Patent Grant
7541039
Pursuant to 37 C.F.R. § 1.52(e)(1)(iii), a compact disc containing an electronic version of the Sequence Listing has been submitted concomitant with this application, the contents of which are hereby incorporated by reference. A second compact disc is submitted and is an identical copy of the first compact disc. The discs are labeled “copy 1” and “copy 2,” respectively, and each disc contains one file entitled “SeqListCRF.txt” which is 88 KB and created on Dec. 9, 2005.
The present invention relates generally to biotechnology, and, more particularly, pertains to a method for obtaining cell-wall material of Gram-positive bacteria with an improved capacity for binding a proteinaceous substance comprising an AcmA cell-wall binding domain, as well as pharmaceutical compositions including the obtained cell-wall material.
Heterologous surface display of proteins (Stahl and Uhlen, TIBTECH May 1997, 15, 185-192) on recombinant microorganisms via the targeting and anchoring of heterologous proteins to the outer surface or the cell wall of host cells, such as yeast, fungi, mammalian cells, plant cells, and bacteria, has been possible for several years. Display of heterologous proteins at the surface of these cells has taken many forms including the expression of reactive groups such as antigenic determinants, heterologous enzymes, single-chain antibodies, polyhistidyl tags, peptides, and other compounds. Heterologous surface display has been applied as a tool for applied and fundamental research in microbiology, molecular biology, vaccinology and biotechnology. Another application of bacterial surface display has been the development of live-bacterial-vaccine delivery systems. The cell-surface display of heterologous antigenic determinants has been considered advantageous for inducing antigen-specific immune responses in live recombinant cells used for immunization. Another application has been the use of bacterial surface display in generating whole-cell bioadsorbents or biofilters for environmental purposes, microbiocatalysts, and diagnostic tools.
Generally, chimeric proteins include an anchoring or targeting portion that is specific and selective for the recombinant organism, wherein the anchoring portion is combined with the reactive group, such as the antigenic determinant, heterologous enzyme, single-chain antibody, polyhistidyl tag, peptide, or other compound. A well-known anchoring portion comprises the so-called LPXTG (SEQ ID NO:1) box, which covalently binds to a Staphylococcus bacterial surface, i.e., in the form of a fully integrated membrane protein. In this manner, at least two polypeptides of different genetic origins may be joined by a normal peptide bond to produce a chimeric protein. For example, PCT International Patent Publication No. WO 94/18330, which relates to the isolation of compounds from complex mixtures and the preparation of immobilized ligands (bioadsorbents), discloses a method for obtaining a ligand comprising anchoring a binding protein in or at the exterior of a cell wall of a recombinant cell. The binding protein is essentially a chimeric protein produced by the recombinant cell and includes an N-terminal part derived from an antibody that is capable of binding to a specific compound, wherein the N-terminal part is joined to a C-terminal anchoring part, derived from an anchoring protein purposely selected for being functional in the specific recombinant cell chosen. PCT International Patent Publication No. WO 97/08553 discloses a method for selectively targeting proteins to the cell wall of Staphylococcus sp., using anchoring proteins which include long stretches of at least 80-90 amino acid long amino acid cell-wall-targeting signals. The signals are derived from the lysostaphin gene or amidase gene of Staphylococcus and encode for proteins that selectively bind to Staphylococcus cell-wall components.
Vaccine delivery or immunization systems with attenuated bacterial vector strains that express distinct antigenic determinants against a wide variety of diseases are currently being developed. Mucosal vaccines for nasal or oral passages using these attenuated bacterial vectors have received a great deal of attention. For example, both systemic and mucosal antibody responses against an antigenic determinant of hornet venom have been detected in mice orally colonized with a genetically engineered human oral commensal Streptococcus gordonii strain that expresses the hornet venom antigenic determinant on its surface (Medaglini et al., PNAS 1995, 2; 6868-6872). A protective immune response was also elicited by oral delivery of a recombinant bacterial vaccine that included tetanus toxin fragment C constitutively expressed in Lactococcus lactis (Robinson et al., Nature Biotechnology 1997, 15; 653-657). Mucosal immunization is considered an effective means of inducing IgG and secretory IgA antibodies directed against specific pathogens of mucosal surfaces.
Immunogens expressed by bacterial vectors may be presented in a particulate form to antigen-presenting cells, such as M-cells, of the immune system and therefore should be less likely to induce tolerance when compared to soluble antigens. Additionally, the existence of a common mucosal immune system permits immunization of one specific mucosal surface in order to induce secretion of antigen-specific IgA and other specific immune responses at distant mucosal sites. A drawback to using bacterial vectors for immunization is the potential of the bacterial strain causing inflammation or disease and potentially leading to fever or bacteremia. Instead of using attenuated bacterial strains that may become pathogenic, recombinant commensal bacteria, such as Streptococcus sp. or Lactococcus sp., may be used as vaccine carriers.
A potential problem with recombinant commensal microorganisms is that they may colonize the mucosal surfaces and generate a long-term exposure to the target antigens expressed and released by the recombinant microorganisms which may cause immune tolerance.
Additionally, the use of genetically modified microorganisms that contain recombinant nucleic acid has met considerable opposition from the public as a whole, stemming from a low-level acceptance of products which contain recombinant DNA or RNA. Similar objections exist against even the use of attenuated pathogenic strains or against proteins, or parts of proteins, derived from pathogenic strains. Further, the heterologous surface display of proteins described herein entails the use of anchoring or targeting proteins specific and selective for a limited set of microorganisms, which are of recombinant or pathogenic nature which greatly restricts their potential applications.
The protein anchor of L. lactis, AcmA (cA), its homologs and functional derivatives (PCT International Patent Publication No. WO99/25836) bind in a non-covalent manner to a wide variety of Gram-positive bacteria. Binding also occurs to isolated cell-wall material. The ligand to which the protein anchor of L. lactis binds in these cell walls is currently unknown.
The use of a gram-positive, food-grade bacterium, such as Lactococcus lactis, offers significant advantages over the use of other bacteria, such as Salmonella, as a vaccine delivery vehicle. For instance, L. lactis does not replicate in or invade human tissues and reportedly possesses low intrinsic immunity (Norton et al. 1994). Further, mucosal-delivered L. lactis that expresses tetanus toxin fragment C has been shown to induce antibodies that protect mice against a lethal challenge with tetanus toxin even if the carrier bacteria was killed prior to administration (Robinson et al. 1997). The killed bacteria still contain recombinant DNA that will be spread into the environment, especially when used in wide-scale oral immunization programs. However, the uncontrollable shedding of recombinant DNA into the environment may have the risk of being taken up by other bacteria or other microorganisms.
Disclosed is a method for improving binding of a proteinaceous substance to cell-wall material of a Gram-positive bacterium. The proteinaceous substance comprises at least one repeat, but may comprise two or three repeat sequences of an AcmA cell-wall binding domain, homolog or functional derivative thereof. The method comprises treating the cell-wall material with a solution capable of removing a cell-wall component, such as a protein, lipoteichoic acid or carbohydrate, from the cell-wall material and contacting the proteinaceous substance with the treated cell-wall material. Improved binding may be obtained by treating the cell-wall material with a solution capable of removing a cell-wall component. The cell-wall material may be subsequently stored until it is contacted with a desired fusion protein. The fusion protein may comprise an AcmA cell-wall binding domain, homolog or functional derivative thereof where the cell-wall material is contacted with the fusion protein. The method of the present invention may be used to obtain cell-wall material with an improved capacity for binding a proteinaceous substance comprising the AcmA cell-wall binding domain, homolog or functional derivative thereof.
Also disclosed is a method for removing components from a bacterial cell wall comprising treating whole cells with a solution capable of removing a cell-wall component such as a protein, lipoteichoic acid or carbohydrate from the cell-wall material. The cell-wall material obtained by the present invention yields cell-wall material with at least 20%, better 30%, best 40% or even 50% of relatively empty, but intact, cell envelopes which include inert spherical microparticles. The inert spherical microparticles will be referred to herein as bacterial “ghosts.” The term “ghosts” reflects the size and shape of the bacterium from which the ghosts are obtained.
Also disclosed is a method for obtaining cell-wall material of a Gram-positive bacterium with an improved capacity for binding with a proteinaceous substance comprising an AcmA cell-wall binding domain, homolog or functional derivative thereof. The method comprises treating the cell-wall material with a solution capable of removing a cell-wall component such as a protein, lipoteichoic acid or carbohydrate from the cell-wall material, wherein the cell-wall material comprises spherical peptidoglycan microparticles referred to herein as ghosts.
Methods to extract bacterial cell-wall material with a solution have been described in EP 0 545 352 A and Brown et al. (Prep. Biochem. 6:479, 1976). A method to obtain purified soluble peptidoglycan from bacteria by exposure to TCA has been disclosed. The cited references describe procedures in which cells are mechanically disrupted, wherein the resulting cell fragments are treated with TCA to extract peptidoglycans from the cell wall. The cited methods provide a peptidoglycan preparation and a lysed, randomly fragmented cell-wall preparation from which cell-wall components have been removed. However, these methods do not yield ghosts. Furthermore, the methods do not allow targeting with a proteinaceous substance comprising an AcmA cell-wall binding domain, homolog or functional derivative thereof.
The method of the present invention is aimed at yielding ghosts from which cell-wall components have been removed. The use of ghosts for display of proteinaceous substances has advantages over the use of the disrupted cell-wall material. For example, binding the proteinaceous substance to bacterial ghosts results in a higher packing density when compared to binding a substance to mechanically disrupted cell-wall material. A high density surface display of proteins is favorable for application in industrial processes. In one embodiment, the present invention discloses a method for obtaining the cell-wall material not involving rupture.
Cell-wall material obtained by mechanical disruption methods suffers from several practical drawbacks. Because cells are completely broken with mechanical disruption, intracellular materials are released from the cell and cell-wall fragments need to be separated from a complex mixture of proteins, nucleic acids, and other cellular components. The released nucleic acids may increase the viscosity of the solution and complicate processing steps, especially chromatography. The cell debris produced by mechanical lysis also often includes small cell fragments which are difficult to remove. These problems are overcome when ghosts are produced using methods of the present invention. The uniform composition of a ghost preparation including particle size and shape offers other advantages for subsequent purification and isolation steps. The invention thus discloses a method of obtaining cell-wall material not involving rupture of the cell wall, wherein the resulting cell-wall material comprises ghosts.
The use of bacterial ghosts is often preferable when compared to the use of mechanically disrupted cell-wall bacteria for the surface display of immunogenic determinants. In contrast to mechanical disruption procedures, ghosts are produced by a process that preserves most of the bacteria's native spherical structure. Bacterial ghosts are better able to bind to and/or are more easily taken up by specific cells or tissues than mechanically disrupted cell-wall material. The ability of bacterial ghosts to target macrophages or dendritic cells enhances their functional efficacy. Thus, the non-recombinant, non-living ghost system disclosed by the present invention is well suited as a vaccine delivery vehicle. Accordingly, the invention discloses a method for obtaining ghosts, wherein the ghosts have an improved capacity for binding with a proteinaceous substance and have an enhanced induction of the cellular immune response.
The invention also discloses a method for binding a proteinaceous substance to the cell-wall material of a Gram-positive bacterium, wherein the proteinaceous substance comprises an AcmA cell-wall binding domain, homolog or functional derivative thereof. The method comprises treating the cell-wall material with a solution capable of removing a cell-wall component such as a protein, lipoteichoic acid or carbohydrate from the cell-wall material, and subsequently contacting the proteinaceous substance with the cell-wall material. The cell-wall material comprises ghosts which have been produced by the present invention which does not involve rupture of the bacterial cell-wall.
In another embodiment, the solution capable of removing the cell-wall material has a pH that is lower than the calculated Pi value of the AcmA cell-wall binding domain, homolog or functional derivative thereof. Particularly, the solution comprises an acid such as acetic acid (HAc), hydrochloric acid (HCl), sulphuric acid (H2SO4), trichloro acetic acid (TCA), trifluoro acetic acid (TFA), and monochloroacetic acid (MCA). The concentration of the acid in the solution will be dependent on the desired pH value which may be determined by calculation using a computer program such as DNA star or Clone Manager. For instance, when the calculated pI is >8, pH values of about 6 to 4 may suffice for effecting appropriate binding. When pI values are calculated to be lower, such as around 6, pH values of 3-4 may be selected. When domains with calculated pI values ranging from 8 to 12 are encountered, using the solution comprising 0.06 to 1.2 M TCA, or comparable acid, may suffice.
The binding may be improved by heating the cell-wall material or ghosts in the solution. However, precise requirements for the heating may vary depending on the cell-wall material or ghosts. However, heating for 5-25 minutes at approximately boiling temperature (i.e., 100° C.) will often generate the desired cell-wall material with improved binding capacity. The cell-wall material may then be washed and pelleted (e.g., by centrifugation) from the treatment solution and subsequently stored (e.g., by freezing or freeze-drying) until further use. Such cell-wall material includes spherical peptidoglycan microparticles that usually reflect the size and shape of the bacterium from which they were obtained.
In one embodiment, the cell-wall material is derived from a Lactococcus, a Lactobacillus, a Bacillus or a Mycobacterium sp. The cell walls of Gram-positive bacteria include complex networks of peptidoglycan layers, proteins, lipoteichoic acids and other modified carbohydrates. Generally, chemical treatment of the cell-wall material may be used to remove cell-wall components such as proteins, lipoteichoic acids and carbohydrates, wherein the chemical treatment yields purified peptidoglycan (Morata de Ambrosini et al. 1998). Sodium dodecyl sulphate (SDS) is also commonly used to remove proteins. Trichloro acid (TCA) is known to specifically remove lipoteichoic acids and carbohydrates from cell-wall isolates. Phenol, formamide and mixtures of chloroform and methanol are other examples of organic solvents that may be used to enhance the purification of peptidoglycan.
In the present invention, the effect of the pretreatment of whole cells of gram-positive bacteria with these and other chemicals in relation to binding technology provides the possibility to obtain bacterial ghosts or cell-wall material derived from the bacteria which possess new traits (i.e., different binding properties) without the introduction of recombinant DNA.
In another embodiment, the present invention discloses the incorporation of cell-wall material with improved binding capacity for AcmA-type anchors into a composition, such as a pharmaceutical composition, with a proteinaceous substance comprising an AcmA-type anchor. Reactive groups, such as antigenic determinants, heterologous enzymes, single-chain antibodies, polyhistidyl tags, peptides, and other compounds may be bound to the cell-wall material as disclosed herein by providing reactive groups with an AcmA-type anchor, and subsequently contacting the cell-wall material with the reactive groups to improve binding capacity. Other reactive groups include fluorescing protein, luciferase, binding protein or peptide, antibiotics, hormones, non-peptide antigenic determinants, carbohydrates, fatty acids, aromatic substances or reporter molecules.
In another embodiment, the invention discloses the use of cell-wall material in generating bioadsorbents or biofilters for environmental purposes, microbiocatalysts, and diagnostic tools. For instance, the use of immobilized biocatalysts, such as enzymes or whole microbial cells, has increased steadily during the past decade in the food, pharmaceutical and chemical industries. The immobilized biocatalysts are more stable, easier to handle, and can be used repeatedly in industrial processes in comparison to their free counterparts. Immobilization of enzymes typically requires a chemical step to link the enzyme to an insoluble support. However, chemical treatments may negatively affect the enzymes. Alternatively, enzymes may be immobilized by incorporation in gels with the disadvantage that diffusion of the substrate into the gel slows down the process.
As disclosed herein, large-scale immobilization of enzymatically active proteins may be accomplished by surface displaying proteins on gram-positive cells or cell-wall material. For instance, the immobilization of a fusion protein comprising α-amylase or β-lactamase fused to the AcmA-protein anchor domain has been demonstrated herein in L. lactis. The addition of the AcmA-anchor fusion protein resulted in the stable attachment of heterologous proteins to the surface of L. lactis and other gram-positive bacteria. Further, pre-treating L. lactis cells and other gram-positive cells with acid as described herein results in a high density surface display of heterologous proteins and is a prerequisite for application in industrial processes. Further, the carrier or gram-positive cells may be obtained in high yield and be non-recombinant. Thus, a method disclosed herein may be used to economically produce the immobilized enzyme and make the AcmA-protein anchor a useful approach for the surface display of enzymes on gram-positive cells.
Another industrial application of an immobilized enzyme is the isomerization of glucose which is catalyzed by glucose isomerase and used during the production of high-fructose corn syrup. This process may be made economically feasible by immobilizing the glucose isomerase. The productivity of glucose isomerase is improved by increasing the stability of epoxide hydrolase in organic solvents by immobilization to microbial cells or cell-wall material as described herein.
Immobilized enzymes may also be used to treat waste water or industrial effluent. For instance, industrial effluents containing low value chemicals produced during synthesis of the commodity chemicals epichlorohydrin and propylene oxide may be treated by using immobilized haloalkane dehalogenase to recycle these low value products into the manufacturing process.
The invention further discloses chimeric or hybrid AcmA-type anchors for the preparation of a composition that has new binding properties. The AcmA-type anchors can be divided into two groups of hybrids based on their pI (see, Table 3). A large group includes hybrids with a pI higher than 8, but lower than 10, and a smaller group includes hybrids with a relatively low pI (i.e., <5). Hybrid AcmA-type anchors are disclosed with at least one AcmA-type domain and a relatively high calculated pI, and another AcmA-type domain is disclosed with a relatively lower calculated pI. The resulting hybrid anchor has an intermediate calculated pI which is useful when release of the bound proteinaceous substance at a higher pH is contemplated. Such a composition may be routed through the stomach, which has a relative low pH, such that the composition releases its anchor bound reactive groups in the intestines, which have a higher pH.
The invention also discloses a proteinaceous substance comprising an AcmA cell-wall binding domain, homolog or functional derivative thereof wherein the binding domain is a hybrid of at least two different AcmA-type cell-wall binding domains, homologs or functional derivatives thereof. The proteinaceous substance may comprise an AcmA cell-wall binding domain, homolog or functional derivative thereof where the binding domain is a hybrid of at least two different AcmA repeat sequences and has a calculated pI lower than 10. For instance, a hybrid protein anchor including the A1 and A2 repeat sequences of AcmA and the D1 repeat sequence of AcmD may be constructed. Such a hybrid domain may comprise at least one AcmA-type domain with a relatively high calculated pI and another AcmA-type domain with a relatively lower calculated pI. The domain with the relatively high pI may be derived from, or be functionally equivalent to, the AcmA-type domain of the lactococcal cell-wall hydrolase AcmA. Of course, many other domains with a high pI are known, such as those disclosed in Table 3. A domain with a relatively low pI may be derived from, or be functionally equivalent to, the AcmA-type domain of the lactococcal cell-wall hydrolase AcmD. However, other domains with relatively low pI are known, including those disclosed in Table 3.
The invention further discloses a proteinaceous substance comprising a hybrid domain with at least two stretches of amino acids, wherein each stretch corresponds to a domain repeat sequence and is located adjacent to each other. The stretches may be separated by one or more amino acid residues of a short distance, i.e., 3-6 to 10-15 amino acids apart, by a medium distance, i.e., 15-100 amino acids apart, or by longer distances, i.e., >100 amino acid residues apart.
In another embodiment, the invention discloses a proteinaceous substance with a hybrid AcmA domain that further comprises a reactive group. Reactive groups that may be used include, without limitation, antigenic determinants, heterologous enzymes, single-chain antibodies or fragments thereof, polyhistidyl tags, fluorescing proteins, luciferase, binding proteins or peptides, antibiotics, hormones, non-peptide antigenic determinants, carbohydrates, fatty acids, aromatic substances, inorganic particles such as latex, and reporter molecules. The reactive group may also include AcmA cell-wall binding domains, homologs or functional derivatives thereof wherein the binding domain is a hybrid of at least two different AcmA cell-wall binding domains, homologs or functional derivatives thereof that are useful in heterologous surface display and are broadly reactive with cell-wall components of a broad range of micro-organisms. As used herein, the AcmA cell-wall binding domains, homologs and functional derivatives thereof will also be referred to as hybrid AcmA domains.
The invention further discloses reactive groups which are non-protein moieties, including substances such as antibiotics, hormones, aromatic substances, inorganic particles, or reporter molecules. The substances may be constructed by binding an antibiotic, such as penicillin, tetracycline or various other antibiotics, a hormone, such as a steroid hormone, or any other compound to a binding domain produced by the present invention. Such binding may be achieved using various techniques known in the art and may function to label or “flag” the binding domain. For instance, a binding domain may be bound to a reporter molecule such as fluorescent nanoparticles, i.e., FITC or HRPO, wherein tools are generated that may be used in diagnostic assays to detect microorganisms possessing peptidoglycan. Similarly, a binding domain may be bound to an antibiotic and used for in vivo parenteral administration into the bloodstream of humans or animals, or used in vitro to bind microorganisms with peptidoglycan in order to increase the concentration of the antibiotic around the microorganism which may be killed by the antibiotics.
The invention further discloses a reactive group which is a protein moiety which may include, without limitation, antigenic determinants, enzymes, single-chain antibodies or fragments thereof, polyhistidyl tags, fluorescing proteins, binding proteins or peptides. For instance, a protein including a reactive group which is another protein or polypeptide is disclosed. The invention also discloses a nucleic acid molecule encoding the protein produced using the methods of the invention. Such a nucleic acid molecule, comprising single-stranded or double-stranded DNA, RNA or DNA-RNA duplex, comprises nucleic acid sequences which encode a hybrid binding domain. The nucleic acid molecule may also comprise nucleic acid sequences encoding the reactive group polypeptide and may further comprise other nucleic acid sequences encoding a signal peptide comprising promoter sequences or regulatory nucleic acid sequences.
A vector comprising a nucleic acid molecule encoding a proteinaceous substance provided by the invention is also disclosed. Examples of vectors include, without limitation, a plasmid, a phage or a virus, wherein the vectors may be constructed using nucleic acids of the invention and routine skills known in the art. Viral vectors include baculovirus vectors or comparable vector viruses through which a protein produced by the present invention may be expressed or produced in cells, such as insect cells.
A host cell or expression system including a nucleic acid molecule or a vector produced using methods of the present invention is also disclosed. The host cell expressing a protein of the present invention may be a microorganism to which the protein is attached. The host cell, or expression system, may be a Gram-positive bacterium, a Gram-negative bacterium, a yeast cell, an insect cell, a plant cell, a mammalian cell, or a cell-free expression system, such as a reticulocyte lysate. The host cell or expression system may be constructed or obtained using a nucleic acid or vector of the present invention and routine skills known in the art.
In a further embodiment, the invention discloses a pharmaceutical composition comprising cell-wall material with an improved binding capacity with an immunogen bound thereto which may be useful for vaccination purposes, i.e., a vaccine. The vaccine may be used to invoke immunity against pathogens, such as malaria, which undergo life cycle stages where the pathogen is not in the blood but hides in cells.
The vaccines may be delivered to mucosal surfaces instead of being injected since mucosal surface vaccines are easier and safer to administer. An L. lactis-derived cell-wall material may be used for mucosal vaccination since this bacterium is of intestinal origin and no adverse immune reactions are generally expected from L. lactis.
The vaccine of the invention may also be administered by injection. When the vaccine is administered through injection, cell-wall material may be derived from a Mycobacterium sp. since mycobacterial cell-wall preparations have beneficial adjuvant properties. The mycobacterial cell-wall vaccine may be mixed with the proteinaceous substance carrying the immunogenic determinants used in the vaccine.
A vaccine produced using a method of the present invention will likely have a reduced risk of generating undesirable immune responses against cell-wall compounds of unwanted immunogens because the unwanted immunogens are not included in the vaccine.
Materials and Methods.
Bacterial Strains and Growth Conditions. Lactococcus lactis strain MG1363 (Gasson 1983) or derivatives thereof, such as MG1363ΔacmA (Buist et al. 1995) or NZ9000ΔacmA, were used as recipients for binding of reporter fusion protein. NZ9000 (Kuipers et al. 1997), which carries one of the reporter plasmids, was used as a production strain. L. lactis strains were grown in M17 broth (Oxoid) supplemented with 0.5% glucose in standing cultures at 30° C. Chloramphenicol was added to the M17 medium to an end-concentration of 5 μg/ml when appropriate. For expression, mid-log phase cultures were induced for 2 hours with the culture supernatant of the nisin producing L. lactis strain NZ9700 as described by Kuipers et al. (1997). Lactobacillus casei, ATCC393, was grown in MRS broth (Oxoid) in standing cultures at 30° C. Mycobacterium smegmatis, ATCC700084, was grown in Middlebrook medium (Oxoid) at 37° C. in aerated cultures. Bacillus subtilis, 168, was grown in TY broth (per liter: 10 g tryptone, 5 g yeast extract, 5 g NaCl pH 7.4) at 37° C. in aerated cultures.
Construction of Reporter Plasmids. The merozoite surface antigen 2 (MSA2) of Plasmodium falciparum strain 3D7 (Ramasamy et al. 1999) fused to the three repeats of AcmA (MSA2::cA) was used as the reporter anchor protein. The reporter anchor protein is encoded by plasmid pNG3041 based on the nisin inducible expression vector pNZ8048 (Kuipers et al. 1997) and contains a modified multiple cloning site in which the hybrid reporter gene was cloned. An in-frame fusion of the reporter was made at the 5′ end, the lactococcal PrtP signal- and prosequence, and at the 3′ end, the AcmA protein anchor sequence. The sequence of the MSA2 gene that was included in the construct corresponds to nucleotides (nt) 61 to 708 in GenBank accession number A06129. Primers used for the amplification of the MSA2 gene were MSA2.1 (5′-ACCATGGCAAAAAATGAAAGTAAATATAGC (SEQ ID NO:2)) and MSA2.4 (5′-CGGTCTCTAGCTTATAAGCTTAGAATTCGGGATGTTGCTGCTCC ACAG (SEQ ID NO:3)). The primers contain tags with restriction endonuclease recognition sites that were used for cloning. For cloning of the PrtP signal and prosequence (nt 1206 to 1766 in Kok et al. 1988), the primers PrtP.sspro.fw (5′-CCGTCTCCCATGCAAAGGAAAAAAGA AAGGGC (SEQ ID NO:4)) and PrtP.sspro.rev (AAAAAAAGCTTGAATTCCCAT GGCAGTCGGATAATAAACTTTCGCC (SEQ ID NO:5)) were used. The primers include restriction sites that were used for cloning. The AcmA protein anchor gene fragment (nt 833 to 1875) was obtained by subcloning a PvuII-HindIII fragment from plasmid pAL01 (Buist et al. 1995). Restriction endonuclease enzymes and Expand High Fidelity PCR polymerase were used in accordance with the instructions of the supplier (Roche). The final expression vector was designated pNG3041 (
A construct including a stop codon introduced after the MSA2 sequence in pNG3041 was designated pNG304. The protein secreted using this construct is substantially the same as the protein expressed from the pNG3041 plasmid except that the protein produced from pNG304 does not contain the AcmA protein anchor. The protein produced from pNG304 is used as a negative control in the binding assays. A vector was also made in which the AcmA protein anchor was exchanged for a protein anchor. The putative cell-wall binding domain of L. lactis AcmD (Bolotin et al. 2001) was cloned (nt 1796 to 2371 in GenBank accession number AE006288) using primers pACMB2 (5′-CGCAAGCTTCTGCAGAGCTCTTAGATTCTAATT GTTTGTCCTGG (SEQ ID NO:6)) and pACMB3 (5′-CGGAATTCAAGGAGGAGAAATA TCAGGAGG (SEQ ID NO:7)) to produce the plasmid pNG3042. pNG3042 contains an in-frame fusion between MSA2 and the protein anchor of AcmD (MSA2::cD) and differs from plasmid pNG3041 only in the gene fragment encoding the protein anchor.
Cell Pretreatment and Binding Conditions. Chemical pretreatment of L. lactis NZ9000ÄacmA was done with 10% TCA (0.6 M) in the following manner. Cells of 0.5 ml stationary phase cultures were sedimented by centrifugation and washed once with 2 volumes of demineralized water. Cells were resuspended in 1 volume of a 10% TCA solution and incubated by placing the reaction tube in boiling water for 15 minutes. Subsequently, cells were washed once with 2 volumes PBS (58 mM Na2HPO4.2H2O, 17 mM NaH2PO4.H2O, 68 mM NaCl; pH 7.2) and three times with 2 volumes demineralized water. The cells were used directly for binding experiments or stored (as described herein) until further use.
The following chemicals and conditions were used to examine the effect of different chemicals on the binding capacity of L. lactis cells for AcmA-type protein anchor fusions: acetic acid (HAc), hydrochloric acid (HCl), sulfuric acid (H2SO4), TCA, trifluoroacetic acid (TFA), and monochloro acetic acid (MCA). The acids were used at a final concentration of 0.6 M and incubated for 15 minutes in boiling water. SDS, dimethyl formamide (DMF) and dimethyl sulfoxide (DMSO) were used at a concentration of 10%. The SDS pretreatment was incubated for 15 minutes in boiling water and DMF and DMSO treatments were incubated at room temperature for 15 minutes. Cells were also pretreated with phenol (Tris buffer saturated) and incubated for 15 minutes at 55° C. Other chemicals pretreated at the 55° C. incubation temperature were: 4 M guanidine hydrochloride (GnHCl), 37% formaldehyde, chloroform:methanol (CHCL3:CH3OH (2:1)) and 0.1% sodium hypochlorite (NaOCl). In addition, incubation with 25 mM dithiothrietol (DTT) for 30 minutes at 37° C. and a pretreatment with hexane (100%) were analyzed.
The effect of enzymatic pretreatment of cells with lysozyme was also tested. For lysozyme pretreatment, the cells were resuspended in buffer (20% sucrose, 10 mM Tris pH 8.1, 10 mM EDTA, 50 mM NaCl) with lysozyme (2 mg/ml) and incubated at 55° C. for 15 minutes. After the chemical and enzymatic pretreatments, the washing steps were the same as the washing steps used for the TCA-treated cells. TCA pretreatment of Bacillus subtilis, Lactobacillus casei and Mycobacterium smegmatis was done as described herein for L. lactis.
Cell-free culture supernatants containing MSA2::cA, MSA2::cD or MSA2 without anchor were incubated in four-fold excess for 10 minutes at room temperature with pretreated cells (e.g., cells from 0.5 ml culture were incubated with 2.0 ml culture supernatant). After binding, cells were sedimented by centrifugation, washed twice in 2 volumes of demineralized water, resuspended in SDS-denaturation buffer, heated for 5 minutes at 98° C., subjected to SDS-PAGE, and analyzed by Western blot analysis.
Storage Conditions. Cell-free supernatants containing MSA2::cA, MSA2::cD or MSA2 were stored at −20° C. with or without 10% glycerol prior to binding. TCA-pretreated L. lactis cells were stored at −80° C. in 10% glycerol prior to binding. TCA pretreated L. lactis cells with bound MSA2::cA were stored at +4° C. or −80° C. with or without 10% glycerol. Cells stored in 10% glycerol were washed once with 1 volume of demineralized water prior to binding.
Cell pellets (in demineralized water) of TCA-pretreated L. lactis cells with or without bound MSA2::cA were frozen by contacting the vials with liquid nitrogen and removing the water with lyophilization. Alternatively, non-frozen cell pellets were dried under vacuum at 30° C. for 2 hours prior to binding.
Western Blotting. For detection of MSA2 proteins, cell pellets corresponding to 500 μl culture were resuspended in 50 μl SDS-denaturation buffer. Cell-free culture supernatants (1 ml) were concentrated by phenol-ether precipitation (Sauvé et al. 1995), vacuum dried and resuspended in 50 μl SDS-denaturation buffer. Proteins were separated with standard SDS-PAGE techniques. After separation, proteins were electroblotted onto PVDF membranes (Roche). In immunoblots, MSA2 proteins were detected with 1:10,000 diluted rabbit MSA2-specific antiserum (Ramasamy et al. 1999) and 1:5,000 diluted anti-rabbit IgG-conjugated alkaline phosphatase (Roche) using known procedures.
Fluorescence Microscopy. 100 μl cell suspensions incubated with MSA2::cA, MSA2::cD or MSA2 fusion proteins were washed twice with demineralized water and resuspended in an equal volume of PBS containing 1% BSA and MSA2-specific rabbit antiserum diluted to 1:200. After incubation for 20 minutes at room temperature, the cells were washed three times with 2 volumes PBS. Subsequently, the cells were incubated for 20 minutes in 1 volume PBS with 1% BSA and 1:100 diluted Oregon green labeled goat anti-rabbit immunoglobulin G (Molecular Probes). After washing once with 2 volumes PBS and twice with 2 volumes demineralized water, the cells were resuspended in 100 μl demineralized water. A 10 μl aliquot of the resuspended cells was spread onto a Polysin microslide (Menzel-Gläser), air dried, and examined under a fluorescence microscope (Zeiss).
Electron microscopy. TCA-pretreated L. lactis cells incubated with MSA2::cA, MSA2::cD or MSA2 were collected and washed as described herein. Immunogold labeling was performed on whole mount preparations of glutaraldehyde fixed cells on Formvar-carbon coated nickel grids using Auroprobe 15 nm goat anti-rabbit IgG gold marker (Amersham). Primary antibodies against MSA2 were diluted 1:1000 in PBS-glycine buffer. The labeled samples were stained with 0.1% uranyl acetate (W/V in water) and examined in a Philips CM10 transmission electron microscope at 100 kV.
Pretreatment of L. Lactis Cells with Different Chemicals. The cA protein anchor of L. lactis AcmA can be used to bind fusion proteins to a wide variety of Gram-positive bacteria. However, the amount of fusion protein that binds varies greatly among this group of bacteria. Binding of MSA2::cA that covers the entire cell surface of some lactobacilli was observed, whereas other bacteria such as L. lactis showed only limited localized binding (
Whether proteins are removed from the cell walls by these acid treatments was also analyzed.
TCA pretreatment was also used in all other experiments. The optimal TCA concentration in the boiling procedure was determined. TCA percentages of 1, 5, 10 and 20% were tested. Although 1% TCA pretreatment already showed a significant improvement in binding of MSA2::cA and 5% TCA pretreatment showed a further increase, no further improvement was observed at concentrations higher than 10% TCA (
The binding characteristics of the lactococcal cA homolog cD in an MSA2 fusion were analyzed using the standard TCA pretreatment procedure. Two of the three AcmD repeats are highly homologous to those of AcmA. An alignment is shown in
The binding of MSA2::cD to non-TCA-pretreated L. lactis cells was low as detected in Western blots (
The fluorescence microscopic images and electron microscopic images of TCA pretreated lactococcal cells (
Binding to Other Gram-Positives. The binding of MSA2::cA, MSA2::cD and MSA2 without anchor domain to the Gram-positive bacteria B. subtilis, Lb. casei and M. smegmatis was also analyzed.
Similar results were obtained for Lb. casei and M. smegmatis. The improved binding of MSA2::cA to TCA-pretreated Lb. casei cells is shown in
Binding strength and storage conditions. The strength of the MSA2::cA binding to TCA-pretreated L. lactis cells was analyzed with a treatment of LiCl after the binding. LiCl is commonly used to remove proteins from bacterial cell walls. From the Western blot of
Cell-free culture supernatants with MSA2::cA were stored with or without 10% glycerol at −20° C. MSA2::cA stored in this manner for several weeks had the same capacity to bind to TCA-pretreated L. lactis cells (not shown).
TCA-pretreated L. lactis cells with bound MSA2::cA were stored for 3 weeks at +4° C. in demineralized water or at −80° C. in demineralized water with or without 10% glycerol. The samples were analyzed in Western blots. Storing pretreated cells with bound MSA2::cA for 3 weeks in water at +4° C. only resulted in a loss of signal of about 50% (
In addition, the effects of drying and lyophilization on the binding of MSA2::cA to TCA-pretreated L. lactis cells were studied. Drying of pretreated cells had no observable negative effect on binding of MSA2::cA afterwards. Dried pretreated cells with bound MSA2::cA could be resuspended in water without losing bound fusion protein. This was also observed for lyophilized cells with bound MSA2::cA. Lyophilization of TCA-pretreated cells prior to binding resulted in loss of the binding capacity for MSA2::cA (results not shown).
From these data, it may be concluded that: (i) in spite of the non-covalent character of cA anchor binding to cell walls, the binding is very strong; (ii) cell-free culture supernatants can be stored safely at −20° C.; and (iii) drying of TCA-pretreated cells provides an efficient and simple method for storage of such cells either with or without bound cA-anchor fusions.
In Example 1, a technology is described that efficiently binds protein hybrids when externally added to the cell surface of non-recombinant gram-positive bacteria by means of an AcmA-type protein anchor. This technology provides the possibility to provide bacteria or bacterial cell walls with new traits without introducing recombinant DNA into them. The immunogenicity in rabbits of the Plasmodium falciparum merozoite surface protein, MSA2 of strain 3D7 (Ramasamy et al. 1999), presented on the cell surface of non-recombinant non-living L. lactis cells as an AcmA anchor fusion protein was investigated.
Materials and Methods.
Bacterial Strains and Growth Conditions. The L. lactis strain which produces MSA2::cA, the strain's growth conditions, the induction for expression, the TCA pretreatment of the L. lactis recipient cells and the binding of MSA2::cA to the cells was described in Example 1 with the following modification: a ratio of 1 (TCA-pretreated cells) to 5 (cell-free culture supernatant with MSA2::cA) was used for binding. An L. lactis NZ9000 strain carrying plasmid pNG3043 was used as a positive control in the immunization experiments (was positive in a previous, unpublished experiment). Plasmid pNG3043 encodes an MSA2 hybrid protein that contains the lactococcal PrtP cell-wall anchoring domain at its C-terminus (MSA2::cP) instead of the AcmA protein anchor. The PrtP cell-wall anchoring domain contains the LPXTG (SEQ ID NO:1) motif that enables a membrane-linked sortase to covalently couple the protein to the cell wall (Navarre and Schneewind 1994). The cP domain used in construct pNG3043 corresponds to nt 6539 to 6914 in Kok et al. (1988). Primers used for the amplification of this fragment were PrtP.cwa.fw3 (5′-ATATAAAGCTTGCAAAGTCTGAAAACGAAGG (SEQ ID NO:8)) and PrtP.cwa.rev (5′-CCGTCTCAAGCTCACTATTCTTCACGTTGTTTCCG (SEQ ID NO:9)). The primers include restriction endonuclease recognition sites for cloning. Plasmid pNG3043 differs from plasmid pNG3041 in the cell-wall binding domain. Growth conditions and induction of expression of strain NZ9000ΔacmA(pNG3043) were the same as for strain NZ9000ΔacmA(pNG3041).
Rabbit Immunizations. Ten barrier-reared, New Zealand white rabbits obtained from Harlan laboratories, The Netherlands, were used in groups of 2 for experimental immunizations. The care and use of animals were according to WHO guidelines (WHO/LAB/88.1). The rabbits were ear bled prior to immunization to obtain preimmune sera. Details of the rabbits and immunogens are as follows:
Rabbits A1 and A2 were subcutaneously immunized with NZ9000ΔacmA(pNG3041) cells (recombinant, MSA2::cA partly surface anchored).
Rabbits B1 and B2 were subcutaneously immunized with NZ9000ΔacmA (negative control).
Rabbits C1 and C2 were orally immunized with NZ9000ΔacmA(pNG3043) cells (recombinant, MSA2::cP surface anchored).
Rabbits D1 and D2 were orally immunized with NZ9000ΔacmA(pNG3041) cells (recombinant, MSA2::cA surface anchored).
Rabbits E1 and E2 were orally immunized with TCA treated NZ9000ΔacmA to which MSA2::cA had been bound from NZ9000ΔacmA(pNG3041) culture supernatant (non-recombinant, MSA2::cA surface anchored).
Stocks of NZ9000ΔacmA(pNG3043) with MSA2::cP expressed at its surface were stored in aliquots of 1011 cells in growth medium containing 10% glycerol at −80° C. The cells remain viable under these conditions and retain MSA2 on the surface as demonstrated by immunofluorescence (not shown). The first immunization was carried out with freshly grown bacteria. For subsequent immunizations, stocks of bacteria were freshly thawed, washed and resuspended in buffer at the appropriate concentration for immunizations.
On the other hand, the non-pretreated NZ9000ΔacmA (negative control), the non-pretreated NZ9000ΔacmA(pNG3041) and the TCA-pretreated NZ9000ΔacmA with the externally bound MSA2::cA were prepared daily from fresh cultures.
Subcutaneous injections were performed with a total of 5×109 cells in 100 μL PBS without any adjuvant into two sides on either side of the spine. The subcutaneous injections were repeated two more times at three-week intervals. Prior to oral immunization, the rabbits were deprived of water and food for two to four hours. The rabbits were then fed 5×1010 cells resuspended in 1 ml of 0.5% sucrose. Each dose was repeated for three successive days to obtain reproducible oral immunization. Altogether, three series of oral immunizations were given at three-week intervals. Adverse effects consequent to the immunizations, including granulomas at the sites of subcutaneous injections, were not observed, indicating that L. lactis was well tolerated by the animals.
Serum Antibody Responses. Rabbits were ear bled two weeks after each immunization to obtain sera for antibody assays. The sera were stored at −20° C. until use. Ten-fold serial dilutions of the antisera in 2% BSA in PBS were used in immunofluorescence assays (IFA) to determine the titer of the antibodies against MSA2 on the surface of 3D7 P. falciparum merozoites. IFA was performed on acetone-methanol fixed late stage 3D7 P. falciparum parasites as previously described (Ramasamy 1987). For detection of antibody isotypes, Oregon Green conjugated goat anti-rabbit Ig (Molecular Probes) was used as the second antibody. For detection of IgG antibodies, a fluorescein conjugated, affinity purified, mouse monoclonal with specificity against rabbit IgG chains (Rockland) was used.
Results and Discussion.
Surface Expression of MSA2 in Different L. Lactis Strains. Coomassie staining of SDS-PAGE gels and fluorescence microscopy were used to determine, in a semi-quantitative way, the number of MSA2 molecules expressed and surface exposed by the recombinant lactococcal strains carrying plasmid pNG3041 or pNG3043 that produce MSA2::cA or MSA2::cP, respectively, and by the non-recombinant TCA-pretreated L. lactis cells to which MSA2::cA had been bound from the outside. The recombinant strains were estimated to produce approximately 1.4×105 molecules of MSA2::cA or MSA2::cP. The surface exposure of MSA2::cA and MSA2::cP differed considerably as shown by fluorescence microscopy in
Accordingly, it may be concluded that the number of surface-exposed MSA2::cA and MSA2::cP on the recombinant lactococcal strains is less than 10% of the total number of molecules produced by these strains. The other molecules are most likely trapped in the membrane or the cell wall. Similar observations were made by Norton et al. (1996) for the expression of TTFC fused to the cP cell-wall anchoring domain. In that study, only membrane-associated or cell-wall-associated TTFC could be demonstrated and no surface-exposed TTFC::cP was demonstrated. Thus, it appears that binding from the outside to TCA-pretreated cells is a more efficient method to surface-exposed proteins on L. lactis cells.
Anti-MSA2 Antibody Responses in Orally Immunized Rabbits. Characteristics of the anti-MSA2 antibody response to the immunizations are summarized in Table 2. The oral immunizations with the recombinant L. lactis that produces MSA2::cP (rabbits C1 and C2) were done before (unpublished results) and used as a positive control. In the previous experiment, a similar antibody response was found. The present experiment showed that specific antibodies against near native MSA2 were detectable after two immunizations for group A, D and E rabbits, and that antibody titers increased in all instances after a third immunization. IgG antibodies were predominant after three immunizations in either the subcutaneous or oral route. A comparatively weak anti-MSA2 surface IFA, attributable to the generation of cross-reactive antibodies (as described herein), was also observed after three control subcutaneous immunizations with L. lactis cells alone.
Taken together, the results indicate that: (i) MSA2 produced by lactococcal cells elicits serum antibodies that recognize native P. falciparum parasite MSA2; (ii) MSA2-specific Th cells are activated through mucosal immunization due to the presence of systemic IgG antibodies (Table 2) that can be boosted (unpublished results); and (iii) oral immunizations with MSA2::cA bound to non-recombinant non-living TCA-pretreated L. lactis cells are as efficient in evoking specific serum antibody responses as the live recombinant strain producing MSA2::cA that was administered subcutaneously or orally, or as efficient as the live recombinant strain producing MSA2::cP that binds MSA2 covalently to its cell wall delivered orally.
Anti-lactococcal Antibody Responses. Western blots (
The cell-wall binding domain or anchor of the lactococcal cell-wall hydrolase AcmA includes three repeats of 45 amino acids that show a high degree of homology (Buist et al. 1995). These three repeats belong to a family of domains that meet the consensus criteria as defined in PCT publication WO 99/25836 and can be found in various surface-located proteins in a wide variety of organisms. Another feature that most of these domains have in common is that their calculated pI values are high, approximately 8 or higher (Table 3). The pH used in previous binding experiments with MSA2::cA (i.e., Examples 1 and 2) was approximately 6, indicating that the binding domain was positively charged.
The AcmA protein anchor homolog of the lactococcal cell-wall hydrolase AcmD (cD) (Bolotin et al. 2001) also includes three repeats (
Materials and Methods.
Bacterial strains, growth and induction conditions, TCA pretreatment of L. lactis cells, incubation of the MSA2 protein anchor fusion proteins to TCA-pretreated cells, washing conditions, protein gel electrophoresis, Western blotting and immunodetection were the same as described herein with reference to Example 1. The cell-free culture supernatants with MSA2::cA, MSA2::cD or A3D1D2D3 have a pH of approximately 6.2. The influence of pH was examined by adjusting the pH of the cultures by the addition of HCl or NaOH to obtain the required pH.
Plasmid Constructions. The plasmid that expresses the MSA2::cD fusion was described herein with reference to Example 1. Plasmid pPA43 is based on the same expression plasmid and contains an in-frame fusion of the lactococcal signal sequence of Usp45 (ssUsp; van Asseldonk et al. 1990. Gene 95: 155-160), the c-myc epitope for detection purposes, the A3 cA repeat and repeats D1, D2 and D3 of cD. Primers used for cloning A3 were cArepeat3.fw (CCG TCT CCA ATT CAA TCT GCT GCT GCT TCA AAT CC (SEQ ID NO:10)) and cA repeat3.rev (TAA TAA GCT TAA AGG TCT CCA ATT CCT TTT ATT CGT AGA TAC TGA CCA ATT AAA ATA G (SEQ ID NO:11)) (the primers include the A3 specific sequences). The primers used for cloning the three cD repeats were cDrepeat1.fw (CCGTCTCCAATTTCAGGAGGAACTGCTGTTACAACTAG) (SEQ ID NO:12) and cDrepeat3.rev (TAATAAGCTTAAAGGTCTCCAATTCCAGCAACTTGCAAAACTTCTCCT AC) (SEQ ID NO:13) (the primers include the cD specific sequences).
Results and Discussion.
Binding of MSA2::cD at Low pH. Since binding of MSA2::cD was not observed at a pH (the pH of the culture medium after growth and induction is about 6.2) higher than the calculated pI for the cD domain (i.e., pI 3.85), binding was studied when the pH of the medium was adjusted to pH 3.2. TCA-pretreated L. lactis cells were used as the binding substrate and the relative amounts of bound MSA2::cD were analyzed in Western blots. The amounts of unbound reporter protein remaining in the culture supernatant after binding were also analyzed.
Binding of cAcD Hybrid Anchors. Analysis of the pI values of the cA homologs in Table 3 indicates that two classes of repeats can be distinguished: a majority (99 out of 148) of homologs that have a high pI value (>8) and a smaller group (33 out 148), of which cD is a representative, that has pI values lower than 6. Based on the experimental results, it is shown that these types of anchoring domains only bind to bacterial cell walls at a pH that is lower than the anchoring domains pI. Notably, most cell-wall binding domain homologs include repeats with a pI that are representatives of one of the two groups, i.e., only repeats with a high or low pI. Some proteins with cell-wall binding domains, e.g., those of DniR of Trepanoma pallidum and an amidase of Borrelia burgdorferi, include repeats with high and low pI. Since the binding pH of such “natural hybrid” cell-wall binding domains is below the intermediate pI value of the total number of repeats present in the domain, a hybrid cell-wall protein anchor was constructed using the cA and cD repeats with an intermediate pI value. Table 5 lists the native AcmA and AcmD anchors and a number of examples of cA/cD hybrids. The constructed hybrid protein anchor (A3 D1D2D3) has a calculated pI value of approximately 5.1. A protein anchor including only D1D2D3 shows little binding at a pH above its calculated pI (as described herein). The A3 (pI 10) domain shows similar binding at pH 5 and pH 7.
The binding of the hybrid anchor A3D1D2D3 was tested at pH 3, pH 5 and pH 7. At pH 3, most protein had been bound to the ghost cells (
Non-genetically modified non-living Lactococcus lactis cells (ghosts) preloaded with the Plasmodium falciparum MSA2 antigen fused to the AcmA protein anchor (MSA2::cA) were used to orally immunize mice in a similar way as described herein with reference to Example 2. In this experiment, the question of whether immunizations through the oral route with the non-recombinant non-living Ghosts carrying MSA2::cA on their surface (Ghosts-MSA2::cA) can elicit typical Th1-type immune responses, such as IgG2 antibodies and gamma-interferon (γIFN)-producing T cells in the spleen is addressed. These responses are particularly relevant to obtain immunity for pathogens, such as malaria, that undergo stages in their life cycle where they are not in the blood but hide in cells.
Materials and Methods.
Groups of five mice of different strains were used for immunization. The strains of mice used were Balb/c (with the major histocompatibility locus allotype of H2d), C57 Black (H2b), C3H (H2k) and ICR (outbred, i.e., of varying H2 types). Oral immunizations were performed at three weekly intervals. Immunizations were performed with MSA2::cA absorbed onto the surfaces of TCA-treated Lactococcus lactis cells (Ghosts-MSA2::cA) or with recombinant L. lactis that displayed MSA2 on the surface through the use of a covalently linked cell-wall anchor (L. lactis(MSA2::cP)) as described herein with reference to Example 2. The mice were tail bled to obtain serum samples two weeks after the second, third and fourth immunizations. Fecal pellets were collected and extracted to examine intestinal IgA antibody production. The mice were sacrificed at the end of each experiment and the spleens were removed for examining T-cell responses by ELISPOT. MSA2-his tag produced in E. coli was used as antigen in the ELISA and ELISPOT assay. The growth of bacterial strains and the preparation of Ghost cells were as described herein with reference to Example 2.
Results and Discussion.
Kinetics and Isotypes of the Serum IgG Antibodies Generated Oral Immunizations. Differences in the kinetics of the antibody response and the isotype distribution were observed between different murine strains. The antibody response was also different when living recombinant L. lactis (MSA2::cP) or Ghosts-MSA2::cA were used as immunogens. With Ghosts-MSA2::cA, high serum antibody levels were detectable in the C3H mice after two immunizations. IgG antibodies were detectable in all four murine strains after three and four immunizations. Antibody titers were highest in C3H mice. IgG antibodies that reacted with native MSA2 on parasites were detected in the sera of immune mice by fluorescence microscopy (IFA) confirming that the immunizing form of the protein elicits biologically relevant antibodies. Control immunizations were performed with Ghosts alone where no MSA2-specific antibodies were elicited. In parallel experiments using MSA2cP as the immunogen, high serum IgG antibody levels were only seen with Balb/c mice after two immunizations. After three and four immunizations, good antibody responses developed in C3H mice. Antibody titers were highest in Balb/c mice.
Significant differences existed between the strains in the isotypes of the elicited serum IgG antibodies in response to immunization with Ghosts-MSA2::cA. Balb/c mice showed higher levels of IgG2a and IgG2b antibodies, some IgG3 antibodies and negligible IgG1, which demonstrates a possible Th1 bias. On the other hand, C57 Black and C3H mice had high IgG1, IgG2a and IgG2b, and lower IgG3 antibodies to MSA2, which is more characteristic of a mixed Th1 and Th2 response. ICR mice, as expected, showed a range of responses. Some ICR mice had the Balb/c and others the C3H/C57 Black pattern of IgG isotypes.
Formation of Mucosal Antibodies. IgA antibodies were detected by ELISA in the fecal pellets of the ICR and Balb/c mice, but were not detected in C3H or C57 Black mice when immunization was performed with living recombinant L. lactis(MSA2::cP) or Ghost-MSA2::cA.
T-Cell Responses. The increase of the intensity of the IgG ELISA reactions seen in mice immunized with Ghosts-MSA2::cA with each immunization demonstrates that boosting takes place and that a Th-dependent antibody response exists in these animals. The IgG isotype distribution further confirms this conclusion. Therefore, Th cells are generated in ICR, Balb/c, C57 Black and C3H mice.
The ELISPOT assay for detecting gamma-interferon (γIFN) producing cells detects mainly CD8+ Tc cells, which are an important component of the immune response to many pathogens, including malaria parasites. His-tagged MSA2 produced in E. coli was used as antigen in the assay. MSA2-specific γIFN producing cells could be detected in the spleens of Balb/c, C57 Black and C3H mice that were immunized with Ghosts-MSA2::cA. MSA2-specific γIFN producing cells were not observed in the spleens of control mice immunized with Ghosts alone or with the living recombinant L. lactis(MSA2-cP). The latter group showed a high level of non-specific γIFN producing cells. The high background observed may be due to ongoing inflammation.
The sensitization of MSA2-specific Tc cells in the spleen after immunization with the non-recombinant non-living L. lactis Ghost system carrying a foreign protein is a novel finding which is applicable to malaria since protection against sporozoite-infection is associated with γIFN producing cells being produced in the spleen.
The non-recombinant non-living Ghost system can be used in oral immunizations to elicit typical Th1-type immune responses. These types of responses are particularly relevant to obtain immunity for pathogens that undergo stages in their life cycle where the pathogens are not in the blood but rather hide in cells. The responses are more pronounced and more specific for the Ghost system than for the living recombinant system. The Ghost system has the additional advantage of eliminating the risk of spreading recombinant DNA into the environment.
Streptococcus pneumoniae is the leading etiological agent of severe infections including septicemia, meningitis, pneumonia, and otitis media. Recent studies on the molecular epidemiology and pathogenesis of S. pneumoniae have identified pneumococcal proteins with vaccine potential. One of these proteins, the protease maturation protein PpmA, has been shown to elicit immune protective potential in a mouse pneumonia model.
The non-genetically modified lactococcal ghosts have been shown to be an efficient carrier for use in oral immunizations of rabbits and mice in order to elicit strong anti-malaria immune responses. The construction of lactococcal ghosts that display the S. pneumoniae PpmA fused to the lactococcal AcmA cell-wall binding domain on their surface is described herein. The ability of these ghosts to protect orally immunized mice from a lethal nasal dose of S. pneumoniae was investigated.
Materials and Methods.
Bacterial Strains and Growth Conditions. L. lactis was grown and ghost cells were prepared as described herein with reference to Example 1. S. pneumoniae was grown as described before (Gingles et al. 2001, Infect. Immun. 69: 426-434).
Construction of ppmA Protein Anchor Fusion Expression Plasmid. The expression plasmid for ppmA protein anchor fusion (PpmA::cA) was substantially similar to the expression plasmid for the MSA2 protein anchor fusion as described herein with reference to Example 2. For the secretion of PpmA::cA, the secretion signal sequence of the Usp45 protein (ssUsp) of L. lactis (van Asseldonk et al. 1990. Gene 95: 155-160) was used. The PpmA gene was cloned by PCR using primers ppmA.1 (CGGTCTCACATGTCGAAAGGGTCAGAAGGTG CAGACC) (SEQ ID NO:14) and ppmA.2 (CGGTCTCGAATTGCTTCGTTTGATGTACTACTG CTTGAG) (SEQ ID NO:15) resulting in plasmid pPA32 which contains ppmA as an in-frame fusion with ssUsp45 and the protein anchor (ssUsp::ppmA::cA). Expression of the fusion gene results in the secreted product PpmA::cA. The primers include an Eco31I restriction enzyme recognition site that was used for digestion of the PCR fragment. This restriction digest produced NcoI and EcoRI sticky ends which were used for cloning. The primers also included the ppmA sequences. Chromosomal DNA of S. pneumoniae strain D39 was used as a template for the PCR reactions.
Preparation of the Vaccine. Three liters of M17 medium with PpmA::cA, obtained after growth and used to induce producer cells for expression of L. lactis (pPA32) was centrifuged and filter sterilized (0.2 μm) to remove the producer cells. Ghost cells were prepared from 0.5 liter of L. lactis NZ9000(ΔacmA). After binding, the ghost cells with PpmA::cA (Ghosts-PpmA::cA) were isolated by centrifugation and washed with PBS. The ghost cells were stored in PBS in aliquots of 2.5×1010 Ghosts/ml at −80° C. Two control groups included: (i) Ghosts without bound PpmA::cA; for the sample preparation, the same amounts of ghost cells were used and the same centrifugation and washing steps were performed, but the binding step was omitted; and (ii) soluble PpmA was isolated as a his-tagged fusion.
Mice Immunizations. Groups of 10 mice (CD-1) were used in the immunizations. Oral doses included 5×109 Ghosts with or without PpmA::cA (50 μg) or 50 μg soluble PpmA in PBS. Nasal doses included 5×108 Ghosts with or without PpmA::cA (5 μg) or 5 μg soluble PpmA. 108 Ghosts-PpmA::cA (1 μg) were subcutaneously injected. For intranasal immunizations, the mice were slightly anesthetized with Isofluorane.
Intranasal Challenge. The groups of orally immunized mice were intranasally challenged 14 days after the last booster immunization with a dose of 106 colony forming units (CFU) S. pneumoniae D39 as described (Kadioglu et al. 2000, Infect. Immun. 68: 492-501). Mice were monitored after the challenge for visible clinical symptoms for 7 days, at which point the experiment was ended. Mice that were alive after 7 days were considered to have survived the pneumococcal challenge and mice that became moribund during the 7-day period were judged to have reached the endpoint of the assay. The time the animal became moribund was recorded, and the animal was sacrificed by cervical dislocation.
ELISA Analysis. Serum samples were taken from each mouse before the intranasal challenge and stored at −20° C. before use. Microtiter plates were coated with 100 μg PpmA/ml in 0.05 carbonate buffer. Serial 10-fold dilutions of pooled serum of each group were incubated on the plates as described (Gingles et al. 2001, Infect. Immun. 69: 426-434). Anti-mouse immunoglobulin-horseradish peroxidase conjugate was used for detection and the absorbance was measured at 492 nm.
Results and Discussion.
Serum Antibody Response. Mice were immunized orally, nasally and subcutaneously according to the scheme shown in
Intranasal administration of Ghosts-PpmA::cA resulted in a high titer of anti-PpmA antibodies (IN PpmA+Ghosts). A high titer was also obtained by subcutaneous administration of Ghosts-PpmA::cA. These titers were lower by a factor of 5 to 10 when compared to soluble PpmA that was subcutaneously administered and formulated with the strong Freund's complete adjuvant (Peter Adrian, Erasmus University Rotterdam, The Netherlands, unpublished results). In addition, the Freund's PpmA vaccine contained 50 μg PpmA per dose, whereas the intranasally administered Ghosts-PpmA:cA contains only 5 μg/dose and the subcutaneous Ghost-PpmA::cA vaccine contains only 1 μg PpmA/dose. This result demonstrates the adjuvant effect of the ghost cells. Side effects of the orally, nasally or subcutaneously administered ghosts were not observed, which is in contrast to the severe side effects that are usually seen with the use of Freund's adjuvants.
The results demonstrate that high titer serum antibodies can be obtained by the mucosal route of administration. These data also show that ghost cells may be safely used in traditionally injected vaccines without side effects in order to induce high titer serum antibodies.
Protection Against Challenge. The mice orally immunized with soluble PpmA, Ghosts alone or Ghosts-PpmA::cA were challenged 14 days post-immunization with a lethal intranasal dose of S. pneumoniae. The mice immunized with soluble PpmA or Ghosts alone died within 72 hours after challenge. The group immunized with Ghosts-PpmA::cA showed a survival rate of 40% (
L. lactis on binding of MSA2::cA.
Plasmodium falciparum 3D7 asexual blood stage parasites.
L. lactis strain used: NZ9000ΔacmA (lactococcal cells lacking the cell wall hydrolase AcmA).
L. lactis [MSA2::cA] and L. lactis [MSA2::cP] are the recombinant strains with surface-expressed MSA2, cell wall anchored through the non-covalent AcmA binding domain (cA) or the covalent PrtP anchoring domain (cP), respectively.
Laclococcus lactis
Enterococcus faecalis
hirae
Listeria
monocytogenes
innocua
ivanovii
seeligeri
welshimeri
grayi
Haemophilus
influenzae
Staphylococcus
somnus
Helicobacter pylori
Pseudomonas
aeruginosa
Putida
Sinorhizoblum
meliloti
Synechocystis sp.
Aquifex aeolicus
Volvox carteri
f. nagariensis
Staphylococcus aureus
Colletotrichum
lindemuthianum
Chlamydophila
Pneumoniae
Chlamydia
trachomatis
Prevotella intermedia
Leuconostoc oenos
Oenococcus oeni
Thermotoga maritime
Treponema pallidum
Borrelia burgdorferi
Laciobacillus Øgle
Bacillus subtilis
sphaericus
Salmonella dublin
Escherichia coli
Staphylococcus
Drosophila
melanogaster
Drosophila
melanogaster
Caenorhabditis
elegans
Caenorhabditis
elegans
Caenorhabditis
elegans
Caenorhabditis
elegans
Bacillus subtilis
Citrobacter fruendii
Escherichia coli
Micrococcus luteus
Bacillus subtilis
Streptococcus
pyogenes
Bacillus subtilis
Bacillus subtilis
Bacillus subtilis
YxVKxGDTLxxIAxxxxxxxxxLxxxNxxLxxxxxIxxGQxIxVx
H IR ESV LS I I L L I
L I V V V L
| Number | Date | Country | Kind |
|---|---|---|---|
| 01202239 | Jun 2001 | EP | regional |
This application is a divisional of application Ser. No. 10/321,857, filed Dec. 16, 2002, now U.S. Pat. No. 7,067,639, which itself is a continuation of International Application Number PCT/NL02/00383 filed on Jun. 11, 2002, designating the United States of America, published in English on Dec. 19, 2002 as PCT International Publication WO 02101026 A2, the contents of the entirety of both which are incorporated by reference.
| Number | Name | Date | Kind |
|---|---|---|---|
| 5470573 | Lubitz et al. | Nov 1995 | A |
| 5616686 | Fischetti et al. | Apr 1997 | A |
| 5786205 | Fischetti et al. | Jul 1998 | A |
| 5821088 | Darzins et al. | Oct 1998 | A |
| 5955258 | Buist et al. | Sep 1999 | A |
| 6027910 | Klis et al. | Feb 2000 | A |
| 6114147 | Frenken et al. | Sep 2000 | A |
| 6177083 | Lubitz | Jan 2001 | B1 |
| 6423316 | Riesbeck et al. | Jul 2002 | B1 |
| 6827940 | Riordan et al. | Dec 2004 | B1 |
| 6896887 | Leenhouts et al. | May 2005 | B2 |
| 7067639 | Leenhouts et al. | Jun 2006 | B2 |
| 20030180816 | Leenhouts et al. | Sep 2003 | A1 |
| 20030186851 | Leenhouts et al. | Oct 2003 | A1 |
| 20060115491 | Leenhouts et al. | Jun 2006 | A1 |
| 20080193427 | Kaesler et al. | Aug 2008 | A1 |
| Number | Date | Country |
|---|---|---|
| 3919644 | Dec 1990 | DE |
| 198 00 746 | Jul 1999 | DE |
| 0 545 352 | Jun 1993 | EP |
| 0 712 935 | May 1996 | EP |
| 02065790 | Mar 1990 | JP |
| 10117783 | May 1998 | JP |
| 2002017357 | Jan 2002 | JP |
| WO 9113155 | Sep 1991 | WO |
| WO 9201791 | Feb 1992 | WO |
| WO 9401567 | Jan 1994 | WO |
| WO 9418330 | Aug 1994 | WO |
| WO 9531561 | Nov 1995 | WO |
| WO 9600579 | Jan 1996 | WO |
| WO 9611263 | Apr 1996 | WO |
| WO 9640943 | Dec 1996 | WO |
| WO 9728263 | Aug 1997 | WO |
| WO 9807874 | Feb 1998 | WO |
| WO 9842850 | Oct 1998 | WO |
| WO 9925836 | May 1999 | WO |
| WO 0044878 | Aug 2000 | WO |
| WO 0053163 | Sep 2000 | WO |
| WO 01-09350 | Feb 2001 | WO |
| WO 0154672 | Aug 2001 | WO |
| WO 0191791 | Dec 2001 | WO |
| WO 02101026 | Dec 2002 | WO |
| Number | Date | Country | |
|---|---|---|---|
| 20060115491 A1 | Jun 2006 | US |
| Number | Date | Country | |
|---|---|---|---|
| Parent | 10321857 | Dec 2002 | US |
| Child | 11299304 | US |
| Number | Date | Country | |
|---|---|---|---|
| Parent | PCT/NL02/00383 | Jun 2002 | US |
| Child | 10321857 | US |
