Infectious bursal disease virus

Abstract

A new virus not neutralized or bound by monoclonal antibodies which are group neutralizing to all IBDV vaccines of current art, and capable of inducing infectious bursal disease in poultry is identified, in essentially pure form. A test kit, and assay for the presence of the virus is disclosed, together with the vaccine incorporating the virus. A monoclonal antibody Mab 50, which neutralizes the virus, form the basis of an alternative vaccine.

Description

BACKGROUND OF THE INVENTION

1. Field of the Invention

This invention relates to the poultry industry, and in particular, infectious bursal disease, a known scourge of this industry. Specifically, a novel virus is identified, and methods of using this virus and information associated therewith are disclosed. A neutralizing monoclonal antibody (Mab) specific for the virus, and a vaccine based thereon, are also disclosed.

2. Background of the Invention

Infectious bursal disease (IBD) has previously been identified as a significant economic drain in the poultry industry. This disease, which strikes chiefly at the chicken industry, is caused by virulent field viruses which cause a highly contagious, immunosuppressive disease condition. This condition, of course, exacerbates other infections in the chicken population. The disease is noted for its impact on young chickens, and is characterized by lesions in the lymphoidal follicles of the bursa of Fabricius.

In U.S. patent application Ser. No. 07/227,311, filed Aug. 2, 1988, the inventor herein reported the identification of a novel IBD virus not neutralized by any available vaccine and not neutralized by antibodies previously developed as sensitive to, and capable of neutralizing, all known viruses identified as inducing IBD. The entire disclosure of that application is incorporated herein by reference. Indeed, that application reports the deposition, under Budapest Treaty Conditions, of two viruses, at the Institute Pasteur, under accession numbers i-792 and i-793. This virus, now referred to as GLS, was detected by the use of monoclonal antibodies, particularly those identified as R63 and B69, expressed by hybridoma cell lines deposited under ATCC HB-9437 and HB-9490. These Mab's, identified as neutralizing monoclonal antibodies, comprise a passive vaccine against known strains of viruses inducing IBD and act as a means for detecting the presence of GLS virus, since the positive binding by a non-neutralizing antibody, such as B29, coupled with a negative reaction for R63 and B69 is proof of the GLS IBDV presence.

Thus, recent history in the poultry industry, particularly that along the eastern coast of the United States, reflects an increasingly large number of reports of outbreaks of infectious bursal disease, which are not fully prevented by any of the known vaccines, including those prepared from the monoclonal antibodies discussed above. Due to the severe economic strain placed on the poultry industry by these uncontrolled outbreaks, a significant degree of investigation of the cause of the outbreaks, and the reason for the failure of known vaccines to prevent such outbreaks, has been undertaken. No fault has been detected in the preparation of the vaccines, or their administration. Nonetheless, unchecked outbreaks continue to occur.

This continual outbreak is addressed, in part, by a vaccine developed using the virus addressed in U.S. application Ser. No. 07/227,311. This vaccine (GLS vaccine), now being successfully commercially introduced, alone or together with more conventional vaccines, provides protection against the dominant forms of IBDV infections.

New research, using monoclonal antibodies specific to 3 general categories of IBDV, has provided greater understanding of the IBDV. These developments are reported in the application identified above, U.S. application Ser. No. 07/432,752.

That application reports the development of neutralizing Mabs such as 179 and 8, available at the ATCC under deposit numbers HB-10158, HB-10174, and neutralizing against all previously known IBDV, and 57, ATCC deposit number HB-10156, neutralizing and specific to the GLS strain and variants. Recently research has identified yet a new IBDV in the field, not controlled by the GLS-vaccine. Monoclonal antibody 179 does not even react in vitro.

Thus, there is yet a new IBDV in the field, against which there is no current active vaccine, and against which no passive vaccine has yet been provided. This new virus, apparently a GLS variant and mutation thereof, given the Mab 57 in vitro binding, is currently uncontrolled. Protection for the poultry industry against this new IBDV is therefore a pressing need.

SUMMARY OF THE INVENTION

It has now been discovered that a new virus responsible for infectious bursal disease in poultry in the USA is a newly identified, GLS variant strain with altered recognition sites, such that none of the previously developed group reactive and neutralizing monoclonal antibodies are capable of neutralizing or binding to the virus. However, these monoclonal antibodies do neutralize and react with all known IBD vaccines of the current art. The virus has been isolated in essentially pure form and can be identified by the failure of monoclonal antibody 179 to bind thereto, while another common non-neutralizing antibody as well as standard polyclonal antisera available from the USDA will bind thereto in positive fashion and Mab 57 will bind it in vitro. Thus, the new virus may be recognized by a negative test. If Mab 179 will not bind, but B29, polyclonal antisera, or Mab 57 do react, the new GLS-variant virus, designated DS326, is present. Since 57 reacts with both GLS and DS 326, positive reaction of this Mab, alone, will not disseminate between the two viruses.

The new virus may be used in killed form as killed vaccines inducing antibodies resistant to the new virus, and may be used in attenuated form or otherwise genetically altered to prepare a live or killed vaccine.

Additionally, a new Mab, designated Mab 50 neutralizes the virus. The can be used to assay for the presence of the virus, and form an alternative vaccine for the passive immunization of young chickens.

BRIEF DESCRIPTION OF THE DRAWINGS

FIGS. 1-1E set forth the nucleotide sequence of the gene for expression of Mab 50 (SEQ ID NO: 1), as well as the amino acid sequence (SEQ ID NO: 2) therefor.

DETAILED DESCRIPTION OF THE INVENTION

As noted above, the new virus is not bound by any available monoclonal antibodies specific thereto. Thus, identification of the presence of the new virus cannot be achieved through conventionally available normal measures. However, by a combination of negative and positive testing, the presence of the virus and isolation of the virus can be achieved.

In particular, the monoclonal antibody designated 179 which neutralizes all previously identified serotype one IBD virus strains and at least one serotype two strain, gives negative results in an antigen capture-ELISA when reacted with the homogenized bursas drawn from chickens which yielded the new viruses. The same results were observed with Mabs B69 and R63, selective for the D78 virus strain and certain classic and Delaware viruses of an earlier art, once thought to be the prevalent strain in the United States. At the same time, another Mab designated B29, expressed by a hybridoma cell line deposited at the ATCC under accession number MB 9746, pursuant to Budapest Treaty conditions, which does not neutralize the virus, nevertheless binds to it, as well as to all known existing virus vaccines. Additionally, the polyclonal IBDV antisera used as a standard, and available from the USDA's national veterinary services laboratory in Ames, Iowa under designation ADU8701, binds, in the antigen capture ELISA, to the novel virus. Mab 57 will bind to the new virus, in vitro, as well as the GLS virus. Those of skill will identify non-neutralizing antibodies which bind to the virus, and can be directly produced as conventional monoclonal antibodies. The invention is not limited to any given Positive test factor. Since the overall size of the virus, in comparison to any available neutralization site is quite large, there will be a large potential field of such positive test factors and polyclonal antisera.

Thus, the presence of the virus can currently be best determined by negative testing in an antigen capture-ELISA for 179, and positive testing of either Mab 8, B29, 57, the polyclonal antisera or other positive Mab. It should be noted, however, that morphological or symptomatic verification of the presence of an IBD virus, coupled with a failure of the 179 to bind to an antigen sample, is clear evidence of the presence of the virus. Further, a positive reaction with Mab 57 indicates either GLS or DS 326 presence.

IDENTIFICATION OF THE VIRUS PRESENCE

To originally identify the presence of the new virus, chicken populations from a disaster farm were sampled. Bursas from the chicken populations were homogenized by placing one bursa in one ml of SGPA-EDTA buffer and grinding the mixture with a mortar and pestle until fluid-like consistency was obtained. This material was clarified by low speed centrifugation, and the supernatents were analyzed by an AC-ELISA.

In this assay, 96-well IMMULON 1 (polystyrene) plates (obtained from Dynatech, of Virginia) were coated with 0.1 ml of two ug/ml of protein A from Staphlycoccus aureus in a coating buffer. After 18 hours at 4.degree. C., the plates were dumped. 1/10 dilutions of acid supernatents collected from hybridoma cultures secreting the 179, and 57 IBD virus specific Mabs were added in the phosphate buffered saline which contained TWEEN 20 (polyoxyethylene -20 sorbitan monolaurate)and 2% non-fat dried powdered milk, in alternating fashion. After a 24 hours reaction at 4.degree. C., the plates were tapped dry and blocked for 30 minutes at room temperature. After blocking, the plates were emptied and tapped dry. 0.1 ml of serial dilutions of each sample of the homogenized bursal suspensions were added to the coated plates, and after incubation, the plates were emptied, tapped dry and washed three times for three minutes with PBS-T. Then, each well received 0.1 ml of a biotin labelled 179 Mab conjugate, which was diluted in PBS-T+NFDM. After an hour of incubation, the plates were again emptied and washed. Subsequently, 0.1 ml of a streptavidin-horseradish peroxidase conjugated was added to each well. After one hour of incubation the plates were again emptied and washed. This was followed by the addition of a TMB substrate. After a brief incubation period, the tests were read at 650 nm with the aid of an automated spectrophotometer. Thus, the biotinylated Mab was used to signal for positive reactions between the virus and 179, and 57 wells, while a similar AC-ELISA was performed with a polyclonal anti-IBDV sera was used to signal the B29 catches. Alternatively, biotinylated B29 could be used to the same effect. Further, any form of labeling of Mab or polyclonal antibodies may be used.

All strains showed negative for reactivity with 179, but were highly positive for the B29 Mab, which combines in a non-neutralizing fashion as well as reacting with neutralizing antibody 57.

As 179 is a neutralizing antibody for all previously identified IBD viruses, an assay employing only this as the positive non-neutralizing assay is adequate. The added use of B69 and R63 or 57 gives a higher confidence level, and can be used to further define and separate IBDV strains of the prior art.

As set forth above, the inventors have developed a new Mab, Mab 50, which is specific for, and neutralizes, virus DS326. As Mab 50 does not bind to, or neutralize, any other previously published, filed or USDA licensed vaccine strain of IBDV, or any other known IBDV virus, the specificity of Mab 50 allows one to assay for the presence of virus strain DS326, or confirm identification of the presence of virus strain DS326 according to the indirect method discussed above.

The murine Mab was developed according to the method set forth in U.S. Pat. No. 4,956,452. Specifically, hybridoma cell lines were prepared according to standard procedure, beginning with BALB/c mice, immunized with the DS326 virus strain, after purification. Hybridomas were prepared therefrom, and the resulting cell lines were assayed, through an enzyme-linked immunosorbant assay (ELISA) to identify those lines that binds to and neutralizes, the DS326 virus strain. The resulting cell line was cloned again and injected into pristane primed mice, to produce acidic fluid with higher titre values. Specific details as the propagation of the IBDV strain, production of the hybridoma, the ELISA, and the virus neutralization tests are set forth in U.S. Pat. No. 4,956,452, beginning at column 3, line 64 and continuing on to Column 5, line 68. The disclosure of this patent is incorporated herein by reference. The Mab 50 has been deposited under accession number ATCC HB 11123, on Sep. 16, 1992 by David Snyder. Further, the cell line is continuously available from Aurum Gudelsky Center, College of Veterinary Medicine, University of Maryland.

CONFIRMATION OF THE PURITY AND VIRULENCE OF THE VIRUS

Samples from the identified strain, which virus is expressed by the deposit made on Oct. 17, 1989, at the Collection Nationale de Culture de Micro-organismes (CNCM), Institut Pasteur, 28, rue du Dr. Roux, 75724 Paris Cedex 15, France, pursuant to Budapest Treaty conditions under accession number i-910 were pooled, and reacted with the 179 Mab and inoculated into SPF chickens. Five days after inoculation, these chickens, and non-inoculated chickens were necropsied. Those birds inoculated with the collected virus, referred to as DS 326 showed lesions consistent only with infectious bursal disease.

For certainty, antisera from the birds was taken at 11 days post-inoculation, and was tested by indirect ELISA and showed serologic conversion to IBDV, but to no other related poultry passed a second time in the presence of 179 with identical results. In both passages, on a scale of 0-9, reactivity with the B29 and 57 Mab was at level 9, and reactivity with 179 was at level 0. Thus, a pure preparation of a previously unidentified virus, not related to any known vaccine at the R63 and B69 neutralization sites, prepared from virus or otherwise, was identified. Preparation of additional monoclonal antibodies, protein information, and RNA analysis, has given rise to Mab 50 and is under further study. This information will provide the necessary base for the preparation of vaccines based on neutralizing, but non-toxic, recombinant virus-like proteins.

Until such "designed" vaccines becomes available, any of the isolated virus preparations each given the designation DS 326 can be used, in killed form, for the preparation of conventional killed vaccines, which do confer immunity against the new virus. The DS 326 strains may be prepared into a vaccine through common methods, which are not per se a part of this invention among the most prominent of which are heat killing and chemical killing, which preserves the essential form of the vaccine to enable the preparation, by the inoculated bird, of protective VN antibodies while rendering it non-virulent. Alternatively, there are known methods of attenuating viruses, including serial passage, cloning of the virus deleting sequences of nucleic acids and site-directed mutagenesis, which will allow the preparation of a live non-virulent virus vaccine. The vaccines may be prepared by simple incorporation of the selected virus derivative and suspending or incorporation of the selected virus derivative and suspending or mixing it in a carrier. Appropriate dosage values can be determined through routine trial and error techniques, sampling for antibody.

An alternative, passive immunization, particularly designed to achieve immunization in a uniform, standardized level, and to augment any maternally derived levels against DS326 IBDV field infection can be obtained by vaccinating 1-day old chicks with the vaccine comprising a pharmacologically acceptable carrier such as a phosphate buffered saline, cell culture medium, Mareti's virus vaccine diluent, etc., in which is present an amount of Mab 50 effective to provide enhanced protection for a period of time which allows the chicks to become more immunologically competent (about 2-3 weeks).

The necessary level of protection can be conferred by a single dose of the vaccine administered to a day-old chick having a Mab concentration of between 1 microgram and 1 milligram, or repeated vaccinations having a smaller effective dose, but carried out over time. If repeated vaccinations are used, the dosage level should range within 10 micrograms to 1 milligram. The concentration level needed to vaccinate older chickens is expected to increase with the weight of the bird.

FIGS. 1-1E contain a full recitation of the nucleotide sequence (SEQ ID NO: 1) for the gene responsible for the expression of the DS326 IBDV structural protein(s) recognized by Mab 50. Presented together with this information in FIG. 1 is the amino acid sequence (SEQ ID NO: 2) for the structural protein(s) recognized by the antibody. As noted above, one aspect of the utility of this Mab is its specificity for IBDV DS326, and it is apparent that modifications of the nucleotide sequence, or the resulting amino acid sequence, that delete critical recognition cites for the identifying characteristics of the DS326 virus will sufficiently alter Mab 50 as to render it incapable of neutralizing the virus, insufficient to support a vaccine, and potentially inadequate to identify the presence of the virus. Nonetheless, based on length of the amino acid sequence required for antibody binding, and studies applied to similar materials, it is expected that up to 10% of the amino acids of the structure can be modified or deleted, and up to 25% of the nucleotide sequence replaced or modified, particularly at the ends of the sequence, without loss of the binding and neutralizing ability of Mab 50. In particular, minor modifications which do not alter theconformal (quaternary) structure of the proteins) will not impede binding. Such modifications are clearly contemplated as one aspect of this invention.

As important as the preparation of the new vaccines is, there is now provided a method by which the presence of the virus can be identified in a given poultry population, by a relatively quick and efficient ELISA assay, which, if reaction to 179 is negative, while the reaction to a polyclonal vaccine, 57 or B29, is positive, then the presence of the virus is confirmed. B29 is expressed by a hybridoma cell line which has been deposited, under Budapest Treaty terms at the ATCC under accession number HB 9746. Alternatively, a positive ELISA using Mab 50 indicates the presence of DS326.

Obviously, numerous modification and variations of the present invention are possible in light of the above teachings. It is therefore to be understood that within the scope of the appended claims, the invention may be alternatively described or practiced otherwise than as specifically described herein.

__________________________________________________________________________SEQUENCE LISTING(1) GENERAL INFORMATION:(iii) NUMBER OF SEQUENCES: 2(2) INFORMATION FOR SEQ ID NO:1:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 3180 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: unknown(D) TOPOLOGY: unknown(ii) MOLECULE TYPE: DNA (genomic)(ix) FEATURE: (A) NAME/KEY: CDS(B) LOCATION: 64..3099(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:GAATTCCTCCTTCTACAATGCTATCATTGATGGTTAGTAGAGATCGGACAAACGATCGCA60GCGATGACAAACCTGCAAGATCAAACCCAACAGATTGTTCCGTTCATA10 8MetThrAsnLeuGlnAspGlnThrGlnGlnIleValProPheIle151015CGGAGCCTTCTGATGCCAACAACCGGACCGGCGTCCATTCCGGACGAC 156ArgSerLeuLeuMetProThrThrGlyProAlaSerIleProAspAsp202530ACCCTGGAGAAGCACACTCTCAGGTCAGAGACCTCGACCTACAAT TTG204ThrLeuGluLysHisThrLeuArgSerGluThrSerThrTyrAsnLeu354045ACTGTGGGGGACACAGGGTCAGGGCTAATTGTCTTTTTCCCTGGA TTC252ThrValGlyAspThrGlySerGlyLeuIleValPhePheProGlyPhe505560CCTGGCTCAATTGTGGGTGCTCACTACACACTGCAGAGCAATGGGAAC 300ProGlySerIleValGlyAlaHisTyrThrLeuGlnSerAsnGlyAsn657075TACAAGTTCGATCAGATGCTCCTGACTGCCCAGAACCTACCGGCCAGC34 8TyrLysPheAspGlnMetLeuLeuThrAlaGlnAsnLeuProAlaSer80859095TACAACTACTGCAGGCTAGTGAGTCGGAGTCTCACAGTAAGGTCAAGC 396TyrAsnTyrCysArgLeuValSerArgSerLeuThrValArgSerSer100105110ACACTCCCTGGTGGCGTTTATGCACTAAACGGCACCATAAACGCC GTG444ThrLeuProGlyGlyValTyrAlaLeuAsnGlyThrIleAsnAlaVal115120125ACCTTCCAAGGAAGCCTGAGTGAACTGACAGATGTTAGCTACAAT GGG492ThrPheGlnGlySerLeuSerGluLeuThrAspValSerTyrAsnGly130135140TTGATGTCTGCAACAGCCAACATCAACGACAAAATCGGGAACGTCCTA 540LeuMetSerAlaThrAlaAsnIleAsnAspLysIleGlyAsnValLeu145150155GTAGGGGAAGGGGTCACCGTCCTCAGCTTACCCACATCATATGATCTT58 8ValGlyGluGlyValThrValLeuSerLeuProThrSerTyrAspLeu160165170175GGGTATGTGAGGCTTGGTGACCCCATACCCGCTATAGGGCTTGACCCA 636GlyTyrValArgLeuGlyAspProIleProAlaIleGlyLeuAspPro180185190AAAATGGTAGCAACATGTGACAGCAGTGACAGGCCCAGAGTCTAC ACC684LysMetValAlaThrCysAspSerSerAspArgProArgValTyrThr195200205ATAACTGCAGCCGATGATTACCAATTCTCATCACAGTACCAATCA GGT732IleThrAlaAlaAspAspTyrGlnPheSerSerGlnTyrGlnSerGly210215220GGGGTAACAATCACACTGTTCTCAGCCAACATTGATGCCATCACAAGC 780GlyValThrIleThrLeuPheSerAlaAsnIleAspAlaIleThrSer225230235CTCAGCGTTGGGGGAGAGCTCGTGTTTAAAACAAGCGTCCAAAGCCTT82 8LeuSerValGlyGlyGluLeuValPheLysThrSerValGlnSerLeu240245250255GTACTGGGCGCCACCATCTACCTCATAGGCTTTGATGGGACTGCGGTA 876ValLeuGlyAlaThrIleTyrLeuIleGlyPheAspGlyThrAlaVal260265270ATCACTAGAGCTGTGGCCGCGAACAATGGGCTGACGGCCGGCACC GAC924IleThrArgAlaValAlaAlaAsnAsnGlyLeuThrAlaGlyThrAsp275280285AATCTTATGCCATTCAATCTTGTGATTCCAACCAACGAGATAACC CAG972AsnLeuMetProPheAsnLeuValIleProThrAsnGluIleThrGln290295300CCAATCACATCCATCAAACTGAAGATTGTGACCTCCAAAAGTGGTGGT 1020ProIleThrSerIleLysLeuLysIleValThrSerLysSerGlyGly305310315CTGGAAGGGGATCAGATGTCATGGTCGGCAAGTGGGAGCCTAGCAGTG106 8LeuGluGlyAspGlnMetSerTrpSerAlaSerGlySerLeuAlaVal320325330335ACGATCCATGGTGGCAACTATCCAGGGGCCCTCCGTCCCGTCACACTA 1116ThrIleHisGlyGlyAsnTyrProGlyAlaLeuArgProValThrLeu340345350GTAGCCTACGAAAGAGTGGCAACAGGATCTGTCGTTACGGTCGCT GGG1164ValAlaTyrGluArgValAlaThrGlySerValValThrValAlaGly355360365GTGAGCAACTTCGAGCTGATCCCAAATCCTGAACTAGCAAAGAAC CTG1212ValSerAsnPheGluLeuIleProAsnProGluLeuAlaLysAsnLeu370375380GTTACAGAATACGGCCGATTTGACCCAGGAGCCATGAACTACACAAAA 1260ValThrGluTyrGlyArgPheAspProGlyAlaMetAsnTyrThrLys385390395TTGATACTGAGTGAGAGGGACCGCCTTGGCATCAAGACCGTCTGGCCA130 8LeuIleLeuSerGluArgAspArgLeuGlyIleLysThrValTrpPro400405410415ACAAGGGAGTACACTGACTTTCGTGAGTACTTCATGGAGGTGGCCGAC 1356ThrArgGluTyrThrAspPheArgGluTyrPheMetGluValAlaAsp420425430CTCAACTCTCCCCTGAAGATTGCAGGAGCATTTGGCTTCAAAGAC ATA1404LeuAsnSerProLeuLysIleAlaGlyAlaPheGlyPheLysAspIle435440445ATCCGGGCCATAAGGAGGATAGCTGTGCCGGTGGTCTCTACATTG TTC1452IleArgAlaIleArgArgIleAlaValProValValSerThrLeuPhe450455460CCACCTGCCGCTCCCCTAGCCCATGCAATTGGGGAAGGTGTAGACTAC 1500ProProAlaAlaProLeuAlaHisAlaIleGlyGluGlyValAspTyr465470475CTGCTGGGCGATGAGGCACAGGCTGCTTCGGGAACTGCTCGAGCCGCG154 8LeuLeuGlyAspGluAlaGlnAlaAlaSerGlyThrAlaArgAlaAla480485490495TCAGGAAAAGCAAGGGCTGCCTCAGGCCGCATAAGGCAGCTGACTCTC 1596SerGlyLysAlaArgAlaAlaSerGlyArgIleArgGlnLeuThrLeu500505510GCCGCCGACAAGGGGTACGAGGTAGTCGCGAATCTATTCCAGGTG CCC1644AlaAlaAspLysGlyTyrGluValValAlaAsnLeuPheGlnValPro515520525CAGAATCCCGTAGTCGACGGGATTCTTGCATCACCCGGGATACTC CGC1692GlnAsnProValValAspGlyIleLeuAlaSerProGlyIleLeuArg530535540GGTGCACACAACCTCGACTGCGTGTTAAGAGAGGGCGCCACGCTATTC 1740GlyAlaHisAsnLeuAspCysValLeuArgGluGlyAlaThrLeuPhe545550555CCTGTGGTCATCACGACAGTGGAAGACGCCATGACACCCAAAGCACTG178 8ProValValIleThrThrValGluAspAlaMetThrProLysAlaLeu560565570575AACAGCAAAATGTTTGCTGTCATTGAAGGCGCGCGAGAAGACCTCCAA 1836AsnSerLysMetPheAlaValIleGluGlyAlaArgGluAspLeuGln580585590CCTCCATCTCAAAGAGGATCCTTTATACGAACTCTCTCCGGACAC AGA1884ProProSerGlnArgGlySerPheIleArgThrLeuSerGlyHisArg595600605GTCTATGGATATGCTCCAGATGGGGTACTTCCACTGGAGACTGGG AGA1932ValTyrGlyTyrAlaProAspGlyValLeuProLeuGluThrGlyArg610615620GACTACACCGTTGTCCCAATAGATGATGTCTGGGACGACAGCATTATG 1980AspTyrThrValValProIleAspAspValTrpAspAspSerIleMet625630635CTGTCCAAAGACCCCATACCCCCTATTGTGGGAAACAGTGGAAACCTA202 8LeuSerLysAspProIleProProIleValGlyAsnSerGlyAsnLeu640645650655GCCATAGCTTACATGGATGTGTTTCGACCCAAAGTCCCCATCCATGTG 2076AlaIleAlaTyrMetAspValPheArgProLysValProIleHisVal660665670GCCATGACGGGAGCCCTCAACGCTTATGGCGAGATTGAGAAAATA AGC2124AlaMetThrGlyAlaLeuAsnAlaTyrGlyGluIleGluLysIleSer675680685TTTAGAAGCACCAAGCTCGCCACTGCACACCGGCTTGGCCTCAAG TTG2172PheArgSerThrLysLeuAlaThrAlaHisArgLeuGlyLeuLysLeu690695700GCTGGTCCCGGAGCATTCGACGTAAACACCGGGCCCAACTGGGCAACG 2220AlaGlyProGlyAlaPheAspValAsnThrGlyProAsnTrpAlaThr705710715TTCATCAAACGTTTCCCTCACAATCCACGCGACTGGGACAGGCTCCCC226 8PheIleLysArgPheProHisAsnProArgAspTrpAspArgLeuPro720725730735TACCTCAACCTTCCATACCTTCCACCCAATGCAGGACGCCAGTACCAC 2316TyrLeuAsnLeuProTyrLeuProProAsnAlaGlyArgGlnTyrHis740745750CTTGCCATGGCTGCATCAGAGTTTAAAGAGACCCCTGAACTCGAG AGC2364LeuAlaMetAlaAlaSerGluPheLysGluThrProGluLeuGluSer755760765GCCGTCAGAGCCATGGAAGCAGCAGCCAATGTGGACCCACTGTTC CAA2412AlaValArgAlaMetGluAlaAlaAlaAsnValAspProLeuPheGln770775780TCTGCACTCAGTGTGTTCATGTGGCTGGAAGAGAATGGGATTGTGGCT 2460SerAlaLeuSerValPheMetTrpLeuGluGluAsnGlyIleValAla785790795GACATGGCCAATTTCGCACTCAGCGACCCGAACGCCCATCGGATGCGA250 8AspMetAlaAsnPheAlaLeuSerAspProAsnAlaHisArgMetArg800805810815AATTTTCTTGCAAACGCACCACAAGCAGGCAGCAAGTCGCAAAGGGCC 2556AsnPheLeuAlaAsnAlaProGlnAlaGlySerLysSerGlnArgAla820825830AAGTACGGGACAGCAGGCTACGGAGTGGAGGCCCGGGGCCCCACA CCA2604LysTyrGlyThrAlaGlyTyrGlyValGluAlaArgGlyProThrPro835840845GAGGAAGCACAGAGGGAAAAAGACACACGGATCTCAAAGAAGATG GAG2652GluGluAlaGlnArgGluLysAspThrArgIleSerLysLysMetGlu850855860ACCATGGGCATCTACTTTGCAACACCAGAATGGGTAGCACTCAATGGG 2700ThrMetGlyIleTyrPheAlaThrProGluTrpValAlaLeuAsnGly865870875CACCGAGGGCCAAGCCCCGGCCAGCTAAAGTACTGGCAGAACACACGA274 8HisArgGlyProSerProGlyGlnLeuLysTyrTrpGlnAsnThrArg880885890895GAAATACCGGACCCAAACGAGGACTATCTAGACTACGTGCATGCAGAG 2796GluIleProAspProAsnGluAspTyrLeuAspTyrValHisAlaGlu900905910AAGAGCCGGTTGGCATCAGAAGAACAAATCCTAAAGGCAGCTACG TCG2844LysSerArgLeuAlaSerGluGluGlnIleLeuLysAlaAlaThrSer915920925ATCTACGGGGCTCCAGGACAGGCAGAGCCACCCCAAGCTTTCATA GAC2892IleTyrGlyAlaProGlyGlnAlaGluProProGlnAlaPheIleAsp930935940GAAGTTGCCAAAGTCTATGAAATCAACCATGGACGTGGCCCTAACCAA 2940GluValAlaLysValTyrGluIleAsnHisGlyArgGlyProAsnGln945950955GAACAGATGAAAGATCTGCTCTTGACTGCAATGGAGATGAAGCATCGC298 8GluGlnMetLysAspLeuLeuLeuThrAlaMetGluMetLysHisArg960965970975AACCCCAGGCGGGCTCCACCAAAGCCCAAGCCAAAACCCAATGCTCCA 3036AsnProArgArgAlaProProLysProLysProLysProAsnAlaPro980985990ACACAGAGACCCCCTGGTCGGCTGGGCCGCTGGATCAGGACCGTC TCT3084ThrGlnArgProProGlyArgLeuGlyArgTrpIleArgThrValSer99510001005GATGAGGACCTTGAGTGAGGCCCCTGGGGGTCTCCCGACACCACCCGCGC AGGCG3139AspGluAspLeuGlu1010TGGACACCAATTCGGCCTTACAACATCCCAAATTGGATCCG3180(2) INFORMATION FOR SEQ ID NO:2:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 1012 amino acids(B) TYPE: amino acid (D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:MetThrAsnLeuGlnAspGlnThrGlnGlnIleValProPheIleArg151015SerLeuLeuMetProThr ThrGlyProAlaSerIleProAspAspThr202530LeuGluLysHisThrLeuArgSerGluThrSerThrTyrAsnLeuThr3540 45ValGlyAspThrGlySerGlyLeuIleValPhePheProGlyPhePro505560GlySerIleValGlyAlaHisTyrThrLeuGlnSerAsnGlyAsnT yr65707580LysPheAspGlnMetLeuLeuThrAlaGlnAsnLeuProAlaSerTyr859095 AsnTyrCysArgLeuValSerArgSerLeuThrValArgSerSerThr100105110LeuProGlyGlyValTyrAlaLeuAsnGlyThrIleAsnAlaValThr 115120125PheGlnGlySerLeuSerGluLeuThrAspValSerTyrAsnGlyLeu130135140MetSerAlaThrAlaAsnIleAsnAsp LysIleGlyAsnValLeuVal145150155160GlyGluGlyValThrValLeuSerLeuProThrSerTyrAspLeuGly1651 70175TyrValArgLeuGlyAspProIleProAlaIleGlyLeuAspProLys180185190MetValAlaThrCysAspSerSerAspArgProArgV alTyrThrIle195200205ThrAlaAlaAspAspTyrGlnPheSerSerGlnTyrGlnSerGlyGly210215220ValThrIle ThrLeuPheSerAlaAsnIleAspAlaIleThrSerLeu225230235240SerValGlyGlyGluLeuValPheLysThrSerValGlnSerLeuVal 245250255LeuGlyAlaThrIleTyrLeuIleGlyPheAspGlyThrAlaValIle260265270ThrArgAlaValAlaAla AsnAsnGlyLeuThrAlaGlyThrAspAsn275280285LeuMetProPheAsnLeuValIleProThrAsnGluIleThrGlnPro290295 300IleThrSerIleLysLeuLysIleValThrSerLysSerGlyGlyLeu305310315320GluGlyAspGlnMetSerTrpSerAlaSerGlySerLeuA laValThr325330335IleHisGlyGlyAsnTyrProGlyAlaLeuArgProValThrLeuVal340345350 AlaTyrGluArgValAlaThrGlySerValValThrValAlaGlyVal355360365SerAsnPheGluLeuIleProAsnProGluLeuAlaLysAsnLeuVal370 375380ThrGluTyrGlyArgPheAspProGlyAlaMetAsnTyrThrLysLeu385390395400IleLeuSerGluArgAspArg LeuGlyIleLysThrValTrpProThr405410415ArgGluTyrThrAspPheArgGluTyrPheMetGluValAlaAspLeu4204 25430AsnSerProLeuLysIleAlaGlyAlaPheGlyPheLysAspIleIle435440445ArgAlaIleArgArgIleAlaValProValValSerThrL euPhePro450455460ProAlaAlaProLeuAlaHisAlaIleGlyGluGlyValAspTyrLeu465470475480Leu GlyAspGluAlaGlnAlaAlaSerGlyThrAlaArgAlaAlaSer485490495GlyLysAlaArgAlaAlaSerGlyArgIleArgGlnLeuThrLeuAla 500505510AlaAspLysGlyTyrGluValValAlaAsnLeuPheGlnValProGln515520525AsnProValValAspGlyIle LeuAlaSerProGlyIleLeuArgGly530535540AlaHisAsnLeuAspCysValLeuArgGluGlyAlaThrLeuPhePro545550555 560ValValIleThrThrValGluAspAlaMetThrProLysAlaLeuAsn565570575SerLysMetPheAlaValIleGluGlyAlaArgGluA spLeuGlnPro580585590ProSerGlnArgGlySerPheIleArgThrLeuSerGlyHisArgVal595600605Tyr GlyTyrAlaProAspGlyValLeuProLeuGluThrGlyArgAsp610615620TyrThrValValProIleAspAspValTrpAspAspSerIleMetLeu625 630635640SerLysAspProIleProProIleValGlyAsnSerGlyAsnLeuAla645650655IleAlaTyrMetAspVal PheArgProLysValProIleHisValAla660665670MetThrGlyAlaLeuAsnAlaTyrGlyGluIleGluLysIleSerPhe675680 685ArgSerThrLysLeuAlaThrAlaHisArgLeuGlyLeuLysLeuAla690695700GlyProGlyAlaPheAspValAsnThrGlyProAsnTrpAlaThrP he705710715720IleLysArgPheProHisAsnProArgAspTrpAspArgLeuProTyr725730735 LeuAsnLeuProTyrLeuProProAsnAlaGlyArgGlnTyrHisLeu740745750AlaMetAlaAlaSerGluPheLysGluThrProGluLeuGluSerAla 755760765ValArgAlaMetGluAlaAlaAlaAsnValAspProLeuPheGlnSer770775780AlaLeuSerValPheMetTrpLeuGlu GluAsnGlyIleValAlaAsp785790795800MetAlaAsnPheAlaLeuSerAspProAsnAlaHisArgMetArgAsn8058 10815PheLeuAlaAsnAlaProGlnAlaGlySerLysSerGlnArgAlaLys820825830TyrGlyThrAlaGlyTyrGlyValGluAlaArgGlyP roThrProGlu835840845GluAlaGlnArgGluLysAspThrArgIleSerLysLysMetGluThr850855860MetGlyIle TyrPheAlaThrProGluTrpValAlaLeuAsnGlyHis865870875880ArgGlyProSerProGlyGlnLeuLysTyrTrpGlnAsnThrArgGlu 885890895IleProAspProAsnGluAspTyrLeuAspTyrValHisAlaGluLys900905910SerArgLeuAlaSerGlu GluGlnIleLeuLysAlaAlaThrSerIle915920925TyrGlyAlaProGlyGlnAlaGluProProGlnAlaPheIleAspGlu930935 940ValAlaLysValTyrGluIleAsnHisGlyArgGlyProAsnGlnGlu945950955960GlnMetLysAspLeuLeuLeuThrAlaMetGluMetLysH isArgAsn965970975ProArgArgAlaProProLysProLysProLysProAsnAlaProThr980985990 GlnArgProProGlyArgLeuGlyArgTrpIleArgThrValSerAsp99510001005GluAspLeuGlu1010

Claims

1. A substantially pure preparation of the virus expressed by the cell line deposited at the Institute Pasteur under the accession number i-910.

2. A vaccine for the prevention of infectious bursal disease in poultry, comprising:

the virus of claim 1 and a pharmacologically acceptable carrier therefor.

3. The vaccine of claim 2, wherein said virus is in a killed form.