng of each primer, 200 .mu.M dNTPs and 1.5 units Taq polymerase (Boehringer Mannheim) in Taq buffer (Boehringer Mannheim) with magnesium. The resulting products (1 .mu.l of the original reaction) were subjected to a second round of PCR with the same primers to increase product yield. This band was eluted from a 1% agarose gel onto Schleicher & Schuell (Keene, N.H.) NA45 paper in a buffer containing 10 mM Tris-HCl, pH 8, 1 mM EDTA, 1.5M NaCl at 65.degree. C., precipitated, and ligated into the pCR.sup.tm II vector (Invitrogen, San Diego, Calif.) using the TA cloning kit (Invitrogen) and the manufacturer's suggested protocol. The ligation mixture was transformed by electroporation into XL-1 Blue bacteria (Stratagene). One clone, 2.7, was determined to contain sequences corresponding to .alpha..sub.TM1 peptide sequences which were not utilized in design of the primers. The sequence of the entire insert of clone 2.7 is set out in SEQ ID NO: 24.

Attempts to isolate the full length canine .alpha..sub.TM1 CDNA from the Stratagene library (as described in Example 2) were unsuccessful. Approximately 1.times.10.sup.6 phage plaques were screened by hybridization under low stringency conditions using 30% formamide with clone 2.7 as a probe, but no positive clones resulted. Attempts to amplify relevant sequences downstream from those represented in clone 2.7 using specific oligonucleotides derived from clone 2.7 or degenerate primers based on amino acid sequence from other peptide fragments paired with a degenerate oligonucleotide based on the conserved .alpha. subunit amino acid motif GFFKR [Tamura, et al., supra] were also unsuccessful.

EXAMPLE 5

Cloning Of A Putative Human Homolog Of Canine .alpha..sub.TM1

To attempt the isolation of a human sequence homologous to canine .alpha..sub.TM1 the approximately 1 kb canine .alpha..sub.TM1 fragment from clone 2.7 was used as a probe. The probe was generated by PCR under conditions described in Example 2 using NT2 (as set out in SEQ ID NO: 25) and p4(R) (SEQ ID NO: 23) primers.

5'-GTNTTYCARGARGAYGG-3' (SEQ ID NO: 25) The PCR product was purified using the Qiagen (Chatsworth, Ga.) Quick Spin kit and the manufacturer's suggested protocol. The purified DNA (200 ng) was labeled with 200 .mu.Ci .alpha..sup.32 PdCTP using the Boehringer Mannheim Random Prime Labelling kit and the manufacturer's suggested protocol. Unincorporated isotope was removed with Sephadex G25 (fine) gravity chromatography. The probe was denatured with 0.2N NaOH and neutralized with 0.4M Tris-HCl, pH 8.0, before use.

Colony lifts on Hybond filters (Amersham) of a human spleen cDNA library in pCDNA/Amp (Invitrogen) were prepared. The filters were initially denatured and neutralized as described in Example 2 and subsequently incubated in a prehybridization solution (8 ml/filter) with 30% formamide at 50.degree. C. with gentle agitation for 2 hours. Labeled probe as described above was added to this solution and incubated with the filters for 14 hours at 42.degree. C. The filters were washed twice in 2X SSC/0.1% SDS at 37.degree. C. and twice in 2X SSC/0.1% SDS at 50.degree. C. Final stringency washes were 1X SSC/0.1% SDS, twice at 65.degree. C. (1X SSC is 150 mM NaCl, 15 mM sodium citrate, pH 7.0). Filters were exposed to Kodak X-Omat AR film for six hours with an intensifying screen. Colonies giving signals on duplicate lifts were streaked on LB medium with magnesium (LBM)/carbenicillin plates and incubated overnight at 37.degree. C. Resulting streaked colonies were lifted with Hybond filters and these filters were treated as above. The filters were hybridized under more stringent conditions with the 1 kb probe from clone 2.7, labeled as previously described, in a 50% formamide hybridization solution at 50.degree. C. for 3 hours. Probed filters were washed with a final stringency of 0.1 X SSC/0.1% SDS at 65'C and exposed to Kodak X-Omat AR film for 2.5 hours at -80.degree. C. with an intensifying screen. Positive colonies were identified and cultured in LBM/carbenicillin medium overnight. DNA from the cultures was prepared using the Promega Wizard miniprep kit according to the manufacturer's suggested protocol and the resulting DNA was sequenced.

The initial screening resulted in 18 positive clones, while the secondary screening under more stringent hybridization conditions produced one positive clone which was designated 19A2. The DNA and deduced amino acid sequences of the human .alpha..sub.d clone 19A2 are set out in SEQ ID NOS: 1 and 2, respectively.

Characteristics Of The Human .alpha..sub.d CDNA and Predicted Polypeptide

Clone 19A2 encompasses the entire coding region for the mature protein, plus 48 bases (16 amino acid residues) of the 5' upstream signal sequence and 241 bases of 3' untranslated sequence which do not terminate in a polyadenylation sequence. The core molecular weight of the mature protein is predicted to be around 125 kD. The extracellular domain is predicted to encompass approximately amino acid residues 17 through 1108 of SEQ ID NO: 2. This extracellular region is contiguous with about a 20 amino acid region homologous to the human CD11 c transmembrane region (residues 1109 through 1128 of SEQ ID NO: 2). The cytoplasmic domain comprises approximately 30 amino acids (about residues 1129 through 1161 of SEQ ID NO: 2). The protein also contains a region (around residues 150 through 352) of approximately 202 amino acids homologous to the I (insertion) domain common to CD11a, CD11b and CD11c [Larson and Springer, supra] and in VLA-2 [Tamura, et al., supra]. This region has not been demonstrated to exist in any other integrin subunits.

The deduced amino acid sequence of .alpha..sub.d shows approximately 28 % identity to that of CD11a, approximately 58% identity to CD11b and approximately 61% identity to CD11c. An alignment of amino acid sequences for (CD11b SEQ ID NO: 3), CD11c (SEQ ID NO: 4) and .alpha..sub.d (SEQ ID NO: 2) is presented in FIG. 1.

EXAMPLE 6

Northern Analysis of Human .alpha..sub.d Expression in Tissues

In order to determine the relative level of expression and tissue specificity of .alpha..sub.d, Northern analysis was performed using a fragment from clone 19A2 as a probe. Approximately 10 .mu.g of total RNA from each of several human tissues were loaded on a formaldehyde agarose gel in the presence of 1 .mu.g of ethidium bromide. After electrophoresis at 100 V for 4 hr, the RNA was transferred to a nitrocellulose membrane (Schleicher & Schuell) by wicking in 10X SSC overnight. The membrane was baked 1.5 hr at 80.degree. C. under vacuum. Prehybridization solution containing 50% formamide in 3-(N-morpholino)propane sulfonic acid (MOPS) buffer was used to block the membrane for 3 hr at 42.degree. C. A 1.6 kb BstXI fragment of clone 19A2 was labeled with the Boehringer Mannheim Random Prime kit according to the manufacturer's instructions including both .alpha.P.sup.32 dCTP and .alpha.P.sup.32 dTTP. Unincorporated label was removed on a Sephadex G25 column in TE buffer. The membrane was probed with 1.5.times.10.sup.6 counts per ml of prehybridization buffer. The blot was then washed successively with 2X SSC/0.1% SDS at room temperature, 2X SSC/0.1% SDS at 42.degree. C., 2X SSC/0.1% SDS at 500C, 1X SSC/0.1% SDS at 50.degree. C., 0.5X SSC/0.1% SDS at 50.degree. C. and 0.1X SSC/0.1% SDS at 50.degree. C. The blot was then exposed to film for 19 hr.

The autoradiogram revealed a weak signal in the approximately 5 kb range in liver, placenta, thymus and tonsil total RNA. No signal was detected in kidney, brain or heart samples. The amount of RNA present in the kidney lane, however, was minimal. RNA from three myeloid lineage cell lines was also probed. The THP-1 cell line, previously stimulated with PMA, gave a diffuse signal in the same size range (approximately 5.0 kb), with a slightly stronger intensity than the tissue signals. RNA from unstimulated and DMSO-stimulated HL-60 cells hybridized with the .alpha..sub.d probe at the same intensity as the tissue samples, however, PMA treatment seemed to increase the signal intensity. U937 cells expressed the .alpha..sub.d message and this signal did not increase with PMA stimulation.

EXAMPLE 7

Expression Of Human .alpha..sub.d Constructs

A. Generation of expression constructs

The human clone 19A2 lacks an initiating methionine codon and possibly some of the 5' signal sequence. Therefore, in order to generate a human expression plasmid containing 19A2 sequences, two different strategies were used. In the first, two plasmids were constructed in which signal peptide sequences derived from genes encoding either CD11b or CD11c were spliced into clone 19A2 to generate a chimeric .alpha..sub.d sequence. In the second approach, a third plasmid was constructed in which an adenosine base was added on at position 0 in clone 19A2 to encode an initiating methionine.

The three plasmids contained different regions which encoded the 5' portion of the .alpha..sub.d sequence or the chimeric .alpha..sub.d sequence. The .alpha..sub.d region was PCR amplified (see conditions in Example 2) with a specific 3' primer BamRev (set out below in SEQ ID NO: 26) and one of three 5' primers. The three 5' primers contained in sequence: (1) identical nonspecific bases at positions 1-6 allowing for digestion, an EcoRI site from positions 7-12 and a consensus Kozak sequence from positions 13-18; (2) a portion of the CD11b (primer ER1B) or CD11c (primer ER1C) signal sequence, or an adenosine (primer ER1D); and (3) an additional 15-17 bases specifically overlapping 5' sequences from clone 19A2 to allow primer annealing. Primers ER1B, ERIC or ER1D are set out in SEQ ID NOS: 27, 28 or 29, respectively, where the initiating methionine codon is underlined and the EcoRI site is double underlined.

Primer BamRev 5 '-CCACTGTCAGGATGCCCGTG-3' (SEQ ID NO: 26) Primer ER1B 5 '-AGTTACGAATTCGCCACCATGGCTCTACGGGTGCTTCTTCTG-3' (SEQ ID NO: 27) Primer ER1C 5 '-AGTTACGAATTCGCCACCATGACTCGGACTGTGCTTCTTCTG-3' (SEQ ID NO: 28) Primer ER1D 5 '-AGTTACGAATTCGCCACCATGACCTTCGGCACTGTG-3' (SEQ ID NO: 29) The resulting PCR product was digested with EcoRI and BamHI.

All three plasmids contained a common second .alpha..sub.d region (to be inserted immediately downstream from the 5' region described in the previous paragraph) including the 3' end of the .alpha..sub.d clone. The second .alpha..sub.d region, which extended from nucleotide 625 into the XbaI site in the vector 3' polylinker region of clone 19A2, was isolated by digestion of clone 19A2 with BamHI and XbaI.

Three ligation reactions were prepared in which the 3' .alpha..sub.d BamHI/XbaI fragment was ligated to one of the three 5' .alpha..sub.d EcoRI/BamHI fragments using Boehringer Mannheim ligase buffer and T4 ligase (1 unit per reaction). After a 4 hour incubation at 14.degree. C., an appropriate amount of vector pcDNA (Invitrogen) digested with EcoRI and XbaI was added to each reaction with an additional unit of ligase. Reactions were allowed to continue for another 14 hours. One tenth of the reaction mixture was then transformed into competent XL-1 Blue cells. The resulting colonies were cultured and the DNA isolated as in Example 5. Digestion with EcoRI identified three clones which were positive for that restriction site, and thus, the engineered signal sequences. The clones were designated pATM.B1 (CD11b/.alpha..sub.d, from primer ER1B), pATM.C10 (CD11c/.alpha..sub.d, from primer ER1C) and pATM.D12 (adenosine/.alpha..sub.d from primer ER1 d). Presence of the appropriate signal sequences in each clone were verified by nucleic acid sequencing.

B. Transfection of COS Cells

Expression from the .alpha..sub.d plasmids discussed above was effected by cotransfection of COS cells with the individual plasmids and a CD 18 expression plasmid, pRC.CD18. As a positive control, COS cells were also co-transfected with the plasmid pRC.CD18 and a CD11a expression plasmid, pDC.CD11A.

Cells were passaged in culture medium (DMEM/10%FBS/pen-strep) into 10 cm Coming tissue culture-treated petri dishes at 50 % confluency 16 hours prior to transfection. Cells were removed from the plates with Versene buffer (0.5 mM NaEDTA in PBS) without trypsin for all procedures. Before transfection, the plates were washed once with serum-free DMEM. Fifteen micrograms of each plasmid were added to 5 ml transfection buffer (DMEM with 20 .mu.g/ml DEAE-Dextran and 0.5 mM chloroquine) on each plate. After 1.5 hours incubation at 37.degree. C., the cells were shocked for 1 minute with 5 ml DMEM/10% DMSO. This DMSO solution was then replaced with 10 ml/plate culture medium.

Resulting transfectants were analyzed by ELISA and FACS as described below.

EXAMPLE 8

ELISA Analysis of COS Transfectants

In order to determine if the COS cells co-transfected with CD 18 expression plasmid pRC. CD 18 and an .alpha..sub.d plasmid expressed .alpha..sub.d on the cell surface in association with CD18, ELISAs were performed using primary antibodies raised against CD18 (e.g., TS1/18 purified from ATCC HB203). As a positive control, ELISAs were also performed on cells co-transfected with the CD18 expression plasmid and a CD11a expression plasmid, pDC.CD11A. The primary antibodies in this control included CD18 antibodies and anti-CD11a antibodies (e.g., TS1/22 purified from ATCC HB202).

For ELISA, cells from each plate were removed with Versene buffer and transferred to a single 96-well flat-bottomed Coming tissue culture plate. Cells were allowed to incubate in culture media 2 days prior to assay. The plates were then washed twice with 150 .mu.l/well D-PBS/0.5 % teleost skin gelatin (Sigma) solution. This buffer was used in all steps except during the development. All washes and incubations were performed at room temperature. The wells were blocked with gelatin solution for 1 hour. Primary antibodies were diluted to 10 .mu.g/ml in gelatin solution and 50 .mu.l were then added to each well. Triplicate wells were set up for each primary antibody. After 1 hour incubation, plates were washed 3X with 150 .mu.l/well gelatin solution. Secondary antibody (goat anti-mouse Ig/HRP-Fc specific [Jackson, West Grove, Pa.]) at a 1:3500 dilution was added at 50 .mu.l/well and plates were incubated for 1 hour. After three washes, plates were developed with 100 .mu.l/well O-phenyldiamine (OPD) (Sigma) solution (1 mg/ml OPD in citrate buffer) and the plates were allowed to develop for 20 minutes before addition of 50 .mu.l/well 15 % sulfuric acid.

Analysis of transfectants in the ELISA format with anti-CD18 specific antibodies revealed no significant expression above background in cells transfected only with the plasmid encoding CD18. Cells co-transfected with plasmid containing CD11a and CD18 showed an increase in expression over background when analyzed with CD18 specific antibodies or with reagents specific for CD11a. Further analysis of cells co-transfected with plasmids encoding CD18 and one of the .alpha..sub.d expression constructs (pATM.C10 or pATM.D12) revealed that cell surface expression of CD18 was rescued by concomitant expression of .alpha..sub.d. The increase in detectable CD18 expression in COS cells transfected with pATM.C10 or pATM.D12 was comparable to that observed in co-transfected CD 11a/CD 18 positive control cells.

EXAMPLE 9

FACS Analysis of COS Transfectants

For FACS analysis, cells in petri dishes were fed with fresh culture medium the day after transfection and allowed to incubate 2 days prior to the assay. Transfectant cells were removed from the plates with 3 ml Versene, washed once with 5 ml FACS buffer (DMEM/2% FBS/0.2% sodium azide) and diluted to 500,000 cells/sample in 0.1 ml FACS buffer. Ten microliters of either 1 mg/ml FITC-conjugated CD18, CD11a, CD11b specific antibodies (Becton Dickinson) or 800 .mu.g/ml CFSE-conjugated murine 23F2G (anti-CD18) (ATCC HB11081 ) were added to each sample. Samples were then incubated on ice for 45 minutes, washed 3.times. with 5 ml/wash FACS buffer and resuspended in 0.2 ml FACS buffer. Samples were processed on a Becton Dickinson FACscan and the data analyzed using Lysys II software (Becton Dickinson).

COS cells transfected with CD18 sequences only did not stain for CD18, CD11a or CD11b. When co-transfected with CD11a/CD18, about 15% of the cells stained with antibodies to CD 11a or CD 18. All cells transfected with CD18 and any .alpha..sub.d construct resulted in no detectable staining for CD11a and CD11b. The pATM.B1, pATM.C10 and pATM.D12 groups stained 4%, 13% and 8 % positive for CD 18, respectively. Fluorescence of the positive population in the CD11a/CD18 group was 4-fold higher than background. In comparison, the co-transfection of .alpha..sub.d constructs with the CD18 construct produced a positive population that showed a 4- to 7-fold increase in fluorescence intensity over background.

EXAMPLE 10

Biotin-Labeled Immunoprecipitation of CD18/.alpha..sub.d Complexes from Co-transfected COS Cells

Immunoprecipitation was attempted on cells co-transfected with CD 18 and each of the .alpha..sub.d expression plasmids separately described in Example 7 in order to determine if .alpha..sub.d could be isolated as part of the .alpha..beta. heterodimer complex characteristic of integrins.

Transfected cells (1-3.times.10.sup.8 cells/group) were removed from petri dishes with Vetserie buffer and washed 3 times in 50 ml/group D-PBS. Each sample was labeled with 2 mg Sulpho-NHS Biotin (Pierce, Rockford, Ill. for 15 minutes at room temperature. The reaction was quenched by washing 3 times in 50 ml/sample cold D-PBS. Washed cells were resuspended in 1 ml lysis buffer (1% NP40, 50 mM Tris-HCl, pH 8.0, 0.2M NaCl, 2 mM Ca.sup.++, 2 mM Mg++, and protease inhibitors) and incubated 15 minutes on ice. Insoluble material was pelleted by centrifugation at 10,000 g for 5 minutes, and the supernatant removed to fresh tubes. In order to remove material non-specifically reactive with mouse immunoglobulin, a pre-clearance step was initially performed. Twenty-five micrograms mouse immunoglobulin (Cappel, West Chester, Pa.) was incubated with supernatants at 4.degree. C. After 2.5 hr, 100 .mu.l (25 .mu.g) rabbit anti-mouse Ig conjugated sepharose (prepared from Protein A Sepharose 4B and rabbit anti-mouse IgG, both from Zymed, San Francisco, Calif.) was added to each sample; incubation was continued at 4.degree. C. with rocking for 16 hours. Sepharose beads were removed from the supernatants by centrifugation. After pre-clearance, the supernatants were then treated with 20 .mu.g anti-CD18 antibody (TS1.18) for 2 hours at 4.degree. C. Antibody/antigen complexes were isolated from supernatants by incubation with 100 .mu.l/sample rabbit anti-mouse/Protein A-sepharose preparation described above. Beads were washed 4 times with 10 mM HEPES, 0.2M NaCl, and 1% Triton-X 100. Washed beads were pelleted and boiled for 10 minutes in 20 .mu.l 2X Laemmli sample buffer with 2% .beta.-mercaptoethanol. Samples were centrifuged and run on an 8 % prepoured Novex polyacrylamide gel (Novex) at 100 V for 30 minutes. Protein was transferred to nitrocellulose membranes (Schleicher & Schuell) in TBS-T buffer at 200 mAmps for 1 hour. Membranes were blocked for 2 hr with 3 % BSA in TBS-T. Membranes were treated with 1:6000 dilution of Strep-avidin horse radish peroxidase (POD) (Boehringer Mannheim) for 1 hour, followed by 3 washes in TBS-T. The Amersham Enhanced Chemiluminescence kit was then used according to the manufacturer's instructions to develop the blot. The membrane was exposed to Hyperfilm MP (Amersham) for 0.5 to 2 minutes.

Immunoprecipitation of CD18 complexes from cells transfected with pRC.CD18 and either pATM.B1, pATM.C10 or pATM.D12 revealed surface expression of a heterodimeric species consisting of approximately 100 kD .beta. chain, consistent with the predicted size of CD18, and an .alpha. chain of approximately 150 kD, corresponding to .alpha..sub.d.

EXAMPLE 11

Production of .alpha..sub.d Monoclonal Antibodies

Transiently transfected cells from Example 7 were washed three times in Dulbecco's phosphate buffered saline (D-PBS) and injected at 5.times.10.sup.6 cells/mouse into Balb/c mice with 50 .mu.g/mouse muramyl dipeptidase (Sigma) in PBS. Mice are injected two more times in the same fashion at two week intervals. The pre-bleed and immunized serum from the mice is screened by FACS analysis as outlined in Example 9 and the spleen from the mouse with the highest reactivity to cells transfected with .alpha..sub.d /CD 18 is fused. Hybridoma culture supernatants are then screened separately for lack of reactivity against COS cells transfected with CD11a/CD18 and for reactivity with cells co-transfected with an .alpha..sub.d expression plasmid and CD18.

Numerous modifications and variations in the invention as set forth in the above illustrative examples are expected to occur to those skilled in the art. Consequently only such limitations as appear in the appended claims should be placed on the invention.

__________________________________________________________________________SEQUENCE LISTING(1) GENERAL INFORMATION:(iii) NUMBER OF SEQUENCES: 29(2) INFORMATION FOR SEQ ID NO:1:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 3726 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: cDNA(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: 3..3485(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:TGACCTTCGGCACTGTGCTTCTTCTGAGTGTCCTGGCTTCTTATCAT47ThrPheGlyThrValLeuLeuLeuSerValLeuAlaSerTyrHis15 1015GGATTCAACCTGGATGTGGAGGAGCCTACGATCTTCCAGGAGGATGCA95GlyPheAsnLeuAspValGluGluProThrIlePheGlnGluAspAla20 2530GGCGGCTTTGGGCAGAGCGTGGTGCAGTTCGGTGGATCTCGACTCGTG143GlyGlyPheGlyGlnSerValValGlnPheGlyGlySerArgLeuVal35 4045GTGGGAGCACCCCTGGAGGTGGTGGCGGCCAACCAGACGGGACGGCTG191ValGlyAlaProLeuGluValValAlaAlaAsnGlnThrGlyArgLeu50 5560TATGACTGCGCAGCTGCCACCGGCATGTGCCAGCCCATCCCGCTGCAC239TyrAspCysAlaAlaAlaThrGlyMetCysGlnProIleProLeuHis6570 75ATCCGCCCTGAGGCCGTGAACATGTCCTTGGGCCTGACCCTGGCAGCC287IleArgProGluAlaValAsnMetSerLeuGlyLeuThrLeuAlaAla8085 9095TCCACCAACGGCTCCCGGCTCCTGGCCTGTGGCCCGACCCTGCACAGA335SerThrAsnGlySerArgLeuLeuAlaCysGlyProThrLeuHisArg100 105110GTCTGTGGGGAGAACTCATACTCAAAGGGTTCCTGCCTCCTGCTGGGC383ValCysGlyGluAsnSerTyrSerLysGlySerCysLeuLeuLeuGly11512 0125TCGCGCTGGGAGATCATCCAGACAGTCCCCGACGCCACGCCAGAGTGT431SerArgTrpGluIleIleGlnThrValProAspAlaThrProGluCys130135 140CCACATCAAGAGATGGACATCGTCTTCCTGATTGACGGCTCTGGAAGC479ProHisGlnGluMetAspIleValPheLeuIleAspGlySerGlySer145150 155ATTGACCAAAATGACTTTAACCAGATGAAGGGCTTTGTCCAAGCTGTC527IleAspGlnAsnAspPheAsnGlnMetLysGlyPheValGlnAlaVal160165170 175ATGGGCCAGTTTGAGGGCACTGACACCCTGTTTGCACTGATGCAGTAC575MetGlyGlnPheGluGlyThrAspThrLeuPheAlaLeuMetGlnTyr180185 190TCAAACCTCCTGAAGATCCACTTCACCTTCACCCAATTCCGGACCAGC623SerAsnLeuLeuLysIleHisPheThrPheThrGlnPheArgThrSer195200 205CCGAGCCAGCAGAGCCTGGTGGATCCCATCGTCCAACTGAAAGGCCTG671ProSerGlnGlnSerLeuValAspProIleValGlnLeuLysGlyLeu210215220ACGTTCACGGCCACGGGCATCCTGACAGTGGTGACACAGCTATTTCAT719ThrPheThrAlaThrGlyIleLeuThrValValThrGlnLeuPheHis225230235CATAAGA ATGGGGCCCGAAAAAGTGCCAAGAAGATCCTCATTGTCATC767HisLysAsnGlyAlaArgLysSerAlaLysLysIleLeuIleValIle240245250255ACA GATGGGCAGAAGTACAAAGACCCCCTGGAATACAGTGATGTCATC815ThrAspGlyGlnLysTyrLysAspProLeuGluTyrSerAspValIle260265270CCC CAGGCAGAGAAGGCTGGCATCATCCGCTACGCTATCGGGGTGGGA863ProGlnAlaGluLysAlaGlyIleIleArgTyrAlaIleGlyValGly275280285CACGC TTTCCAGGGACCCACTGCCAGGCAGGAGCTGAATACCATCAGC911HisAlaPheGlnGlyProThrAlaArgGlnGluLeuAsnThrIleSer290295300TCAGCGCCTC CGCAGGACCACGTGTTCAAGGTGGACAACTTTGCAGCC959SerAlaProProGlnAspHisValPheLysValAspAsnPheAlaAla305310315CTTGGCAGCATCCAGAAG CAGCTGCAGGAGAAGATCTATGCAGTTGAG1007LeuGlySerIleGlnLysGlnLeuGlnGluLysIleTyrAlaValGlu320325330335GGAACCCAGTCCAGG GCAAGCAGCTCCTTCCAGCACGAGATGTCCCAA1055GlyThrGlnSerArgAlaSerSerSerPheGlnHisGluMetSerGln340345350GAAGGCTTCAGCAC AGCCCTCACAATGGATGGCCTCTTCCTGGGGGCT1103GluGlyPheSerThrAlaLeuThrMetAspGlyLeuPheLeuGlyAla355360365GTGGGGAGCTTTAGCT GGTCTGGAGGTGCCTTCCTGTATCCCCCAAAT1151ValGlySerPheSerTrpSerGlyGlyAlaPheLeuTyrProProAsn370375380ATGAGCCCCACCTTCATCAAC ATGTCTCAGGAGAATGTGGACATGAGG1199MetSerProThrPheIleAsnMetSerGlnGluAsnValAspMetArg385390395GACTCTTACCTGGGTTACTCCACCGAGCTA GCCCTGTGGAAGGGGGTA1247AspSerTyrLeuGlyTyrSerThrGluLeuAlaLeuTrpLysGlyVal400405410415CAGAACCTGGTCCTGGGGGCCCCCCG CTACCAGCATACCGGGAAGGCT1295GlnAsnLeuValLeuGlyAlaProArgTyrGlnHisThrGlyLysAla420425430GTCATCTTCACCCAGGTGTCCAGGC AATGGAGGAAGAAGGCCGAAGTC1343ValIlePheThrGlnValSerArgGlnTrpArgLysLysAlaGluVal435440445ACAGGGACGCAGATCGGCTCCTACTTC GGGGCCTCCCTCTGCTCCGTG1391ThrGlyThrGlnIleGlySerTyrPheGlyAlaSerLeuCysSerVal450455460GATGTGGACAGCGATGGCAGCACCGACCTGATC CTCATTGGGGCCCCC1439AspValAspSerAspGlySerThrAspLeuIleLeuIleGlyAlaPro465470475CATTACTATGAGCAGACCCGAGGGGGCCAGGTGTCCGTGTG TCCCTTG1487HisTyrTyrGluGlnThrArgGlyGlyGlnValSerValCysProLeu480485490495CCTAGGGGGCAGAGGGTGCAGTGGCAGTGTGACGCTG TTCTCCGTGGT1535ProArgGlyGlnArgValGlnTrpGlnCysAspAlaValLeuArgGly500505510GAGCAGGGCCACCCCTGGGGCCGCTTTGGGGCAGCC CTGACAGTGTTG1583GluGlnGlyHisProTrpGlyArgPheGlyAlaAlaLeuThrValLeu515520525GGGGATGTGAATGAGGACAAGCTGATAGACGTGGCCATT GGGGCCCCG1631GlyAspValAsnGluAspLysLeuIleAspValAlaIleGlyAlaPro530535540GGAGAGCAGGAGAACCGGGGTGCTGTCTACCTGTTTCACGGAGC CTCA1679GlyGluGlnGluAsnArgGlyAlaValTyrLeuPheHisGlyAlaSer545550555GAATCCGGCATCAGCCCCTCCCACAGCCAGCGGATTGCCAGCTCCCAG1 727GluSerGlyIleSerProSerHisSerGlnArgIleAlaSerSerGln560565570575CTCTCCCCCAGGCTGCAGTATTTTGGGCAGGCGCTGAGTGGGGGTCAG 1775LeuSerProArgLeuGlnTyrPheGlyGlnAlaLeuSerGlyGlyGln580585590GACCTCACCCAGGATGGACTGATGGACCTGGCCGTGGGGGCCCGGGGC 1823AspLeuThrGlnAspGlyLeuMetAspLeuAlaValGlyAlaArgGly595600605CAGGTGCTCCTGCTCAGGAGTCTGCCGGTGCTGAAAGTGGGGGTGGCC 1871GlnValLeuLeuLeuArgSerLeuProValLeuLysValGlyValAla610615620ATGAGATTCAGCCCTGTGGAGGTGGCCAAGGCTGTGTACCGGTGCTGG1919 MetArgPheSerProValGluValAlaLysAlaValTyrArgCysTrp625630635GAAGAGAAGCCCAGTGCCCTGGAAGCTGGGGACGCCACCGTCTGTCTC1967GluGluLy sProSerAlaLeuGluAlaGlyAspAlaThrValCysLeu640645650655ACCATCCAGAAAAGCTCACTGGACCAGCTAGGTGACATCCAAAGCTCT2015ThrI leGlnLysSerSerLeuAspGlnLeuGlyAspIleGlnSerSer660665670GTCAGGTTTGATCTGGCACTGGACCCAGGTCGTCTGACTTCTCGTGCC2063Val ArgPheAspLeuAlaLeuAspProGlyArgLeuThrSerArgAla675680685ATTTTCAATGAAACCAAGAACCCCACTTTGACTCGAAGAAAAACCCTG2111IlePhe AsnGluThrLysAsnProThrLeuThrArgArgLysThrLeu690695700GGACTGGGGATTCACTGTGAAACCCTGAAGCTGCTTTTGCCAGATTGT2159GlyLeuGlyIl eHisCysGluThrLeuLysLeuLeuLeuProAspCys705710715GTGGAGGATGTGGTGAGCCCCATCATTCTGCACCTCAACTTCTCACTG2207ValGluAspValValSerP roIleIleLeuHisLeuAsnPheSerLeu720725730735GTGAGAGAGCCCATCCCCTCCCCCCAGAACCTGCGTCCTGTGCTGGCC2255ValArgGluProIle ProSerProGlnAsnLeuArgProValLeuAla740745750GTGGGCTCACAAGACCTCTTCACTGCTTCTCTCCCCTTCGAGAAGAAC2303ValGlySerGlnAsp LeuPheThrAlaSerLeuProPheGluLysAsn755760765TGTGGGCAAGATGGCCTCTGTGAAGGGGACCTGGGTGTCACCCTCAGC2351CysGlyGlnAspGlyLe uCysGluGlyAspLeuGlyValThrLeuSer770775780TTCTCAGGCCTGCAGACCCTGACCGTGGGGAGCTCCCTGGAGCTCAAC2399PheSerGlyLeuGlnThrLeuT hrValGlySerSerLeuGluLeuAsn785790795GTGATTGTGACTGTGTGGAACGCAGGTGAGGATTCCTACGGAACCGTG2447ValIleValThrValTrpAsnAlaGlyGlu AspSerTyrGlyThrVal800805810815GTCAGCCTCTACTATCCAGCAGGGCTGTCGCACCGACGGGTGTCAGGA2495ValSerLeuTyrTyrProAlaGlyLeu SerHisArgArgValSerGly820825830GCCCAGAAGCAGCCCCATCAGAGTGCCCTGCGCCTGGCATGTGAGACA2543AlaGlnLysGlnProHisGlnSerAl aLeuArgLeuAlaCysGluThr835840845GTGCCCACTGAGGATGAGGGCCTAAGAAGCAGCCGCTGCAGTGTCAAC2591ValProThrGluAspGluGlyLeuArgS erSerArgCysSerValAsn850855860CACCCCATCTTCCATGAGGGCTCTAACGGCACCTTCATAGTCACATTC2639HisProIlePheHisGluGlySerAsnGlyThr PheIleValThrPhe865870875GATGTCTCCTACAAGGCCACCCTGGGAGACAGGATGCTTATGAGGGCC2687AspValSerTyrLysAlaThrLeuGlyAspArgMetLeuMet ArgAla880885890895AGTGCAAGCAGTGAGAACAATAAGGCTTCAAGCAGCAAGGCCACCTTC2735SerAlaSerSerGluAsnAsnLysAlaSerSerSerLy sAlaThrPhe900905910CAGCTGGAGCTCCCGGTGAAGTATGCAGTCTACACCATGATCAGCAGG2783GlnLeuGluLeuProValLysTyrAlaValTyrThrM etIleSerArg915920925CAGGAAGAATCCACCAAGTACTTCAACTTTGCAACCTCCGATGAGAAG2831GlnGluGluSerThrLysTyrPheAsnPheAlaThrSer AspGluLys930935940AAAATGAAAGAGGCTGAGCATCGATACCGTGTGAATAACCTCAGCCAG2879LysMetLysGluAlaGluHisArgTyrArgValAsnAsnLeuSer Gln945950955CGAGATCTGGCCATCAGCATTAACTTCTGGGTTCCTGTCCTGCTGAAC2927ArgAspLeuAlaIleSerIleAsnPheTrpValProValLeuLeuAsn960 965970975GGGGTGGCTGTGTGGGATGTGGTCATGGAGGCCCCATCTCAGAGTCTC2975GlyValAlaValTrpAspValValMetGluAlaProSerGlnSerLeu 980985990CCCTGTGTTTCAGAGAGAAAACCTCCCCAGCATTCTGACTTCCTGACC3023ProCysValSerGluArgLysProProGlnHisSerAspPheLeuThr 99510001005CAGATTTCAAGAAGTCCCATGCTGGACTGCTCCATTGCTGACTGCCTG3071GlnIleSerArgSerProMetLeuAspCysSerIleAlaAspCysLeu 101010151020CAGTTCCGCTGTGACGTCCCCTCCTTCAGCGTCCAGGAGGAGCTGGAT3119GlnPheArgCysAspValProSerPheSerValGlnGluGluLeuAsp102 510301035TTCACCCTGAAGGGCAATCTCAGTTTCGGCTGGGTCCGCGAGACATTG3167PheThrLeuLysGlyAsnLeuSerPheGlyTrpValArgGluThrLeu1040 104510501055CAGAAGAAGGTGTTGGTCGTGAGTGTGGCTGAAATTACGTTCGACACA3215GlnLysLysValLeuValValSerValAlaGluIleThrPheAspThr 106010651070TCCGTGTACTCCCAGCTTCCAGGACAGGAGGCATTTATGAGAGCTCAG3263SerValTyrSerGlnLeuProGlyGlnGluAlaPheMetArgAlaGln 107510801085ATGGAGATGGTGCTAGAAGAAGACGAGGTCTACAATGCCATTCCCATC3311MetGluMetValLeuGluGluAspGluValTyrAsnAlaIleProIle109 010951100ATCATGGGCAGCTCTGTGGGGGCTCTGCTACTGCTGGCGCTCATCACA3359IleMetGlySerSerValGlyAlaLeuLeuLeuLeuAlaLeuIleThr1105 11101115GCCACACTGTACAAGCTTGGCTTCTTCAAACGCCACTACAAGGAAATG3407AlaThrLeuTyrLysLeuGlyPhePheLysArgHisTyrLysGluMet11201125 11301135CTGGAGGACAAGCCTGAAGACACTGCCACATTCAGTGGGGACGATTTC3455LeuGluAspLysProGluAspThrAlaThrPheSerGlyAspAspPhe1140 11451150AGCTGTGTGGCCCCAAATGTGCCTTTGTCCTAATAATCCACTTTCCTGTT3505SerCysValAlaProAsnValProLeuSer11551160TATC TCTACCACTGTGGGCTGGACTTGCTTGCAACCATAAATCAACTTACATGGAAACAA3565CTTCTGCATAGATCTGCACTGGCCTAAGCAACCTACCAGGTGCTAAGCACCTTCTCGGAG3625AGATAGAGATTGTAATGTTTTTACATATCTGTCCATCTTTTTCAGCAATG ACCCACTTTT3685TACAGAAGCAGGCATGGTGCCAGCATAAATTTTCATATGCT3726(2) INFORMATION FOR SEQ ID NO:2:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 1161 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:ThrPheGlyThrValLeuLeuLeuSerValLeuAlaSerTyrHisGly151015PheAsnLeuAspValGluGluProThrIlePheGlnGluAspAlaGly 202530GlyPheGlyGlnSerValValGlnPheGlyGlySerArgLeuValVal354045GlyAlaProLeuGluValVa lAlaAlaAsnGlnThrGlyArgLeuTyr505560AspCysAlaAlaAlaThrGlyMetCysGlnProIleProLeuHisIle657075 80ArgProGluAlaValAsnMetSerLeuGlyLeuThrLeuAlaAlaSer859095ThrAsnGlySerArgLeuLeuAlaCysGlyProThrLeuH isArgVal100105110CysGlyGluAsnSerTyrSerLysGlySerCysLeuLeuLeuGlySer115120125ArgTrpGlu IleIleGlnThrValProAspAlaThrProGluCysPro130135140HisGlnGluMetAspIleValPheLeuIleAspGlySerGlySerIle145150 155160AspGlnAsnAspPheAsnGlnMetLysGlyPheValGlnAlaValMet165170175GlyGlnPheGluGlyThrAspThrLeuPh eAlaLeuMetGlnTyrSer180185190AsnLeuLeuLysIleHisPheThrPheThrGlnPheArgThrSerPro19520020 5SerGlnGlnSerLeuValAspProIleValGlnLeuLysGlyLeuThr210215220PheThrAlaThrGlyIleLeuThrValValThrGlnLeuPheHisHis225 230235240LysAsnGlyAlaArgLysSerAlaLysLysIleLeuIleValIleThr245250255AspGlyGlnLysTyrLys AspProLeuGluTyrSerAspValIlePro260265270GlnAlaGluLysAlaGlyIleIleArgTyrAlaIleGlyValGlyHis275280 285AlaPheGlnGlyProThrAlaArgGlnGluLeuAsnThrIleSerSer290295300AlaProProGlnAspHisValPheLysValAspAsnPheAlaAlaLeu3 05310315320GlySerIleGlnLysGlnLeuGlnGluLysIleTyrAlaValGluGly325330335ThrGln SerArgAlaSerSerSerPheGlnHisGluMetSerGlnGlu340345350GlyPheSerThrAlaLeuThrMetAspGlyLeuPheLeuGlyAlaVal355 360365GlySerPheSerTrpSerGlyGlyAlaPheLeuTyrProProAsnMet370375380SerProThrPheIleAsnMetSerGlnGluAsnValAsp MetArgAsp385390395400SerTyrLeuGlyTyrSerThrGluLeuAlaLeuTrpLysGlyValGln405410 415AsnLeuValLeuGlyAlaProArgTyrGlnHisThrGlyLysAlaVal420425430IlePheThrGlnValSerArgGlnTrpArgLysLysAlaGluValThr 435440445GlyThrGlnIleGlySerTyrPheGlyAlaSerLeuCysSerValAsp450455460ValAspSerAspGlySerThrAspLeu IleLeuIleGlyAlaProHis465470475480TyrTyrGluGlnThrArgGlyGlyGlnValSerValCysProLeuPro485490 495ArgGlyGlnArgValGlnTrpGlnCysAspAlaValLeuArgGlyGlu500505510GlnGlyHisProTrpGlyArgPheGlyAlaAlaLeuThrVal LeuGly515520525AspValAsnGluAspLysLeuIleAspValAlaIleGlyAlaProGly530535540GluGlnGluAsnArgG lyAlaValTyrLeuPheHisGlyAlaSerGlu545550555560SerGlyIleSerProSerHisSerGlnArgIleAlaSerSerGlnLeu565 570575SerProArgLeuGlnTyrPheGlyGlnAlaLeuSerGlyGlyGlnAsp580585590LeuThrGlnAspGlyLeuMetAspLeuAla ValGlyAlaArgGlyGln595600605ValLeuLeuLeuArgSerLeuProValLeuLysValGlyValAlaMet610615620ArgPh eSerProValGluValAlaLysAlaValTyrArgCysTrpGlu625630635640GluLysProSerAlaLeuGluAlaGlyAspAlaThrValCysLeuThr 645650655IleGlnLysSerSerLeuAspGlnLeuGlyAspIleGlnSerSerVal660665670ArgPheAspLeuAlaLeuA spProGlyArgLeuThrSerArgAlaIle675680685PheAsnGluThrLysAsnProThrLeuThrArgArgLysThrLeuGly690695 700LeuGlyIleHisCysGluThrLeuLysLeuLeuLeuProAspCysVal705710715720GluAspValValSerProIleIleLeuHisLeuAsnPheSerLeu Val725730735ArgGluProIleProSerProGlnAsnLeuArgProValLeuAlaVal740745750GlySerGl nAspLeuPheThrAlaSerLeuProPheGluLysAsnCys755760765GlyGlnAspGlyLeuCysGluGlyAspLeuGlyValThrLeuSerPhe77077 5780SerGlyLeuGlnThrLeuThrValGlySerSerLeuGluLeuAsnVal785790795800IleValThrValTrpAsnAlaGlyGluAspSerT yrGlyThrValVal805810815SerLeuTyrTyrProAlaGlyLeuSerHisArgArgValSerGlyAla8208258 30GlnLysGlnProHisGlnSerAlaLeuArgLeuAlaCysGluThrVal835840845ProThrGluAspGluGlyLeuArgSerSerArgCysSerValAsnHis850 855860ProIlePheHisGluGlySerAsnGlyThrPheIleValThrPheAsp865870875880ValSerTyrLysAlaThrLeuGl yAspArgMetLeuMetArgAlaSer885890895AlaSerSerGluAsnAsnLysAlaSerSerSerLysAlaThrPheGln900905 910LeuGluLeuProValLysTyrAlaValTyrThrMetIleSerArgGln915920925GluGluSerThrLysTyrPheAsnPheAlaThrSerAspGluLysL ys930935940MetLysGluAlaGluHisArgTyrArgValAsnAsnLeuSerGlnArg945950955960AspLeuAlaIle SerIleAsnPheTrpValProValLeuLeuAsnGly965970975ValAlaValTrpAspValValMetGluAlaProSerGlnSerLeuPro980 985990CysValSerGluArgLysProProGlnHisSerAspPheLeuThrGln99510001005IleSerArgSerProMetLeuAspCysSerIleA laAspCysLeuGln101010151020PheArgCysAspValProSerPheSerValGlnGluGluLeuAspPhe1025103010351040ThrLeuLysGlyAsnLeuSerPheGlyTrpValArgGluThrLeuGln104510501055LysLysValLeuValValSerValAlaGluIleThrPheAspThrSer 106010651070ValTyrSerGlnLeuProGlyGlnGluAlaPheMetArgAlaGlnMet107510801085GluMetValLeuGluGluA spGluValTyrAsnAlaIleProIleIle109010951100MetGlySerSerValGlyAlaLeuLeuLeuLeuAlaLeuIleThrAla110511101115 1120ThrLeuTyrLysLeuGlyPhePheLysArgHisTyrLysGluMetLeu112511301135GluAspLysProGluAspThrAlaThrPheSerGlyA spAspPheSer114011451150CysValAlaProAsnValProLysSer11551160(2) INFORMATION FOR SEQ ID NO:3:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 1153 amino acids (B) TYPE: amino acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:MetAlaLeuArgValLeuLeuLeuThrAlaLeuThrLeuCysHisGly1510 15PheAsnLeuAspThrGluAsnAlaMetThrPheGlnGluAsnAlaArg202530GlyPheGlyGlnSerValValGlnLeuGlnGlySerArgVa lValVal354045GlyAlaProGlnGluIleValAlaAlaAsnGlnArgGlySerLeuTyr505560Gl nCysAspTyrSerThrGlySerCysGluProIleArgLeuGlnVal65707580ProValGluAlaValAsnMetSerLeuGlyLeuSerLeuAlaAlaTh r859095ThrSerProProGlnLeuLeuAlaCysGlyProThrValHisGlnThr100105110CysSerGluAsnThrTyrValLysGlyLeuCysPheLeuPheGlySer115120125AsnLeuArgGlnGlnProGlnLysPheProGluAlaLeuArgGlyCys 130135140ProGlnGluAspSerAspIleAlaPheLeuIleAspGlySerGlySer145150155160 IleIleProHisAspPheArgArgMetLysGluPheValSerThrVal165170175MetGluGlnLeuLysLysSerLysThrLeuPheSerLeuMetGlnT yr180185190SerGluGluPheArgIleHisPheThrPheLysGluPheGlnAsnAsn195200205 ProAsnProArgSerLeuValLysProIleThrGlnLeuLeuGlyArg210215220ThrHisThrAlaThrGlyIleArgLysValValArgGluLeuPheAsn225 230235240IleThrAsnGlyAlaArgLysAsnAlaPheLysIleLeuValValIle245250255 ThrAspGlyGluLysPheGlyAspProLeuGlyTyrGluAspValIle260265270ProGluAlaAspArgGluGlyValIleArgTyrValIleGlyValGly275280285AspAlaPheArgSerGluLysSerArgGlnGluLeuAsnThrIleAla290295300SerLysP roProArgAspHisValPheGlnValAsnAsnPheGluAla305310315320LeuLysThrIleGlnAsnGlnLeuArgGluLysIlePheAlaIleGlu 325330335GlyThrGlnThrGlySerSerSerSerPheGluHisGluMetSerGln340345350 GluGlyPheSerAlaAlaIleThrSerAsnGlyProLeuLeuSerThr355360365ValGlySerTyrAspTrpAlaGlyGlyValPheLeuTyrThrSerLys 370375380GluLysSerThrPheIleAsnMetThrArgValAspSerAspMetAsn385390395400Asp AlaTyrLeuGlyTyrAlaAlaAlaIleIleLeuArgAsnArgVal405410415GlnSerLeuValLeuGlyAlaProArgTyrGlnHisIleGlyLeuVal 420425430AlaMetPheArgGlnAsnThrGlyMetTrpGluSerAsnAlaAsnVal435440445Lys GlyThrGlnIleGlyAlaTyrPheGlyAlaSerLeuCysSerVal450455460AspValAspSerAsnGlySerThrAspLeuValLeuIleGlyAlaPro465 470475480HisTyrTyrGluGlnThrArgGlyGlyGlnValSerValCysProLeu485490495P roArgGlyGlnArgAlaArgTrpGlnCysAspAlaValLeuTyrGly500505510GluGlnGlyGlnProTrpGlyArgPheGlyAlaAlaLeuThrValLeu 515520525GlyAspValAsnGlyAspLysLeuThrAspValAlaIleGlyAlaPro530535540GlyGluGluAs pAsnArgGlyAlaValTyrLeuPheHisGlyThrSer545550555560GlySerGlyIleSerProSerHisSerGlnArgIleAlaGlySerLys 565570575LeuSerProArgLeuGlnTyrPheGlyGlnSerLeuSerGlyGlyGln580585590Asp LeuThrMetAspGlyLeuValAspLeuThrValGlyAlaGlnGly595600605HisValLeuLeuLeuArgSerGlnProValLeuArgValLysAlaIle 610615620MetGluPheAsnProArgGluValAlaArgAsnValPheGluCysAsn625630635640AspGln ValValLysGlyLysGluAlaGlyGluValArgValCysLeu645650655HisValGlnLysSerThrArgAspArgLeuArgGluGlyGlnIleGln 660665670SerValValThrTyrAspLeuAlaLeuAspSerGlyArgProHisSer675680685ArgAlaV alPheAsnGluThrLysAsnSerThrArgArgGlnThrGln690695700ValLeuGlyLeuThrGlnThrCysGluThrLeuLysLeuGlnLeuPro705 710715720AsnCysIleGluAspProValSerProIleValLeuArgLeuAsnPhe725730735SerLe uValGlyThrProLeuSerAlaPheGlyAsnLeuArgProVal740745750LeuAlaGluAspAlaGlnArgLeuPheThrAlaLeuPheProPheGlu 755760765LysAsnCysGlyAsnAspAsnIleCysGlnAspAspLeuSerIleThr770775780PheSerPheMetSer LeuAspCysLeuValValGlyGlyProArgGlu785790795800PheAsnValThrValThrValArgAsnAspGlyGluAspSerTyrArg 805810815ThrGlnValThrPhePhePheProLeuAspLeuSerTyrArgLysVal820825830SerThr LeuGlnAsnGlnArgSerGlnArgSerTrpArgLeuAlaCys835840845GluSerAlaSerSerThrGluValSerGlyAlaLeuLysSerThrSer850 855860CysSerIleAsnHisProIlePheProGluAsnSerGluValThrPhe865870875880AsnIleThrP heAspValAspSerLysAlaSerLeuGlyAsnLysLeu885890895LeuLeuLysAlaAsnValThrSerGluAsnAsnMetProArgThrAsn 900905910LysThrGluPheGlnLeuGluLeuProValLysTyrAlaValTyrMet915920925ValValThrSe rHisGlyValSerThrLysTyrLeuAsnPheThrAla930935940SerGluAsnThrSerArgValMetGlnHisGlnTyrGlnValSerAsn945 950955960LeuGlyGlnArgSerLeuProIleSerLeuValPheLeuValProVal965970975ArgLeuAsn GlnThrValIleTrpAspArgProGlnValThrPheSer980985990GluAsnLeuSerSerThrCysHisThrLysGluArgLeuProSerHis 99510001005SerAspPheLeuAlaGluLeuArgLysAlaProValValAsnCysSer101010151020IleAlaValCysGlnAr gIleGlnCysAspIleProPhePheGlyIle1025103010351040GlnGluGluPheAsnAlaThrLeuLysGlyAsnLeuSerPheAspTrp 104510501055TyrIleLysThrSerHisAsnHisLeuLeuIleValSerThrAlaGlu106010651070IleLeu PheAsnAspSerValPheThrLeuLeuProGlyGlnGlyAla107510801085PheValArgSerGlnThrGluThrLysValGluProPheGluValPro1090 10951100AsnProLeuProLeuIleValGlySerSerValGlyGlyLeuLeuLeu1105111011151120LeuAlaLe uIleThrAlaAlaLeuTyrLysLeuGlyPhePheLysArg112511301135GlnTyrLysAspMetMetSerGluGlyGlyProProGlyAlaGluPro 114011451150Gln(2) INFORMATION FOR SEQ ID NO:4:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 1163 amino acids(B) TYPE: amino acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:M etThrArgThrArgAlaAlaLeuLeuLeuPheThrAlaLeuAlaThr151015SerLeuGlyPheAsnLeuAspThrGluGluLeuThrAlaPheArgVal 202530AspSerAlaGlyPheGlyAspSerValValGlnTyrAlaAsnSerTrp354045ValV alValGlyAlaProGlnLysIleIleAlaAlaAsnGlnIleGly505560GlyLeuTyrGlnCysGlyTyrSerThrGlyAlaCysGluProIleGly65 707580LeuGlnValProProGluAlaValAsnMetSerLeuGlyLeuSerLeu859095AlaS erThrThrSerProSerGlnLeuLeuAlaCysGlyProThrVal100105110HisHisGluCysGlyArgAsnMetTyrLeuThrGlyLeuCysPheLeu 115120125LeuGlyProThrGlnLeuThrGlnArgLeuProValSerArgGlnGlu130135140CysProArgGlnGl uGlnAspIleValPheLeuIleAspGlySerGly145150155160SerIleSerSerArgAsnPheAlaThrMetMetAsnPheValArgAla 165170175ValIleSerGlnPheGlnArgProSerThrGlnPheSerLeuMetGln180185190PheSer AsnLysPheGlnThrHisPheThrPheGluGluPheArgArg195200205ThrSerAsnProLeuSerLeuLeuAlaSerValHisGlnLeuGlnGly210 215220PheThrTyrThrAlaThrAlaIleGlnAsnValValHisArgLeuPhe225230235240HisAlaSer TyrGlyAlaArgArgAspAlaIleLysIleLeuIleVal245250255IleThrAspGlyLysLysGluGlyAspSerLeuAspTyrLysAspVal 260265270IleProMetAlaAspAlaAlaGlyIleIleArgTyrAlaIleGlyVal275280285GlyLeuAlaP heGlnAsnArgAsnSerTrpLysGluLeuAsnAspIle290295300AlaSerLysProSerGlnGluHisIlePheLysValGluAspPheAsp305 310315320AlaLeuLysAspIleGlnAsnGlnLeuLysGluLysIlePheAlaIle325330335GluGlyTh rGluThrIleSerSerSerSerPheGluLeuGluMetAla340345350GlnGluGlyPheSerAlaValPheThrProAspGlyProValLeuGly 355360365AlaValGlySerPheThrTrpSerGlyGlyAlaPheLeuTyrProPro370375380AsnMetSerProThrPhe IleAsnMetSerGlnGluAsnValAspMet385390395400ArgAspSerTyrLeuGlyTyrSerThrGluLeuAlaLeuTrpLysGly 405410415ValGlnSerLeuValLeuGlyAlaProArgTyrGlnHisIleGlyLys420425430AlaValIle PheIleGlnValSerArgGlnTrpArgMetLysAlaGlu435440445ValIleGlyThrGlnIleGlySerTyrPheGlyAlaSerLeuCysSer450 455460ValAspValAspThrAspGlySerThrAspLeuValLeuIleGlyAla465470475480ProHisTyrTyrG luGlnThrArgGlyGlyGlnValSerValCysPro485490495LeuProArgGlyTrpArgArgTrpTrpCysAspAlaValLeuTyrGly 500505510GluGlnGlyHisProTrpGlyArgPheGlyAlaAlaLeuThrValLeu515520525GlyAspValAsnGl yAspLysLeuThrAspValValIleGlyAlaPro530535540GlyGluGluGluAsnArgGlyAlaValTyrLeuPheHisGlyValLeu545550 555560GlyProSerIleSerProSerHisSerGlnArgIleAlaGlySerGln565570575LeuSerSerArg LeuGlnTyrPheGlyGlnAlaLeuSerGlyGlyGln580585590AspLeuThrGlnAspGlyLeuValAspLeuAlaValGlyAlaArgGly595 600605GlnValLeuLeuLeuArgThrArgProValLeuTrpValGlyValSer610615620MetGlnPheIleProAlaGlu IleProArgSerAlaPheGluCysArg625630635640GluGlnValValSerGluGlnThrLeuValGlnSerAsnIleCysLeu6 45650655TyrIleAspLysArgSerLysAsnLeuLeuGlySerArgAspLeuGln660665670SerSerValThrL euAspLeuAlaLeuAlaProGlyArgLeuSerPro675680685ArgAlaIlePheGlnGluThrLysAsnArgSerLeuSerArgValArg690 695700ValLeuGlyLeuLysAlaHisCysGluAsnPheAsnLeuLeuLeuPro705710715720SerCysValGluAspSe rValIleProIleIleLeuArgLeuAsnPhe725730735ThrLeuValGlyLysProLeuLeuAlaPheArgAsnLeuArgProMet740 745750LeuAlaAlaLeuAlaGlnArgTyrPheThrAlaSerLeuProPheGlu755760765LysAsnCysGlyAlaAsp HisIleCysGlnAspAsnLeuGlyIleSer770775780PheSerPheProGlyLeuLysSerLeuLeuValGlySerAsnLeuGlu785790 795800LeuAsnAlaGluValMetValTrpAsnAspGlyGluAspSerTyrGly805810815ThrThrIleThrPhe SerHisProAlaGlyLeuSerTyrArgTyrVal820825830AlaGluGlyGlnLysGlnGlyGlnLeuArgSerLeuHisLeuThrCys835 840845CysSerAlaProValGlySerGlnGlyThrTrpSerThrSerCysArg850855860IleAsnHisLeuIlePheArgGlyG lyAlaGlnIleThrPheLeuAla865870875880ThrPheAspValSerProLysAlaValGlyLeuAspArgLeuLeuLeu885 890895IleAlaAsnValSerSerGluAsnAsnIleProArgThrSerLysThr900905910IlePheGlnLeuGluLe uProValLysTyrAlaValTyrIleValVal915920925SerSerHisGluGlnPheThrLysTyrLeuAsnPheSerGluSerGlu930 935940GluLysGluSerHisValAlaMetHisArgTyrGlnValAsnAsnLeu945950955960GlyGlnArgAspLeuProVal SerIleAsnPheTrpValProValGlu965970975LeuAsnGlnGluAlaValTrpMetAspValGluValSerHisProGln980 985990AsnProSerLeuArgCysSerSerGluLysIleAlaProProAlaSer99510001005AspPheLeuAlaHisIleGln LysAsnProValLeuAspCysSerIle101010151020AlaGlyCysLeuArgPheArgCysAspValProSerPheSerValGln10251030 10351040GluGluLeuAspPheThrLeuLysGlyAsnLeuSerPheGlyTrpVal104510501055ArgGlnIleLeuGlnL ysLysValSerValValSerValAlaGluIle106010651070IlePheAspThrSerValTyrSerGlnLeuProGlyGlnGluAlaPhe1075 10801085MetArgAlaGlnThrIleThrValLeuGluLysTyrLysValHisAsn109010951100ProIleProLeuIleValGlySer SerIleGlyGlyLeuLeuLeuLeu1105111011151120AlaLeuIleThrAlaValLeuTyrLysValGlyPhePheLysArgGln112 511301135TyrLysGluMetMetGluGluAlaAsnGlyGlnIleAlaProGluAsn114011451150GlyThrGlnThrP roSerProProSerGluLys11551160(2) INFORMATION FOR SEQ ID NO:5:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 12 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: peptide(xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:PheAsnLeuAspVa lGluGluProMetValPheGln1510(2) INFORMATION FOR SEQ ID NO:6:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 35 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA(xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:TTYAAYYTGGAYGTNGARGARCCNATGGTNTTYCA35(2) INFORMATION FOR SEQ ID NO:7:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 36 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA(xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:TTCAACCTGGACGTGGAGGAGCCCATGGTGTTCCAA36(2) INFORMATION FOR SEQ ID NO:8:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 36 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA(xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:TTCAACCTGGACGTNGAASANCCCATGGTCTTCCAA36(2) INFORMATION FOR SEQ ID NO:9:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 23 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA(xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:TTYAAYYTNGAYGTNGARGARCC23(2) INFORMATION FOR SEQ ID NO:10:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 20 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA(xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:TTYAAYYTGGACGTNGAAGA20(2) INFORMATION FOR SEQ ID NO:11:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 17 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA(xi) SEQUENCE DESCRIPTION: SEQ ID NO:11:TGRAANACCATNGGYTC17(2) INFORMATION FOR SEQ ID NO:12:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 18 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA(xi ) SEQUENCE DESCRIPTION: SEQ ID NO:12:TTGGAAGACCATNGGYTC18(2) INFORMATION FOR SEQ ID NO:13:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 17 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA(x i) SEQUENCE DESCRIPTION: SEQ ID NO:13:ATTAACCCTCACTAAAG17(2) INFORMATION FOR SEQ ID NO:14:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 17 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA( xi) SEQUENCE DESCRIPTION: SEQ ID NO:14:AATACGACTCACTATAG17(2) INFORMATION FOR SEQ ID NO:15:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 11 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: peptide(xi) SEQUENCE DESCRIPTION: SEQ ID NO:15: ValPheGlnGluXaaGlyAlaGlyPheGlyGln1510(2) INFORMATION FOR SEQ ID NO:16:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 14 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: peptide(xi) SEQUENCE DESCRIPTION: SEQ ID NO:16: LeuTyrAspXaaValAlaAlaThrGlyLeuXaaGlnProIle1510(2) INFORMATION FOR SEQ ID NO:17:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 12 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:17:ProLeuGluTyrXaaAspValIleProGlnAlaGlu1510(2) INFORMATION FOR SEQ ID NO:18:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 10 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide(xi) SEQUENCE DESCRIPTION: SEQ ID NO:18:PheGlnGluGlyPheSerXaaValLeuXaa1510(2) INFORMATION FOR SEQ ID NO:19:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 14 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide(xi) SEQUENCE DESCRIPTION: SEQ ID NO:19:ThrSerProThrPheIleXaaMetSerGlnGluAsnValAsp1510(2) INFORMATION FOR SEQ ID NO:20:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 17 amino acids(B) TYPE: amino acid (D) TOPOLOGY: linear(ii) MOLECULE TYPE: peptide(xi) SEQUENCE DESCRIPTION: SEQ ID NO:20:LeuValValGlyAlaProLeuGluValValAlaValXaaGlnThrGly151015Arg(2) INFORMATION FOR SEQ ID NO:21:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 9 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: peptide(xi) SEQUENCE DESCRIPTION: SEQ ID NO:21:LeuAspXaaLysProXaaAspThrAla15(2) INFORMATION FOR SEQ ID NO:22:(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 7 amino acids(B) TYPE: amino acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: peptide(xi) SEQUENCE DESCRIPTION: SEQ ID NO:22:PheGlyGluGlnPheSerGlu15(2) INFORMATION FOR SEQ ID NO:23:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 21 base pairs (B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA(xi) SEQUENCE DESCRIPTION: SEQ ID NO:23:RAANCCYTCYTGRAAACTYTC21(2) INFORMATION FOR SEQ ID NO:24:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 1006 base pairs (B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: cDNA(xi) SEQUENCE DESCRIPTION: SEQ ID NO:24:TTCAACCTGGACGTGGAGGAGCCCATGGTGTTCAAGAGGATGGAGCTGGCTTTGGACAGA60GCGTGGCCCAGCTTGGCGGATCTAGACTCGTGGTGGGAGCCC CCCTGGAGGTGGTGGCGG120TCAACCAAACAGGAAGGTTGTATGACTGTGTGGCTGCCACTGGCCTTGTCAACCCATACC180CCTGCACACACCCCCAGATGCTGTGAACATGTCCCTGGGTCTGTCCCTGTCAGCCGCCGC240CAGTCGCCCCTGGCTGCTGG CCTGTGGCCCAACCATGCACAGAGCCTGTGGGGAGAATAT300GTATGCAGAAGGCTTTTGCCTCCTGTTGGACTCCCATCTGCAGACCATTTGGACAGTACC360TGCTGCCCTACCAGAGTGTCCAAGTCAAGAGATGGACATTGTCTTCCTGATTGATGGTTC42 0TGGCAGTATGAGCAAAGTGACTTTAAACAAATGAAGGATTTGTGAGAGCTGTGATGGGAC480AGTTTGAGGGCACCCAAACCCTGTTCTCACTGATACAGTATCCCACCTCCCTGAAGATCC540ACTTCACCTTCACGCAATTCCAGAGCAGCTGGAACCCTCTGA GCCTGGTGGATCCCATTG600TCCAACTGGACGGCCTGACATATACAGCCACGGGCATCCGGAAAGTGGTGGAGGAACTGT660TTCATAGTAAGAATGGGGCCCGTAAAAGTGCCAAGAAGATCCTCATTGTCATCACAGATG720GCAAAAATACAAAGACCCCC TGGAGTACGAGGACGTATCCCCAGGCAGAGAGAGCGGATC780ATCCGCTATGCCATTGGGGTGGGAGATGCTTTCTGGAAACCCAGTGCCAAGCAGGAGCTG840GACAACATTGGCTCAGAGCCGGCTCAGGACCATGTGTTCAGGGTGGACAACTTTGCAGCA90 0CTCAGCAGCATCCAGGAGCAGCTGCAGGAGAAGATCTTTGCACTCGAAGGAACCCAGTCG960ACGACAAGTAGCTCTTTCCAACATGAGATGTTCCAAGAAGGGTTCA1006(2) INFORMATION FOR SEQ ID NO:25:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 17 base pairs (B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA(xi) SEQUENCE DESCRIPTION: SEQ ID NO:25:GTNTTYCARGARGAYGG17(2) INFORMATION FOR SEQ ID NO:26:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 20 base pairs (B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA(xi) SEQUENCE DESCRIPTION: SEQ ID NO:26:CCACTGTCAGGATGCCCGTG20(2) INFORMATION FOR SEQ ID NO:27:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 42 base pairs (B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA(xi) SEQUENCE DESCRIPTION: SEQ ID NO:27:AGTTACGAATTCGCCACCATGGCTCTACGGGTGCTTCTTCTG42(2) INFORMATION FOR SEQ ID NO:28:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 42 base pairs (B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA(xi) SEQUENCE DESCRIPTION: SEQ ID NO:28:AGTTACGAATTCGCCACCATGACTCGGACTGTGCTTCTTCTG42(2) INFORMATION FOR SEQ ID NO:29:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 36 base pairs (B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA(xi) SEQUENCE DESCRIPTION: SEQ ID NO:29:AGTTACGAATTCGCCACCATGACCTTCGGCACTGTG36

Claims

1. A purified and isolated .alpha..sub.d polynucleotide consisting of the human .alpha..sub.d protein coding sequence set out in SEQ ID NO: 1.

2. The polynucleotide of claim 1 which is a DNA molecule.

3. The DNA molecule of claim 2 which is a cDNA molecule.

4. The DNA molecule of claim 2 which is a genomic DNA molecule.

5. The DNA molecule of claim 2 which is a wholly or partially chemically synthesized DNA molecule.

6. A full length purified and isolated .alpha..sub.d encoding polynucleotide selected from the group consisting of:

a) the human DNA sequence set out in SEQ ID NO: 1, and

b) a DNA molecule which hybridizes under stringent conditions to the protein coding portion of the DNA of a).

7. A DNA molecule encoding the human .alpha..sub.d amino acid sequence set out in SEQ ID NO: 2.

8. A DNA expression construct comprising a DNA molecule according to claim 2.

9. A host cell transformed with a DNA molecule according to claim 2.