Patent Application
20230043907
The disclosure relates to the field of genetic engineering, and specifically to a genetically-modified non-human animal, especially a rodent, such as a genetically-modified mouse. Specifically, the disclosure relates to a genetically-modified mouse containing a human interleukin 17A (IL-17A) gene, a human17RA (IL-17RA) gene and/or a human TNF-alpha gene, and a method for producing the same, and a use thereof.
This application contains a sequence listing that has been submitted electronically in XML format and is hereby incorporated by reference in its entirety. Said XML file is named 44835-0066002_SL_ST26.XML. The XML file, created on Jul. 27, 2022, is 148,545 bytes in size.
Interleukin (IL) 17 (IL17 or IL-17) family is a class of characteristic cytokine, which is mainly secreted by activated T cells. Six members of the IL-17 family have been discovered, namely IL-17A, IL-17B, IL-17C, IL-17D, IL-17E (also known as IL-25) and IL-17F. IL-17 receptors (IL17R or IL-17R) have also been grouped into a unique family, which included 5 homologous member subunits presently, namely IL-17RA, IL-17RB, IL-17RC, IL-17RD and IL-17RE. IL-17 binds to the receptor to activate the downstream signaling pathways (including MAP kinase pathway, NF-kB pathway, mRNA stabilization signaling pathway, ERK signaling pathway and JAK/STAT signaling pathway), and then stimulates a variety of cells to produce inflammatory mediators. It has become a key participant in immune and inflammatory diseases, and may lead to organ-specific or systemic autoimmune diseases.
A large number of studies have shown that a variety of autoimmune diseases (such as multiple sclerosis, asthma, inflammatory bowel disease, psoriasis, and rheumatoid arthritis) have high levels of IL-17 expression. In addition, IL-17 is also closely related to the occurrence and development of a variety of autoimmune diseases, including Crohn's disease, Behcet's disease, systemic lupus erythematosus, primary Sjogren's syndrome, multiple sclerosis, myocarditis, type I diabetes, thyroiditis, atopic dermatitis, hypersensitivity, rheumatoid arthritis, graft versus host disease and psoriasis. In addition, IL-17 is also expressed in a variety of tumor tissues. IL-17 is capable of cooperating with TNF-α, LTα, IFNγ and IL-1β to enhance inflammation. Deficiency of IL-17 and IL-17R leads to the reduction of allergen-specific immune response and autoimmune inflammation. Blocking the biological activity of IL-17 in vivo by specific antibodies has shown significant clinical effects. At present, the US FDA has approved three human IL-17/IL-17R-related antibodies, including IL-17A monoclonal antibody Secukinumab, Ixekizumab and IL-17RA monoclonal antibody Brodalumab, which are mainly used for moderate to severe plaque psoriasis. However, these agents have obvious side effects, such as infections, diarrhea, etc., and Brodalumab is found associated with patients' suicidal tendency. Many drugs targeting this signaling pathway are or have entered clinical research. Considering that most of the existing drugs for the treatment of autoimmune diseases can only ameliorate the symptoms of the diseases and are far from fully meeting the clinical needs, more drugs targeting IL-17/IL-17R still need to be developed. Experimental animal disease models are indispensable research tools for studying the etiology and pathogenesis of human diseases, developing prevention and treatment technologies and drugs. Because the amino acid sequences of human IL-17 and IL-17 receptor family are significantly different from the corresponding protein in rodents, for example, the identity of human IL-17A and mouse IL-17A protein sequence is only 60%, so antibodies that recognize human IL-17A protein usually cannot recognize mouse IL-17A, that is, regular mice cannot be used to screen and evaluate the effectiveness of drugs targeting the IL-17/IL-17R signaling pathway. In view of the wide participation of IL-17/IL-17R in the process of diseases and the great application value of targeting this signaling pathway, in order to make pre-clinical trials more effective and minimize R&D failures, there is an urgent need in the field to develop non-human animal models expressing humanized proteins associated with IL-17/IL-17R signaling pathway.
Unless otherwise specified, the practice of this disclosure will adopt the traditional techniques of cell biology, cell culture, molecular biology, genetically-modified biology, recombinant DNA and immunology. These techniques are descripted in detail in the following documents. For example: Molecular Cloning A Laboratory Manual, 2nd Ed., ed. By Sambrook, Fritsch and Maniatis (Cold Spring Harbor Laboratory Press: 1989); DNA Cloning, Volumes I and II (D. N. Glovered., 1985); Oligonucleotide Synthesis (M. J. Gaited., 1984); Mullisetal. U.S. Pat. No. 4,683,195; Nucleic Acid Hybridization (B. D. Hames & S. J. Higginseds.1984); Transcription And Translation (B. D. Hames&S. J. Higginseds.1984); Culture Of Animal Cells (R. I. Freshney AlanR. Liss, Inc., 1987); Immobilized Cells And Enzymes (IRL Press, 1986); B. Perbal, APractical Guide To Molecular Cloning(1984); the series, Methods In ENZYMOLOGY (J. Abelson and M. Simon, eds.—in-chief, Academic Press, Inc., New York), Vols. 154 and 155 (Wu etal. eds.) and Vol. 185, “Gene Expression Technology” (D. Goeddel, ed.); Gene Transfer Vectors For Mammalian Cells (J. H. Miller and M. P. Caloseds., 1987, Cold Spring Harbor Laboratory); Immunochemical Methods In Cell And Molecular Biology (Mayer and Walker, eds., Academic Press, London, 1987); Handbook Of Experimental Immunology, Volumes V (D. M. Weir and C. C. Blackwell, eds., 1986); and Manipulating the Mouse Embryo, (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1986).
Cytokine interleukin 17 (IL17 or IL-17) family is a class of characteristic cytokine, which is mainly secreted by activated T cells. Six members of the IL-17 family have been discovered, namely IL-17A, IL-17B, IL-17C, IL-17D, IL-17E (also known as IL-25) and IL-17F. Members of the IL-17 family have low sequence similarity with any other known cytokines, and the sequence similarity among the members of the family is also relatively low. For example, IL-17F has the highest homology with IL-17A (55%), and is usually co-expressed with IL-17A; the sequences of IL-17B, IL-17D and IL-17C overlap with that of IL-17A by 29% to 23%; and IL-17E seems to be the most different member of the family, with only 16% sequence homology (Gaffen S L, Nat. Rev. Immunol. 2009 August; 9(8):556-67). IL-17 receptors (IL-17R or IL17R) have also been grouped into a unique family, including 5 homologous subunits presently, namely IL-17RA, IL-17RB, IL-17RC, IL-17RD and IL-17RE, in which IL-17RB, -RC, -RD, -RE have homology with the earliest discovered IL-17RA. IL-17 binds to the receptor to activate the downstream signaling pathways (including MAP kinase pathway, NF-kB pathway, mRNA stabilization signaling pathway, ERK signaling pathway and JAK/STAT signaling pathway), and stimulates a variety of cells to produce inflammatory mediators. It has become a key participant in immune and inflammatory diseases, and may lead to organ-specific or systemic autoimmune diseases.
IL17 receptors are type I transmembrane proteins. Among them, IL-17RA is ubiquitously expressed; IL-17RB dominant expresses on the surface of a type of NKT cells that mediate airway allergic reactions; IL-17RC only expresses in stromal cells and non-hematopoietic cells, but not in thymus and leukocytes; IL-17RD mainly expresses in endothelial cells, epithelial cells and smooth muscle cells; the cells expressing IL-17RE are not yet clear, and some studies have shown that the colon cells and kidney cells of mice might express IL-17RE. The IL-17 family members all contain cysteine knot formed by 4 cysteines and 2 serines. Except for IL-17B, the IL-17 family members all form dimer. IL-17A and IL-17F can exist as homodimer or form heterodimer with each other, which binds to the receptor heterodimer formed by IL-17RA and IL-17RC to initiate the downstream signal transduction pathway. The dimer of IL-17A or IL-17F first binds to one of the receptors, IL17-RA and IL17-RC, and after binding, the unbound monomer in the dimer exhibits a decreased affinity for the previously bound receptor, causing the remaining monomer to only bind to another type of receptor. In mice, this is a little difference. Although murine IL-17RA can bind murine IL-17A and IL17-F, murine IL-17RC can only bind IL-17F. At present, it is not fully understood which ligand each IL-17R binds to (see Table 1), but studies have suggested that the ubiquitously expressed IL-17RA may be a signal transduction subunit shared by all IL-17 family members. According to different activated cells, IL-17RA signal can induce the synthesis of a variety of molecules, such as cytokines, chemokines, antimicrobial peptides, mucins, etc. IL-17RA-deficient mice are resistant to a variety of inflammatory diseases, such as rheumatoid arthritis, multiple sclerosis (MS), and asthma, but are also prone to infections by multiple pathogens, such as Toxoplasma gondii and Candida albicans. In addition, both human IL-17A and human IL-17F can cause the production of chemokine ligand (CXCL) 1 in murine cells, suggesting that there is no species specificity. However, hIL-17AR alone cannot initiate signaling pathways in IL-17RA−/− mouse fibroblasts, suggesting that hIL-17AR and hIL-17RC are species-specific.
Because the amino acid sequence of human IL-17 family and IL-17 receptor family are significantly different from the corresponding proteins in rodents, for example, the identity of human IL-17A and mouse IL-17A protein sequences is only 60%, antibodies that recognize human IL-17A protein usually cannot recognize mouse IL-17A, that is, regular mice cannot used to screen and evaluate the effectiveness of drugs targeting the IL-17/IL17R signaling pathway.
Genetically-Modified Non-Human Animal
The disclosure solves the above technical problems by constructing a genetically-modified non-human animal, such as a genetically-modified mouse containing a sequence of human IL-17A gene and/or IL-17RA gene in the genome.
Accordingly, in one aspect, the disclosure relates to a genetically-modified non-human animal containing a sequence of the human IL-17A gene in an expressible form in the genome.
As used herein, a gene in an “expressible form” means that the gene is expressed in animal or animal cells under the control of a promoter that can function in the animal or animal cells. The promoter is not particularly limited as long as it functions in the animal or animal cells into which the gene has been introduced. The promoter may be a promoter derived from the animal or animal cell, or a heterologous promoter. The promoter may also be a natural promoter of the gene to be introduced or a promoter of another gene.
In some embodiments, the sequence of the corresponding endogenous sequence in the genome of the animal is replaced with the human IL-17A gene. In some embodiments, at least 1, at least 2, or all 3 of exons 1-3 of the human IL-17A gene, in a whole or partially, are used to replace the corresponding endogenous sequences in the genome of the animal.
The term “corresponding” as used herein refers to a method used to determine the corresponding nucleotide/amino acid sequence corresponding to a certain nucleotide/amino acid sequence. For example, for the purpose of the disclosure, when referring to a certain nucleotide/amino acid sequence, those skilled in the art can compare another nucleotide/amino acid sequence with the reference sequence, so as to determine which sequence in the another nucleotide/amino acid sequence is the nucleotide/amino acid sequence corresponding to the reference nucleotide/amino acid sequence.
In some embodiments, the animal expresses human IL-17A protein. For example, the human IL-17A protein may comprise an amino acid sequence with at least 80% sequence identity, such as at least 85%, at least 90%, at least 95%, at least 98% or at least 99% sequence identity with SEQ ID NO: 4, or comprises or consists of SEQ ID NO: 4.
In some embodiments, the sequence of the human IL-17A gene comprises the coding sequence of the human IL-17A gene. In some embodiments, the sequence of the human IL-17A gene comprises the sequence from the start codon to the stop codon of the human IL-17A gene.
In some embodiments, the sequence of the human IL-17A gene comprises a nucleotide sequence with at least 80% sequence identity, such as at least 85%, at least 90%, at least 95%, at least 98% or at least 99% sequence identity with SEQ ID NO: 7. In a preferred embodiment, the sequence of the human IL-17A gene comprises or consists of SEQ ID NO: 7.
The correlation between two amino acid sequences or between two nucleotide sequences is described by the parameter “sequence identity”.
In some embodiments of the above genetically-modified non-human animal, the animal is homozygous for the human IL-17A gene sequence or a fragment thereof. In other embodiments, the animal is heterozygous for the human IL-17A gene sequence or a fragment thereof.
Individuals of a biological population or species usually include multiple alleles at each locus. An exogenous allele is an allele introduced into an organism, while an endogenous allele is an allele naturally present in the cell, and usually the one in the wild-type unmodified organism. Heterozygous animals have two types of allele. In some cases, it is desirable to introduce an exogenous allele to produce an animal that is homozygous for the allele, and the allele is already present in the heterozygous animal.
In some embodiments, in addition to the sequence of the human IL-17A gene in an expressible form, the genome of the genetically-modified animal may also comprises a sequence of the human IL-17RA gene in an expressible form and/or a sequence of the human TNF-α gene in an expressible form. In some embodiments, the animal may be homozygous or heterozygous for the sequence of the human IL-17RA gene and/or the sequence of the human TNF-α gene.
In some embodiments, the sequence of the human IL-17RA gene is used to replace the corresponding endogenous sequence in the genome of the animal. In some embodiments, at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, or all 11 of exons 1-11 of the human IL-17RA gene, in a whole or partially, are used to replace the corresponding endogenous sequences in the genome of the animal.
In some embodiments, the sequence of the human TNF-α gene is used to replace the corresponding endogenous sequence in the genome of the animal.
In some embodiments, the animal expresses human IL-17RA protein or humanized IL-17RA protein, and/or human TNF-α protein.
In some embodiments, the human IL-17RA protein comprises an amino acid sequence with at least 80% sequence identity, such as at least 85%, at least 90%, at least 95%, at least 98% or at least 99% sequence identity with SEQ ID NO: 32, or comprises or consists of SEQ ID NO: 32.
In some embodiments, the humanized IL-17RA protein comprises an amino acid sequence with at least 80% sequence identity, such as at least 85%, at least 90%, at least 95%, at least 98% or at least 99% sequence identity with amino acids 49-341 of SEQ ID NO: 32, or comprises or consists of amino acids 49-341 of SEQ ID NO: 32.
In some embodiments, the humanized IL-17RA protein comprises an amino acid sequence with at least 80% sequence identity, such as at least 85%, at least 90%, at least 95%, at least 98% or at least 99% sequence identity with SEQ ID NO: 39, or comprises or consists of SEQ ID NO: 39.
In some embodiments, the human TNF-α protein comprises an amino acid sequence with at least 80% sequence identity, such as at least 85%, at least 90%, at least 95%, at least 98% or at least 99% sequence identity with SEQ ID NO: 58, or comprises or consists of SEQ ID NO: 58.
In some embodiments, the sequence of the human IL-17RA gene comprises the coding sequence of the human IL-17RA gene. In other embodiments, the sequence of the human IL-17RA comprises the sequence from exon 2 to exon 11 of the human IL-17RA gene.
In some embodiments, the sequence of the human IL-17RA gene comprises a nucleotide sequence with at least 80% sequence identity, such as at least 85%, at least 90%, at least 95%, at least 98% or at least 99% sequence identity with SEQ ID NO: 35. In a preferred embodiment, the sequence of the human IL-17RA gene comprises or consists of SEQ ID NO: 35.
In some embodiments, the sequence of the human TNF-α gene comprises the coding sequence of the human TNF-α gene. In some embodiments, the sequence of the human TNF-α gene comprises the sequence from the start codon to the stop codon of the human TNF-α gene.
In some embodiments, the sequence of the human TNF-α gene comprises a nucleotide sequence with at least 80% sequence identity, such as at least 85%, at least 90%, at least 95%, at least 98% or at least 99% sequence identity with SEQ ID NO: 61. In a preferred embodiment, the sequence of the human TNF-α gene comprises or consists of SEQ ID NO: 61.
In another aspect, the disclosure relates to a genetically-modified non-human animal comprising a sequence of the human IL-17RA gene in an expressible form in the genome of the animal.
In some embodiments, the sequence of the human IL-17RA gene is used to replace the corresponding endogenous sequence in the genome of the animal.
In some embodiments, the animal expresses human IL-17RA protein. In other embodiments, the animal expresses humanized IL-17RA protein.
In some embodiments, the human IL-17RA protein comprises an amino acid sequence with at least 80% sequence identity, such as at least 85%, at least 90%, at least 95%, at least 98% or at least 99% sequence identity with SEQ ID NO: 32, or comprises or consists of SEQ ID NO: 32.
In some embodiments, the humanized IL-17RA protein comprises an amino acid sequence with at least 80% sequence identity, such as at least 85%, at least 90%, at least 95%, at least 98% or at least 99% sequence identity with amino acids 49-341 of SEQ ID NO: 32, or comprises or consists of amino acids 49-341 of SEQ ID NO: 32.
In some embodiments, the humanized IL-17RA protein comprises an amino acid sequence with at least 80% sequence identity, such as at least 85%, at least 90%, at least 95%, at least 98% or at least 99% sequence identity with SEQ ID NO: 39, or comprises or consists of SEQ ID NO: 39.
In some embodiments, the sequence of the human IL-17RA gene comprises the coding sequence of the human IL-17RA gene. In other embodiments, the sequence of the human IL-17RA comprises the sequence from exon 2 to exon 11 of the human IL-17RA gene.
In some embodiments, the sequence of the human IL-17RA gene comprises a nucleotide sequence with at least 80% sequence identity, such as at least 85%, at least 90%, at least 95%, at least 98% or at least 99% sequence identity with SEQ ID NO: 35. In a preferred embodiment, the sequence of the human IL-17RA gene comprises or consists of SEQ ID NO: 35.
In some embodiments, the animal is homozygous for the sequence of the human IL-17RA gene. In other embodiments, the animal is heterozygous for the sequence of the human IL-17RA gene.
In some embodiments, in addition to the sequence of the human IL-17RA gene in an expressible form, the genome of the genetically-modified animal may also comprise a sequence of the human TNF-α gene in an expressible form. The animal may be homozygous or heterozygous for the sequence of the human TNF-α gene.
In some embodiments, the sequence of the human TNF-α gene is used to replace the corresponding endogenous sequence in the genome of the animal.
In some embodiments, the human TNF-α protein comprises an amino acid sequence with at least 80% sequence identity, such as at least 85%, at least 90%, at least 95%, at least 98% or at least 99% sequence identity with SEQ ID NO: 58, or comprises or consists of SEQ ID NO: 58.
In some embodiments, the sequence of the human TNF-α gene comprises the coding sequence of the human TNF-α gene. In some embodiments, the sequence of the human TNF-α gene comprises the sequence from the start codon to the stop codon of the human TNF-α gene.
In some embodiments, the sequence of the human TNF-α gene comprises a nucleotide sequence with at least 80% sequence identity, such as at least 85%, at least 90%, at least 95%, at least 98% or at least 99% sequence identity with SEQ ID NO: 61. In a preferred embodiment, the sequence of the human TNF-α gene comprises or consists of SEQ ID NO: 61.
In any of the embodiments of the above genetically-modified non-human animal, the animal may be selected from mammals, such as non-primates, for example, livestock, pigs, cattle, sheep, goats, chickens, rabbits, fish, zebrafish, dogs, mice, cats, rats, and laboratory animals.
In some embodiments, the animal is a rodent, such as a mouse or a rat. In a preferred embodiment, the animal is a mouse.
Various strains of mice and rats are known in the art and can be used to produce genetically-modified non-human animals as described in the present application. For example, the mouse can be selected from the following strains:
C57BL strain, for example, selected from C57BL/A, C57BL/An, C57BL/GrFa, C57BL/KaLwN, C57BL/6, C57BL/6J, C57BL/6ByJ, C57BL/6NJ, C57BL/10, C57BL/10ScSn, C57BL/10Cr, C57BL/01a;
129 strain, for example, selected from 129P1, 129P2, 129P3, 129X1, 129S1 (e.g., 12951/SV, 12951/SvIm), 129S2, 129S4, 129S5, 12959/SvEvH, 129S6 (129/SvEvTac), 129S7, 129S8, 129T1, 129T2;
BALB strain, such as BALB/c; and
hybrids of the above strains, for example, 50% BALB/c-50% 12954/Sv; or 50% C57BL/6-50% 129.
The rat may be selected from the following strains: Wistar rat, LEA rat, Sprague Dawley rat, Fischer rat, F344, F6 and Dark Agouti, and hybrids of two or more of the above strains.
In another aspect, the disclosure relates to cells obtained from the above genetically-modified non-human animals. In some embodiments, the cells may be selected from somatic cells, stem cells such as embryonic stem cells, germ cells, and fertilized eggs.
In one aspect, the disclosure relates to a non-human animal cell comprising a sequence of the human IL-17A gene in an expressible form in the genome of the cell.
In some embodiments, the sequence of the human IL-17A gene is used to replace the corresponding endogenous sequence in the genome of the cell.
In some embodiments, the cell expresses human IL-17A protein. For example, the human IL-17A protein comprises an amino acid sequence with at least 80% sequence identity, such as at least 85%, at least 90%, at least 95%, at least 98% or at least 99% sequence identity with SEQ ID NO: 4, or comprises or consists of SEQ ID NO: 4.
In some embodiments, the sequence of the human IL-17A gene comprises the coding sequence of the human IL-17A gene. In some embodiments, the sequence of the human IL-17A gene comprises the sequence from the start codon to the stop codon of the human IL-17A gene.
In some embodiments, the sequence of the human IL-17A gene comprises a nucleotide sequence with at least 80% sequence identity, such as at least 85%, at least 90%, at least 95%, at least 98% or at least 99% sequence identity with SEQ ID NO: 7. In a preferred embodiment, the sequence of the human IL-17A gene comprises or consists of SEQ ID NO: 7.
In some embodiments, the cell is homozygous for the human IL-17A gene sequence or a fragment thereof. In other embodiments, the cell is heterozygous for the human IL-17A gene sequence or a fragment thereof.
In some embodiments, the genome of the cell also comprises a sequence of the human IL-17RA gene and/or a sequence of the human TNF-α gene in an expressible form.
In some embodiments, the sequence of the human IL-17RA gene and/or the sequence of the human TNF-α gene are used to replace the corresponding endogenous sequence in the genome of the cell.
In some embodiments, the cell expresses human IL-17RA protein or humanized IL-17RA protein, and/or human TNF-α protein.
In some embodiments, the human IL-17RA protein comprises an amino acid sequence with at least 80% sequence identity, such as at least 85%, at least 90%, at least 95%, at least 98% or at least 99% sequence identity with SEQ ID NO: 32, or comprises or consists of SEQ ID NO: 32.
In some embodiments, the humanized IL-17RA protein comprises an amino acid sequence with at least 80% sequence identity, such as at least 85%, at least 90%, at least 95%, at least 98% or at least 99% sequence identity with amino acids 49-341 of SEQ ID NO: 32, or comprises or consists of amino acids 49-341 of SEQ ID NO: 32.
In some embodiments, the humanized IL-17RA protein comprises an amino acid sequence with at least 80% sequence identity, such as at least 85%, at least 90%, at least 95%, at least 98% or at least 99% sequence identity with SEQ ID NO: 39, or comprises or consists of SEQ ID NO: 39.
In some embodiments, the human TNF-α protein comprises an amino acid sequence with at least 80% sequence identity, such as at least 85%, at least 90%, at least 95%, at least 98% or at least 99% sequence identity with SEQ ID NO: 58, or comprises or consists of SEQ ID NO: 58.
In some embodiments, the sequence of the human IL-17RA gene comprises the coding sequence of the human IL-17RA gene. In other embodiments, the sequence of the human IL-17RA gene comprises the sequence from exon 2 to exon 11 of the human IL-17RA gene.
In some embodiments, the sequence of the human IL-17RA gene comprises a nucleotide sequence with at least 80% sequence identity, such as at least 85%, at least 90%, at least 95%, at least 98% or at least 99% sequence identity with SEQ ID NO: 35. In a preferred embodiment, the sequence of the human IL-17RA gene comprises or consists of SEQ ID NO: 35.
In some embodiments, the sequence of the human TNF-α gene comprises the coding sequence of the human TNF-α gene. In some embodiments, the sequence of the human TNF-α gene comprises the sequence from the start codon to the stop codon of the human TNF-α gene.
In some embodiments, the sequence of the human TNF-α gene comprises a nucleotide sequence with at least 80% sequence identity, such as at least 85%, at least 90%, at least 95%, at least 98% or at least 99% sequence identity with SEQ ID NO: 61. In a preferred embodiment, the sequence of the human TNF-α gene comprises or consists of SEQ ID NO: 61.
In another aspect, the disclosure relates to a non-human animal cell a sequence of the human IL-17A gene in an expressible form in the genome of the cell.
In some embodiments, the sequence of the human IL-17RA gene is used to replace the corresponding endogenous sequence in the genome of the cell.
In some embodiments, the cell expresses human IL-17RA protein. In other embodiments, the cell expresses humanized IL-17RA protein.
In some embodiments, the human IL-17RA protein comprises an amino acid sequence with at least 80% sequence identity, such as at least 85%, at least 90%, at least 95%, at least 98% or at least 99% sequence identity with SEQ ID NO: 32, or comprises or consists of SEQ ID NO: 32.
In some embodiments, the humanized IL-17RA protein comprises an amino acid sequence with at least 80% sequence identity, such as at least 85%, at least 90%, at least 95%, at least 98% or at least 99% sequence identity with amino acids 49-341 of SEQ ID NO: 32, or comprises or consists of amino acids 49-341 of SEQ ID NO: 32.
In some embodiments, the humanized IL-17RA protein comprises an amino acid sequence with at least 80% sequence identity, such as at least 85%, at least 90%, at least 95%, at least 98% or at least 99% sequence identity with SEQ ID NO: 39, or comprises or consists of SEQ ID NO: 39.
In some embodiments, the sequence of the human IL-17RA gene comprises the coding sequence of the human IL-17RA gene. In other embodiments, the sequence of the human IL-17RA comprises the sequence from exon 2 to exon 11 of the human IL-17RA gene.
In some embodiments, the sequence of the human IL-17RA gene comprises a nucleotide sequence with at least 80% sequence identity, such as at least 85%, at least 90%, at least 95%, at least 98% or at least 99% sequence identity with SEQ ID NO: 35. In a preferred embodiment, the sequence of the human IL-17RA gene comprises or consists of SEQ ID NO: 35.
In some embodiments, the cell is homozygous for the sequence of the human IL-17RA gene. In other embodiments, the cell is heterozygous for the sequence of the human IL-17RA gene.
In some embodiments, in addition to the sequence of the human IL-17RA gene in an expressible form, the genome of the cell may also comprise a sequence of the human TNF-α gene in an expressible form. The cell may be homozygous or heterozygous for the sequence of the human TNF-α gene.
In some embodiments, the sequence of the human TNF-α gene is used to replace the corresponding endogenous sequence in the genome of the cell.
In some embodiments, the cell expresses human TNF-α protein. In some embodiments, the human TNF-α protein comprises an amino acid sequence with at least 80% sequence identity, such as at least 85%, at least 90%, at least 95%, at least 98% or at least 99% sequence identity with SEQ ID NO: 58, or comprises or consists of SEQ ID NO: 58.
In some embodiments, the sequence of the human TNF-α gene comprises the coding sequence of the human TNF-α gene. In some embodiments, the sequence of the human TNF-α gene comprises the sequence from the start codon to the stop codon of the human TNF-α gene.
In some embodiments, the sequence of the human TNF-α gene comprises a nucleotide sequence with at least 80% sequence identity, such as at least 85%, at least 90%, at least 95%, at least 98% or at least 99% sequence identity with SEQ ID NO: 61. In a preferred embodiment, the sequence of the human TNF-α gene comprises or consists of SEQ ID NO: 61.
In any of the above embodiments regarding non-human animal cells, the cells may be rodent cells, such as mouse or rat cells. The mice and rats may be any strain of mice and rats known in the art, for example, any strain of mice and rats described above.
In any of the above embodiments regarding non-human animal cells, the cells may be selected from somatic cells, stem cells such as embryonic stem cells, germ cells, and fertilized eggs.
In one aspect, the disclosure relates to the uses of the non-human animal cells of the disclosure in the production of a genetically-modified non-human animal.
In another aspect, the disclosure relates to uses of the genetically-modified non-human animal and non-human animal cells of the disclosure in screening agents for regulating IL-17A/IL-17RA signaling pathway.
In some embodiments, the agent may be selected from antibodies, antibody fragments, receptors or ligands or a fragment thereof, fusion proteins, and small molecule compounds.
In yet another aspect, the disclosure relates to uses of the genetically-modified non-human animal of the disclosure in constructing a disease model related to abnormal IL-17A/IL-17RA signaling pathway.
In some embodiments, the disease is selected from autoimmune diseases and tumors. In some embodiments, the disease may be selected from multiple sclerosis, asthma, inflammatory bowel disease, psoriasis, rheumatoid arthritis, Crohn's disease, Behcet's disease, systemic lupus erythematosus, primary Sjogren's syndrome, myocarditis, type I diabetes, thyroiditis, atopic dermatitis, hypersensitivity, and graft versus host disease.
In one aspect, the disclosure relates to uses of the IL-17A humanized animal of the disclosure in testing the in vivo effectiveness of an agent targeting human IL-17A.
In some embodiments, the agent is selected from an antibody or antibody fragment or a small molecule antagonist against human IL-17A.
In some embodiments, the genetically-modified non-human animal is used to construct a disease model related to abnormal IL-17A signaling pathway, and to test the in vivo effectiveness of the agent in the disease model.
In some embodiments, the disease model is an autoimmune disease model, for example selected from experimental autoimmune encephalomyelitis (EAE) model and psoriasis model. In some embodiments, the psoriasis model is an imiquimod-induced psoriasis model.
In another aspect, the disclosure relates to a method for detecting the in vivo effectiveness of an agent targeting human IL-17A, comprising:
a. constructing a disease model associated with abnormal IL-17A signaling pathway using the IL-17A humanized animals of the disclosure;
b. administering the agent targeting human IL-17A to the disease model animal; and
c. evaluating the in vivo effectiveness of the agent targeting IL-17A.
In some embodiments, the agent is selected from an antibody or antibody fragment and a small molecule antagonist against human IL-17A.
In some embodiments, the disease model is an autoimmune disease model, for example selected from experimental autoimmune encephalomyelitis (EAE) model and psoriasis model. In some embodiments, the psoriasis model is an imiquimod-induced psoriasis model.
In one aspect, the disclosure relates to a targeting vector comprising the coding sequence or the sequence from the start codon to the stop codon of the human IL-17A gene, and the upstream and downstream homologous arm sequences of the mouse IL-17A gene.
As used herein, the term “targeting vector” refers to a vector that can be integrated into the genome of a host cell after being introduced into the host cell, thereby replicating together with the host genome. Generally, expression vectors useful in recombinant DNA technology are usually in the form of plasmids. However, the disclosure is intended to include other forms of expression vectors, such as viral vectors (e.g., replication defective retroviruses, adenoviruses, and adeno-associated viruses), which perform equivalent functions.
In some embodiments, the sequence of the human IL-17A gene comprises a nucleotide sequence with at least 80% sequence identity, such as at least 85%, at least 90%, at least 95%, at least 98% or at least 99% sequence identity with SEQ ID NO: 7. In a preferred embodiment, the sequence of the human IL-17A gene comprises or consists of SEQ ID NO: 7.
In some embodiments, each of the upstream and downstream homology arm sequences of the mouse IL-17A gene comprises at least 100 nucleotides, for example at least 200 nucleotides, at least 300 nucleotides, at least 500 nucleotides, at least 1,000 nucleotides, at least 2,000 nucleotides, or at least 3,000 nucleotides, such as 100-500 nucleotides, 500-1,000 nucleotides, 1,000-2,000 nucleotides, 2,000-3,000 nucleotides, 3,000-5,000 nucleotides or 5,000-10,000 nucleotides. Preferably, each of the upstream and downstream homology arm sequences of the mouse IL-17RA gene comprises 3,000 to 5,000 nucleotides.
In a preferred embodiment, the upstream homology arm sequence of the mouse IL-17A gene comprises SEQ ID NO: 5, and the downstream homology arm sequence of the mouse IL-17A gene comprises SEQ ID NO: 6.
In another aspect, the disclosure relates to a targeting vector comprising the coding sequence or the sequence from exon 2 to exon 11 of the human IL-17RA gene, and the upstream and downstream homologous arm sequences of the mouse IL-17RA gene.
In some embodiments, the sequence of the human IL-17RA gene comprises a nucleotide sequence with at least 80% sequence identity, such as at least 85%, at least 90%, at least 95%, at least 98% or at least 99% sequence identity with SEQ ID NO: 31 or SEQ ID NO: 35. In a preferred embodiment, the sequence of the human IL-17RA gene comprises or consists of SEQ ID NO: 35.
In some embodiments, each of the upstream and downstream homology arm sequences of the mouse IL-17RA gene comprises at least 100 nucleotides, for example at least 200 nucleotides, at least 300 nucleotides, at least 500 nucleotides, at least 1,000 nucleotides, at least 2,000 nucleotides, or at least 3,000 nucleotides, such as 100-500 nucleotides, 500-1,000 nucleotides, 1,000-2,000 nucleotides, 2,000-3,000 nucleotides, 3,000-5,000 nucleotides or 5,000-10,000 nucleotides. Preferably, each of the upstream and downstream homology arm sequences of the mouse IL-17RA gene comprises 3,000 to 5,000 nucleotides.
In a preferred embodiment, the upstream homology arm sequence of the mouse IL-17RA gene comprises SEQ ID NO: 33, and the downstream homology arm sequence of the mouse IL-17RA gene comprises SEQ ID NO: 34.
In yet another aspect, the disclosure relates to a targeting vector comprising the coding sequence or the sequence from the start codon to the stop codon of the human TNF-α gene and the upstream and downstream homology arm sequences of the mouse TNF-α gene.
In some embodiments, the targeting vector comprises the sequence from the start codon to the stop codon of the human TNF-α gene and the upstream and downstream homology arm sequences of the mouse TNF-α gene.
In some embodiments, the sequence of the human TNF-α gene comprises a nucleotide sequence with at least 80% sequence identity, such as at least 85%, at least 90%, at least 95%, at least 98% or at least 99% sequence identity with SEQ ID NO: 61. In a preferred embodiment, the sequence of the human TNF-α gene comprises or consists of SEQ ID NO: 61.
In some embodiments, each of the upstream and downstream homology arm sequences of the mouse TNF-α gene comprises at least 100 nucleotides, for example at least 200 nucleotides, at least 300 nucleotides, at least 500 nucleotides, at least 1,000 nucleotides, at least 2,000 nucleotides, or at least 3,000 nucleotides, such as 100-500 nucleotides, 500-1,000 nucleotides, 1,000-2,000 nucleotides, 2,000-3,000 nucleotides, 3,000-7,000 nucleotides or 7,000-10,000 nucleotides. Preferably, each of the upstream and downstream homology arm sequences of the mouse TNF-α gene comprises 3,000 to 7,000 nucleotides.
In a preferred embodiment, the upstream homology arm sequence of the mouse TNF-α gene comprises SEQ ID NO: 59, and the downstream homology arm sequence of the mouse TNF-α gene comprises SEQ ID NO: 60.
In any embodiment regarding a targeting vector, the targeting vector may further comprise a resistance gene for positive screening. In some embodiments, the resistance gene is the coding sequence of neomycin phosphotransferase.
It is usually beneficial to avoid reporter genes because there is no need remove them later. However, the expression of the reporter gene at the embryo/modification stage at cell level allows the exclusion of cells that do not express the reporter gene. Alternatively, it allows the selection of cells expressing the reporter gene for use in animals by cloning or by other genetically-modified animal technology, or for being transferred to a second culture for further cultivation and/or number expansion and/or addition of other vectors and/or nucleic acids and/or other genetic modifications. Selecting cells based on the expression of reporter gene which does not depend on the gene of interest is a co-selection method. The term reporter gene, as used herein, includes reporter genes and selectable markers. The term selectable marker, as used herein, refers to genetically expressed biomolecules that allow separation by selection criteria for positive or negative survival. The reporter gene may be, for example, a fluorescent marker such as green fluorescent protein and yellow fluorescent protein. The reporter gene may be a selectable marker, such as puromycin, ganciclovir, adenosine deaminase (ADA), aminoglycoside phosphotransferase (neo, G418, APH), dihydrofolate reductase (DHFR), Hygromycin-B-phosphotransferase, thymidine kinase (TK), or xanthine-guanine phosphoribosyltransferase (XGPRT). For example, cells can be removed from culture and used for cloning. Alternatively, cells can be removed from the culture and placed in a second culture to establish a clony or use in further experiments. Alternatively, embryos or fertilized eggs expressing the reporter gene can be used for implantation into surrogate animals or for cloning, while other embryos or fertilized eggs that do not express the reporter gene are not used for cloning. In some embodiments, the reporter gene is a selectable marker, which is used to select cells or embryos expressing the marker.
In some embodiments, the targeting vector further includes a marker gene for negative screening. In some embodiments, the marker gene is the coding sequence of diphtheria toxin A subunit.
In any embodiment regarding the targeting vector, the vector can be used to replace the corresponding endogenous gene sequence in the mouse genome.
In yet another aspect, the disclosure relates to uses of the targeting vector of the disclosure in replacing the corresponding endogenous gene sequence in the mouse genome.
In another aspect, the disclosure relates to uses of the targeting vector of the disclosure in constructing a genetically-modified mouse or a genetically-modified mouse cell.
In one aspect, the disclosure relates to a method for producing a genetically-modified non-human animal containing a sequence of the human IL-17A gene, comprising inserting the sequence of the human IL-17A gene into the genome of the animal.
In some embodiments, the sequence of the human IL-17A gene is used to replace the corresponding endogenous sequence in the genome of the animal.
In some embodiments, the animal is a rodent, such as a mouse.
In some embodiments, the method comprises the following steps:
a. providing the targeting vector comprising the coding sequence or the sequence from the start codon to the stop codon of the human IL-17A gene, and the upstream and downstream homologous arm sequences of the mouse IL-17A gene of the disclosure;
b1. injecting the targeting vector into a fertilized egg of a mouse;
c1. transplanting the fertilized egg into a surrogate mother mouse and breeding, to obtain the genetically-modified mouse; or
b2. injecting the targeting vector into an embryonic stem cell of a mouse;
c2. generating the genetically-modified mouse by the embryonic stem cell.
Methods for preparing colonies from cultured cells are known. One of such method involves dispersing cells from a first culture into a second culture, in which individual cells do not contact each other, for example, by diluting the cells into a multi-well plate, or into a dish having a relatively large surface area relative to the number of total cells in the dish. The cells are cultured for a period of time to proliferate. Proliferating cells are cultured under conditions in which they are unlikely to move far from their original location. As a result, after a period of time, the user can observe the cells and see the individual colonies established by single cell and its progeny. It is possible to sample a subset of cells in a colony without disturbing other cells in the colony.
In some embodiments, step c2 comprises introducing the embryonic stem cell into an isolated blastocyst, and transplanting the obtained chimeric blastocysts into a surrogate mother mouse, and breeding to obtain the genetically-modified mouse.
In some embodiments, the method further comprises the step of detecting the offspring of the surrogate mother mouse to screen genetically-modified mouse containing the sequence of the human IL-17A gene sequence in the genome.
In some embodiments, the method further comprises the step of crossing the genetically-modified mice to obtain a mouse homozygous for the sequence of the human IL-17A gene.
In another aspect, the disclosure relates to a method of producing a genetically-modified animal containing a sequence of the human IL-17RA gene, comprising inserting the sequence of the human IL-17RA gene into the genome of the animal.
In some embodiments, the sequence of the human IL-17RA gene is used to replace the corresponding endogenous sequence in the genome of the animal.
In some embodiments, the method comprises the following steps:
a. providing a targeting vector comprising the coding sequence or the sequence from exon 2 to exon 11 of the human IL-17RA gene, and the upstream and downstream homologous arm sequences of the mouse IL-17RA gene;
b1. injecting the targeting vector into a fertilized egg of a mouse;
c1. transplanting the fertilized egg into a surrogate mother mouse and breeding, to obtain the genetically-modified mouse; or
b2. injecting the targeting vector into an embryonic stem cell of a mouse;
c2. generating the genetically-modified mouse by the embryonic stem cell.
In some embodiments, step c2 comprises introducing the embryonic stem cell into an isolated blastocyst, and transplanting the obtained chimeric blastocysts into a surrogate mother mouse, and breeding to obtain the genetically-modified mouse.
In some embodiments, the method further comprises the step of detecting the offspring of the surrogate mother mouse to screen genetically-modified mice containing the sequence of the human IL-17RA gene sequence in the genome.
In some embodiments, the method further comprises the step of crossing the genetically-modified mice to obtain a mouse homozygous for the sequence of the human IL-17RA gene.
In another aspect, the disclosure relates to a method for producing a genetically-modified non-human animal containing a sequence of the human TNF-α gene, comprising inserting the sequence of the human TNF-α gene into the genome of the animal.
In some embodiments, the sequence of the human TNF-α gene is used to replace the corresponding endogenous sequence in the genome of the animal.
In some embodiments, the method comprises the following steps:
a. providing a targeting vector comprising the coding sequence or the sequence from the start codon to the stop codon of the human TNF-α gene and the upstream and downstream homology arm sequences of the mouse TNF-α gene.
b1. injecting the targeting vector into a fertilized egg of a mouse;
c1. transplanting the fertilized egg into a surrogate mother mouse and breeding, to obtain the genetically-modified mouse; or
b2. injecting the targeting vector into an embryonic stem cell of a mouse;
c2. generating the genetically-modified mouse by the embryonic stem cell.
In some embodiments, step c2 comprises introducing the embryonic stem cell into an isolated blastocyst, and transplanting the obtained chimeric blastocysts into a surrogate mother mouse, and breeding to obtain the genetically-modified mouse.
In some embodiments, the method further comprises the step of detecting the offspring of the surrogate mother mouse to screen genetically-modified mice containing the sequence of the human TNF-α gene in the genome.
In some embodiments, the method further comprises the step of crossing the genetically-modified mice to obtain a mouse homozygous for the sequence of the human TNF-α gene.
In any embodiment of the above methods, the animal may be a rodent, such as a rat or a mouse. In a preferred embodiment, the animal is a mouse.
The present disclosure also includes a genetically-modified non-human animal, such as a genetically-modified mouse, comprising a sequence of the human IL-17A gene, a sequence of the human IL-17RA gene, or a sequence of the human TNF-α gene, produced by the method of the disclosure.
In another aspect, the disclosure relates to a method for producing a genetically-modified non-human animal, such as a genetically-modified mouse, containing a sequence of the human IL-17A gene and a sequence of the human IL-17RA gene, comprising crossing a genetically-modified non-human animal, such as a genetically-modified mouse, having a sequence of the human IL-17A gene and a genetically-modified non-human animal, such as a genetically-modified mouse, having a sequence of the human IL-17RA gene of the disclosure.
In another aspect, the disclosure relates to a method for producing a genetically-modified non-human animal, such as a genetically-modified mouse, containing a sequence of the human IL-17A gene and a sequence of the human TNF-α gene, comprising crossing a genetically-modified non-human animal, such as a genetically-modified mouse, having a sequence of the human IL-17A gene and a genetically-modified non-human animal, such as a genetically-modified mouse, having a sequence of the human TNF-α gene of the disclosure.
In another aspect, the disclosure relates to a method for producing a genetically-modified non-human animal, such as a genetically-modified mouse, containing a sequence of the human IL-17RA gene and a sequence of the human TNF-α gene, comprising crossing a genetically-modified non-human animal, such as a genetically-modified mouse, having a sequence of the human IL-17RA gene and a genetically-modified non-human animal, such as a genetically-modified mouse, having a sequence of the human TNF-α gene of the disclosure.
In another aspect, the disclosure relates to a method for producing a genetically-modified non-human animal, such as a genetically-modified mouse, containing a sequence of the human IL-17A gene, a sequence of the human IL-17RA gene, and a sequence of the human TNF-α gene, comprising crossing a genetically-modified non-human animal, such as a genetically-modified mouse, having a sequence of the human IL-17A gene, a genetically-modified non-human animal, such as a genetically-modified mouse, having a sequence of the human IL-17RA gene, and a genetically-modified non-human animal, such as a genetically-modified mouse, having a sequence of the human TNF-α gene of the disclosure.
In yet another aspect, the disclosure relates to a method for producing a genetically-modified non-human animal, such as a genetically-modified mouse, having a sequence of the human IL-17A gene and a sequence of the human IL-17RA gene, comprising
a1. providing a fertilized egg or an embryonic stem cell obtained from a genetically-modified non-human animal, such as a genetically-modified mouse, having a sequence of the human IL-17A gene of the disclosure;
b1. in the fertilized egg or embryonic stem cell, inserting a sequence of the human IL-17RA gene into the genome of the genetically-modified non-human animal, such as the genetically-modified mouse, by the method of the disclosure, thereby generating a genetically-modified mouse comprising a sequence of the human IL-17A gene and a sequence of the human IL-17RA gene; or
a2. providing a fertilized egg or an embryonic stem cell obtained from a genetically-modified non-human animal, such as a genetically-modified mouse, having a sequence of the human IL-17RA gene of the disclosure;
b2. in the fertilized egg or embryonic stem cell, inserting a sequence of the human IL-17A gene into the genome of the genetically-modified non-human animal, such as the genetically-modified mouse, by the method of the disclosure, thereby generating a genetically-modified mouse comprising a sequence of the human IL-17A gene and a sequence of the human IL-17RA gene.
In yet another aspect, the disclosure relates to a method for producing a genetically-modified non-human animal, such as a genetically-modified mouse, having a sequence of the human IL-17A gene and a sequence of the human TNF-α gene, comprising
a1. providing a fertilized egg or an embryonic stem cell obtained from a genetically-modified non-human animal, such as a genetically-modified mouse, having a sequence of the human IL-17A gene of the disclosure;
b1. in the fertilized egg or embryonic stem cell, inserting a sequence of the human TNF-α gene into the genome of the genetically-modified non-human animal, such as the genetically-modified mouse, by the method of the disclosure, thereby generating a genetically-modified mouse comprising a sequence of the human IL-17A gene and a sequence of the human TNF-α gene; or
a2. providing a fertilized egg or an embryonic stem cell obtained from a genetically-modified non-human animal, such as a genetically-modified mouse, having a sequence of the human TNF-α gene of the disclosure;
b2. in the fertilized egg or embryonic stem cell, inserting a sequence of the human IL-17A gene into the genome of the genetically-modified non-human animal, such as the genetically-modified mouse, by the method of the disclosure, thereby generating a genetically-modified mouse comprising a sequence of the human IL-17A gene and a sequence of the human TNF-α gene.
In yet another aspect, the disclosure relates to a method for producing a genetically-modified non-human animal, such as a genetically-modified mouse, having a sequence of the human IL-17RA gene and a sequence of the human TNF-α gene, comprising
a1. providing a fertilized egg or an embryonic stem cell obtained from a genetically-modified non-human animal, such as a genetically-modified mouse, having a sequence of the human IL-17RA gene of the disclosure;
b1. in the fertilized egg or embryonic stem cell, inserting a sequence of the human TNF-α gene into the genome of the genetically-modified non-human animal, such as the genetically-modified mouse, by the method of the disclosure, thereby generating a genetically-modified mouse comprising a sequence of the human IL-17RA gene and a sequence of the human TNF-α gene; or
a2. providing a fertilized egg or an embryonic stem cell obtained from a genetically-modified non-human animal, such as a genetically-modified mouse, having a sequence of the human TNF-α gene of the disclosure;
b2. in the fertilized egg or embryonic stem cell, inserting a sequence of the human IL-17RA gene into the genome of the genetically-modified non-human animal, such as the genetically-modified mouse, by the method of the disclosure, thereby generating a genetically-modified mouse comprising a sequence of the human IL-17RA gene and a sequence of the human TNF-α gene.
In one aspect, the disclosure relates to a polypeptide comprises an amino acid sequence with at least 80% sequence identity, such as at least 85%, at least 90%, at least 95%, at least 98% or at least 99% sequence identity with SEQ ID NO: 39. In some embodiments, the polypeptide comprises or consists of SEQ ID NO: 39.
In another aspect, the disclosure relates to a polynucleotide encoding the polypeptide of the disclosure. In some embodiments, the polynucleotide comprises SEQ ID NO: 38.
In yet another aspect, the disclosure relates to a vector comprising the polynucleotide of the disclosure.
In one aspect, the disclosure relates to a chimeric 11,17-RA gene comprising a partial human IL-17RA gene sequence and a partial non-human animal IL-17RA gene sequence, preferably, all or part of the partial human IL17RA gene sequence has at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identity with SEQ ID NO: 35, SEQ ID NO: 36 or SEQ ID NO: 37, and more preferably, the partial human IL17RA gene sequence is SEQ ID NO: 35.
In another aspect, the disclosure relates to a chimeric TNF-α gene comprising a partial human TNF-α gene sequence and a partial non-human animal TNF-α gene sequence, preferably, the partial human TNF-α gene sequence has at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identity with SEQ ID NO: 61, and more preferably, the partial human TNF-α gene sequence is SEQ ID NO: 61
In one aspect, the disclosure relates to a chimeric IL-17A gene comprising a partial human IL-17A gene sequence and a partial non-human animal IL-17A gene sequence, preferably, all or part of the partial human IL-17A gene sequence has at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identity with SEQ ID NO: 7, SEQ ID NO: 8 or SEQ ID NO: 9, and more preferably, the partial human IL-17A gene sequence is SEQ ID NO: 7.
Herein after, the embodiments of the disclosure will be described in detail with reference to the accompanying drawings.
The invention will be further described below in conjunction with specific examples, and the advantages and characteristics of the invention will become clearer with the description. However, these examples are only exemplary and do not constitute any limitation to the scope of the invention. Those skilled in the art should understand that the details and forms of the technical solution of the invention can be modified or replaced without departing from the spirit and scope of the invention, and these modifications and replacements fall within the protection scope of the invention.
In the following examples, the equipment and materials were obtained from the companies indicated below.
EcoRI, ScaI, HindIII, amHI, XhoI, EcoRV, SalI and BbsI enzymes were purchased from NEB, with catalog numbers R3101M, R3122M, R3104M, R3136M, R0146M, R3195M, R3138M and R0539L, respectively.
C57BL/6 mice were purchased from the National Resource Center for Rodent Laboratory Animal of the National Institutes for Food and Drug Control, China.
Mouse MC38 colon cancer cells were purchased from Shanghai Biological Technology Co., Ltd. enzyme research.
The BAC library was purchased from Invitrogen, with catalog numbers RPCI23.0 and RPCI11. C.
BV711 hamster anti-mouse CD3e (mCD3) was purchased from BD, with catalog number 63123.
Flow cytometer was purchased from BD, with model Calibur.
IL-17A ELISA kit was purchased from Biolegend, with catalog number 433917.
CD217 (IL-17Ra) monoclonal antibody (PAJ-17R), PE (mIL17RA PE) was purchased from ebioscience, with catalog number 12-7182-80.
CD217 (IL-17Ra) monoclonal antibody (J10MBS), PE (hIL17RA PE) was purchased from ebioscience, with catalog number 12-7517-41.
APC anti-mouse Ly-6G/Ly-6C (Gr-1) antibody (mGR1PerCP) was purchased from Biolegend, with catalog number 108412.
PE anti-human IL-17A antibody (anti-human IL-17A PE) was purchased from Biolegend, with catalog number 512305.
APC anti-mouse IFN-γ antibody (anti-mouse IFN-γAPC) was purchased from Biolegend, with catalog number 505809.
Alexa Fluor® 488 anti-mouse CD3 antibody was purchased from Biolegend, with catalog number 100212.
Brilliant Violet 421™ anti-mouse CD4 antibody was purchased from Biolegend, with catalog number 100443.
Brilliant Violet 510™ anti-mouse CD45 antibody was purchased from Biolegend, with catalog number 103137.
eBioscience™ Foxp3/Transcription Factor Staining Buffer Set was purchased from ThermoFisher, with catalog number 00-5523-00.
Imiquimod cream (Aldara) was purchased from 3M Health Care Limited, with specification 250 mg: 12.5 mg, and approval number H20160079.
MOG35-55 was purchased from ProSpec, with specification 100 mg.
Pertussis toxin (PTX) was purchased from Millipore, with catalog number 516560.
The mouse IL-17A gene (NCBI Gene ID: 16171, Primary source: MGI: 107364, UniProt ID: Q62386, located at 20730905 to 20734496 of chromosome 1 NC 000067.6, based on the transcript NM_010552.3 (SEQ ID NO: 1) and encoded protein NP_034682.1 (SEQ ID NO: 2)) and human IL-17A gene (NCBI Gene ID: 3605, Primary source: HGNC: 5981, UniProt ID: Q16552, located at 52186387 to 52190638 of chromosome 6 NC_000006.12, based on the transcript NM_002190.3 (SEQ ID NO: 3) and encoded protein NP_002181.1 (SEQ ID NO: 4)) is shown in
In order to achieve the purpose of the disclosure, a sequence encoding human IL-17A protein can be introduced into the mouse endogenous IL-17A locus, such that the mouse can express human IL-17A protein. Specifically, gene editing technology can be used to replace the specific mouse IL-17A gene sequence on the mouse endogenous IL-17A locus with a human IL-17A gene sequence, for example, replace the about 2.9 kb (2898 bp) sequence containing at least the start codon ATG to the stop codon TAA of the mouse IL-17A gene with the corresponding human DNA sequence to obtain a humanized IL-17A locus (as shown schematically in
Bacterial Artificial Chromosome (BAC) was used to obtain the DNA sequences of mouse and human IL-17A genes, respectively. In the schematic diagram of the targeting strategy shown in
In addition, the targeting vector also includes an antibiotic resistance gene for positive clone screening (neomycin phosphotransferase coding sequence Neo) and two FRT recombination sites on both sides of the antibiotic resistance gene that formed a Neo cassette. The connection sequence between the 5′end of the Neo cassette and the mouse locus is designed as 5′-CCGGTGGACACATCTGGAGTACAGCGTCTGCGTCGACGGTATCGATAAGCTTGATATC GAATTCCGAAGTTCCTATTCTCTAG-3′ (SEQ ID NO: 10), in which the last “C” of the sequence “TCTGC” is the last nucleotide of the mouse sequence, and the first “G” of the sequence “GTCGA” is the first nucleotide of the Neo cassette. The connection sequence between the 3′ end of the Neo cassette and the mouse locus is designed as 5′-AGTATAGGAACTTCATCAGTCAGGTACATAATGGTGGATCCACTAGTATCTGTAGCTCG GGGAACATCATGAGAGAGGAGC-3′(SEQ ID NO: 11), in which the last “T” of the sequence “CTAGT” is the last nucleotide of the Neo cassette, and the “A” of the sequence “ATCTG” is the first nucleotide of the mouse sequence. In addition, a coding sequence for a negative selectable marker, that is, the coding sequence for diphtheria toxin A subunit (DTA) was designed downstream of the 3′homology arm of the targeting vector.
The vector can be constructed by conventional methods, such as restriction digestion and ligation, and the like. The constructed targeting vector sequence can be initially verified by restriction digestion, followed the sequencing company for sequencing verification. The targeting vector verified by sequencing was transferred into embryonic stem cells of C57BL/6 mice by electroporation, and the obtained cells were screened by selectable marker for the positive clones, and the integration of foreign genes was confirmed by PCR and Southern Blot methods, to screen out the correct positive clones. The positive clones were identified by PCR (PCR results not shown) were then subjected to Southern Blot (DNA extracted from cells was digested with EcoRV or SpeI or SacI, and then hybridized with 3 probes). The results are shown in
The following primers are used for PCR.
The following probes are used for Southern Blot.
According to the technique known in the art, the positive colonies (from black mouse) were selected and introduced into the isolated blastocyst (from white mouse), and the obtained chimeric blastocyst was transferred to the culture medium for short-term culture and then transplanted into the oviduct of the recipient mother mouse (white mouse) to produce F0 generation chimeric mouse (black and white chequered). The F0 generation chimeric mice and wild-type mice were backcrossed to obtain F1 generation mice, and then F1 generation heterozygous mice were mated with each other to obtain F2 generation homozygous mice. The positive mouse can also be bred with the Flp tool mouse to remove the selectable marker gene from the positive clone (the process diagram is shown in
Through this method, it is possible to construct a humanized IL-17A gene genetically-modified mouse without random insertion that can be stably passaged.
The expression of human IL-17A protein in the obtained positive mice can be confirmed by routine detection methods, for example, using the ELISA method. One wild-type C57BL/6 mouse and one mouse heterozygous for humanized IL-17A gene were selected, and 7.5 μg anti-mouse CD3 antibody (mCD3) and 4 μg anti-mouse CD28 antibody (mCD28) were injected intraperitoneally into the mice. After 2 hours, the serum was collected and diluted 2 times, and then the level of human IL-17A protein was detected. The detection results (see
Schematic diagram of mouse IL-17RA gene (NCBI Gene ID: 16172, Primary source: MGI: 107399, UniProt ID: Q60943, located at 120463181 to 120483731 of chromosome 6 NC_000072.6, based on the transcript NM_008359.2 (SEQ ID NO: 29) and encoded protein NP_032385.1 (SEQ ID NO: 30)) compared with human IL-17RA gene (NCBI Gene ID: 23765, Primary source: HGNC: 5985, UniProt ID: Q96F46, located at 17084959 to 17115694 of chromosome 22 NC_000022.11, based on the transcript NM_014339.6 (NM_014339.6) and encoded protein NP_055154.3 (SEQ ID NO: 32) is shown in
In order to achieve the purpose of the disclosure, a sequence encoding human IL-17RA protein can be introduced into the extracellular region of the mouse endogenous IL-17RA locus, so that the mouse expresses human or humanized IL-17RA protein. Specifically, gene editing technology is used to modify mouse cells to replace the specific mouse IL-17RA gene sequence on the mouse endogenous IL-17RA locus with a human IL-17RA gene sequence. Under the control of the mouse IL-17RA gene regulatory element, for example, at least a 8.9 kb sequence from exon2 to exon 11 of the mouse IL-17RA gene was replaced with the corresponding human gene sequence to obtain the mouse humanized IL-17RA locus, as shown in Figure. 9.
Further, a target strategy as shown in
The targeting vector also includes an antibiotic resistance gene for positive clone screening, (neomycin phosphotransferase coding sequence Neo), and two FRT recombination sites on both sides of antibiotic the resistance gene, which constitutes a Neo cassette. The connection sequence between the 5′ end of the Neo cassette and the mouse IL-17RA locus is designed as 5′-AGGAGCAGACCCTGAACTCACAAGGGAAGACCCTCACTCGATATCGAATTCCGAAGT TCCTATTCTCTAGAAAGTATAGG-3′ (SEQ ID NO: 40), in which the last “C” of the sequence “CACTC” is the last nucleotide of the mouse, and the “G” of the sequence “GATAT” is the first nucleotide of the Neo cassette. The connection sequence between the 3′ end of the Neo cassette and the mouse IL-17RA locus is designed as 5′-GTATAGGAACTTCATCAGTCAGGTACATAATGGTGGATCCCAATTGTCCACCAGCTTTG TAGTCACAGGAGACCTAATCT-3′(SEQ ID NO: 41), in which the “G” of the sequence “AATTG” is the last nucleotide of the Neo cassette, and the “T” of the sequence “TCCAC” is the first nucleotide of the mouse sequence. In addition, a coding sequence for a negative selectable marker, that is, the coding sequence for diphtheria toxin A subunit (DTA) was designed downstream of the 3′ homology arm of the targeting vector.
The targeting vectors can be constructed by conventional methods, such as restriction digestion and ligation, direct synthesis and the like. The constructed targeting vector sequence can be initially verified by restriction digestion, followed the sequencing company for sequencing verification. The targeting vector verified by sequencing was transferred into embryonic stem cells of C57BL/6 mice by electroporation, and the obtained cells were screened by selectable marker gene of the positive clones, and the integration of foreign genes was confirmed by PCR and Southern Blot methods, to screen out the correct positive clones. The positive clones that were identified by PCR were then subjected to Southern Blot (DNA extracted from cells was digested with PstI, MfeI or SspI, and hybridized with 3 probes). The Southern Blot results are shown in
The following primers are used for PCR.
The following probes are used for Southern Blot.
According to the methods described in Example 1, the blastocyst injection and progeny breeding were carried out to obtain heterozygous and homozygous mice for humanized IL-17RA gene expressing humanized IL-17RA protein. The genotypes of somatic cells in offspring mice can be identified by PCR. The identification results of exemplary F1 generation mice (Neo has been removed) are shown in
Through this method, a humanized IL-17RA gene genetically-modified mouse without random insertion that can be stably passaged was constructed.
The expression of humanized IL-17RA protein in mice can be confirmed by conventional detection methods, for example, the anti-mouse IL-17RA antibody mIL-17RA PE and the anti-mouse Gr-1 antibody mGR1PerCP, or the anti-human IL-17RA antibody hIL-17RA PE and anti-mouse Gr-1 antibody mGR1PerCP were used to identify and stain the bone marrow cells of mice, and then a flow cytometry was used to detect the expression of IL-17RA protein. The flow analysis result is shown (see
Mouse TNF-α gene (NCBI Gene ID: 21926, Primary source: MGI: 104798, UniProt ID: P06804, located at 35199367 to 35202007 of 17 NC_000083.6, based on the transcript NM_013693.3 (SEQ ID NO: 55) and encoded protein NP_038721.1 (SEQ ID NO: 56)), human TNF-α gene (NCBI Gene ID: 7124, Primary source: HGNC: 11892, UniProt ID: P01375, located at 31575567 to 31575567 of chromosome 6 NC_000006.12, based on the transcript NM_000594.3 (SEQ ID NO: 57) and encoded protein NP_000585.2 (SEQ ID NO: 58)).
In order to achieve the purpose of the disclosure, a sequence encoding human TNF-α protein can be introduced into the endogenous mouse TNF-α locus so that the mouse expresses human TNF-α protein. Specifically, gene editing technology can be used to replace a specific mouse TNF-α gene sequence on the mouse endogenous TNF-α locus with a human TNF-α gene sequence, for example, replace the about 1.8 kb (1,796 bp) sequence containing at least the start codon ATG to the stop codon TAA of the mouse TNF-α gene with the corresponding human gene sequence to realize the humanization of the mouse TNF-α gene.
A targeting vector for homologous recombination was constructed, which contains an upstream homology arm sequence and a downstream homology arm sequence (the DNA sequence of 6,173 bp upstream and 4,033 bp downstream of the mouse endogenous TNF-α locus), and a sequence of the human TNF-α locus. The upstream homology arm sequence (5′ homology arm, SEQ ID NO: 59) is identical to the 35209909-35203737 of NC_0000083.6, the downstream homology arm sequence (3′ homology arm, SEQ ID NO: 60) is identical to the 35197201 to 35193169 of NC_0000083.6, and the DNA fragment containing the human TNF-α gene sequence (6,287 bp, SEQ ID NO: 61) is identical to the 31573694-31579980 of NC_000006.12.
The targeting vector also includes an antibiotic resistance gene for positive clone screening (neomycin phosphotransferase coding sequence Neo), and two LoxP recombination sites on both sides of the resistance gene, which constitutes a Neo cassette. The 5′ end of the Neo cassette is directly connected to the DNA fragment sequence (SEQ ID NO: 61) containing human TNF-α, and the connection sequence between the 3′ end of the Neo cassette and the mouse locus is designed as 5′-AATGTATGCTATACGAAGTTATTAGGTCCCTCGAGGGGATCCGAATTCATCGGCTTCCT CCTGGAACTCCTCCTCCTCG-3′(SEQ ID NO: 62), in which the last “T” of the sequence “GAATT” is the last nucleotide of the Neo cassette, and the first “C” of the sequence “CATCG” is the first nucleoside of the mouse sequence acid. In addition, a coding sequence for a negative selectable marker, for example, the coding sequence for diphtheria toxin A subunit (DTA) was designed downstream of the 3′ homology arm of the targeting vector.
The vector can be constructed by conventional methods, such as restriction digestion and ligation and the like. After the constructed targeting vector was first verified by restriction digestion, it was sent to the sequencing company for sequencing verification. The targeting vector verified by sequencing was transferred into embryonic stem cells of C57BL/6 mice by electroporation, and the obtained cells were screened by selectable marker for the positive clones, and the integration of foreign genes was confirmed by PCR and Southern Blot methods, to screen out the correct positive clones. According to the method described in Example 1, the blastocyst injection and progeny breeding were carried out to obtain humanized TNF-α gene heterozygous and homozygous mice expressing human TNF-α protein. The genotype of the somatic cells of the offspring mouse can be identified by PCR. The identification result of an exemplary F1 generation mouse is shown in
Through this method, a humanized TNF-α gene genetically-modified mouse without random insertion that can be stably passaged was constructed.
The genetically-modified mice with humanized IL-17A gene, IL-17RA gene, or TNF-α gene produced by the method can also be used to produce mouse model with double humanized or multi-humanized genes. For example, in the above Example 1, the embryonic stem cells used for blastocyst microinjection can be selected from mice containing other genetic modifications. Alternatively, on the basis of genetically-modified mice with humanized IL-17A and/or IL-17RA and/or TNF-α, isolated mouse ES cells and gene homologous recombination technology can be used to obtain double-gene or multi-gene modified mouse model with modified IL-17A and/or IL-17RA and/or TNF-α genes and other gene.
The homozygous or heterozygous IL-17A and/or IL-17RA and/or TNF-α genetically-modified mice obtained by this method can also be bred with other genetically modified homozygous or heterozygous mice, and their offspring can be screened. According to Mendelian inheritance rules, there is a certain chance of getting double-gene or multi-gene modified heterozygous mice with humanized IL-17A and/or IL-17RA and/or TNF-α genes and other genetic modifications, and then the heterozygous mice can be bred with each other to obtain double-gene or multi-gene modified homozygous mice. These double-gene or multi-gene modified mice can be used for in vivo pharmacodynamics verification of regulators targeting human IL-17A and/or IL-17RA and/or TNF-α and other related signaling pathways.
For example, for L-17A/TNF-α genes double humanized mice, since the mouse IL-17A gene and TNF-α gene are located on chromosomes 1 and 17, respectively, the IL-17A gene humanized mice are bred with the TNF-α gene humanized mice, and the positive offspring mice are screened to finally obtain the IL-17A/TNF-α genes double humanized mice.
For example, for L-17A/IL-17RA genes double humanized mice, since the mouse IL-17A gene and IL-17RA gene are located on chromosomes 1 and 6, respectively, the IL-17A gene humanized mice are mated with the IL-17RA gene humanized mice, and the positive offspring mice are screened to finally obtain the IL-17A/IL-17RA genes double humanized mice.
The humanized mice disclosed in the disclosure can be used to produce a variety of human disease models, including multiple sclerosis, asthma, allergies, and other diseases, which can be used to test the in vivo effectiveness of human specific antibodies. For example, mice with humanized IL-17A and/or IL-17RA genes can be used to evaluate the pharmacodynamics, pharmacokinetics and in vivo therapeutic effectiveness of specific antagonists for human IL-17 signaling pathway in various disease models known in the art.
For example, for the production of Experimental Autoimmune Encephalomyelitis (EAE) model, the mice (about 10 weeks age) with humanized IL-17A, IL-17A/IL-17RA and other genes produced in the disclosure can be immunized with MOG once (on day 0, by subcutaneous injection of 200 μg/mouse), and given intraperitoneal injection of pertussis toxin (PTX) twice (day 0 and day 1, at a dose of 400 μg/mouse). After the first immunization, the mice were weighed and observed continuously every day. After the onset of the disease, the mice were divided into groups and administered drugs by gavage, intraperitoneal injection, or tail vein injection. Multiple detection indicators such as behavioral score, brain/spinal cord IHC pathology, HE pathology examination, detection of Th17 type cytokines of serum/brain homogenate, and flow cytometry of CNS, spleen, and lymph nodes maybe used to assess the in vivo effectiveness of different drugs for human.
In one study, the mouse homozygous for humanized IL-17A as described in Example 1 was used to establish an EAE disease model. The experimental groups are shown in Table 1. After immunization as described in the above method, none of the mice in the PBS control group (G1, G3) developed the disease, and only mice in the modeling group (G2, G4) were found to have the disease. The clinical symptoms included listlessness, weight loss, loss of tail tension, paralysis of hind limbs or extremities, incontinence, and ataxia developed in individual mice. A total of 10 mice in the two modeling groups developed the disease at 10-12 days after the first immunization, and had weight loss. With the increase in the number of days after sensitization, the number of cases gradually increased. The clinical symptoms reached a peak 3-5 days after the onset, and then entered a remission period, when the weight gradually increased, showing an “onset-remission” trend.
The incidence of female mice was compared with that of the male mice in the modeling group. Every day, animal body weight was measured and the neurological indicators were evaluated according to a 4-point scale (clinical score): 0, normal; 1, weak tail; 2, paralysis of partial hind limbs; 3, paralysis of all hind limbs; 4, paralysis of limbs. It was found that there was no significant difference in morbidity, onset time, peak time, and severity of symptom during the modeling process of both sexes, but the weight and clinical symptoms of female mice recovered better (see
In the EAE model, IL-17A is mainly produced by CD4+Th17 cells during the development of the disease. In order to detect the production of human IL-17 in mice, lymph node cells from MOG-immunized mice homozygous for humanized IL-17A (female, n=5) were isolated and stimulated with PMA and ionomycin in the presence of Brefeldin A for 6 hours. Cells producing IL-17 and IFNγ were analyzed by FACS.
The above results indicate that the genetically humanized mice produced by the methods of the disclosure can be used to establish a stable EAE model.
The EAE model was established according to the method described in Example 5 using female IL-17A humanized mouse homozygotes. After the onset of disease, the mice were divided into groups and injected intraperitoneally with the anti-human IL-17A antibody Ixekizumab according to different dosing schedules; and the control group was injected with PBS. The experimental procedure is shown in
Toll-like receptors play an important role in the occurrence and development of psoriasis. Imiquimod is a Toll-like receptor agonist and can be used to model psoriasis. In this example, the humanized mouse homozygous for IL-17A as described in Example 1 was used to establish a psoriasis model by the method of imiquimod induction. The female IL-17A humanized mice were randomly divided into a control group (G1; no induction), a model group (G2) and a treatment group (G3), with 5 mice in each group. At the beginning of the experiment (−D3), the back hairs of the mice were removed with a shaver, exposing a 2 cm×3 cm skin area. After 3 days (D0), mice in the model group and the treatment group were administered with 5% Imiquimod (IMQ) cream (local dose 83 mg) to the back skin area every day for 12 consecutive days; and mice in the control group were administered with Vaseline. Mice in the treatment group were intraperitoneally injected with anti-human IL-17A antibody (Ixekizumab, 100 mg/kg single dose) at −D3, D0, D4, D7 and D11 for 5 times in total. The entire experiment period is 17 days, and the specific experiment scheme is shown in
Starting from D0, the mice were weighed daily and photographed to observe the back skin conditions, and the clinical score of the condition of the mice was obtained. The scoring items include erythema and scales in mouse skin lesions. Each item is divided into 0-4 points according to the severity, based on the following PASI scoring standards: 0-none; 1-mild; 2-moderate; 3-severe; 4-extremely severe. For each group of mice, the score of each item or the average of the total scores of two items are compared. At the end of the experiment (D14), the skin specimens of the back and right ear of the mice were sliced and stained with hematoxylin and eosin (HE). The erosion, appearance of spinous processes, hypokeratosis, and mixed inflammatory cell infiltration on the back of each group of mice were scored according to the severity (0.5-2 points): 0.5-slight, 1-mild, 1.5-moderate, 2-severe. Stromal cell proliferation was scored (0.5-2 points): 0.5:2-4 layers, 1: 4-6 layers, 1.5:6-8 layers, and 2: 8-10 layers; the appearance of scabs: 0.5. Results statistics and pathological analysis scores between groups were performed, and the epidermal thickness was measured.
From the change of mouse body weight over time (
The above results demonstrate that the humanized mice of the disclosure can be used to establish a psoriasis model for evaluating the in vivo effectiveness of drugs targeting human IL-17A.
The humanized mouse homozygous for IL-17A as described in Example 1 was used to establish a psoriasis model by the method of imiquimod induction. Female mice were randomly divided into blank control G1 group (Vaseline; no induction of disease) and different treatment model groups (the following doses are single doses): control G2 group (0.9% NaCl), isotype control G3 group (10 mg/kg IgG4), G4 group (1 mg/kg ixekizumab), G5 group (3 mg/kg ixekizumab), G6 group (10 mg/kg ixekizumab), with 5 animals in each group. At the beginning of the experiment (−D3), the back hairs were removed with a shaver, exposing a 2 cm×3 cm skin area. Three days later (D0), mice in the treatment group were administered with 5% imiquimod (IMQ) cream (local dose 80 mg) to the back skin area every day for 12 consecutive days; and mice in the G1 group were administered with Vaseline as a blank control. The treatment group was intraperitoneally injected with anti-human IL17A antibody (ixekizumab), 0.9% NaCl or IgG4 every week from the beginning of the experiment (−D3) for a total of 5 administrations. The entire experimental period is 14 days, and the specific experimental scheme is shown in
From the change of mouse body weight over time (
The statistical results of the epidermal thickness of the back tissues of the mice in each group (
The preferred embodiments of the invention are described in detail above. However, the invention is not limited to the specific details in the above embodiments. Those skilled in the art will understand that within the scope of the technical concept of the invention, various modifications can be made to the technical solution of the invention, and these modifications all belong to the protection scope of the invention.
In addition, it should be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, various possible combinations are not described separately in the invention.
In addition, various different embodiments of the invention can also be combined arbitrarily, as long as they do not violate the spirit of the invention, and they should also be regarded as the disclosed content of the invention.
| Number | Date | Country | Kind |
|---|---|---|---|
| 201910044180.6 | Jan 2019 | CN | national |
| 201910616231.8 | Jul 2019 | CN | national |
This application is a divisional of U.S. application Ser. No. 17/089,479, filed on Nov. 4, 2020, which is a continuation of International Application No. PCT/CN2020/072714, filed on Jan. 17, 2020, which claims the priorities of Chinese Patent Application No. CN 201910044180.6 filed on Jan. 17, 2019 and entitled “GENETICALLY MODIFIED NON-HUMAN ANIMAL” and Chinese Patent Application No. CN 201910616231.8 filed on Jul. 9, 2019 and entitled “GENETICALLY MODIFIED NON-HUMAN ANIMAL”, which are incorporated herein by reference in their entirety.
| Number | Date | Country | |
|---|---|---|---|
| Parent | 17089479 | Nov 2020 | US |
| Child | 17816608 | US |
| Number | Date | Country | |
|---|---|---|---|
| Parent | PCT/CN2020/072714 | Jan 2020 | US |
| Child | 17089479 | US |
