Identification of candidate genes for the atherosclerosis susceptibility locus (ATHS)

Abstract

Genes, nucleic acids, proteins, antibodies, marker sets, and arrays for the atherosclerosis susceptibility locus (ATHS) are provided. Methods of detecting atherosclerosis susceptibility and modulating cholesterol phenotype in cells are also provided.

Description

COPYRIGHT NOTIFICATION

[0002] Pursuant to 37 C.F.R. 1.71(e), Applicants note that a portion of this disclosure contains material which is subject to copyright protection. The copyright owner has no objection to the facsimile reproduction by anyone of the patent document or patent disclosure, as it appears in the Patent and Trademark Office patent file or records, but otherwise reserves all copyright rights whatsoever.

STATEMENT AS TO RIGHTS TO INVENTIONS MADE UNDER FEDERALLY SPONSORED RESEARCH AND DEVELOPMENT

[0003] Not applicable.

FIELD OF THE INVENTION

[0004] This invention is in the field of genes which are relevant to atherosclerosis. The present invention relates, e.g., to the identification of candidate genes associated with ATHS/ALP, polypeptides encoded by these genes, related probes, marker sets, methods for detecting and monitoring subjects at risk for atherosclerosis, and cellular and transgenic models relevant to atherosclerosis.

BACKGROUND OF THE INVENTION

[0005] Complications of atherosclerosis are the most common causes of death in westernized societies, and epidemiological studies have shown that the genetic contribution to atherosclerosis is high, frequently exceeding 50%. Although studies on rare Mendelian forms of atherosclerosis have revealed several aberrant single genes underlying disorders that either elevate plasma LDL or decrease plasma HDL (e.g., LDLR, apoB-100, ARH, ABCG5/ABCG8, ABCA1), genes contributing to common multigenic forms of atherosclerosis remain to be identified.

[0006] Atherosclerosis susceptibility (ATHS) is associated with an atherogenic lipoprotein phenotype (ALP) characterized by a preponderance of small, dense, low density lipoprotein (LDL) particles (subclass pattern B), increased levels of triglyceride-rich lipoproteins, reduced levels of HDLs, and a 3-fold increased risk of myocardial infarction. One of the genes controlling this common heritable trait, the ATHS/ALP gene, has been mapped to the 19p13.3-p13.2 region and close linkage to the LDL receptor (LDLR) gene has been reported in several publications. See e.g. Nishina et al. (1992), Proc. Nat. Acad. Sci. 89: 708-712, Rotter et al. (1996), Am. J. Hum. Genet. 58: 585-594, and Naggert et al. (1997), Clin. Genet. 51: 236-240. Despite this attractive correlation, at least one study has shown that a structural mutation in the LDLR is not likely to be responsible for ATHS/ALP. Thus, identification and characterization of gene(s) underlying this common form of atherosclerosis is of great interest, and will be of significant diagnostic and therapeutic importance.

[0007] The chromosomal region 19p13.3-p13.2 containing the ATHS/ALP locus extends over 18 Mb, and includes at least 237 genes. The present invention relates to the identification of candidate genes associated with ATHS/ALP, polypeptides encoded by these genes, as well as to probes, marker sets, methods for detecting and monitoring subjects at risk for atherosclerosis, and cellular and transgenic models, as well as other features that will become apparent upon review of the accompanying disclosure.

SUMMARY OF THE INVENTION

[0008] The present invention relates to a set of polynucleotide sequences localized to human chromosome 19, in the region associated with a locus associated with genetic atherosclerosis susceptibility (ATHS). These polynucleotide sequences are designated SEQ ID NO:1 through SEQ ID NO:6. In a first aspect, the invention relates to compositions including one or more nucleic acid expression vectors including the polynucleotide sequences of SEQ ID NOs:1-6. For example, such expression vectors include nucleic acids including at least one polynucleotide sequence selected from SEQ ID NO:1 to SEQ ID NO:6, or conservative modifications thereof. The expression vectors also include polynucleotide sequences complementary to any one of SEQ ID NO:1 through SEQ ID NO:6. Similarly, sequences that hybridize under stringent hybridization conditions, or that are at least about 70%, (or at least about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, or at least about 99%) identical to one or more of SEQ ID NOs:1-6 can be included in the expression vectors of the invention. Likewise, expression vectors incorporating nucleic acids with subsequences of at least about 10 contiguous nucleotides of SEQ ID NOs:1-6 (or at least about 12, about 14, about 16, or about 18 contiguous nucleotides of one of the designated sequences) are included among the compositions of the invention. In addition, expression vectors, including polynucleotide sequences that encode a polypeptide sequence selected from among SEQ ID NO:7-SEQ ID NO:12, or conservative variations thereof, are compositions of the invention. In some embodiments, the expression vector includes a promoter operably linked to one or more of the nucleic acids described above. Such expression vectors can encode expression products such as sense or antisense RNAs, or polypeptides.

[0009] Polypeptides having an amino acid sequence selected from the group consisting of SEQ ID NO:7 to SEQ ID NO:12, and conservative variants thereof are also a feature of the invention, as are polypeptides encoded by a polynucleotide sequence selected from the group consisting of SEQ ID NO:1-SEQ ID NO:6, and conservatively modified variants thereof. Similarly, polypeptides encoded by polynucleotides that hybridize under stringent conditions to one of SEQ ID NO:1 through SEQ ID NO:6, or which are at least about 70% identical to one of SEQ ID NO:1 through SEQ ID NO:6, are polypeptides of the invention. Polypeptides (and oligopeptides and peptides) including amino acid subsequences of SEQ ID NO:7 through SEQ ID NO:12 are also a feature of the invention. For example, fusion proteins including a polypeptide of SEQ ID NO:7 through SEQ ID NO:12, or a subsequence, e.g., an antigenic subsequence, thereof are included in the polypeptides of the invention. Likewise, proteins having a sequence selected from SEQ ID NO:7 to SEQ ID NO:12 and homologous or variant polypeptides and a peptide or polypeptide tag, such as a reporter peptide or polypeptide, localization signal or sequence, or antigenic epitope, are included among the polypeptides of the invention.

[0010] Cells including an expression vector, and/or expressing a polypeptide as described above, are also a feature of the invention. In certain embodiments, the expressed polypeptide is encoded by an exogenous polynucleotide, i.e., an expression vector. Such expression vectors typically include a polynucleotide sequence encoding the polypeptide of interest operably linked to, and under the transcriptional regulation of, a constitutive or inducible promoter. In other embodiments, the polypeptide is encoded by an endogenous polynucleotide sequence activated by an exogenous promoter and/or enhancer.

[0011] Antibodies specific for the polypeptides of the invention, e.g., SEQ ID NO:7-SEQ ID NO:12, and conservatively modified variants, etc., are also a feature of the invention. Such specific antibodies can be either derived from a polyclonal antiserum or can be monoclonal antibodies. For example, such antibodies are specific for an epitope including or derived from a subsequence of one of SEQ ID NO:7-SEQ ID NO:12.

[0012] Another aspect of the invention provides labeled nucleic acid or polypeptide probes. For example, nucleic acid probes of the invention include DNA or RNA molecules with a polynucleotide sequence selected from SEQ ID NO:1 to SEQ ID NO:6, or a subsequence thereof including at least about 10 contiguous nucleotides. Optionally, the subsequences include at least about 12 contiguous nucleotides of one of SEQ ID NOs: 1-6. Often such subsequences include at least about 14 contiguous nucleotides, typically at least 16 contiguous nucleotides, and usually at least about 18 contiguous nucleotides of SEQ ID NO:1 to SEQ ID NO:6. These nucleic acid probes can be, e.g., synthetic oligonucleotides and probes, cDNA molecules, amplification products (e.g., produced by PCR or LCR), transcripts, or restriction fragments. In other embodiments, the labeled probes are polypeptides, such as polypeptides with amino acid sequences corresponding to SEQ ID NOs:7-12, or subsequences thereof, including peptide subsequences. Antibodies specific for such polypeptides or peptides are also a feature of the invention (as are polypeptides which bind to such antibodies). For example, a polypeptide probe can be a fusion protein, or a polypeptide with an epitope tag. A peptide probe can be an antigenic peptide derived from one of SEQ ID NO:7 through SEQ ID NO:12.

[0013] The label of the nucleic acid, polypeptide or antibody probe can be any of a variety of detectable moieties including isotopic, fluorescent, fluorogenic, or colorimetric labels.

[0014] In another aspect, the invention relates to a marker set, e.g., for predicting atherosclerosis susceptibility. Such marker sets can include a plurality of nucleic acids including one or more polynucleotide sequence selected from SEQ ID NO:1 to SEQ ID NO:6, or conservative modifications thereof; polynucleotide sequences complementary to one or more of SEQ ID NO:1 to SEQ ID NO:6; polynucleotide sequences that hybridize under stringent hybridization conditions, or that are at least about 70%, (or at least about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, or at least about 99%) identical to one or more of SEQ ID NOs:1-6; and polynucleotide sequences including at least about 10 contiguous nucleotides of SEQ ID NOs:1-6 (or at least about 12, about 14, about 16, or about 18 contiguous nucleotides of one of the designated sequences).

[0015] In one embodiment, the marker set includes a plurality of oligonucleotides, such as synthetic oligonucleotides. In other embodiments, the marker set includes expression products, amplification products, nucleic acid probes, or the like. The marker set of the invention can also include multiple nucleic acids selected from among different molecular classifications, e.g., oligonucleotides, expression products (such as cDNAs), amplification products, restriction fragments, etc. In one embodiment, the marker set is made up of nucleic acids including polynucleotide sequences corresponding to each of SEQ ID NO:1 through SEQ ID NO:6.

[0016] Markers of the invention can also be polypeptides, e.g., polypeptides encoded by SEQ ID NO:7-SEQ ID NO:12, or polypeptide or peptide subsequences thereof. Typically a peptide subsequence comprises at least about 5 contiguous amino acids, e.g., about 10 contiguous amino acids or more, often at least about 15 contiguous amino acids, and frequently at least about 20 contiguous amino acids of one of SEQ ID NOs:7-12.

[0017] Markers of the invention can also be antibodies, e.g., monoclonal or polyclonal antibodies or anti-sera specific for an epitope derived from a polypeptide found in one or more of SEQ ID NO:7 through SEQ ID NO:12.

[0018] In certain useful embodiments, the marker set is logically or physically arrayed. For example, the members of the marker set, whether nucleic acid, polypeptide, peptide or antibody, or a combination thereof, can be physically arrayed in a solid phase or liquid phase array, such as a bead (or microbead) array. Arrays, including a plurality of SEQ ID NO:1 to SEQ ID NO:6, SEQ ID NO:7-SEQ ID NO:12, or antibodies specific therefor, are also a feature of the invention. In some embodiments, the arrays include polynucleotides corresponding to majority of SEQ ID NO:1 to SEQ ID NO:6, SEQ ID NO:7 to SEQ ID NO:12, or antibodies specific therefor. In one embodiment, the array includes polynucleotides corresponding to each of SEQ ID NO:1 to SEQ ID NO:6, SEQ ID NO:7 to SEQ ID NO:12, or antibodies specific therefor. In an embodiment, the marker set is a mixed marker set including members that are selected from nucleic acids, polypeptides or peptides, and antibodies.

[0019] In one embodiment, the marker set of the invention is used to predict atherosclerosis susceptibility by hybridizing one or more nucleic acids of the marker set to a DNA or RNA sample from a cell or tissue (e.g., from a patient), and detecting at least one polymorphic polynucleotide or differentially expressed expression product in the sample. In another related embodiment, differentially expressed expression products are detected using an antibody array.

[0020] Another aspect of the invention provides methods for modulating cholesterol homeostasis in a cell, tissue or organism, such as a cell line or tissue of a human or non-human mammal, e.g., a human, a mouse, a rat, a rabbit, a dog, a pig, a sheep or a non-human primate. For example, cholesterol homeostasis is modulated in one or more cell-types such as liver, adipose tissue, gall bladder, pancreas, monocytes, macrophages, foam cells, T cells, endothelia and smooth muscle derived from blood vessels and gut, fibroblasts, and/or glia and nerve cells. The methods of the invention for modulating cholesterol homeostasis in a cell or tissue optionally include modulating expression or activity of at least one polypeptide encoded by a nucleic acid with a polynucleotide sequence selected from SEQ ID NO:1 to SEQ ID NO:6, or conservative modifications thereof; a polynucleotide sequence complementary to one or more of SEQ I) NO:1 to SEQ ID NO:6; a polynucleotide sequence encoding a polypeptide sequence selected from SEQ ID NO:7 to SEQ I) NO:12; a polynucleotide sequence that hybridizes under stringent hybridization conditions, or that is at least about 70%, (or at least about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, or at least about 99%) identical to at least one of SEQ ID NOs:1-6; or a polynucleotide sequence including at least about 10 contiguous nucleotides of SEQ ID NOs:1-6 (or at least about 12, about 14, about 16, or about 18 contiguous nucleotides of one of the designated sequences).

[0021] In one preferred embodiment, cholesterol homeostasis is regulated by modulating expression or activity of at least one polypeptide contributing to an atherogenic lipoprotein phenotype. In an embodiment, expression is modulated by expressing an exogenous nucleic acid including a polynucleotide sequence selected from SEQ ID NO:1 to SEQ ID NO:6. In other embodiments, expression of an endogenous nucleic acid, such as an endogenous nucleic acid encoding one of SEQ ID NO:7 through SEQ ID NO:12 is induced or suppressed, for example, by integrating an exogenous nucleic acid including at least one promoter that regulates expression of the endogenous nucleic acid. In other embodiments, expression or activity is modulated in response to cholesterol.

[0022] In some embodiments, the methods involve detecting altered expression or activity of an expression product, such as an RNA or polypeptide, encoded by a nucleic acid including a polynucleotide sequence selected from SEQ ID NO:1 to SEQ ID NO:6. In some cases, altered expression or activity in response to a pharmaceutical agent is detected. In other cases, altered expression or activity in response to diet is detected. In certain embodiments, a plurality of expression products are detected, e.g., in a high-throughput assay. For example, a plurality of expression products can be detected in an array, such as a bead array.

[0023] In an embodiment, a data record related to the altered expression or activity is recorded in a database. For example, a data record can be a character string recorded in a data base made up of a plurality of character strings recorded in a computer or on a computer readable medium.

[0024] In another aspect, the invention provides methods for detecting atherosclerosis susceptibility in a subject, such as a human subject. The methods of the invention for detecting atherosclerosis susceptibility involve providing a subject cell or tissue sample of nucleic acids and detecting at least one polymorphic polynucleotide sequence or expression product corresponding to a polynucleotide sequence of the invention, such as: a polynucleotide sequence selected from SEQ ID NO:1 to SEQ ID NO:6, or a conservative modification thereof; a polynucleotide sequence complementary to one or more of SEQ ID NO:1 to SEQ ID NO:6; a polynucleotide sequence encoding a polypeptide sequence selected from SEQ ID NO:7 to SEQ ID NO:12; a polynucleotide sequence that hybridizes under stringent hybridization conditions, or that is at least about 70%, (or at least about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, or at least about 99%) identical to one or more of SEQ ID NOs:1-6; or a polynucleotide sequence including at least about 10 contiguous nucleotides of SEQ ID NOs:1-6 (or at least about 12, about 14, about 16, or about 18 contiguous nucleotides of one of the designated sequences).

[0025] Detection of expression products is performed either qualitatively (presence or absence of one or more product of interest) or quantitatively (by monitoring the level of expression of one or more product of interest). In one embodiment, the polymorphic nucleic acid or expression product corresponds to or is encoded by an atherosclerosis susceptibility locus on human chromosome 19, for example, in the 19p13.3-13.2 region. In one embodiment, the expression product is an RNA expression product, such as differentially expressed RNA. The present invention optionally includes monitoring an expression level of a nucleic acid or polypeptide as noted herein for detection of an atherosclerosis susceptibility in an individual, such as a human, or in a population such as a human population.

[0026] Kits which incorporate one or more of the nucleic acids, polypeptides, antibodies, or arrays noted above are also a feature of the invention. Such kits can include any of the above noted components and further include, e.g., instructions for use of the components in any of the methods noted herein, packaging materials, containers for holding the components, and/or the like.

[0027] Digital systems which incorporate one or more representation (e.g., character string, data table, or the like) of one or more of the nucleic acids or polypeptides herein are also a feature of the invention.

[0028] Definitions

[0029] Before describing the present invention in detail, it is to be understood that this invention is not limited to particular devices or biological systems, which can, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting. As used in this specification and the appended claims, the singular forms “a”, “an” and “the” include plural referents unless the content clearly dictates otherwise. Thus, for example, reference to “a surface” includes a combination of two or more surfaces; reference to “bacteria” includes mixtures of bacteria, and the like.

[0030] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention pertains. In describing and claiming the present invention, the following terminology will be used in accordance with the definitions set out below.

[0031] “Atherosclerosis susceptibility,” (ATHS) also called “Atherogenic Lipoprotein Phenotype” (OMIM 108725) is a common heritable trait characterized by a preponderance of small, dense low density lipoprotein (LDL) particles (subclass pattern B), increased level of triglyceride-rich lipoproteins, and reduced levels of high density lipoprotein (HDL). ATHS is associated with a 3-fold increased risk of myocardial infarction relative to the population average. The “atherosclerosis susceptibility locus” (“ATHS locus”) is a human genetic locus, mapped to chromosome 19, associated with the atherosclerosis susceptibility (or atherogenic lipoprotein) phenotype described above.

[0032] The term “correlatable,” when used relative to atherosclerosis susceptibility, indicates that the designated subject, e.g., a polymorphic nucleic acid or the expression or activity of an expression product, is statistically associated with atherosclerosis susceptibility.

[0033] The term “nucleic acid” is generally used in its art-recognized meaning to refer to a ribose nucleic acid (RNA) or deoxyribose nucleic acid (DNA) polymer, or analog thereof. e.g., a nucleotide polymer comprising modifications of the nucleotides, a peptide nucleic acid, or the like. In certain applications, the nucleic acid can be a polymer including both RNA and DNA subunits. A nucleic acid can be, e.g., a chromosome or chromosomal segment, a vector (e.g., an expression vector), a naked DNA or RNA polymer, the product of a polymerase chain reaction (PCR), an oligonucleotide, a probe, etc.

[0034] The term “polynucleotide sequence” refers to a contiguous sequence of nucleotides in a single nucleic acid or to a representation, e.g., a character string, thereof. “Polymorphic polynucleotides” are polynucleotide sequences corresponding to a single locus, i.e., alleles at a locus, characterized by at least one variant (or alternative) nucleotide subunit. Thus, a polymorphic polynucleotide is a polynucleotide that differs, e.g., from another allele at the same locus, or between an otherwise homologous or similar polynucleotide, at one or more nucleotide positions.

[0035] The term “unique nucleotides” refers to a polynucleotide sequence corresponding to a unique locus, e.g., a non-repetitive, or unduplicated, locus in the human genome.

[0036] An “expression vector” is a vector, e.g., a plasmid, capable of producing transcripts and, potentially, polypeptides encoded by a polynucleotide sequence. Typically, an expression vector is capable of producing transcripts in an exogenous cell, e.g., a bacterial cell, or a mammalian cultured cell. Expression of a product can be either constitutive or inducible depending, e.g., on the promoter selected. In the context of an expression vector, a promoter is said to be “operably linked” to a polynucleotide sequence if it is capable of regulating expression of the associated polynucleotide sequence. The term also applies to alternative exogenous gene constructs, such as expressed or integrated transgenes. Similarly, the term operably linked applies equally to alternative or additional transcriptional regulatory sequences such as enhancers, associated with a polynucleotide sequence.

[0037] An “expression product” is a transcribed sense or antisense RNA, or a translated polypeptide corresponding to a polynucleotide sequence. Depending on context, the term also can be used to refer to an amplification product (amplicon) or cDNA corresponding to the RNA expression product transcribed from the polynucleotide sequence.

[0038] A polynucleotide sequence is said to “encode” a sense or antisense RNA molecule, or a polypeptide, if the polynucleotide sequence can be transcribed (in spliced or unspliced form) or translated into the RNA or polypeptide, or a fragment of thereof.

[0039] A probe and a gene (or expression product) are said to “correspond” when they share substantial structural identity, or complimentarity, depending on context. For example, a probe or an expression product, e.g., a messenger RNA, corresponds to a gene when it is derived from a genetic element with substantial sequence identity.

DETAILED DESCRIPTION

[0040] Atherosclerosis Susceptibility (ATHS) is a common heritable human condition characterized by a preponderance of small, dense, low density lipoprotein (LDL) particles, accompanied by a reduction in high density lipoproteins (HDL), and increased plasma levels of triglyceride-rich lipoproteins. Individuals with inherited atherosclerosis susceptibility exhibit an atherogenic lipoprotein phenotype, and are at three times the average population risk for myocardial infarction.

[0041] Cholesterol metabolism is subject to complex regulatory controls involving de novo synthesis, on the one hand, and uptake and transport of ingested cholesterol, mediated by plasma lipoproteins, on the other. While cholesterol provides an essential component of cell membranes, excess cholesterol, most typically originating in the diet, if inefficiently processed and excreted, contributes to atherogenic plaques and consequently to heart disease.

[0042] In brief, dietary cholesterol released from the gut in chylomicrons, as well as endogenous cholesterol in very low density lipoproteins (VLDL) is hydrolyzed to generate precursors for high-density lipoproteins (HDL). Cholesterol and apolipoproteins are taken up in HDL for transport to the liver, where the cholesterol can be taken up and excreted via the bile. Chylomicron remnants and a proportion of the VLDL remnants are rapidly cleared by receptor mediated uptake into the liver. However, the remaining VLDL remnants are modified in the plasma to become low density lipoproteins (LDL) which are taken up via endocytosis, mediated by the LDL-receptor (LDLR), to maintain intracellular homeostasis. Excess LDL are subject to cell-mediated oxidative damage contributing to the development of atherogenic plaques.

[0043] The LDLR gene is localized to the short arm of human chromosome 19. The present invention defines additional sequences present in this region which are relevant to cholesterol homeostasis. Linkage analysis and an association study have demonstrated that the ATHS/ALP locus is tightly linked, but distinct from the LDL receptor (LDLR) locus on human chromosome 19.

[0044] The present invention makes use of tissue culture models of cholesterol induction and suppression to identify expression products that exhibit a significant change in abundance in response to cholesterol. Massively Parallel Signature Sequencing (MPSS) technology was used to identify sequence signatures that map within the ATHS/ALP region on chromosome 19. Signatures corresponding to expression products regulated in response to cholesterol, were evaluated for their alignment with genes and ESTs localized to the same genomic region.

[0045] In this manner, a set of differentially expressed genes associated with cholesterol metabolism localized to human chromosome 19p13.3-p13.2, in close proximity to the ATHS locus have been identified. These sequences, SEQ ID NO:1 through SEQ ID NO:6, are preferred candidates for the ATHS locus, and are significant as markers and probes for evaluating atherosclerosis susceptibility, as well as for the production of animal and cell culture models useful for the evaluation and monitoring of therapeutic agents and protocols aimed at reducing risk of atherosclerosis and myocardial infarction due to atherosclerosis.

[0046] Polynucleotides of the Invention

[0047] The present invention is based on the identification and isolation of a set of genes regulated by cholesterol that are localized to human chromosome 19p13.3-p13.2, in close proximity with the ATHS locus. The unique utility of these polynucleotide sequences, designated herein SEQ ID NO:1 through SEQ ID NO:6, resides in their particular and simultaneous satisfaction of these two criteria. Firstly, the specified sequences are implicated in cholesterol metabolism by their differential regulation in response to experimental conditions indicative of cellular metabolic processes either induced by or suppressed by cholesterol. Secondly, the specified polynucleotide sequences correspond to loci on human chromosome 19 in a narrowly delimited chromosomal region, 19p13.3-p13.2, in which the ATHS locus is located. That the specified sequences satisfy these two independent and distinct conditions confers certain unique utilities, individually and collectively, on the polynucleotide sequence of the invention.

[0048] Accordingly, in one aspect, the polynucleotide sequences of the invention are useful for identifying chromosomal segments and corresponding cDNAs associated with the ATHS locus. More generally, the polynucleotide sequences of the invention and corresponding polypeptides are useful, individually and/or collectively, as probes (e.g., probes labeled with a detectable moiety) and markers. Such probes and markers are useful not only for identifying the ATHS gene, but also for evaluating atherosclerosis susceptibility (e.g., for diagnostic assays for determining atherosclerosis susceptibility in a subject, such as a human subject, or patient). In addition, the polynucleotide sequences of the invention are useful for the production of animal and cell culture models useful for the evaluation of monitoring of therapeutic agents and protocols aimed at reducing risk of atherosclerosis and myocardial infarction due to atherosclerosis.

[0049] Polynucleotide sequences of the invention include, e.g., the polynucleotide sequences represented by SEQ ID NO:1 through SEQ ID NO:6 of the accompanying sequence ID listing, as well as polynucleotide sequences complementary thereto. For example, polynucleotides encoding polypeptide sequences represented by SEQ ID NO:7 through SEQ ID NO:12 are one embodiment of the invention. Subsequences of SEQ ID NO:1-6 including at least about 10 contiguous nucleotides or complementary subsequences are also a feature of the invention. More commonly a subsequence includes, e.g., at least about 12 contiguous nucleotides of one or more of SEQ ID NO:1 through SEQ ID NO:6. Typically, the subsequence includes at least about 14, frequently at least about 16, and usually at least about 18 contiguous nucleotides of one of the specified polynucleotide sequences. Such subsequences are typically oligonucleotides, such as synthetic oligonucleotides.

[0050] In addition to the polynucleotide sequences of the invention, e.g., enumerated in SEQ ID NO:1 to SEQ ID NO:6, polynucleotide sequences that are substantially identical to a polynucleotide of the invention can be used in the compositions and methods of the invention. Substantially identical, or substantially similar polynucleotide (or polypeptide) sequences are defined as polynucleotide (or polypeptide) sequences that are identical, on a nucleotide by nucleotide basis, with at least a subsequence of one of SEQ ID NO:1-6 (or 7-12). Such polynucleotides can include, e.g., insertions, deletions, and substitutions relative to any of SEQ ID NO:1-6. For example, such polynucleotides are typically at least about 70% identical to a reference polynucleotide (or polypeptide) selected from among SEQ ID NO:1 through SEQ ID NO:6. That is, at least 7 out of 10 nucleotides (or amino acids) within a window of comparison are identical to the reference sequence selected SEQ ID NO:1-12. Frequently, such sequences are at least about 80%, e.g., at least about 90%, and often at least about 95%, or even at least about 98%, or about 99%, identical to the reference sequence, e.g., at least one of SEQ ID NO:1 to SEQ ID NO:12.

[0051] Where polynucleotide sequences are translated to form a polypeptide or subsequence of a polypeptide, nucleotide changes can result in either conservative or non-conservative amino acid substitutions. Conservative amino acid substitutions refer to the interchangeability of residues having functionally similar side chains. Conservative substitution tables providing functionally similar amino acids are well known in the art. Table 1 sets forth six groups which contain amino acids that are “conservative substitutions” for one another. Other art available conservative substitution charts are available and can be used in a similar manner.

TABLE 1
Conservative Substitution Groups
1 Alanine (A)	Serine (S)	Threonine (T)
2 Aspartic acid (D)	Glutamic acid (E)
3 Asparagine (N)	Glutamine (Q)
4 Arginine (R)	Lysine (K)
5 Isoleucine (I)	Leucine (L)	Methionine (M)	Valine (V)
6 Phenylalanine (F)	Tyrosine (Y)	Tryptophan (W)

[0052] One of skill will appreciate that many conservative variations of the nucleic acid constructs which are disclosed yield a functionally identical construct. For example, as discussed above, owing to the degeneracy of the genetic code, “silent substitutions” (i.e., substitutions in a nucleic acid sequence which do not result in an alteration in an encoded polypeptide) are an implied feature of every nucleic acid sequence which encodes an amino acid. Similarly, “conservative amino acid substitutions,” in one or a few amino acids in an amino acid sequence (e.g., about 1%, about 2%, about 3%, about 4%, about 5%, about 6%, about 7%, about 8%, about 9%, about 10% or more) are substituted with different amino acids with highly similar properties, are also readily identified as being highly similar to a disclosed construct. Such conservative variations of each disclosed sequence are a feature of the present invention.

[0053] Methods for obtaining conservative variants, as well as more divergent versions of the nucleic acids and polypeptides of the invention are widely known in the art. In addition to naturally occurring homologues which can be obtained, e.g., by screening genomic or expression libraries according to any of a variety of well-established protocols, see, e.g., Ausubel, Sambrook, Berger, additional variants can be produced by a variety of mutagenesis procedures. Many such procedures are known in the art, including site directed mutagenesis, oligonucleotide-directed mutagenesis, and many others. For example, site directed mutagenesis is described, e.g., in Smith (1985) “In vitro mutagenesis” Ann. Rev. Genet. 19:423-462, and references therein, Botstein & Shortle (1985) “Strategies and applications of in vitro mutagenesis” Science 229:1193-1201; and Carter (1986) “Site-directed mutagenesis” Biochem. J. 237:1-7. Oligonucleotide-directed mutagenesis is described, e.g., in Zoller & Smith (1982) “Oligonucleotide-directed mutagenesis using M13-derived vectors: an efficient and general procedure for the production of point mutations in any DNA fragment” Nucleic Acids Res. 10:6487-6500). Mutagenesis using modified bases is described e.g., in Kunkel (1985) “Rapid and efficient site-specific mutagenesis without phenotypic selection” Proc. Natl. Acad. Sci. USA 82:488-492, and Taylor et al. (1985) “The rapid generation of oligonucleotide-directed mutations at high frequency using phosphorothioate-modified DNA” Nucl. Acids Res. 13: 8765-8787. Mutagenesis using gapped duplex DNA is described, e.g., in Kramer et at. (1984) “The gapped duplex DNA approach to oligonucleotide-directed mutation construction” Nucl. Acids Res. 12: 9441-9456). Point mismatch repair is described, e.g., by Kramer et al. (1984) “Point Mismatch Repair” Cell 38:879-887). Double-strand break repair is described, e.g., in Mandecki (1986) “Oligonucleotide-directed double-strand break repair in plasmids of Escherichia coli: a method for site-specific mutagenesis” Proc. Natl. Acad. Sci. USA, 83:7177-7181, and in Arnold (1993) “Protein engineering for unusual environments” Current Opinion in Biotechnology 4:450-455). Mutagenesis using repair-deficient host strains is described, e.g., in Carter et al. (1985) “Improved oligonucleotide site-directed mutagenesis using M13 vectors” Nucl. Acids Res. 13: 4431-4443. Mutagenesis by total gene synthesis is described e.g., by Nambiar et al. (1984) “Total synthesis and cloning of a gene coding for the ribonuclease S protein” Science 223: 1299-1301. DNA shuffling is described, e.g., by Stemmer (1994) “Rapid evolution of a protein in vitro by DNA shuffling” Nature 370:389-391, and Stemmer (1994) “DNA shuffling by random fragmentation and reassembly: In vitro recombination for molecular evolution.” Proc. Natl. Acad. Sci. USA 91:10747-10751).

[0054] Many of the above methods are further described in Methods in Enzymology Volume 154, which also describes useful controls for trouble-shooting problems with various mutagenesis methods. Kits for mutagenesis, library construction and other diversity generation methods are also commercially available. For example, kits are available from, e.g., Amersham International plc (e.g., using the Eckstein method above), Anglian Biotechnology Ltd (e.g., using the Carter/Winter method above), Bio/Can Scientific, Bio-Rad (e.g., using the Kunkel method described above), Boehringer Mannheim Corp., Clonetech Laboratories, DNA Technologies, Epicentre Technologies (e.g., the 5 prime 3 prime kit); Genpak Inc, Lemargo Inc, Life Technologies (Gibco BRL), New England Biolabs, Pharmacia Biotech, Promega Corp., Quantum Biotechnologies, Stratagene (e.g., QuickChange™ site-directed mutagenesis kit; and Chameleon™ double-stranded, site-directed mutagenesis kit).

[0055] Determining Sequence Relationships

[0056] A variety of methods for determining relationships between two or more sequences (e.g., identity, similarity and/or homology) are available, and well known in the art. The methods include manual alignment, computer assisted sequence alignment and combinations thereof. A number of algorithms (which are generally computer implemented) for performing sequence alignment are widely available, or can be produced by one of skill. These methods include, e.g., the local homology algorithm of Smith and Waterman (1981) Adv. Appl. Math. 2:482; the homology alignment algorithm of Needleman and Wunsch (1970) J. Mol. Biol. 48:443; the search for similarity method of Pearson and Lipman (1988) Proc. Natl. Acad. Sci. (USA) 85:2444; and/or by computerized implementations of these algorithms (e.g., GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package Release 7.0, Genetics Computer Group, 575 Science Dr., Madison, Wis.).

[0057] For example, software for performing sequence identity (and sequence similarity) analysis using the BLAST algorithm is described in Altschul et al. (1990) J. Mol. Biol. 215:403-410. This software is publicly available, e.g., through the National Center for Biotechnology Information on the World Wide Web at ncbi.nlm.nih.gov. This algorithm involves first identifying high scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence, which either match or satisfy some positive-valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighborhood word score threshold. These initial neighborhood word hits act as seeds for initiating searches to find longer HSPs containing them. The word hits are then extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Cumulative scores are calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues; always >0) and N (penalty score for mismatching residues; always <0). For amino acid sequences, a scoring matrix is used to calculate the cumulative score. Extension of the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached. The BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment. The BLASTN program (for nucleotide sequences) uses as defaults a wordlength (W) of 11, an expectation (E) of 10, a cutoff of 100, M=5, N=−4, and a comparison of both strands. For amino acid sequences, the BLASTP (BLAST Protein) program uses as defaults a wordlength (W) of 3, an expectation (E) of 10, and the BLOSUM62 scoring matrix (see, Henikoff & Henikoff (1989) Proc. Natl. Acad. Sci. USA 89:10915).

[0058] Additionally, the BLAST algorithm performs a statistical analysis of the similarity between two sequences (see, e.g., Karlin & Altschul (1993) Proc. Nat'l. Acad. Sci. USA 90:5873-5787). One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance. For example, a nucleic acid is considered similar to a reference sequence (and, therefore, in this context, homologous) if the smallest sum probability in a comparison of the test nucleic acid to the reference nucleic acid is less than about 0.1, or less than about 0.01, and or even less than about 0.001.

[0059] Another example of a useful sequence alignment algorithm is PILEUP. PILEUP creates a multiple sequence alignment from a group of related sequences using progressive, pairwise alignments. It can also plot a tree showing the clustering relationships used to create the alignment. PILEUP uses a simplification of the progressive alignment method of Feng & Doolittle (1987) J. Mol. Evol. 35:351-360. The method used is similar to the method described by Higgins & Sharp (1989) CABIOS 5:151-153. The program can align, e.g., up to 300 sequences of a maximum length of 5,000 letters. The multiple alignment procedure begins with the pairwise alignment of the two most similar sequences, producing a cluster of two aligned sequences. This cluster can then be aligned to the next most related sequence or cluster of aligned sequences. Two clusters of sequences can be aligned by a simple extension of the pairwise alignment of two individual sequences. The final alignment is achieved by a series of progressive, pairwise alignments. The program can also be used to plot a dendogram or tree representation of clustering relationships. The program is run by designating specific sequences and their amino acid or nucleotide coordinates for regions of sequence comparison.

[0060] An additional example of an algorithm that is suitable for multiple DNA, or amino acid, sequence alignments is the CLUSTALW program (Thompson, J. D. et al. (1994) Nucl. Acids. Res. 22: 4673-4680). CLUSTALW performs multiple pairwise comparisons between groups of sequences and assembles them into a multiple alignment based on homology. Gap open and Gap extension penalties can be, e.g., 10 and 0.05 respectively. For amino acid alignments, the BLOSUM algorithm can be used as a protein weight matrix. See, e.g., Henikoff and Henikoff (1992) Proc. Natl. Acad. Sci. USA 89: 10915-10919.

[0061] Nucleic Acid Hybridization

[0062] Similarity between nucleic acids can also be evaluated by “hybridization” between single stranded (or single stranded regions of) nucleic acids with complementary or partially complementary polynucleotide sequences. Hybridization is a measure of the physical association between nucleic acids, typically, in solution, or with one of the nucleic acid strands immobilized on a solid support, e.g., a membrane, a bead, a chip, a filter, etc. Nucleic acid hybridization occurs based on a variety of well characterized physico-chemical forces, such as hydrogen bonding, solvent exclusion, base stacking and the like. Numerous protocols for nucleic acid hybridization are well known in the art. An extensive guide to the hybridization of nucleic acids is found in Tijssen (1993) Laboratory Techniques in Biochemistry and Molecular Biology—Hybridization with Nucleic Acid Probes, part I, chapter 2, “Overview of principles of hybridization and the strategy of nucleic acid probe assays,” (Elsevier, New York), as well as in Ausubel et al. Current Protocols in Molecular Biology (supplemented through 2001) John Wiley & Sons, New York (“Ausubel”); Sambrook et al. Molecular Cloning—A Laboratory Manual (2nd Ed.), Vol. 1-3, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., 1989 (“Sambrook”), and Berger and Kimmel Guide to Molecular Cloning Techniques, Methods in Enzymology volume 152 Academic Press, Inc., San Diego, Calif. (“Berger”). Hames and Higgins (1995) Gene Probes 1, IRL Press at Oxford University Press, Oxford, England (Hames and Higgins 1) and Hames and Higgins (1995) Gene Probes 2, IRL Press at Oxford University Press, Oxford, England (Hames and Higgins 2) provide details on the synthesis, labeling, detection and quantification of DNA and RNA, including oligonucleotides.

[0063] Conditions suitable for obtaining hybridization, including differential hybridization, are selected according to the theoretical melting temperature (Tm) between complementary and partially complementary nucleic acids. Under a given set of conditions, e.g., solvent composition, ionic strength, etc., the Tm is the temperature at which the duplex between the hybridizing nucleic acid strands is 50% denatured. That is, the Tm corresponds to the temperature corresponding to the midpoint in transition from helix to random coil; it depends on length, nucleotide composition, and ionic strength for long stretches of nucleotides.

[0064] After hybridization, unhybridized nucleic acids can be removed by a series of washes, the stringency of which can be adjusted depending upon the desired results. Low stringency washing conditions (e.g., using higher salt and lower temperature) increase sensitivity, but can product nonspecific hybridization signals and high background signals. Higher stringency conditions (e.g., using lower salt and higher temperature that is closer to the Tm) lower the background signal, typically with primarily the specific signal remaining. See, also, Rapley, R. and Walker, J. M. eds., Molecular Biomethods Handbook (Humana Press, Inc. 1998).

[0065] “Stringent hybridization wash conditions” or “stringent conditions” in the context of nucleic acid hybridization experiments, such as Southern and northern hybridizations, are sequence dependent, and are different under different environmental parameters. An extensive guide to the hybridization of nucleic acids is found in Tijssen (1993), supra, and in Hames and Higgins 1 and Hames and Higgins 2, supra.

[0066] An example of stringent hybridization conditions for hybridization of complementary nucleic acids which have more than 100 complementary residues on a filter in a Southern or northern blot is 2×SSC, 50% formamide at 42° C., with the hybridization being carried out overnight (e.g., for approximately 20 hours). An example of stringent wash conditions is a 0.2×SSC wash at 65° C. for 15 minutes (see Sambrook, supra for a description of SSC buffer). Often, the wash determining the stringency is preceded by a low stringency wash to remove signal due to residual unhybridized probe. An example low stringency wash is 2×SSC at room temperature (e.g., 20° C. for 15 minutes).

[0067] In general, a signal to noise ratio of at least 2.5×-5× (and typically higher) than that observed for an unrelated probe in the particular hybridization assay indicates detection of a specific hybridization. Detection of at least stringent hybridization between two sequences in the context of the present invention indicates relatively strong structural similarity to, e.g., the nucleic acids of the present invention provided in the sequence listings herein.

[0068] For purposes of the present invention, generally, “highly stringent” hybridization and wash conditions are selected to be about 5° C. or less lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength and pH (as noted below, highly stringent conditions can also be referred to in comparative terms). Target sequences that are closely related or identical to the nucleotide sequence of interest (e.g., “probe”) can be identified under stringent or highly stringent conditions. Lower stringency conditions are appropriate for sequences that are less complementary.

[0069] For example, in determining stringent or highly stringent hybridization (or even more stringent hybridization) and wash conditions, the hybridization and wash conditions are gradually increased (e.g., by increasing temperature, decreasing salt concentration, increasing detergent concentration and/or increasing the concentration of organic solvents, such as formamide, in the hybridization or wash), until a selected set of criteria are met. For example, the hybridization and wash conditions are gradually increased until a probe comprising one or more polynucleotide sequences or subsequences selected from SEQ ID NO:1 to SEQ ID NO:6, and/or complementary polynucleotide sequences thereof, binds to a perfectly matched complementary target (again, a nucleic acid comprising one or more nucleic acid sequences or subsequences selected from SEQ ID NO:1 to SEQ ID NO:6, and complementary polynucleotide sequences thereof), with a signal to noise ratio that is at least 2.5×, and optionally 5×, or 10×, or 100× or more as high as that observed for hybridization of the probe to an unmatched target, as desired.

[0070] Using subsequences of the derived from the nucleic acids encoding the polypeptides of the invention, novel target nucleic acids can be obtained, such target nucleic acids are also a feature of the invention. For example, such target nucleic acids include sequences that hybridize under stringent conditions to an oligonucleotide probe that encodes a unique subsequence in any of the polypeptides of the invention, e.g., SEQ ID NOs:7-12.

[0071] For example, hybridization conditions are chosen under which a target oligonucleotide that is perfectly complementary to the oligonucleotide probe hybridizes to the probe with at least about a 5-10× higher signal to noise ratio than for hybridization of the target oligonucleotide to a control nucleic acid, e.g., a nucleic acid that is not a polynucleotide sequence of SEQ ID NO:1-SEQ ID NO:6, complementary thereto, or a conservative variation thereof; a polynucleotide that encodes a polypeptide sequence of SEQ ID NO:7-SEQ ID NO:12, or conservative variations thereof; a polynucleotide sequence that hybridizes under stringent conditions thereto; or a polynucleotide sequence that is at least about 70% identical thereto.

[0072] Higher ratios of signal to noise can be achieved by increasing the stringency of the hybridization conditions such that ratios of about 15×, 20×, 30×, 50× or more are obtained. The particular signal will depend on the label used in the relevant assay, e.g., a fluorescent label, a colorimetric label, a radio active label, or the like.

[0073] Probes

[0074] Nucleic acids including one or more polynucleotide sequence of the invention are favorably used as probes for the detection of corresponding or related nucleic acids in a variety of contexts, such as the nucleic hybridization experiments discussed above. The probes can be either DNA or RNA molecules, such as restriction fragments of genomic or cloned DNA, cDNAs, amplification products, transcripts, and oligonucleotides, and can vary in length from oligonucleotides as short as about 10 nucleotides in length to chromosomal fragments or cDNAs in excess of one or more kilobases. For example, in some embodiments, a probe of the invention includes a polynucleotide sequence or subsequence selected from among SEQ ID NO:1 to SEQ ID NO:6, or sequences complementary thereto. Alternatively, polynucleotide sequences that are variants of one of the above designated sequences are used as probes. Most typically, such variants include one or a few conservative nucleotide variations. For example, pairs (or sets) of oligonucleotides can be selected, in which the two (or more) polynucleotide sequences are conservative variations of each other, wherein one polynucleotide sequence correspond identically to a first allele or allelic variant and the other(s) correspond identically to additional alleles or allelic variants. Such pairs of oligonucleotide probes are particularly useful, e.g., for allele specific hybridization experiments to detect polymorphic nucleotides. In other applications, probes are selected that are more divergent, that is probes that are at least about 70% (or about 80%, about 90%, about 95%, about 98%, or about 99%) identical are selected.

[0075] The probes of the invention, as exemplified by sequences derived from SEQ ID NO:1 through SEQ ID NO:6, can also be used to identify additional useful polynucleotide sequences according to procedures routine in the art. In one set of preferred embodiments, one or more probes, as described above, are utilized to screen libraries of expression products or chromosomal segments (i.e., expression libraries or genomic libraries) to identify clones that include sequences identical to, or with significant sequence similarity to, one or more of SEQ ID NO:1-6, i.e., allelic variants, homologues or orthologues. In turn, each of these identified sequences can be used to make probes, including pairs or sets of variant probes as described above. It will be understood that in addition to such physical methods as library screening, computer assisted bioinformatic approaches, e.g., BLAST and other sequence homology search algorithms, and the like, can also be used for identifying related polynucleotide sequences. Polynucleotide sequences identified in this manner are also a feature of the invention.

[0076] For example, oligonucleotide probes, most typically produced by well known synthetic methods, such as the solid phase phosphoramidite triester method described by Beaucage and Caruthers (1981) Tetrahedron Letts. 22(20):1859-1862, e.g., using an automated synthesizer, as described in Needham-VanDevanter et al. (1984) Nucleic Acids Res., 12:6159-6168. Purification of oligonucleotides, where necessary, is typically performed by either native acrylamide gel electrophoresis or by anion-exchange HPLC as described in Pearson and Regnier (1983) J. Chrom. 255:137-149. The sequence of the synthetic oligonucleotides can be verified using the chemical degradation method of Maxam and Gilbert (1980) in Grossman and Moldave (eds.) Academic Press, New York, Methods in Enzymology 65:499-560. Oligonucleotides can also be custom made and ordered from a variety of commercial sources known to persons of skill.

[0077] Essentially any nucleic acid can be custom ordered from any of a variety of commercial sources, such as The Midland Certified Reagent Company (mcrc@oligos.com), The Great American Gene Company (available on the World Wide Web at genco.com), ExpressGen Inc. (available on the World Wide Web at expressgen.com), Operon Technologies Inc. (Alameda, Calif.) and many others. Similarly, peptides and antibodies can be custom ordered from any of a variety of sources, such as PeptidoGenic (pkim@ccnet.com), HTI Bio-products, inc. (available on the World Wide Web at htibio.com), BMA Biomedicals Ltd (U.K.), Bio Synthesis, Inc., and many others.

[0078] As noted, in one embodiment, oligonucleotide probes of the invention include subsequences of SEQ ID NO:1 through SEQ ID NO:6, and/or complementary sequences thereof, e.g., of at least about 10 contiguous nucleotides in length. Commonly, the oligonucleotide probes are at least about 12 contiguous nucleotides in length; usually, the oligonucleotides are at least about 14 contiguous nucleotides in length; frequently, the oligonucleotides are at least about 16 contiguous nucleotides in length, and in many cases the oligonucleotides are at least about 18 contiguous nucleotides of at least one sequence selected from SEQ ID NO:1 to SEQ ID NO:6. In some cases, the oligonucleotide probes consist of a polynucleotide sequence selected from SEQ ID NO:1 through SEQ ID NO:6.

[0079] In other circumstances, e.g., relating to functional attributes of cells or organisms expressing the polynucleotides and polypeptides of the invention, probes that are polypeptides, peptides or antibodies are favorably utilized. For example, polypeptides, polypeptide fragments and peptides corresponding to, or derived from SEQ ID NO:7 to SEQ ID NO:12, are favorably used to identify and isolate antibodies or other binding proteins, e.g., from phage display libraries, combinatorial libraries, polyclonal sera, and the like.

[0080] Antibodies specific for any one of SEQ ID NO:7 to SEQ ID NO:12 are likewise valuable as probes for evaluating expression products, e.g., from cells or tissues. In addition, antibodies are particularly suitable for evaluating expression of proteins corresponding to SEQ ID NOs7-12, in situ, in a cell, tissue or organism, e.g., an organism providing an experimental model of cholesterol homeostasis. Antibodies can be directly labeled with a detectable reagent as described below, or detected indirectly by labeling of a secondary antibody specific for the heavy chain constant region (i.e., isotype) of the specific antibody. Additional details regarding production of specific antibodies are provided below in the section entitled “Antibodies.”

[0081] Labeling and Detecting Probes

[0082] Numerous methods are available for labeling and detection of the nucleic acid and polypeptide (or peptide or antibody) probes of the invention, these include: 1) Fluorescence (using, e.g., fluorescein, Cy-5, rhodamine or other fluorescent tags); 2) Isotopic methods, e.g., using end-labeling, nick translation, random priming, or PCR to incorporate radioactive isotopes into the probe polynucleotide/oligonucleotide; 3) Chemifluorescence using Alkaline Phosphatase and the substrate AttoPhos (Amersham) or other substrates that produce fluorescent products; 4) Chemiluminescence (using either Horseradish Peroxidase and/or Alkaline Phosphatase with substrates that produce photons as breakdown products, kits providing reagents and protocols are available from such commercial sources as Amersham, Boehringer-Mannheim, and Life Technologies/Gibco BRL); and, 5) Colorimetric methods (again using both Horseradish Peroxidase and Alkaline Phosphatase with substrates that produce a colored precipitate, kits are available from Life Technologies/Gibco BRL, and Boehringer-Mannheim). Other methods for labeling and detection will be readily apparent to one skilled in the art.

[0083] More generally, a probe can be labeled with any composition detectable by spectroscopic, photochemical, biochemical, immunochemical, electrical, optical, chemical or other available means. Useful labels in the present invention include spectral labels such as fluorescent dyes (e.g., fluorescein isothiocyanate, Texas red, rhodamine, and the like), radiolabels (e.g., 3H, 125I, 35S, 14C, 32P, 33P, etc.), enzymes (e.g., horse-radish peroxidase, alkaline phosphatase, etc.), spectral colorimetric labels such as colloidal gold or colored glass or plastic (e.g. polystyrene, polypropylene, latex, etc.) beads. The label may be coupled directly or indirectly to a component of the detection assay (e.g., a probe, such as an oligonucleotide, isolated DNA, amplicon, restriction fragment, or the like) according to methods well known in the art. As indicated above, a wide variety of labels may be used, with the choice of label depending on sensitivity required, ease of conjugation with the compound, stability requirements, available instrumentation, and disposal provisions. In general, a detector which monitors a probe-target nucleic acid hybridization is adapted to the particular label which is used. Typical detectors include spectrophotometers, phototubes and photodiodes, microscopes, scintillation counters, cameras, film and the like, as well as combinations thereof. Examples of suitable detectors are widely available from a variety of commercial sources known to persons of skill. Commonly, an optical image of a substrate comprising a nucleic acid array with particular set of probes bound to the array is digitized for subsequent computer analysis.

[0084] Because incorporation of radiolabeled nucleotides into nucleic acids is straightforward, this detection represents one favorable labeling strategy. Exemplar technologies for incorporating radiolabels include end-labeling with a kinase or phoshpatase enzyme, nick translation, incorporation of radio-active nucleotides with a polymerase and many other well known strategies.

[0085] Fluorescent labels are desirable, having the advantage of requiring fewer precautions in handling, and being amenable to high-throughput visualization techniques. Preferred labels are typically characterized by one or more of the following: high sensitivity, high stability, low background, low environmental sensitivity and high specificity in labeling. Fluorescent moieties, which are incorporated into the labels of the invention, are generally are known, including Texas red, fluorescein isothiocyanate, rhodamine, etc. Many fluorescent tags are commercially available from SIGMA chemical company (Saint Louis, Mo.), Molecular Probes (Eugene, Oreg.), R&D systems (Minneapolis, Minn.), Pharmacia LKB Biotechnology (Piscataway, N.J.), CLONTECH Laboratories, Inc. (Palo Alto, Calif.), Chem Genes Corp., Aldrich Chemical Company (Milwaukee, Wis.), Glen Research, Inc., GIBCO BRL Life Technologies, Inc. (Gaithersberg, Md.), Fluka Chemica-Biochemika Analytika (Fluka Chemie AG, Buchs, Switzerland), and Applied Biosystems (Foster City, Calif.) as well as other commercial sources known to one of skill. Similarly, moieties such as digoxygenin and biotin, which are not themselves fluorescent but are readily used in conjunction with secondary reagents, i.e., anti-digoxygenin antibodies, avidin (or streptavidin), that can be labeled, are suitable as labeling reagents in the context of the probes of the invention.

[0086] The label is coupled directly or indirectly to a molecule to be detected (a product, substrate, enzyme, or the like) according to methods well known in the art. As indicated above, a wide variety of labels are used, with the choice of label depending on the sensitivity required, ease of conjugation of the compound, stability requirements, available instrumentation, and disposal provisions. Non-radioactive labels are often attached by indirect means. Generally, a ligand molecule (e.g., biotin) is covalently bound to a nucleic acid such as a probe, primer, amplicon, or the like. The ligand then binds to an anti-ligand (e.g., streptavidin) molecule which is either inherently detectable or covalently bound to a signal system, such as a detectable enzyme, a fluorescent compound, or a chemiluminescent compound. A number of ligands and anti-ligands can be used. Where a ligand has a natural anti-ligand, for example, biotin, thyroxine, and cortisol, it can be used in conjunction with labeled, anti-ligands. Alternatively, any haptenic or antigenic compound can be used in combination with an antibody. Labels can also be conjugated directly to signal generating compounds, e.g., by conjugation with an enzyme or fluorophore or chromophore. Enzymes of interest as labels will primarily be hydrolases, particularly phosphatases, esterases and glycosidases, or oxidoreductases, particularly peroxidases. Fluorescent compounds include fluorescein and its derivatives, rhodamine and its derivatives, dansyl, umbelliferone, etc. Chemiluminescent compounds include luciferin, and 2,3-dihydrophthalazinediones, e.g., luminol. Means of detecting labels are well known to those of skill in the art. Thus, for example, where the label is a radioactive label, means for detection include a scintillation counter or photographic film as in autoradiography. Where the label is optically detectable, typical detectors include microscopes, cameras, phototubes and photodiodes and many other detection systems which are widely available.

[0087] It will be appreciated that probe design is influenced by the intended application. For example, where several allele-specific probe-target interactions are to be detected in a single assay, e.g., on a single DNA chip, it is desirable to have similar melting temperatures for all of the probes. Accordingly, the length of the probes are adjusted so that the melting temperatures for all of the probes on the array are closely similar (it will be appreciated that different lengths for different probes may be needed to achieve a particular Tm where different probes have different GC contents). Although melting temperature is a primary consideration in probe design, other factors are optionally used to further adjust probe construction, such as selecting against primer self-complementarity and the like.

[0088] Marker Sets

[0089] Sets of probes, including multiple nucleic acids with polynucleotide sequences or selected from SEQ ID NO:1 through SEQ ID NO:6, or subsequences thereof, are also a feature of the invention. Such sets of probes are useful as marker sets, e.g., for predicting atherosclerosis susceptibility, identifying cell phenotype, and the like.

[0090] Marker sets of the invention favorably include any of the probe sequences described above, such as polynucleotide sequences that are conservative variations of SEQ ID NO:1 through SEQ ID NO:6, sequences complementary to SEQ ID NO:1 through SEQ ID NO:6, or which hybridize under stringent conditions, or are at least about 70% identical to one or more of SEQ ID NO:1 through SEQ ID NO:6. It will be appreciated that subsequences of SEQ ID NOs:1-6 including at least about 10 contiguous nucleotides can also be used in the context of the marker sets of the invention.

[0091] In one embodiment, the marker set of the invention is a plurality of oligonucleotides, e.g., synthetic oligonucleotides produced by the phosporamidite triester synthesis method on an automated synthesizer, as described above. For example, at least two oligonucleotides including a polynucleotide sequence of at least about 10 contiguous nucleotides of sequences selected from SEQ ID NO:1 to SEQ ID NO:6, or conservative variations thereof, can be used as a set to predict atherosclerosis susceptibility. Frequently, the oligonucleotides selected will be longer than 10 contiguous nucleotides in length, for example, oligonucleotides of at least about 12, or about 14, or about 16 or about 18, or more contiguous nucleotides are favorably employed in the marker sets of the invention.

[0092] While as few as one or two probes can constitute a marker set, it is frequently desirable to employ marker sets with more than two members. Typically, a marker set of the invention has at least about 3, often at least about 5 or more, and in one favorable embodiment, the marker set includes oligonucleotides corresponding in sequence to at least part of each of SEQ ID NO:1 through SEQ ID NO:6. In another embodiment, the marker sets are made up of expression products such as cDNAs, or amplification products corresponding to cDNA or RNA expression products.

[0093] In some applications, the marker set includes labeled nucleic acid probes as described in the preceding section. In other applications, e.g., certain array applications, a labeled nucleic acid sample is hybridized to a set of unlabeled marker nucleic acids.

[0094] The marker sets of the invention are frequently employed in the context of a polynucleotide sequence array. Any of the polynucleotide sequences of the invention, as described above, can be logically or physically arrayed to produce a useful array. For example, nucleic acids, e.g., oligonucleotides, cDNAs, amplicons, or chromosomal segments, can be physically arrayed in a solid phase or liquid phase array. Common solid phase arrays include a variety of solid substrates suitable for attaching nucleic acids in an ordered manner, such as membranes, filters, chips, beads, pins, slides, plates, etc. Common liquid phase arrays include, e.g., arrays of wells (e.g., as in microtiter trays) or containers (e.g., as in arrays of test tubes).

[0095] Nucleic acids of the marker sets are optionally immobilized, for example by direct or indirect cross-linking, to the solid support. Essentially any solid support capable of withstanding the reagents and conditions used in the particular detection assay can be utilized. For example, functionalized glass, silicon, silicon dioxide, modified silicon, any of a variety of polymers, such as (poly)tetrafluoroethylene, (poly)vinylidenedifluoride, polystyrene, polycarbonate, membranes (e.g., nylon or nitrocellulose), or combinations thereof, can all serve as the substrate for a solid phase array.

[0096] In a preferred embodiment, the array is a “chip” composed, e.g., of one of the above specified materials. Polynucleotide probes, e.g., RNA or. DNA, such as cDNA, synthetic oligonucleotides, and the like, as discussed above are adhered to the chip in a logically ordered manner, i.e., in an array. Additional details regarding methods for linking nucleic acids and proteins to a chip substrate, can be found in, e.g., U.S. Pat. No. 5,143,854 “Large Scale Photolithographic Solid Phase Synthesis of Polypeptides and Receptor Binding Screening Thereof” to Pirrung et al., issued, Sep. 1, 1992; U.S. Pat. No. 5,837,832 “Arrays of Nucleic Acid Probes on Biological Chips” to Chee et al., issued Nov. 17, 1998; U.S. Pat. No. 6,087,112 “Arrays with Modified Oligonucleotide and Polynucleotide Compositions” to Dale, issued Jul. 11, 2000; U.S. Pat. No. 5,215,882 “Method of Immobilizing Nucleic Acid on a Solid Substrate for Use in Nucleic Acid Hybridization Assays” to Bahl et al., issued Jun. 1, 1993; U.S. Pat. No. 5,707,807 “Molecular Indexing for Expressed Gene Analysis” to Kato, issued Jan. 13, 1998; U.S. Pat. No. 5,807,522 “Methods for Fabricating Microarrays of Biological Samples” to Brown et al., issued Sep. 15, 1998; U.S. Pat. No. 5,958,342 “Jet Droplet Device” to Gamble et al., issued Sep. 28, 1999; U.S. Pat. No. 5,994,076 “Methods of Assaying Differential Expression” to Chenchik et al., issued Nov. 30, 1999; U.S. Pat. No. 6,004,755 “Quantitative Microarray Hybridization Assays” to Wang, issued Dec. 21, 1999; U.S. Pat. No. No. 6,048,695 “Chemically Modified Nucleic Acids and Method for Coupling Nucleic Acids to Solid Support” to Bradley et al., issued Apr. 11, 2000; U.S. Pat. No. 6,060,240 “Methods for Measuring Relative Amounts of Nucleic Acids in a Complex Mixture and Retrieval of Specific Sequences Therefrom” to Kamb et al., issued May 9, 2000; U.S. Pat. No. No. 6,090,556 “Method for Quantitatively Determining the Expression of a Gene” to Kato, issued Jul. 18, 2000; and U.S. Pat. No. 6,040,138 “Expression Monitoring by Hybridization to High Density Oligonucleotide Arrays” to Lockhart et al., issued Mar. 21, 2000.

[0097] In addition to being able to design, build and use probe arrays using available techniques, one of skill can simply order custom-made arrays and array-reading devices from manufacturers specializing in array manufacture. For example, Affymetrix Corp., in Santa Clara, Calif. manufactures DNA VLSIP™ arrays.

[0098] In addition to marker sets made up of nucleic acid probes described above, marker sets including polypeptide, peptide, and antibody probes as discussed in the section entitled “Labeled probes” are favorably used in certain applications. As discussed above for individual probes, sets of probes including multiple members selected from SEQ ID NOs:7-12, or antibodies specific to such sequences can be used in liquid phase, or immobilized as described above with respect to nucleic acid markers.

[0099] Vectors, Promoters and Expression Systems

[0100] The present invention includes recombinant constructs incorporating one or more of the nucleic acid sequences described above. Such constructs include a vector, for example, a plasmid, a cosmid, a phage, a virus, a bacterial artificial chromosome (BAC), a yeast artificial chromosome (YAC), etc., into which one or more of the polynucleotide sequences of the invention, e.g., SEQ ID NO:1-6, or a subsequence thereof, has been inserted, in a forward or reverse orientation. For example, the inserted nucleic acid can include a chromosomal sequence or cDNA including a all or part of at least one of SEQ ID NO:1 through SEQ ID NO:6, such as a sequence originating on human chromosome 19, or a cDNA corresponding to an mRNA expression product transcribed from a polynucleotide sequence on human chromosome 19. In a preferred embodiment, the construct further comprises regulatory sequences, including, for example, a promoter, operably linked to the sequence. Large numbers of suitable vectors and promoters are known to those of skill in the art, and are commercially available.

[0101] The polynucleotides of the present invention can be included in any one of a variety of vectors suitable for generating sense or antisense RNA, and optionally, polypeptide expression products. Such vectors include chromosomal, nonchromosomal and synthetic DNA sequences, e.g., derivatives of SV40; bacterial plasmids; phage DNA; baculovirus; yeast plasmids; vectors derived from combinations of plasmids and phage DNA, viral DNA such as vaccinia, adenovirus, fowl pox virus, pseudorabies, adenovirus, adeno-associated virus, retroviruses and many others. Any vector that is capable of introducing genetic material into a cell, and, if replication is desired, which is replicable in the relevant host can be used.

[0102] In an expression vector, the polynucleotide sequence of interest is physically arranged in proximity and orientation to an appropriate transcription control sequence (promoter, and optionally, one or more enhancers) to direct mRNA synthesis. That is, the polynucleotide sequence of interest is operably linked to an appropriate transcription control sequence. Examples of such promoters include: LTR or SV40 promoter, E. coli lac or trp promoter, phage lambda PL promoter, and other promoters known to control expression of genes in prokaryotic or eukaryotic cells or their viruses. The expression vector also contains a ribosome binding site for translation initiation, and a transcription terminator. The vector optionally includes appropriate sequences for amplifying expression. In addition, the expression vectors optionally comprise one or more selectable marker genes to provide a phenotypic trait for selection of transformed host cells, such as dihydrofolate reductase or neomycin resistance for eukaryotic cell culture, or such as tetracycline or ampicillin resistance in E. coli.

[0103] Additional Expression Elements

[0104] Where translation of polypeptide encoded by a nucleic acid comprising a polynucleotide sequence of the invention is desired, additional translation specific initiation signals can improve the efficiency of translation. These signals can include, e.g., an ATG initiation codon and adjacent sequences. In some cases, for example, full-length cDNA molecules or chromosomal segments including a coding sequence incorporating, e.g., a polynucleotide sequence of SEQ ID NO:1 to SEQ ID NO:6, a translation initiation codon and associated sequence elements are inserted into the appropriate expression vector simultaneously with the polynucleotide sequence of interest. In such cases, additional translational control signals frequently are not required. However, in cases where only a polypeptide coding sequence, or a portion thereof, is inserted, exogenous translational control signals, including an ATG initiation codon is provided for expression of the relevant sequence. The initiation codon is put in the correct reading frame to ensure transcription of the polynucleotide sequence of interest. Exogenous transcriptional elements and initiation codons can be of various origins, both natural and synthetic. The efficiency of expression can be enhanced by the inclusion of enhancers appropriate to the cell system in use (Scharf D et al. (1994) Results Probl Cell Differ 20:125-62; and, Bittner et al. (1987) Methods in Enzymol 153:516-544).

[0105] Expression Hosts

[0106] The present invention also relates to host cells which are transduced with vectors of the invention, and the production of polypeptides of the invention by recombinant techniques. Host cells are genetically engineered (i.e., transduced, transformed or transfected) with a vector, such as an expression vector, of this invention. As described above, the vector can be in the form of a plasmid, a viral particle, a phage, etc. Examples of appropriate expression hosts include: bacterial cells, such as E. coli, Streptomyces, and Salmonella typhimurium; fungal cells, such as Saccharomyces cerevisiae, Pichia pastoris, and Neurospora crassa; insect cells such as Drosophila and Spodoptera frugiperda; mammalian cells such as COS, CHO, BHK, HEK 293 or Bowes melanoma; plant cells, etc.

[0107] The engineered host cells can be cultured in conventional nutrient media modified as appropriate for activating promoters, selecting transformants, or amplifying the inserted polynucleotide sequences. The culture conditions, such as temperature, pH and the like, are typically those previously used with the host cell selected for expression, and will be apparent to those skilled in the art and in the references cited herein, including, e.g., Freshney (1994) Culture of Animal Cells, a Manual of Basic Technique, third edition, Wiley- Liss, New York and the references cited therein. Expression products corresponding to the nucleic acids of the invention can also be produced in non-animal cells such as plants, yeast, fungi, bacteria and the like. In addition to Sambrook, Berger and Ausubel, details regarding cell culture can be found in Payne et al. (1992) Plant Cell and Tissue Culture in Liquid Systems John Wiley & Sons, Inc. New York, N.Y.; Gamborg and Phillips (eds) (1995) Plant Cell, Tissue and Organ Culture; Fundamental Methods Springer Lab Manual, Springer-Verlag (Berlin Heidelberg New York) and Atlas and Parks (eds) The Handbook of Microbiological Media (1993) CRC Press, Boca Raton, Fla.

[0108] In bacterial systems, a number of expression vectors can be selected depending upon the use intended for the expressed product. For example, when large quantities of a polypeptide or fragments thereof are needed for the production of antibodies, vectors which direct high level expression of fusion proteins that are readily purified are favorably employed. Such vectors include, but are not limited to, multifunctional E. coli cloning and expression vectors such as BLUESCRIPT (Stratagene), in which the coding sequence of interest, e.g., SEQ ID NO:1 through SEQ ID NO:6, can be ligated into the vector in-frame with sequences for the amino-terminal translation initiating Methionine and the subsequent 7 residues of beta-galactosidase producing a catalytically active beta galactosidase fusion protein; pIN vectors (Van Heeke & Schuster (1989) J Biol Chem 264:5503-5509); pET vectors (Novagen, Madison Wis.); and the like.

[0109] Similarly, in the yeast Saccharomyces cerevisiae a number of vectors containing constitutive or inducible promoters such as alpha factor, alcohol oxidase and PGH can be used for production of the desired expression products. For reviews, see Berger, Ausubel, and, e.g., Grant et al. (1987; Methods in Enzymology 153:516-544).

[0110] In mammalian host cells, a number expression systems, such as viral-based systems, can be utilized. For example, in cases where an adenovirus is used as an expression vector, a coding sequence is optionally ligated into an adenovirus transcription/translation complex consisting of the late promoter and tripartite leader sequence. Insertion in a nonessential E1 or E3 region of the viral genome will result in a viable virus capable of expressing the polypeptides of interest in infected host cells (Logan and Shenk (1984) Proc Natl Acad Sci 81:3655-3659). In addition, transcription enhancers, such as the rous sarcoma virus (RSV) enhancer, can be used to increase expression in mammalian host cells.

[0111] Transformed or transfected host cells containing the expression vectors described above are also a feature of the invention. The host cell can be a eukaryotic cell, such as a mammalian cell, a yeast cell, or a plant cell, or the host cell can be a prokaryotic cell, such as a bacterial cell. Introduction of the construct into the host cell can be effected by calcium phosphate transfection, DEAE-Dextran mediated transfection, electroporation, or other common techniques (Davis, L., Dibner, M., and Battey, I. (1986) Basic Methods in Molecular Biology).

[0112] A host cell strain is optionally chosen for its ability to modulate the expression of the inserted sequences or to process the expressed protein in the desired fashion. Such modifications of the protein include, but are not limited to, acetylation, carboxylation, glycosylation, phosphorylation, lipidation and acylation. Post-translational processing which cleaves a precursor form into a mature form of the protein is sometimes important for correct insertion, folding and/or function. Different host cells such as COS, CHO, HeLa, BHK, MDCK, 293, W138, etc. have specific cellular machinery and characteristic mechanisms for such post-translational activities and can be chosen to ensure the correct modification and processing of the introduced, foreign protein.

[0113] For long-term, high-yield production of recombinant proteins encoded by or having subsequences encoded by the polynucleotides of the invention, stable expression systems are typically used. For example, cell lines which stably express a polypeptide of the invention are transfected using expression vectors which contain viral origins of replication or endogenous expression elements and a selectable marker gene. Following the introduction of the vector, cells are allowed to grow for 1-2 days in an enriched media before they are switched to selective media. The purpose of the selectable marker is to confer resistance to selection, and its presence allows growth and recovery of cells which successfully express the introduced sequences. For example, resistant clumps of stably transformed cells can be proliferated using tissue culture techniques appropriate to the cell type.

[0114] Host cells transformed with a nucleotide sequence encoding a polypeptide of the invention are optionally cultured under conditions suitable for the expression and recovery of the encoded protein from cell culture. The protein or fragment thereof produced by a recombinant cell can be secreted, membrane-bound, or contained intracellularly, depending on the sequence and/or the vector used.

[0115] Polypeptide Production and Recovery

[0116] Following transduction of a suitable host cell line or strain and growth of the host cells to an appropriate cell density, the selected promoter is induced by appropriate means (e.g., temperature shift or chemical induction) and cells are cultured for an additional period. The secreted polypeptide product is then recovered from the culture medium. Alternatively, cells can be harvested by centrifugation, disrupted by physical or chemical means, and the resulting crude extract retained for further purification. Eukaryotic or microbial cells employed in expression of proteins can be disrupted by any convenient method, including freeze-thaw cycling, sonication, mechanical disruption, or use of cell lysing agents, or other methods, which are well know to those skilled in the art.

[0117] Expressed polypeptides can be recovered and purified from recombinant cell cultures by any of a number of methods well known in the art, including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography (e.g., using any of the tagging systems noted herein), hydroxylapatite chromatography, and lectin chromatography. Protein refolding steps can be used, as desired, in completing configuration of the mature protein. Finally, high performance liquid chromatography (HPLC) can be employed in the final purification steps. In addition to the references noted above, a variety of purification methods are well known in the art, including, e.g., those set forth in Sandana (1997) Bioseparation of Proteins, Academic Press, Inc.; and Bollag et al. (1996) Protein Methods, 2nd Edition Wiley-Liss, NY; Walker (1996) The Protein Protocols Handbook Humana Press, NJ, Harris and Angal (1990) Protein Purification Applications: A Practical Approach IRL Press at Oxford, Oxford, England; Harris and Angal Protein Purification Methods: A Practical Approach IRL Press at Oxford, Oxford, England; Scopes (1993) Protein Purification: Principles and Practice 3rd Edition Springer Verlag, NY; Janson and Ryden (1998) Protein Purification: Principles, High Resolution Methods and Applications, Second Edition Wiley-VCH, NY; and Walker (1998) Protein Protocols on CD-ROM Humana Press, NJ.

[0118] Alternatively, cell-free transcription/translation systems can be employed to produce polypeptides corresponding to SEQ ID NO:7 through SEQ ID NO:12, variants thereof, e.g., conservatively modified variants, and fragments thereof, using DNAs or RNAs of the present invention, e.g., SEQ ID NOs:1-6, and conservatively modified variants thereof. A number of suitable in vitro transcription and translation systems are commercially available. A general guide to in vitro transcription and translation protocols is found in Tymms (1995) In vitro Transcription and Translation Protocols: Methods in Molecular Biology Volume 37, Garland Publishing, NY.

[0119] In addition, the polypeptides, or subsequences thereof, e.g., subsequences comprising antigenic peptides, can be produced manually or by using an automated system, by direct peptide synthesis using solid-phase techniques (see, Stewart et al. (1969) Solid-Phase Peptide Synthesis, W H Freeman Co, San Francisco; Merrifield J (1963) J. Am. Chem. Soc. 85:2149-2154). Exemplary automated systems include the Applied Biosystems 431A Peptide Synthesizer (Perkin Elmer, Foster City, Calif.). If desired, subsequences can be chemically synthesized separately, and combined using chemical methods to provide full-length polypeptides.

[0120] Conservatively Modified Variations

[0121] The polypeptides of the present invention include conservatively modified variations of SEQ ID NO:7 to SEQ ID NO:12. Such conservatively modified variations comprise substitutions, additions or deletions which alter, add or delete a single amino acid or a small percentage of amino acids (typically less than about 5%, more typically less than about 4%, about 2%, or about 1%) in any of SEQ ID NO:7 to SEQ ID NO:12. Typically, substitutions of amino acids are conservative substitutions according to the six substitution groups set forth in Table 1 (supra).

[0122] A conservatively substituted variation of the polypeptide identified herein as SEQ ID NO:7 will contain “conservative substitutions”, according to the six groups defined above, in up to 35 residues (i.e., 5% of the amino acids) in the 706 amino acid polypeptide.

[0123] For example, if four conservative substitutions were localized in the region corresponding to amino acids 2-26 of SEQ ID NO:7, examples of conservatively substituted variations of this region,

[0124] GDERP HYYGK HGTPQ KYDPT FKGPI include:

[0125] GDDRP HFYGK HGTPQ KYDPS FKGPL and

[0126] GEERP HYFGK HGTPQ KYDPA FRGPI and the like, in accordance with the conservative substitutions listed in Table 1 (in the above example, conservative substitutions are underlined). Listing of a protein sequence herein, in conjunction with the above substitution table, provides an express listing of all conservatively substituted proteins.

[0127] Finally, the addition of sequences which do not alter the encoded activity of a nucleic acid molecule, such as the addition of a non-functional sequence, is a conservative variation of the basic nucleic acid.

[0128] The polypeptides of the invention, including conservatively substituted sequences, can be present as part of larger polypeptide sequences such as occur upon the addition of one or more domains for purification of the protein (e.g., poly his segments, FLAG tag segments, etc.), e.g., where the additional functional domains have little or no effect on the activity of the protein, or where the additional domains can be removed by post synthesis processing steps such as by treatment with a protease.

[0129] Modified Amino Acids

[0130] Expressed polypeptides of the invention can contain one or more modified amino acid. The presence of modified amino acids can be advantageous in, for example, (a) increasing polypeptide serum half-life, (b) reducing polypeptide antigenicity, (c) increasing polypeptide storage stability. Amino acid(s) are modified, for example, co-translationally or post-translationally during recombinant production (e.g., N-linked glycosylation at N-X-S/T motifs during expression in mammalian cells) or modified by synthetic means (e.g., via PEGylation).

[0131] Non-limiting examples of a modified amino acid include a glycosylated amino acid, a sulfated amino acid, a prenlyated (e.g., farnesylated, geranylgeranylated) amino acid, an acetylated amino acid, an acylated amino acid, a PEG-ylated amino acid, a biotinylated amino acid, a carboxylated amino acid, a phosphorylated amino acid, and the like, as well as amino acids modified by conjugation to, e.g., lipid moieties or other organic derivatizing agents. References adequate to guide one of skill in the modification of amino acids are replete throughout the literature. Example protocols are found in Walker (1998) Protein Protocols on CD-ROM Human Press, Towata, N.J.

[0132] Antibodies

[0133] The polypeptides of the invention can be used to produce antibodies specific for the polypeptides of SEQ ID NO:7-SEQ ID NO:12, and conservative variants thereof. Antibodies specific for, e.g., SEQ ID NOs:7-12, and related variant polypeptides are useful, e.g., for diagnostic and therapeutic purposes, e.g., related to the activity, distribution, and expression of target polypeptides. For example, antibodies that block receptor binding, are useful for certain therapeutic applications.

[0134] Antibodies specific for the polypeptides of the invention can be generated by methods well known in the art. Such antibodies can include, but are not limited to, polyclonal, monoclonal, chimeric, humanized, single chain, Fab fragments and fragments produced by an Fab expression library.

[0135] Polypeptides do not require biological activity for antibody production. However, the polypeptide or oligopeptide is antigenic. Peptides used to induce specific antibodies typically have an amino acid sequence of at least about 10 amino acids, and often at least about 15 or about 20 amino acids. Short stretches of a polypeptide, e.g., selected from among SEQ ID NO:7-SEQ ID NO:12, can be fused with another protein, such as keyhole limpet hemocyanin, and antibody produced against the chimeric molecule.

[0136] Numerous methods for producing polyclonal and monoclonal antibodies are known to those of skill in the art, and can be adapted to produce antibodies specific for the polypeptides of the invention, e.g., corresponding to SEQ ID NO:7-SEQ ID NO:12. See, e.g., Coligan (1991) Current Protocols in Immunology Wiley/Greene, NY; and Harlow and Lane (1989) Antibodies: A Laboratory Manual Cold Spring Harbor Press, NY; Stites et al. (eds.) Basic and Clinical Immunology (4th ed.) Lange Medical Publications, Los Altos, Calif., and references cited therein; Goding (1986) Monoclonal Antibodies: Principles and Practice (2d ed.) Academic Press, New York, N.Y.; Fundamental Immunology, e.g., 4th Edition (or later),W. E. Paul (ed.), Raven Press, N.Y. (1998); and Kohler and Milstein (1975) Nature 256: 495-497. Other suitable techniques for antibody preparation include selection of libraries of recombinant antibodies in phage or similar vectors. See, Huse et al. (1989) Science 246: 1275-1281; and Ward, et al. (1989) Nature 341: 544-546. Specific monoclonal and polyclonal antibodies and antisera will usually bind with a KD of at least about 0.1 μM, preferably at least about 0.01 μM or better, and most typically and preferably, 0.001 μM or better.

[0137] For certain therapeutic applications, humanized antibodies are desirable. Detailed methods for preparation of chimeric (humanized) antibodies can be found in U.S. Pat. No, 5,482,856. Additional details on humanization and other antibody production and engineering techniques can be found in Borrebaeck (ed) (1995) Antibody Engineering, 2nd Edition Freeman and Company, NY (Borrebaeck); McCafferty et al. (1996) Antibody Engineering, A Practical Approach IRL at Oxford Press, Oxford, England (McCafferty), and Paul (1995) Antibody Engineering Protocols Humana Press, Towata, N.J. (Paul). Additional details regarding specific procedures can be found, e.g., in Ostberg et al. (1983), Hybridoma 2: 361-367, Ostberg, U.S. Pat. No. 4,634,664, and Engelman et al., U.S. Pat. No. 4,634,666.

[0138] Defining Polypeptides by Immunoreactivity

[0139] The polypeptides of the invention listed in the sequence listing herein, as well as novel variants derived therefrom, which are also encompassed within the present invention, provide a variety of structural features which can be recognized, e.g., in immunological assays. The generation of antisera which specifically binds the polypeptides of the invention, as well as the polypeptides which are bound by such antisera, are a feature of the invention.

[0140] The invention includes polypeptides that specifically bind to or that are specifically immunoreactive with an antibody or antisera generated against an immunogen comprising an amino acid sequence selected from one or more of SEQ ID NO:7 to SEQ ID NO:12. To eliminate cross-reactivity with non-related polypeptides, the antibody or antisera can be subtracted with unrelated polypeptides or proteins.

[0141] In one typical format, the immunoassay uses a polyclonal antiserum which was raised against one or more polypeptide comprising one or more of the sequences corresponding to one or more of: SEQ ID NO:7 to SEQ ID NO:12, or a subsequence thereof (e.g., a substantial subsequence including at least about 30% of the full length sequence provided). Such an antigenic peptide or polypeptide is referred to as an “immunogenic polypeptide.” The resulting antisera is optionally selected to have low cross-reactivity against unrelated polypeptides, e.g., BSA, and any such cross-reactivity can be removed by immunoabsorbtion with one or more of the unrelated polypeptides, or protein preparations, prior to use of the polyclonal antiserum in the immunoassay.

[0142] In order to produce antisera for use in an immunoassay, one or more of the immunogenic polypeptides is produced and purified as described herein. For example, recombinant protein may be produced in a mammalian cell line. An inbred strain of mice (used in this assay because results are more reproducible due to the virtual genetic identity of the mice) is immunized with the immunogenic protein(s) in combination with a standard adjuvant, such as Freund's adjuvant, and a standard mouse immunization protocol (see, Harlow and Lane (1988) Antibodies, A Laboratory Manual, Cold Spring Harbor Publications, New York, for a standard description of antibody generation, immunoassay formats and conditions that can be used to determine specific immunoreactivity). Alternatively, one or more synthetic or recombinant polypeptide derived from the sequences disclosed herein is conjugated to a carrier protein and used as an immunogen.

[0143] Polyclonal sera are collected and titered against the immunogenic polypeptide in an immunoassay, for example, a solid phase immunoassay with one or more of the immunogenic proteins immobilized on a solid support. Polyclonal antisera with a titer of 106 or greater are selected, pooled and subtracted with the control unrelated polypeptides to produce subtracted pooled titered polyclonal antisera.

[0144] If desired, the subtracted pooled titered polyclonal antisera are tested for cross reactivity against any unrelated polypeptides. Discriminatory binding conditions are determined for the subtracted titered polyclonal antisera which result in at least about a 5-10 fold higher signal to noise ratio for binding of the titered polyclonal antisera to the immunogenic polypeptide of interest as compared to binding to the unrelated polypeptide. That is, the stringency of the binding reaction is adjusted by the addition of non-specific competitors such as albumin or non-fat dry milk, or by adjusting salt conditions, temperature, or the like. These binding conditions are used in subsequent assays for determining whether a test polypeptide is specifically bound by the pooled subtracted polyclonal antisera. In particular, test polypeptides which show at least a 2-5× and preferably 10× or higher signal to noise ratio than the control polypeptides under discriminatory binding conditions, and at least about a ½ signal to noise ratio as compared to the immunogenic polypeptide(s) (and typically 90% or more of the signal to noise ratio shown for the immunogenic peptide), shares substantial structural similarity with the immunogenic polypeptide as compared to unrelated polypeptides, and is, therefore, a polypeptide of the invention.

[0145] Such methods are also useful for detecting an unknown test protein or polypeptide, which is also specifically bound by the antisera under conditions as described above. In one format, the immunogenic polypeptide(s) are immobilized to a solid support which is exposed to the subtracted pooled antisera. Test proteins are added to the assay to compete for binding to the pooled subtracted antisera. The ability of the test protein(s) to compete for binding to the pooled subtracted antisera as compared to the immobilized protein(s) is compared to the ability of the immunogenic polypeptide(s) added to the assay to compete for binding (the immunogenic polypeptides compete effectively with the immobilized immunogenic polypeptides for binding to the pooled antisera). The percent cross-reactivity for the test proteins is calculated, using standard calculations.

[0146] In a parallel assay, the ability of the control proteins to compete for binding to the pooled subtracted antisera is determined as compared to the ability of the immunogenic polypeptide(s) to compete for binding to the antisera. Again, the percent cross-reactivity for the control polypeptides is calculated, using standard calculations. Where the percent cross-reactivity is at least 5-10× as high for the test polypeptides, the test polypeptides are said to specifically bind the pooled subtracted antisera.

[0147] In general, the immunoabsorbed and pooled antisera can be used in a competitive binding immunoassay as described herein to compare any test polypeptide to the immunogenic polypeptide(s). In order to make this comparison, the two polypeptides are each assayed at a wide range of concentrations and the amount of each polypeptide required to inhibit 50% of the binding of the subtracted antisera to the immobilized protein is determined using standard techniques. If the amount of the test polypeptide required is less than twice the amount of the immunogenic polypeptide that is required, then the test polypeptide is said to specifically bind to an antibody generated to the immunogenic protein, provided the amount is at least about 5-10× as high as for a control polypeptide.

[0148] As a final determination of specificity, the pooled antisera is optionally fully immunosorbed with the immunogenic polypeptide(s) (rather than the control polypeptides) until little or no binding of the resulting immunogenic polypeptide subtracted pooled antisera to the immunogenic polypeptide(s) used in the immunosorbtion is detectable. This fully immunosorbed antisera is then tested for reactivity with the test polypeptide. If little or no reactivity is observed (i.e., no more than 2× the signal to noise ratio observed for binding of the fully immunosorbed antisera to the immunogenic polypeptide), then the test polypeptide is specifically bound by the antisera elicited by the immunogenic protein.

[0149] Predicting Atherosclerosis Susceptibility

[0150] The probes and marker sets of the invention are favorably employed in methods for predicting atherosclerosis susceptibility in a subject, such as a patient undergoing medical evaluation for risk of atherosclerosis or heart disease. Nucleic acids of a marker set or individual probes including one or more polynucleotides of the invention, as described, e.g., in the section entitled “Probes,” are hybridized, e.g., as an array, to a DNA or RNA sample from a subject cell or tissue sample. Upon hybridization of the sample to at least a subset of the probes, a signal is detected corresponding to at least one polymorphic nucleic acid or to expression or activity of an expression product correlatable to atherosclerosis susceptibility. When expression is detected, the evaluation can be made on a qualitative basis, that is, detecting whether or not an expression product (or multiple expression products) are expressed in a subject cell or tissue sample. Alternatively, the evaluation can be quantitative, determine whether levels.

[0151] While a variety of biological samples reflective of cholesterol metabolism can be employed, the subject sample is usually selected for ease of acquisition and to minimize invasiveness of the collection procedure to the subject. Thus, in the context of human subjects, peripheral blood samples, spinal fluid and needle biopsies from liver are preferred samples, and can be obtained by well-known procedures. In the case of certain experimental applications, e.g., using animal models, alternative samples are preferred, e.g., one or more cell-types selected from the group comprising liver, adipose tissue, gall bladder, pancreas, monocytes, macrophages, foam cells, T cells, endothelia and smooth muscle derived from blood vessels and gut, fibroblasts, glia and nerve cells, etc.

[0152] For example, a marker set including a plurality (e.g., several or all of SEQ ID NO:1 through SEQ ID NO:6) of the polynucleotides of the invention, can be hybridized individually, or as an array, to an RNA or cDNA sample produced, e.g., by a reverse transcription-polymerase chain reaction (RT-PCR), from a subject RNA sample. Typically, prior to hybridization of the probes or array to a subject or “test” sample, the probe or array is validated and/or calibrated by comparing samples obtained from classes of subjects known to differ with respect to their risk of atherosclerosis. For example, subjects shown, e.g., by metabolic assays, to be at enhanced risk of atherosclerosis are compared to subjects that show no increased risk relative to the general population.

[0153] Alternatively, a marker set including a plurality of antibodies, or other binding proteins, specific for SEQ ID NO:7-SEQ ID NO:12, are employed as individual probes or marker sets to evaluate expression of proteins corresponding to SEQ ID NO:7-SEQ ID NO:12 in a cell or tissue sample. In this case, rather than, or in addition to, preparing RNA from a sample, proteins are recovered and exposed to the probe or marker set of antibodies, in liquid phase or with either the target of antibody immobilized on a solid substrate, such as a solid phase array.

[0154] Patterns of expression correlatable to atherosclerosis susceptibility are detected by hybridization to one or more probes. In some embodiments, a single probe with a high predictive value is favored, e.g., for ease of handling and cost containment. In other embodiments multiple probes, e.g., the entire marker set, are preferred, e.g., to increase sensitivity or diagnostic or prognostic value. Optimal probes and marker sets are readily ascertained on an empirical basis.

[0155] Alternatively, an oligonucleotide or polynucleotide probe that detects sequence polymorphisms rather than expression differences between subjects in different atherosclerosis risk classes. Polymorphisms at a nucleotide level can correspond either directly or indirectly to the gene of interest underlying atherosclerosis susceptibility, and can be detected in any of several ways, for example, as restriction fragment length polymorphisms, by allele specific hybridization, as amplification length polymorphisms, and the like.

[0156] For example, oligonucleotide probes including conservative variants of a polynucleotide sequences are selected that correspond to polymorphic variations in a target sequence. For example, a probe pair incorporating a single variant nucleotide can be designed to hybridize under allele specific hybridization conditions to allelic target sequences in which one allele is indicative of atherosclerosis susceptibility and the other allele indicates a relatively reduced susceptibility. In some embodiments, the selected probes correspond to a sequence selected from among SEQ ID NO:1 through SEQ ID NO:6 and a conservative variant thereof. In some instances, for example, where the cDNA or chromosomal segment has been sequenced and a particular nucleotide polymorphism is associated with atherosclerosis susceptibility, the probes are chosen to detect the nucleotide polymorphism, e.g., by allele specific hybridization.

[0157] Modulating Cholesterol Metabolism in a Cell or Tissue

[0158] The invention also provides experimental and therapeutic methods for modulating cholesterol homeostasis in vitro and in vivo. Tissue culture and animal models useful for elucidating the molecular mechanisms underlying atherosclerosis susceptibility as well as for screening and evaluating potential therapeutic targets are produced by modulating expression or activity of polypeptides (e.g., represented by SEQ ID NO:7-SEQ ID NO:12, and conservative variants thereof) encoded by the nucleic acids of the invention.

[0159] For example, mammalian cells in culture are transfected with a polynucleotide selected from SEQ ID NO:1 through SEQ ID NO:6 to produce cells that express a polypeptide involved in cholesterol homeostasis. It will be understood, that where exogenous polynucleotide sequences are introduced into cells, tissues or organisms, that the polynucleotide sequences can be selected from among SEQ ID NO:1-6, conservative variants thereof, polynucleotide sequences encoding SEQ ID NO:7-12, or other homologous polynucleotide sequences such as polynucleotides sequences that hybridize thereto, or polynucleotides that are at least about 70% identical thereto. In some cases, it is preferable to link the polynucleotide sequence of interest to the regulatory sequences with which it is typically associated in vivo in nature. Alternatively, in cases where constitutive expression at levels that are in excess of those found in nature is desired, exogenous promoters and enhancers can be employed, as described in detail in the section entitled “Vectors, Promoters and Expression Systems.”

[0160] Expression and/or activity of the gene or polypeptide can also be modulated in a negative manner, that is, suppressed. For example, knock out mutations can be produced by homologous recombination of an exogenous gene homologue, e.g., bearing stop codon, and/or insertion of, e.g., a selectable marker, that disrupts production of an intact transcript. Alternatively, vectors incorporating the sequence of interest in the antisense orientation can be introduced to suppress translation at a post-transcriptional level.

[0161] Alternatively, cell lines that express polypeptides corresponding to one or more of SEQ ID NO:7-SEQ ID NO:12 into which vectors have been transduced that randomly activate expression of associated endogenous sequences upon integration can be isolated. Such vectors have been described, e.g., by Harrington et al. “Creation of genome-wide protein expression libraries using random activation of gene expression.” Nature Biotechnology 19: 440-445, which is incorporated herein by reference. Typically, the vector is constructed with a strong exogenous promoter linked to an exon and an unpaired splice donor site. Upon integration into the genome, splicing with a proximal splice-acceptor site occurs activating expression of a chimeric transcript encoding at least a portion of the endogenous gene. Cells expressing a polypeptide of interest e.g., SEQ ID NO:7-SEQ ID NO:12 can be selected by well known methods, including those based on phenotypic screening methods, antibody or receptor binding, RNA analytical methods, e.g., RT-PCR, northern analysis, MPSS, and the like. By preference, the screening is performed in a high-throughput format.

[0162] In certain embodiments, modulation of expression or activity of the polypeptide encoded by the transfected polynucleotide contributes to a detectable atherogenic lipoprotein phenotype. As described above, the atherogenic lipoprotein phenotype is characteristic result of a mutation in the atherosclerosis susceptibility locus. Thus, in one preferred embodiment, modulation of expression or activity of a polynucleotide corresponding to the atherosclerosis susceptibility locus is achieved by inducing or suppressing expression of the polynucleotide or by introducing a mutation that results in an increase or decrease in the activity of the encoded polypeptide.

[0163] The above-described methods for producing cell culture model systems can be adapted for use in the screening of therapeutic or dietary interventions, e.g., aimed at regulating cholesterol levels in subjects with ATHS mutations or other conditions which predispose to increased cholesterol or to an atherogenic lipoprotein phenotype. For example, it is desirable to select promoters and enhancers that are modulated in response to cholesterol, e.g. those regulated by the SREBP family of transcription factors. One such promoter is associated with the 3-hydroxy-3methylgutaryl CoA reductase (HMG CoA reductase) gene, which is the target of cholesterol mediated feedback regulation in vivo. Other promoters regulated by SREBP's include the promoters associated with genes encoding LDL receptor, HMG-CoA synthase, farnesyl diphosphate synthase, squalene synthase, acetyl-CoA carboxlyase, fatty acid synthase, stearoyl-CoA desaturase 1, stearoyl-CoA desaturase 2, glycerol-3-phosphate acyltransferase, and ATP-citrate lyase. See e.g. Edwards et al. (2000), Biochimica et Biophysica Acta 1529:103-113.

[0164] Following treatment with cholesterol, cholesterol analogues, cholesterol precursors, e.g., mevalonate, or other molecules that regulate cholesterol biosynthesis, e.g., statin drugs altered expression or activity can be detected at the RNA or protein level. Detection of altered levels of RNA is most conveniently accomplished by such methods as RT-PCR, MPSS, or northern analysis. Protein expression is conveniently monitored using, e.g., antibody based detection methods, such as ELISA's, immunoprecipitations, or immunohistochemical methods including Western analysis. In each of these procedures, the sample including the expressed protein of interest is reacted with an antibody (e.g., monoclonal antibody) or antiserum specific for the protein of interest. Methods for generating specific antibodies are well known and further details are provided above in the section entitled “Antibodies.”

[0165] The cell culture models can be used to identify pharmaceutical agents capable of favorably regulating the expression or activity of a polypeptide of interest, e.g., a polypeptide selected from among SEQ ID NO:7-12, in a cell culture system as described above. Most typically, this involves exposing the cells to a chemical or biological composition, e.g., a small organic molecule, or biological macromolecule such as a protein, e.g., an antibody, binding protein, or macromolecular cofactor, e.g., an apolipoprotein. Following exposure to the one or more compositions, for example, members of a chemical or biological composition library, such as a combinatorial chemical library, a library of peptide or polypeptide products expressed from a library of nucleic acids, an antibody (or other polypeptide) display library such as a phage display library, etc., modulation of the polypeptide of interest is detected. As discussed above, modulation of the polypeptide can be detected as an alteration in expression at the level of transcription or translation, or as an alteration in the activity of the encoded protein or polypeptide. In some instances, it is desirable to monitor expression or activity of multiple expression products in the same cell, or cell line. The monitored expression products can be exogenous, i.e., introduced as described above, or endogenous, such as transcripts or polypeptides whose expression or activity is dependent on the amount or activity of a polypeptide selected from SEQ ID NO:7-12.

[0166] In cases where the expression or activity of multiple products are of interest, or where the effect of a plurality of different compounds on the expression or activity of one or more expression products, e.g., screening for pharmaceutical agents as described above, the monitoring assay is conveniently performed in an array. For example, cells can be arrayed by aliquoting into the wells of a multiwell plate, e.g., a 96, 384, 1536, or other convenient format selected according to available equipment. The arrayed cells can exposed to members of a composition library, and the cells sampled and monitored by, e.g., FACS, immunohistochemisty, ELISA, etc. Alternatively, nucleic acids or proteins can be prepared from the arrayed cells, in a manual, semi-automatic or automated procedure, and the products arranged in a liquid or solid phase array for evaluation. Additional details regarding arrays are provided above in the section entitled “Marker Sets.” Alternative high throughput processing methods, such as microfluidic devices, are also available, and can favorably be employed in the context of monitoring modulation of expression products, e.g., corresponding to SEQ ID NO:1-12.

[0167] Typically, when processing and evaluating large numbers of samples, e.g., in a high throughput assay, data relating to expression or activity is recorded in a database, typically the database includes a character strings representing the data recorded on a computer or in a computer readable medium.

[0168] In addition to tissue culture systems, transgenic animals, most typically non-human mammals, can be produced which have integrated one or more of the polynucleotide sequences of the invention, e.g., selected from SEQ ID NO:1 to SEQ ID NO:6. In this context, commonly used experimental animals include, e.g., mouse, rat, rabbit (e.g., New Zealand White), dog, pig, sheep, or a non-human primate. In some cases the animal of choice has a naturally occurring or introduced mutation in a gene which encodes a protein involved in cholesterol homeostasis (e.g., an ApoE deficient mouse).

[0169] Such transgenic animal models are useful, in addition to the cultured cells discussed above, for the evaluation of pharmaceutical agents suitable for the modulation of cholesterol homeostasis. Transgenic animal models, e.g., expressing a polypeptide selected from SEQ ID NO:7-12 are also suitable for evaluating dietary interventions aimed at regulating cholesterol homeostasis. For example, following administration of a defined diet to a transgenic animal expressing a polypeptide of the invention, cholesterol homeostasis is monitored. Monitoring can involve detecting altered expression or activity of an expression product corresponding to one or more of SEQ ID NO:1-12 as discussed above. Alternatively, standard clinical laboratory methods for detecting and evaluating cholesterol and lipoprotein profiles in the serum can be utilized. Such assays can also be adapted to evaluate cholesterol quantity and composition in other tissues and organs, e.g., liver, adipose tissue, etc.

[0170] Administration in Patients

[0171] In one aspect, the present invention provides for the administration of one or more of the nucleic acids herein, e.g., for gene therapy and/ or for the administration of a protein herein as a therapeutic agent. In addition, modulators of expression of genes encoding the nucleic acids or proteins herein and/ or activity modulators of the proteins herein can be administered to regulate cholesterol metabolism or to otherwise regulate ATHS.

[0172] Whether the therapeutic agent is a nucleic acid, a protein or a modulator of an activity of a nucleic acid or protein, administration is by any of the routes normally used for introducing a molecule into ultimate contact with blood or tissue cells. Suitable methods of administering compositions in the context of the present invention to a patient are available, and, although more than one route can be used to administer a particular composition, a particular route can provide a more immediate and more effective reaction than another route.

[0173] Pharmaceutically acceptable carriers are determined in part by the particular composition being administered, as well as by the particular method used to administer the composition. Accordingly, there is a wide variety of suitable formulations of pharmaceutical compositions of the present invention.

[0174] Formulations suitable for oral administration can consist of (a) liquid solutions, such as an effective amount of the packaged nucleic acid suspended in diluents, such as water, saline or PEG 400; (b) capsules, sachets or tablets, each containing a predetermined amount of the active ingredient, as liquids, solids, granules or gelatin; (c) suspensions in an appropriate liquid; and (d) suitable emulsions. Tablet forms can include one or more of lactose, sucrose, mannitol, sorbitol, calcium phosphates, corn starch, potato starch, tragacanth, microcrystalline cellulose, acacia, gelatin, colloidal silicon dioxide, croscarmellose sodium, talc, magnesium stearate, stearic acid, and other excipients, colorants, fillers, binders, diluents, buffering agents, moistening agents, preservatives, flavoring agents, dyes, disintegrating agents, and pharmaceutically compatible carriers. Lozenge forms can comprise the active ingredient in a flavor, usually sucrose and acacia or tragacanth, as well as pastilles comprising the active ingredient in an inert base, such as gelatin and glycerin or sucrose and acacia emulsions, gels, and the like containing, in addition to the active ingredient, carriers known in the art.

[0175] The materials, alone or in combination with other suitable components, can be made into aerosol formulations (i.e., they can be “nebulized”) to be administered via inhalation. Aerosol formulations can be placed into pressurized acceptable propellants, such as dichlorodifluoromethane, propane, nitrogen, and the like.

[0176] Suitable formulations for rectal administration include, for example, suppositories, which consist of the packaged nucleic acid with a suppository base. Suitable suppository bases include natural or synthetic triglycerides or paraffin hydrocarbons. In addition, it is also possible to use gelatin rectal capsules which consist of a combination of materials with a base, including, for example, liquid triglycerides, polyethylene glycols, and paraffin hydrocarbons.

[0177] Formulations suitable for parenteral administration, such as, for example, by intraarticular (in the joints), intravenous, intramuscular, intradermal, intraperitoneal, and subcutaneous routes, include aqueous and non-aqueous, isotonic sterile injection solutions, which can contain antioxidants, buffers, bacteriostats, and solutes that render the formulation isotonic with the blood of the intended recipient, and aqueous and non-aqueous sterile suspensions that can include suspending agents, solubilizers, thickening agents, stabilizers, and preservatives. Parenteral administration and intravenous administration are one class of preferred methods of administration. Formulations can be presented in unit-dose or multi-dose sealed containers, such as ampules and vials.

[0178] Injection solutions and suspensions can be prepared from sterile powders, granules, and tablets. Cells transduced by expression vectors or gene therapy vectors (e.g., in the context of ex vivo gene therapy) can also be administered intravenously or parenterally as described above.

[0179] The dose administered to a patient, in the context of the present invention should be sufficient to effect a beneficial therapeutic response in the patient over time. The dose will be determined by the efficacy of the particular composition employed and the condition of the patient, as well as the body weight or surface area of the patient to be treated. The size of the dose also will be determined by the existence, nature, and extent of any adverse side-effects that accompany the administration of a particular composition (e.g., gene therapy vector, transduced cell type, protein or activity modulator) in a particular patient.

[0180] In determining an effective amount to be administered in the treatment or prophylaxis of ATHS or an associated condition, the physician evaluates circulating plasma cholesterol levels, vector toxicities, progression of disease, and, e.g., production of antibodies to the therapeutic composition.

[0181] For example, in one aspect, the dose equivalent of a naked nucleic acid encoding a nucleic acid herein is from about 0.1 μg to 1 mg for a typical 70 kilogram patient, and doses of vectors which include a gene therapy or expression vector, such as a retroviral particle, are calculated to yield an approximately equivalent amount of a nucleic acid.

[0182] In the practice of this invention, compositions can be administered, for example, by intravenous infusion, orally, topically, intraperitoneally, intravesically or intrathecally. The preferred method of administration will often be oral, rectal or intravenous, but materials can also be applied in a suitable vehicle for the local and topical treatment of related conditions. The agents of this invention can supplement treatment of ATHS related conditions by any known conventional therapy, including cholesterol metabolism regulatory agents, biologic response modifiers and the like.

[0183] For administration, compositions of the present invention can be administered at a rate determined by the LD-50 of composition and the side-effects of the composition at various concentrations, as applied to the mass and overall health of the patient. Administration can be accomplished via single or divided doses.

[0184] For ex-vivo therapy, transduced cells are prepared for reinfusion according to established methods. See, Abrahamsen et al. (1991) J. Clin. Apheresis 6:48-53; Carter et al. (1988) J. Clin. Arpheresis 4:113-117; Aebersold et al. (1988), J. Immunol. Methods 112: 1-7; Muul et al. (1987) J. Immunol. Methods 101:171-181 and Carter et al. (1987) Transfusion 27:362-365. After a period of about 2-4 weeks in culture, the cells should number between 1×108 and 1×1012. In this regard, the growth characteristics of cells vary from patient to patient and from cell type to cell type. About 72 hours prior to reinfusion of the transduced cells, an aliquot is taken for analysis of phenotype, and percentage of cells expressing the therapeutic agent.

[0185] If a patient undergoing infusion of a therapeutic composition develops fevers, chills, or muscle aches, he/she receives the appropriate dose of aspirin, ibuprofen or acetaminophen. Patients who experience reactions to the infusion such as fever, muscle aches, and chills are premedicated 30 minutes prior to the future infusions with either aspirin, acetaminophen, or diphenhydramine. Meperidine is used for more severe chills and muscle aches that do not quickly respond to antipyretics and antihistamines. Cell infusion is slowed or discontinued depending upon the severity of the reaction.

[0186] Kits and Reagents

[0187] The present invention is optionally provided to a user as a kit. For example, a kit of the invention contains one or more nucleic acid, polypeptide, antibody, or cell line described herein. Most often, the kit contains a diagnostic nucleic acid or polypeptide, e.g., antibody, probe set, e.g., as a cDNA microarray packaged in a suitable container, or other nucleic acid such as one or more expression vector. The kit typically further comprises, one or more additional reagents, e.g., substrates, labels, primers, for labeling expression products, tubes and/or other accessories, reagents for collecting samples, buffers, hybridization chambers, cover slips, etc. The kit optionally further comprises an instruction set or user manual detailing preferred methods of using the kit components for discovery or application of diagnostic gene sets.

[0188] When used according to the instructions, the kit can be used, e.g., for evaluating expression or polymorphisms in a subject sample, i.e., for evaluating atherosclerosis susceptibility, or for evaluating effects of a pharmaceutical agent or dietary intervention on cholesterol homeostasis in a cell or organism.

[0189] Digital Systems

[0190] The present invention provides digital systems, e.g., computers, computer readable media and integrated systems comprising character strings corresponding to the sequence information herein for the polypeptides and nucleic acids herein, including, e.g., those sequences listed herein and the various silent substitutions and conservative substitutions thereof. Integrated systems can further include, e.g., gene synthesis equipment for making genes corresponding to the character strings.

[0191] Various methods known in the art can be used to detect homology or similarity between different character strings, or can be used to perform other desirable functions such as to control output files, provide the basis for making presentations of information including the sequences and the like. Examples include BLAST, discussed supra. Computer systems of the invention can include such programs, e.g., in conjunction with one or more data file or data base comprising a sequence as noted herein.

[0192] Thus, different types of homology and similarity of various stringency and length can be detected and recognized in the integrated systems herein. For example, many homology determination methods have been designed for comparative analysis of sequences of biopolymers, for spell-checking in word processing, and for data retrieval from various databases. With an understanding of double-helix pair-wise complement interactions among 4 principal nucleobases in natural polynucleotides, models that simulate annealing of complementary homologous polynucleotide strings can also be used as a foundation of sequence alignment or other operations typically performed on the character strings corresponding to the sequences herein (e.g., word-processing manipulations, construction of figures comprising sequence or subsequence character strings, output tables, etc.).

[0193] Thus, standard desktop applications such as word processing software (e.g., Microsoft Word™ or Corel WordPerfect™) and database software (e.g., spreadsheet software such as Microsoft Excel™, Corel Quattro Pro™, or database programs such as Microsoft Access™ or Paradox™) can be adapted to the present invention by inputting a character string corresponding to one or more polynucleotides and polypeptides of the invention (either nucleic acids or proteins, or both). For example, a system of the invention can include the foregoing software having the appropriate character string information, e.g., used in conjunction with a user interface (e.g., a GUI in a standard operating system such as a Windows, Macintosh or LINUX system) to manipulate strings of characters corresponding to the sequences herein. As noted, specialized alignment programs such as BLAST can also be incorporated into the systems of the invention for alignment of nucleic acids or proteins (or corresponding character strings).

[0194] Systems in the present invention typically include a digital computer with data sets entered into the software system comprising any of the sequences herein. The computer can be, e.g., a PC (Intel x86 or Pentium chip-compatible DOS™, OS2™ WINDOWS™ WINDOWS NT™, WINDOWS95™, WINDOWS98™ LINUX based machine, a MACINTOSH™, Power PC, or a UNIX based (e.g., SUN™ work station) machine) or other commercially common computer which is known to one of skill. Software for aligning or otherwise manipulating sequences is available, or can easily be constructed by one of skill using a standard programming language such as Visualbasic, Fortran, Basic, Java, or the like.

[0195] Any controller or computer optionally includes a monitor which is often a cathode ray tube (“CRT”) display, a flat panel display (e.g., active matrix liquid crystal display, liquid crystal display), or others. Computer circuitry is often placed in a box which includes numerous integrated circuit chips, such as a microprocessor, memory, interface circuits, and others. The box also optionally includes a hard disk drive, a floppy disk drive, a high capacity removable drive such as a writeable CD-ROM, and other common peripheral elements. Inputting devices such as a keyboard or mouse optionally provide for input from a user and for user selection of sequences to be compared or otherwise manipulated in the relevant computer system.

[0196] The computer typically includes appropriate software for receiving user instructions, either in the form of user input into a set parameter fields, e.g., in a GUI, or in the form of preprogrammed instructions, e.g., preprogrammed for a variety of different specific operations. The software then converts these instructions to appropriate language for instructing the operation of the fluid direction and transport controller to carry out the desired operation.

[0197] The software can also include output elements for controlling nucleic acid synthesis (e.g., based upon a sequence or an alignment of a sequences herein) or other operations.

[0198] In an additional aspect, the present invention provides system kits embodying the methods, composition, systems and apparatus herein. System kits of the invention optionally comprise one or more of the following: (1) an apparatus, system, system component or apparatus component as described herein; (2) instructions for practicing the methods described herein, and/or for operating the apparatus or apparatus components herein and/or for using the compositions herein. In a further aspect, the present invention provides for the use of any apparatus, apparatus component, composition or kit herein, for the practice of any method or assay herein, and/or for the use of any apparatus or kit to practice any assay or method herein.

[0199] Molecular Techniques

[0200] In the context of the invention, nucleic acids and/or proteins are manipulated according to well known molecular biology methods. Detailed protocols for numerous such procedures are described in, e.g., in Ausubel et al. Current Protocols in Molecular Biology (supplemented through 2001) John Wiley & Sons, New York (“Ausubel”); Sambrook et al. Molecular Cloning—A Laboratory Manual (2nd Ed.), Vol. 1-3, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., 1989 (“Sambrook”), and Berger and Kimmel Guide to Molecular Cloning Techniques, Methods in Enzymology volume 152 Academic Press, Inc., San Diego, Calif. (“Berger”).

[0201] In addition to the above references, protocols for in vitro amplification techniques, such as the polymerase chain reaction (PCR), the ligase chain reaction (LCR), Q-replicase amplification, and other RNA polymerase mediated techniques (e.g., NASBA), useful e.g., for amplifying cDNA probes of the invention, are found in Mullis et al. (1987) U.S. Pat. No. 4,683,202; PCR Protocols A Guide to Methods and Applications (Innis et al. eds) Academic Press Inc. San Diego, Calif. (1990) (“Innis”); Arnheim and Levinson (1990) C&EN 36; The Journal Of NIH Research (1991) 3:81; Kwoh et al. (1989) Proc Natl Acad Sci USA 86, 1173; Guatelli et al. (1990) Proc Natl Acad Sci USA 87:1874; Lomell et al. (1989) J Clin Chem 35:1826; Landegren et al. (1988) Science 241:1077; Van Brunt (1990) Biotechnology 8:291; Wu and Wallace (1989) Gene 4: 560; Barringer et al. (1990) Gene 89:117, and Sooknanan and Malek (1995) Biotechnology 13:563. Additional methods, useful for cloning nucleic acids in the context of the present invention, include Wallace et al. U.S. Pat. No. 5,426,039. Improved methods of amplifying large nucleic acids by PCR are summarized in Cheng et al. (1994) Nature 369:684 and the references therein.

[0202] Certain polynucleotides of the invention, e.g., oligonucleotides can be synthesized utilizing various solid-phase strategies involving mononucleotide- and/or trinucleotide-based phosphoramidite coupling chemistry. For example, nucleic acid sequences can be synthesized by the sequential addition of activated monomers and/or trimers to an elongating polynucleotide chain. See e.g., Caruthers, M. H. et al. (1992) Meth Enzymol 211:3. In lieu of synthesizing the desired sequences, essentially any nucleic acid can be custom ordered from any of a variety of commercial sources, such as The Midland Certified Reagent Company (mcrc@oligos.com), The Great American Gene Company (available on the World Wide Web at genco.com), ExpressGen, Inc. (available on the World Wide Web at expressgen.com), Operon Technologies, Inc. (available on the World Wide Web at operon.com), and many others.

[0203] Similarly, commercial sources for nucleic acid and protein microarrays are available, and include, e.g., Affymetrix, Santa Clara, Calif. (available on the World Wide Web at affymetrix.com); and Agilent, Palo Alto, Calif. (available on the World Wide Web at agilent.com) Zyomyx, Hayward, Calif. (available on the World Wide Web at zyomyx.com); and Ciphergen Biosciences, Fremont, Calif. (available on the World Wide Web at ciphergen.com).

EXAMPLES

[0204] The following examples are offered to illustrate, but not to limit the claimed invention.

Example 1

[0205] Cholesterol Induced Differential Expression

[0206] Human fibroblast cells were maintained in culture in DMEM supplemented with 10% lipoprotein-deficient serum. The cells were divided into two groups representing a cholesterol induced status and a cholesterol suppressed status. The medium of the cholesterol suppressed cells (“Ncho”) was supplemented with 50 μm compactin and 10 μm mevalonate. Whereas the medium of the cholesterol induced cells (“Ycho”) was supplemented with 1 μg/ml 25-hydroxycholesterol and 10 μg/ml cholesterol. Following an incubation of 48 hours in supplemented medium, RNA was extracted from Ncho and Ycho treated cells using established procedures. cDNA libraries corresponding to the Ncho and Ycho RNA expression products were w then produced by reverse transcription, 2nd strand synthesis, restriction digestion, and cloning using established procedures. The two cDNA libararies were separately loaded onto microbeads using the Lynx Megaclone technology as described in Brenner et al., (2000) PNAS USA 97: 165-1670, and 17-base signature sequences at the GATC site upsteam of the poly(A) tail of cDNA were determined by using Lynx MPSS technology as described in, e.g., Brenner et al. (2000) Nature Biotechnology 18:630-634. Sequencing of 629,269 and 807,483 cDNA clones derived from the Ncho and Ycho treated samples, respectively, yielded a total of 24,854 unique signatures.

Example 2

[0207] Analysis of MPSS Data

[0208] Statistical analysis of the dataset, i.e. the 24,854 signatures obtained as described above, was performed using normal approximation methods, e.g., as described in “Methods for Analysis of Massively Parallel Signature Sequencing” by Jing Zhong Lin et al., filed Dec. 11, 2001, U.S. Ser. No. 60/341,030 (Attorney Docket No. 37-000700US) and “Methods for Analysis of Massively Parallel Signature Sequencing” by Jing Zhong Lin et al., filed Dec. 10, 2002, U.S. Ser. No. ______ (Attorney Docket No. 37-000710US), both of which are incorporated herein by reference, to identify signatures that exhibited a statistically significant change in abundance with either the Ncho or Ycho treatment. Those signatures shown to be differentially expressed under one of the two treatment conditions were searched using the BLAST algorithms against the NCBI NR and EST databases. A total of 722 signatures exhibited differential expression at the significance level of p<0.0001 were identified. Of these, 322 signatures were suppressed by cholesterol, and 400 signatures were induced by cholesterol.

Example 3

[0209] Mapping of MPSS Signatures to the 19P13.3-P13.2 Region

[0210] To determine which of the MPSS signatures that exhibited a significant expression change (p<0.0001) in response to cholesterol were localized to the ATHS/ALP region on chromosome 19, the 18 Mb sequence corresponding to the 19p13.3-p13.2 region was downloaded from the UCSC Human Genome Project Working Draft web site (http://genome.ucsc.edu; August 2001 freeze assembly, from the 19pter to the HSPC023 gene). Seventeen base “signature” sequences starting at the 5′ end with GATC were then extracted from the genomic sequence to generate a list of unique signature sequences that appear no more than 3 times within this 18 Mb region. 19 unique signatures out of the 722 signatures altered by cholesterol as described in EXAMPLE 2 were found to have perfect match to the signature sequences extracted from the 19p13.3-p13.2 genomic region. Each of the signatures was then searched against the genomic sequence to which it aligns to determine whether it was located in the correct position and orientation with respect to any transcription unit that also mapped to the same genomic region. In addition, blast search of each of the signatures against NCBI NR and EST databases was performed to determine whether any of the signatures mapped to multiple chromosomal locations. Of these 19 unique signatures, three signatures suppressed by cholesterol mapped to the position and were oriented in the same direction as known genes: the signature (GATCCTGGAGAGGGAGA) is mapped to the choline transporter like 2 gene (CTL2), the signature (GATCCTGGAGGACCCTG) is mapped to the gene annotated as G-protein coupled receptor kinase 7 (GPRK7, also called MAP kinase-interacting kinase 2a), and the signature (GATCCGCGACTTCAACA) is mapped to the embryonic lethal, abnormal vision, drosophila homolog-like 1 gene (ELAVL1). In addition, one signature (GATCTCAAAGACTAAGC) is mapped to a predicted gene encoding a zinc finger protein (ENSP000270543|ZINC FINGER PROTEIN). Two signatures induced by cholesterol are mapped to known genes: the signature (GATCTGCCAAGATTCTT) is mapped to the gene encoding the zinc finger protein AL136732, and the signature (GATCTGAGGGACTCCTC) is mapped to the Lamin B2 gene.

[0211] References

[0212] The following references provide additional details relevant to the foregoing.

[0213] Allayee, H.; Aouizerat, B. E.; Cantor, R. M.; Dallinga-Thie, G. M.; Krauss, R. M.; Lanning, C. D.; Rotter, J. I.; Lusis, A. J.; de Bruin, T. W. A.: Families with familial combined hyperlipidemia and families enriched for coronary artery disease share genetic determinants for the atherogenic lipoprotein phenotype. Am. J. Hum. Genet. 63: 577-585, 1998.

[0214] Austin, M. A.; Breslow, J. L.; Hennekens, C. H.; Buring, J. E.; Willett, W. C.; Krauss, R. M.: Low-density lipoprotein subclass patterns and risk of myocardial infarction. J.A.M.A. 260: 1917-1921, 1988.

[0215] Juo, S.-H. H.; Bredie, S. J. H.; Kiemeney, L. A.; Demacker, P. N. M.; Stalenhoef, A. F. H.: A common genetic mechanism determines plasma apolipoprotein B levels and dense LDL subfraction distribution in familial combined hyperlipidemia. Am. J. Hum. Genet. 63: 586-594, 1998.

[0216] Naggert, J. K.; Recinos, A., III; Lamerdin, J. E.; Krauss, R. M.; Nishina, P. M.: The atherogenic lipoprotein phenotype is not caused by a mutation in the coding region of the low density lipoprotein receptor gene. Clin. Genet. 51: 236-240, 1997.

[0217] Nishina, P. M.; Johnson, J. P.; Naggert, J. K.; Krauss, R. M.: Linkage of atherogenic lipoprotein phenotype to the low density lipoprotein receptor locus on the short arm of chromosome 19. Proc. Nat. Acad. Sci. 89: 708-712, 1992.

[0218] Rotter, J. I.; Bu, X.; Cantor, R. M.; Warden, C. H.; Brown, J.; Gray, R. J.; Blanche, P. J.; Krauss, R. M.; Lusis, A. J.: Multilocus genetic determinants of LDL particle size in coronary artery disease families. Am. J. Hum. Genet. 58: 585-594, 1996.

[0219] It is understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application and scope of the appended claims.

[0220] While the foregoing invention has been described in some detail for purposes of clarity and understanding, it will be clear to one skilled in the art from a reading of this disclosure that various changes in form and detail can be made without departing from the true scope of the invention. For example, all the techniques and apparatus described above can be used in various combinations. All publications, patents, patent applications, and/or other documents cited in this application are incorporated by reference in their entirety for all purposes to the same extent as if each individual publication, patent, patent application, and/or other document were individually indicated to be incorporated by reference for all purposes.

SEQUENCE ID TABLE:
	Gene
	Name
	Accession
SEQ ID NO:	Number	Sequence
SEQ ID NO:1	CTL2	ATGGGGGACGAGCGGCCCCACTACTACGGGAAACACGGAACGCCA
	NM_020428.1	CAGAAGTATGATCCCACTTTCAAAGGACCCATTTACAATAGGGGCT
		GCACGGATATCATATGCTGTGTGTTCCTGCTCCTGGCCATTGTGGG
		CTACGTGGCTGTAGGCATCATAGCCTGGACTCATGGAGACCCTCGA
		AAGGTGATCTACCCCACTGATAGCCGGGGCGAGTTCTGCGGGCAG
		AAGGGCACAAAAAACGAGAACAAACCCTATCTGTTTTATTTCAAC
		ATTGTGAAATGTGCCAGCCCCCTGGTTCTGCTGGAATTCCAATGTC
		CCACTCCCCAGATCTGCGTGGAAAAATGCCCCGACCGCTACCTCAC
		GTACCTGAATGCTCGCAGCTCCCGGGACTTTGAGTACTATAAGCAG
		TTCTGTGTTCCTGGCTTCAAGAACAATAAAGGAGTGGCTGAGGTGC
		TTCGAGATGGTGACTGCCCTGCTGTCCTCATCCCCAGCAAACCCTT
		GGCCCGGAGATGCTTCCCCGCTATCCACGCCTACAAGGGTGTCCTG
		ATGGTGGGCAATGAGACGACCTATGAGGATGGGCATGGCTCCCGG
		AAAAACATCACAGACCTGGTGGAGGGCGCCAAGAAAGCCAATGG
		AGTCCTAGAGGCGCGGCAACTCGCCATGCGCATATTTGAAGATTA
		CACCGTCTCTTGGTACTGGATTATCATAGGCCTGGTCATTGCCATG
		GCGATGAGCCTCCTGTTCATCATCCTGCTTCGCTTCCTGGCTGGTAT
		TATGGTCTGGGTGATGATCATCATGGTGATTCTGGTGCTGGGCTAC
		GGAATATTTCACTGCTACATGGAGTACTCCCGACTGCGTGGTGAGG
		CCGGCTCTGATGTCTCTTTGGTGGACCTCGGCTTTCAGACGGATTT
		CCGGGTGTACCTGCACTTACGGCAGACCTGGTTGGCCTTTATGATC
		ATTCTGAGTATCCTTGAAGTCATTATCATCTTGCTGCTCATCTTTCT
		CCGGAAGAGAATTCTCATCGCGATTGCACTCATCAAAGAAGCCAG
		CAGGGCTGTGGGATACGTCATGTGCTCCTTGCTCTACCCACTGGTC
		ACCTTCTTCTTGCTGTGCCTCTGCATCGCCTACTGGGCCAGCACTGC
		TGTCTTCCTGTCCACTTCCAACGAAGCGGTCTATAAGATCTTTGAT
		GACAGCCCCTGCCCATTTACTGCGAAAACCTGCAACCCAGAGACC
		TTCCCCTCCTCCAATGAGTCCCGCCAATGCCCCAATGCCCGTTGCC
		AGTTCGCCTTCTACGGTGGTGAGTCGGGCTACCACCGGGCCCTGCT
		GGGCCTGCAGATCTTCAATGCCTTCATGTTCTTCTGGTTGGCCAAC
		TTCGTGCTGGCGCTGGGCCAGGTCACGCTGGCCGGGGCCTTTGCCT
		CCTATTACTGGGCCCTGCGCAAGCCGGACGACCTGCCGGCCTTCCC
		GCTCTTCTCTGCCTTTGGCCGGGCGCTCAGGTACCACACAGGCTCC
		CTGGCCTTTGGNGCGCTCATCCTGGCCATTGTGCAGATCATCCGTG
		TGATACTCGAGTACCTGGATCAGCGGCTGAAAGGTGCAGAGAACA
		AGTTTGCCAAGTGCCTCATGACCTGTCTCAAATGCTGCTTCTGGTG
		CCTGGAGAAGTTCATCAAATTCCTTAATAGGAATGCCTACATCATG
		ATTGCCATCTACGGCACCAATTTCTGCACCTCGGCCAGGAATGCCT
		TCTTCCTGCTCATGAGAAACATCATCAGAGTGGCTGTCCTGGATAA
		AGTTACTGACTTCCTCTTCCTGTTGGGCAAACTTCTGATCGTTGGTA
		GTGTGGGGATCCTGGCTTTCTTCTTCTTCACCCACCGTATCAGGATC
		GTGCAGGATACAGCACCACCCCTCAATTATTACTGGGTTCCTATAC
		TGACGGTGATCGTTGGCTCCTACTTGATTGCACACGGTTTCTTCAG
		CGTCTATGGCATGTGTGTGGACACGCTGTTCCTCTGCTTCTTGGAG
		GACCTGGAGAGGAATGACGGCTCGGCCGAGAGGCCTTACTTCATG
		TCTTCCACCCTCAAGAAACTCTTGAACAAGACCAACAAGAAGGCA
		GCGGAGTCCTGA
SEQ ID NO:2	ELAV	ATGTCTAATGGTTATGAAGACCACATGGCCGAAGACTGCAGGGGT
	NM_001419	GACATCGGGAGAACGAATTTGATCGTCAACTACCTCCCTCAGAAC
		ATGACCCAGGATGAGTTACGAAGCCTGTTCAGCAGCATTGGTGAA
		GTTGAATCTGCAAAACTTATTCGGGATAAAGTAGCAGGACACAGC
		TTGGGCTACGGCTTTGTGAACTACGTGACCGCGAAGGATGCAGAG
		AGAGCGATCAACACGCTGAACGGCTTGAGGCTCCAGTCAAAAACC
		ATTAAGGTGTCGTATGCTCGCCCGAGCTCAGAGGTGATCAAAGAC
		GCCAACTTGTACATCAGCGGGCTCCCGCGGACCATGACCCAGAAG
		GACGTAGAAGACATGTTCTCTCGGTTTGGGCGGATCATCAACTCGC
		GGGTCCTCGTGGATCAGACTACAGGTTTGTCCAGAGGGGTTGCGTT
		TATCCGGTTTGACAAACGGTCGGAGGCAGAAGAGGCAATTACCAG
		TTTCAATGGTCATAAACCCCCAGGTTCCTCTGAGCCCATCGCAGTG
		AAGTTTGCAGCCAACCCCAACCAGAACAAAAACGTGGCACTCCTC
		TCGCAGCTGTACCACTCGCCAGCGCGACGGTTCGGAGGCCCCGTTC
		ACCACCAGGCGCAGAGATTCAGGTTCTCCCCCATGGGCGTCGATC
		ACATGAGCGGGCTCTCTGGCGTCAACGTGCCAGGAAACGCCTCCT
		CCGGCTGGTGCATTTTCATCTACAACCTGGGGCAGGATGCCGACGA
		GGGGATCCTCTGGCAGATGTTTGGGCCGTTTGGTGCCGTCACCAAT
		GTGAAAGTGATCCGCGACTTCAACACCAACAAGTGCAAAGGGTTT
		GGCTTTGTGACCATGACAAACTATGAAGAAGCCGCGATGGCCATA
		GCCAGCCTGAACGGCTACCGCCTGGGGGACAAAATCTTACAGGTT
		TCCTTCAAAACCAACAAGTCCCACAAATAA
SEQ ID NO:3	GPRK7	ATGGTGCAGAAGAAACCAGCCGAACTTCAGGGTTTCCACCGTTCG
	NM_017572	TTCAAGGGGCAGAACCCCTTCGAGCTGGCCTTCTCCCTAGACCAGC
		CCGACCACGGAGACTCTGACTTTGGCCTGCAGTGCTCAGCCCGCCC
		TGACATGCCCGCCAGCCAGCCCATTGACATCCCGGACGCCAAGAA
		GAGGGGCAAGAAGAAGAAGCGCGGCCGGGCCACCGACAGCTTCT
		CGGGCAGGTTTGAAGACGTCTACCAGCTGCAGGAAGATGTGCTGG
		GGGAGGGCGCTCATGCCCGAGTGCAGACCTGCATCAACCTGATCA
		CCAGCCAGGAGTACGCCGTCAAGATCATTGAGAAGCAGCCAGGCC
		ACATTCGGAGCAGGGTTTTCAGGGAGGTGGAGATGCTGTACCAGT
		GCCAGGGACACAGGAACGTCCTAGAGCTGATTGAGTTCTTCGAGG
		AGGAGGACCGCTTCTACCTGGTGTTTGAGAAGATGCGGGGAGGCT
		CCATCCTGAGCCACATCCACAAGCGCCGGCACTTCAACGAGCTGG
		AGGCCAGCGTGGTGGTGCAGGACGTGGCCAGCGCCTTGGACTTTC
		TGCATAACAAAGGCATCGCCCACAGGGACCTAAAGCCGGAAAACA
		TCCTCTGTGAGCACCCCAACCAGGTCTCCCCCGTGAAGATCTGTGA
		CTTCGACCTGGGCAGCGGCATCAAACTCAACGGGGACTGCTCCCCT
		ATCTCCACCCCGGAGCTGCTCACTCCGTGCGGCTCGGCGGAGTACA
		TGGCCCCGGAGTTAGTGGAGGCCTTCAGCGAGGAGGCTAGCATCT
		ACGACAAGCGCTGCGACCTGTGGAGCCTGGGCGTCATCTTGTATAT
		CCTACTCAGCGGCTACCCGCCCTTCGTGGGCCGCTGTGGCAGCGAC
		TGCGGCTGGGACCGCGGCGAGGCCTGCCCTGCCTGCGAGAACATG
		CTGTTTGAGAGCATCCAGGAGGGCAAGTACGAGTTCCCCGACAAG
		GACTGGGCCCACATCTCCTGCGCTGCCAAAGACCTCATCTCCAAGC
		TGCTGGTCCGTGACGCCAAGCAGAGGCTGAGTGCCGCCCAAGTCC
		TGCAACACCCCTGGGTTCAGGGGTGCGCCCCGGAGAACACCTTGC
		CCACTCCCATGGTCCTGCAGAGGTGGGACAGTCACTTCCTCCTCCC
		TCCCCACCCCTGTCGCATCCACGTGCGACCTGGAGGACTGGTCAGA
		ACCGTTACTGTGAATAGTGA
SEQ ID NO:4	IMAGE:4710	TTAGTGACCTTTGAGGATGTGGCTGTGGACTTTACCCAGGAGGAGT
	6365	GGACTTTGTTGGATCAAGCCCAGAGAGATCTCTACAGAGATGTGA
	BG565273.1	TGTTGGAGAACTACAAGAATCTCATTATACTAGAGAAAACTTCTGA
		GGATAATCAGAGTGGAAAAGCCTTAAGAAAGAACTTTCCTCATAG
		TTTTTACAAGAAAAGTCATGCTGAGGGGAAAATGCCTAAGTGTGTT
		AAACATGAAAAAGCCTTCAACCAGTTTCCAAATCTTACTAGGCAG
		AATAAAACTCACACACAAGAGAAATTGTGTGAATGCAAAGACTGT
		TGGAGAACTTTTCTTAATCAGTCATCCCTTAAGTTACATATAAGAT
		CTCACAATGGAGACAAACACTATGTATGTAAGGAATGTGGGAAAG
		CCTTCAGTAATTCCTCACACCTTATAGGACATGGAAGAATTCACAG
		TGGAGAGAAGCCCTATGTCTGTAAAGAATGTGGTAAAGCTTTCACT
		CAATCCACAGGACTTAAATTACACATCAGAACTCACAGTGGAGAA
		AAACCATATAAATGTAAAGAGTGTGGGAAAGCCTTCACCCATTCTT
		CATACCTTACTGATCATACAAGAATCCACAGTGGAAAGAAGCCCT
		ATGTATGTATGGAATGTGGAAAAGCCTTCACTAGATCCACAGGAC
		TTATTTTACACATGCGAATTCACACTGGAGAAAAGCCATATGAATG
		TAAGGAGTGTGGAAAAGCTTTTATTCATTCCTCATACCTTACAAAA
		CATGTAAGGATTCACAGTGGAGAGAAGCTGTATTTATGTAAGGCA
		TGTGGGAAAGCTTTTACTCGTTCCTCAGGACTTGTTTTACACATGA
		GAACACATACTGGAGAAAAGCCCTATGAATGTAAAGAATGTGGGA
		AAGCCTTTAATAATTCCTCAATGCTTAGTCAACATGTAAGGATTCA
		CACTGGAGAGAAGCCATATGAATGCAAAGAATGTGGGAAAGCTTT
		CACTCAATCCTCGGGCCTTAGTACCCATTTAAGAACTCACACTGGA
		GAAAAGGCCTGTGAATGTAAGGAATGCGGTAAAGCATTTGCTCGT
		TCCACAAATCTTAATATGCACATGCGAACGCACACAGGAGAAAAG
		CCTTATGCATGTAAAGAATGTGGGAAAGCCTTCAGGTATTCCACAT
		ACCTTAACGTTCACACACGAACTCACACTGGAGCAAAACCATATG
		AATCTCATACTGGAAAGAAATTCAAAAAGACTAAGAAATATGGGA
		AATCCTTCACTAATTTTTCTCAACTTTCTGCACATGTGAAAACTCAT
		AAAGAGGAGAAGTCCTTTGATTGTAAAGAATGTGGAATTTCCGTT
		AGAAATTCCTCATATCTTAATGATCACATTCAAACTCCAACTGGAA
		AACCACACAAATATACAGACTGTGGGAAAGCCTTCACTAGATCAA
		TTCAACTTACTGAACATGTAAGAACTCACACTGGGGTAAAACCCTA
		TGAATGTAAGGAATGTGGGAAAGCCTTCACTCAGTACACGGGCCT
		TGCTATACACTTACGAAGTCACAGTGGAGAGAAACCCTATCAGTG
		TAACAAATGTGGAAAAGCCTTCACTAGATCCTCAGGCCTTACTCAA
		CATACAATAATTCAGATGGGAGAGAAGCCTTATGAATGTGTTGAA
		TGTGGAAAAACCTTC
SEQ ID NO:5	LAMB2	AGAGTCCTGGATGAGACGGCTCGAGAGCGTGCCCGGCTGCAGATA
	M94362.1	GAGATTGGGAAGCTGAGGGCAGAGTTGGACGAGGTCAACAAGAG
		CGCCAAGAAGAGGGAGGGCGAGCTTACGGTGGCCCAGGGCCGTGT
		GAAGGACCTGGAGTCCCTGTTCCACCGGAGCGAGGTGGAGCTGGC
		AGCTGCCCTCAGCGACAAGCGCGGCCTGGAGAGTGACGTGGCTGA
		GCTGCGGGCCCAGCTGGCCAAGGCCGAGGACGGTCATGCAGTGGC
		CAAAAAGCAGCTGGAGAAGGAGACGCTGATGCGTGTGGACCTGGA
		GAACCGCTGCCAGAGCCTGCAGGAGGAGCTGGACTTCCGGAAGAG
		TGTGTTCGAGGAGGAGGTGCGGGAGACGCGGCGGCGGCACGAGC
		GGCGCCTGGTGGAGGTGGACAGCAGCCGGCAGCAGGAGTACGACT
		TCAAGATGGCACAGGCGCTGGAGGAGCTGCGGAGCCAGCACGACG
		AGCAAGTGCGGCTCTACAAGCTGGAGCTGGAGCAGACCTACCAGG
		CCAAGCTGGACAGCGCCAAGCTGAGCTCTGACCAGAACGACAAGG
		CGGCCAGTGCGGCTCGCGAGGAGCTGAAGGAGGCCCGCATGCGCC
		TGGAGTCCCTCAGCTACCAGCTCTCCGGCCTCCAGAAGCAGGCCA
		GTGCCGCTGAAGATCGCATTCGGGAGCTGGAGGAGGCCATGGCCG
		GGGAGCGGGACAAGTTCCGGAAGATGCTGGACGCCAAGGAGCAG
		GAGATGACGGAGATGCGGGACGTGATGCAGCAGCAGCTGGCCGA
		GTACCAGGAGCTGCTGGACGTGAAGCTGGCCCTGGACATGGAGAT
		CAACGCCTACCGGAAGCTCCTGGAGGGCGAGGAGGAGAGCCTGAA
		GCTGTCCCCCAGCCCATCTTCGCGCGTCACCGTCTCACGAGCCACC
		TCGAGCAGCAGCGGCAGCTTGTCCGCCACCGGGCGCCTGGGCCGC
		AGTAAGCGGAAGCGCTGGAGGTGGAGGAGCCCTTGGCAGCGGCCC
		AAGCGTCCTGGGCACGGGCACGGGTGGCAGCGGTGGCTTCCACCT
		GGCCCAGCAGGCCTCGGCCTCGGGCAGCGTCACATCGAGGAGATC
		GACCTGGAGGGCAAGTTTGTGCAGCTCAAGAACAACTCGGACAAG
		GATCAGTCTCTGGGGAACTGGAGAATCAAGAGGCAGGTCTTGGAG
		GGGGAGGAGATCGCCTACAAGTTCACGCCCAAGTACATCCTGCGG
		GCCGGCCAGATGGTCACGGTGTGGGCAGCTGGTGCGGGGGTGGCC
		CACAGCCCCCCCTCGACGCTGGTGTGGAAGGGCCAGAGCAGCTGG
		GGCACGGGCGAGAGCTTCCGCACCGTCCTGGTTAACGCGGATGGC
		GAGGAAGTGGCCATGAGGACTGTGAAGAAGTCCTCGGTGATGCGT
		GAGAATGAGAATGGGGAGGAAGAGGAGGAGGAAGCCGAGTTTGG
		CGAGGAGGATCTTTTCCACCAACAGGGGGACCCGAGGACCACCTC
		AAGAGGCTGCTACGTGATGTGA
SEQ ID NO:6	DKFZp43411	ATGCCCTGCTGTAGTCACAGGAGCTGTAGAGAGGACCCCGGTACA
	610	TCTGAAAGCCGGGAAATGGACCCAGTGGCCTTTGAGGATGTGGCT
	AL136732.1	GTGAACTTCACCCAGGAAGAGTGGACATTGCTGGATATTTCCCAG
		AAGAATCTCTTCAGGGAAGTGATGCTGGAAACTTTCAGGAACCTG
		ACCTCTATAGGAAAAAAATGGAGTGACCAGAACATTGAATATGAG
		TACCAAAACCCCAGAAGAAGCTTCAGGAGTCTCATAGAAGAGAAA
		GTCAATGAAATTAAAGAAGACAGTCATTGTGGAGAAACTTTTACC
		CAGGTTCCAGATGACAGACTGAACTTCCAGGAGAAGAAAGCTTCT
		CCTGAAGTAAAATCATGTGACAGCTTTGTGTGTGCAGAAGTTGGCA
		TAGGTAACTCATCTTTTAATATGAGCATCAGAGGTGACACTGGACA
		CAAGGCATATGAGTATCAGGAATATGGACCAAAGCCATATAAGTG
		TCAACAACCTAAAAATAAGAAAGCCTTCAGGTATCGCCCATCCATT
		AGAACACAAGAAAGGGATCACACTGGAGAGAAACCCTATGCTTGT
		AAAGTCTGTGGAAAAACCTTTATTTTCCATTCAAGCATTCGAAGAC
		ACATGGTAATGCACAGTGGGGATGGAACTTATAAATGTAAATTTT
		GTGGGAAAGCCTTCCATTCTTTCAGTTTATATCTTATCCATGAAAG
		AACTCACACTGGAGAGAAACCATATGAATGTAAACAATGTGGTAA
		ATCCTTTACTTATTCTGCTACCCTTCAAATACATGAAAGAACTCAC
		ACTGGGGAGAAGCCCTATGAATGTAGCAAATGTGATAAAGCATTT
		CATAGTTCTAGTTCCTATCATAGACATGAAAGAAGTCACATGGGA
		GAGAAGCCTTATCAATGCAAAGAATGTGGAAAAGCATTTGCATAT
		ACCAGTTCTCTTCGTAGACATGAAAGGACCCACTCTGGGAAAAAA
		CCGTATGAATGTAAGCAATATGGGGAAGGCTTATCCTATCTTATAA
		GTTTTCAAACACACATAAGAATGAACTCTGGAGAAAGACCTTATA
		AATGTAAGATATGTGGGAAAGGCTTTTATTCTGCCAAGTCATTTCA
		AACACATGAAAAAACTCACACTGGAGAGAAACGCTATAAATGCAA
		GCAATGTGGTAAAGCCTTCAATCTTTCCAGTTCCTTTCGATATCAT
		GAAAGGATTCACACTGGAGAGAAACCCTATGAGTGTAAGCAGTGT
		GGGAAAGCCTTCAGATCTGCCTCACAGCTTCGAGTGCACGGTGGG
		ACTCACACTGGAGAGAAACCCTATGAATGTAAGGAATGTGGGAAA
		GCCTTCAGATCTACCTCACACCTTCGAGTGCATGGTAGGACTCATA
		CTGGAGAGAAACCCTATGAATGTAAGGAATGTGGGAAAGCCTTCA
		GATATGTGAAGCACCTTCAAATTCATGAAAGGACAGAAAAACACA
		TAAGAATGCCCTCTGGAGAAAGACCTTATAAATGTAGTATATGTG
		AGAAAGGCTTTTATTCTGCCAAGTCATTTCAAACACATGAAAAAAC
		TCACACTGGAGAGAAACCCTATGAATGCAACCAATGTGGTAAAGC
		CTTCAGATGTTGCAATTCCCTTCGATATCATGAAAGGACTCACACT
		GGAGAGAAACCCTATGAGTGTAAGCAATGTGGGAAAGCCTTCAGA
		TCTGCCTCACACCTTCGAATGCATGAAAGGACTCACACTGGAGAG
		AAACCCTATGAGTGTAAGCAATGTGGGAAAGCCTTCAGTTGTGCCT
		CAAACCTTCGAAAGCATGGTAGGACTCACACTGGAGAGAAACCCT
		ATGAGTGTAAGCAATGTGGGAAAGCCTTCAGATCTGCCTCAAACC
		TTCAGATGCATGAAAGGACTCACACTGGAGAGAAACCCTATGAAT
		GTAAGGAATGCGAAAAAGCATTCTGTAAATTCTCTTCTTTTCAAAT
		ACATGAAAGGAAGCACAGAGGAGAGAAGCCCTATGAATGTAAGC
		ATTGTGGGAATGGATTCACATCTGCCAAGATTCTTCAAATACATGC
		AAGAACACACATTGGAGAGAAACACTATGAATGTAAGGAATGCGG
		AAAAGCATTCAATTATTTTTCTTCCTTGCATATACACGCAAGGACT
		CATATGGGAGAGAAGCCATATGAATGTAAGGATTGTGGGAAAGCT
		TCAGCTAG
SEQ ID NO:7	CTL2	MetGlyAspGluArgProHisTyrTyrGlyLysHisGlyThrPro
	NP_065161.1	GlnLysTyrAspProThrPheLysGlyProIleTyrAsnArgGly
		CysThrAspLleIleCysCysValPheLeuLeuLeulaIleVal
		GlyTyrValAIaVaIGlyIleIleAlaTrpThrHisGlyASpPro
		ArgLysValIleTyrProThrAspSerArgGlyGluPheCysGly
		GlnLysGlylhrLysAsnGluAsnLysProTyrLeuPheTyrPhe
		AsnIleValLysCysAlaSerProLeuValLeuLeuGluPheGln
		CysProThrProGlnhleCysValGluLysCysProAspArgTyr
		LeuThrTyrLeuAsnAlaArgSerSerArgASpPheGluTyrTyr
		LysGlnPheCysValProGlyPheLysAsnAsnLysGlyValAla
		GluValLeuArgAspGIyAspCysProAlaValLeuIleProSer
		LysProLeuAlaArgArgCysPheProAlaIleHisAlaTyrLys
		GlyValLeuMetValGlyAsnGluThrTyrTyrGluAspGlyHis
		GlySerArgLysAsnIleThrAspLeuValGluGlyAlaLysLys
		AlaAsnGlyValLeuGluAlaArgGlnLeuAlaMetArgIlePhe
		GluAspTyrThrValSerTrpTyrTrpIleIleIleGlyLeuVal
		IleAlaMetAlaMetSerLeuLeuPheIleIleLeuLeuArgPhe
		LeuAlaGlyIleMetValTrpValMetIleIleMetValIleLeu
		ValLeuGlyTyrGlyIlePheHisCysTyrMetGluTyrSerArg
		LeuArgGlyGluAlaGlySerAspValSerLeuValAspLeuGly
		PheGlnThrAspPheArgValTyrLeuHisLeuArgGlnThrTry
		LeuAlaPheMetIleIleLeuSerIleLeuGluValIleIleIle
		LeuLeuLeuIlePheLeuArgLysArgIleLeuIleAlaIleAla
		LeuIleLysGluAlaSerArgAlaValGlyTyrValMetCysSer
		LeuLeuTyrProLeuValThrPhePheLeuLeuCysLeuCysIle
		AlaTyrTrpAlaSerThrAlaValPhCLeuSerThrSerAsnGlu
		AlaValTyrLysIlePheAspAspSerProCysProPheThrAla
		LysThrCysAsnProGluThrPheProSerSerAsnGluSerArg
		GlnCysProAsnAlaArgCysGlnPheAlaPheTyrGlyGlyGlu
		SerGlyTyrHisArgAlaLeuLeuGlyLeuGlnhIePheAsnAla
		PheMetPhePheTrpLeuAlaAsnPheValLeuAlaLeuGlyGln
		ValThrLeuAlaGlyAlaPheAlaSerTyrTyrTrpAlaLeuArg
		LysProAspAspLeuProAlaPheProLeuPheSerAlaPheGly
		ArgAlaLeuArgTyrHisThrGlySerLeuAlaPheGlyAlaLeu
		IleLeuAlaIleValGlnIleIleArgValLleLeuGluTyrLeu
		AspGlnArgLeuLysGlyAlaGluAsnLysPheAlaLysCysLeu
		MetThrCysLeuLysCysCysPheTrpCysLeuGluLysPheIle
		LysPheLeuAsnArgAsnAlaTyrIleMetIleAlaIleTyrGly
		ThrAsnPheCysThrSerAlaArgAsnAlaPhePheLeuLeuMet
		ArgAsnhleIleArgValAlaValLeuAspLysValThrAspPhe
		LeuPheLeuLeuGlyLysLeuLeuIleValGlySerValGlyIle
		LeuAlaPhePhePhePheThrHisArgIleArgIleValGlnAsp
		ThrAlaProProLeuAsnTyrTyrTrpValProIleLeuThrVal
		IleValGlySerTyrLeuIleAlaHisGlyPhePheSerValTyr
		GlyMetCysValAspThrLCuPheLeuCysPheLeuGluAspLeu
		GluArgAsnAspGlySerAlacluArgProTyrPheMetSerSer
		ThrLeuLysLysLeuLeuAsnLysThrAsnLysLysAlaAlaGlu
		Ser
SEQ ID NO:8	ELAV	MetSerAsnGlyTyrGluAspHisMetAlaGluAspCysArgGly
	NP_001410.1	AspIleGlyArgThrAsnLeuIleValAsnTyrLeuProGlnAsn
		MetThrGlnAspGluLeuArgSerLeuPheSerSerIleGlyGlu
		ValGluSerAlaLysLeuIleArgAspLysValAlaGlyHisSer
		LeuGlyTyrGlyPheValAsnTyrValThrAlaLysAspAlaGlu
		ArgAlaIleAsnThrLeuAsnGlyLeuArgLeuGlnSerLysThr
		IleLysValSerTyrAlaArgProSerSerGluValIleLysAsp
		AlaAsnLeuTyrIleSerGlyLeuProArgThrMetThrGlnLys
		AspValGluAspMetPheSerArgPheGlyArgIleIleAsnSer
		ArgValLeuValAspGlnlhrThrGlyLeuSerArgGlyValAla
		PheIleArgPheAspLysArgSerGluAlaGluGluAlaIleThr
		SerPheAsnGlyHisLysProProGlySerSerGluProIleAla
		ValLysPheAlaAlaAsnProAsnGlnAsnLysAsnValAlaLeu
		LeuSerGlnLeuTyrHisSerProAlaArgArgPheGlyGlyPro
		ValHisHisGlnAlaGlnArgPheArgPheSerProMetGlyVal
		AspHisMetSerGlyLeuSerGlyValAsnValProGlyAsnAla
		SerSerGlyTrpCysIlePheIleTyrAsnLeuGlyGlnAspAla
		AspGluGlyIleLeuTrpGlnMetPheGlyProPheGlyAlaVal
		ThrAsnValLysValIleArgAspPheAsnThrAsnLysCysLys
		GlyPheGlyPheValThrMetThrAsnTyrGluGluAlaAlaMet
		AlaIleAlaSerLeuAsnGlyTyrArgLeuGlyAspLysIleLeu
		GlnValSerPheLysThrAsnLysSerHisLys
SEQ ID NO:9	G protein-	MetValGlnLysLysProAlaGluLeuGlnGlyPheHisArgSer
	coupled	PheLysGlyGlnAsnProPheGluLeuAlaPheSerLeuAspGln
	receptor	ProAspHisGlyAspSerAspPheGlyLeuGlnCysSerAlaArg
	kinase 7	ProAspMetProAlaSerGlnProIleAspIleProAspAlaLys
	NP_060042.1	LysArgGlyLysLysLysLysArgGlyArgAlaThrAspSerPhe
		SerGlyArgPheGluAspValTyrGlnLeuGlnGluAspValLeu
		GlyGluGlyAlaHisAlaArgValGlnThrCysIleAsnLeuIle
		ThrSerGlnGluTyrAlaValLysIleIleGluLysGlnProGly
		HisIleArgSerArgValPheArgGluValGluMetLeuTyrGln
		CysGlnGlyHisArgAsnValLeuGluLeuIleGluPhePheGlu
		GluGluAspArgPheTyrLeuValPheGluLysMetArgGlyGly
		SerIleLeuSerHisIleHisLysArgArgHisPheAsnGluLeu
		GluAlaSerValValValGlnAspValAlaSerAlaLeuAspPhe
		LeuHisAsnLysGlyIleAlaHisArgAspLeuLysProGluAsn
		IleLeuCysGluHisProAsnGlnValSerProValLysIleCys
		AspPheAspLeuGlySerGlyIleLysLeuAsnGlyAspCysSer
		ProIleSerThrProGluLeuLeuThrProCysGlySerAlaGlu
		TyrMetAlaProGluLeuValGluAlaPheSerGluGluAlaSer
		IleTyrAspLysArgCysAspLeuTrpSerLeuGlyValIleLeu
		TyrIleLeuLeuSerGlyTyrProProPheValGlyArgCysGly
		SerAspCysGlyTrpAspArgGlyGluAlaCysProAlaCysGln
		AsnMetLeuPheGluSerIleGlnGluGlyLysTyrGluPhePro
		AspLysAspTrpAlaHisIleSerCysAlaAlaLysAspLeuIle
		SerLysLeuLeuValArgAspAlaLysGlnArgLeuSerAlaAla
		GlnValLeuGlnHisProTrpValGlnGlyCysAlaProGluAsn
		ThrLeuProThrProMetValLeuGlnArgTrpAspSerHisPhe
		LeuLeuProProHisProCysArgIleHisValArgProGlyGly
		LeuValArgThrValThrValAsnGlu
SEQ ID NO:10	ENSP000002	LeuValThrPheGluAspValAlaValAspPheThrGlnGluGlu
	70543|ZINC	TrpThrLeuLeuAspGlnAlaGlnArgAspLeuTyrArgAspVal
	FINGER	MetLeuGluAsnTyrLysAsnLeuIleIleLeuGluLysThrSer
	PROTEIN	GluAspAsnGlnSerGlyLysAlaLeuArgLysAsnPheProHis
	ENSG0000001	SerPheTyrLysLysSerHisAlaGluGlyLysMetProLysCys
	42469	ValLysHisGluLysAlaPheAsnGlnPheProAsnLeuThrArg
		GlnAsnLysThrHisThrGlnGluLysLeuCysGluCysLysAsp
		CysTrpArgThrPheLeuAsnGlnSerSerLeuLysLeuHisIle
		ArgSerHisAsnGlyAspLysHisTyrValCysLysGluCysGly
		LysAlaPheSerAsnSerSerHisLeuIleGlyHisGlyArgIle
		HisSerGlyGluLysProTyrValCysLysGluCysGlyLysAla
		PheThrGlnScrThrGlyLeuLysLeuHisIleArgThrHisSer
		GlyGluLysProTyrLysCysLysGluCysGlyLysAlaPheThr
		HisSerSerTyrLeuThrAspHisThrArgIleHisSerGlyLys
		LysProTyrValCysMetGluCysGlyLysAlaPheThrArgSer
		ThrGlyLeuIleLeuHisMetArgIleHisThrGlyGluLysPro
		TyrGluCysLysGluCysGlyLysAlaPheIleHisSerSerTyr
		LeuThrLysHisValArgIleHisSerGlyGluLysLeuTyrLeu
		CysLysAlaCysGlyLysAlaPheThrArgSerSerGlyLeuVal
		LeuHisMetArgThrHisThrGlyGluLysProTyrGluCysLys
		GluCysGlyLysAlaPheAsnAsnSerSerMetLeuSerGlnHis
		ValArgIleHisThrGlyGluLysProTyrGluCysLysGluCys
		GlyLysAlaPheThrGlnSerSerGlyLeuSerThrHisLeuArg
		ThrHisThrGlyGluLysAlaCysGluCysLysGluCysGlyLys
		AlaPheAlaArgSerThrAsnLeuAsnMetHisMetArgThrHis
		ThrGlyGluLysProTyrAlaCysLysGluCysGlyLysAlaPhe
		ArgTyrSerThrTyrLeuAsnValHisThrArgThrHislhrGly
		AlaLysProTyrGluSerHisThrGlyLysLysPheLysLysThr
		LysLysTyrGlyLysSerPheThrAsnPheSerGlnLeuSerAla
		HisValLysThrHisLysGluGluLysSerPheAspCysLysGlu
		CysGlyIleSerValArgAsnSerSerTyrLeuAsnAspHisIle
		GlnThrProThrGlyLysProHisLysTyrThrAspCysGlyLys
		AlaPheThrArgSerIleGlnLeuThrGluHisValArgThrHis
		ThrGlyValLysProTyrGluCysLysGluCysGlyLysAlaPhe
		ThrGlnTyrThrGlyLeuAlaIleHisLeuArgSerHisSerGly
		GluLysProTyrGlnCysAsnLysCysGlyLysAlaPheThrArg
		SerSerGlyLeuThrGlnHisThrIleIleGlnMetGlyGluLys
		ProTyrGluCysValGluCysGlyLysThrPhe
SEQ ID NO:11	LAM2_HUM	MetAlaThrProLeuProGlyArgAlaGlyGlyProAlaThrPro
	AN LAMIN	LeuSerProThrArgLeuSerArgLeuGlnGluLysGluGluLeu
	B2	ArgGluLeuAsnAspArgLeuAlaHisTyrIleAspArgValArg
	Q03252	AlaLeuGluLeuGluAsnAspArgLeuLeuLeuLysIleSerGlu
		LysGluGluValThrThrArgGluXxxXxxXxxXxxXxxXxxXxx
		XxxXxxXxxXxxXxxXxxXxxXxxXxxArgValLeuAspGluThr
		AlaArgGluArgAlaArgLeuGlnIleGluLleGlyLysLeuArg
		AlaGluLeuAspGluValAsnLysSerAlaLysLysArgGluGly
		GluLeuThrValAlaGlnGlyArgValLysAspLeuGluSerLeu
		PheHisArgSerGluValGluLeuAlaAlaAlaLeuSerAspLys
		ArgGlyLeuGluSerAspValAlaGluLeuArgAlaGlnLeuAla
		LysAlaGluAspGlyHisAlaValAlaLysLysGlnLeuGluLys
		GluThrLeuMetArgValAspLeuGluAsnArgCysGlnSerLeu
		GlnGluGluLeuAspPheArgLysSerValPheGluGluGluVal
		ArgGluThrArgArgArgHisGluArgArgLeuValGluValAsp
		SerSerArgGlnGlnGluTyrAspPheLysMetAlaGlnAlaLeu
		GluGluLeuArgSerGlnHisAspGluGlnValArgLeuTyrLys
		LeuGluLeuGluGlnThrTyrGlnAlaLysLeuAspSerAlaLys
		LeuSerSerAspGlnAsnAspLysAlaAlaSerAlaAlaArgGlu
		GluLeuLysGluAlaArgMetArgLeuGluSerLeuSerTyrGln
		LeuSerGlyLeuGlnLysGlnAlaSerAlaAlaGluAspArgIle
		ArgGluLeuGluGluAlaMetAlaGlyGluArgAspLysPheArg
		LysMetLeuAspAlaLysGluGlnGluMetThrGluMetArgAsp
		ValMetGlnGlnGlnLeuAlaGluTyrGlnGluLeuLeuAspVal
		LysLeuAlaLeuAspMetGluIleAsnAlaTyrArgLysLeuLeu
		GluGlyGluGluGluSerLeuLysLeuSerProSerProSerSer
		ArgValThrValSerArgAlaThrSerSerSerSerGlySerLeu
		SerAlaThrGlyArgLeuGlyArgSerLysArgLysArgTrpArg
		TrpArgSerProTrpGlnArgProLysArgProGlyHisGlyHis
		GlyTrpGlnArgTrpLeuProProGlyProAlaGlyLeuGlyLeu
		GlyGlnArgHisIleGluGluIleAspLeuGluGlyLysPheVal
		GlnLeuLysAsnAsnSerAspLysAspGlnSerLeuGlyAsnTrp
		ArgIleLysArgGlnValLeuGluGlyGluGluIleAlaTyrLys
		PheThrProLysTyrIleLeuArgAlaGlyGlnMetValThrVal
		TrpAlaAlaGlyAlaGlyValAlaHisSerProProSerThrLeu
		ValTrpLysGlyGlnSerSerTrpGlyThrGlyGluSerPheArg
		ThrValLeuValAsnAlaAspGlyGluGluValAlaMetArgThr
		ValLysLysSerSerValMetArgGluAsnGluAsnGlyGluGlu
		GluGluGluGluAlaGluPheGlyGluGluAspLeuPheHisGln
		GlnGlyAspProArgThrThrSerArgGlyCysTyrValMet
SEQ ID NO:12	hypothetical	MetProCysCysSerHisArgSerCysArgGluAspProGlyThr
	protein	SerGluSerArgGluMetAspProValAlaPheGluAspValAla
	[Homo	ValAsnPheThrGlnGluGluTrpThrLeuLeuAspIleSerGln
	sapiens]	LysAsnLeuPheArgGluValMetLeuGluThrPheArgAsnLeu
	CAB66666.1	ThrSerIleGlyLysLysTrpSerAspGlnAsnIleGluTyrGlu
		TyrGlnAsnProArgArgSerPheArgSerLeuIleGluGluLys
		ValAsnGluIleLysGluAspSerHisCysGlyGluThrPheThr
		GlnValProAspAspArgLeuAsnPheGlnGluLysLysAlaSer
		ProGluValLysSerCysAspSerPheValCysAlaGluValGly
		IleGlyAsnSerSerPheAsnMetSerIleArgGlyAspThrGly
		HisLysAlaTyrGluTyrGlnGluTyrGlyProLysProTyrLys
		CysGlnGlniProLysAsnLysLysAlaPheArgTyrArgProSer
		IleArgThrGlnGluArgAspHisThrGlyGluLysProTyrAla
		CysLysValCysGlyLysThrPheIlePheHisSerSerIleArg
		ArgHisMetValMetHisSerGlyAspGlyThrTyrLysCysLys
		PheCysGlyLysAlaPheHisSerPheSerLeuTyrLeuIleHis
		GluArgThrHisThrGlyGluLysProTyrGluCysLysGlnCys
		GlyLysSerPheThrTyrSerAlaThrLeuGlnIleHisGluArg
		ThrHisThrGlyGluLysProTyrGluCysSerLysCysAspLys
		AlaPheHisSerSerSerSerTyrHisArgHisGluArgSerHis
		MetGlyGluLysProTyrGlnCysLysGluCysGlyLysAlaPhe
		AlaTyrThrSerSerLeuArgArgHisGluArgThrHisSerGly
		LysLysProTyrGluCysLysGlnTyrGlyGluGlyLeuSerTyr
		LeuIleSerPheGlnThrHisLleArgMetAsnSerGlyGluArg
		ProTyrLysCysLysIleCysGlyLysGlyPheTyrSerAlaLys
		SerPheGlnThrnisGluLysThruisThrGlyGluLysArgTyr
		LysCysLysGlnCysGlyLysAlaPheAsnLeuSerSerSerPhe
		ArgTyrHisGluArgIleHisThrGlyGluLysProTyrGluCys
		LysGlnCysGlyLysAlaPheArgSerAlaSerGlnLeuArgVal
		HisGlyGlyThrHisThrGlyGluLysProTyrGluCysLysGlu
		CysGlyLysAlaPheArgSerThrSerHisLeuArgValHisGly
		ArgThrHisThrGlyGluLysProTyrGluCysLysGluCysGly
		LysAlaPheArgTyrValLysHisLeuGlnhleHisGluArgThr
		GluLysHisIleArgMetProSerGlyGluArgProTyrLysCys
		SerIleCysGluLysGlyPheTyrSerAlaLysSerPheGlnThr
		HisGluLysThrHisThrGlyGluLysProTyrGluCysAsnGln
		CysGlyLysAlaPheArgCysCysAsnSerLeuArgTyrHisGlu
		ArgThrHisThrGlyGluLysProTyrGluCysLysGlnCysGly
		LysAlaPheArgSerAlaSerHisLeuArgMetHisGluArgThr
		HisThrGlyGluLysProTyrGluCysLysGlnCysGlyLysAla
		PheSerCysAlaSerAsnLeuArgLysHisGlyArgThrHisThr
		GlyGluLysProTyrGluCysLysGlnCysGlyLysAlaPheArg
		SerAlaSerAsnLeuGlnMetHisGluArgThrHisThrGlyGlu
		LysProTyrGluCysLysGluCysGluLysAlaPheCysLysPhe
		SerSerPheGlnIleHisGluArgLysHisArgGlyGluLysPro
		TyrGluCysLysHisCysGlyAsnGlyPheThrSerAlaLysIle
		LeuGlnIleHisAlaArgThrHisIleGlyGluLysHisTyrGlu
		CysLysGluCysGlyLysAlaPheAsnTyrPheSerSerLeuHis
		IleHisAlaArgThrHisMetGlyGluLysProTyrGluCysLys
		AspCysGlyLysAlaPheSer

Claims

1. A composition comprising at least one expression vector, which expression vector comprises a nucleic acid comprising: (a) at least one polynucleotide sequence selected from the group consisting of SEQ ID NO:1-SEQ ID NO:6, or conservative variations thereof; (b) at least one polynucleotide sequence complementary to a polynucleotide sequence of (a); (c) at least one polynucleotide encoding a polypeptide sequence selected from the group consisting of SEQ ID NO:7-SEQ ID NO:12, or conservative variations thereof; (d) at least one polynucleotide sequence that hybridizes under stringent conditions to a polynucleotide sequence of (a) or (b); (e) at least one polynucleotide sequence that is at least about 70% identical to a polynucleotide sequence of (a) or (b); and/or, (f) at least one polynucleotide sequence comprising at least about 10 contiguous nucleotides of a polynucleotide sequence selected from the group consisting of SEQ ID NO:1-SEQ ID NO:6, or a sequence complementary thereto.

2. The vector of claim 1, wherein the vector comprises a promoter operably linked to the nucleic acid comprising the polynucleotide sequence of (a), (b), (c), (d), (e) and/or (f).

3. The vector of claim 1, wherein the nucleic acid encodes a polypeptide.

4. The vector of claim 1, wherein the polypeptide comprises a polypeptide sequence of at least one of SEQ ID NO:7-SEQ ID NO:12.

5. The vector of claim 1, wherein the nucleic acid encodes a sense or antisense RNA.

6. A cell comprising the vector of claim 1.

7. The cell of claim 6, which cell expresses a polypeptide selected from the group consisting of SEQ ID NO:7-SEQ ID NO:12.

8. An isolated or recombinant polypeptide, comprising: (a) an amino acid sequence selected from the group consisting of SEQ ID NO:7 to SEQ ID NO:12, and conservative variants thereof; (b) an amino acid sequence encoded by a polynucleotide sequence selected from the group consisting of SEQ ID NO:1 to SEQ ID NO:6, and conservative variations thereof; (c) an amino acid sequence encoded by a polynucleotide sequence that hybridizes under stringent hybridization conditions to a polynucleotide sequence selected from the group consisting of SEQ ID NO:1 to SEQ ID NO:6; (d) an amino acid sequence encoded by a polynucleotide sequence that is at least about 70% identical to a polynucleotide selected from the group consisting of SEQ ID NO:1 to SEQ ID NO:6; or (e) a polypeptide comprising an amino acid subsequence of (a), (b), (c) or (d).

9. The polypeptide of claim 8, comprising a fusion protein.

10. The polypeptide of claim 8, comprising a peptide or polypeptide tag.

11. The polypeptide of claim 10, wherein the peptide or polypeptide tag comprises a reporter peptide or polypeptide.

12. The polypeptide of claim 10, wherein the peptide or polypeptide tag comprises an epitope.

13. The polypeptide of claim 10, wherein the peptide or polypeptide tag comprises a localization signal or sequence.

14. An antibody specific for a polypeptide of claim 8.

15. The antibody of claim 14, wherein the antibody comprises a monoclonal antibody or polyclonal serum.

16. The antibody of claim 14, which antibody is specific for an epitope comprising a subsequence of a polypeptide selected from the group consisting of SEQ ID NO:7-SEQ ID NO:12.

17. An isolated polypeptide which specifically binds the antibody of claim 16.

18. A cell comprising at least one exogenous nucleic acid, which cell expresses a polypeptide of claim 8.

19. The cell of claim 18, wherein the expressed polypeptide is encoded by an exogenous nucleic acid.

20. The cell of claim 18, wherein the exogenous nucleic acid comprises a promoter, which promoter regulates transcription of an endogenous nucleic acid encoding the polypeptide.

21. A labeled probe comprising a nucleic acid or polypeptide comprising: (a) a polynucleotide sequence selected from the group consisting of: SEQ ID NO:1-SEQ ID NO:6; conservative variants of any one of SEQ ID NO:1-SEQ ID NO:6; or, a subsequence of SEQ ID NO:1-SEQ ID NO:6 or conservative variants thereof comprising at least about 10 nucleotides; (b) a polypeptide or peptide comprising an amino acid sequence selected from the group consisting of: SEQ ID NO:7-SEQ ID NO:12; conservative variants of any one of SEQ ID NO:7-SEQ ID NO:12; or, subsequences of SEQ ID NO:7-SEQ ID NO:12 or conservative variants thereof comprising at least six amino acids; or, (c) an antibody specific for a polypeptide or peptide sequence of (b).

22. The labeled probe of claim 21, comprising a nucleic acid.

23. The labeled probe of claim 21, comprising an oligonucleotide.

24. The labeled probe of claim 21, wherein the oligonucleotide comprises subsequence of SEQ ID NO:1-SEQ ID NO:6 comprising at least 12 nucleotides.

25. The labeled probe of claim 21, wherein the oligonucleotide comprises subsequence of SEQ ID NO:1-SEQ ID NO:6 comprising at least 14 nucleotides.

26. The labeled probe of claim 21, wherein the oligonucleotide comprises subsequence of SEQ ID NO:1-SEQ ID NO:6 comprising at least 16 nucleotides.

27. The labeled probe of claim 21, wherein the oligonucleotide comprises subsequence of SEQ ID NO:1-SEQ ID NO:6 comprising at least 18 nucleotides.

28. The labeled probe of claim 21, comprising a peptide.

29. The labeled probe of claim 21, comprising an antigenic peptide.

30. The labeled probe of claim 21, comprising a fusion protein.

31. The labeled probe of claim 21, comprising an epitope tag.

32. The labeled probe of claim 21, comprising an isotopic, fluorescent, fluorgenic, or colorimetric label.

33. The labeled probe of claim 21, comprising a DNA or RNA molecule.

34. The labeled probe of claim 21, comprising a cDNA, an amplification product, a transcript, a restriction fragment, or an oligonucleotide.

35. The labeled probe of claim 21, comprising an oligonucleotide consisting of a polynucleotide sequence selected from a subsequence of SEQ ID NO:1 to SEQ ID NO:6, or conservative variations thereof.

36. A marker set for predicting atherosclerosis susceptibility comprising a plurality of: (a) one or more polynucleotide sequences selected from the group consisting of: SEQ I) NO:1-SEQ ID NO:6; conservative variants of any one of SEQ ID NO:1-SEQ ID NO:6; and, subsequences of SEQ ID NO:1-SEQ ID NO:6 or conservative variants thereof comprising at least about 10 nucleotides; (b) one or more polypeptides or peptides comprising an amino acid sequence selected from the group consisting of: SEQ ID NO:7-SEQ ID NO:12; conservative variants of any one of SEQ ID NO:7-SEQ ID NO:12; or, subsequences of SEQ ID NO:7-SEQ ID NO:12 or conservative variants thereof comprising at least six amino acids; and/or, (c) one or more antibodies specific for a polypeptide or peptide sequence of (b).

37. The marker set of claim 36, wherein the plurality of nucleic acids comprise one or more of oligonucleotides, expression products and amplification products.

38. The marker set of claim 37, wherein the oligonucleotides are synthetic oligonucleotides.

39. The marker set of claim 36, comprising a plurality of labeled nucleic acid probes.

40. The marker set of claim 36, comprising a plurality of polypeptides or peptides.

41. The marker set of claim 36, comprising a plurality of antibodies.

42. The marker set of claim 36, comprising a plurality of members, which members include nucleic acids and polypeptides.

43. The marker set of claim 36, wherein the nucleic acids or polypeptides are logically or physically arrayed.

44. The marker set of claim 36, wherein the nucleic acids or polypeptides are physically arrayed in a solid phase or liquid phase array.

45. The marker set of claim 43, wherein the array comprises a bead array.

46. The marker set of claim 36, comprising at least about 10 contiguous nucleotides of each of SEQ ID NO:1-SEQ ID NO:6.

47. The marker set of claim 36, comprising at least about six contiguous amino acids of each of SEQ ID NO:7-SEQ ID NO:12.

48. The marker set of claim 36, comprising at least one antibody specific for each of SEQ ID NO:7-SEQ ID NO:12, or a subsequence thereof.

49. The marker set of claim 36, wherein atherosclerosis susceptibility is predicted by hybridizing the nucleic acids of the marker set to a DNA or RNA sample from a cell or tissue, and detecting at least one polymorphic polynucleotide or differentially expressed expression product.

50. An array comprising the marker set of claim 36.

51. A method for modulating cholesterol homeostasis in a cell, tissue or organism, the method comprising: modulating expression or activity of at least one polypeptide encoded by a nucleic acid comprising: (a) at least one polynucleotide sequence selected from the group consisting of SEQ ID NO:1-SEQ ID NO:6, or conservative variations thereof; (b) at least one polynucleotide sequence complementary to a polynucleotide sequence of (a); (c) at least one polynucleotide encoding a polypeptide sequence selected from the group consisting of SEQ ID NO:7-SEQ ID NO:12, or conservative variations thereof; (d) at least one polynucleotide sequence that hybridizes under stringent conditions to a polynucleotide sequence of (a) or (b); and/or, (e) at least one polynucleotide sequence that is at least about 70% identical to a polynucleotide sequence of (a) or (b).

52. The method of claim 51, comprising modulating expression or activity of at least one polypeptide contributing to an atherogenic lipoprotein phenotype.

53. The method of claim 51, comprising modulating cholesterol homeostasis in one or more cell-types selected from the group comprising liver, adipose tissue, gall bladder, pancreas, monocytes, macrophages, foam cells, T cells, endothelia and smooth muscle derived from blood vessels and gut, fibroblasts, glia and nerve cells.

54. The method of claim 51, comprising modulating expression by expressing an exogenous nucleic acid comprising a polynucleotide sequence selected from SEQ ID NO:1 to SEQ ID NO:6.

55. The method of claim 51, comprising modulating expression in a cell line or non-human mammal.

56. The method of claim 55, wherein the non-human mammal comprises a mouse, a rat, a dog, a rabbit, a pig, a sheep or a non-human primate

57. The method of claim 54, comprising modulating expression by inducing or suppressing expression of an endogenous nucleic acid.

58. The method of claim 57, wherein the endogenous nucleic acid encodes a polypeptide selected from among SEQ ID NO:7-SEQ ID NO:12, or homologues thereof.

59. The method of claim 54, comprising introducing an exogenous nucleic acid comprising at least one promoter, which promoter regulates expression of the endogenous nucleic acid modulating cholesterol homeostasis.

60. The method of claim 54, wherein expression is modulated in response to cholesterol.

61. The method of claim 54, further comprising detecting altered expression or activity of an expression product encoded by a nucleic acid comprising a polynucleotide sequence selected from SEQ ID NO:1-SEQ ID NO:6, or conservative variants thereof.

62. The method of claim 61, comprising detecting altered expression or activity in a high throughput assay.

63. The method of claim 60, comprising detecting altered expression or activity in response to administration of a pharmaceutical agent.

64. The method of claim 60, comprising detecting altered expression or activity in response to diet.

65. The method of claim 60, wherein a plurality of expression products are detected.

66. The method of claim 65, wherein the plurality of expression products are detected in an array.

67. The method of claim 66, wherein the array comprises a bead array.

68. The method of claim 60, wherein a data record comprising the altered expression or activity is recorded in a database.

69. The method of claim 67, wherein the database comprises a plurality of character strings recorded on a computer or in a computer readable medium.

70. A method for detecting atherosclerosis susceptibility in a subject, the method comprising: (i) providing a subject cell or tissue sample of nucleic acids; (ii) detecting at least one polymorphic nucleic acid or at least one expression product corresponding to a polynucleotide sequence, comprising; (a) at least one polynucleotide sequence selected from the group consisting of SEQ ID NO:1-SEQ ID NO:6, or conservative variations thereof; (b) at least one polynucleotide sequence complementary to a polynucleotide sequence of (a); (c) at least one polynucleotide encoding a polypeptide sequence selected from the group consisting of SEQ ID NO:7-SEQ ID NO:12, or conservative variations thereof; (d) at least one polynucleotide sequence that hybridizes under stringent conditions to a polynucleotide sequence of (a) or (b); and/or, (e) at least one polynucleotide sequence that is at least about 70% identical to a polynucleotide sequence of (a) or (b).

71. The method of claim 70, wherein the expression product comprises an RNA.

72. The method of claim 70, wherein the detecting step comprises qualitative detection.

73. The method of claim 70, wherein the detecting step comprises quantitative detection.