Leishmania antigens for use in the therapy and diagnosis of leishmaniasis

Abstract

Compositions and methods for preventing, treating and detecting leishmaniasis and stimulating immune responses in patients are disclosed. The compounds provided include polypeptides that contain at least an immunogenic portion of one or more Leishmania antigens, or a variant thereof. Vaccines and pharmaceutical compositions comprising such polypeptides, or polynucleotides encoding such polypeptides, are also provided and may be used, for example, for the prevention and therapy of leishmaniasis, as well as for the detection of Leishmania infection.

Description

TECHNICAL FIELD

The present invention relates generally to compositions and methods for preventing, treating and detecting leishmaniasis, and for stimulating immune responses in patients. The invention is more particularly related to polypeptides comprising an immunogenic portion of a Leishmania antigen or a variant thereof, and to vaccines and pharmaceutical compositions comprising one or more such polypeptides. The vaccines and pharmaceutical compositions may be used, for example, for the prevention and therapy of leishmaniasis, as well as for the detection of Leishmania infection.

BACKGROUND OF THE INVENTION

Leishmania organisms are intracellular protozoan parasites of macrophages that cause a wide range of clinical diseases in humans and domestic animals, primarily dogs. In some infections, the parasite may lie dormant for many years. In other cases, the host may develop one of a variety of forms of leishmaniasis. For example, the disease may be asymptomatic or may be manifested as subclinical visceral leishmaniasis, which is characterized by mild symptoms of malaise, diarrhea and intermittent hepatomegaly. Patients with subclinical or asymptomatic disease usually have low antibody titers, making the disease difficult to detect with standard techniques. Alternatively, leishmaniasis may be manifested as a cutaneous disease, which is a severe medical problem but is generally self-limiting, or as a highly destructive mucosal disease, which is not self-limiting. Finally, and most seriously, the disease may be manifested as an acute visceral infection involving the spleen, liver and lymph nodes, which, untreated, is generally a fatal disease. Symptoms of acute visceral leishmaniasis include hepatosplenomegaly, fever, leukopenia, anemia and hypergammaglobulinemia.

Leishmaniasis is a serious problem in much of the world, including Brazil, China, East Africa, India and areas of the Middle East. The disease is also endemic in the Mediterranean region, including southern France, Italy, Greece, Spain, Portugal and North Africa. The number of cases of leishmaniasis has increased dramatically in the last 20 years, and millions of cases of this disease now exist worldwide. About 2 million new cases are diagnosed each year, 25% of which are visceral leishmaniasis. There are, however, no vaccines or effective treatments currently available.

Accurate diagnosis of leishmaniasis is frequently difficult to achieve. There are 20 species of Leishmania that infect humans, including L. donovani, L. chagasi, L. infantum, L. major, L. amazonensis, L. braziliensis, L. panamensis, L. mexicana, L. tropica , and L. guyanensis , and there are no distinctive signs or symptoms that unambiguously indicate the presence of Leishmania infection. Parasite detection methods have been used, but such methods are neither sensitive nor clinically practical. Current skin tests typically use whole or lysed parasites. Such tests are generally insensitive, irreproducible and prone to cross-reaction with a variety of other diseases. In addition, the preparations employed in such tests are often unstable. Thus, there is a need for improved methods for the detection of Leishmania infection.

Current experimental vaccines consisting of whole organisms have not proven effective in humans. Accordingly, there remains a need in the art for vaccines to prevent leishmaniasis in humans and dogs, and for improved therapeutic compositions for the treatment of leishmaniasis.

SUMMARY OF THE INVENTION

Briefly stated, the present invention provides compositions and methods for preventing, treating and detecting leishmaniasis, as well as for stimulating immune responses in patients. In one aspect, polypeptides are provided which comprise at least an immunogenic portion of a Leishmania antigen, or a variant of such an antigen that differs only in conservative substitutions and/or modifications. In specific embodiments of the invention, the Leishmania antigen comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 2, 4, 20, 22, 24, 26, 36-38, 41, 50-53, 82 and 104. DNA sequences encoding the above polypeptides, recombinant expression vectors comprising these DNA sequences and host cells transformed or transfected with such expression vectors are also provided.

In further aspects, the present invention provides fusion proteins comprising Leishmania antigens, together with polynucleotides encoding such fusion proteins. In certain specific embodiments, such fusion proteins comprise an amino acid sequence selected from the group consisting of SEQ ID NOs: 95, 96, and 97 and encoded by a polynucleotide sequence selected from the group consisting of SEQ ID NOs: 94, 98, 99, 100, and 101.

In related aspects, the present invention provides pharmaceutical compositions which comprise one or more of the polypeptides and/or fusion proteins described herein, or a polynucleotide encoding such polypeptides and fusion proteins, and a physiologically acceptable carrier. Vaccines which comprise one or more such polypeptides, fusion proteins or polynucleotides, together with an immunostimulant are also provided. In specific embodiments of these aspects, the Leishmania antigen has an amino acid sequence selected from the group consisting of SEQ ID NO: 2, 4, 20, 22, 24, 26, 36-38, 41, 50-53, 82, 104, 106, 108, 110 and 112.

In still further related embodiments, the pharmaceutical compositions and vaccines comprise at least two different polypeptides, each polypeptide comprising an immunogenic portion of a Leishmania antigen having an amino acid sequence selected from the group consisting of sequences recited in SEQ ID NO: 2, 4, 6, 8, 10, 20, 22, 24, 26, 36-38, 41, 50-53, 82, 104, 106, 108, 110 and 112, and variants thereof that differ only in conservative substitutions and/or modifications. In other embodiments, the inventive pharmaceutical compositions comprise one or more of the inventive polypeptides in combination with a known Leishmania antigen.

In yet other related embodiments, the pharmaceutical compositions and vaccines comprise soluble Leishmania antigens.

In another aspect, the present invention provides methods for inducing protective immunity against leishmaniasis in a patient, comprising administering to a patient a pharmaceutical composition or vaccine as described above.

In further aspects, methods and diagnostic kits are provided for detecting Leishmania infection in a patient. The methods comprise: (a) contacting dermal cells of a patient with a pharmaceutical composition as described above; and (b) detecting an immune response on the patient's skin, therefrom detecting Leishmania infection in the patient. The diagnostic kits comprise: (a) a pharmaceutical composition as described above; and (b) an apparatus sufficient to contact the pharmaceutical composition with the dermal cells of a patient.

In further aspects, the present invention provides methods for stimulating a cellular and/or humoral immune response in a patient, comprising administering to a patient a pharmaceutical composition or vaccine as described above.

In a related aspect, methods are provided for treating a patient afflicted with a disease responsive to IL-12 stimulation, comprising administering to a patient a pharmaceutical composition or vaccine as described above.

These and other aspects of the present invention will become apparent upon reference to the following detailed description and attached drawings. All references disclosed herein are hereby incorporated by reference in their entirety as if each was incorporated individually.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 shows the stimulation of proliferation of T-cells obtained from L. donovani -immunized BALB/c mice (represented by stimulation index) by L. donovani -infected macrophages after incubation for 24, 48 and 72 hours.

FIG. 2 illustrates representative HPLC profiles of peptides isolated from MHC class II molecules of P388D1 macrophages. Panel A shows peptides isolated from uninfected macrophages and panel B shows peptides isolated from L. donovani infected macrophages. The arrows in panel B indicate peptide peaks present only in the infected macrophage preparation.

FIG. 3 illustrates the expression and purification of the Leishmania antigen Ldp23 as a recombinant fusion protein. Panel A shows a Coomassie blue-stained SDS-PAGE gel of lysed E. coli without (lane 1) and with (lane 2) IPTG induction of Ldp23 expression. Arrow indicates the recombinant fusion protein. Panel B shows the fusion protein following excision from a preparative SDS-PAGE gel, electroelution, dialysis against PBS and analytical SDS-PAGE.

FIG. 4 presents a Northern blot analysis of total RNA prepared from L. donovani, L. major, L. amazonensis and L. pifanoi with a 32 P labeled Ldp23 gene. 1, 2 and 3 refer to RNA obtained from promastigotes at the logarithmic growth phase, promastigotes at the stationary growth phase and amastigote forms, respectively.

FIG. 5 shows a Western blot analysis of L. donovani promastigote antigens incubated with pre-immune rabbit serum (lane A) or with anti-Ldp23 rabbit antiserum (lane B).

FIG. 6 illustrates the surface expression of Ldp23 on live L. donovani promastigotes. The dotted line shows the indirect immunofluorescence performed using pre-immune mouse serum and the solid line shows the result obtained with mouse anti-GST-Ldp23 antiserum. Fluorescence intensity was analyzed by FACScan.

FIG. 7 shows the stimulation of Leishmania-specific T-cell proliferation by Ldp23. The results are presented as relative cell number as a function of fluorescence intensity. T-cells (10 5 /well) were purified from lymph nodes of BALB/c mice immunized in the foot pad with L. donovani promastigotes in CFA and were cultured with various concentrations of the purified recombinant Ldp23 in the presence of 2×10 5 Mitomycin C-treated normal BALB/c spleen mononuclear cells. Proliferation of T-cells was measured at 27 hours of culture. Values are expressed as cpm and represent the mean of [ 3 H]TdR incorporation of triplicate cultures.

FIG. 8 illustrates Ldp23-induced cytokine production by lymph node cells of BALB/c mice. Cultures were incubated with varying amounts of Ldp23 or Leishmania lysate, presented as μg/mL, and were assayed by ELISA for the production of interferon-γ (panel A) or interleukin-4 (panel B), both of which are shown as ng/mL.

FIG. 9 shows the PCR amplification of cytokine mRNAs isolated from mucosal leishmaniasis (Panel A) and cutaneous leishmaniasis (panel B) patient PBMC before and after stimulation with representative polypeptides of the present invention. Lanes O and -indicate the level of PCR products at the initiation of culture and after 72 hours of culture, respectively, in the absence of added polypeptide; lanes Lb, 83a and 83b indicate the level of PCR products following culturing of PBMC with L. braziliensis lysate, and the Leishmania antigens Lbhsp83a and Lbhsp83b, respectively.

FIG. 10 presents a comparison of the levels of interferon-γ (panel A) and TNF-α (panel B) in the supernatants of 72 hour PBMC cultures from Leishmania-infected and control individuals in response to stimulation with parasite lysate or the indicated polypeptides.

FIG. 11 illustrates the levels of IL-10 p40 (in pg/mL) in the supernatant of PBMC cultures from L. braziliensis -infected individuals and uninfected controls 72 hours following stimulation with parasite promastigote lysate (Lb), Lbhsp83a or Lbhsp83b.

FIG. 12 presents the reactivities of sera from L. braziliensis infected-patients with representative polypeptides of the present invention in a standard ELISA. Values are expressed as absorbance at 405 nm.

FIGS. 13A and 13B illustrate the level of secreted IL-4 and IFN-γ (in pg/mL) stimulated in mouse lymph node cultures by the addition of representative polypeptides of the present invention.

FIG. 14 shows the level of IFN-γ (in pg/mL) secreted by Leishmania-infected and uninfected human PBMC stimulated by the Leishmania antigen M15, as compared to the levels stimulated by L. major lysate and L-Rack, an antigen that does not appear to be recognized by Leishmania-infected humans.

FIG. 15 shows the level of IFN-γ (in pg/mL) secreted by infected and uninfected human PBMC stimulated by soluble Leishmania antigens (S antigens), as compared to the levels stimulated by L. major lysate and L-Rack.

FIG. 16 illustrates the proliferation of murine lymph node cultures stimulated by the addition of representative polypeptides of the present invention. Values are expressed as cpm.

FIG. 17 shows the proliferation of human PBMC, prepared from Leishmania-immune and uninfected individuals, stimulated by M15 as compared to the proliferation stimulated by L. major lysate and L-Rack. Values are expressed as cpm.

FIG. 18 illustrates the proliferation of human PBMC, prepared from Leishmania-infected and uninfected individuals, stimulated by soluble Leishmania antigens as compared to the proliferation stimulated by culture medium, L. major lysate and L-Rack. Values are expressed as cpm.

FIG. 19 presents a comparison of a Lbhsp83 sequence (SEQ ID NO:6) with homologous sequences from L. amazonensis (Lahsp83) (SEQ ID NO:16), T. cruzi (Tchsp83) (SEQ ID NO:17) and humans (Huhsp89) (SEQ ID NO:18).

FIG. 20 illustrates the reactivity of rabbit sera raised against soluble Leishmania antigens with Leishmania promastigote lysate (lane 1) and soluble Leishmania antigens (lane 2).

FIG. 21 shows the cDNA and predicted amino acid sequence for the Leishmania antigen Lmsp1a.

FIG. 22 shows a Southern blot of genomic DNA from L. major digested with a panel of restriction enzymes (lanes 1 to 7) and six other Leishmania species digested with PstI (lanes 8 to 13) probed with the full-length cDNA insert of Lmsp1a.

FIG. 23 shows a Southern blot of genomic DNA from L. major digested with a panel of restriction enzymes, six other Leishmania species digested with PstI and the infectious pathogens T. cruzi and T. brucei , probed with the full-length cDNA insert of the Leishmania antigen MAPS-1A.

FIG. 24 illustrates the proliferation of PBMC isolated from uninfected-individuals, patients with active mucosal leishmaniasis and patients post kala-azar infection, stimulated by MAPS-1A.

FIG. 25 illustrates the proliferation of murine lymph node cultures stimulated by MAPS-1A.

FIG. 26 illustrates the reactivity of MAPS-1A with sera from human leishmaniasis patients.

FIG. 27 illustrates the reactivity of MAPS-1A with sera from mice immunized against and/or infected with leishmaniasis.

FIG. 28 illustrates the effectiveness of immunization with either soluble Leishmania antigens or a mixture of Ldp23, LbeIF4A and M15 plus adjuvant in conferring protection against infection (as measured by footpad swelling) in a murine leishmaniasis model system, as compared to the administration of adjuvant alone.

FIG. 29 illustrates the effectiveness of immunization with MAPS-1A plus adjuvant in conferring protection against infection (as measured by footpad swelling) in a murine leishmaniasis model system, as compared to the administration of adjuvant alone.

FIGS. 30A and B illustrate the proliferation of murine lymph node cultures stimulated with either LcgSP8, LcgSP10 or LcgSP3.

FIG. 31 illustrates the effectiveness of immunization with soluble Leishmania antigens, MAPS-1A and M15 plus adjuvant, IL-12, in conferring protection against infection (as measured by footpad swelling) in a murine leishmaniasis model system, as compared to the administration of adjuvant IL-12 alone.

FIG. 32 illustrates the effectiveness of immunization with M15 DNA and MAPS-1A DNA in conferring protection against infection (as measured by footpad swelling) in a murine leishmaniasis model system, as compared to control DNA and saline.

FIG. 33 illustrates the effectiveness of immunization with Leishmania fusion proteins plus IL-12 as adjuvant, in conferring protection against infection in a murine leishmaniasis model system.

FIG. 34 illustrates the effectiveness of immunization with Leishmania fusion proteins plus the adjuvant MPL-SE, in conferring protection against infection in a murine leishmaniasis model system.

DETAILED DESCRIPTION OF THE INVENTION

As noted above, the present invention is generally directed to compositions and methods for preventing, treating and detecting leishmaniasis, as well as for stimulating immune responses in patients. The compositions of the subject invention include polypeptides that comprise at least an immunogenic portion of a Leishmania antigen, or a variant of such an antigen. In one preferred embodiment, compositions of the present invention include multiple polypeptides selected so as to provide enhanced protection against a variety of Leishmania species.

Polypeptides within the scope of the present invention include, but are not limited to, polypeptides comprising immunogenic portions of Leishmania antigens comprising the sequences recited in SEQ ID NO:2 (referred to herein as M15), SEQ ID NO:4 (referred to herein as Ldp23), SEQ ID NO:6 (referred to herein as Lbhsp83), SEQ ID NO:8 (referred to herein as Lt-210), SEQ ID NO:10 (referred to herein as LbeIF4A), SEQ ID NO: 20 (referred to herein as Lmsp1a), SEQ ID NO: 22 (referred to herein as Lmsp9a), SEQ ID NOs: 24 and 26 (referred to herein as MAPS-1A), and SEQ ID NO: 36-42, 49-53 and 55. As used herein, the term “polypeptide” encompasses amino acid chains of any length, including full length proteins (i.e., antigens), wherein the amino acid residues are linked by covalent bonds. Thus, a polypeptide comprising an immunogenic portion of one of the above antigens may consist entirely of the immunogenic portion, or may contain additional sequences. The additional sequences may be derived from the native Leishmania antigen or may be heterologous, and such sequences may (but need not) be immunogenic. An antigen “having” a particular sequence is an antigen that contains, within its full length sequence, the recited sequence. The native antigen may, or may not, contain additional amino acid sequence.

An immunogenic portion of a Leishmania antigen is a portion that is capable of eliciting an immune response (i.e., cellular and/or humoral) in a presently or previously Leishmania-infected patient (such as a human or a dog) and/or in cultures of lymph node cells or peripheral blood mononuclear cells (PBMC) isolated from presently or previously Leishmania-infected individuals. The cells in which a response is elicited may comprise a mixture of cell types or may contain isolated component cells (including, but not limited to, T-cells, NK cells, macrophages, monocytes and/or B cells). In particular, immunogenic portions are capable of inducing T-cell proliferation and/or a dominantly Th1-type cytokine response (e.g., IL-2, IFN-γ, and/or TNF-α production by T-cells and/or NK cells; and/or IL-12 production by monocytes, macrophages and/or B cells). Immunogenic portions of the antigens described herein may generally be identified using techniques known to those of ordinary skill in the art, including the representative methods provided herein.

The compositions and methods of the present invention also encompass variants of the above polypeptides. A polypeptide “variant,” as used herein, is a polypeptide that differs from a native protein in one or more substitutions, deletions, additions and/or insertions, such that the immunogenicity of the polypeptide is not substantially diminished. In other words, the ability of a variant to react with antigen-specific antisera may be enhanced or unchanged, relative to the native protein, or may be diminished by less than 50%, and preferably less than 20%, relative to the native protein. Such variants may generally be identified by modifying one of the above polypeptide sequences and evaluating the reactivity of the modified polypeptide with antigen-specific antibodies or antisera as described herein. Preferred variants include those in which one or more portions, such as an N-terminal leader sequence or transmembrane domain, have been removed. Other preferred variants include variants in which a small portion (e.g., 1-30 amino acids, preferably 5-15 amino acids) has been removed from the N- and/or C-terminal of the mature protein.

Polypeptide variants encompassed by the present invention include those exhibiting at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or more identity (determined as described above) to the polypeptides disclosed herein.

Preferably, a variant contains conservative substitutions. A “conservative substitution” is one in which an amino acid is substituted for another amino acid that has similar properties, such that one skilled in the art of peptide chemistry would expect the secondary structure and hydropathic nature of the polypeptide to be substantially unchanged. Amino acid substitutions may generally be made on the basis of similarity in polarity, charge, solubility, hydrophobicity, hydrophilicity and/or the amphipathic nature of the residues. For example, negatively charged amino acids include aspartic acid and glutamic acid; positively charged amino acids include lysine and arginine; and amino acids with uncharged polar head groups having similar hydrophilicity values include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; and serine, threonine, phenylalanine and tyrosine. Other groups of amino acids that may represent conservative changes include: (1) ala, pro, gly, glu, asp, gln, asn, ser, thr; (2) cys, ser, tyr, thr; (3) val, ile, leu, met, ala, phe; (4) lys, arg, his; and (5) phe, tyr, trp, his. A variant may also, or alternatively, contain nonconservative changes. In a preferred embodiment, variant polypeptides differ from a native sequence by substitution, deletion or addition of five amino acids or fewer. Variants may also (or alternatively) be modified by, for example, the deletion or addition of amino acids that have minimal influence on the immunogenicity, secondary structure and hydropathic nature of the polypeptide.

Polynucleotides may comprise a native sequence (i.e., an endogenous sequence that encodes a protein or a portion thereof) or may comprise a variant, or a biological or antigenic functional equivalent of such a sequence. Polynucleotide variants may contain one or more substitutions, additions, deletions and/or insertions, as further described below, preferably such that the immunogenicity of the encoded polypeptide is not diminished, relative to a native tumor protein. The effect on the immunogenicity of the encoded polypeptide may generally be assessed as described herein. The term “variants” also encompasses homologous genes of xenogenic origin.

When comparing polynucleotide or polypeptide sequences, two sequences are said to be “identical” if the sequence of nucleotides or amino acids in the two sequences is the same when aligned for maximum correspondence, as described below. Comparisons between two sequences are typically performed by comparing the sequences over a comparison window to identify and compare local regions of sequence similarity. A “comparison window” as used herein, refers to a segment of at least about 20 contiguous positions, usually 30 to about 75, 40 to about 50, in which a sequence may be compared to a reference sequence of the same number of contiguous positions after the two sequences are optimally aligned.

Optimal alignment of sequences for comparison may be conducted using the Megalign program in the Lasergene suite of bioinformatics software (DNASTAR, Inc., Madison, Wis.), using default parameters. This program embodies several alignment schemes described in the following references: Dayhoff, M. O. (1978) A model of evolutionary change in proteins—Matrices for detecting distant relationships. In Dayhoff, M. O. (ed.) Atlas of Protein Sequence and Structure, National Biomedical Research Foundation, Washington D.C. Vol. 5, Suppl. 3, pp. 345-358; Hein J. (1990) Unified Approach to Alignment and Phylogenes pp. 626-645 Methods in Enzymology vol. 183, Academic Press, Inc., San Diego, Calif.; Higgins, D. G. and Sharp, P. M. (1989) CABIOS 5:151-153; Myers, E. W. and Muller W. (1988) CABIOS 4:11-17; Robinson, E. D. (1971) Comb. Theor 11:105; Santou, N. Nes, M. (1987) Mol. Biol. Evol . 4:406-425; Sneath, P. H. A. and Sokal, R. R. (1973) Numerical Taxonomy—the Principles and Practice of Numerical Taxonomy , Freeman Press, San Francisco, Calif.; Wilbur, W. J. and Lipman, D. J. (1983) Proc. Natl. Acad., Sci. USA 80:726-730.

Alternatively, optimal alignment of sequences for comparison may be conducted by the local identity algorithm of Smith and Waterman (1981) Add. APL. Math 2:482, by the identity alignment algorithm of Needleman and Wunsch (1970) J. Mol. Biol . 48:443, by the search for similarity methods of Pearson and Lipman (1988) Proc. Natl. Acad. Sci. USA 85: 2444, by computerized implementations of these algorithms (GAP, BESTFIT, BLAST, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group (GCG), 575 Science Dr., Madison, Wis.), or by inspection.

One preferred example of algorithms that are suitable for determining percent sequence identity and sequence similarity are the BLAST and BLAST 2.0 algorithms, which are described in Altschul et al. (1977) Nucl. Acids Res . 25:3389-3402 and Altschul et al. (1990) J. Mol. Biol . 215:403-410, respectively. BLAST and BLAST 2.0 can be used, for example with the parameters described herein, to determine percent sequence identity for the polynucleotides and polypeptides of the invention. Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information. In one illustrative example, cumulative scores can be calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues; always >0) and N (penalty score for mismatching residues; always <0). For amino acid sequences, a scoring matrix can be used to calculate the cumulative score. Extension of the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached. The BLAST algorithm parameters W, T and X determine the sensitivity and speed of the alignment. The BLASTN program (for nucleotide sequences) uses as defaults a wordlength (W) of 11, and expectation (E) of 10, and the BLOSUM62 scoring matrix (see Henikoff and Henikoff (1989) Proc. Natl. Acad. Sci. USA 89:10915) alignments, (B) of 50, expectation (E) of 10, M=5, N=−4 and a comparison of both strands.

Preferably, the “percentage of sequence identity” is determined by comparing two optimally aligned sequences over a window of comparison of at least 20 positions, wherein the portion of the polynucleotide or polypeptide sequence in the comparison window may comprise additions or deletions (i.e., gaps) of 20 percent or less, usually 5 to 15 percent, or 10 to 12 percent, as compared to the reference sequences (which does not comprise additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions at which the identical nucleic acid bases or amino acid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the reference sequence (i.e., the window size) and multiplying the results by 100 to yield the percentage of sequence identity.

Therefore, the present invention encompasses polynucleotide and polypeptide sequences having substantial identity to the sequences disclosed herein, for example those comprising at least 50% sequence identity, preferably at least 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or higher, sequence identity compared to a polynucleotide or polypeptide sequence of this invention using the methods described herein, (e.g., BLAST analysis using standard parameters, as described below). One skilled in this art will recognize that these values can be appropriately adjusted to determine corresponding identity of proteins encoded by two nucleotide sequences by taking into account codon degeneracy, amino acid similarity, reading frame positioning and the like.

In additional embodiments, the present invention provides isolated polynucleotides and polypeptides comprising various lengths of contiguous stretches of sequence identical to or complementary to one or more of the sequences disclosed herein. For example, polynucleotides are provided by this invention that comprise at least about 15, 20, 30, 40, 50, 75, 100, 150, 200, 300, 400, 500 or 1000 or more contiguous nucleotides of one or more of the sequences disclosed herein as well as all intermediate lengths there between. It will be readily understood that “intermediate lengths”, in this context, means any length between the quoted values, such as 16, 17, 18, 19, etc.; 21, 22, 23, etc.; 30, 31, 32, etc.; 50, 51, 52, 53, etc.; 100, 101, 102, 103, etc.; 150, 151, 152, 153, etc.; including all integers through 200-500; 500-1,000, and the like.

The polynucleotides of the present invention, or fragments thereof, regardless of the length of the coding sequence itself, may be combined with other DNA sequences, such as promoters, polyadenylation signals, additional restriction enzyme sites, multiple cloning sites, other coding segments, and the like, such that their overall length may vary considerably. It is therefore contemplated that a nucleic acid fragment of almost any length may be employed, with the total length preferably being limited by the ease of preparation and use in the intended recombinant DNA protocol. For example, illustrative DNA segments with total lengths of about 10,000, about 5000, about 3000, about 2,000, about 1,000, about 500, about 200, about 100, about 50 base pairs in length, and the like, (including all intermediate lengths) are contemplated to be useful in many implementations of this invention.

In other embodiments, the present invention is directed to polynucleotides that are capable of hybridizing under moderately stringent conditions to a polynucleotide sequence provided herein, or a fragment thereof, or a complementary sequence thereof. Hybridization techniques are well known in the art of molecular biology. For purposes of illustration, suitable moderately stringent conditions for testing the hybridization of a polynucleotide of this invention with other polynucleotides include prewashing in a solution of 5×SSC, 0.5% SDS, 1.0 mM EDTA (pH 8.0); hybridizing at 50° C.-65° C., 5×SSC, overnight; followed by washing twice at 65° C. for 20 minutes with each of 2×, 0.5× and 0.2×SSC containing 0.1% SDS.

Moreover, it will be appreciated by those of ordinary skill in the art that, as a result of the degeneracy of the genetic code, there are many nucleotide sequences that encode a polypeptide as described herein. Some of these polynucleotides bear minimal homology to the nucleotide sequence of any native gene. Nonetheless, polynucleotides that vary due to differences in codon usage are specifically contemplated by the present invention. Further, alleles of the genes comprising the polynucleotide sequences provided herein are within the scope of the present invention. Alleles are endogenous genes that are altered as a result of one or more mutations, such as deletions, additions and/or substitutions of nucleotides. The resulting mRNA and protein may, but need not, have an altered structure or function. Alleles may be identified using standard techniques (such as hybridization, amplification and/or database sequence comparison).

“Polypeptides” as described herein also include combination polypeptides, also referred to as fusion proteins. A “combination polypeptide” is a polypeptide comprising at least one of the above immunogenic portions and one or more additional immunogenic Leishmania sequences, which are joined via a peptide linkage into a single amino acid chain. The sequences may be joined directly (i.e., with no intervening amino acids) or may be joined by way of a linker sequence (e.g., Gly-Cys-Gly) that does not significantly diminish the immunogenic properties of the component polypeptides.

Fusion proteins may generally be prepared using standard techniques, including chemical conjugation. Preferably, a fusion protein is expressed as a recombinant protein, allowing the production of increased levels, relative to a non-fused protein, in an expression system. Briefly, DNA sequences encoding the polypeptide components may be assembled separately, and ligated into an appropriate expression vector. The 3′ end of the DNA sequence encoding one polypeptide component is ligated, with or without a peptide linker, to the 5′ end of a DNA sequence encoding the second polypeptide component so that the reading frames of the sequences are in frame. This permits translation into a single fusion protein that retains the biological activity of both component polypeptides.

A peptide linker sequence may be employed to separate the first and the second polypeptide components by a distance sufficient to ensure that each polypeptide folds into its secondary and tertiary structures. Such a peptide linker sequence is incorporated into the fusion protein using standard techniques well known in the art. Suitable peptide linker sequences may be chosen based on the following factors: (1) their ability to adopt a flexible extended conformation; (2) their inability to adopt a secondary structure that could interact with functional epitopes on the first and second polypeptides; and (3) the lack of hydrophobic or charged residues that might react with the polypeptide functional epitopes. Preferred peptide linker sequences contain Gly, Asn and Ser residues. Other near neutral amino acids, such as Thr and Ala may also be used in the linker sequence. Amino acid sequences which may be usefully employed as linkers include those disclosed in Maratea et al., Gene 40:39-46, 1985; Murphy et al., Proc. Natl. Acad. Sci. USA 83:8258-8262, 1986; U.S. Pat. No. 4,935,233 and U.S. Pat. No. 4,751,180. The linker sequence may generally be from 1 to about 50 amino acids in length. Linker sequences are not required when the first and second polypeptides have non-essential N-terminal amino acid regions that can be used to separate the functional domains and prevent steric interference.

The ligated DNA sequences are operably linked to suitable transcriptional or translational regulatory elements. The regulatory elements responsible for expression of DNA are located only 5′ to the DNA sequence encoding the first polypeptides. Similarly, stop codons required to end translation and transcription termination signals are only present 3′ to the DNA sequence encoding the second polypeptide. The preparation of fusion proteins of Leishmania antigens is described below in Example 19.

In general, Leishmania antigens having immunogenic properties, and DNA sequences encoding such antigens, may be prepared using any of a variety of procedures from one or more Leishmania species including, but not limited to, L. donovani, L. chagasi, L. infantum, L. major, L. amazonensis, L. braziliensis, L. panamensis, L. mexicana, L. tropica , and L. guyanensis . Such species are available, for example, from the American Type Culture Collection (ATCC), Rockville, Md. For example, peptides isolated from MHC class II molecules of macrophages infected with a Leishmania species may be used to rescue the corresponding Leishmania donor antigens. MHC class II molecules are expressed mainly by cells of the immune system, including macrophages. These molecules present peptides, which are usually 13-17 amino acids long, derived from foreign antigens that are degraded in cellular vesicles. The bound peptide antigens are then recognized by CD4 T-cells. Accordingly, foreign peptides isolated from MHC class II molecules of, for example, Leishmania-infected murine macrophages may be used to identify immunogenic Leishmania proteins.

Briefly, peptides derived from Leishmania antigens may be isolated by comparing the reverse phase HPLC profile of peptides extracted from infected macrophages with the profile of peptides extracted from uninfected cells. Peptides giving rise to distinct HPLC peaks unique to infected macrophages may then be sequenced using, for example, Edman chemistry as described in Edman and Berg, Eur J. Biochem , 80:116-132 (1967). A DNA fragment corresponding to a portion of a Leishmania gene encoding the peptide may then be amplified from a Leishmania cDNA library using an oligonucleotide sense primer derived from the peptide sequence and an oligo dT antisense primer. The resulting DNA fragment may then be used as a probe to screen a Leishmania library for a full length cDNA or genomic clone that encodes the Leishmania antigen. Such screens may generally be performed using techniques well known to those of ordinary skill in the art, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual , Cold Spring Harbor Laboratories, Cold Spring Harbor, N.Y. (1989).

This approach may be used to identify a 23 kD Leishmania donovani antigen (referred to herein as Ldp23). The sequence of a polynucleotide encoding Ldp23 is provided in SEQ ID NO:3 and the amino acid sequence of Ldp23 is provided in SEQ ID NO:4. Using the methods described herein, Ldp23 has been shown to induce a Th1 immune response in T-cells prepared from Leishmania-infected mice.

Alternatively, a Leishmania cDNA or genomic expression library may be screened with serum from a Leishmania-infected individual, using techniques well known to those of ordinary skill in the art. Polynucleotides encoding reactive antigens may then be used to express the recombinant antigen for purification. The immunogenic properties of the purified Leishmania antigens may then be evaluated using, for example the representative methods described herein.

For example, sera from Leishmania-infected mice may be used to screen a cDNA library prepared from Leishmania amastigotes. Reactive clones may then be expressed and recombinant proteins assayed for the ability to stimulate T-cells or NK cells derived from Leishmania-immune individuals (i.e., individuals having evidence of infection, as documented by positive serological reactivity with Leishmania-specific antibodies and/or a Leishmania-specific DTH response, without clinical symptoms of leishmaniasis). This procedure may be used to obtain a recombinant polynucleotide encoding the Leishmania antigen designated M15. The sequence of such a polynucleotide is provided in SEQ ID NO:1, and the amino acid sequence of the encoded protein is provided in SEQ ID NO:2.

A similar approach may be used to isolate a genomic polynucleotide encoding an immunogenic Leishmania braziliensis antigen, referred to herein as Lbhsp83. More specifically, a genomic clone encoding Lbhsp83 may be isolated by screening a L. braziliensis expression library with sera from a Leishmania-infected individual. The DNA encoding Lbhsp83 is homologous to the gene encoding the eukaryotic 83 kD) heat shock protein. The sequence of a polynucleotide encoding nearly all of Lbhsp83 is presented in SEQ ID NO:5, and the encoded amino acid sequence is provided in SEQ ID NO:6. Using the methods described below, Lbhsp83 has been found to stimulate proliferation, and a mixed Th1 and Th2 cytokine profile, in PBMC isolated from L. braziliensis -infected patients. Accordingly, Lbhsp83 is an immunogenic Leishmania antigen. Regions of Lbhsp83 that are not conserved with the mammalian gene have been found to be particularly potent for T-cell stimulation and antibody binding. Such regions may be identified, for example, by visual inspection of the sequence comparison provided in FIG. 19 .

This approach may also be used to isolate a polynucleotide encoding a 210 kD immunogenic L. tropica antigen, referred to herein as Lt-210. The preparation and characterization of Lt-210, and immunogenic portions thereof (such as Lt-1 and immunogenic repeat and non-repeat sequences), is described in detail in U.S. patent application Ser. No. 08/511,872, filed Aug. 4, 1995. The sequence of a polynucleotide encoding Lt-1 is provided in SEQ ID NO:7 and the encoded amino acid sequence is presented in SEQ ID NO:8.

The above approach may further be used to isolate a polynucleotide encoding a L. braziliensis antigen referred to herein as LbeIF4A. Briefly, such a clone may be isolated by screening a L. braziliensis expression library with sera obtained from a patient afflicted with mucosal leishmaniasis, and analyzing the reactive antigens for the ability to stimulate proliferative responses and preferential Th1 cytokine production in PBMC isolated from Leishmania-infected patients, as described below. The preparation and characterization of LbeIF4A is described in detail in U.S. patent application Ser. Nos. 08/454,036 and 08/488,386, which are continuations-in-part of U.S. patent application Ser. No. 08/232,534, filed Apr. 22, 1994. The sequence of a polynucleotide encoding LbeIF4A is provided in SEQ ID NO:9 and the encoded amino acid sequence is presented in SEQ ID NO:10. Homologs of LbeIF4A, such as that found in L. major , may also be isolated using this approach, and are within the scope of the present invention.

Compositions of the present invention may also, or alternatively, contain soluble Leishmania antigens. As used herein, “soluble Leishmania antigens” refers to a mixture of at least 8 different Leishmania antigens that may be isolated from the supernatant of Leishmania promastigotes of any species grown for 8-12 hours in protein-free medium. Briefly, the organisms are grown to late log phase in complex medium with serum until they reach a density of 2-3×10 7 viable organisms per mL of medium. The organisms are thoroughly washed to remove medium components and resuspended at 2-3×10 7 viable organisms per mL of defined serum-free medium consisting of equal parts RPMI 1640 and medium 199, both from Gibco BRL, Gaithersburg, Md. After 8-12 hours, the supernatant containing soluble Leishmania antigens is removed, concentrated 10 fold and dialyzed against phosphate-buffered saline for 24 hours. The presence of at least eight different antigens within the mixture of Leishmania antigens may be confirmed using SDS-PAGE (i.e., through the observation of at least 8 different bands). The immunogenic properties of the soluble Leishmania antigens may be confirmed by evaluating the ability of the preparation to elicit an immune response in cultures of lymph node cells and/or peripheral blood mononuclear cells (PBMC) isolated from presently or previously Leishmania-infected individuals. Such an evaluation may be performed as described below.

Individual antigens present within the mixture of soluble Leishmania antigens may be isolated by immunizing mice or rabbits with Leishmania culture supernatant, containing soluble antigens, and employing the resultant sera to screen a Leishmania cDNA expression library as described in detail below. This procedure may be used to isolate recombinant polynucleotides encoding the L. major antigens referred to herein as Lmsp1a, Lmsp9a and MAPS-1A. DNA sequences encoding Lmsp1a, Lmsp9a and MAPS-1A are provided in SEQ ID NO: 19, 21 and 23, respectively, with the corresponding predicted amino acid sequences being presented in SEQ ID NO: 20, 22 and 24, respectively. Similarly, sera from mice or rabbits immunized with L. major culture supernatant may be used to screen an L. major genomic DNA library. As detailed below, this procedure may be used to isolate polynucleotides encoding the L. major antigens referred to herein as LmgSP1, LmgSP3, LmgSP5, LmgSP8, LmgSP9, LmgSP13, LmgSP19, and polynucleotides encoding the L. chagasi antigens LcgSP1, LcgSP3, LcgSP4, LcgSP8, and LcgSP10. The DNA sequences encoding these antigens are provided in SEQ ID NO:29-35 and 44-48, respectively, with the corresponding amino acid sequences being provided in SEQ ID NO: 36-42 and 49-53. The L. major antigens referred to herein as 1G6-34, 1E6-44, 4A5-63, 1B11-39, 2A10-37, 4G2-83, 4H6-41 and 8G3-100 may be isolated by means of CD4+ T cell expression cloning as described below. DNA sequences encoding these antigens are provided in SEQ ID NO: 72-79, respectively, with the corresponding predicted amino acid sequences being provided in SEQ ID NO: 80-87. The immunogenic properties of the isolated Leishmania antigens may be evaluated using, for example, the representative methods described herein.

Regardless of the method of preparation, the antigens described herein are immunogenic. In other words, the antigens (and immunogenic portions thereof) are capable of eliciting an immune response in cultures of lymph node cells and/or peripheral blood mononuclear cells (PBMC) isolated from presently or previously Leishmania-infected individuals. More specifically, the antigens, and immunogenic portions thereof, have the ability to induce T-cell proliferation and/or to elicit a dominantly Th1-type cytokine response (e.g., IL-2, IFN-γ, and/or TNF-α production by T-cells and/or NK cells; and/or IL-12 production by monocytes, macrophages and/or B cells) in cells isolated from presently or previously Leishmania-infected individuals. A Leishmania-infected individual may be afflicted with a form of leishmaniasis (such as subclinical, cutaneous, mucosal or active visceral) or may be asymptomatic. Such individuals may be identified using methods known to those of ordinary skill in the art. Individuals with leishmaniasis may be identified based on clinical findings associated with at least one of the following: isolation of parasite from lesions, a positive skin test with Leishmania lysate or a positive serological test. Asymptomatic individuals are infected individuals who have no signs or symptoms of the disease. Such individuals can be identified based on a positive serological test and/or skin test with Leishmania lysate.

The term “PBMC,” which refers to a preparation of nucleated cells consisting primarily of lymphocytes and monocytes that are present in peripheral blood, encompasses both mixtures of cells and preparations of one or more purified cell types. PBMC may be isolated by methods known to those in the art. For example, PBMC may be isolated by density centrifugation through, for example, Ficol™ (Winthrop Laboratories, New York). Lymph node cultures may generally be prepared by immunizing BALB/c mice (e.g., in the rear foot pad) with Leishmania promastigotes emulsified in complete Freünd's adjuvant. The draining lymph nodes may be excised following immunization and T-cells may be purified in an anti-mouse Ig column to remove the B cells, followed by a passage through a Sephadex G10 column to remove the macrophages. Similarly, lymph node cells may be isolated from a human following biopsy or surgical removal of a lymph node.

The ability of a polypeptide (e.g., a Leishmania antigen or a portion or other variant thereof) to induce a response in PBMC or lymph node cell cultures may be evaluated by contacting the cells with the polypeptide and measuring a suitable response. In general, the amount of polypeptide that is sufficient for the evaluation of about 2×10 5 cells ranges from about 10 ng to about 100 μg, and preferably is about 1-10 μg. The incubation of polypeptide with cells is typically performed at 37° C. for about 1-3 days. Following incubation with polypeptide, the cells are assayed for an appropriate response. If the response is a proliferative response, any of a variety of techniques well known to those of ordinary skill in the art may be employed. For example, the cells may be exposed to a pulse of radioactive thymidine and the incorporation of label into cellular DNA measured. In general, a polypeptide that results in at least a three fold increase in proliferation above background (i.e., the proliferation observed for cells cultured without polypeptide) is considered to be able to induce proliferation.

Alternatively, the response to be measured may be the secretion of one or more cytokines (such as interferon-γ (IFN-γ), interleukin-4 (IL-4), interleukin-12 (p70 and/or p40), interleukin-2 (IL-2) and/or tumor necrosis factor-α (TNF-α)) or the change in the level of mRNA encoding one or more specific cytokines. In particular, the secretion of interferon-γ, interleukin-2, tumor necrosis factor-α and/or interleukin-12 is indicative of a Th1 response, which is responsible for the protective effect against Leishmania. Assays for any of the above cytokines may generally be performed using methods known to those of ordinary skill in the art, such as an enzyme-linked immunosorbent assay (ELISA). Suitable antibodies for use in such assays may be obtained from a variety of sources such as Chemicon, Temucula, Calif. and PharMingen, San Diego, Calif., and may generally be used according to the manufacturer's instructions. The level of mRNA encoding one or more specific cytokines may be evaluated by, for example, amplification by polymerase chain reaction (PCR). In general, a polypeptide that is able to induce, in a preparation of about 1-3×10 5 cells, the production of 30 pg/mL of IL-12, IL-4, IFN-γ, TNF-α or IL-12p40, or 10 pg/mL of IL-12p70, is considered able to stimulate production of a cytokine.

Immunogenic portions of the antigens described herein may be prepared and identified using well known techniques, such as those summarized in Paul, Fundamental Immunology, 3rd ed., 243-247 (Raven Press, 1993) and references cited therein. Such techniques include screening polypeptides derived from the native antigen for immunogenic properties using, for example, the representative techniques described herein. An immunogenic portion of a polypeptide is a portion that, within such representative assays, generates an immune response (e.g., proliferation and/or cytokine production) that is substantially similar to that generated by the full length antigen. In other words, an immunogenic portion of an antigen may generate at least about 25%, and preferably at least about 50%, of the response generated by the full length antigen in the model assays described herein.

Portions and other variants of immunogenic Leishmania antigens may be generated by synthetic or recombinant means. Synthetic polypeptides having fewer than about 100 amino acids, and generally fewer than about 50 amino acids, may be generated using techniques well known to those of ordinary skill in the art. For example, such polypeptides may be synthesized using any of the commercially available solid-phase techniques, such as the Merrifield solid-phase synthesis method, where amino acids are sequentially added to a growing amino acid chain. See Merrifield, J. Am. Chem. Soc . 85:2149-2146, 1963. Equipment for automated synthesis of polypeptides is commercially available from suppliers such as Perkin Elmer/Applied BioSystemsDivision, Foster City, Calif., and may be operated according to the manufacturer's instructions.

Recombinant polypeptides containing portions and/or variants of a native antigen may be readily prepared from a DNA sequence encoding the antigen. For example, supernatants from suitable host/vector systems which secrete recombinant protein into culture media may be first concentrated using a commercially available filter. Following concentration, the concentrate may be applied to a suitable purification matrix such as an affinity matrix or an ion exchange resin. Finally, one or more reverse phase HPLC steps can be employed to further purify a recombinant protein.

In general, any of a variety of expression vectors known to those of ordinary skill in the art may be employed to express recombinant polypeptides of this invention. Expression may be achieved in any appropriate host cell that has been transformed or transfected with an expression vector containing a polynucleotide that encodes a recombinant polypeptide. Suitable host cells include prokaryotes, yeast and higher eukaryotic cells. Preferably, the host cells employed are E. coli , yeast or a mammalian cell line such as COS or CHO. The DNA sequences expressed in this manner may encode naturally occurring antigens, portions of naturally occurring antigens, or other variants thereof. For example, variants of a native antigen may generally be prepared using standard mutagenesis techniques, such as oligonucleotide-directed site-specific mutagenesis, and sections of the DNA sequence may be removed to permit preparation of truncated polypeptides.

In another aspect, the present invention provides epitope repeat sequences, or antigenic epitopes, of a Leishmania antigen, together with polypeptides comprising at least two such contiguous antigenic epitopes. As used herein an “epitope” is a portion of an antigen that reacts with sera from Leishmania-infected individuals (i.e. an epitope is specifically bound by one or more antibodies present in such sera). As discussed above, epitopes of the antigens described in the present application may be generally identified using techniques well known to those of skill in the art.

In one embodiment, antigenic epitopes of the present invention comprise an amino acid sequence provided in SEQ ID NO:43, 56, 57 or 58. As discussed in more detail below, antigenic epitopes provided herein may be employed in the diagnosis and treatment of Leishmania infection, either alone or in combination with other Leishmania antigens or antigenic epitopes. Antigenic epitopes and polypeptides comprising such epitopes may be prepared by synthetic means, as described generally above and in detail in Example 15.

In certain aspects of the present invention, described in detail below, the polypeptides, antigenic epitopes and/or soluble Leishmania antigens may be incorporated into pharmaceutical compositions or vaccines. For clarity, the term “polypeptide” will be used when describing specific embodiments of the inventive therapeutic compositions and diagnostic methods. However, it will be clear to one of skill in the art that the antigenic epitopes of the present invention may also be employed in such compositions and methods.

Pharmaceutical compositions comprise one or more polypeptides, each of which may contain one or more of the above sequences (or variants thereof), and a physiologically acceptable carrier. Vaccines, also referred to as immunogenic compositions, comprise one or more of the above polypeptides and an immunostimulant, such as an adjuvant (e.g., LbeIF4A, interleukin-12 or other cytokines) or a liposome (into which the polypeptide is incorporated). In certain embodiments, the inventive vaccines include an adjuvant capable of eliciting a predominantly Th-1 type response. Preferred adjuvants for use in eliciting a predominantly Th1-type response include, for example, a combination of monophosphoryl lipid A, preferably 3-de-O-acylated monophosphoryl lipid A (3D-MPL), together with an aluminum salt. MPL adjuvants are available from Ribi ImmunoChem Research Inc. (Hamilton, Mont.; see U.S. Pat. Nos. 4,436,727; 4,877,611; 4,866,034 and 4,912,094). CpG-containing oligonucleotides (in which the CpG dinucleotide is unmethylated) also induce a predominantly Th1 response. Such oligonucleotides are well known and are described, for example, in WO 96/02555 and WP 99/33488. Immunostimulatory DNA sequences are also described, for example, by Sato et al., Science 273:352, 1996. Another preferred adjuvant is a saponin, preferably QS21 (Aquila, United States), which may be used alone or in combination with other adjuvants. For example, an enhanced system involves the combination of a monophosphoryl lipid A and saponin derivative, such as the combination of QS21 and 3D-MPL as described in WO 94/00153, or a less reactogenic composition where the QS21 is quenched with cholesterol, as described in WO 96/33739. Other preferred formulations comprise an oil-in-water emulsion and tocopherol. A particularly potent adjuvant formulation involving QS21, 3D-MPL and tocopherol in an oil-in-water emulsion is described in WO 95/17210.

Vaccines may additionally contain a delivery vehicle, such as a biodegradable microsphere (disclosed, for example, in U.S. Pat. Nos. 4,897,268 and 5,075,109). Pharmaceutical compositions and vaccines within the scope of the present invention may also contain other Leishmania antigens, either incorporated into a combination polypeptide or present within one or more separate polypeptides.

Alternatively, a pharmaceutical composition or vaccine may contain an immunostimulant such as, an adjuvant (e.g., LbeIF4A, interleukin-12 or other cytokines) or DNA coding for such enhancers, and DNA encoding one or more of the polypeptides as described above, such that the polypeptide is generated in situ. In such pharmaceutical compositions and vaccines, the DNA may be present within any of a variety of delivery systems known to those of ordinary skill in the art, including nucleic acid expression systems, bacteria and viral expression systems. Appropriate nucleic acid expression systems contain the necessary DNA sequences for expression in the patient (such as a suitable promoter and terminating signal). Bacterial delivery systems involve the administration of a bacterium (such as Bacillus-Calmette-Guerrin) that expresses an immunogenic portion of the polypeptide on its cell surface. In a preferred embodiment, the DNA may be introduced using a viral expression system (e.g., vaccinia or other pox virus, retrovirus, or adenovirus), which may involve the use of a non-pathogenic (defective), replication competent virus. Techniques for incorporating DNA into such expression systems are well known to those of ordinary skill in the art. The DNA may also be “naked,” as described, for example, in Ulmer et al., Science 259:1745-1749 (1993) and reviewed by Cohen, Science 259:1691-1692 (1993). The uptake of naked DNA may be increased by coating the DNA onto biodegradable beads, which are efficiently transported into the cells.

While any suitable carrier known to those of ordinary skill in the art may be employed in the pharmaceutical compositions of this invention, the type of carrier will vary depending on the mode of administration. For parenteral administration, such as subcutaneous injection, the carrier preferably comprises water, saline, alcohol, a fat, a wax or a buffer. For oral administration, any of the above carriers or a solid carrier, such as mannitol, lactose, starch, magnesium stearate, sodium saccharine, talcum, cellulose, glucose, sucrose, and magnesium carbonate, may be employed. Biodegradable microspheres (e.g., polylactic galactide) may also be employed as carriers for the pharmaceutical compositions of this invention. Suitable biodegradable microspheres are disclosed, for example, in U.S. Pat. Nos. 4,897,268 and 5,075,109.

Any of a variety of adjuvants may be employed in the vaccines of this invention to nonspecifically enhance the immune response. Most adjuvants contain a substance designed to protect the antigen from rapid catabolism, such as aluminum hydroxide or mineral oil, and a nonspecific stimulator of immune responses, such as lipid A, Bordella pertussis or Mycobacterium tuberculosis . Suitable adjuvants are commercially available as, for example, Freund's Incomplete Adjuvant and Complete Adjuvant (Difco Laboratories, Detroit, Mich.), Merck Adjuvant 65 (Merck and Company, Inc., Rahway, N.J.), alum, biodegradable microspheres, monophosphoryl lipid A and quil A. Preferred adjuvants include LbeIF4A, IL-12 and other cytokines such as IFN-γ or granulocyte-macrophage colony stimulating factor (GM-CSF). By virtue of its ability to induce an exclusive Th1 immune response, the use of LbeIF4A, and variants thereof, as an adjuvant in the vaccines of the present invention is particularly preferred.

In one preferred embodiment, compositions of the present invention include multiple polypeptides selected so as to provide enhanced protection against a variety of Leishmania species. Such polypeptides may be selected based on the species of origin of the native antigen or based on a high degree of conservation of amino acid sequence among different species of Leishmania. A combination of individual polypeptides may be particularly effective as a prophylactic and/or therapeutic vaccine because (1) stimulation of proliferation and/or cytokine production by a combination of individual polypeptides may be additive, (2) stimulation of proliferation and/or cytokine production by a combination of individual polypeptides may be synergistic, (3) a combination of individual polypeptides may stimulate cytokine profiles in such a way as to be complementary to each other and/or (4) individual polypeptides may be complementary to one another when certain of them are expressed more abundantly on the individual species or strain of Leishmania responsible for infection. A preferred combination contains polypeptides that comprise immunogenic portions of M15, Ldp23, Lbhsp83, Lt-1 and LbeIF4A. Alternatively, or in addition, the combination may include one or more polypeptides comprising immunogenic portions of other Leishmania antigens disclosed herein, and/or soluble Leishmania antigens.

In another preferred embodiment, compositions of the present invention include single polypeptides selected so as to provide enhanced protection against a variety of Leishmania species. A single individual polypeptide may be particularly effective as a prophylactic and/or therapeutic vaccine for those reasons stated above for combinations of individual polypeptides.

In another embodiment, compositions of the present invention include individual polypeptides and combinations of the above described polypeptides employed with a variety of adjuvants, such as IL-12 (protein or DNA) to confer a protective response against a variety of Leishmania species.

In yet another embodiment, compositions of the present invention include DNA constructs of the various Leishmania species employed alone or in combination with variety of adjuvants, such as IL-12 (protein or DNA) to confer a protective response against a variety of Leishmania species.

The above pharmaceutical compositions and vaccines may be used, for example, to induce protective immunity against Leishmania in a patient, such as a human or a dog, to prevent leishmaniasis. Appropriate doses and methods of administration for this purposes are described in detail below.

The pharmaceutical compositions and vaccines described herein may also be used to stimulate an immune response, which may be cellular and/or humoral, in a patient. For Leishmania-infected patients, the immune responses that may be generated include a preferential Th1 immune response (i.e., a response characterized by the production of the cytokines interleukin-1, interleukin-2, interleukin-12 and/or interferon-γ, as well as tumor necrosis factor-α). For uninfected patients, the immune response may be the production of interleukin-12 and/or interleukin-2, or the stimulation of gamma delta T-cells. In either category of patient, the response stimulated may include IL-12 production. Such responses may also be elicited in biological samples of PBMC or components thereof derived from Leishmania-infected or uninfected individuals. As noted above, assays for any of the above cytokines may generally be performed using methods known to those of ordinary skill in the art, such as an enzyme-linked immunosorbent assay (ELISA).

Suitable pharmaceutical compositions and vaccines for use in this aspect of the present invention are those that contain at least one polypeptide comprising an immunogenic portion of a Leishmania antigen disclosed herein (or a variant thereof). Preferably, the polypeptides employed in the pharmaceutical compositions and vaccines are complementary, as described above. Soluble Leishmania antigens, with or without additional polypeptides, may also be employed.

The pharmaceutical compositions and vaccines described herein may also be used to treat a patient afflicted with a disease responsive to IL-12 stimulation. The patient may be any warm-blooded animal, such as a human or a dog. Such diseases include infections (which may be, for example, bacterial, viral or protozoan) or diseases such as cancer. In one embodiment, the disease is leishmaniasis, and the patient may display clinical symptoms or may be asymptomatic. In general, the responsiveness of a particular disease to IL-12 stimulation may be determined by evaluating the effect of treatment with a pharmaceutical composition or vaccine of the present invention on clinical correlates of immunity. For example, if treatment results in a heightened Th1 response or the conversion of a Th2 to a Th1 profile, with accompanying clinical improvement in the treated patient, the disease is responsive to IL-12 stimulation. Polypeptide administration may be as described below, or may extend for a longer period of time, depending on the indication. Preferably, the polypeptides employed in the pharmaceutical compositions and vaccines are complementary, as described above. A particularly preferred combination contains polypeptides that comprise immunogenic portions of M15, Ldp23, Lbhsp83, Lt-1 and LbeIF4A, Lmsp1a, Lmsp9a, and MAPS-1A. Soluble Leishmania antigens, with or without additional polypeptides, may also be employed.

Routes and frequency of administration, as well as dosage, for the above aspects of the present invention will vary from individual to individual and may parallel those currently being used in immunization against other infections, including protozoan, viral and bacterial infections. In general, the pharmaceutical compositions and vaccines may be administered by injection (e.g., intracutaneous, intramuscular, intravenous or subcutaneous), intranasally (e.g., by aspiration) or orally. Between 1 and 12 doses may be administered over a 1 year period. For therapeutic vaccination (i.e., treatment of an infected individual), 12 doses are preferably administered, at one month intervals. For prophylactic use, 3 doses are preferably administered, at 3 month intervals. In either case, booster vaccinations may be given periodically thereafter. Alternate protocols may be appropriate for individual patients. A suitable dose is an amount of polypeptide or DNA that, when administered as described above, is capable of raising an immune response in an immunized patient sufficient to protect the patient from leishmaniasis for at least 1-2 years. In general, the amount of polypeptide present in a dose (or produced in situ by the DNA in a dose) ranges from about 100 ng to about 1 mg per kg of host, typically from about 10 μg to about 100 μg. Suitable dose sizes will vary with the size of the patient, but will typically range from about 0.1 mL to about 5 mL.

In another aspect, this invention provides methods for using one or more of the polypeptides described above to diagnose Leishmania infection in a patient using a skin test. As used herein, a “skin test” is any assay performed directly on a patient in which a delayed-type hypersensitivity (DTH) reaction (such as induration and accompanying redness) is measured following intradermal injection of one or more polypeptides as described above. Such injection may be achieved using any suitable device sufficient to contact the polypeptide or polypeptides with dermal cells of the patient, such as a tuberculin syringe or 1 mL syringe. Preferably, the reaction is measured at least 48 hours after injection, more preferably 72 hours after injection.

The DTH reaction is a cell-mediated immune response, which is greater in patients that have been exposed previously to a test antigen (i.e., an immunogenic portion of a polypeptide employed, or a variant thereof). The response may measured visually, using a ruler. In general, induration that is greater than about 0.5 cm in diameter, preferably greater than about 1.0 cm in diameter, is a positive response, indicative of Leishmania infection, which may or may not be manifested as an active disease.

The polypeptides of this invention are preferably formulated, for use in a skin test, as pharmaceutical compositions containing at least one polypeptide and a physiologically acceptable carrier, as described above. Such compositions typically contain one or more of the above polypeptides in an amount ranging from about 1 μg to 100 μg, preferably from about 10 μg to 50 μg in a volume of 0.1 mL. Preferably, the carrier employed in such pharmaceutical compositions is a saline solution with appropriate preservatives, such as phenol and/or Tween 80™.

The inventive polypeptides may also be employed in combination with one or more known Leishmania antigens in the diagnosis of leishmaniasis, using, for example, the skin test described above. Preferably, individual polypeptides are chosen in such a way as to be complementary to each other. Examples of known Leishmania antigens which may be usefully employed in conjunction with the inventive polypeptides include K39 (Burns et al., Proc. Natl. Acad. Sci. USA , 1993 90:775-779).

The following Examples are offered by way of illustration and not by way of limitation.

EXAMPLES

Example 1

Preparation of M15

This Example illustrates the preparation of a Leishmania antigen M15, having the sequence provided in SEQ ID NO:2.

An L. major (Friedlan strain) amastigote cDNA expression library prepared in the λZAP II vector (Stratagene, La Jolla, Calif.) was screened according to manufacturer's instructions using sera obtained from L. major infected BALB/c mice (8 weeks post inoculation). Approximately 40,000 plaques were screened and four clones expressing reactive antigens were purified to homogeneity by two subsequent rounds of low density screening. Bluescript phagemid inserts were excised from positive clones for further analysis. An EcoRI/SstII restriction fragment from the 5′ end of one partial cDNA insert isolated during first round screening (pLmal-1) was subsequently used as a probe to rescreen for clones containing full length cDNA inserts. The probe was labeled to high specific activity (□10 9 cpm/μg) with [├→- 32 P]dCTP using the random primer method and was used to screen □10,000 plaques of the L. major expression library described above. Positive clones were compared by restriction enzyme digestion and the clone with the largest insert (pfl1-1) was chosen for subsequent analysis.

DNA sequence analyses were performed on an Applied Biosystems automated sequencer using Taq polymerase and dye coupled ddNTP terminators or dye-labeled sequencing primers. The complete sequence of the 2685 bp insert was determined using a combination of primer-directed sequencing and by sequencing a series of overlapping Exonuclease III deletion subclones generated using the Erase-a-base system (Promega, Madison, Wis.). The sequence of this insert is provided in SEQ ID NO: 1, and the deduced amino acid sequence is provided in SEQ ID NO:2.

The complete insert of clone pfl-1 was excised by digestion with BamHI/KpnI and was subcloned in frame into BamHI/KpnI digested pQE31 (QUIAGEN) to generate the construct pM151A. E. coli containing this construct inducibly expressed high levels of the L. major antigen encoded by pfl1-1 (designated as M15) with the addition of a 6-histidine tag at the amino terminus. Large volume cultures (500 ml) of E. coli host cells containing the pM151A construct were induced to express recombinant protein by the addition of 2 mM IPTG at mid-log phase of growth. Growth was continued for 4 to 5 hours and bacteria were then pelleted and washed once with cold PBS. Bacteria were resuspended in 20 ml of lysis buffer (50 mM Na 2 HPO 4 , pH 8.0, 300 mM NaCl, 10 mM β-mercaptoethanol) containing 20 mg of lysozyme and were lysed by a 1 hour incubation at 4° C. followed by brief sonication. Insoluble material was removed by centrifugation at 10,000×g for 10 minutes and although the recombinant protein was found to be evenly distributed between the soluble and insoluble fractions the insoluble material was discarded at this point. Recombinant protein containing the amino terminal histidine tag was affinity purified using Ni-NTA resin (QIAGEN) according to the manufacturer's recommendations. Briefly, 8 ml of Ni-NTA resin resuspended in lysis buffer was added to the soluble lysate fraction and binding was conducted with constant mixing for 1 hour at 4° C. The mixture was then loaded into a gravity flow column and the non-binding material was allowed to flow through. The Ni-NTA matrix was washed 3 times with 25 ml of wash buffer (50 mM Na 2 HPO 4 , pH 6.0, 300 mM NaCl, 10 mM β-mercaptoethanol) and bound material was eluted in 25 ml of elution buffer (50 mM Na 2 HPO 4 , pH 5.0, 300 mM NaCl, 10 mM β-mercaptoethanol). The eluted material was then dialyzed against 3 changes of PBS, sterile filtered and stored at −20° C. The purified recombinant protein was shown by SDS-PAGE analysis to be free of any significant amount of E. coli protein. A small number of bands of lower molecular weight were assumed to be proteolytic products of the L. major antigen based on their reactivity by western blot analysis. A high titre polyclonal antisera against M15 was generated in rabbits by repeated subcutaneous injection of recombinant protein. Western blot analysis of lysates from L. major promastigotes and amastigotes using this antisera indicated that the protein is constitutively expressed throughout the parasite lifecycle.

Example 2

Preparation of Ldp23

This Example illustrates the preparation of a Leishmania antigen Ldp23, having the sequence provided in SEQ ID NO:4.

A. Purification of MHC Class II-associated Peptides From P388D1 Macrophages Infected With L. donovani

To ascertain that in vitro infection of macrophages would load their MHC class II molecules with parasite peptides, initial experiments were carried out to test the ability of L. donovani -infected macrophage cell line P388D1 to present parasite antigens to L. donovani specific T-cells. This macrophage cell line was chosen because it has the same H-2 haplotype as the BALB/c mouse, which is a strain of mouse moderately susceptible to L. donovani infection and selected to conduct the in vivo experiments. Using a proportion of 3-5 parasites per cell and an initial incubation at room temperature for 4-6 hours follows by 37° C. for 24-48 hours, close to 90% of the macrophages were infected. The level of MHC class II molecule expression, as determined by FACS analysis, indicated that infection did not cause an effect on the levels of MHC class II expression when compared to non-infected control cells.

To test the ability of the L. donovani -infected P388D1 cells to present parasite antigens, macrophages were infected as indicated above and incubated at 26° C. for 6 hours, and then as 37° C. for either 24, 48 or 72 hours. At each of these time points the non-adherent cells and free parasites were washed out and the adherent cells were mechanically dislodged, washed and fixed with paraformaldehyde. These cells were then used as antigen presenting cells (APCs) for purified lymph node T-cells from BALB/c mice immunized with L. donovani promastigotes. To generate these anti- L. donovani specific T-cells, BALB/c mice (H-2 d ) of both sexes (The Jackson Laboratory, Bar Harbor, Me.) were immunized at 8 to 14 weeks of age in the rear foot pad with 5-10×10 6 L. donovani promastigotes emulsified in complete Freünd's adjuvant (CFA) (Difco Laboratories, Madison, Mich.) as described in Rodrigues et al., Parasite Immunol . 14:49 (1992). The draining lymph nodes were excised 8 days after the immunization and T-cells were purified in an anti-mouse Ig column to remove the B cells, as described in Bunn-Moreno and Campos-Neto, J. Immunol . 127:427 (1981), followed by a passage through a Sephadex G10 column to remove the macrophages.

Stimulation index was calculated by dividing the cpm obtained for the cells cultured in the presence of infected P388D1 macrophages by the cpm obtained for the cells cultured in the presence of non-infected macrophages, but subjected to the same conditions as the infected macrophages. The results shown FIG. 1 indicate that L. donovani -infected P388D1 macrophage process parasite antigens and that optimal presentation occurs after 48 hours of infection. No stimulation of the T-cells by the non-infected macrophages was observed.

To isolate the MHC class II associated L. donovani peptides, P388D1 macrophages were infected with L. donovani promastigotes for an initial incubation of 6 hours at room temperature. The cultures were then transferred to 37° C. for the remainder of the 48 hour incubation period. At a ratio of 3-5 parasites per macrophage nearly 90% of the macrophages were infected after 24 hours of incubation at 37° C.

The MHC class II molecules were then affinity-purified. Approximately 1.5×10 10 L. donovani -infected or an equal number of non-infected P388D1 macrophages were used for each purification. The cells were harvested, washed with PBS and incubated for 30 minutes in cold lysis buffer (PBS, 1% Nonidet P40, 25 mM iodoacetamide, 0.04% sodium azide, 1 mM aprotinin and 1 mM PMSF). The insoluble material was removed by centrifugation at 40,000g for 1 hour and the supernatant was recycled overnight at 4° C. over a 5ml anti-MHC class II molecules (H-2 d ) Sepharose column (Protein G Sepharose column to which the monoclonal antibody MK-D6 has been bound). Culture supernatants of MK-D6 hybridoma cells (American Type Culture Collection, Rockville, Md.) were employed as the source for anti-MHC class II (H-2 d ) monoclonal antibody. The column was washed with 50 ml of lysis buffer and then with 50 ml of PBS containing 0.5% octyl glucopyranoside detergent. Bound molecules were eluted from the column with 1M acetic acid in 0.2% NaCl. The MHC/peptide molecules were separated from the IgG (MK-D6 monoclonal antibody) using a Centricon 100 filter unit (Amicon Division, W.R. Grace & Co., Beverly, Mass.). The peptides were then dissociated from the class II molecules by the addition of acetic acid to 2.5M, followed by separation using a Centricon 10 filter unit. The resulting peptide preparation, present in the low molecular weight sample, was then dried using a speed vac concentrator (Savant Instrument Inc., Farmingdale, N.Y.).

The peptides were redissolved in 200 μl of 0.05% TFA and separated by reverse-phase high performance liquid chromatography (RP-HPLC) using a 2.1 mm×25 cm Vydac C-18 column at a flow rate of 0.15 ml/min employing a 1 to 30% acetonitrile gradient (60 min) followed by a 30 to 60% gradient (30 min) and then a 60 to 80% gradient (90-110 min). Non-infected P388D1 cells were similarly processed to serve as background control for endogenous MHC class II associated peptides. FIG. 2 shows a representative experiment; four distinct peaks which are present only in the material isolated from infected macrophages (panel B), and not in the material isolated from uninfected macrophages (panel A) are indicated.

Out of three independent peptide extractions, twenty five distinct HPLC peptide peaks were isolated from L. donovani -infected macrophages and were subjected to protein sequence analysis using automated Edman degradation on an Applied Biosystems 477 gas-phase protein sequencer. Protein sequence and amino acid analysis were performed by the W.M. Keck Foundation, Biotechnology Resource Laboratory, Yale University, New Haven, Conn. In practically all determinations, no assignment could be made for the first position. Also, in most cases the definition of the amino acid residues of the 10-15 positions was based on the quantitative dominance of one residue over others. Using this approach, the sequences obtained for several peptides showed the presence of 3-6 different residues in many of the 10-15 sequence cycles analyzed for each determination, reflecting a mixture of peptides. In addition, sequences could not be obtained for some peaks because the peptides were blocked. Notwithstanding, three peptides sequences were determined. Amino-acid sequences were searched for identity with proteins in the GenBank database using the GENPETP, PIR and SWISSPROT programs. The sequence data base analysis revealed that one of the peptides was highly homologous to glyceraldehyde-3-phosphate dehydrogenase of various species. Another peptide had homology with elongation factor of several species, including Leishmania. The third sequence was not clearly related to any known proteins, and is shown below:

XQXPQ(L/K)VFDEXX (SEQ ID NO: 11).

B. Cloning and Sequencing of the Ldp23 Gene

In order to retrieve the L. donovani protein that was processed into a peptide associated with the MHC class II molecules of infected macrophages, the peptide sequence of uncertain origin was chosen to guide the strategy for cloning the corresponding parasite gene. A DNA fragment was initially amplified from L. donovani promastigote cDNA by PCR. The sense primer was a peptide derived oligonucleotide (5′> GGAATTCC CCInCAGCTInGTInTTCGAC<3′) (SEQ ID NO:12) containing an EcoRI restriction endonuclease site (underlined). The bases were selected following the preferential codon usage of L. donovani , as described in Langford et al., Exp. Parasitol . 74:360 (1992). Inosine was used for the residues of positions 4, 6 and 7 because of the low codon usage assurance for the corresponding amino acids. In addition, the carboxyl-terminal L-glutamic acid was not included for the design of the primer. The antisense primer was a poly-thymidine oligonucleotide (oligo dT, downstream primer) containing a XhoI restriction endonuclease site.

The gene fragment was amplified from a L. donovani promastigote cDNA preparation using the following reaction conditions: one cycle of 3 min at 94° C. immediately followed by 35 cycles of 1 min at 94° C., 1 min at 45° C. and 1 min at 72° C. The L. donovani cDNA was prepared from 5×10 7 washed promastigote forms harvested at the log growth phase (3 days culture). The cDNA was obtained using an Invitrogen cDNA cycle™ kit (Invitrogen Co., San Diego, Calif.). Oligonucleotide primers were synthesized by the DNA Synthesis Laboratory, Department of Pathology, Yale University School of Medicine.

The PCR products were analyzed by gel electrophoresis. Only one band of approximately 300 bp was obtained. This fragment was cloned and its sequence confirmed the sequence of the peptide-based primer including the glutamic acid codon, deliberately not included in the primer sequence.

The PCR amplified gene fragment was ligated into the pCR™ vector using the TA cloning system (Invitrogen Co., San Diego, Calif.). Transformants were selected in LB medium containing 100 μg/ml ampicillin and the plasmid DNA was isolated using the Wizard™ Minipreps DNA purification kit (Promega Co., Madison, Wis.). Insert DNA was released with the restriction enzymes EcoRI and XhoI (New England Biolabs, Beverly, Mass.), purified from an agarose gel electrophoresis and labeled with 32 P using a random priming method (Megaprime Labeling Kit, Amersham Life Science, Buckinghamshire, England).

This DNA fragment was used as probe to screen a L. donovani promastigote cDNA library as described in Skeiky et al., Infect. Immun . 62:1643 (1994). An approximately 650 bp cDNA (Ldp23) was excised from the phagemid by in vivo excision using the Stratagene protocol. DNA sequencing was performed using the Sequenase version 2 system (DNA sequencing kit) in the presence or absence of 7-deaza-GTP (United States Biochemical, Cleveland, Ohio). The sequence is provided as SEQ ID NO:3, and shows complete homology with the original 300 bp PCR fragment. A 525 bp open reading frame containing an ATG codon that follows the last 4 bases of the spliced leader sequence and 3 stop codons adjacent to the poly A tail was identified. This frame also codes the carboxyl terminal sequence (KVFDE) (SEQ ID NO:13) of the purified MHC class II associated peptide. The sequence analysis of the deduced protein sequence revealed one potential glycosylation site (Asn-Cys-Ser) at positions 68-70.

Sequence analysis was performed using the University of Wisconsin Genetics Computer Group Programs and the GenBank and EMBL data bases of protein and DNA sequences. The search for homology of the Ldp23 gene with known sequences revealed no significant homology.

C. Bacterial Expression and Purification of Recombinant Protein

The recombinant L. donovani peptide donor protein was produced in E. coli transformed with the pGEX 2T expression vector in which the Ldp23 gene was subcloned in frame. PCR was used to subclone the cloned gene in frame into the expression vector pGEX 2T. Primers containing the appropriate restriction site enzymes, initiation and termination codons were: 5′> GGATCC ATGGTCAAGTCCCACTACATCTGC<3′ (SEQ ID NO: 14) for the upstream primer and 5′> GAATTC AGACCGGATAGAAATAAGCCAATGAAA<3′ (SEQ ID NO: 15) for the downstream primer (restriction sites of BamHI and EcoRI are underlined respectively). PCR conditions were as indicated above for the amplification of the original peptide related DNA fragment. The template used was pBluescript plasmid containing the cloned gene from the cDNA library.

Overexpression of the recombinant fusion protein was accomplished by growing the transformed E. coli (DH5α) and inducing the tac promoter with 1 mM isopropyl-β-thiogalactopyranoside (IPTG) (Stratagene, La Jolla, Calif.). Cells were collected, centrifuged, and analyzed for the presence of the fusion protein by SDS-PAGE. A glutathione-S-transferase fusion protein of 43-44 kD was produced, indicating a leishmanial protein of approximately 18 kD, as glutathione-S-transferase (GST) has a MW of 26 kD. However, the fusion protein was very insoluble and therefore could not be purified by affinity chromatography using a glutathione column. The use of low concentrations of detergents like SDS, sarcosyl, deoxycolate, and octyl-glucopyranoside during the extraction steps was efficient to solubilize the protein but unfortunately prevented its binding to the glutathione column. Other maneuvers, such as the growth of the E. coli and incubation and induction of the tac promoter with IPTG at 33° C., did not improve the protein solubility. However, the purification was achieved by preparative SDS-PAGE. The band was visualized with 0.1 M KCl, cut and electroeluted from the gel followed by extensive dialysis against PBS and concentration on Centricon 10 filters.

Approximately 500 μg of purified protein was obtained. The purified protein is shown in FIG. 3 . In panel A, E. coli (DH5α) transformed with the expression vector pGEX 2T containing the Ldp23 gene was grown in LB medium and the tac promoter was induced with IPTG for 3 hours. The cells were pelleted, resuspended in loading buffer and submitted to SDS-PAGE (10%) under reducing condition. The gel was stained with Coomassie blue. Lane 1 shows the uninduced E. coli and land 2 shows the induced E. coli . The arrow indicates the recombinant protein. Panel B shows the protein prepared as in panel A and submitted to a preparative SDS-PAGE. The band corresponding to the overexpressed recombinant fusion protein was identified by KCl, cut out, electroeluted from the gel strip, dialyzed against PBS and submitted to analytical SDS-PAGE (12%). Numbers on the left side indicate the molecular weights of the markers. Attempts to further purify the leishmanial protein by cleaving it out from the fusion protein GST with thrombin were unsuccessful.

D. Expression of Ldp23

To ascertain that the Ldp23 peptide is expressed in Leishmania organisms, a Northern blot analysis was performed using RNA prepared from different promastigote growth phases (logarithmic and stationary) and from the amastigote form of these parasites.

The RNA was prepared from 2×10 7 parasite cells using the Micro RNA isolation kit (Stratagene, La Jolla, Calif.) according to the company's recommended instructions. RNA was prepared from L. donovani promastigotes (logarithmic growth phase); from L. major promastigotes (logarithmic and stationary growth phases); from L. amazonensis , both promastigotes (logarithmic and stationary growth phases) and amastigotes purified from CBA/J infected mice; and from L. pifanoi , both promastigotes (logarithmic and stationary growth phases) and amastigotes (from axenic culture medium). L. donovani (1S strain), L. amazonensis (MHOM/BR/77/LTB0016), L. major (MHOM/IR/79/LRC-L251) and L. pifanoi (MHOM/VE/60/Ltrod) promastigotes were grown and maintained at 26° C. in Schneider's medium containing 20% FCS and 50 μg/ml gentamicin. The amastigote forms of L. amazonensis were obtained by differential centrifugation of a “pus-like” foot pad lesion of a CBA/J mouse infected for 6 months with this parasite. L. pifanoi amastigotes were obtained from axenic culture as previously reported by Pan et al., J. Euk. Microbiol . 40:213 (1993).

The hybridization was carried out at 45° C. in the presence of 50% formamide, 5×Denhardt's solution, 0.1% SDS, 100 μg/ml single stranded salmon sperm DNA and 5×SSPE using 0.45 μm Nytran membrane filters (Schleicher & Schuell, Keene, NH). The probe was the 32 P labeled Ldp23 gene.

FIG. 4 shows that one single RNA band of 680 bp was observed for all growth phases and forms of all tested Leishmania. Within FIG. 4 , the numbers 1, 2 and 3 refer to RNA obtained from promastigotes at the logarithmic growth phase, promastigotes at the stationary growth phase and amastigote forms, respectively, and the numbers on the left side indicate the molecular weights of the markers in base pairs. This result is consistent with the corresponding gene size (525 bp) and with the molecular weight of the expressed protein and points to the ubiquitous distribution and expression of this gene within the genus Leishmania.

E. Induction of Anti- L. donovani Antibody Response in Mice and Rabbits by Purified Recombinant Protein

In order to evaluate the immunogenicity of the recombinant leishmanial protein, and to investigate its expression in the parasites, mice and rabbits were immunized with the GST-fusion protein in CFA. BALB/c mice were immunized in the rear foot pad with 5-10 μg of protein emulsified in CFA. Protein concentration was determined using the Bio-Rad Protein Assay reagent (Bio-Rad Laboratories, Richmond, Calif.). The mice were boosted 7 days later with 5-10 μg of protein emulsified in incomplete Freünd's adjuvant (IFA) inoculated into the peritoneal cavity. The mice were bled 7 days after the second immunization. New Zealand white rabbits (Millbrook Farm, Amherst, Mass.) were immunized according to the following protocol: one intramuscular (IM) injection of 25-30 μg of purified recombinant protein emulsified in CFA into each thigh on day one; one IM injection of 25-30 μg of purified protein emulsified in IFA into each shoulder on day 7; on day 15, 25-30 μg of the purified protein in PBS was injected into the subcutaneous tissue. The rabbit was bled 7 days after the last immunization.

Sera were prepared and the anti-Leishmania antibody response was measured by Western blot analysis and by FACScan. In both cases L. donovani promastigotes were used as antigen. Approximately 2×10 6 L. donovani promastigotes were grown in Schneider's medium for 3 days (log phase), were washed with PBS, lysed with SDS-PAGE loading buffer and submitted to electrophoresis under reducing conditions using a 15% polyacrylamide gel. The proteins were transferred onto 0.45μ Immobilon-P transfer membrane (Millipore Co., Bedford, Mass.) using a wet-type electroblotter (Mini Trans-Blot Electrophoretic Transfer Cell, Bio Rad Life Science Division, Richmond, Calif.) for 2 hours at 50 V. The membranes were blocked overnight at room temperature with PBS containing 3% normal goat serum (NGS), 0.2% Tween-20 and 0.05% sodium azide, followed by 3 washes with PBS. The blots were then incubated for 3-4 hours at 4° C. with a 1/200 dilution of pre-immune rabbit serum (lane A, FIG. 5 ) or with the same dilution of anti-fusion protein rabbit antiserum (lane B, FIG. 5 ). The sera was previously absorbed 2× with non-viable desiccated Mycobacterium tuberculosis H-37 RA (Difco Laboratories, Detroit, Mich.) and were diluted in PBS containing 1% NGS and 5% powdered non-fat bovine milk (Carnation, Nestl{dot over (e)} Food Company, Glendale, Calif.). The membranes were then washed with PBS, incubated for 1 hour at room temperature with goat anti-rabbit IgG antibody conjugated with alkaline phosphatase (Promega, Madison, Wis.), washed once with PBS and 2× with veronal buffer pH 9.4. The reaction was visualized using the substrate mixture 5-bromo-4-chloro-3-indoyl-phosphate and nitroblue tetrazoli um (Kirkegaard & Perry Laboratories Inc., Gaithersburg, Md.) according to the manufacturer's instructions.

FIG. 5 shows that the rabbit anti-recombinant protein antiserum detects a single protein of 23 kDa (Ldp23) in the Leishmania crude extract antigen preparation. No bands were observed when an anti-GST antiserum was used (not shown). Moreover, the FACScan analysis ( FIG. 6 ) shows that the antibody induced by the recombinant Ldp23 reacts with intact live L. donovani promastigotes, thus pointing to a cell surface expression of this molecule on these organisms. The dotted line in FIG. 6 shows the indirect immunofluorescence performed using pre-immune mouse serum and the solid line in FIG. 6 shows the result obtained with mouse anti-GST-Ldp23 antiserum. Both sera were diluted at 1/100. Parasites were washed with staining buffer and incubated with FITC conjugated goat anti-mouse immunoglobulin antibody. Fluorescence intensity was analyzed by FACScan.

F. Recognition of Recombinant Ldp23 by Leishmania-specific Lymph Node T-cells

To test the responsiveness of T-cells to the Ldp23 protein, two sets of experiments were performed. In the first experiment, lymph node T-cells (10 5 /well) from BALB/c mice immunized with L. donovani promastigotes (as described above) were stimulated to proliferate with 2×10 5 Mitomycin C-treated normal mononuclear spleen cells (APC) and pulsed with the purified recombinant fusion protein. Proliferation of T-cells was measured at 72 hours of culture. Values are expressed in FIG. 7 as cpm and represent the mean of [ 3 H]TdR incorporation of triplicate cultures. Background cpm of cells (T cells+APC) cultured in the presence of medium alone was 1291. FIG. 7 shows that Leishmania specific T-cells proliferate well and in a dose response manner to recombinant Ldp23. No response was observed when purified GST was added instead of the recombinant fusion protein nor when lymph node T-cells from mice immunized with CFA alone were stimulated to proliferate in the presence of the Leishmanial fusion protein (not shown).

The recognition of the recombinant Ldp23 protein by Leishmania-specific T-cells was also tested using two murine models of leishmaniasis, the L. major highly susceptible BALB/c mice and the L. amazonensis susceptible CBA/J mice as described in Champsi and McMahon-Pratt, Infect. Immun . 56:3272 (1988). These models were selected to investigate the cytokine pattern induced by Ldp23. In the mouse model of leishmaniasis, resistance is associated with Th1 cytokines while susceptibility is linked to Th2 responses.

Lymph node cells were obtained 3 weeks after the initiation of infection of BALB/c mice with L. major and the ability of these cells to recognize the recombinant Ldp23 was measured by proliferation and by the production of the cytokines IFN-γ and IL-4. 2×10 6 cells obtained from the draining popliteal lymph node of infected mice were cultured for 72 hours in the presence of recombinant Ldp23 or Leishmania lysate. The levels of IFN-γ and IL-4 in culture supernatants were measured by ELISA as previously described (Chatelain et al., J. Immunol . 148:1172 (1992), Curry et al., J. Immunol. Meth . 104:137 (1987), and Mossman and Fong, J. Immunol. Meth . 116:151 (1989)) using specific anti IFN-γ and IL-4 monoclonal antibodies (PharMingen, San Diego, Calif.).

Ldp23 did stimulate these cells to proliferate (not shown) and induced a typical Th1 type of cytokine response as indicated by the production of high levels of IFN-γ (panel A of FIG. 8 ) and no IL-4 (panel B of FIG. 8 ). Stimulation of these cells with a Leishmania crude lysate yielded a mixed Th cytokine profile. Exactly the same pattern of cytokine production was obtained from the CBA/J mice infected with L. amazonensis (not shown). These results clearly indicate that Ldp23 is a powerful and selective activator of the Th1 cytokines by mouse cells.

Example 3

Preparation of Hsp83

This Example illustrates the preparation of a Leishmania antigen Hsp83, having the sequence provided in SEQ ID NO:6.

A genomic expression library was constructed with sheared DNA from L. braziliensis (MHOM/BR/75/M2903) in bacteriophage λZAP II (Stratagene, La Jolla, Calif.). The expression library was screened with Escherichia coli preadsorbed serum from an L. braziliensis -infected individual with ML. Immunoreactive plaques were purified, and the pBSK(−) phagemid was excised by protocols suggested by the manufacturer. Nested deletions were performed with exonuclease III to generate overlapping deletions for single-stranded template preparations and sequencing. Single-stranded templates were isolated following infection with VCSM13 helper phage as recommended by the manufacturer (Stratagene, La Jolla, Calif.) and sequenced by the dideoxy chain terminator method or by the Taq dye terminator system using the Applied Biosystems automated sequencer model 373A.

Recombinant antigens produced by these clones were purified from 500 ml of isopropyl-β-D-thiogalactopyranoside (IPTG)-induced cultures as described in Skeiky et al., J. Exp. Med . 176:201-211 (1992). These antigens were then assayed for the ability to stimulate PBMC from Leishmania-infected individuals to proliferate and secrete cytokine. Peripheral blood was obtained from individuals living in an area (Corte de Pedra, Bahia, Brazil) where L. braziliensis is endemic and where epidemiological, clinical, and immunological studies have been performed for over a decade, and PBMC were isolated from whole blood by density centrifugation through Ficoll (Winthrop Laboratories, New York, N.Y.). For in vitro proliferation assays, 2×10 5 to 4×10 5 cells per well were cultured in complete medium (RPMI 1640 supplemented with gentamicin, 2-mercaptoethanol, L-glutamine, and 10% screened pooled A+ human serum; Trimar, Hollywood, Calif.) in 96-well flat-bottom plates with or without 10 μg of the indicated antigens per ml or 5 μg of phytohemagglutinin per ml (Sigma Immunochemicals, St. Louis, Mo.) for 5 days. The cells were then pulsed with 1 μCi of [ 3 H]thymidine for the final 18 h of culture. For determination of cytokine production 0.5 to 1 ml of PBMC was cultured at 1×10 6 to 2×10 6 cells per ml with or without the Leishmania antigens for 48 and 72 h.

The supernatants and cells were harvested and analyzed for secreted cytokine or cytokine mRNAs. Aliquots of the supernatants were assayed for gamma interferon (IFN-γ), tumor necrosis factor alpha (TNF-α), interleukin-4 (IL-4), and IL-10 as described in Skeiky et al., J. Exp. Med . 181:1527-1537 (1995). For cytokine mRNA PCR analysis, total RNA was isolated from PBMC and cDNA was synthesized by using poly(dT) (Pharmacia, Piscataway, N.J.) and avian mycloblastosis virus reverse transcriptase. Following normalization to β-actin, diluted cDNA was amplified by PCR using Taq polymerase (Perkin-Elmer Cetus, Foster City, Calif.) with 0.2 μM concentrations of the respective 5′ and 3′ external primers in a reaction volume of 50 μl. The nucleotide sequences of the primary pairs and the PCR conditions used were as described in Skeiky et al., J. Exp. Med . 181:1527-1537 (1995). We verified that our PCR conditions were within the semiquantitative range by initially performing serial dilutions of the cDNAs and varying the number of cycles used for PCR. Plasmids containing the human sequences for IL-2, IFN-γ, IL-4, IL-10, and β-actin were digested, and the DNA inserts were purified after separation on 1% agarose gels. Radiolabeled 32 P probes were prepared by the random priming method. PCR products were analyzed by electrophoresis on 1.5% agarose gels, transferred to nylon membranes, and probed with the appropriate 32 P-labeled DNA insert.

A recombinant clone was identified in the above assays which, following sequence comparison of its predicted amino acid sequence with sequences of other proteins, was identified as a Leishmania braziliensis homolog of the eukaryotic 83 kD heat shock protein (Lbhsp83). The sequence of the clone is provided in SEQ ID NO:5 and the deduced protein sequence is provided in SEQ ID NO:6. On the basis of the homology, this clone, designated Lbhsp83a, appears to lack the first 47 residues of the full length 703 amino acid residues. Lbhsp83 has an overall homology of 94% (91% identity and 3% conservative substitution), 91% (84% identity and 7% conservative substitution) and 77% (61% identity and 16% conservative substitution) with L. amazonensis hsp83 , T. cruzi hsp83 and human hsp89, respectively. A second clone (designated Lbhsp83b), which contained the 43 kD C-terminal portion of hsp83 (residues 331 to 703) was also isolated. FIG. 19 presents a comparison of the Lbhsp83 sequence with L. amazonensis hsp83(Lahsp83), T. cruzi hsp83 (Tchsp83) and human hsp89 (Huhsp89).

The results of proliferation assays using Lbhsp83a are shown in Table 1. Cells from all mucosal leishmaniasis (ML) patients proliferated strongly in response to Lbhsp83a, with stimulation indices (SIs) ranging from 19 to 558 (as compared to 20 to 1,634 for parasite lysate). Proliferation of PBMC from cutaneous leishmaniasis (CL) patients was variable and except for levels in two patients (IV and VII), levels were significantly lower than those of ML patients. By comparison, the proliferative responses of individuals with self-healing CL to Lbhsp83a were similar to those of individuals with ML. However, the responses of all six self-healing individuals to Lbhsp83 were consistently higher than those to Lbhsp83b. This suggests that PBMC from self-healing CL patients preferentially recognize one or more T-cell epitopes located within the amino portion of Lbhsp83.

TABLE 1
In vitro Proliferation of PMBC from L. braziliensis -infected Individuals
in Response to Lbhsp83
	Mean [ 3 H]thymidine
	incorporation [10 3 cpm (SD)], SI with:
Group and
Patient	Lysate	Lbhsp83a	Lbhsp83b
ML
I	41.3, (1.3), 294	32.5, (6.6), 221	46.7, (1.4), 318
II	44.2, (0.5), 104	20, (3.7), 47	36.7, (0.76), 86
III	27.4, (1.5), 150	8.1, (1.7), 44	9.9, (0.32), 54
IV	52.7, (3.3), 138	54.1, (6.2), 142	32.0, (1.3), 84
V	140.6, (7.6), 308	151.8, (57), 333	150.4, (7.9), 331
VI	15.8, (1.8), 20	21.3, (4.4), 28	14.4, (1.3), 19
VII	300.1, (9.4), 1634	102.1, (7.6), 558	41.7, (4.9), 228
CL
I	0.26, (0.0), 1.5	0.57, (0.3), 3.3	0.43, (0.17), 3.3
II	55.63, (8.6), 218	0.42, (0.0), 1.6	0.8, (0.14), 3.2
III	0.39, (0.5), 4.0	3.4, (0.5), 9	2.6, (0.9), 6.6
IV	19.14, (1.3), 87	7.17, (0.6), 32	5.9, (0.9), 27
V	0.32, (0.2), 3.0	1.47, (0.5), 14	0.3, (0.1), 3.0
VI	0.77, (0.1), 4.7	1.44, (0.2), 9	1.3, (0.6), 8.0
VII	4.01, (1.0), 2.0	60.3, (8.5), 15	66.7, (3.9), 16.6
Self-healing
CL
I	19.7, (4.4), 94	61.3, (4.6), 293	5.0, (2.0), 24
II	0.6, (0.1), 6.5	7.0, (2.0), 79	1.2, (0.8), 13
III	59.6, (7.1), 519	49.4, (3.1), 429	21.4, (3.7), 186
IV	0.2, (0.1), 1.6	13.1, (1.7), 108	0.6, (0.1), 5
V	27.1, (2.0), 225	6.3, (2.6), 52	3.0, (1.5), 25
VI	130.3, (14), 340	28.2, (2.9), 74	7.7, (3.8), 20
Control
(uninfected)
I	0.19, (0.0), 1.4	0.18, (0.0), 1.3	0.40, (0.16), 2.8
II	0.31, (0.1), 1.7	0.19, (0.0), 1.0	0.27, (0.0), 1.5
III	0.44, (0.2), 4.1	0.48, (0.1), 5.0	0.51, (0.2), 5.2
IV	0.4, (0.1), 3.2	0.52, (0.2), 5.1	0.50, (0.1), 5.0

A more detailed analysis of cytokine patterns of PBMC from ML patients was performed by reverse transcriptase PCR. Cytokine mRNAs were evaluated in cells prior to culturing ( FIG. 9 , lanes O) or following culturing in the absence (lanes −) or presence of the indicated antigen for 48 and 72 h. FIG. 4A shows the results for five of the six ML patients whose PBMC were analyzed. In about half of the ML patients, noncultured (resting) PBMC had detectable levels of mRNA for IFN-γ, IL-2, and IL-4 but not IL-10. CL patient PBMC, however, had IL-10 mRNA in the resting state in addition to mRNAs for the other cytokines tested (FIG. 4 B). Following in vitro culture without antigen, the levels of mRNA for IFN-γ, IL-2, and IL-4 in resting cells from ML patients decreased to background levels while IL-10 mRNA levels increased. In contrast, PBMC of most CL patients had stable or increased IL-10 mRNA, while the mRNAs for IL-2, IFN-γ, and IL-4 were reduced to barely detectable levels in the absence of antigen stimulation.

In PBMC of three ML patients, stimulation with lysate resulted in increased expression of mRNA for IFN-γ, IL-2, and IL-4 but not IL-10. By comparison, both Lbhsp83 polypeptides elicited the production of mRNA for IFN-γ and IL-2 from all ML patient PBMC tested. In contrast, profiles of mRNA for IL-10 and IL-4 differed for the two hsp83 polypeptides. Lbhsp83a stimulated the production of IL-10 but not IL-4 mRNA (patients I, II, III, and IV), while Lbhsp83b stimulated the production of IL-4 but not IL-10 mRNA in all six patients.

All CL patients tested responded to both Lbhsp83 polypeptides as well as to the parasite lysate by upregulating the synthesis of mRNAs for IL-2 and IFN-γ, and in two of four patients (I and IV), the level of IL-4 mRNA also increased, indicating stimulation of both Th1 and Th2 cytokines. Interestingly and as in the case of ML patient uncultured PBMC which did not have detectable levels of IL-10 mRNA, Lbhsp83a and not Lbhsp83b stimulated PBMC from one CL patient (IV) to synthesize IL-10 mRNA. However, in the other three patients (I, II, and III) with resting levels of IL-10 mRNA, both rLbhsp83 polypeptides as well as the parasite lysate downregulated the expression of IL-10 mRNA.

PBMC supernatants were also assayed for the presence of secreted IFN-γ, TNF-α, IL-4, and IL-10. Cells from all ML and self-healing CL patients (seven and six patients, respectively) and from four of seven CL patients were analyzed for secreted IFN-γ following stimulation with both rLbhsp83 polypeptides, parasite lysate and Lbhsp70, an L. braziliensis protein homologous to the eukaryotic 70 kD heat shock protein (FIG. 10 A). In general, rLbhsp83a stimulated patient PBMC to secrete higher levels of IFN-γ than did rLbhsp83b (0.2 to 36 and 0.13 to 28 ng/ml, respectively). The presence of secreted IFN-γ correlated well with the corresponding mRNA detected by PCR.

PBMC from four of five ML patients (I, II, V, and VII) had supernatant TNF-β levels (0.8 to 2.2 ng/ml) higher than those detected in cultures of PBMC from uninfected controls following stimulation with parasite lysate (FIG. 10 B). Similarly, the same PBMC were stimulated by rLbhsp83 to produce levels of TNF-α in supernatant ranging from 0.61 to 2.9 ng/ml. Compared with those of uninfected controls, PBMC from three (I, V, and VI), five (I, II, IV, V, and VI), and two (II and V) of six individuals analyzed produced higher levels of TNF-α in response to parasite lysate, rLbhsp83a, and rLbhsp83b, respectively. The levels of TNF-α produced by PBMC from CL patients in response to parasite lysate were comparable to those produced by uninfected controls. However, rLbhsp83 stimulated TNF-α production in the PBMC of two of these patients. rLbhsp83a stimulated higher levels of TNF-α production than did rLbhsp83b. In the absence of antigen stimulation, only PBMC from MLpatients (five of six) produced detectable levels of supernatant TNF-α (60 to 190 pg/ml).

In agreement with the IL-10 mRNA, IL-10 was detected by ELISA in the antigen-stimulated PMBC culture supernatants from ML and CL patients. The levels (49 to 190 pg) were significantly higher (up to 10-fold) following stimulation with rLbhsp83a compared with those after parallel stimulation of the same cells with rLbhsp83b (FIG. 11 ). Parasite lysate also stimulated PMBC from some of the patients to produce IL-10. Although rLbhsp83 stimulated PMBC from uninfected individuals to produce IL-10, with one exception, the levels were lower than those observed with patient PMBC. IL-4 was not detected in any of the supernatants analyzed. Therefore, the level of any secreted IL-4 is below the detection limit of the ELISA employed (50 pg/ml). Taken together, the results demonstrate that a predominant Th1-type cytokine profile is associated with PMBC from L. braziliensis -infected individuals following stimulation with rLbhsp83 polypeptides.

To determine the correlation between the observed T-cell responses and antibody production to Lbhsp83, we compared the antibody (immunoglobulin G) reactivities to Lbhsp83 in sera from the three patient groups (FIG. 12 ). The ELISA reactivities of ML patient sera with rLbhsp83a were comparable to those observed with parasite lysate, and in general, there was a direct correlation between ML patient anti-Lbhsp83 antibody titer and T-cell proliferation. Of 23 serum samples from ML patients analyzed, 22 were positive (˜96%) with absorbance values of 0.20 to >3.0. Eleven of the ML patient serum samples had optical density values that were >1. In general, CL patients had significantly lower anti-Lbhsp83 antibody titers $$ ( = 0.74 ;   ⁢ standard ⁢   ⁢ error ⁢   ⁢ of ⁢   ⁢ the ⁢   ⁢ mean ⁢   [ S ⁢   ⁢ E ⁢   ⁢ M ] = 0.1 )

compared to those of ML patients. Therefore, ML and CL patient anti-rhsp83 antibody titers correlated with their respective T-cell proliferative responses. Anti-rLbhsp83 antibody titers were significantly higher in patients with ML $$ ( = 1.5 ; S ⁢   ⁢ E ⁢   ⁢ M = 0.2 )

than in self-healing CL patients $$ ( = 0.35 ; S ⁢   ⁢ E ⁢   ⁢ M = 0.056 ) ,

although their T-cell proliferative responses were similar. In fact, anti-Lbhsp83 antibody titers in serum from self-healing CL patients were comparable to those from uninfected controls $$ ( = 0.24 ; S ⁢   ⁢ E ⁢   ⁢ M = 0.028 ) . ⁢  

By using 2 standard deviations greater than the mean absorbance value of uninfected control (0.484) as a criterion for positive reactivity to Lbhsp83, eight of nine of the self-healing patient serum samples tested were negative.

Example 4

Preparation of Clones Encoding Lt-210

This Example illustrates the preparation of clones encoding portions of the Leishmania antigen Lt-210, and which has the sequence provided in SEQ ID NO:8.

An expression library was constructed from L. tropica (MHOM/SA/91/WR1063C) genomic DNA. The DNA was isolated by solubilizing L. tropica promastigotes in 10 mM Tris-HCl, pH 8.3, 50 mM EDTA, 1% SDS and treating with 100 μg/ml RNaseA and 100μg/ml proteinase K. The sample was then sequentially extracted with an equal volume of phenol, phenol:chloroform (1:1), and Chloroform. DNA was precipitated by adding 0.1 volume of 3M sodium acetate (pH 5.2) and 2.5 volume 95% ethanol. The precipitate was resuspended in 10 μM Tris, 1 mM EDTA. DNA was sheared by passage through a 30-gauge needle to a size range of 2-6 kilobase, and was repaired by incubation with DNA poll in the presence of 100 μM each dATP, dCTP, dGTP, and dTTP. EcoRI adapters were ligated to the DNA fragments. After removal of unligated adapters by passage over a G-25 Sephadex™ column, the fragments were inserted in EcoRI cut Lambda ZapII (Stratagene, La Jolla, Calif.).

Approximately 43,000 pfu were plated and screened with sera isolated from viscerotropic leishmaniasis (VTL) patients. Sera from VTL patients were received from Drs. M. Grogl and A. Magill. The VTL patient group included eight individuals from whom parasites were isolated and cultured, seven of which had confirmed infection with L. tropica . Four other patients were culture negative, but were still considered to be infected based on either PCR analysis or a positive monoclonal antibody smear (Dr. Max Grogl, personal communication). Serum samples from the 11 infected patients were pooled and anti- E. coli reactivity removed by affinity chromatography (Sambrook et al., supra, p. 12.27-12.28). Lambda phage expressing reactive proteins were detected after antibody binding by protein A-horseradish peroxidase and ABTS substrate.

Three clones, Lt-1, Lt-2, and Lt-3, containing a portion of the Lt-210 gene were identified and purified. The clones ranged in size from 1.4 to 3.3 kb and encoded polypeptides of 75 kD, 70 kD, and 120 kD, respectively. These three clones contain partial sequences of the Lt-210 gene. Lt-1 and Lt-2 are overlapping clones and were chosen for further study.

The DNA sequences of Lt-1 and Lt-2 were determined. Exonuclease III digestion was used to create overlapping deletions of the clones (Heinikoff, Gene 28:351-359, 1984). Single strand template was prepared and the sequence determined with Applied Biosystems Automated Sequencer model 373A or by Sanger dideoxy sequencing. The sequence on both strands of the coding portion of Lt-1 clone was determined. The partial sequence of one strand of Lt-2 clone was determined.

SEQ ID NO:7 presents the DNA sequence of Lt-1, and SEQ ID NO:8 provides the predicted amino acid sequence of the open reading frame. The DNA sequence of the coding portion of the Lt-1 clone includes a repeated nucleotide sequence at the 5′ portion of the clone containing eight copies of a 99 bp repeat, three copies of a 60 bp repeat unit, which is part of the larger 99 bp repeat, and 800 bp of non-repeat sequence. The deduced amino acid sequence of the 99 bp repeat contains limited degeneracies. The mass of the predicted recombinant protein is 67,060 Daltons. A database search of PIR with the predicted amino acid sequence of the open reading frame yielded no significant homology to previously submitted sequences. Predicted secondary structure of the repeat portion of the clone is entirely α-helical.

Sequence analysis of Lt-2 revealed that the 3′ portion of the clone consisted of a mixture of 60 and 99 bp repeats that were identical, excepting occasional degeneracies, to the 60 and 99 bp repeats observed in Lt-1. Collectively, the sequencing data suggest that Lt-1 and Lt-2 are different portions of the same gene, Lt-2 being upstream of Lt-1, with possibly a small overlap.

Hybridization analysis confirmed that rLt-2 and rLt-1 contain overlapping sequences. Genomic DNAs of various Leishmania species were restricted with a variety of enzymes, separated by agarose gel electrophoresis, and blotted on Nytran membrane filter (Schleicher & Schuell, Keene, NH). Inserts from rLt-1 and rLt-2 were labeled with 32 P CTP by reverse transcriptase from random oligonucleotide primers and used as probes after separation from unincorporated nucleotides on a Sephadex G-50 column. Hybridizations using the rLt-1 or the rLt-2 probe are performed in 0.2M NaH 2 PO 4 /3.6 M NaCl at 65° C., whereas hybridization using the rLt-1r probe is performed in 0.2 M NaH 2 PO 4 /3.6 M NaCl/0.2 M EDTA at 60° C. overnight. Filters are washed in 0.075 M NaCl/0.0075 M sodium citrate pH 7.0 (0.15 M NaCl/0.0150 M sodium citrate for the Lt-1r probe), plus 0.5% SDS at the same temperature as hybridization.

Genomic DNA from a number of Leishmania species including L. tropica were analyzed by Southern blots as described above using the Lt-1, Lt-2, and Lt-1r inserts separately as probes. Collectively, various digests of L. tropica DNA indicate that this gene has a low copy number. A similar, overlapping pattern was observed using either the Lt-1 or Lt-2 insert as a probe, consistent with the premise that these two clones contain sequences near or overlapping one another. In addition, sequences hybridizing with these clones are present in other Leishmania species.

L. tropica isolates have limited heterogeneity. Southern analyses of digested genomic DNA from four L. tropica parasite strains isolated from VTL patients and three L. tropica parasite strains isolated from CL cases (two human, one canine) were performed. The Lt-1r insert described below was labeled and used as a probe. The seven different L. tropica isolates yielded similar intensities and restriction patterns, with only a single restriction fragment length polymorphism among the isolates. These data, along with Southern analyses with additional enzymes, indicate limited heterogeneity in this region among the L. tropica isolates.

The recombinant proteins of Lt-1 and Lt-2 were expressed and purified. The nested deletion set of Lt-1 formed for sequencing included a clone referred to as Lt-1r, which contains one and one-third repeats. This polypeptide was also expressed and purified. In vivo excision of the pBluescript SK − phagemid from Lambda Zap II was performed according to the manufacturer's protocol. Phagemid virus particles were used to infect E. coli XL-1 Blue. Production of protein was induced by the addition of IPTG. Protein was recovered by first lysing pellets of induced bacteria in buffer (LB, 50 mM Tris-HCl, pH 8.0, 100 mM NaCl, 10 mM EDTA) using a combination of lysozyme (750 μg/mL) and sonication. rLt-1, rLt-2, and rLt-1r, were recovered from the inclusion bodies after solubilization in 8M urea (rLt-1 and rLt-2) or 4M urea (rLt-1r). Proteins rLt-1 and rLt-2 were enriched and separated by precipitation with 25%-40% ammonium sulfate and rLt-1r was enriched by precipitation with 10%-25% ammonium sulfate. The proteins were further purified by preparative gel electrophoresis in 10% SDS-PAGE. Recombinant proteins were eluted from the gels and dialyzed in phosphate-buffered saline (PBS). Concentration was measured by the Pierce (Rockford, Ill.) BCA assay, and purity assessed by Coomassie blue staining after SDS-PAGE.

Example 5

Preparation of LbeIF4A

This example illustrates the molecular cloning of a DNA sequence encoding the L. braziliensis ribosomal antigen LbeIF4A.

A genomic expression library was constructed with sheared DNA from L. braziliensis (MHOM/BR/75/M2903) in bacteriophage λZAPII (Stratagene, La Jolla, Calif.). The expression library was screened with E. coli -preadsorbed patient sera from an L. braziliensis -infected individual with mucosal leishmaniasis. Plaques containing immunoreactive recombinant antigens were purified, and the pBSK(−) phagemid excised using the manufacturer's protocols. Nested deletions were performed with Exonuclease III to generate overlapping deletions for single stranded template preparations and sequencing. Single stranded templates were isolated following infection with VCSM13 helper phage as recommended by the manufacturer (Stratagene, La Jolla, Calif.) and sequenced by the dideoxy chain terminator method or by the Taq dye terminator system using the Applied Biosystems Automated Sequencer Model 373A.

The immunoreactive recombinant antigens were then analyzed in patient T-cell assays for their ability to stimulate a proliferative and cytokine production, as described in Examples 7 and 8 below.

A recombinant clone was identified in the above assays which, following sequence comparison of its predicted amino acid sequence with sequences of other proteins, was identified as a Leishmania braziliensis homolog of the eukaryotic initiation factor 4A (eIF4A). The isolated clone (pLeIF.1) lacked the first 48 amino acid residues (144 nucleotides) of the full length protein sequence. The pLeIF.1 insert was subsequently used to isolate the full length genomic sequence.

SEQ ID NO:9 shows the entire nucleotide sequence of the full-length LbeIF4A polypeptide. The open reading frame (nucleotides 115 to 1323) encodes a 403 amino acid protein with a predicted molecular weight of 45.3 kD. A comparison of the predicted protein sequence of LbeIF4A with the homologous proteins from tobacco (TeIF4A), mouse (MeIF4A), and yeast (YeIF4A) shows extensive sequence homology, with the first 20-30 amino acids being the most variable. The lengths (403, 413, 407, and 395 amino acids), molecular weights (45.3, 46.8, 46.4, and 44.7 kDa), and isoelectric points (5.9, 5.4, 5.5, and 4.9) of LbeIF4A, TeIF4A, MeIF4A and YeIF4A, respectively, are similar. LbeIF4A shows an overall homology of 75.5% (57% identity, 18.5% conservative substitution) with TeIF4A, 68.6% (50% identity, 18.6% conservative substitution) with MeIF4A and 67.2% (47.6% identity, 19.6% conservative substitution) with YeIF4A.

Example 6

Preparation of Soluble Leishmania Antigens

This Example illustrates the preparation of soluble Leishmania antigens from an L. major culture supernatant. L. major promastigotes were grown to late log phase in complex medium with serum until they reached a density of 2-3×10 7 viable organisms per mL of medium. The organisms were thoroughly washed to remove medium components and resuspended at 2-3×10 7 viable organisms per mL of defined serum-free medium consisting of equal parts RPMI 1640 and medium 199, both from Gibco BRL, Gaithersburg, Md. After 8-12 hours, the supernatant was removed, concentrated 10 fold and dialyzed against phosphate-buffered saline for 24 hours. Protein concentration was then determined and the presence of at least eight different antigens confirmed by SDS-PAGE. This mixture is referred to herein as “soluble Leishmania antigens.”

Example 7

Comparison of Interleukin-4 and Interferon-γ Production Stimulated by Leishmania Antigens

This Example illustrates the immunogenic properties of the antigens prepared according to Examples 1, 2, 5 and 6, as determined by their ability to stimulate IL-4 and IFN-γ in lymph node cultures from infected mice and in human PBMC preparations. Lymph node cultures for use in these studies were prepared from L. major -infected BALB/c mice 10 days after infection, as described in Example 2. PBMC were prepared using peripheral blood obtained from individuals with cured L. donovani infections who were immunologically responsive to Leishmania. Diagnosis of the patients was made by clinical findings associated with at least one of the following: isolation of parasite from lesions, a positive skin test with Leishmania lysate or a positive serological test. Uninfected individuals were identified based on a lack of clinical signs or symptoms, a lack of history of exposure or travel to endemic areas, and the absence of a serological or cellular response to Leishmania antigens. Peripheral blood was collected and PBMC isolated by density centrifugation through Ficoll™ (Winthrop Laboratories, New York).

Culture supernatants were assayed for the levels of secreted IL-4 and IFN-γ. IFN-γ was quantitated by a double sandwich ELISA using mouse anti-human IFN-γ mAb (Chemicon, Temucula, Calif.) and polyclonal rabbit anti-human IFN-γ serum. Human rIFN-γ (Genentech Inc., San Francisco, Calif.) was used to generate a standard curve. IL-4 was quantitated in supernatants by a double sandwich ELISA using a mouse anti-human IL-4 mAb (M1) and a polyclonal rabbit anti-human IL-4 sera (P3). Human IL-4 (Immunex Corp., Seattle, Wash.) was used to generate a standard curve ranging from 50 μg/ml to 1 ng/ml.

FIGS. 13A and 13B , illustrate the mean level of secreted IL-4 and IFN-γ, respectively, 72 hours after addition of 10 μg/mL of each of the following antigens to a lymph node culture prepared as described above: soluble Leishmania antigen (i.e., an extract prepared from ruptured promastigotes which contains membrane and internal antigens (SLA)), Ldp23, LbeIF4A (LeIF), Lbhsp83, M15 and LmeIF (the L. major homolog of LbeIF4A). The levels of secreted IL-4 and IFN-γ in medium alone (i.e., unstimulated) are also shown. While SLA elicits a predominantly Th2 response from lymph node cells of Leishmania-infected mice, Ldp23, LbeIF4A, Lbhsp83 and M15 elicited relatively little IL-4 and large amounts of IFN-γ, consistent with a Th1 response profile.

FIG. 14 shows the level of secreted IFN-γ in culture filtrate from infected and uninfected human PBMC preparations 72 hours after addition of 10 μg/mL L. major lysate, M15 or L-Rack, an immunodominant leishmanial antigen in murine leishmaniasis. Similarly, FIG. 15 illustrates the level of secreted IFN-γ in culture filtrate from infected and uninfected human PBMC preparations 72 hours after addition of 10 μg/mL L. major lysate, soluble Leishmania antigens (prepared as described in Example 6) or L-Rack. These results indicate that M15 and soluble Leishmania antigens, but not L-Rack, are potent stimulators of IFN-γ production in patient PBMC, but not in PBMC obtained from uninfected individuals. Thus, M15 and soluble Leishmania antigens elicit a dominant Th1 cytokine profile in both mice and humans infected with Leishmania.

Example 8

Comparison of Proliferation Stimulated by Leishmania Antigens

This Example illustrates the immunogenic properties of the antigens prepared according to Examples 1, 2, 5 and 6, as determined by their ability to stimulate proliferation in lymph node cultures from infected mice and in human PBMC preparations.

For in vitro proliferation assays, 2-4×10 5 cells/well were cultured in complete medium (RPMI 1640 supplemented with gentamycin, 2-ME, L-glutamine, and 10% screened pooled A+ human serum; Trimar, Hollywood, Calif.) in 96-well flat bottom plates with or without 10 μg/ml of the indicated antigens or 5 μg/ml PHA (Sigma Immunochemicals, St. Louis, Mo.) for five days. The cells were then pulsed with 1 μCi of [ 3 H] thymidine for the final 18 hours of culture.

FIG. 16 illustrates the proliferation observed after addition of 10 μg/mL or 20 μg/mL of each of the following antigens to a lymph node culture prepared as described in Example 7: SLA, Ldp23, LbeIF4A, Lbhsp83, and M15. The level of proliferation without the addition of antigen is also shown. Data are represented as mean cpm. These results demonstrate that a variety of leishmanial antigens are capable of stimulatory lymph node cell proliferation from Leishmania-infected mice.

FIGS. 17 and 18 illustrate the proliferation observed in human PBMC preparations from Leishmania-immune and uninfected individuals following the addition of 10 μg/mL M15 and soluble Leishmania antigens, respectively. These values are compared to the proliferation observed following the addition of culture medium, L. major lysate or L-Rack. The results show that M15 and soluble Leishmania antigens stimulate proliferation in Leishmania-immune PBMC, but not in PBMC obtained from uninfected individuals, demonstrating that M15 and soluble antigens (but not L-Rack) are recognized by PBMC from individuals immune to Leishmania due to a previous infection.

Example 9

Preparation of Lmsp1A and Lmsp9A

This Example illustrates the preparation of two soluble Leishmania antigens, Lmsp1a and Lmsp9a.

A. Purification of Lmsp1a and Lmsp9a From a Mixture of Soluble L. major Antigens

A high titer rabbit sera was raised against L. major soluble antigens, prepared as described above in Example 6. Specifically, a New Zealand white rabbit was immunized subcutaneously at multiple sites with 180 μg of L. major soluble antigens in a suspension containing 100 μg muramyl dipeptide and 50% incomplete Freund's adjuvant. Six weeks later the rabbit was given a subcutaneous boost of 100 μg of the same soluble antigen preparation in incomplete Freund's adjuvant. This was followed by two intravenous boosts spaced two weeks apart, each with 100 μg of the soluble antigen preparation. Sera was collected from the rabbit 11 days after the final boost.

Anti E. coli antibody reactivities were removed from the rabbit sera by pre-adsorbing on nitrocellulose filters containing lysed E. coli . Adsorbed sera were evaluated by Western blot analysis using 10 μg Leishmania promastigote lysate (lane 1) and 1 μg soluble L. major antigen mixture (lane 2). As shown in FIG. 20 , the rabbit sera was found to be reactive with seven dominant antigens of the soluble L. major antigen mixture with molecular weights ranging from 18 to >200 kDa. A four times longer exposure of the same blot revealed three additional immunoreactive species with molecular weights less than 18 kDa. The same sera reacted with approximately 10 antigens of the promastigote lysate, but with a pattern significantly different from that observed with the soluble L. major antigens (FIG. 20 ). This is suggestive of potential post-translational modification of the same antigen before (intracellular localization) and after secretion/shedding. Such modifications may include cleavage of a leader sequence and/or the addition of carbohydrate molecules to the secreted/shed antigens.

The rabbit sera described above was subsequently used to screen an L. major cDNA expression library prepared from L. major promastigote RNA using the unidirectional Lambda ZAP (uni-ZAP) kit (Stratagene) according to the manufacturer's protocol. A total of 70,000 pfu of the amplified cDNA library was screened with the rabbit sera at a 1:250 dilution. Nineteen positive clones were confirmed in the tertiary screening. The phagemid were excised and DNA from each of the 19 clones was sequenced using a Perkin Elmer/Applied Biosystems Division automated sequencer Model 373A. All 19 clones were found to represent two distinct sequences, referred to as Lmsp1a and Lmsp9a. The determined cDNA sequences for Lmsp1a and Lmsp9a are provided in SEQ ID NO: 19 and 21, respectively, with the corresponding amino acid sequences being provided in SEQ ID NO: 20 and 22, respectively.

B. Characterization of Lmsp1a and Lmsp9a

FIG. 21 shows the full-length cDNA (SEQ ID NO: 19) and predicted amino acid sequence (SEQ ID NO: 20) for the antigen Lmsp1a. The EcoRI/XhoI insert is 1019 bp long and contains the following features: a) the last 17 nt of the spliced leader sequence characteristic of all trypanosoma nuclearly encoded mRNA; b) 39 nt of 5′ untranslated sequence; c) an open reading frame of 453 nt long coding for a 151 deduced amino acid sequence with a predicted molecular mass of 16.641 kDa; and d) 471 nt of 3′ untranslated sequence terminating with a poly A tail. The predicted amino acid sequence contains three potential phosphorylation sites at amino acid residues 3, 85 and 102. In addition, Lmsp1a contains an RGD sequence at residue 104, a sequence that may play a role in parasite invasion of the macrophage. RGD sequences have been shown to mediate the binding of various adhesion proteins to their cell surface receptors. There is no obvious leader sequence (secretory signal) at the amino terminal portion suggesting that the protein might be shed or excreted. Lmsp1a appears to be one of the most abundant antigens found in the culture supernatant of live promastigote, since 17 of the 19 clones contain sequences of variable lengths identical to Lmsp1a.

Comparison of the amino acid sequence of Lmps1a with known sequences using the DNA STAR system (Version 87) revealed that Lmsp1a shares between 65% to 70% homology with the eukaryotic nucleoside diphosphate kinase protein, also referred to in the mouse and human as a tumor metastasis inhibitor gene.

Southern blot analysis of genomic DNA from L. major (Friedlander strain) digested with a panel of restriction enzymes (lanes 1 to 7) and six other Leishmania species of different geographic locations digested with PstI (lanes 8 to 13) using the full-length cDNA insert of Lmps1a, demonstrated that Lmsp1a is present in all the species characterized with a high degree of conservation (FIG. 22 ). This suggests evolutionary significance for the maintenance of Lmsp1a and the existence of homologous species among all the Leishmania species.

The remaining two cDNA clones isolated from the soluble L. major antigen mixture represent identical sequences (referred to as Lmsp9a; SEQ ID NO: 21), suggesting that the two copies resulted from amplification of the primary library. Sequencing of the Lmsp9a cDNA revealed that the clone does not contain the full length 5′ sequence since it is lacking both the spliced leader and 5′ untranslated sequences. The 3′ end of the cDNA contains a poly A stretch, as would be expected for a Leishmania mRNA. Of the predicted translated sequence (SEQ ID NO: 22), 34 of the 201 amino acids (17%) represent cysteine residues. Comparison of the predicted protein sequence with those of known proteins as described above, revealed some homology with other cysteine rich proteins such as the major surface trophozoite antigen of Giardia lamblia and furin proteases.

Example 10

Preparation and Characterization of MAPS-1A

This Example illustrates the preparation and characterization of the Leishmania antigen MAPS-1A (SEQ ID NO: 24).

A pool of sera was obtained from 5 BALB/c mice that had been given a primary immunization and two boosts with crude L. major promastigote culture supernatant as described below in Example 12. These mice were subsequently shown to be protected when challenged with a dose of live L. major promastigotes generally found to be lethal. The mouse sera thus obtained were used to screen an L. major amastigote cDNA expression library prepared as described in Example 1. Several seroreactive clones were isolated and sequenced using a Perkin Elmer/Applied Biosystems Division automated sequencer Model 373A (Foster City, Calif.).

One of these clones, referred to herein as MAPS-1A, was found to be full-length. Comparison of the cDNA and deduced amino acid sequences for MAPS-1A (SEQ ID Nos: 23 and 24, respectively) with known sequences in the gene bank using the DNA STAR system revealed no significant homologies to known Leishmania sequences, although some sequence similarity was found to a group of proteins, known as thiol-specific antioxidants, found in other organisms.

Recombinant MAPS-1A protein having an amino-terminal HIS-Tag was prepared using a high level E. coli expression system and recombinant protein was purified by affinity chromatography as described in Example 1. Southern blot analysis of genomic DNA from L. major digested with a panel of restriction enzymes, seven other Leishmania species digested with PstI, and two other infectious-disease pathogens ( T. cruzi and T. brucei ), using the full length insert of MAPS-1A, demonstrated that MAPS-1A is present in all eight Leishmania species tested (FIG. 23 ). Northern blot analysis of L. major promastigote and amastigote RNAs indicated that MAPS-1A is constitutively expressed.

Using oligonucleotide primers (SEQ ID NOs:27 and 28) based on the MAPS-1A cDNA sequence provided in SEQ ID NO: 23, the corresponding gene was isolated from L. tropica by means of PCR (using 30 cycles of the following temperature step sequence: 94° C., 1 minute; 50° C., 1 minute; 72° C., 1 minute) The determined cDNA sequence for the L. tropica MAPS-1A protein is provided in SEQ ID NO: 25, with the corresponding amino acid sequence being provided in SEQ ID NO: 26.

The ability of recombinant MAPS-1A to stimulate cell proliferation was investigated as follows. PBMC from 3 L. braziliensis -infected patients having active mucosal leishmaniasis, from 4 patients post kala-azar infection (previously infected with L. chagasi and/or L. donovani ) and from 3 uninfected-individuals were prepared as described above in Example 7. The ability of MAPS-1A to stimulate proliferation of these PBMC was determined as described in Example 8 above. As shown in FIG. 24 , significant levels of MAPS-1A specific PBMC proliferation were seen in 2 of the 7 Leishmania patients.

The ability of MAPS-1A to stimulate proliferation in mice lymph node cultures was determined as described in Example 8. FIG. 25 shows the amount of proliferation stimulated by MAPS-1A (at 25 μg/ml, 5 μg/ml and 1 μg/ml) as compared to hat stimulated by the positive control ConA and by crude L. major promastigote supernatant proteins, 20 days post-infection with L. major . Cells isolated 20 days post-infection were highly responsive to MAPS-1A, whereas cells isolated 10 days post-infection were unresponsive.

Example 11

Immunoreactivity of Soluble Leishmania Antigens With Sera From Leishmania-infected Patients

The reactivity of MAPS-1A with sera from uninfected individuals, from human leishmaniasis patients with cutaneous infection, from human patients with acute visceral leishmaniasis, and from L. major -infected BALB/c mice was determined as follows.

Assays were performed in 96-well plates coated with 200 ng antigen diluted to 50 μL in carbonate coating buffer, pH 9.6. The wells were coated overnight at 4° C. (or 2 hours at 37° C.). The plate contents were then removed and the wells were blocked for 2 hours with 200 μL of PBS/1% BSA. After the blocking step, the wells were washed five times with PBS/0.1% Tween 20™. 50 μL sera, diluted 1:100 in PBS/0.1% Tween 20™/0.1% BSA, was then added to each well and incubated for 30 minutes at room temperature. The plates were then washed again five times with PBS/0.1% Tween 20™.

The enyzme conjugate (horseradish peroxidase—Protein A, Zymed, San Francisco, Calif.) was then diluted 1:10,000 in PBS/0.1% Tween 20™/0.1% BSA, and 50 μL of the diluted conjugate was added to each well and incubated for 30 minutes at room temperature. Following incubation, the wells were washed five times with PBS/0.1% Tween 20™. 100 μL of tetramethylbenzidine peroxidase (TMB) substrate (Kirkegaard and Perry Laboratories, Gaithersburg, Md.) was added, undiluted, and incubated for about 15 minutes. The reaction was stopped with the addition of 100 μL of 1 N H 2 SO 4 to each well, and the plates were read at 450 nm.

As shown in FIG. 26 , approximately 50% of the samples from human leishmaniasis patients showed reactivities with recombinant MAPS-1A substantially above background. FIG. 27 shows the reactivity of MAPS-1A with increasing dilutions of sera from BALB/c mice previously administered either (i) saline solution; (ii) the adjuvant B. pertussis ; (iii) soluble Leishmania antigens plus B. pertussis ; (iv) live L. major promastigotes; or (v) soluble Leishmania antigens plus B. pertussis followed by live L. major promastigotes (as described below in Example 12). Considerably higher absorbances were seen with sera from mice infected with live L. major promastigotes and with mice infected with live L. major promastigotes following immunization with soluble Leishmania antigens plus B. pertussis , than with sera from the other three groups of mice, indicating that anti-MAPS-1A antibody titers increase following Leishmania infection.

Example 12

Use of Leishmania Antigens for Vaccination Against Leishmania Infection

This example illustrates the effectiveness of Leishmania antigens in conferring protection against disease in the experimental murine leishmaniasis model system. For a discussion of the murine leishmaniasis model system see, for example, Reiner et al. Annu. Rev. Immunol ., 13:151-77, 1995.

The effectiveness of (i) crude soluble Leishmania antigens, (ii) MAPS-1A, and (iii) a mixture of Ldp23, LbeIF4A and M15, as vaccines against Leishmania infection was determined as follows. BALB/c mice (5 per group) were immunized intra-peritoneally three times at biweekly intervals with either (i) 30 μg crude soluble Leishmania antigens, (ii) 20 μg MAPS-1A or (iii) a mixture containing 10 μg each of LeIF, Ldp23 and M15, together with 100 μg of the adjuvant C. parvum . Two control groups were immunized with either saline or C. parvum alone. Two weeks after the last immunization, the mice were challenged with 2×10 5 late-log phase promastigotes of L. major . Infection was monitored weekly by measurement of footpad swelling. The amount of footpad swelling seen in mice immunized with either crude soluble Leishmania antigens, a mixture of Ldp23, LbeIF4A and M15 (FIG. 28 ), or MAPS-1A ( FIG. 29 ) was significantly less than that seen in mice immunized with C. parvum alone. These results demonstrate that the Leishmania antigens of the present invention are effective in conferring protection against Leishmania infection.

Example 13

Isolation of DNA Encoding for Soluble Antigens From an L. major Genomic DNA Library

This example illustrates the isolation of seven soluble Leishmania antigen genes from an L. major genomic DNA library.

An L. major genomic DNA expression library was prepared from L. major promastigotes using the unidirectional Lambda ZAP (uni-ZAP) kit (Stratagene) according to the manufacturer's protocol. This library was screened with a high titer rabbit sera raised against L. major soluble antigens, as described above in Example 9. Seven positive clones were identified. The phagemid were excised and DNA from each of the seven clones was sequenced using a Perkin Elmer/Applied Biosystems Division automated sequencer Model 373A. The DNA sequences for these antigens, referred to as LmgSP1, LmgSP3, LmgSP5, LmgSP8, LmgSP9, LmgSP13, LmgSP19, are provided in SEQ ID NO:29-35, respectively, with the corresponding amino acid sequences being provided in SEQ ID NO: 36-42, respectively. LmgSP13 was found to contain a 39 amino acid repeat sequence shown in SEQ ID NO:43.

Subsequent studies resulted in the isolation of a full-length sequence for LmgSP9. The full-length DNA sequence is provided in SEQ ID NO: 54, with the corresponding predicted amino acid sequence being provided in SEQ ID NO: 55. The amino acid sequence was found to contain six14 amino acid repeat units (SEQ ID NO: 56), with each unit being further divided into two 7 amino acid units, provided in SEQ ID NO: 57 and 58.

Comparison of the DNA and amino acid sequences for the isolated antigens as described above, revealed no significant homologies to LmgSP1, LmgSP3, and LmgSP13. LmgSP5 was found to be related to the known Promastigote surface antigen-2 (PSA2) family. LmgSP8 was found to bear some homology to a sequence previously identified in E. coli (2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylic acid synthase). LmgSP9 and LmgSP19 were found to be homologous to a L. major hydrophilic surface protein referred to as Gene B (Flinn, H. M. et al. Mol. Biochem. Parasit . 65:259-270, 1994), and to ubiquitin, respectively. To the best of the inventors' knowledge, none of these antigens have been previously shown to elicit T or B cell responses.

In further studies, a 220 bp DNA fragment was amplified from LmgSP5 and used to screen a L. major genomic library in Lambda ZAP. Seventeen positive clones were purified after secondary screening. To select for a clone that had a likelihood of having the 5′ sequence of the LmgSP5 insert, a labeled oligonucleotide from the 5′ region was used to screen the DNA from the secondary positive clones. DNA from three clones hybridized to the 5′ oligonucleotide, with one clone hybridizing stronger than the other two. This clone (cDNA sequence provided in SEQ ID NO: 103) was found to contain an insert of 2421 bp which contained the entire open reading frame for the novel PSA-2 gene. This ORF was amplified and cloned in the expression vector pET-17b for expression of recombinant protein in E. coli . The cDNA sequence of the ORF is provided in SEQ ID NO: 102, with the corresponding amino acid sequence being provided in SEQ ID NO: 104.

The reactivity of recombinant LmgSP9 with sera from patients with visceral leishmaniasis, (from both Sudan and Brazil) and from normal donors was evaluated by ELISA as described above. The absorbance values were compared with those obtained using the known Leishmania antigen K39 described above, with L. chagasi lysate being employed as a positive control. Representative results of these assays are provided below in Table 2, wherein all the patients from Brazil and those from the Sudan designated as “VL” were inflicted with visceral leishmaniasis. The results demonstrated that LmgSP9 specifically detects antibody in most individuals with visceral leishmaniasis, regardless of geographical location. In several cases, the absorbance values of the antibody reactivity to LmgSP9 were comparable to that observed with K39. In addition, LmgSP9 detected several cases of leishmaniasis that were not detected using K39. These results indicate that LmgSP9 can be used to complement the reactivity of K39.

TABLE 2
REACTIVITY OF LMGSP9 WITH
SERA FROM LEISHMANIA PATIENTS
	Patient No.	L. chagasi lysate	K39	LmgSP9
	Sudanese samples:
	B19	1.067	0.306	0.554
	B25	1.884	3.435	0.974
	B43	1.19	3.225	0.86
	B47	2.405	2.892	0.375
	B50	0.834	0.748	0.432
	B58	0.921	0.235	0.92
	B63	1.291	0.303	0.764
	B70	0.317	0.089	3.056
	VL4	1.384	3.035	2.965
	VL11	0.382	0.144	0.142
	VL12	0.277	0.068	0.098
	VL13	0.284	0.12	0.194
	Brazilian samples:
	105	3.508	3.53	0.374
	106	2.979	3.373	2.292
	107	2.535	3.444	0.46
	109	1.661	3.415	3.319
	111	3.595	3.537	0.781
	112	2.052	3.469	0.63
	113	3.352	3.429	0.963
	114	2.316	3.437	1.058
	115	2.073	3.502	1.186
	116	3.331	3.461	0.96
	Normal Donors:
	129	0.157	0.104	0.08
	130	0.195	0.076	0.095
	131	0.254	0.134	0.086
	132	0.102	0.035	0.043

In order to obtain a higher specificity for the detection of antibodies in sera from visceral leishmaniasis patients, a homologue of LmgSP9 was isolated from L. chagasi , one of the causative agents of visceral leishmaniasis. A total of 80,000 pfu of an amplified L. chagasi genomic library were screened with the entire coding region of LmgSP9 (amplified from L. major genomic DNA). Seven hybridizing clones were purified to homogeneity. The determined DNA sequences for two of these clones, referred to as Lc Gene A and LcGene B, are provided in SEQ ID NO: 59 and 60, respectively, with the corresponding predicted amino acid sequences being provided in SEQ ID NO: 61 and 62, respectively. The open reading frame for Lc Gene A was found to show some homology to Gene A/C, previously isolated from L. major (McKlean et al., Mol. Bio. Parasitol ., 85:221-231, 1997). The open reading frame for Lc Gene B showed some homology to Gene B of L. major , discussed above, and was found to contain eleven repeats of a 14 amino acid repeat unit (SEQ ID NO: 63), with each repeat being further divided into two 7 amino acid units, provided in SEQ ID NO: 64 and 65.

The diagnostic potentials of Lc Gene A and Lc Gene B were evaluated by ELISA as described above using sera from visceral leishmaniasis patients from Sudan and Brazil, and from uninfected controls. Absorbance values were compared to those obtained using LmgSP9. Much higher absorbance values were obtained with Lc Gene A and Lc Gene B than with LmgSP9, with Lc Gene B appearing to be more effective that Lc Gene A in detecting antibodies in certain cases. These results indicate that Lc Gene B is highly effective in the diagnosis of visceral leishmaniasis.

In order to assess the diagnostic potential of the repeats found within Lc Gene B, a series of 6 peptides were synthesized (SEQ ID NO: 66-71; referred to as Pep 1-6), differing in an R or H residue. An ELISA was carried out using the full-length LcGene B protein and the six peptides. The absorbance values obtained with Pep 3 were higher than those obtained with the other 5 peptides, however they were not as high as those obtained with the full length protein.

Example 14

Isolation and Characterization of DNA Encoding for Soluble Antigens From an L. chagasi Genomic DNA Library

This example illustrates the preparation of five soluble Leishmania antigen genes from an L. chagasi genomic DNA library.

An L. chagasi genomic DNA expression library was prepared from L. chagasi promastigotes using the unidirectional Lambda ZAP (uni-ZAP) kit (Stratagene) according to the manufacturer's protocol. This library was screened with a high titer rabbit sera raised against L. major soluble antigens, as described above in Example 9. Five positive clones were identified. The phagemid were excised and DNA from each of the Five clones was sequenced using a Perkin Elmer/Applied Biosystems Division automated sequencer Model 373A. The DNA sequences for these antigens, referred to as LcgSP1, LcgSP3, LcgSP4, LcgSP8, and LcgSP10 are provided in SEQ ID NO:44-48, respectively, with the corresponding amino acid sequences being provided in SEQ ID NO:49-53, respectively.

Comparison of these sequences with known sequences in the gene bank as described above, revealed no known homologies to LcgSP3, LcgSP4, LcgSP8 and LcgSP10. LcgSP1 was found to be homologous to the known antigen HSP70.

FIGS. 30A and B illustrate the proliferative response of murine lymph nodes to recombinant LcgSP8, LcgSP10 and LcgSP3. Lymph nodes were taken BALB/c mice 17 days after infection with L. major . Infection occurred by footpad injection of 2×10 6 parasites/footpad. The cells were stimulated with recombinant antigen and proliferation was measured at 72 hours using 3 H-thymidine. FIG. 30A shows the CPM, a direct measurement of mitotic activity in response to the antigens, and FIG. 30B shows the stimulation index, which measures the proliferative response relative to the negative control.

Example 15

Isolation of DNA Encoding for L. major Antigens by CD4+ T Cell Expression Cloning

This example illustrates the isolation of T cell antigens of L. major using a direct T cell screening approach.

Leishmania-specific CD4+ T cell lines were derived from the PBMC of an individual who tested positive in a leishmania skin test but had no clinical history of disease. These T cell lines were used to screen a L. major amastigote cDNA expression library prepared as described in Example 1. Immunoreactive clones were isolated and sequenced as described above. The determined cDNA sequences for the 8 isolated clones referred to as 1G6-34, 1E6-44, 4A5-63, 1B11-39, 2A10-37, 4G2-83, 4H6-41, 8G3-100 are provided in SEQ ID NO: 72-79, respectively, with the corresponding predicted amino acid sequences being provided in SEQ ID NO: 80-87, respectively. The cDNA sequences provided for 1E6-44, 2A10-37, 4G2-83, 4H6-41 and 8G3-100 are believe to represent partial clones. All of these clones were shown to stimulate T cell proliferation.

Comparison of these sequences with those in the gene bank as described above revealed no known homologies to the antigen 4A5-63. 1G6-34 was found to have some homology to histone H2B previously identified in L. enrietti . Antigens 1E6-44, 1B11-39 and 8G3-100 showed some homology to sequences previously identified in other eukaryotes, in particular Saccharomyces cerevisae . 2A10-37 and 4H6-41 were found to be homologous to the two previously identified proteins alpha tubulin from L. donovani and beta tubulin from L. major , respectively, and 4G2-83 was found to be homologous to elongation initiation factor 2 previously identified in T. cruzi.

Subsequent full-length cloning studies, using standard techniques, led to the isolation of an extended cDNA sequence for 1E6-44, provided in SEQ ID NO: 105. The corresponding amino acid sequence is provided in SEQ ID NO: 106. An extended cDNA sequence for 2A10-37 is provided in SEQ ID NO: 107. This sequence was found to contain a complete open reading frame which encodes the amino acid sequence of SEQ ID NO: 108. An extended cDNA sequence for 4G2-83 is provided in SEQ ID NO: 109. This sequence contains a complete open reading frame which encodes the amino acid sequence of SEQ ID NO: 110. An extended cDNA sequence for 8G3-100 is provided in SEQ ID NO: 111, with the corresponding amino acid sequence being provided in SEQ ID NO: 112.

All eight of the antigens described above (1G6-34, 1E6-44, 4A5-63, 1B11-39, 2A10-37, 4G2-83, 4H6-41, 8G3-100) were expressed in E. coli as recombinant fusion proteins containing N-terminal histidine tags and were purified to homogeneity using nickel affinity chromatography. All 8 purified recombinant proteins elicited strong proliferative responses from the CD4+ T cell lines employed in the library screening. T cell reactivity to 1G6-34, 4H6-41 and 8G3-100 was also observed in T cells generated against both Leishmania promastigote culture filtrate and amastigote culture filtrate, indicating that these antigens are expressed in both the promastigote and amastigote life stages at levels that are sufficient to evoke strong cellular immunes response.

The ability of the 8 antigens to stimulate proliferation and IFN-γ production in PBMC from patients with active cutaneous leishmaniasis (CL) and from normal donors was examined as described above. In addition to the 8 antigens, leishmanial promastigote lysate (LPr) and purified protein derivative from M. tuberculosis (PPD) were also tested. The number of patients and/or donors responding to each antigen is shown in Table 3 below. All CL patients responded to at least one of the 8 antigens. Most notably, the antigens 1G6-34 and 4H6-41 elicited cell proliferation in 6/7 and 7/7 CL patients, respectively, and IFN-γ production in 6/7 and 5/7 CL patients, respectively. In addition 1G6-34 was not recognized by PBMC from uninfected control donors.

TABLE 3
CELL PROLIFERATION AND IFN-γ PRODUCTION
IN PBMC FROM PATIENTS WITH CUTANEOUS
LEISHMANIASIS
	CL Patients	Normal donors
	IFN-γ	Cell	IFN-γ	Cell
Antigen	production	Proliferation	production	Proliferation
LPr	7/7	6/7	3/8	5/8
1G6-34	6/7	5/7	0/8	0/8
1E6-44	0/7	4/7	5/8	2/8
4A5-63	1/7	1/7	0/8	0/8
1B11-39	5/7	3/7	1/8	0/8
2A10-37	1/7	3/7	1/8	0/8
4H6-41	7/7	5/7	3/8	1/8
8G3-100	0/7	2/7	5/8	2/8
PPD	7/7	7/7	7/8	7/8

Example 16

Synthesis of Polypeptides

Polypeptides may be synthesized on a Perkin Elmer/Applied Biosystems Division 430A peptide synthesizer using FMOC chemistry with HPTU (O-Benzotriazole-N,N,N′,N′-tetramethyluronium hexafluorophosphate) activation. A Gly-Cys-Gly sequence may be attached to the amino terminus of the peptide to provide a method of conjugation, binding to an immobilized surface, or labeling of the peptide. Cleavage of the peptides from the solid support may be carried out using the following cleavage mixture: trifluoroacetic acid:ethanedithiol:thioanisole:water:phenol (40:1:2:2:3). After cleaving for 2 hours, the peptides may be precipitated in cold methyl-t-butyl-ether. The peptide pellets may then be dissolved in water containing 0.1% trifluoroacetic acid (TFA) and lyophilized prior to purification by C18 reverse phase HPLC. A gradient of 0%-60% acetonitrile (containing 0.1% TFA) in water (containing 0.1% TFA) may be used to elute the peptides. Following lyophilization of the pure fractions, the peptides may be characterized using electrospray or other types of mass spectrometry and by amino acid analysis.

Example 17

Use of Leishmania Antigens Plus Adjuvant for Vaccination Against Leishmania Infection

This example illustrates the effectiveness of recombinant Leishmania antigens, M15 and MAPS, plus an adjuvant, IL-12, in conferring protection against disease in the experimental murine leishmaniasis model system. For discussion of the murine leishmaniasis model system see, for example, Reiner et al., Annu. Rev. Immunol ., 13:151-77, 1995. The effectiveness of M15 and MAPS in combination with IL-12, as vaccine against Leishmania infection was determined as follows: BALB/c mice (5 per group) were immunized subcutaneously in the left footpad, twice (3 weeks apart) with the 10 μg of the individual antigens mixed with 1 μg of IL-12. As controls, three separate groups of mice were immunized with soluble leishmania lysate antigens (SLA) plus IL-12, with IL-12 alone or with PBS. Three weeks after the last immunization the mice were infected in the right footpad with 2×10 5 promastigote forms of L. major (stationary phase). Footpad swelling was then measured weekly. Results are expressed in FIG. 31 and clearly indicate that the mice immunized with either M15 or MAPS and IL-12 were greatly protected against the infection; whereas mice immunized with IL-12 alone did not show protection from infection. The protection induced by these antigens was as efficient or better than that induced by SLA+IL-12, a regimen known to induce good protection against leishmaniasis in this animal model (Afonso, L. C. C., T. M. Scharton, L. Q. Vieira, M. Wysocka, G. Trinchieri, and P. Scott. 1994. The adjuvant effect of interleukin-12 in a vaccine against Leishmania major. Science 263:235-237). The same pattern of protection described above, was obtained i.e., M15, MAPS, and SLA, induced protection against L. major infection when C. parvum instead of IL-12 was used as adjuvant (Example 12). These results demonstrate that both M15 and MAPS recombinant antigens induce excellent protection against L. major infection in the BALB/c model of human leishmaniasis. In addition, both antigens induced protection when tested in two different adjuvant formulations, (e.g., IL-12 and C. parvim .) This finding is of high significance because it demonstrates that immunity to leishmaniasis can be induced by the specific antigens delivered in adjuvants that are suitable for human use.

Example 18

Use of Leishmania DNA for Vaccination Against Leishmania Infection

This example illustrates the effectiveness of Leishmania DNA in conferring protection against disease in the experimental murine leishmaniasis model system. For discussion of the murine leishmaniasis model system see, for example, Reiner et al., Annu. Rev. Immunol ., 13:151-77, 1995. The protection properties of the recombinant antigens was tested by immunizing mice with naked DNA containing the corresponding M15 and MAPS genes. The DNA construct used was the pcDNA3.1 vector (Invitrogen) containing a CMV promotor. BALB/c mice (5 per group) were injected in the left footpad three times (3 weeks apart) with 100 μg of the indicated naked DNA preparations. Mice were bled before and after the immunizations to monitor the development of specific immune response. The antibody response was evaluated by ELISA. Specific anti-M15 and anti-MAPS IgG2a antibodies were detected after the second immunization in the sera of the mice immunized with the respective naked DNA. The presence of specific antibodies indicates that the DNA immunization resulted in the production of specific protein antigen. Three weeks after the last immunization, the mice were then challenged in the right footpad with 2×10 5 promastigote forms of L. major (stationary phase). Footpad swelling was then measured weekly thereafter. Results are expressed in FIG. 32 and clearly indicated that, again, mice immunized with naked DNA containing either the M15 or MAPS genes were greatly protected against the infection with L. major . These results demonstrate that both M15 and MAPS genes induce excellent protection against L. major infection in the BALB/c model of human leishmaniasis.

Example 19

Preparation and Characterization of Leishmania Fusion Proteins

Fusion proteins comprising the Leishmania antigens MAPS-1A (SEQ ID NO: 24), M15 (SEQ ID NO: 2), Lbhsp83 (SEQ ID NO: 6) and LbeIF4A (SEQ ID NO: 10) were prepared as follows.

A fusion construct of MAPS-1A and M15 was prepared by first PCR amplifying the full-length coding sequence of MAPS-1A using the primers of SEQ ID NO: 88 and 89. The resulting products were digested with NdeI and BamHI follows by sub-cloning into the pET17b expression vector, also digested with NdeI and BamHI. The ligated products were transformed into E. coli and transformants containing the correct insert were identified by restriction digest and verified by DNA sequencing. The MAPS-1A-pET plasmid was digested with BamHI and EcoRI. The latter cuts within the poly-linker sequence of the pET vector which is located downstream of the BamHI site.

The primers of SEQ ID NO: 90 and 91 were employed to PCR amplify the full-length coding sequence of M15 and the resulting product was digested with BamHI and EcoRI followed by sub-cloning into the predigested MAPS1A-pET plasmid above. The ligated products were then transformed into E. coli and transformants with the correct insert were identified by restriction digest and verified by DNA sequencing. The MAPS1A-M15 pET construct was transformed into the bacterial host (BL21; pLysE). Expression of the protein resulted in a single recombinant molecule with a predicted molecular weight of 85.7 kDa. The recombinant MAPS1A-M15 fusion protein also contained 33 amino acid residues of run-through vector as a result of the removal of the stop codon of M15 and was subsequently digested with EcoRI. The DNA sequence of the MAPS1A-M15 construct is provided in SEQ ID NO: 101.

The primers of SEQ ID NO: 92 and 93 were used to PCR amplify the first 226 amino acid residues of LbeIF4A. The resulting PCR product was digested with EcoRI and sub-cloned into the MAPS1A-M15-pET plasmid. The ligated products were then transformed into E. coli and transformants with the correct insert and orientation were identified by restriction digest and verified by DNA sequencing. The expressed recombinant protein was purified by affinity chromatography over a Ni column. The DNA and amino acid sequences of the fusion protein MAPS1A-M15-LbeIF4A are provided in SEQ ID NO: 94 and 95, respectively.

Additional fusion proteins were prepared using the methodology described above. The amino acid sequences for the fusion proteins MAPS1A-M15-Lbhsp83 and MAPS1A-M15-Lbhsp83-LeIF4A are provided in SEQ ID NO: 96 and 97, respectively. The DNA sequence that encodes the amino acid sequence of SEQ ID NO: 97 is provided in SEQ ID NO: 98. The DNA sequences of MAPS1A-M15-Lbhsp83 and MAPS1A-M15-Lbhsp83-LeIF4A vectors employed in DNA vaccines are provided in SEQ ID NO: 99 and 100, respectively.

Example 20

Use of Leishmania Fusion Proteins Plus Adjuvant for Vaccination Against Leishmania Infection

The ability of the Leishmania fusion proteins MAPS1A-M15 (referred to as the diFusion) and MAPS1A-M15-LbeIF4A (referred to as the triFusion), plus adjuvant, to confer protection against disease in the experimental murine leishmaniasis model system was examined as follows.

The diFusion and triFusion were prepared as described above. In a first series of experiments, groups of BALB/c mice were immunized with either the individual recombinant antigens, (MAPS1A, M15 or LbeIF4A), the diFusion or the triFusion, with IL-12 as an adjuvant, as described above in Example 17. Control mice were immunized with IL-12 alone or saline. Before challenge, some mice (three per group) were sacrificed and the immune responses to the fusion proteins and to the individual antigens were investigated. Both T cell (cytokine production by spleen cells) and B cell responses (antibody response) were evaluated. The results indicated that immunization of mice with the fusion proteins did not interfere with the immunogenicity of the individual antigens. More specifically, Th1 responses (namely induction of IFN-γ production and specific IgG2a production) were observed to both MAPS1A and M15, when mice were immunized with both the diFusion and triFusion recombinant proteins. In addition, immunization with the triFusion resulted in good immune response to LeIF.

To evaluate the protection conferred by these fusion proteins, the immunized and control mice were infected in the right footpad with 2×10 3 amastigote forms of L. major and footpad swelling was measured weekly thereafter. The results, shown in FIG. 33 , clearly indicated that both fusion proteins induced protection comparable to MAPS1A and M15.

A second series of experiments was performed in which MPL-SE (Ribi ImmunoChem Research Inc. (Hamilton, Mont.) was employed as the adjuvant. BALB/c mice were immunized three times (three weeks interval) with 2 μg of the individual antigens (MAPS1A, M15 or LbeIF4A), diFusion or triFusion proteins plus MPL-SE, and tested for immunogenicity of the antigens and for protection as described above. As with the experiments performed with IL-12 as adjuvant, the mice immunized with the individual antigens as well as with the fusion proteins showed both specific T and B cell responses to the immunizing antigens. Moreover, no antigen competition between the individual antigens was observed when the fusion proteins were used as immunogens.

As with the protection studies in which IL-12 was used as adjuvant, protection was achieved with the individual antigens MAS1A and M15, as well as with the two fusion proteins (FIG. 34 ). Slightly better protection was observed in the group of mice immunized with the triFusion than in mice immunized with the diFusion.

From the foregoing, it will be appreciated that, although specific embodiments of the invention have been described herein for the purpose of illustration, various modifications may be made without deviating from the spirit and scope of the invention.

112 1 3134 DNA Leishmania major misc_feature (1)...(3134) n = A,T,C or G 1caagtgtcga aggacagtgt tcnccgtgtg agatcgccgg ctgtgcgtgt gaaggcggtg 60ccatcggana aacaacaccg gtgganccgc aggaaaccat ctttctccgc aggtctcttt 120ttgttgtcga ttgagagtgc nccaaaccct gctggtgccc ttctcacata tcatgttttt 180cgttgtgcgc tcgctttgcc tttcctctcc tttccctctc ttccgtggtg ccgtgtatac 240ttctggcacc cgctacgtca cttcgctggt ttgaacagaa ccactgtgaa cacccacggg 300cgatcgcaca catacacatc cctcactcac acacacagct acatctatcc tacataaagc 360tgaaaaaaaa gtctacgaac aattttgttt ttacagtgcg ttgccgcaca tttctccgta 420atggacgcaa ctgagctgaa gaacaagggg aacgaagagt tctccgccgg ccgctatgtg 480gaggcggtga actacttctc aaaggcgatc cagttggatg agcagaacag tgtcctctac 540agcaaccgct ccgcctgttt tgcagccatg cagaaataca aggacgcgct ggacgacgcc 600gacaagtgca tctcgatcaa gccgaattgg gccaagggct acgtgcgccg aggagcagct 660ctccatggca tgcgccgcta cgacgatgcc attgccgcgt atgaaaaggg gctcaaggtg 720gacccttcca acagcggctg cgcgcagggc gtgaaggacg tgcaggtagc caaggcccgc 780gaagcacgtg accccatcgc tcgcgtcttc accccggagg cgttccgcaa gatccaagag 840aatcccaagc tgtctctact tatgctgcag ccggactacg tgaagatggt agacaccgtc 900atccgcgacc cttcgcaggg ccggctgtac atggaagacc agcgctttgc cctgacgctc 960atgtacctga gcggaatgaa gattcccaac gatggtgatg gcgaggagga ggaacgtccg 1020tctgcgaagg cggcagagac agcgaagcca aaagaggaga agcctctcac cgacaacgag 1080aaggaggccc tggcgctcaa ggaggagggc aacaagctgt acctctcgaa gaagtttgag 1140gaggcgctga ccaagtacca agaggcgcag gtgaaagacc ccaacaacac tttatacatt 1200ctgaacgtgt cggccgtgta cttcgagcag ggtgactacg acaagtgcat cgccgagtgc 1260gagcacggta tcgagcacgg tcgcgagaac cactgcgact acacaatcat tgcgaagctc 1320atgacccgga acgccttgtg cctccagagg cagaggaagt acgaggctgc tatcgacctt 1380tacaagcgcg cccttgtcga gtggcgtaac cctgacaccc tcaagaagct gacggagtgc 1440gagaaggagc accaaaaggc ggtggaggaa gcctacatcg atcctgagat cgcgaagcag 1500aagaaagacg aaggtaacca gtacttcaag gaggataagt tccccgaggc cgtggcagcg 1560tacacggagg ccatcaagcg caaccctgcc gagcacacct cctacagcaa tcgcgcggcc 1620gcgtacatca agcttggagc cttcaacgac gccctcaagg acgcggagaa gtgcattgag 1680ctgaagcccg actttgttaa gggctacgcg cgcaagggtc atgcttactt ttggaccaag 1740cagtacaacc gcgcgctgca ggcgtacgat gagggcctca aggtggaccc gagcaatgcg 1800gactgcaagg atgggcggta tcgcacaatc atgaagattc aggagatggc atctggccaa 1860tccgcggatg gcgacgaggc ggcgcgccgg gccatggacg atcctgaaat cgcggcaatc 1920atgcaagata gctacatgca actagtgttg aaggagatgc agaacgatcc cacgcgcatt 1980caggagtaca tgaaggactc cgggatctca tcgaagatca acaagctgat ttcagctggc 2040atcattcgtt ttggtcagta gacttctacg ctgcctcatc ttttccgtgt ctttgcgtcg 2100gcgggtatcg taaagcacaa taaagcagcg attcacatgc acgagtaaag tgctgcgcct 2160ctcaaacacg acgtcgaggc tgtggtgcag atgcgcgtcc tgcatgaagg tagtgaagag 2220gaaagtaagg gatgttgttt gtgggccttc gtggctgcgc acacacctct tatctccttc 2280gcttggtacc ttctcccttt ttcgtcttca cccccctttc tcttctcacg ctctccctgg 2340cgcggtggtg caacgatttc gttttattta cgtctgtgta gctcctctat tcaacggtgc 2400gatgacgcta acgaagctgg cctgtattcg gctaaggcga aggcaaaaga ctaggagggg 2460ggggggaagg agacggcgtg accatcactg cgaagaaaca agccgaagaa aaggccccga 2520acgcctgcat ttccgcgcgc cctcgcccgc cttccttcct tccttcgctc tctctctctc 2580tctctctcgc tatcttctca acggagacat gaaaggcgtt tgttaggaaa agaggggggg 2640gggaagagtg ggacgacgcg ctgcgtcttt tgggcactgg tcacgtgcgt caccctcttt 2700ttttatctct attggcactg tcttgtttct tttccctttc ctatcatacg cgtctcgcaa 2760acgactccgc gctgagcagc catgtgctgc ggcgtggagg aagtacacag acatcacgga 2820tgcatatgtg cgcgtccgtg tacgcgcttg tatggggctt ctaacagcgc ctgtgtgtgt 2880ttgtgtgtgt gtgtgtgtgt gtgtctgtgt atttcgagcg tctgtatgct attctattaa 2940gcaccgaaga agagacacac acgacagcga aggagatggt gtcggctttt cggctaatca 3000ctcccttcca tagcttctct gaaggaggct ctcttccaga ggaatagact gcagatgggg 3060tccacgttta tctgaggagt caacggaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 3120aaaaaaaact cgag 3134 2 546 PRT Leishmania major 2Met Asp Ala Thr Glu Leu Lys Asn Lys Gly Asn Glu Glu Phe Ser Ala 1 5 10 15Gly Arg Tyr Val Glu Ala Val Asn Tyr Phe Ser Lys Ala Ile Gln Leu 20 25 30Asp Glu Gln Asn Ser Val Leu Tyr Ser Asn Arg Ser Ala Cys Phe Ala 35 40 45Ala Met Gln Lys Tyr Lys Asp Ala Leu Asp Asp Ala Asp Lys Cys Ile 50 55 60Ser Ile Lys Pro Asn Trp Ala Lys Gly Tyr Val Arg Arg Gly Ala Ala65 70 75 80Leu His Gly Met Arg Arg Tyr Asp Asp Ala Ile Ala Ala Tyr Glu Lys 85 90 95Gly Leu Lys Val Asp Pro Ser Asn Ser Gly Cys Ala Gln Gly Val Lys 100 105 110Asp Val Gln Val Ala Lys Ala Arg Glu Ala Arg Asp Pro Ile Ala Arg 115 120 125Val Phe Thr Pro Glu Ala Phe Arg Lys Ile Gln Glu Asn Pro Lys Leu 130 135 140Ser Leu Leu Met Leu Gln Pro Asp Tyr Val Lys Met Val Asp Thr Val145 150 155 160Ile Arg Asp Pro Ser Gln Gly Arg Leu Tyr Met Glu Asp Gln Arg Phe 165 170 175Ala Leu Thr Leu Met Tyr Leu Ser Gly Met Lys Ile Pro Asn Asp Gly 180 185 190Asp Gly Glu Glu Glu Glu Arg Pro Ser Ala Lys Ala Ala Glu Thr Ala 195 200 205Lys Pro Lys Glu Glu Lys Pro Leu Thr Asp Asn Glu Lys Glu Ala Leu 210 215 220Ala Leu Lys Glu Glu Gly Asn Lys Leu Tyr Leu Ser Lys Lys Phe Glu225 230 235 240Glu Ala Leu Thr Lys Tyr Gln Glu Ala Gln Val Lys Asp Pro Asn Asn 245 250 255Thr Leu Tyr Ile Leu Asn Val Ser Ala Val Tyr Phe Glu Gln Gly Asp 260 265 270Tyr Asp Lys Cys Ile Ala Glu Cys Glu His Gly Ile Glu His Gly Arg 275 280 285Glu Asn His Cys Asp Tyr Thr Ile Ile Ala Lys Leu Met Thr Arg Asn 290 295 300Ala Leu Cys Leu Gln Arg Gln Arg Lys Tyr Glu Ala Ala Ile Asp Leu305 310 315 320Tyr Lys Arg Ala Leu Val Glu Trp Arg Asn Pro Asp Thr Leu Lys Lys 325 330 335Leu Thr Glu Cys Glu Lys Glu His Gln Lys Ala Val Glu Glu Ala Tyr 340 345 350Ile Asp Pro Glu Ile Ala Lys Gln Lys Lys Asp Glu Gly Asn Gln Tyr 355 360 365Phe Lys Glu Asp Lys Phe Pro Glu Ala Val Ala Ala Tyr Thr Glu Ala 370 375 380Ile Lys Arg Asn Pro Ala Glu His Thr Ser Tyr Ser Asn Arg Ala Ala385 390 395 400Ala Tyr Ile Lys Leu Gly Ala Phe Asn Asp Ala Leu Lys Asp Ala Glu 405 410 415Lys Cys Ile Glu Leu Lys Pro Asp Phe Val Lys Gly Tyr Ala Arg Lys 420 425 430Gly His Ala Tyr Phe Trp Thr Lys Gln Tyr Asn Arg Ala Leu Gln Ala 435 440 445Tyr Asp Glu Gly Leu Lys Val Asp Pro Ser Asn Ala Asp Cys Lys Asp 450 455 460Gly Arg Tyr Arg Thr Ile Met Lys Ile Gln Glu Met Ala Ser Gly Gln465 470 475 480Ser Ala Asp Gly Asp Glu Ala Ala Arg Arg Ala Met Asp Asp Pro Glu 485 490 495Ile Ala Ala Ile Met Gln Asp Ser Tyr Met Gln Leu Val Leu Lys Glu 500 505 510Met Gln Asn Asp Pro Thr Arg Ile Gln Glu Tyr Met Lys Asp Ser Gly 515 520 525Ile Ser Ser Lys Ile Asn Lys Leu Ile Ser Ala Gly Ile Ile Arg Phe 530 535 540Gly Gln545 3 676 DNA Leishmania donovani 3aattcggcac gaggcattgt gcataatggt caagtcccac tacatctgcg cgggccgcct 60ggtgcgcatc ctgcgtggcc cccgccagga ccgcgttggt gtgatcgtcg acattgtcga 120cgcgaaccgc gtgctggtgg agaacccgga ggacgcgaag atgtggcgcc acgtgcagaa 180cctgaagaac gtggagccgc tgaagtactg cgtgagcgtc agccgcaact gcagcgcgaa 240ggcgctgaag gatgcgctgg cctcgtcgaa ggcgctggag aagtacgcga agacgcgcac 300tgctgcgcgc gtggaggcga agaaggcgtg cgccgcgtcg acggacttcg agcgctacca 360gctgcgcgtt gcgcgccgtt ctcgcgcgca ctgggcgcgc aaggtgttcg acgagaagga 420cgcgaagacg cccgtgtcgt ggcacaaggt tgcgctgaag aagatgcaga agaaggccgc 480aaagatggac tcgaccgagg gcgctaagag gcgcatgcag aaggcgatcg ctgcccgcaa 540ggcgaaaaag taaggccata ccctcacttc gcttgtttcg tgatttttcg tgggagtcgg 600tggccctacc agcggtcttt cattggctta tttctatccg gtctgaaaga ggtacaaaaa 660aaaaaaaaaa aaaaaa 676 4 175 PRT Leishmania donovani 4Met Val Lys Ser His Tyr Ile Cys Ala Gly Arg Leu Val Arg Ile Leu 1 5 10 15Arg Gly Pro Arg Gln Asp Arg Val Gly Val Ile Val Asp Ile Val Asp 20 25 30Ala Asn Arg Val Leu Val Glu Asn Pro Glu Asp Ala Lys Met Trp Arg 35 40 45His Val Gln Asn Leu Lys Asn Val Glu Pro Leu Lys Tyr Cys Val Ser 50 55 60Val Ser Arg Asn Cys Ser Ala Lys Ala Leu Lys Asp Ala Leu Ala Ser65 70 75 80Ser Lys Ala Leu Glu Lys Tyr Ala Lys Thr Arg Thr Ala Ala Arg Val 85 90 95Glu Ala Lys Lys Ala Cys Ala Ala Ser Thr Asp Phe Glu Arg Tyr Gln 100 105 110Leu Arg Val Ala Arg Arg Ser Arg Ala His Trp Ala Arg Lys Val Phe 115 120 125Asp Glu Lys Asp Ala Lys Thr Pro Val Ser Trp His Lys Val Ala Leu 130 135 140Lys Lys Met Gln Lys Lys Ala Ala Lys Met Asp Ser Thr Glu Gly Ala145 150 155 160Lys Arg Arg Met Gln Lys Ala Ile Ala Ala Arg Lys Ala Lys Lys 165 170 175 5 2040 DNA Leishmania braziliensis 5cgcggtggcg gccgctctag aactagtgga tcccccgggc tgcaggaatt cggcacgaga 60gagcctgacg gacccggcgg tgctgggcga ggagactcac ctgcgcgtcc gcgtggtgcc 120ggacaaggcg aacaagacgc tgacggtgga ggataacggc atcggcatga ccaaggcgga 180cctcgtgaac aatctgggca cgatcgcgcg ctccggcacg aaggctttca tggaggcact 240ggaggccggc ggcgacatga gcatgatcgg ccagttcggt gtcggcttct actccgcgta 300ccttgtggcg gaccgcgtga cggtggtgtc gaagaacaac tcggacgagg cgtactggga 360atcgtctgcg gggggcacgt tcaccatcac gagcgtgcag gagtcggaca tgaagcgcgg 420cacgagtaca acgctgcacc taaaggagga ccagcaggag tacctggagg agcgccgggt 480gaaggagctg atcaagaagc actccgagtt catcggctac gacatcgagc tgatggtgga 540gaagacggcg gagaaggagg tgacggacga ggacgaggag gaggacgagt cgaagaagaa 600gtcctgcggg gacgagggcg agccgaaggt ggaggaggtg acggagggcg gcgaggacaa 660gaagaagaag acgaagaagg tgaaggaggt gaagaagacg tacgaggtca agaacaagca 720caagccgctc tggacgcgcg acacgaagga cgtgacgaag gaggagtacg cggccttcta 780caaggccatc tccaacgact gggaggacac ggcggcgacg aagcacttct cggtggaggg 840ccagctggag ttccgcgcga tcgcgttcgt gccgaagcgc gcgccgttcg acatgttcga 900gccgaacaag aagcgcaaca acatcaagct gtacgtgcgc cgcgtgttca tcatggacaa 960ctgcgaggac ctgtgcccgg actggctcgg cttcgtgaag ggcgtcgtgg acagcgagga 1020cctgccgctg aacatctcgc gcgagaacct gcagcagaac aagatcctga aggtgatccg 1080caagaacatc gtgaagaagt gcctggagct gttcgaagag atagcggaga acaaggagga 1140ctacaagcag ttctacgagc agttcggcaa gaacatcaag ctgggcatcc acgaggacac 1200ggcgaaccgc aagaagctga tggagttgct gcgcttctac agcaccgagt cgggggagga 1260gatgacgaca ctgaaggact acgtgacgcg catgaagccg gagcagaagt cgatctacta 1320catcactggc gacagcaaga agaagctgga gtcgtcgccg ttcatcgaga aggcgagacg 1380ctgcgggctc gaggtgctgt tcatgacgga gccgatcgac gagtacgtga tgcagcaggt 1440gaaggacttc gaggacaaga agttcgcgtg cctgacgaag gaaggcgtgc acttcgagga 1500gtccgaggag gagaagaagc agcgcgagga gaagaaggcg gcgtgcgaga agctgtgcaa 1560gacgatgaag gaggtgctgg gcgacaaggt ggagaaggtg accgtgtcgg agcgcctgtt 1620gacgtcgccg tgcatcctgg tgacgtcgga gtttgggtgg tcggcgcaca tggaacagat 1680catgcgcaac caggcgctgc gcgactccag catggcgcag tacatggtgt ccaagaagac 1740gatggaggtg aaccccgacc accccatcat caaggagctg cgccgccgcg tggaggcgga 1800cgagaacgac aaggccgtga aggacctcgt cttcctgctc ttcgacacgt cgctgctcac 1860gtccggcttc cagctggatg accccaccgg ctacgccgag cgcatcaacc gcatgatcaa 1920gctcggcctg tcgctcgacg aggaggagga ggaggtcgcc gaggcgccgc cggccgaggc 1980agcccccgcg gaggtcaccg ccggcacctc cagcatggag caggtggact gagccggtaa 2040 6 656 PRT Leshmania brailiensis 6Ser Leu Thr Asp Pro Ala Val Leu Gly Glu Glu Thr His Leu Arg Val 1 5 10 15Arg Val Val Pro Asp Lys Ala Asn Lys Thr Leu Thr Val Glu Asp Asn 20 25 30Gly Ile Gly Met Thr Lys Ala Asp Leu Val Asn Asn Leu Gly Thr Ile 35 40 45Ala Arg Ser Gly Thr Lys Ala Phe Met Glu Ala Leu Glu Ala Gly Gly 50 55 60Asp Met Ser Met Ile Gly Gln Phe Gly Val Gly Phe Tyr Ser Ala Tyr 65 70 75 80Leu Val Ala Asp Arg Val Thr Val Val Ser Lys Asn Asn Ser Asp Glu 85 90 95Ala Tyr Trp Glu Ser Ser Ala Gly Gly Thr Phe Thr Ile Thr Ser Val 100 105 110Gln Glu Ser Asp Met Lys Arg Gly Thr Ser Thr Thr Leu His Leu Lys 115 120 125Glu Asp Gln Gln Glu Tyr Leu Glu Glu Arg Arg Val Lys Glu Leu Ile 130 135 140Lys Lys His Ser Glu Phe Ile Gly Tyr Asp Ile Glu Leu Met Val Glu145 150 155 160Lys Thr Ala Glu Lys Glu Val Thr Asp Glu Asp Glu Glu Glu Asp Glu 165 170 175Ser Lys Lys Lys Ser Cys Gly Asp Glu Gly Glu Pro Lys Val Glu Glu 180 185 190Val Thr Glu Gly Gly Glu Asp Lys Lys Lys Lys Thr Lys Lys Val Lys 195 200 205Glu Val Lys Lys Thr Tyr Glu Val Lys Asn Lys His Lys Pro Leu Trp 210 215 220Thr Arg Asp Thr Lys Asp Val Thr Lys Glu Glu Tyr Ala Ala Phe Tyr225 230 235 240Lys Ala Ile Ser Asn Asp Trp Glu Asp Thr Ala Ala Thr Lys His Phe 245 250 255Ser Val Glu Gly Gln Leu Glu Phe Arg Ala Ile Ala Phe Val Pro Lys 260 265 270Arg Ala Pro Phe Asp Met Phe Glu Pro Asn Lys Lys Arg Asn Asn Ile 275 280 285Lys Leu Tyr Val Arg Arg Val Phe Ile Met Asp Asn Cys Glu Asp Leu 290 295 300Cys Pro Asp Trp Leu Gly Phe Val Lys Gly Val Val Asp Ser Glu Asp305 310 315 320Leu Pro Leu Asn Ile Ser Arg Glu Asn Leu Gln Gln Asn Lys Ile Leu 325 330 335Lys Val Ile Arg Lys Asn Ile Val Lys Lys Cys Leu Glu Leu Phe Glu 340 345 350Glu Ile Ala Glu Asn Lys Glu Asp Tyr Lys Gln Phe Tyr Glu Gln Phe 355 360 365Gly Lys Asn Ile Lys Leu Gly Ile His Glu Asp Thr Ala Asn Arg Lys 370 375 380Lys Leu Met Glu Leu Leu Arg Phe Tyr Ser Thr Glu Ser Gly Glu Glu385 390 395 400Met Thr Thr Leu Lys Asp Tyr Val Thr Arg Met Lys Pro Glu Gln Lys 405 410 415Ser Ile Tyr Tyr Ile Thr Gly Asp Ser Lys Lys Lys Leu Glu Ser Ser 420 425 430Pro Phe Ile Glu Lys Ala Arg Arg Cys Gly Leu Glu Val Leu Phe Met 435 440 445Thr Glu Pro Ile Asp Glu Tyr Val Met Gln Gln Val Lys Asp Phe Glu 450 455 460Asp Lys Lys Phe Ala Cys Leu Thr Lys Glu Gly Val His Phe Glu Glu465 470 475 480Ser Glu Glu Glu Lys Lys Gln Arg Glu Glu Lys Lys Ala Ala Cys Glu 485 490 495Lys Leu Cys Lys Thr Met Lys Glu Val Leu Gly Asp Lys Val Glu Lys 500 505 510Val Thr Val Ser Glu Arg Leu Leu Thr Ser Pro Cys Ile Leu Val Thr 515 520 525Ser Glu Phe Gly Trp Ser Ala His Met Glu Gln Ile Met Arg Asn Gln 530 535 540Ala Leu Arg Asp Ser Ser Met Ala Gln Tyr Met Val Ser Lys Lys Thr545 550 555 560Met Glu Val Asn Pro Asp His Pro Ile Ile Lys Glu Leu Arg Arg Arg 565 570 575Val Glu Ala Asp Glu Asn Asp Lys Ala Val Lys Asp Leu Val Phe Leu 580 585 590Leu Phe Asp Thr Ser Leu Leu Thr Ser Gly Phe Gln Leu Asp Asp Pro 595 600 605Thr Gly Tyr Ala Glu Arg Ile Asn Arg Met Ile Lys Leu Gly Leu Ser 610 615 620Leu Asp Glu Glu Glu Glu Glu Val Ala Glu Ala Pro Pro Ala Glu Ala625 630 635 640Ala Pro Ala Glu Val Thr Ala Gly Thr Ser Ser Met Glu Gln Val Asp 645 650 655 7 1771 DNA Leishmania tropica 7caggcccgcg tccaggccct cgaggaggca gcgcgtctcc gcgcggagct ggaggcggcc 60gaggaggcgg cccgcctgga tgtcatgcat gcggccgagc aggcccgtgt ccaggccctc 120gaggaggcag cgcgtctccg cgcggagctg gaggaggccg aggaggcggc ccgcctggat 180gtcatgcatg cggccgagca ggcccgcgtc caggccctcg aggaggcagc gcgtctccgc 240gcggagctgg aggctgccga ggaggcggcg cgcctggagg ccatgcacga ggccgagcag 300gcccgctccc aggccctcga ggaggcagcg cgtctccgcg cggagctgga ggaagccgag 360gaggcggccc gcctggatgt catgcatgcg gccgagcagg cccgcgtcca ggccctcgag 420gaggcagcgc gtctccgcgc ggagctggag gaggccgagg aggcggcccg cctggaggcc 480atgcacgagg ccgagcaggc ccgctcccag gccctcgagg aggcagcgcg tctccgcgcg 540gagctggagg cggccgagga ggcggcccgc ctggatgtca tgcacgaggc cgagcaggcc 600cgtgtccagg ccctcgagga ggcggcgcgc ctggatgtca tgcacgaggc cgagcaggcc 660cgcgtccagg ccctcgagga ggcagcgcgt ctccgcgcgg agctggaggc ggccgaggag 720gcggcccgcc tggatgtcat gcacgaggcc gagcaggccc gcgtccaggc cctcgaggag 780gcagcgcgtc tccgcgcgga gctggaggcg gccgaggagg cggcccgcct ggatgtcatg 840cacgagggcg agcaggcccg tgtccaggcc ctcgaggagg cggcccgcct ggaggccatg 900cacgaggccg agcaggcccg ctcccaggcc ctcgaggagg cagcgcgtct ctgcgcggag 960ctggaggctg aggaggagga aaaagatgag cggccggcga cgtcgagcta cagcgaggag 1020tgcaaagggc gactgctatc gagggcgcgg ccggatccgc ggaggccgct gccgcggccg 1080ttcattggga tgtcactgtt ggaggatgtg gagaagagta ttctcattgt ggacgggctc 1140tacagggatg ggccggcgta ccagacgggc atccgcctcg gggatgtcct cttgcgtatc 1200gcgggggttt acgtggattc aatagcgaag gcgaggcagg tggtcgatgc gcgttgccgc 1260tgcggctgcg tcgttcccgt gacgctggcg acgaagatga accagcagta cagcgtggct 1320ctgtatatca tgacggtgga tccgcagcac aacgacaagc cctttttttt tgatgtgcac 1380atccaccacc gcatcgagag ctcgcacatg gggaagaagg cgcagtggat ggaagttctt 1440gagagcccat ccgtatcttc ggctgccacc acccctctcg tgccgctctt gcgtgagccg 1500acgccgcgta ggggctcaga gctgcagtca agtgctcgtt ccgccttcgt tgccacgtct 1560tacttctcga gcgcgcgcag gtcggtcagc tcagaaagtg agcgaccgcg cgggtcctct 1620agcgtggcta tggcggagga ggcgatcgcg ctggcgccgc aagggtatac cccacccaac 1680caagtgcgcg gccgtagttg acgtctctgt gtgagtgtgt gtcgctccgt ctccttcctt 1740tttcgtcatg tgttttattc atttcttttt c 1771 8 566 PRT Leishmania tropica 8Gln Ala Arg Val Gln Ala Leu Glu Glu Ala Ala Arg Leu Arg Ala Glu 1 5 10 15Leu Glu Ala Ala Glu Glu Ala Ala Arg Leu Asp Val Met His Ala Ala 20 25 30Glu Gln Ala Arg Val Gln Ala Leu Glu Glu Ala Ala Arg Leu Arg Ala 35 40 45Glu Leu Glu Glu Ala Glu Glu Ala Ala Arg Leu Asp Val Met His Ala 50 55 60Ala Glu Gln Ala Arg Val Gln Ala Leu Glu Glu Ala Ala Arg Leu Arg65 70 75 80Ala Glu Leu Glu Ala Ala Glu Glu Ala Ala Arg Leu Glu Ala Met His 85 90 95Glu Ala Glu Gln Ala Arg Ser Gln Ala Leu Glu Glu Ala Ala Arg Leu 100 105 110Arg Ala Glu Leu Glu Glu Ala Glu Glu Ala Ala Arg Leu Asp Val Met 115 120 125His Ala Ala Glu Gln Ala Arg Val Gln Ala Leu Glu Glu Ala Ala Arg 130 135 140Leu Arg Ala Glu Leu Glu Glu Ala Glu Glu Ala Ala Arg Leu Glu Ala145 150 155 160Met His Glu Ala Glu Gln Ala Arg Ser Gln Ala Leu Glu Glu Ala Ala 165 170 175Arg Leu Arg Ala Glu Leu Glu Ala Ala Glu Glu Ala Ala Arg Leu Asp 180 185 190Val Met His Glu Ala Glu Gln Ala Arg Val Gln Ala Leu Glu Glu Ala 195 200 205Ala Arg Leu Asp Val Met His Glu Ala Glu Gln Ala Arg Val Gln Ala 210 215 220Leu Glu Glu Ala Ala Arg Leu Arg Ala Glu Leu Glu Ala Ala Glu Glu225 230 235 240Ala Ala Arg Leu Asp Val Met His Glu Ala Glu Gln Ala Arg Val Gln 245 250 255Ala Leu Glu Glu Ala Ala Arg Leu Arg Ala Glu Leu Glu Ala Ala Glu 260 265 270Glu Ala Ala Arg Leu Asp Val Met His Glu Gly Glu Gln Ala Arg Val 275 280 285Gln Ala Leu Glu Glu Ala Ala Arg Leu Glu Ala Met His Glu Ala Glu 290 295 300Gln Ala Arg Ser Gln Ala Leu Glu Glu Ala Ala Arg Leu Cys Ala Glu305 310 315 320Leu Glu Ala Glu Glu Glu Glu Lys Asp Glu Arg Pro Ala Thr Ser Ser 325 330 335Tyr Ser Glu Glu Cys Lys Gly Arg Leu Leu Ser Arg Ala Arg Pro Asp 340 345 350Pro Arg Arg Pro Leu Pro Arg Pro Phe Ile Gly Met Ser Leu Leu Glu 355 360 365Asp Val Glu Lys Ser Ile Leu Ile Val Asp Gly Leu Tyr Arg Asp Gly 370 375 380Pro Ala Tyr Gln Thr Gly Ile Arg Leu Gly Asp Val Leu Leu Arg Ile385 390 395 400Ala Gly Val Tyr Val Asp Ser Ile Ala Lys Ala Arg Gln Val Val Asp 405 410 415Ala Arg Cys Arg Cys Gly Cys Val Val Pro Val Thr Leu Ala Thr Lys 420 425 430Met Asn Gln Gln Tyr Ser Val Ala Leu Tyr Ile Met Thr Val Asp Pro 435 440 445Gln His Asn Asp Lys Pro Phe Phe Phe Asp Val His Ile His His Arg 450 455 460Ile Glu Ser Ser His Met Gly Lys Lys Ala Gln Trp Met Glu Val Leu465 470 475 480Glu Ser Pro Ser Val Ser Ser Ala Ala Thr Thr Pro Leu Val Pro Leu 485 490 495Leu Arg Glu Pro Thr Pro Arg Arg Gly Ser Glu Leu Gln Ser Ser Ala 500 505 510Arg Ser Ala Phe Val Ala Thr Ser Tyr Phe Ser Ser Ala Arg Arg Ser 515 520 525Val Ser Ser Glu Ser Glu Arg Pro Arg Gly Ser Ser Ser Val Ala Met 530 535 540Ala Glu Glu Ala Ile Ala Leu Ala Pro Gln Gly Tyr Thr Pro Pro Asn545 550 555 560Gln Val Arg Gly Arg Ser 565 9 1618 DNA Leishmania braziliensis 9ccactctctc ggtcgtctgt ctcccacgcg cgcacgcagt tgatttccgc cttcttaaac 60gctctctttt tttttatttt tcacctgacc aaccgcacca cgtcggcctc catcatgtcg 120cagcaagacc gagttgcccc acaggaccag gactcgttcc tcgacgacca gcccggcgtc 180cgcccgatcc cgtccttcga tgacatgccg ttgcaccaga accttctgcg cggcatctac 240tcgtacggct tcgagaaacc gtccagcatc cagcagcgcg ccatcgcccc cttcacgcgc 300ggcggcgaca tcatcgcgca ggcgcagtcc ggtaccggca agacgggcgc cttctccatc 360ggcctgctgc agcgcctgga cttccgccac aacctgatcc agggcctcgt gctctccccg 420acccgcgagc tggccctgca gacggcggag gtgatcagcc gcatcggcga gttcctgtcg 480aacagcgcga agttctgtga gacctttgtg ggtggcacgc gcgtgcagga tgacctgcgc 540aagctgcagg ctggcgtcgt cgtcgccgtg gggacgccgg gccgcgtgtc cgacgtgatc 600aagcgcggcg cgctgcgcac cgagtccctg cgcgtgctgg tgctcgacga ggctgatgag 660atgctgtctc agggcttcgc ggatcagatt tacgagatct tccgcttcct gccgaaggac 720atccaggtcg cgctcttctc cgccacgatg ccggaggagg tgctggagct gacaaagaag 780ttcatgcgcg accccgtacg cattctcgtg aagcgcgaga gcctgacgct ggagggcatc 840aagcagttct tcatcgccgt cgaggaggag cacaagctgg acacgctgat ggacctgtac 900gagaccgtgt ccatcgcgca gtccgtcatc ttcgccaaca cccgccgcaa ggtggactgg 960atcgccgaga agctgaatca gagcaaccac accgtcagca gcatgcacgc cgagatgccc 1020aagagcgacc gcgagcgcgt catgaacacc ttccgcagcg gcagctcccg cgtgctcgta 1080acgaccgacc tcgtggcccg cggcatcgac gtgcaccacg tgaacatcgt catcaacttc 1140gacctgccga cgaacaagga gaactacctg caccgcattg gccgcggcgg ccgctacggc 1200gtaaagggtg ttgccatcaa cttcgtgacg gagaaagacg tggagctgct gcacgagatc 1260gaggggcact accacacgca gatcgatgag ctcccggtgg actttgccgc ctacctcggc 1320gagtgagcgg gcccctgccc cccttccctg cccccctctc gcgacgagag aacgcacatc 1380gtaacacagc cacgcgaacg atagtaaggg cgtgcggcgg cgttcccctc ctcctgccag 1440cggcccccct ccgcagcgct tctcttttga gaggggggca gggggaggcg ctgcgcctgg 1500ctggatgtgt gcttgagctt gcattccgtc aagcaagtgc tttgttttaa ttatgcgcgc 1560cgttttgttg ctcgtccctt tcgttggtgt tttttcggcc gaaacggcgt ttaaagca 1618 10 403 PRT Leishmania braziliensis 10Met Ser Gln Gln Asp Arg Val Ala Pro Gln Asp Gln Asp Ser Phe Leu 1 5 10 15Asp Asp Gln Pro Gly Val Arg Pro Ile Pro Ser Phe Asp Asp Met Pro 20 25 30Leu His Gln Asn Leu Leu Arg Gly Ile Tyr Ser Tyr Gly Phe Glu Lys 35 40 45Pro Ser Ser Ile Gln Gln Arg Ala Ile Ala Pro Phe Thr Arg Gly Gly 50 55 60Asp Ile Ile Ala Gln Ala Gln Ser Gly Thr Gly Lys Thr Gly Ala Phe65 70 75 80Ser Ile Gly Leu Leu Gln Arg Leu Asp Phe Arg His Asn Leu Ile Gln 85 90 95Gly Leu Val Leu Ser Pro Thr Arg Glu Leu Ala Leu Gln Thr Ala Glu 100 105 110Val Ile Ser Arg Ile Gly Glu Phe Leu Ser Asn Ser Ala Lys Phe Cys 115 120 125Glu Thr Phe Val Gly Gly Thr Arg Val Gln Asp Asp Leu Arg Lys Leu 130 135 140Gln Ala Gly Val Val Val Ala Val Gly Thr Pro Gly Arg Val Ser Asp145 150 155 160Val Ile Lys Arg Gly Ala Leu Arg Thr Glu Ser Leu Arg Val Leu Val 165 170 175Leu Asp Glu Ala Asp Glu Met Leu Ser Gln Gly Phe Ala Asp Gln Ile 180 185 190Tyr Glu Ile Phe Arg Phe Leu Pro Lys Asp Ile Gln Val Ala Leu Phe 195 200 205Ser Ala Thr Met Pro Glu Glu Val Leu Glu Leu Thr Lys Lys Phe Met 210 215 220Arg Asp Pro Val Arg Ile Leu Val Lys Arg Glu Ser Leu Thr Leu Glu225 230 235 240Gly Ile Lys Gln Phe Phe Ile Ala Val Glu Glu Glu His Lys Leu Asp 245 250 255Thr Leu Met Asp Leu Tyr Glu Thr Val Ser Ile Ala Gln Ser Val Ile 260 265 270Phe Ala Asn Thr Arg Arg Lys Val Asp Trp Ile Ala Glu Lys Leu Asn 275 280 285Gln Ser Asn His Thr Val Ser Ser Met His Ala Glu Met Pro Lys Ser 290 295 300Asp Arg Glu Arg Val Met Asn Thr Phe Arg Ser Gly Ser Ser Arg Val305 310 315 320Leu Val Thr Thr Asp Leu Val Ala Arg Gly Ile Asp Val His His Val 325 330 335Asn Ile Val Ile Asn Phe Asp Leu Pro Thr Asn Lys Glu Asn Tyr Leu 340 345 350His Arg Ile Gly Arg Gly Gly Arg Tyr Gly Val Lys Gly Val Ala Ile 355 360 365Asn Phe Val Thr Glu Lys Asp Val Glu Leu Leu His Glu Ile Glu Gly 370 375 380His Tyr His Thr Gln Ile Asp Glu Leu Pro Val Asp Phe Ala Ala Tyr385 390 395 400Leu Gly Glu 11 12 PRT Leishmania donovani VARIANT (1)...(5) Xaa = any amino acid 11Xaa Gln Xaa Pro Gln Xaa Val Phe Asp Glu Xaa Xaa 1 5 10 12 26 DNA Artificial Sequence Sense PCR pri mer 12ggaattcccc ncagctngtn ttcgac 26 13 5 PRT Leishmania donovani 13Lys Val Phe Asp Glu 1 5 14 30 DNA Artificial Sequence PCR primer 14ggatccatgg tcaagtccca ctacatctgc 30 15 33 DNA Artificial Sequence PCR primer 15gaattcagac cggatagaaa taagccaatg aaa 33 16 701 PRT Leishmania amozonensis 16Met Thr Glu Thr Phe Ala Phe Gln Ala Glu Ile Asn Gln Leu Met Ser 1 5 10 15Leu Ile Ile Asn Thr Phe Tyr Ser Asn Lys Glu Ile Phe Leu Arg Asp 20 25 30Val Ile Ser Asn Ala Ser Asp Ala Cys Asp Lys Ile Arg Tyr Gln Ser 35 40 45Leu Thr Asp Pro Ala Val Leu Gly Asp Ala Thr Arg Leu Cys Val Arg 50 55 60Val Val Pro Asp Lys Glu Asn Lys Thr Leu Thr Val Glu Asp Asn Gly65 70 75 80Ile Gly Met Thr Lys Ala Asp Leu Val Asn Asn Leu Gly Thr Ile Ala 85 90 95Arg Ser Gly Thr Lys Ala Phe Met Glu Ala Leu Glu Ala Gly Ala Asp 100 105 110Met Ser Met Ile Gly Gln Phe Gly Val Gly Phe Tyr Ser Ala Tyr Leu 115 120 125Val Ala Asp Arg Val Thr Val Thr Ser Lys Asn Asn Ser Asp Glu Val 130 135 140Tyr Val Trp Glu Ser Ser Ala Gly Gly Thr Phe Thr Ile Thr Ser Ala145 150 155 160Pro Glu Ser Asp Met Lys Leu Pro Ala Arg Ile Thr Leu His Leu Lys 165 170 175Glu Asp Gln Leu Glu Tyr Leu Glu Ala Arg Arg Leu Lys Glu Leu Ile 180 185 190Lys Lys His Ser Glu Phe Ile Gly Tyr Asp Ile Glu Leu Met Val Glu 195 200 205Lys Thr Thr Glu Lys Glu Val Thr Asp Glu Asp Glu Glu Glu Ala Lys 210 215 220Lys Ala Asp Glu Asp Gly Glu Glu Pro Lys Val Glu Glu Val Thr Glu225 230 235 240Gly Glu Glu Asp Lys Lys Lys Lys Thr Lys Lys Val Lys Glu Val Thr 245 250 255Lys Glu Tyr Glu Val Gln Asn Lys His Lys Pro Leu Trp Thr Arg Asp 260 265 270Pro Lys Asp Val Thr Lys Glu Glu Tyr Ala Ala Phe Tyr Lys Ala Ile 275 280 285Ser Asn Asp Trp Glu Asp Pro Pro Ala Thr Lys His Phe Ser Val Glu 290 295 300Gly Gln Leu Glu Phe Arg Ala Ile Met Phe Val Pro Lys Arg Ala Pro305 310 315 320Phe Asp Met Leu Glu Pro Asn Lys Lys Arg Asn Asn Ile Lys Leu Tyr 325 330 335Val Arg Arg Val Phe Ile Met Asp Asn Cys Glu Asp Leu Cys Pro Asp 340 345 350Trp Leu Gly Phe Val Lys Gly Val Val Asp Ser Glu Asp Leu Pro Leu 355 360 365Asn Ile Ser Arg Glu Asn Leu Gln Gln Asn Lys Ile Leu Lys Val Ile 370 375 380Arg Lys Asn Ile Val Lys Lys Cys Leu Glu Met Phe Glu Glu Val Ala385 390 395 400Glu Asn Lys Glu Asp Tyr Lys Gln Phe Tyr Glu Gln Phe Gly Lys Asn 405 410 415Ile Lys Leu Gly Ile His Glu Asp Thr Ala Asn Arg Lys Lys Leu Met 420 425 430Glu Leu Leu Arg Phe Tyr Ser Thr Glu Ser Gly Glu Val Met Thr Thr 435 440 445Leu Lys Asp Tyr Val Thr Arg Met Lys Ala Glu Gln Asn Ser Ile Tyr 450 455 460Tyr Ile Thr Gly Asp Ser Lys Lys Lys Leu Glu Ser Ser Pro Phe Ile465 470 475 480Glu Gln Ala Lys Arg Arg Gly Phe Glu Val Leu Phe Met Thr Glu Pro 485 490 495Tyr Asp Glu Tyr Val Met Gln Gln Val Lys Asp Phe Glu Asp Lys Lys 500 505 510Phe Ala Cys Leu Thr Lys Glu Gly Val His Phe Glu Glu Ser Glu Glu 515 520 525Glu Lys Lys Gln Arg Glu Glu Glu Lys Ala Thr Cys Glu Lys Leu Cys 530 535 540Lys Thr Met Lys Glu Val Leu Gly Asp Lys Val Glu Lys Val Thr Val545 550 555 560Ser Glu Arg Leu Ser Thr Ser Pro Cys Ile Leu Val Thr Ser Glu Phe 565 570 575Gly Trp Ser Ala His Met Glu Gln Met Met Arg Asn Gln Ala Leu Arg 580 585 590Asp Ser Ser Met Ala Gln Tyr Met Met Ser Lys Lys Thr Met Glu Leu 595 600 605Asn Pro Lys His Pro Ile Ile Lys Glu Leu Arg Arg Arg Val Glu Ala 610 615 620Asp Glu Asn Asp Lys Ala Val Lys Asp Leu Val Phe Leu Leu Phe Asp625 630 635 640Thr Ser Leu Leu Thr Ser Gly Phe Gln Leu Glu Asp Pro Thr Tyr Ala 645 650 655Glu Arg Ile Asn Arg Met Ile Lys Leu Gly Leu Ser Leu Asp Glu Glu 660 665 670Glu Glu Glu Glu Ala Val Glu Ala Ala Val Ala Glu Thr Ala Pro Ala 675 680 685Glu Val Thr Ala Gly Thr Ser Ser Met Glu Leu Val Asp 690 695 700 17 704 PRT T. Cruzi 17Met Thr Glu Thr Phe Ala Phe Gln Ala Glu Ile Asn Gln Leu Met Ser 1 5 10 15Leu Ile Ile Asn Thr Phe Tyr Ser Asn Lys Glu Ile Phe Leu Arg Glu 20 25 30Leu Ile Ser Asn Ala Ser Asp Ala Cys Asp Lys Ile Arg Tyr Gln Ser 35 40 45Leu Thr Asn Gln Ala Val Leu Gly Asp Glu Ser His Leu Arg Ile Arg 50 55 60Val Val Pro Asp Lys Ala Asn Lys Thr Leu Thr Val Glu Asp Thr Gly65 70 75 80Ile Gly Met Thr Lys Ala Glu Leu Val Asn Asn Leu Gly Thr Ile Ala 85 90 95Arg Ser Gly Thr Lys Ala Phe Met Glu Ala Leu Glu Ala Gly Gly Asp 100 105 110Met Ser Met Ile Gly Gln Phe Gly Val Gly Phe Tyr Ser Ala Tyr Leu 115 120 125Val Ala Asp Arg Val Thr Val Val Ser Lys Asn Asn Asp Asp Glu Ala 130 135 140Tyr Thr Trp Glu Ser Ser Ala Gly Gly Thr Phe Thr Val Thr Pro Thr145 150 155 160Pro Asp Cys Asp Leu Lys Arg Gly Thr Arg Ile Val Leu His Leu Lys 165 170 175Glu Asp Gln Gln Glu Tyr Leu Glu Glu Arg Arg Leu Lys Asp Leu Ile 180 185 190Lys Lys His Ser Glu Phe Ile Gly Tyr Asp Ile Glu Leu Met Val Glu 195 200 205Lys Ala Thr Glu Lys Glu Val Thr Asp Glu Asp Glu Asp Glu Ala Ala 210 215 220Ala Thr Lys Asn Glu Glu Gly Glu Glu Pro Lys Val Glu Glu Val Lys225 230 235 240Asp Asp Ala Glu Glu Gly Glu Lys Lys Lys Lys Thr Lys Lys Val Lys 245 250 255Glu Val Thr Gln Glu Phe Val Val Gln Asn Lys His Lys Pro Leu Trp 260 265 270Thr Arg Asp Pro Lys Asp Val Thr Lys Glu Glu Tyr Ala Ala Phe Tyr 275 280 285Lys Ala Ile Ser Asn Asp Trp Glu Glu Pro Leu Ser Thr Lys His Phe 290 295 300Ser Val Glu Gly Gln Leu Glu Phe Arg Ala Ile Leu Phe Val Pro Lys305 310 315 320Arg Ala Pro Phe Asp Met Phe Glu Pro Ser Lys Lys Arg Asn Asn Ile 325 330 335Lys Leu Tyr Val Arg Arg Val Phe Ile Met Asp Asn Cys Glu Asp Leu 340 345 350Cys Pro Glu Trp Leu Ala Phe Val Arg Gly Val Val Asp Ser Glu Asp 355 360 365Leu Pro Leu Asn Ile Ser Arg Glu Asn Leu Gln Gln Asn Lys Ile Leu 370 375 380Lys Val Ile Arg Lys Asn Ile Val Lys Lys Ala Leu Glu Leu Phe Glu385 390 395 400Glu Ile Ala Glu Asn Lys Glu Asp Tyr Lys Lys Phe Tyr Glu Gln Phe 405 410 415Gly Lys Asn Val Lys Leu Gly Ile His Glu Asp Ser Ala Asn Arg Lys 420 425 430Lys Leu Met Glu Leu Leu Arg Phe His Ser Ser Glu Ser Gly Glu Asp 435 440 445Met Thr Thr Leu Lys Asp Tyr Val Thr Arg Met Lys Glu Gly Gln Lys 450 455 460Cys Ile Tyr Tyr Val Thr Gly Asp Ser Lys Lys Lys Leu Glu Thr Ser465 470 475 480Pro Phe Ile Glu Gln Ala Arg Arg Arg Gly Phe Glu Val Leu Phe Met 485 490 495Thr Glu Pro Ile Asp Glu Tyr Val Met Gln Gln Val Lys Asp Phe Glu 500 505 510Asp Lys Lys Phe Ala Cys Leu Thr Lys Glu Gly Val His Phe Glu Glu 515 520 525Thr Glu Glu Glu Lys Lys Gln Arg Glu Glu Glu Lys Thr Ala Tyr Glu 530 535 540Arg Leu Cys Lys Ala Met Lys Asp Val Leu Gly Asp Lys Val Glu Lys545 550 555 560Val Val Val Ser Glu Arg Leu Ala Thr Ser Pro Cys Ile Leu Val Thr 565 570 575Ser Glu Phe Gly Trp Ser Ala His Met Glu Gln Ile Met Arg Asn Gln 580 585 590Ala Leu Arg Asp Ser Ser Met Ser Ala Tyr Met Met Ser Lys Lys Thr 595 600 605Met Glu Ile Asn Pro Ala His Pro Ile Val Lys Glu Leu Lys Arg Arg 610 615 620Val Glu Ala Asp Glu Asn Asp Lys Ala Val Lys Asp Leu Val Tyr Leu625 630 635 640Leu Phe Asp Thr Ala Leu Leu Thr Ser Gly Phe Thr Leu Asp Asp Pro 645 650 655Thr Ser Tyr Ala Glu Arg Ile His Arg Met Ile Lys Leu Gly Leu Ser 660 665 670Leu Asp Asp Glu Asp Asn Gly Asn Glu Glu Ala Glu Pro Ala Ala Ala 675 680 685Val Pro Ala Glu Pro Val Ala Gly Thr Ser Ser Met Glu Gln Val Asp 690 695 700 18 732 PRT Homo sapien 18Met Pro Glu Glu Thr Gln Thr Gln Asp Gln Pro Met Glu Glu Glu Glu 1 5 10 15Val Glu Thr Phe Ala Phe Gln Ala Glu Ile Ala Gln Leu Met Ser Leu 20 25 30Ile Ile Asn Thr Phe Tyr Ser Asn Lys Glu Ile Phe Leu Arg Glu Leu 35 40 45Ile Ser Asn Ser Ser Asp Ala Leu Asp Lys Ile Arg Tyr Glu Ser Leu 50 55 60Thr Asp Pro Ser Lys Leu Asp Ser Gly Lys Glu Leu His Ile Asn Leu65 70 75 80Ile Pro Asn Lys Gln Asp Arg Ala Leu Thr Ile Val Asp Thr Gly Ile 85 90 95Gly Met Thr Lys Ala Asp Leu Ile Asn Asn Leu Gly Thr Ile Ala Lys 100 105 110Ser Gly Thr Lys Ala Phe Met Glu Ala Leu Gln Ala Gly Ala Asp Ile 115 120 125Ser Met Ile Gly Gln Phe Gly Val Gly Phe Tyr Ser Ala Tyr Leu Val 130 135 140Ala Glu Lys Val Thr Val Ile Thr Lys His Asn Asp Asp Glu Gln Tyr145 150 155 160Ala Trp Glu Ser Ser Ala Gly Gly Ser Phe Thr Val Arg Thr Asp Thr 165 170 175Gly Glu Pro Met Gly Arg Gly Thr Lys Val Ile Leu His Leu Lys Glu 180 185 190Asp Gln Thr Glu Tyr Leu Glu Glu Arg Arg Ile Lys Glu Ile Val Lys 195 200 205Lys His Ser Gln Phe Ile Gly Tyr Pro Ile Thr Leu Phe Val Glu Lys 210 215 220Glu Arg Asp Lys Glu Val Ser Asp Asp Glu Ala Glu Glu Lys Glu Asp225 230 235 240Lys Glu Glu Glu Lys Glu Lys Glu Glu Lys Glu Ser Glu Asp Lys Pro 245 250 255Glu Ile Glu Asp Val Gly Ser Asp Glu Glu Asp Glu Lys Lys Asp Gly 260 265 270Asp Lys Lys Lys Lys Lys Lys Ile Lys Glu Lys Tyr Ile Asp Lys Glu 275 280 285Glu Leu Asn Lys Thr Lys Pro Ile Trp Thr Arg Asn Pro Asp Asp Ile 290 295 300Thr Asn Glu Glu Tyr Gly Glu Phe Tyr Lys Ser Leu Thr Asn Asp Trp305 310 315 320Glu Asp His Leu Ala Val Lys His Phe Ser Val Glu Gly Gln Leu Glu 325 330 335Phe Arg Ala Leu Leu Phe Val Pro Arg Arg Ala Pro Phe Asp Leu Phe 340 345 350Glu Asn Arg Lys Lys Lys Asn Asn Ile Lys Leu Tyr Val Arg Arg Val 355 360 365Phe Ile Met Asp Asn Cys Glu Glu Leu Ile Pro Glu Tyr Leu Asn Phe 370 375 380Ile Arg Gly Val Val Asp Ser Glu Asp Leu Pro Leu Asn Ile Ser Arg385 390 395 400Glu Met Leu Gln Gln Ser Lys Ile Leu Lys Val Ile Arg Lys Asn Leu 405 410 415Val Lys Lys Cys Leu Glu Leu Phe Thr Glu Leu Ala Glu Asp Lys Glu 420 425 430Asn Tyr Lys Lys Phe Tyr Glu Gln Phe Ser Lys Asn Ile Lys Leu Gly 435 440 445Ile His Glu Asp Ser Gln Asn Arg Lys Lys Leu Ser Glu Leu Leu Arg 450 455 460Tyr Tyr Thr Ser Ala Ser Gly Asp Glu Met Val Ser Leu Lys Asp Tyr465 470 475 480Cys Thr Arg Met Lys Glu Asn Gln Lys His Ile Tyr Tyr Ile Thr Gly 485 490 495Glu Thr Lys Asp Gln Val Ala Asn Ser Ala Phe Val Glu Arg Leu Arg 500 505 510Lys His Gly Leu Glu Val Ile Tyr Met Ile Glu Pro Ile Asp Glu Tyr 515 520 525Cys Val Gln Gln Leu Lys Glu Phe Glu Gly Lys Thr Leu Val Ser Val 530 535 540Thr Lys Glu Gly Leu Glu Leu Pro Glu Asp Glu Glu Glu Lys Lys Lys545 550 555 560Gln Glu Glu Lys Lys Thr Lys Phe Glu Asn Leu Cys Lys Ile Met Lys 565 570 575Asp Ile Leu Glu Lys Lys Val Glu Lys Val Val Val Ser Asn Arg Leu 580 585 590Val Thr Ser Pro Cys Cys Leu Val Thr Ser Thr Tyr Gly Trp Thr Ala 595 600 605Asn Met Glu Arg Ile Met Lys Ala Gln Ala Leu Arg Asp Asn Ser Thr 610 615 620Met Gly Tyr Met Ala Ala Lys Lys His Leu Glu Ile Asn Pro Asp His625 630 635 640Ser Ile Ile Glu Thr Leu Arg Gln Lys Ala Glu Ala Asp Lys Asn Asp 645 650 655Lys Ser Val Lys Asp Leu Val Ile Leu Leu Tyr Glu Thr Ala Leu Leu 660 665 670Ser Ser Gly Phe Ser Leu Glu Asp Pro Gln Thr His Ala Asn Arg Ile 675 680 685Tyr Arg Met Ile Lys Leu Gly Leu Gly Ile Asp Glu Asp Asp Pro Thr 690 695 700Ala Asp Asp Thr Ser Ala Ala Val Thr Glu Glu Met Pro Pro Leu Glu705 710 715 720Gly Asp Asp Asp Thr Ser Arg Met Glu Glu Val Asp 725 730 19 1019 DNA Leishmania major 19gaattcggca cgaggtttct gtactttatt gcttccagcc tttattcact cttcgatttc 60ctctaacacc atgtcctccg agcgcacctt tattgccgtc aagccggacg gcgtgcagcg 120cggcctcgtt ggcgagatca tcgcccgctt cgagcgcaag ggctacaagc tcgtcgcctt 180gaagatactg cagccgacga cggagcaggc ccagggtcac tataaggacc tttgctccaa 240gccgtttttc ccggcccttg tgaagtactt ctcctctggc ccgatcgtgt gtatggtgtg 300ggagggtaag aacgtggtga agagcggccg cgtgctgctc ggcgcgacga acccggccga 360ctcacagccc ggcacgatcc gtggcgactt tgccgtggat gtgggccgca acgtgtgcca 420cgggtccgac tctgtggaga gcgcggagcg cgagatcgcc ttttggttca aggcggatga 480gatcgcgagc tggacgtcgc actccgtgtc ccagatctat gagtaacggt gattgcggac 540acgctttgag gacgtagctg tacccccaat gaattcttct ctgaaaacca catcataagc 600ctcttaagag gttatttttc ttgatcgatg cccggtggtg accagcacca ttcctttatc 660ggattcactc acactcctag cgaatcatgt agtgcggtga gagtgggctc tggaggagac 720tgttgtgtag ccatggcttc aggagagaaa acaaaataca aggaaaggca atatgtaact 780atggggttcc cttttttact atgcaaagtt tttataactc ctgatcggca aaaacaacaa 840caaccgccat acaccaagag caaatgcttt cttctgcgga ctgtgcttct gttttttttt 900atgaaggagt gactcgcgcg atgaaaagtg tgtgcgtggg agatgtattt cctttttttg 960ttcatagtgg cgacagctca ctgttgacga tgacaaaaaa aaaaaaaaaa aaactcgag 1019 20 151 PRT Leishmania major 20Met Ser Ser Glu Arg Thr Phe Ile Ala Val Lys Pro Asp Gly Val Gln 1 5 10 15Arg Gly Leu Val Gly Glu Ile Ile Ala Arg Phe Glu Arg Lys Gly Tyr 20 25 30Lys Leu Val Ala Leu Lys Ile Leu Gln Pro Thr Thr Glu Gln Ala Gln 35 40 45Gly His Tyr Lys Asp Leu Cys Ser Lys Pro Phe Phe Pro Ala Leu Val 50 55 60Lys Tyr Phe Ser Ser Gly Pro Ile Val Cys Met Val Trp Glu Gly Lys65 70 75 80Asn Val Val Lys Ser Gly Arg Val Leu Leu Gly Ala Thr Asn Pro Ala 85 90 95Asp Ser Gln Pro Gly Thr Ile Arg Gly Asp Phe Ala Val Asp Val Gly 100 105 110Arg Asn Val Cys His Gly Ser Asp Ser Val Glu Ser Ala Glu Arg Glu 115 120 125Ile Ala Phe Trp Phe Lys Ala Asp Glu Ile Ala Ser Trp Thr Ser His 130 135 140Ser Val Ser Gln Ile Tyr Glu145 150 21 1523 DNA Leishmania major 21gaattcggca cgagtgctgc ccgacatgac atgctcgctg accggacttc agtgcacaga 60cccgaactgc aagacctgca caacttacgg tcagtgcaca gactgcaacg acggctacgg 120tctcacctcc tccagcgttt gcgtgcgctg cagtgtagcg ggctgcaaga gctgccccgt 180cgacgctaac gtctgcaaag tgtgtctcgg cggcagcgag ccgatcaaca atatgtgccc 240ctgcaccgac cccaactgcg ccagctgccc cagcgacgct ggcacgtgca ctcagtgcgc 300gaacggctac ggtctcgtgg acggcgcctg tgtgagatgc caggagccca actgcttcag 360ctgcgacagc gacgcgaata agtgcacaca atgtgcgccg aactactacc tcaccccgct 420cttgacctgc tccccggtgg cctgcaacat cgagcactgc atgcagtgcg acccacagac 480gccgtcgcgc tgccaggagt gcgtgtcccc ctacgtggtt gacagctacg acggcctctg 540caggctctcc gatgcctgct ccgtgcccaa ctgcaagaag tgcgagaccg gtacctccag 600gctctgcgcc gagtgcgaca ccggctacag tctctccgcc gacgcgacga gctgcagcag 660tccaaccacg cagccgtgcg aggtggagca ctgcaacaca tgtgtgaacg gcgatagcac 720ccgctgtgcc tactgcaaca ccggctacta cgtctccgat ggcaagtgca aggccatgca 780gggctgctac gtgtcgaact gcgcgcagtg catgctgctt gacagcacca agtgctccac 840gtgcgtgaaa gggtacctgc tcacgtcgtc ctacagttgc gtctcgcaga aagtcatcaa 900cagtgcggcc gcgccctact ctctgtgggt ggccgccgcc gtgctcctca cctcttttgc 960catgcaccta gcatagtgcg cagcggcatg cgaacaaccc cactctcatt ctccaacatg 1020tgcatacaca cacacacaga cagcggggca gcaccccctc cccacacaca cacacgcact 1080tcccccttgt cttgttcttc tttcctcgtt cgcatttctt tctctcgtgc gctggcgccg 1140gcctcctgca cgtcgctccc ctccccctaa cctctattct ctctctctct ctctctcgcc 1200ggcatcattg cttcttaccc ttttctgatc cttgctcgcg tgggcggaca ctgccacagt 1260cccacagcgc agacacacgt gtttaaacgg cgcaggcatc cctccctatc acttcatttc 1320tcctaaagcc actcaccaag tcgcacaccg ccctccccca tcggccgccc ttccgggcgc 1380agctgtgcgg aatgggtgtg tgctcgacct cgttcctggc agctcactcg catgtgtaca 1440gccactccaa ccacgaaagc tctcttctgc gcacataaaa aaaaaaaaaa aaaaaaaact 1500cgaggggggg cccggtaccc aaa 1523 22 320 PRT Leishmania major 22Val Leu Pro Asp Met Thr Cys Ser Leu Thr Gly Leu Gln Cys Thr Asp 1 5 10 15Pro Asn Cys Lys Thr Cys Thr Thr Tyr Gly Gln Cys Thr Asp Cys Asn 20 25 30Asp Gly Tyr Gly Leu Thr Ser Ser Ser Val Cys Val Arg Cys Ser Val 35 40 45Ala Gly Cys Lys Ser Cys Pro Val Asp Ala Asn Val Cys Lys Val Cys 50 55 60Leu Gly Gly Ser Glu Pro Ile Asn Asn Met Cys Pro Cys Thr Asp Pro65 70 75 80Asn Cys Ala Ser Cys Pro Ser Asp Ala Gly Thr Cys Thr Gln Cys Ala 85 90 95Asn Gly Tyr Gly Leu Val Asp Gly Ala Cys Val Arg Cys Gln Glu Pro 100 105 110Asn Cys Phe Ser Cys Asp Ser Asp Ala Asn Lys Cys Thr Gln Cys Ala 115 120 125Pro Asn Tyr Tyr Leu Thr Pro Leu Leu Thr Cys Ser Pro Val Ala Cys 130 135 140Asn Ile Glu His Cys Met Gln Cys Asp Pro Gln Thr Pro Ser Arg Cys145 150 155 160Gln Glu Cys Val Ser Pro Tyr Val Val Asp Ser Tyr Asp Gly Leu Cys 165 170 175Arg Leu Ser Asp Ala Cys Ser Val Pro Asn Cys Lys Lys Cys Glu Thr 180 185 190Gly Thr Ser Arg Leu Cys Ala Glu Cys Asp Thr Gly Tyr Ser Leu Ser 195 200 205Ala Asp Ala Thr Ser Cys Ser Ser Pro Thr Thr Gln Pro Cys Glu Val 210 215 220Glu His Cys Asn Thr Cys Val Asn Gly Asp Ser Thr Arg Cys Ala Tyr225 230 235 240Cys Asn Thr Gly Tyr Tyr Val Ser Asp Gly Lys Cys Lys Ala Met Gln 245 250 255Gly Cys Tyr Val Ser Asn Cys Ala Gln Cys Met Leu Leu Asp Ser Thr 260 265 270Lys Cys Ser Thr Cys Val Lys Gly Tyr Leu Leu Thr Ser Ser Tyr Ser 275 280 285Cys Val Ser Gln Lys Val Ile Asn Ser Ala Ala Ala Pro Tyr Ser Leu 290 295 300Trp Val Ala Ala Ala Val Leu Leu Thr Ser Phe Ala Met His Leu Ala305 310 315 320 23 797 DNA Leishmania major 23ctgtacttta ttgccaccag ccagccatgt cctgcggtaa cgccaagatc aactctcccg 60cgccgtcctt cgaggaggtg gcgctcatgc ccaacggcag cttcaagaag atcagcctct 120cctcctacaa gggcaagtgg gtcgtgctct tcttctaccc gctcgacttt agcttcgtgt 180gcccgacaga ggtcatcgcg ttctccgaca gcgtgagtcg cttcaacgag ctcaactgcg 240aggtcctcgc gtgctcgata gacagcgagt acgcgcacct gcagtggacg ctgcaggacc 300gcaagaaggg cggcctcggg accatggcga tcccaatgct agccgacaag accaagagca 360tcgctcgttc ctacggcgtg ctggaggaga gccagggcgt ggcctaccgc ggtctcttca 420tcatcgaccc ccatggcatg ctgcgtcaga tcaccgtcaa tgacatgccg gtgggccgca 480gcgtggagga ggttctacgc ctgctggagg cttttcagtt cgtggagaag cacggcgagg 540tgtgccccgc gaactggaag aagggcgccc ccacgatgaa gccggaaccg aatgcgtctg 600tcgagggata cttcagcaag cagtaaacct gtgagcgtcg caggagtcag tgtgacctca 660cccgcctctg ccagtgggtg cgagagggcg tgagggattg tgggaaggct gttggatatg 720atgcagacag cgatgaatgc aactcccaca cactggccct cctcagccct ctccacacag 780acacacgcac gcatgtg 797 24 199 PRT Leishmania major 24Met Ser Cys Gly Asn Ala Lys Ile Asn Ser Pro Ala Pro Ser Phe Glu 1 5 10 15Glu Val Ala Leu Met Pro Asn Gly Ser Phe Lys Lys Ile Ser Leu Ser 20 25 30Ser Tyr Lys Gly Lys Trp Val Val Leu Phe Phe Tyr Pro Leu Asp Phe 35 40 45Ser Phe Val Cys Pro Thr Glu Val Ile Ala Phe Ser Asp Ser Val Ser 50 55 60Arg Phe Asn Glu Leu Asn Cys Glu Val Leu Ala Cys Ser Ile Asp Ser65 70 75 80Glu Tyr Ala His Leu Gln Trp Thr Leu Gln Asp Arg Lys Lys Gly Gly 85 90 95Leu Gly Thr Met Ala Ile Pro Met Leu Ala Asp Lys Thr Lys Ser Ile 100 105 110Ala Arg Ser Tyr Gly Val Leu Glu Glu Ser Gln Gly Val Ala Tyr Arg 115 120 125Gly Leu Phe Ile Ile Asp Pro His Gly Met Leu Arg Gln Ile Thr Val 130 135 140Asn Asp Met Pro Val Gly Arg Ser Val Glu Glu Val Leu Arg Leu Leu145 150 155 160Glu Ala Phe Gln Phe Val Glu Lys His Gly Glu Val Cys Pro Ala Asn 165 170 175Trp Lys Lys Gly Ala Pro Thr Met Lys Pro Glu Pro Asn Ala Ser Val 180 185 190Glu Gly Tyr Phe Ser Lys Gln 195 25 637 DNA Leishmania tropica 25ttacatatgc atcaccacca ccaccacatg tcctgcggta acgccaagat caactctccc 60gcgccgccct tcgaggagat ggcgctcatg cccaacggca gcttcaagaa gatcagcctc 120tccgcctaca agggcaagtg ggtcgtgctc ttcttctacc cgctcgactt caccttcgtg 180tgcccgacag agatcatcgc gttctccgac aacgtgagtc gcttcaacga gctcaactgc 240gaggtcctcg cgtgctcgat ggacagcgag tacgcgcacc tgcagtggac gctgcaggac 300cgcaagaagg gcggcctcgg ggccatggcg atcccaatgc tggccgacaa gactaagagc 360atcgctcgtt cctacggcgt gctggaggag agccagggcg tggcctaccg cggtctcttc 420atcatcgacc cccgtggcat ggtgcgtcag atcaccgtca acgacatgcc ggtgggccgc 480aacgtggagg aggctctgcg cctgctggag gctttgcagt tcgtggagaa gcacggcgag 540gtgtgccccg cgaactggaa gaagggcgcc cccacgatga agccggaacc gaaggcgtct 600gtcgagggat acttcagcaa gcagtaagaa ttccatg 637 26 206 PRT Leishmania tropica 26Met His His His His His His Met Ser Cys Gly Asn Ala Lys Ile Asn 1 5 10 15Ser Pro Ala Pro Pro Phe Glu Glu Met Ala Leu Met Pro Asn Gly Ser 20 25 30Phe Lys Lys Ile Ser Leu Ser Ala Tyr Lys Gly Lys Trp Val Val Leu 35 40 45Phe Phe Tyr Pro Leu Asp Phe Thr Phe Val Cys Pro Thr Glu Ile Ile 50 55 60Ala Phe Ser Asp Asn Val Ser Arg Phe Asn Glu Leu Asn Cys Glu Val65 70 75 80Leu Ala Cys Ser Met Asp Ser Glu Tyr Ala His Leu Gln Trp Thr Leu 85 90 95Gln Asp Arg Lys Lys Gly Gly Leu Gly Ala Met Ala Ile Pro Met Leu 100 105 110Ala Asp Lys Thr Lys Ser Ile Ala Arg Ser Tyr Gly Val Leu Glu Glu 115 120 125Ser Gln Gly Val Ala Tyr Arg Gly Leu Phe Ile Ile Asp Pro Arg Gly 130 135 140Met Val Arg Gln Ile Thr Val Asn Asp Met Pro Val Gly Arg Asn Val145 150 155 160Glu Glu Ala Leu Arg Leu Leu Glu Ala Leu Gln Phe Val Glu Lys His 165 170 175Gly Glu Val Cys Pro Ala Asn Trp Lys Lys Gly Ala Pro Thr Met Lys 180 185 190Pro Glu Pro Lys Ala Ser Val Glu Gly Tyr Phe Ser Lys Gln 195 200 205 27 51 DNA Artificial Sequence PCR primer 27caattacata tgcatcacca tcaccatcac atgtcctgcg gtaacgccaa g 51 28 31 DNA Artificial Sequence PCR primer 28catggaattc ttactgcttg ctgaagtatc c 31 29 520 DNA Leishmania major misc_feature (1)...(520) n = A, T, C or G 29ggcacgagcc cttgcctaca tttgctcgcc gatattcgcg gggagttctt caatttgcgt 60cgcgtagaac tgctcaatgt cgcgcaacaa gcgcagctcg tcgtggcgca cgaaggtgat 120ggccagtcca gtgcggccca tgcggccagt gcggccgatg cggtgaatgt actgctcacg 180cgcgagcggc aaatcgtagc tgaggacgag cgagacgcgc tccacatcaa tgccacgcgc 240ccacaggtcc gttgtaatga ncacgcggct gtgtccatta cggaatgccg cataatctcg 300tcgcgctccg cctggggcat gtcgccgtgc atggcggaca cagcgaaatt ctcgcgcgtc 360atcttcttgg caagctgctc cacctttttg cgggtgttgc anaaaaccac ngcgtgggcg 420atcgttaagc tgtcgtacaa actccatcaa gaaatcgaat ttgtttttct cttcgtcnac 480nganacaaan tactgtttaa cgctntccac ggtgatctca 520 30 600 DNA Leishmania major misc_feature (1)...(600) n = A, T, C or G 30ggcacaaggt tttcgggtta tcttcacgca tggtggagcg cagatgggtg aagtaaatac 60gcggaccgaa ctgcttgatc atatcaacca gatcgttgtc agcacgcacg ccgtangaac 120cggtgcacat ggtaaaaccg tntgccatgc tgtttacggt atcaaccatc cactgcatat 180cttcaatggt ggaaacaatg cgcggcaggc cgaggatccg gcgcggctca tcatnnagnt 240natnaaccan tcgcacgtct anttctgcac taaactacaa ntatcggtna catatnataa 300ggccnatttt cggtccagga ntatgtnctn tcaaaatgcc ncgttannca ctcttaaatg 360tctcangngn aaantngttc taaagggtgt ccaaaanntn nttaccnttc cccncttact 420tcaananctc ctcnaattcc cnggcccttn gacnannatt tnctattaaa anatanaann 480ttcaaattna ttcccnacct nccntnncca aanntancna ataatcannc ccctntcann 540anntcccanc ttaccctccn ntngnngggn nnnccnattn ccccaanccc ncnctaaata 600 31 600 DNA Leishmania major misc_feature (1)...(600) n = A, T, C or G 31ggcacgagcc tcagtggagc tcaatgaaga tattgcagta tcttactctg gatggcactc 60aggtctccgg cacgctgccg ccccagtgga gcgcgatggc atcggtgcga attcttaacc 120tgnagggtac tgaggtctct ggtacgctgc cgcctgagtg gatatcnatg ancaggctgc 180aaactctgaa tctgcggcgc acgaaantat ccggcactct gccgcccgaa tgganttcta 240tgaacagcct ggagtacttt cacctttatc ttactcaggt ctccggcacg ctgccgcccg 300agtggagtgg gatgtcnaag gccgcatact tctggctgga atactgcgac ctgtccggca 360ntctgccgcc cnagtggtcg tcnatgccaa agctgcgcgg tatctcactg ancggcaaca 420aattcttgcg ngtgtntncc ngactcntgg gattcagaaa ggtggtcctt gttgttgggc 480atcnaaggan caaaccccaa ngggcccncn aattgcttgg gcntgcttaa gganttgcac 540naaccaacnc cnccaaaaac cccccccacc ncnaaannac nancccccac ttaanncccn 600 32 600 DNA Leishmania major misc_feature (1)...(600) n = A,T,C or G 32ngcacgagaa gcgcaactgg cgcatcgcat ctgtgactat ctgcctgaac aggggcaatn 60gtttgttggt aacagcctgg tggtacgtct gattgatncg cttncgcaan ttccggcagg 120ttacccggtg tacancaacc gtggggccan cggtatcnac nggctgcttt cgaccgccgc 180cggngttcan cgggcaancg gcaaaccgac gctggcgatt gtgggcgatc tctccgcact 240ttacgatctc aacgcnctgg cgttattgcg tcaggtttct gcgccgctgg tattaattgt 300ggtgaacaac aacggcnggg caaaattttc tcgctgttgc caacgccccc aaagcnagcg 360tgaagcgttt ctatctgatg ccgcaaaacg tccattttga aacacgccgc cncccatgtt 420tcganctgaa aatatcatcg tccgcaaaac tggcangaaa cttngaaaac cgcattttgc 480cgacnccctg gcncacgccc aacccaccca ccggttgatt gaaaatggtg ggttaacgaa 540nccnnatggg tgccccaaan cncnnccanc caaatttctg ggcccaggtt aaancccttt 600 33 600 DNA Leishmania major misc_feature (1)...(600) n = A,T,C or G 33acgatgacca tgccccgaag gaggatggcc atgcgccgaa gaacgatgac catgccccga 60aggaggatgg ccatgcgccg aagaacgatg accatgcccc gaaggaggat ggccatgcgc 120cgaagaacga cggggatgtg cagaanaaga gcgaagatgg agacaacgtg ggagagggag 180gcaagggcaa tgaggatggt aacgatgatc agccgaagga gcacgctgcc ggcaactagt 240gggctgcgtc cgggcttgtg tgcganccgt gctctgcacc ccgccgctcg tgcatcctcg 300catgtggact gcgtgtgtct ctcccgcttt gtctctctcc cccacacagt ggctgatgcc 360tgcacggggt tgctgtggct gcacctcctg accactgcca gctttcttgg cttgcctccc 420ctctgcgcct ccgctcgtgc cgctcgtgcc gaattcgata tcaagcttat cgataccgtc 480nacctcgaag gggggcccgg ttacccattc gccctatant gagtcntatt acaattcctg 540gcgtcgtttt acacgtcgtg actgggaaaa accctggcgt tccccactta tcgccttgca 600 34 516 DNA Leishmania major 34agctgcagca gcgcctagac accgccacgc agcagcgcgc cgagctggag gcacgggtgg 60cacggctggc cgcggaccgc gacgaggcgc gccagcagct ggccgcgaac gccgaggagc 120tgcagcagcg cctagacacc gccacgcagc agcgcgccga gctggaggca cgggtggcac 180ggctggccgc ggacggcgac gaggcccgcc agcagctggc cgcgaacgcc gaggagctgc 240agcagcgcct agacaccgcc acgcagcagc gcgccgagct ggaggcacag gtggcacggc 300tggccgcgaa cgccgaggag ctgcagcagc gcctagacac cgccacgcag cagcgcgccg 360agctggaggc acgggtggca cggctggccg cggaccgcga cgaggcgcgc cagcagctgg 420ccgcgaacgc cgaggagctg cagcagcgcc tagacaccgc cacgcagcag cgcgccgagc 480tggargcaca ggtggcacgg ctggccgcga amgccg 516 35 822 DNA Leishmania major misc_feature (1)...(822) n = A,T,C or G 35ggcacganag atcttcgtga agacgctgac cggcaanacg atcgcgctgg aggtggagcc 60gagcgacacg atcgagaacg tgaaggccaa gatccaggac aaggagggca tcccgccgga 120ccagcagcgc ctgatcttcg ccggcaagca gctggaggan ggccgcacgc tctcggacta 180caacatccag aaggagtcca cgctgcacct ggtgctgcgc ctgcgcggcg gcatgcanat 240cttcgtgaaa acgctnaccg gcaanacaat cgcgctggaa gtggagccga acgaccnatc 300gaaaacgtga aggccnanat ccangacaag gaaggcntcc cgccgganca gcacgcctga 360tcttccnccg gcaaccactt gangaagggc ncacgctctc ngactacnac atccanaaag 420gattccnccc tgcaccttgt tgcttgcncc ttgctcgggg ggcatgccna atcttccttn 480aaaacctcaa ccggcaanaa caatcccccn cngaagttgg aacccaacca ncccattcna 540aaactttaaa ggccnnnatt ccngaacaan gaagggcttc ccccccggac cnncaancnc 600cctgattntt cccccggnnn ncantttgga angaagggcc ccnccctccn ccgaattncn 660acntcccnaa anggattccc cccctnccct tgntttttgc gccnnnnnnc ggcnncntnc 720cnaaattccg nccnaaggnc cccantanan cnactttccc nttccccccc nnnnttttgc 780ntaaantttt tncccccnna aanntcccnt ttncnanttn an 822 36 146 PRT Leishmania major VARIANT (1)...(146) Xaa = Any Amino Acid 36Gly Thr Ser Pro Cys Leu His Leu Leu Ala Asp Ile Arg Gly Glu Phe 1 5 10 15Phe Asn Leu Arg Arg Val Glu Leu Leu Asn Val Ala Gln Gln Ala Gln 20 25 30Leu Val Val Ala His Glu Gly Asp Gly Gln Ser Ser Ala Ala His Ala 35 40 45Ala Ser Ala Ala Asp Ala Val Asn Val Leu Leu Thr Arg Glu Arg Gln 50 55 60Ile Val Ala Glu Asp Glu Arg Asp Ala Leu His Ile Asn Ala Thr Arg65 70 75 80Pro Gln Val Arg Cys Asn Xaa His Ala Ala Val Ser Ile Thr Glu Cys 85 90 95Arg Ile Ile Ser Ser Arg Ser Ala Trp Gly Met Ser Pro Cys Met Ala 100 105 110Asp Thr Ala Lys Phe Ser Arg Val Ile Phe Leu Ala Ser Cys Ser Thr 115 120 125Phe Leu Arg Val Leu Xaa Lys Thr Thr Ala Trp Ala Ile Val Lys Leu 130 135 140Ser Tyr145 37 77 PRT Leishmania major VARIANT (1)...(77) Xaa = Any Amino Acid 37Ala Gln Gly Phe Arg Val Ile Phe Thr His Gly Gly Ala Gln Met Gly 1 5 10 15Glu Val Asn Thr Arg Thr Glu Leu Leu Asp His Ile Asn Gln Ile Val 20 25 30Val Ser Thr His Ala Val Xaa Thr Gly Ala His Gly Lys Thr Val Cys 35 40 45His Ala Val Tyr Gly Ile Asn His Pro Leu His Ile Phe Asn Gly Gly 50 55 60Asn Asn Ala Arg Gln Ala Glu Asp Pro Ala Arg Leu Ile65 70 75 38 68 PRT Leishmania major VARIANT (1)...(68) Xaa = Any Amino Acid 38His Glu Pro Gln Trp Ser Ser Met Lys Ile Leu Gln Tyr Leu Thr Leu 1 5 10 15Asp Gly Thr Gln Val Ser Gly Thr Leu Pro Pro Gln Trp Ser Ala Met 20 25 30Ala Ser Val Arg Ile Leu Asn Leu Xaa Gly Thr Glu Val Ser Gly Thr 35 40 45Leu Pro Pro Glu Trp Ile Ser Met Xaa Arg Leu Gln Thr Leu Asn Leu 50 55 60Arg Arg Thr Lys65 39 65 PRT Leishmania major VARIANT (1)...(65) Xaa = Any Amino Acid 39Ala Arg Glu Ala Gln Leu Ala His Arg Ile Cys Asp Tyr Leu Pro Glu 1 5 10 15Gln Gly Gln Xaa Phe Val Gly Asn Ser Leu Val Val Arg Leu Ile Asp 20 25 30Xaa Leu Xaa Gln Xaa Pro Ala Gly Tyr Pro Val Tyr Xaa Asn Arg Gly 35 40 45Ala Xaa Gly Ile Xaa Xaa Leu Leu Ser Thr Ala Ala Gly Val Xaa Arg 50 55 60Ala65 40 78 PRT Leishmania major VARIANT (1)...(78) Xaa = Any Amino Acid 40Asp Asp His Ala Pro Lys Glu Asp Gly His Ala Pro Lys Asn Asp Asp 1 5 10 15His Ala Pro Lys Glu Asp Gly His Ala Pro Lys Asn Asp Asp His Ala 20 25 30Pro Lys Glu Asp Gly His Ala Pro Lys Asn Asp Gly Asp Val Gln Xaa 35 40 45Lys Ser Glu Asp Gly Asp Asn Val Gly Glu Gly Gly Lys Gly Asn Glu 50 55 60Asp Gly Asn Asp Asp Gln Pro Lys Glu His Ala Ala Gly Asn65 70 75 41 169 PRT Leishmania major 41Leu Gln Gln Arg Leu Asp Thr Ala Thr Gln Gln Arg Ala Glu Leu Glu 1 5 10 15Ala Arg Val Ala Arg Leu Ala Ala Asp Arg Asp Glu Ala Arg Gln Gln 20 25 30Leu Ala Ala Asn Ala Glu Glu Leu Gln Gln Arg Leu Asp Thr Ala Thr 35 40 45Gln Gln Arg Ala Glu Leu Glu Ala Arg Val Ala Arg Leu Ala Ala Asp 50 55 60Gly Asp Glu Ala Arg Gln Gln Leu Ala Ala Asn Ala Glu Glu Leu Gln65 70 75 80Gln Arg Leu Asp Thr Ala Thr Gln Gln Arg Ala Glu Leu Glu Ala Gln 85 90 95Val Ala Arg Leu Ala Ala Asn Ala Glu Glu Leu Gln Gln Arg Leu Asp 100 105 110Thr Ala Thr Gln Gln Arg Ala Glu Leu Glu Ala Arg Val Ala Arg Leu 115 120 125Ala Ala Asp Arg Asp Glu Ala Arg Gln Gln Leu Ala Ala Asn Ala Glu 130 135 140Glu Leu Gln Gln Arg Leu Asp Thr Ala Thr Gln Gln Arg Ala Glu Leu145 150 155 160Glu Ala Gln Val Ala Arg Leu Ala Ala 165 42 98 PRT Leishmania major VARIANT (1)...(98) Xaa = Any Amino Acid 42Ala Arg Xaa Ile Phe Val Lys Thr Leu Thr Gly Xaa Thr Ile Ala Leu 1 5 10 15Glu Val Glu Pro Ser Asp Thr Ile Glu Asn Val Lys Ala Lys Ile Gln 20 25 30Asp Lys Glu Gly Ile Pro Pro Asp Gln Gln Arg Leu Ile Phe Ala Gly 35 40 45Lys Gln Leu Glu Xaa Gly Arg Thr Leu Ser Asp Tyr Asn Ile Gln Lys 50 55 60Glu Ser Thr Leu His Leu Val Leu Arg Leu Arg Gly Gly Met Xaa Ile65 70 75 80Phe Val Lys Thr Leu Thr Gly Xaa Thr Ile Ala Leu Glu Val Glu Pro 85 90 95Asn Asp 43 39 PRT Leishmania major 43Leu Gln Gln Arg Leu Asp Thr Ala Thr Gln Gln Arg Ala Glu Leu Glu 1 5 10 15Ala Arg Val Ala Arg Leu Ala Ala Asp Arg Asp Glu Ala Arg Gln Gln 20 25 30Leu Ala Ala Asn Ala Glu Glu 35 44 600 DNA Leishmania chagasi misc_feature (1)...(600) n = A,T,C or G 44cggccgcctc agcgaggagg agatcgagcg catggtgcgc gaggctgccg agttcgagga 60tgaggaccgc aaggtgcgcg aacgtgtcga agcgaagaac tcgctagaga gcatcgcgta 120ctcgcttcgc aaccagatca acgacaagga caagcttggt gacaagctcg ccgcggacga 180caagaaggcg atcgaggagg ctgtgaagga tgccctcgac tttgtccacg agaaccccaa 240tgcagaccgt gaggagttcg aggctgctcg cacgaagctg cagagtgtga cgaaccccat 300cattcaaaag gtgtaccagg gcgccgccgg ctctggtgca gaagaggcgg acgcgatgga 360tgacttgtta gtcggccgcg tgaaaagaaa aacagggaaa gcgggaacat nccacaanaa 420ccnaagaaga aagggggtng cgacaccgct cgaacaccga cggcncacat ncntcatggg 480catgctcagc tttcctctcc ccaacaaacc agaaggtttt ctccaaacnc cgtctcngcn 540cccaaaatac ggaaangtta ancgaaaaan ccccttccac caattgnngt tcttttgttt 600 45 1748 DNA Leishmania chagasi 45ctagtggatc ccccgggctg caggaattca cggaatacgt acctcctccc ccttcttggt 60agaagaacaa caacaacgtt caagacgacg ccgcgccttc ttgtaccgca tttgcttctg 120agcacgttca atccgtgcct tgcaaacatg gaggcgtaca agaagctgga aacgatcttt 180acgaaggtct accgcctgga ccacttcctc ggtctgggca actgggacat gaacacaaac 240atgcccccca agggcgagga atcacgcggt gaggcgatgg cgatgctctc ggagctccgc 300tttggcttca tcacggcacc ggaggtgaaa agcctgattg agagtgccac caagggcagc 360gaggagctga atgcggtgca gcgcgctaac ttgcgggaga tgaggcgtgc gtggaagagc 420gccaccgcct tgccggctga gtttgtgggc cgcaagatgc gcctcacgac acacgcgcac 480agcgtgtggc gcgacagccg caaagcaaat gacttcgcca agttcctacc ggtgctcagg 540gacctggtgg cgctcgcccg tgaggagggc tcatacctcg ccgccggcac ctccctctcc 600ccgtatgagg cgctcatgaa cgagtacgag ccaggaatca cgacacaaaa gctggatgag 660gtgtacgcaa atgtaaagtc gtggctgccg cagctgctaa aggacattgt gcagaagcag 720tccggcgagt cggtgattgc gttctcgcat aagttcccgc aggacaagca ggaagcactg 780tgcaaggaat tcatgaagat ctggcacttc gacaccgatg ccggtcgcct cgacgtcagc 840ccccaccctt tcacgggaat gacgaaggag gactgccgac tcacaacaaa ctacatcgaa 900gacacgtttg ttcagagctt gtatggcgtc atccacgaga gtgggcatgg caagtacgag 960cagaactgtg gcccacgcga gcacatcacg cagccggtgt gcaacgcccg ctctcttggc 1020ctgcatgaga gccagagcct ctttgcggag tttcagatcg gccacgcgac gcccttcatc 1080gactacctca caactcgcct tcctgagttc ttcgaggcgc agccagcgtt ctcgcaggac 1140aacatgcgca agtcgctgca gcaggtgaag ccgggctaca ttcgcgtcga tgccgatgag 1200gtgtgctacc ctctgcacgt gatcctgcgc tacgagatcg agcgcgactt gatggagggc 1260aaaatggagg tggaagacgt gccgcgcgcg tggaacgcaa agatgcagga gtacttgggt 1320ctctcaacgg agggccgtga cgacgttggg tgcctgcagg acgtgcattg gtccatggtg 1380cgctcggcta ctctccgacg tactcgctcg gcgccatgta tgcggcgcag atcatggcga 1440gcatccgaaa ggagctggga gacgacaagg tggatgagtg cctgcgcacc ggtgagctcg 1500gccccctcct ggaaaagcag caggagaaga tctgggatca tgggtgcctg tacgagacgg 1560acgacctcat gacgcgtgcg acgggcgaga cgctgaaccc cgagtacctg cgccgccacc 1620tggaggcgcg ctacataaac gcctgagtcg cgagcggttg acacacgcgc tcgctagcac 1680atgacgcgtc tttattattc tttgttgtgc attcggaatt ccgcggaatt cgatatcaag 1740cttatcga 1748 46 560 DNA Leishmania chagasi misc_feature (1)...(560) n = A,T,C or G 46cggaaggagg atggccatac acagaaaaat gacggcgatg gccctaagga ggacggccgt 60acacagaaaa acgacgacgg tggccctaag gaggacggcc atacacagaa aaatgacggc 120gatggcccta aggaggacgg ccgtacacag aaaaataacg gcgatggccc tnaggaggac 180ggccatacac agaaaaatga cggcgatgcc cctnaggagg acggccgtac acanaaaaat 240gacggcnatg gccctnagga ggacggccgt acacagaaaa atgacngcca tggcccttag 300gangacgccg tacacagaaa aatgacgcna tggccctnag ggaggacggc catacccana 360aaaattgacg gcnatngccc ttaggangac ggccgtnccc anaaanantg acngcggtng 420cccttaagga agatgaaaat ctgccaccaa aacnattggg aatgcncagg aaaanaacna 480anatngaccc cacgtggggg atgganctta cngcnattaa nattgttacc attatcnacc 540naaggacnng ttgccgncaa 560 47 600 DNA Leishmania chagasi misc_feature (1)...(600) n = A,T,C or G 47cgtccgagaa acccgtacat gtatgctgct ggtagaaggc gcagagctgg tccctctgat 60gcacaagcat gaggtcgtac attgcctggt tcgtcatttt ccagagcaca acgagcagcg 120tcatcataca gcatccaata gccgccagag tgaatgcgat gcgcacacca agtcgaaagt 180ggtcgaccag taggggaatg tgaccctggc tggcgtgcaa catgatcgcc acgccagcgg 240tgggccacac cacaacagag gcgacgaaag agaacatgaa cttgctcacg aagctnacaa 300taagggcgtc gctngtgatg ctaagaacca cgccnaggta gacggcgaag ancaaactaa 360acacaagcgt gacgatcccg aaaagaagga tctctgcgga attttcgtga gataganaat 420gcccgtactg gaaaaanaag ccggcaggcg cgcgataacg ctgcaacttg ccgctcctcg 480cgggcgcgtt ttcgctcctt ctccgacttg atggcgcngt cngncttgac aaaacggtta 540agctcctcat gccccagccg attcccagct cacggtccac ttccggccat gcccacggac 600 48 1053 DNA Leishmania chagasi misc_feature (1)...(1053) n = A,T,C or G 48gggaaaaaag tggagctcca ccgcggtggc ggccgctcta gaactagtgg atcccccggg 60ctgcaggaat tccgcggaat tccgcggaat tccgcggaat tccgtccgac gcggcacccg 120cacaggggtc gacagtgacg caacctcctc caccactgcg gcctacgacg gcgccggctc 180cgcgccagtg atggttgacg ccaatgtgag ccaccctccg tacgcggggc atgaccaagt 240gtacatgcac gtcggcaagc ccatcgtggg caacaccctc gacggataca acgggtgcgt 300gttcgcctac gggcanacgg gcagcggcaa aaccttcacg atgctcggnt acgcgccgag 360cacgancgac atccgcgctc gcaaagggtc cgtcccctgc ggggccagca gcatggagaa 420cagcactcct cttgacagcg ctgtggagcc gtttgagagc gatgacggcg acgacgtggt 480ggacaagacg gggctggatc cgaacgagct gcaaggcatc atcccgcgcg cgtgcacgga 540cctgttcgat ggtctccgtg cgaagcgcgc caaggactcc gacttcacgt accgcgtgga 600ggtgtcttac tacgagatct acaacgagaa ggtgttcgat ctcatccggc cgcagcgcaa 660cacggacctg aggatacgta actcgcccaa ctccggtcca tttatcgaag gcctgacgtg 720gaagatggtg tccaaggagg aagacgtcgc ccgcgtgatt cgcaagggca tgcaggagcg 780ccacacggct gcgaccaagt tcaacgaccg cagcagccgc agccacgcca tcctcacctt 840caacattgtg cagctgtcga tggacgactc cgacaacgcg ttccagatgc gcagcaagct 900gaacctggtg gaccttgctg ggtcggagcg cactggtgcg gccggagccg agggcaatga 960gttccacgac ggtgtgaaga tcaaccactc gctgacggtg ctggggcgcg tgatcgaccg 1020tctggcggac ctctcgcaga acaagggagg ggg 1053 49 136 PRT Leishmania chagasi 49Gly Arg Leu Ser Glu Glu Glu Ile Glu Arg Met Val Arg Glu Ala Ala 1 5 10 15Glu Phe Glu Asp Glu Asp Arg Lys Val Arg Glu Arg Val Glu Ala Lys 20 25 30Asn Ser Leu Glu Ser Ile Ala Tyr Ser Leu Arg Asn Gln Ile Asn Asp 35 40 45Lys Asp Lys Leu Gly Asp Lys Leu Ala Ala Asp Asp Lys Lys Ala Ile 50 55 60Glu Glu Ala Val Lys Asp Ala Leu Asp Phe Val His Glu Asn Pro Asn65 70 75 80Ala Asp Arg Glu Glu Phe Glu Ala Ala Arg Thr Lys Leu Gln Ser Val 85 90 95Thr Asn Pro Ile Ile Gln Lys Val Tyr Gln Gly Ala Ala Gly Ser Gly 100 105 110Ala Glu Glu Ala Asp Ala Met Asp Asp Leu Leu Val Gly Arg Val Lys 115 120 125Arg Lys Thr Gly Lys Ala Gly Thr 130 135 50 510 PRT Leishmania chagasi 50Tyr Leu Leu Pro Leu Leu Gly Arg Arg Thr Thr Thr Thr Phe Lys Thr 1 5 10 15Thr Pro Arg Leu Leu Val Pro His Leu Leu Leu Ser Thr Phe Asn Pro 20 25 30Cys Leu Ala Asn Met Glu Ala Tyr Lys Lys Leu Glu Thr Ile Phe Thr 35 40 45Lys Val Tyr Arg Leu Asp His Phe Leu Gly Leu Gly Asn Trp Asp Met 50 55 60Asn Thr Asn Met Pro Pro Lys Gly Glu Glu Ser Arg Gly Glu Ala Met65 70 75 80Ala Met Leu Ser Glu Leu Arg Phe Gly Phe Ile Thr Ala Pro Glu Val 85 90 95Lys Ser Leu Ile Glu Ser Ala Thr Lys Gly Ser Glu Glu Leu Asn Ala 100 105 110Val Gln Arg Ala Asn Leu Arg Glu Met Arg Arg Ala Trp Lys Ser Ala 115 120 125Thr Ala Leu Pro Ala Glu Phe Val Gly Arg Lys Met Arg Leu Thr Thr 130 135 140His Ala His Ser Val Trp Arg Asp Ser Arg Lys Ala Asn Asp Phe Ala145 150 155 160Lys Phe Leu Pro Val Leu Arg Asp Leu Val Ala Leu Ala Arg Glu Glu 165 170 175Gly Ser Tyr Leu Ala Ala Gly Thr Ser Leu Ser Pro Tyr Glu Ala Leu 180 185 190Met Asn Glu Tyr Glu Pro Gly Ile Thr Thr Gln Lys Leu Asp Glu Val 195 200 205Tyr Ala Asn Val Lys Ser Trp Leu Pro Gln Leu Leu Lys Asp Ile Val 210 215 220Gln Lys Gln Ser Gly Glu Ser Val Ile Ala Phe Ser His Lys Phe Pro225 230 235 240Gln Asp Lys Gln Glu Ala Leu Cys Lys Glu Phe Met Lys Ile Trp His 245 250 255Phe Asp Thr Asp Ala Gly Arg Leu Asp Val Ser Pro His Pro Phe Thr 260 265 270Gly Met Thr Lys Glu Asp Cys Arg Leu Thr Thr Asn Tyr Ile Glu Asp 275 280 285Thr Phe Val Gln Ser Leu Tyr Gly Val Ile His Glu Ser Gly His Gly 290 295 300Lys Tyr Glu Gln Asn Cys Gly Pro Arg Glu His Ile Thr Gln Pro Val305 310 315 320Cys Asn Ala Arg Ser Leu Gly Leu His Glu Ser Gln Ser Leu Phe Ala 325 330 335Glu Phe Gln Ile Gly His Ala Thr Pro Phe Ile Asp Tyr Leu Thr Thr 340 345 350Arg Leu Pro Glu Phe Phe Glu Ala Gln Pro Ala Phe Ser Gln Asp Asn 355 360 365Met Arg Lys Ser Leu Gln Gln Val Lys Pro Gly Tyr Ile Arg Val Asp 370 375 380Ala Asp Glu Val Cys Tyr Pro Leu His Val Ile Leu Arg Tyr Glu Ile385 390 395 400Glu Arg Asp Leu Met Glu Gly Lys Met Glu Val Glu Asp Val Pro Arg 405 410 415Ala Trp Asn Ala Lys Met Gln Glu Tyr Leu Gly Leu Ser Thr Glu Gly 420 425 430Arg Asp Asp Val Gly Cys Leu Gln Asp Val His Trp Ser Met Val Arg 435 440 445Ser Ala Thr Leu Arg Arg Thr Arg Ser Ala Pro Cys Met Arg Arg Arg 450 455 460Ser Trp Arg Ala Ser Glu Arg Ser Trp Glu Thr Thr Arg Trp Met Ser465 470 475 480Ala Cys Ala Pro Val Ser Ser Ala Pro Ser Trp Lys Ser Ser Arg Arg 485 490 495Arg Ser Gly Ile Met Gly Ala Cys Thr Arg Arg Thr Thr Ser 500 505 510 51 107 PRT Leishmania chagasi VARIANT (1)...(107) Xaa = Any Amino Acid 51Gly Arg Arg Met Ala Ile His Arg Lys Met Thr Ala Met Ala Leu Arg 1 5 10 15Arg Thr Ala Val His Arg Lys Thr Thr Thr Val Ala Leu Arg Arg Thr 20 25 30Ala Ile His Arg Lys Met Thr Ala Met Ala Leu Arg Arg Thr Ala Val 35 40 45His Arg Lys Ile Thr Ala Met Ala Leu Arg Arg Thr Ala Ile His Arg 50 55 60Lys Met Thr Ala Met Pro Leu Arg Arg Thr Ala Val His Xaa Lys Met65 70 75 80Thr Ala Met Ala Leu Arg Arg Thr Ala Val His Arg Lys Met Thr Ala 85 90 95Met Ala Leu Arg Xaa Thr Pro Tyr Thr Glu Lys 100 105 52 63 PRT Leishmania chagasi 52Val Arg Glu Thr Arg Thr Cys Met Leu Leu Val Glu Gly Ala Glu Leu 1 5 10 15Val Pro Leu Met His Lys His Glu Val Val His Cys Leu Val Arg His 20 25 30Phe Pro Glu His Asn Glu Gln Arg His His Thr Ala Ser Asn Ser Arg 35 40 45Gln Ser Glu Cys Asp Ala His Thr Lys Ser Lys Val Val Asp Gln 50 55 60 53 324 PRT Leishmania chagasi VARIANT (1)...(324) Xaa = Any Amino Acid 53Phe Arg Gly Ile Pro Arg Asn Ser Val Arg Arg Gly Thr Arg Thr Gly 1 5 10 15Val Asp Ser Asp Ala Thr Ser Ser Thr Thr Ala Ala Tyr Asp Gly Ala 20 25 30Gly Ser Ala Pro Val Met Val Asp Ala Asn Val Ser His Pro Pro Tyr 35 40 45Ala Gly His Asp Gln Val Tyr Met His Val Gly Lys Pro Ile Val Gly 50 55 60Asn Thr Leu Asp Gly Tyr Asn Gly Cys Val Phe Ala Tyr Gly Xaa Thr65 70 75 80Gly Ser Gly Lys Thr Phe Thr Met Leu Gly Tyr Ala Pro Ser Thr Xaa 85 90 95Asp Ile Arg Ala Arg Lys Gly Ser Val Pro Cys Gly Ala Ser Ser Met 100 105 110Glu Asn Ser Thr Pro Leu Asp Ser Ala Val Glu Pro Phe Glu Ser Asp 115 120 125Asp Gly Asp Asp Val Val Asp Lys Thr Gly Leu Asp Pro Asn Glu Leu 130 135 140Gln Gly Ile Ile Pro Arg Ala Cys Thr Asp Leu Phe Asp Gly Leu Arg145 150 155 160Ala Lys Arg Ala Lys Asp Ser Asp Phe Thr Tyr Arg Val Glu Val Ser 165 170 175Tyr Tyr Glu Ile Tyr Asn Glu Lys Val Phe Asp Leu Ile Arg Pro Gln 180 185 190Arg Asn Thr Asp Leu Arg Ile Arg Asn Ser Pro Asn Ser Gly Pro Phe 195 200 205Ile Glu Gly Leu Thr Trp Lys Met Val Ser Lys Glu Glu Asp Val Ala 210 215 220Arg Val Ile Arg Lys Gly Met Gln Glu Arg His Thr Ala Ala Thr Lys225 230 235 240Phe Asn Asp Arg Ser Ser Arg Ser His Ala Ile Leu Thr Phe Asn Ile 245 250 255Val Gln Leu Ser Met Asp Asp Ser Asp Asn Ala Phe Gln Met Arg Ser 260 265 270Lys Leu Asn Leu Val Asp Leu Ala Gly Ser Glu Arg Thr Gly Ala Ala 275 280 285Gly Ala Glu Gly Asn Glu Phe His Asp Gly Val Lys Ile Asn His Ser 290 295 300Leu Thr Val Leu Gly Arg Val Ile Asp Arg Leu Ala Asp Leu Ser Gln305 310 315 320Asn Lys Gly Gly 54 1585 DNA Leishmania major misc_feature (1)...(1585) n = A,T,C or G 54aaagctggag ctccaccgcg gtggcggccg ctctagaact agtggatccc ccgggctgca 60ggaattcggc acgagtgctg cccgacatga catgctcgct gaccggactt cagtgcacag 120acccgaactg caagacctgc acaacttacg gtcagtgcac agactgcaac gacggctacg 180gtctcacctc ctccagcgtt tgcgtgcgct gcagtgtagc gggctgcaag agctgccccg 240tcgacgctaa cgtctgcaaa gtgtgtctcg gcggcagcga gccgatcaac aatatgtgcc 300cctgcaccga ccccaactgc gccagctgcc ccagcgacgc tggcacgtgc actcagtgcg 360cgaacggcta cggtctcgtg gacggcgcct gtgtgagatg ccaggagccc aactgcttca 420gctgcgacag cgacgcgaat aagtgcacac aatgtgcgcc gaactactac ctcaccccgc 480tcttgacctg ctccccggtg gcctgcaaca tcgagcactg catgcagtgc gacccacaga 540cgccgtcgcg ctgccaggag tgcgtgtccc cctacgtggt tgacagctac gacggcctct 600gcaggctctc cgatgcctgc tccgtgccca actgcaagaa gtgcgagacc ggtacctcca 660ggctctgcgc cgagtgcgac accggctaca gtctctccgc cgacgcgacg agctgcagca 720gtccaaccac gcagccgtgc gaggtggagc actgcaacac atgtgtgaac ggcgatagca 780cccgctgtgc ctactgcaac accggctact acgtctccga tggcaagtgc aaggccatgc 840agggctgcta cgtgtcgaac tgcgcgcagt gcatgctgct tgacagcacc aagtgctcca 900cgtgcgtgaa agggtacctg ctcacgtcgt cctacagttg cgtctcgcag aaagtcatca 960acagtgcggc cgcgccctac tctctgtggg tggccgccgc cgtgctcctc acctcttttg 1020ccatgcacct agcatagtgc gcagcggcat gcgaacaacc ccactctcat tctccaacat 1080gtgcatacac acacacacag acagcggggc agcaccccct ccccacacac acacacgcac 1140ttcccccttg tcttgttctt ctttcctcgn ttcgcatttc tttctctcgt gcgctggcgc 1200cggcctcctg cacgtcgctc ccctccccct aacctctatt ctctctctct ctctctctcg 1260ccggcatcat tgcttcttac ccttttctga tccttgctcg cgtgggcgga cactgccaca 1320gtcccacagc gcagacacac gtgtttaaac ggcgcaggca tccctcccta tcacttcatt 1380tctcctaaag ccactcacca agtcgcacac cgccctcccc catcggccgc ccttccgggc 1440gcagctgtgc ggaatgggtg tgtgctcgac ctcgttcctg gcagctcact cgcatgtgta 1500cagccactcc aaccacgaaa gctctcttct gcgcacataa aaaaaaaaaa aaaaaaaaaa 1560ctcgaggggg ggcccggtac ccaaa 1585 55 320 PRT Leishmania major 55Val Leu Pro Asp Met Thr Cys Ser Leu Thr Gly Leu Gln Cys Thr Asp 1 5 10 15Pro Asn Cys Lys Thr Cys Thr Thr Tyr Gly Gln Cys Thr Asp Cys Asn 20 25 30Asp Gly Tyr Gly Leu Thr Ser Ser Ser Val Cys Val Arg Cys Ser Val 35 40 45Ala Gly Cys Lys Ser Cys Pro Val Asp Ala Asn Val Cys Lys Val Cys 50 55 60Leu Gly Gly Ser Glu Pro Ile Asn Asn Met Cys Pro Cys Thr Asp Pro65 70 75 80Asn Cys Ala Ser Cys Pro Ser Asp Ala Gly Thr Cys Thr Gln Cys Ala 85 90 95Asn Gly Tyr Gly Leu Val Asp Gly Ala Cys Val Arg Cys Gln Glu Pro 100 105 110Asn Cys Phe Ser Cys Asp Ser Asp Ala Asn Lys Cys Thr Gln Cys Ala 115 120 125Pro Asn Tyr Tyr Leu Thr Pro Leu Leu Thr Cys Ser Pro Val Ala Cys 130 135 140Asn Ile Glu His Cys Met Gln Cys Asp Pro Gln Thr Pro Ser Arg Cys145 150 155 160Gln Glu Cys Val Ser Pro Tyr Val Val Asp Ser Tyr Asp Gly Leu Cys 165 170 175Arg Leu Ser Asp Ala Cys Ser Val Pro Asn Cys Lys Lys Cys Glu Thr 180 185 190Gly Thr Ser Arg Leu Cys Ala Glu Cys Asp Thr Gly Tyr Ser Leu Ser 195 200 205Ala Asp Ala Thr Ser Cys Ser Ser Pro Thr Thr Gln Pro Cys Glu Val 210 215 220Glu His Cys Asn Thr Cys Val Asn Gly Asp Ser Thr Arg Cys Ala Tyr225 230 235 240Cys Asn Thr Gly Tyr Tyr Val Ser Asp Gly Lys Cys Lys Ala Met Gln 245 250 255Gly Cys Tyr Val Ser Asn Cys Ala Gln Cys Met Leu Leu Asp Ser Thr 260 265 270Lys Cys Ser Thr Cys Val Lys Gly Tyr Leu Leu Thr Ser Ser Tyr Ser 275 280 285Cys Val Ser Gln Lys Val Ile Asn Ser Ala Ala Ala Pro Tyr Ser Leu 290 295 300Trp Val Ala Ala Ala Val Leu Leu Thr Ser Phe Ala Met His Leu Ala305 310 315 320 56 14 PRT Leishmania major 56Pro Lys Glu Asp Gly His Ala Pro Lys Asn Asp Asp His Ala 1 5 10 57 7 PRT Leishmania major 57Pro Lys Glu Asp Gly His Ala 1 5 58 7 PRT Leishmania major 58Pro Lys Asn Asp Asp His Ala 1 5 59 264 DNA Leishmania chagasi 59atgcaccatc atcaccatca catgggaagc tcctgcacga aggactccgc aaaggagccc 60cagaagcgtg ctgataacat cgatacgacc actcgaagcg atgagaagga cggcatccat 120gtccaggaga gcgccggtcc tgtgcaggag aacttcgggg atgcgcagga gaagaacgaa 180gatggacaca acgtggggga tggagctaac gacaatgagg atggtaacga tgatcagccg 240aaggagcagg ttgccggcaa ctag 264 60 744 DNA Leishmania chagasi 60atgggagcct actgcacgaa ggactccgca aaggagcccc agaagcgtgc tgataacatc 60cataaaacca ctgaggccaa tcacagaggc gccgccggtg tgcccccgaa gcacgccggc 120ggtgcgatga acgactctgc cccgaaggag gatggccata cacagaaaaa tgacggcgat 180ggccctaagg aggacggccg tacacagaaa aacgacgacg gtggccctaa ggaggacggc 240catacacaga aaaatgacgg cgatggccct aaggaggacg gccgtacaca gaaaaataac 300ggcgatggcc ctaaggagga cggccataca cagaaaaatg acggcgatgc ccctaaggag 360gacggccgta cacagaaaaa tgacggcgat ggccctaagg aggacggccg tacacagaaa 420aatgacggcg atggccctaa ggaggacggc cgtacacaga aaaatgacgg cgatggccct 480aaggaggacg gccgtacaca gaaaaatgac ggcgatggcc ctaaggagga cggccataca 540cagaaaaatg acggcgatgg ccctaaggag gacggccgta cacagaaaaa tgacggcggt 600ggccctaagg aggatgagaa tctgcagcaa aacgatggga atgcgcagga gaagaacgaa 660gatggacaca acgtggggga tggagctaac ggcaatgagg atggtaacga tgatcagccg 720aaggagcagg ttgccggcaa ctag 744 61 80 PRT Leishmania chagasi 61Met Gly Ser Ser Cys Thr Lys Asp Ser Ala Lys Glu Pro Gln Lys Arg 1 5 10 15Ala Asp Asn Ile Asp Thr Thr Thr Arg Ser Asp Glu Lys Asp Gly Ile 20 25 30His Val Gln Glu Ser Ala Gly Pro Val Gln Glu Asn Phe Gly Asp Ala 35 40 45Gln Glu Lys Asn Glu Asp Gly His Asn Val Gly Asp Gly Ala Asn Asp 50 55 60Asn Glu Asp Gly Asn Asp Asp Gln Pro Lys Glu Gln Val Ala Gly Asn65 70 75 80 62 247 PRT Leishmania chagasi 62Met Gly Ala Tyr Cys Thr Lys Asp Ser Ala Lys Glu Pro Gln Lys Arg 1 5 10 15Ala Asp Asn Ile His Lys Thr Thr Glu Ala Asn His Arg Gly Ala Ala 20 25 30Gly Val Pro Pro Lys His Ala Gly Gly Ala Met Asn Asp Ser Ala Pro 35 40 45Lys Glu Asp Gly His Thr Gln Lys Asn Asp Gly Asp Gly Pro Lys Glu 50 55 60Asp Gly Arg Thr Gln Lys Asn Asp Asp Gly Gly Pro Lys Glu Asp Gly65 70 75 80His Thr Gln Lys Asn Asp Gly Asp Gly Pro Lys Glu Asp Gly Arg Thr 85 90 95Gln Lys Asn Asn Gly Asp Gly Pro Lys Glu Asp Gly His Thr Gln Lys 100 105 110Asn Asp Gly Asp Ala Pro Lys Glu Asp Gly Arg Thr Gln Lys Asn Asp 115 120 125Gly Asp Gly Pro Lys Glu Asp Gly Arg Thr Gln Lys Asn Asp Gly Asp 130 135 140Gly Pro Lys Glu Asp Gly Arg Thr Gln Lys Asn Asp Gly Asp Gly Pro145 150 155 160Lys Glu Asp Gly Arg Thr Gln Lys Asn Asp Gly Asp Gly Pro Lys Glu 165 170 175Asp Gly His Thr Gln Lys Asn Asp Gly Asp Gly Pro Lys Glu Asp Gly 180 185 190Arg Thr Gln Lys Asn Asp Gly Gly Gly Pro Lys Glu Asp Glu Asn Leu 195 200 205Gln Gln Asn Asp Gly Asn Ala Gln Glu Lys Asn Glu Asp Gly His Asn 210 215 220Val Gly Asp Gly Ala Asn Gly Asn Glu Asp Gly Asn Asp Asp Gln Pro225 230 235 240Lys Glu Gln Val Ala Gly Asn 245 63 14 PRT Leishmania chagasi VARIANT (6)...(6) Xaa = His or Arg 63Pro Lys Glu Asp Gly Xaa Thr Gln Lys Asn Asp Xaa Xaa Gly 1 5 10 64 7 PRT Leishmania chagasi VARIANT (6)...(6) Xaa = His or Arg 64Pro Lys Glu Asp Gly Xaa Thr 1 5 65 7 PRT Leishmania chagasi VARIANT (5)...(5) Xaa = Gly or Asp 65Gln Lys Asn Asp Xaa Xaa Gly 1 5 66 17 PRT Artificial Sequence Synthetic peptide to asses diagnostic potential of repeat in Lc Gene B 66Gly Cys Gly Pro Lys Glu Asp Gly Arg Thr Gln Lys Asn Asp Gly Asp 1 5 10 15Gly 67 31 PRT Artificial Sequence Synthetic peptide to asses diagnostic potential of repeat in Lc Gene B 67Gly Cys Gly Pro Lys Glu Asp Gly Arg Thr Gln Lys Asn Asp Gly Asp 1 5 10 15Gly Pro Lys Glu Asp Gly Arg Thr Gln Lys Asn Asp Gly Asp Gly 20 25 30 68 45 PRT Artificial Sequence Synthetic peptide to asses diagnostic potential of repeat in Lc Gene B 68Gly Cys Gly Pro Lys Glu Asp Gly Arg Thr Gln Lys Asn Asp Gly Asp 1 5 10 15Gly Pro Lys Glu Asp Gly Arg Thr Gln Lys Asn Asp Gly Asp Gly Pro 20 25 30Lys Glu Asp Gly Arg Thr Gln Lys Asn Asp Gly Asp Gly 35 40 45 69 17 PRT Artificial Sequence Synthetic peptide to asses diagnostic potential of repeat in Lc Gene B 69Gly Cys Gly Pro Lys Glu Asp Gly His Thr Gln Lys Asn Asp Gly Asp 1 5 10 15Gly 70 31 PRT Artificial Sequence Synthetic peptide to asses diagnostic potential of repeat in Lc Gene B 70Gly Cys Gly Pro Lys Glu Asp Gly His Thr Gln Lys Asn Asp Gly Asp 1 5 10 15Gly Pro Lys Glu Asp Gly His Thr Gln Lys Asn Asp Gly Asp Gly 20 25 30 71 45 PRT Gly Cys Gly Pro Lys Glu Asp Gly His Thr Gln Synthetic peptide to asses diagnostic potential of repeat in Lc Gene B 71Gly Cys Gly Pro Lys Glu Asp Gly His Thr Gln Lys Asn Asp Gly Asp 1 5 10 15Gly Pro Lys Glu Asp Gly His Thr Gln Lys Asn Asp Gly Asp Gly Pro 20 25 30Lys Glu Asp Gly His Thr Gln Lys Asn Asp Gly Asp Gly 35 40 45 72 664 DNA Leishmania major misc_feature (1)...(664) n = A,T,C or G 72gctgcaggaa ttcggcacga gattgcttcc cagcccacct tcgctatcca gccactctcg 60ctcttctaca tctcccaccc cctcacaccg ccatggcttc ttcccgcaag gcttccaacc 120cgcacaagtc gcaccgcaag ccgaagcgct cgtggaacgt gtacgtgggc cgctcgctga 180aggcgatcaa cgcccagatg tcgatgtcgc accgcacgat gaagatcgtg aactcgtacg 240tgaacgacgt gatggagcgc atctgcactg aggccgcgtc gattgttcgc gcgaacaaga 300agcgcacgtt gggtgcgcgc gaggtgcaga cggcggtgcg cattgtgctg ccggcggagc 360tcgcgaagca tgccatggct gagggcacga aggccgtgtc gagcgcgtcc cgctaaagcg 420gcttgccgga tgccgtgtga gtaggagggt ggcttgccgc aaacgctgac ctcggcgatt 480gcggcgtggc gctccccttc tcctccttgt ccggcggtgt gtgtcatgca tttgcgtgac 540tcctccctct tatagatgca agcttttttt ttctcttgac gttttatttt ctcctccccc 600tcccttaacg tgaagtgtat atganagcgt actggacatg ananaaaaaa aaaanaaact 660cgag 664 73 1432 DNA Leishmania major misc_feature (1)...(1432) n = A,T,C or G 73gatgaagaag aggaggacac caccatcaac aactccgacg tggtggtgcg ctacaagaag 60gccgcaacgt ggtgcaatga aacgttgcgc gtgcttatcg atgccacaaa acctggcgcc 120aaggtgtgcg acctgtgccg cctcggtgat gacaccatca ccgccnaggt caagacaatg 180ttcaaaggca cggaaaaagg catcgctttc ccgacctgca tctcggtcaa caactgcgta 240tgccacaaca gccctggcgt gtcggacgag acgacgcagc aagagatcgc gatgggtgac 300gtcgtgcact acgacctggg catccacgtg gacggctact gcgccgtcgt cgcgcacacc 360attcaggtga cagaggacaa tgagcttggc aaggacgaga aggcggcgcg cgtcattaca 420gcggcgtaca acatcctgaa cacggcgctg cgccagatgc gtcccggtac gaccatctac 480caggtgacag acgtagttga gaaggctgcg gagcactaca aggtgactcc ggtagacggc 540gtcctctcgc atatgatgaa gcgctacatc atagacngat accgctgtat cccgcagcgc 600agggtcgcgg agcacatggt gcacgactac gatctcgaga aagcgcaggt gtggacgcta 660gacattgtca tgacctccgg caagggcaag ctgaaggagc gcgatgcgcg gccgtgcgtg 720ttcaaggtgg ctctggactc caactactct gtgaaaatgg aaagcgcgaa ggaggttcag 780aaggaaatcg actccnagta tgccaccttc ccctttgcca tccgcaacct ggaggccaag 840aaggcccgcc tcggtctcaa cgagatggcg aagcacggtg ctgtcatccc gtaccctatt 900ctcttcgaaa aggaaggcga ggtcgtcgcc catttcaaga ttacggtgct catcagcaac 960aagaagattg agccgattac cggcctgaag ccgcagaagg ccccggcgct cgagccatac 1020acggacgaga tgctgcttgc gacgaacaag ctcttcgctg tcgctagaga agaaggcggc 1080gaagtagacg gccgtggcat ccgtgacgct gtactgcgag ctttcgtagg cgtacgcctc 1140ttgtgaggcg tacacgtgtg ctgtttgcgg acgaggaggc acccattctg ttccccttct 1200tcgctaatct tcgcgtttcc tctgacgctg gcttctytgc cggagtgtgg tgaggcgcgt 1260gggggagaaa cggcccacty gcatgcctgt gcatacgcga gcacggtagg gagcgcggtg 1320tgtgtgtgtg tgggggggcg tgttacgagt acaaaagagg ctcgatcttt gcgatctttt 1380ctttctgtaa acaggaacat aagtaaccaa aaaaaaaaaa aaaaaactcg ag 1432 74 873 DNA Leishmania major misc_feature (1)...(873) n = A,T,C or G 74ctttattgtc atcactgtaa agcactgttt tttctttcac tttttcttga gtgttttctt 60ctattcacca tgagcattat caaggaggac gacgccgtgg gctgctacat gacggtgacc 120ctcgtggacg acaccaaggt ggagggtacc atcttcacct acaattccaa ggagggcatc 180atagtactcc tgtccctccg cgacgatcag acgaacatga agctaatccg cactccgtac 240atcaaagact tcagcctttc acacgctgag gagggagcgc acctgccccc ggcactggac 300tccttcaacg agcttccgtc catgcacgcc ggccgcgaca agtccatctt caagcacgcc 360agcacgcagc tcaagaacgc cgaggcgaac cgcgaaaagc acttcaactc tgtcacgacc 420gacacaccga ttgccacact tgatgcgtac ctcaagctcc tgcggctata ccccttaatt 480gagtggaaca gcgacgaggg tgtcatccag gtctcggaca ccgtcattgt cgtaggagac 540cccgactggc ggacgcccaa ggcaatgctg gtggacggcg cccctgagaa ggacagaccg 600cttgtagatc gcctgcaggt tgcgctcggm aacggcaaga agtgattcag tgtgtagcgg 660acagaacatc gtgtgcttgt gtgtctgttt gangtttgtt tgttttctct ttgtggtact 720gcgtacgacg gcgccttctc ccggtggtgg gtgagtccat aagcagttga gttctyggtt 780gtagnaavgc ctyacygccg accatatggg agagggcgaa caaatntttg atagaagttg 840aaaatcccaa agtyaaaaga aaaaaaaaan aaa 873 75 1238 DNA Leishmania major misc_feature (1)...(1238) n = A,T,C or G 75tttctgtact ttattgaaca tcagtagaac acgttcttcc cgcaaagatg gccaagaagc 60acctcaagcg cttgtatgcg cccaaggact ggatgctgag caagctgacc ggcgtgttcg 120cgccgcgtcc gcgtccgggt ccgcacaagc tgcgcgagtg cctgccgctn ctggtgatca 180tccgcaaccg gctgaagtac gcgctgaacg cgcgcgaggg tgagatgatc ctgcgccagg 240gtctggtgca cgtggacaac cacccgcgcc gcgacggcaa gtatcccgcc ggtttcatgg 300acgtggtcga gatcccgaag acgggcgacc gcttccgcct gatgtacgac gtcaagggcc 360gcttcgcgtt ggtgaacctg tccgaggcgg aggcgcagat caagctgatg aaggttgtga 420acctgtacac ggccaccggc cgcgtgccgg tcgctgtgac gcacgacggc caccgcatcc 480gctacccgga cccgcacacc tccattggtg acaccatcgt gtacaacgtc aaggagaaga 540agtgcgtgga cctgatcaag aaccgccagg gcaaggccgt gatcgtgacc ggtggcgcca 600accgcggccg catcggcgag atcgtgaagg tggagtgcca ccccggtgcg ttcaacattg 660cgcacctgaa ggacgcgtcc ggcgccgagt tcgccacccg cgccgcgaac atcttcgtga 720tcggcaagga cctgaacaac ctgcaggtaa cggtgccgaa gcagcagggc ctgcgcatga 780acgtgatcca ggagcgcgag gagcgcctga tcgcggcgga ggcccgcaag aacgcgccgg 840ctcgtggtgc ccgcagggcc cgcaagtgag gaggcgatta cacgcatgcg tgtttgtggc 900tctgaagcga cttggcgggt cggctgtgag ggtttgagag gaggtgtgtg atgcgtgtga 960agtccttctc cgttctcagc tctctctgtg ctgtagctgt gcctttcccc agatcgcttt 1020accgcatttg catacatctg tgtagtcgca tgtgcgtgtt tctgtctctc ggtgggtctc 1080cctctccctc cctttctgcc tctctctttg agtgggtgtg catgcgtcgc gcgcgacggg 1140ctccgcttna gtgattctct cgtgttttan ggctgtttty tttctyagtt nagcgtttty 1200gttcatgatt tcctcagacc caaaaaaaaa aaaaaaaa 1238 76 712 DNA Leishmania major misc_feature (1)...(712) n = A,T,C or G 76ctgacggagt tccagacgaa ccttgtgccg tacccgcgca tccacttcgt gctgacaagc 60tacgctccgg tggtgtctgc cgagaaggcg taccacgagc agctntccgt cgcggacatc 120acgaactcgg tntttgagcc tgctggcatg ctnacaaagt gcgatcctcg ccacggcaag 180tacatgtcgt gctgcctcat gtaccgcggt gatgtcgtgc cgaaggatgt caacgccgcg 240attgcgacga tcaagacgaa gcgcacaatt cagttcgtgg actggtgccc gaccggcttc 300aagtgcggca tcaactacca gccgccgacc gttgtgcccg gcggtgacct cgcgaaggtg 360cagcgcgccg tgtgcatgat tgccaactcg accgcgatcg ctgaggtgtt tgcccgcatc 420gaccacaagt tcgacctgat gtacagcaag cgcgcgtttg tgcactggta cgtgggtgag 480ggcatggagg agggcgagtt ctccgaggcg cgcgaggatc tcgctgcgct ggagaaggac 540tacgaggagg ttggcgccga gtccgccgac gacatgggcg aggaggacgt cgaggagtac 600taaggtagac tcgtgccgcg cgctgatgat gtaggtgcac gcgtgcgtgt gctgcagcgg 660agccgccgcc accgcgactg tgtgtgtgtg cgcgcgtgac gaccggctcg ag 712 77 1086 DNA Leishmania major misc_feature (1)...(1086) n = A,T,C or G 77caagaagtgg atcaagcagg agacgaacgc cgatggcgag cgcgtgcgcc gcgcgttctg 60ccagttctgc ctagacccca tctaccagat cttcgacgct gtgatgaacg agaagaagga 120caaggtggac aagatgctca agtcgctgca cgtgacgctn acggctgagg agcgcgagca 180ggtgccgaan aagcttctga agacggtgat gatgaanttc ctgccggctg ctgagacgct 240gctacagatg atcgtggcgc acctgccgtc gcccaagaag gcgcaggcgt accgtgcgga 300gatgctgtac tctggcgagg cgtcgccgga ggacaagtac ttcatgggta tcaagaactg 360cgaccccgct gcgccgctca tgctgtacat cagcaagatg gtgccgacgg ccgaccgcgg 420ccgcttcttc gcctttggcc gcatcttctc cggtaaggtg cgcagcggcc agaaggtgcg 480catcatgggt aacaactacg tctacggcaa gaagcaggac ctgtacgagg acaagcctgt 540gcagcgctcc gtgctgatga tgggccgcta ccaggaggcc gtggaggaca tgccgtgcgg 600taacgtggtg ggccttgtgg gcgtggacaa gtacatcgtg aagtccgcga cgatcacgga 660cgatggcgag agcccgcacc cgctgcgcga catgaagtac tctgtgtcgc ccgtcgtgcg 720tgtggccgtg gaggcgaaga acccgtccga cctgccgaag cttgtggagg gcctgaagcg 780ccttgccaag tccgacccgc tggtggtgtg cagcattgag gagtctggcg agcacattgt 840tgccggcgct ggcgagcttc accttgagat ttgcctgaag gatctccagg aggacttcat 900gaacggcgcg ccgctnaaga tctccgagcc ggtggtgtcg ttccgcgaga cggtgacgga 960tgtgtcgtcg cagcagtgcc tgtcgaagtc tgcgaacaag cacaaccgtc tcttctgccg 1020cggtgcgccg ctnacagagg anctggcgct ggcgatngan gaaggcaccg ctggtcccga 1080ngcgga 1086 78 447 DNA Leishmania major misc_feature (1)...(447) n = A,T,C or G 78cgcatcaacg tctacttcga tnagtcgacg ggaggccgct acgtgccgcg cgccgtgctg 60atggacctcg agcccggcac tatggactcc gttcgcgccg gcccgtacgg ccagctgttc 120cgcccggaca acttcatctt tggtcagtcc ggcgctggca acaactgggc caagggccac 180tacactgagg gcgcggagct gatcgactcc gtgcttgatg tgtgccgcaa ggaggcggag 240agctgcgact gcctgcaggg cttccagctg tctcactccc tcggcggcgg cacgggctcc 300ggcatgggca cgctgctcat ttccaanctg cgcgangagt acccggaccg gatcatgatg 360accttctccg tcatcccgtc cccccgcgtg tcggataccg ttgtggancc gtacaacacg 420accctctctg tgcaccagct cgtggaa 447 79 375 DNA Leishmania major misc_feature (1)...(375) n = A,T,C or G 79gtaacccgct ggtgtacgca tatgtagaca cagacgggca gcacgagacg acgttcctcg 60cgatccctgt ggtgcttggc atgaatggaa tcgagaagcg cctgccgatt ggtccgctgc 120actcgacgga ggaaacgctg ctgaaggcgg cactgccggt gatcaagaag aatatcgtga 180agggcagcga gttcgcgcgc tcacacctgt agcacctcag cttttttttt ttgcgttaaa 240cgggcgtggg aagcacctcg atacttcgct tcgcgctgac ggacccgcac gacatcgttc 300gtcatccccc tccccctctt cggccctata cgcatgaagg agtggaatta tgcaacagca 360tgttnatatc aagtg 375 80 107 PRT Leishmania major 80Met Ala Ser Ser Arg Lys Ala Ser Asn Pro His Lys Ser His Arg Lys 1 5 10 15Pro Lys Arg Ser Trp Asn Val Tyr Val Gly Arg Ser Leu Lys Ala Ile 20 25 30Asn Ala Gln Met Ser Met Ser His Arg Thr Met Lys Ile Val Asn Ser 35 40 45Tyr Val Asn Asp Val Met Glu Arg Ile Cys Thr Glu Ala Ala Ser Ile 50 55 60Val Arg Ala Asn Lys Lys Arg Thr Leu Gly Ala Arg Glu Val Gln Thr65 70 75 80Ala Val Arg Ile Val Leu Pro Ala Glu Leu Ala Lys His Ala Met Ala 85 90 95Glu Gly Thr Lys Ala Val Ser Ser Ala Ser Arg 100 105 81 381 PRT Leishmania major VARIANT (1)...(381) Xaa = Any Amino Acid 81Asp Glu Glu Glu Glu Asp Thr Thr Ile Asn Asn Ser Asp Val Val Val 1 5 10 15Arg Tyr Lys Lys Ala Ala Thr Trp Cys Asn Glu Thr Leu Arg Val Leu 20 25 30Ile Asp Ala Thr Lys Pro Gly Ala Lys Val Cys Asp Leu Cys Arg Leu 35 40 45Gly Asp Asp Thr Ile Thr Ala Xaa Val Lys Thr Met Phe Lys Gly Thr 50 55 60Glu Lys Gly Ile Ala Phe Pro Thr Cys Ile Ser Val Asn Asn Cys Val65 70 75 80Cys His Asn Ser Pro Gly Val Ser Asp Glu Thr Thr Gln Gln Glu Ile 85 90 95Ala Met Gly Asp Val Val His Tyr Asp Leu Gly Ile His Val Asp Gly 100 105 110Tyr Cys Ala Val Val Ala His Thr Ile Gln Val Thr Glu Asp Asn Glu 115 120 125Leu Gly Lys Asp Glu Lys Ala Ala Arg Val Ile Thr Ala Ala Tyr Asn 130 135 140Ile Leu Asn Thr Ala Leu Arg Gln Met Arg Pro Gly Thr Thr Ile Tyr145 150 155 160Gln Val Thr Asp Val Val Glu Lys Ala Ala Glu His Tyr Lys Val Thr 165 170 175Pro Val Asp Gly Val Leu Ser His Met Met Lys Arg Tyr Ile Ile Asp 180 185 190Xaa Tyr Arg Cys Ile Pro Gln Arg Arg Val Ala Glu His Met Val His 195 200 205Asp Tyr Asp Leu Glu Lys Ala Gln Val Trp Thr Leu Asp Ile Val Met 210 215 220Thr Ser Gly Lys Gly Lys Leu Lys Glu Arg Asp Ala Arg Pro Cys Val225 230 235 240Phe Lys Val Ala Leu Asp Ser Asn Tyr Ser Val Lys Met Glu Ser Ala 245 250 255Lys Glu Val Gln Lys Glu Ile Asp Ser Xaa Tyr Ala Thr Phe Pro Phe 260 265 270Ala Ile Arg Asn Leu Glu Ala Lys Lys Ala Arg Leu Gly Leu Asn Glu 275 280 285Met Ala Lys His Gly Ala Val Ile Pro Tyr Pro Ile Leu Phe Glu Lys 290 295 300Glu Gly Glu Val Val Ala His Phe Lys Ile Thr Val Leu Ile Ser Asn305 310 315 320Lys Lys Ile Glu Pro Ile Thr Gly Leu Lys Pro Gln Lys Ala Pro Ala 325 330 335Leu Glu Pro Tyr Thr Asp Glu Met Leu Leu Ala Thr Asn Lys Leu Phe 340 345 350Ala Val Ala Arg Glu Glu Gly Gly Glu Val Asp Gly Arg Gly Ile Arg 355 360 365Asp Ala Val Leu Arg Ala Phe Val Gly Val Arg Leu Leu 370 375 380 82 191 PRT Leishmania major 82Met Ser Ile Ile Lys Glu Asp Asp Ala Val Gly Cys Tyr Met Thr Val 1 5 10 15Thr Leu Val Asp Asp Thr Lys Val Glu Gly Thr Ile Phe Thr Tyr Asn 20 25 30Ser Lys Glu Gly Ile Ile Val Leu Leu Ser Leu Arg Asp Asp Gln Thr 35 40 45Asn Met Lys Leu Ile Arg Thr Pro Tyr Ile Lys Asp Phe Ser Leu Ser 50 55 60His Ala Glu Glu Gly Ala His Leu Pro Pro Ala Leu Asp Ser Phe Asn65 70 75 80Glu Leu Pro Ser Met His Ala Gly Arg Asp Lys Ser Ile Phe Lys His 85 90 95Ala Ser Thr Gln Leu Lys Asn Ala Glu Ala Asn Arg Glu Lys His Phe 100 105 110Asn Ser Val Thr Thr Asp Thr Pro Ile Ala Thr Leu Asp Ala Tyr Leu 115 120 125Lys Leu Leu Arg Leu Tyr Pro Leu Ile Glu Trp Asn Ser Asp Glu Gly 130 135 140Val Ile Gln Val Ser Asp Thr Val Ile Val Val Gly Asp Pro Asp Trp145 150 155 160Arg Thr Pro Lys Ala Met Leu Val Asp Gly Ala Pro Glu Lys Asp Arg 165 170 175Pro Leu Val Asp Arg Leu Gln Val Ala Leu Gly Asn Gly Lys Lys 180 185 190 83 273 PRT Leishmania major 83Met Ala Lys Lys His Leu Lys Arg Leu Tyr Ala Pro Lys Asp Trp Met 1 5 10 15Leu Ser Lys Leu Thr Gly Val Phe Ala Pro Arg Pro Arg Pro Gly Pro 20 25 30His Lys Leu Arg Glu Cys Leu Pro Leu Leu Val Ile Ile Arg Asn Arg 35 40 45Leu Lys Tyr Ala Leu Asn Ala Arg Glu Gly Glu Met Ile Leu Arg Gln 50 55 60Gly Leu Val His Val Asp Asn His Pro Arg Arg Asp Gly Lys Tyr Pro65 70 75 80Ala Gly Phe Met Asp Val Val Glu Ile Pro Lys Thr Gly Asp Arg Phe 85 90 95Arg Leu Met Tyr Asp Val Lys Gly Arg Phe Ala Leu Val Asn Leu Ser 100 105 110Glu Ala Glu Ala Gln Ile Lys Leu Met Lys Val Val Asn Leu Tyr Thr 115 120 125Ala Thr Gly Arg Val Pro Val Ala Val Thr His Asp Gly His Arg Ile 130 135 140Arg Tyr Pro Asp Pro His Thr Ser Ile Gly Asp Thr Ile Val Tyr Asn145 150 155 160Val Lys Glu Lys Lys Cys Val Asp Leu Ile Lys Asn Arg Gln Gly Lys 165 170 175Ala Val Ile Val Thr Gly Gly Ala Asn Arg Gly Arg Ile Gly Glu Ile 180 185 190Val Lys Val Glu Cys His Pro Gly Ala Phe Asn Ile Ala His Leu Lys 195 200 205Asp Ala Ser Gly Ala Glu Phe Ala Thr Arg Ala Ala Asn Ile Phe Val 210 215 220Ile Gly Lys Asp Leu Asn Asn Leu Gln Val Thr Val Pro Lys Gln Gln225 230 235 240Gly Leu Arg Met Asn Val Ile Gln Glu Arg Glu Glu Arg Leu Ile Ala 245 250 255Ala Glu Ala Arg Lys Asn Ala Pro Ala Arg Gly Ala Arg Arg Ala Arg 260 265 270Lys 84 200 PRT Leishmania major 84Leu Thr Glu Phe Gln Thr Asn Leu Val Pro Tyr Pro Arg Ile His Phe 1 5 10 15Val Leu Thr Ser Tyr Ala Pro Val Val Ser Ala Glu Lys Ala Tyr His 20 25 30Glu Gln Leu Ser Val Ala Asp Ile Thr Asn Ser Val Phe Glu Pro Ala 35 40 45Gly Met Leu Thr Lys Cys Asp Pro Arg His Gly Lys Tyr Met Ser Cys 50 55 60Cys Leu Met Tyr Arg Gly Asp Val Val Pro Lys Asp Val Asn Ala Ala65 70 75 80Ile Ala Thr Ile Lys Thr Lys Arg Thr Ile Gln Phe Val Asp Trp Cys 85 90 95Pro Thr Gly Phe Lys Cys Gly Ile Asn Tyr Gln Pro Pro Thr Val Val 100 105 110Pro Gly Gly Asp Leu Ala Lys Val Gln Arg Ala Val Cys Met Ile Ala 115 120 125Asn Ser Thr Ala Ile Ala Glu Val Phe Ala Arg Ile Asp His Lys Phe 130 135 140Asp Leu Met Tyr Ser Lys Arg Ala Phe Val His Trp Tyr Val Gly Glu145 150 155 160Gly Met Glu Glu Gly Glu Phe Ser Glu Ala Arg Glu Asp Leu Ala Ala 165 170 175Leu Glu Lys Asp Tyr Glu Glu Val Gly Ala Glu Ser Ala Asp Asp Met 180 185 190Gly Glu Glu Asp Val Glu Glu Tyr 195 200 85 361 PRT Leishmania major VARIANT (1)...(361) Xaa = Any Amino Acid 85Lys Lys Trp Ile Lys Gln Glu Thr Asn Ala Asp Gly Glu Arg Val Arg 1 5 10 15Arg Ala Phe Cys Gln Phe Cys Leu Asp Pro Ile Tyr Gln Ile Phe Asp 20 25 30Ala Val Met Asn Glu Lys Lys Asp Lys Val Asp Lys Met Leu Lys Ser 35 40 45Leu His Val Thr Leu Thr Ala Glu Glu Arg Glu Gln Val Pro Xaa Lys 50 55 60Leu Leu Lys Thr Val Met Met Xaa Phe Leu Pro Ala Ala Glu Thr Leu65 70 75 80Leu Gln Met Ile Val Ala His Leu Pro Ser Pro Lys Lys Ala Gln Ala 85 90 95Tyr Arg Ala Glu Met Leu Tyr Ser Gly Glu Ala Ser Pro Glu Asp Lys 100 105 110Tyr Phe Met Gly Ile Lys Asn Cys Asp Pro Ala Ala Pro Leu Met Leu 115 120 125Tyr Ile Ser Lys Met Val Pro Thr Ala Asp Arg Gly Arg Phe Phe Ala 130 135 140Phe Gly Arg Ile Phe Ser Gly Lys Val Arg Ser Gly Gln Lys Val Arg145 150 155 160Ile Met Gly Asn Asn Tyr Val Tyr Gly Lys Lys Gln Asp Leu Tyr Glu 165 170 175Asp Lys Pro Val Gln Arg Ser Val Leu Met Met Gly Arg Tyr Gln Glu 180 185 190Ala Val Glu Asp Met Pro Cys Gly Asn Val Val Gly Leu Val Gly Val 195 200 205Asp Lys Tyr Ile Val Lys Ser Ala Thr Ile Thr Asp Asp Gly Glu Ser 210 215 220Pro His Pro Leu Arg Asp Met Lys Tyr Ser Val Ser Pro Val Val Arg225 230 235 240Val Ala Val Glu Ala Lys Asn Pro Ser Asp Leu Pro Lys Leu Val Glu 245 250 255Gly Leu Lys Arg Leu Ala Lys Ser Asp Pro Leu Val Val Cys Ser Ile 260 265 270Glu Glu Ser Gly Glu His Ile Val Ala Gly Ala Gly Glu Leu His Leu 275 280 285Glu Ile Cys Leu Lys Asp Leu Gln Glu Asp Phe Met Asn Gly Ala Pro 290 295 300Leu Lys Ile Ser Glu Pro Val Val Ser Phe Arg Glu Thr Val Thr Asp305 310 315 320Val Ser Ser Gln Gln Cys Leu Ser Lys Ser Ala Asn Lys His Asn Arg 325 330 335Leu Phe Cys Arg Gly Ala Pro Leu Thr Glu Xaa Leu Ala Leu Ala Xaa 340 345 350Xaa Glu Gly Thr Ala Gly Pro Xaa Ala 355 360 86 149 PRT Leishmania major VARIANT (1)...(149) Xaa = Any Amino Acid 86Arg Ile Asn Val Tyr Phe Asp Xaa Ser Thr Gly Gly Arg Tyr Val Pro 1 5 10 15Arg Ala Val Leu Met Asp Leu Glu Pro Gly Thr Met Asp Ser Val Arg 20 25 30Ala Gly Pro Tyr Gly Gln Leu Phe Arg Pro Asp Asn Phe Ile Phe Gly 35 40 45Gln Ser Gly Ala Gly Asn Asn Trp Ala Lys Gly His Tyr Thr Glu Gly 50 55 60Ala Glu Leu Ile Asp Ser Val Leu Asp Val Cys Arg Lys Glu Ala Glu65 70 75 80Ser Cys Asp Cys Leu Gln Gly Phe Gln Leu Ser His Ser Leu Gly Gly 85 90 95Gly Thr Gly Ser Gly Met Gly Thr Leu Leu Ile Ser Xaa Leu Arg Xaa 100 105 110Glu Tyr Pro Asp Arg Ile Met Met Thr Phe Ser Val Ile Pro Ser Pro 115 120 125Arg Val Ser Asp Thr Val Val Xaa Pro Tyr Asn Thr Thr Leu Ser Val 130 135 140His Gln Leu Val Glu145 87 69 PRT Leishmania major 87Asn Pro Leu Val Tyr Ala Tyr Val Asp Thr Asp Gly Gln His Glu Thr 1 5 10 15Thr Phe Leu Ala Ile Pro Val Val Leu Gly Met Asn Gly Ile Glu Lys 20 25 30Arg Leu Pro Ile Gly Pro Leu His Ser Thr Glu Glu Thr Leu Leu Lys 35 40 45Ala Ala Leu Pro Val Ile Lys Lys Asn Ile Val Lys Gly Ser Glu Phe 50 55 60Ala Arg Ser His Leu65 88 54 DNA Artificial Sequence PCR primer 88agtattcata tgcaccacca ccaccaccac atgtcctgcg gtaacgccaa gatc 54 89 33 DNA Artificial Sequence PCR primer 89ctcacaggat ccctgcttgc tgaagtatcc ttc 33 90 36 DNA Artificial Sequence PCR primer 90catttcggat ccatggacgc aactgagctg aagaac 36 91 33 DNA Artificial Sequence PCR primer 91cgtagagaat tcctgaccaa aacgaatgat gcc 33 92 33 DNA Artificial Sequence PCR primer 92caccacgaat tcatggcgca gaatgataag atc 33 93 34 DNA Artificial Sequence PCR primer 93actgacctcg aggaattctt agtcgcgcat gaac 34 94 3012 DNA Artificial Sequence DNA sequence encoding fusion (poly-protein) constructs comprising multiple Leishmania antigens 94catatgcacc accaccacca ccacatgtcc tgcggtaacg ccaagatcaa ctctcccgcg 60ccgtccttcg aggaggtggc gctcatgccc aacggcagct tcaagaagat cagcctctcc 120tcctacaagg gcaagtgggt cgtgctcttc ttctacccgc tcgacttcac cttcgtgtgc 180ccgacagagg tcatcgcgtt ctccgacagc gtgagtcgct tcaacgagct caactgcgag 240gtcctcgcgt gctcgataga cagcgagtac gcgcacctgc agtggacgct gcaggaccgc 300aagaagggcg gcctcgggac catggcgatc ccaatgctag ccgacaagac caagagcatc 360gctcgttcct acggcgtgct ggaggagagc cagggcgtgg cctaccgcgg tctcttcatc 420atcgaccccc atggcatgct gcgtcagatc accgtcaatg acatgccggt gggccgcagc 480gtggaggagg ttctacgcct gctggaggct tttcagttcg tggagaagca cggcgaggtg 540tgccccgcga actggaagaa gggcgccccc acgatgaagc cggaaccgaa tgcgtctgtc 600gagggatact tcagcaagca gggatccatg gacgcaactg agctgaagaa caaggggaac 660gaagagttct ccgccggccg ctatgtggag gcggtgaact acttctcaaa ggcgatccag 720ttggatgagc agaacagtgt cctctacagc aaccgctccg cctgttttgc agccatgcag 780aaatacaagg acgcgctgga cgacgccgac aagtgcatct cgatcaagcc gaattgggcc 840aagggctacg tgcgccgagg agcagctctc catggcatgc gccgctacga cgatgccatt 900gccgcgtatg aaaaggggct caaggtggac ccttccaaca gcggctgcgc gcagggcgtg 960aaggacgtgc aggtagccaa ggcccgcgaa gcacgtgacc ccatcgctcg cgtcttcacc 1020ccggaggcgt tccgcaagat ccaagagaat cccaagctgt ctctacttat gctgcagccg 1080gactacgtga agatggtaga caccgtcatc cgcgaccctt cgcagggccg gctgtacatg 1140gaagaccagc gctttgccct gacgctcatg tacctgagcg gaatgaagat tcccaacgat 1200ggtgatggcg aggaggagga acgtccgtct gcgaaggcgg cagagacagc gaagccaaaa 1260gaggagaagc ctctcaccga caacgagaag gaggccctgg cgctcaagga ggagggcaac 1320aagctgtacc tctcgaagaa gtttgaggag gcgctgacca agtaccaaga ggcgcaggtg 1380aaagacccca acaacacttt atacattctg aacgtgtcgg ccgtgtactt cgagcagggt 1440gactacgaca agtgcatcgc cgagtgcgag cacggtatcg agcacggtcg cgagaaccac 1500tgcgactaca caatcattgc gaagctcatg acccggaacg ccttgtgcct ccagaggcag 1560aggaagtacg aggctgctat cgacctttac aagcgcgccc ttgtcgagtg gcgtaaccct 1620gacaccctca agaagctgac ggagtgcgag aaggagcacc aaaaggcggt ggaggaagcc 1680tacatcgatc ctgagatcgc gaagcagaag aaagacgaag gtaaccagta cttcaaggag 1740gataagttcc ccgaggccgt ggcagcgtac acggaggcca tcaagcgcaa ccctgccgag 1800cacacctcct acagcaatcg cgcggccgcg tacatcaagc ttggagcctt caacgacgcc 1860ctcaaggacg cggagaagtg cattgagctg aagcccgact ttgttaaggg ctacgcgcgc 1920aagggtcatg cttacttttg gaccaagcag tacaaccgcg cgctgcaggc gtacaatgag 1980ggcctcaagg tggacccgag caatgcggac tgcaaggatg ggcggtatcg cacaatcatg 2040aagattcagg agatggcatc tggccaatcc gcggatggcg acgaggcggc gcgccgggcc 2100atggacgatc ctgaaatcgc ggcaatcatg caagatagct acatgcaact agtgttgaag 2160gagatgcaga acgatcccac gcgcattcag gagtacatga aggactccgg gatctcatcg 2220aagatcaaca agctgatttc agctggcatc attcgttttg gtcaggaatt catggcgcag 2280aatgataaga tcgcccccca ggaccaggac tccttcctcg atgaccagcc cggcgttcgc 2340ccgatcccgt ccttcgacga catgccgctg caccagaacc tgctgcgtgg catctactcg 2400tacgggttcg agaagccgtc cagcatccag cagcgcgcga tagccccctt cacgcgcggc 2460ggcgacatca tcgcgcaggc ccagtccggt accggcaaga cgggtgcctt ctccatcggt 2520ctgctgcagc gcctggactt ccgccacaac ctgatccagg gcctcgtgct ctcccccact 2580cgcgagctgg ccctgcagac ggcggaggtg atcagccgca tcggtgagtt cctgtcgaac 2640agctccaagt tctgcgagac ctttgtcggc ggcacgcgcg tgcaggatga cctgcgcaag 2700ctgcaggccg gcgtcatcgt tgccgtgggc acgccgggcc gcgtgtccga cgtgatcaag 2760cgtggcgcgc tgcgcacaga gtcgctgcgc gtgctggtgc tcgacgaggc tgatgagatg 2820ctgtctcagg gcttcgcgga ccagatttac gagatcttcc gcttcctgcc gaaggacatc 2880caggtcgcgc tcttctccgc cacgatgccg gaggaggtac tggagctgac gaagaagttc 2940atgcgcgact aagaattcct cgagcagatc cggctgctaa caaagcccga aaggaagctg 3000aatggctgct gc 3012 95 982 PRT Artificial Sequence Fusion (poly-protein) constructs comprising multiple Leishmania antigens 95Met His His His His His His Met Ser Cys Gly Asn Ala Lys Ile Asn 5 10 15Ser Pro Ala Pro Ser Phe Glu Glu Val Ala Leu Met Pro Asn Gly Ser 20 25 30Phe Lys Lys Ile Ser Leu Ser Ser Tyr Lys Gly Lys Trp Val Val Leu 35 40 45Phe Phe Tyr Pro Leu Asp Phe Thr Phe Val Cys Pro Thr Glu Val Ile 50 55 60Ala Phe Ser Asp Ser Val Ser Arg Phe Asn Glu Leu Asn Cys Glu Val 65 70 75 80Leu Ala Cys Ser Ile Asp Ser Glu Tyr Ala His Leu Gln Trp Thr Leu 85 90 95Gln Asp Arg Lys Lys Gly Gly Leu Gly Thr Met Ala Ile Pro Met Leu 100 105 110Ala Asp Lys Thr Lys Ser Ile Ala Arg Ser Tyr Gly Val Leu Glu Glu 115 120 125Ser Gln Gly Val Ala Tyr Arg Gly Leu Phe Ile Ile Asp Pro His Gly 130 135 140Met Leu Arg Gln Ile Thr Val Asn Asp Met Pro Val Gly Arg Ser Val145 150 155 160Glu Glu Val Leu Arg Leu Leu Glu Ala Phe Gln Phe Val Glu Lys His 165 170 175Gly Glu Val Cys Pro Ala Asn Trp Lys Lys Gly Ala Pro Thr Met Lys 180 185 190Pro Glu Pro Asn Ala Ser Val Glu Gly Tyr Phe Ser Lys Gln Gly Ser 195 200 205Met Asp Ala Thr Glu Leu Lys Asn Lys Gly Asn Glu Glu Phe Ser Ala 210 215 220Gly Arg Tyr Val Glu Ala Val Asn Tyr Phe Ser Lys Ala Ile Gln Leu225 230 235 240Asp Glu Gln Asn Ser Val Leu Tyr Ser Asn Arg Ser Ala Cys Phe Ala 245 250 255Ala Met Gln Lys Tyr Lys Asp Ala Leu Asp Asp Ala Asp Lys Cys Ile 260 265 270Ser Ile Lys Pro Asn Trp Ala Lys Gly Tyr Val Arg Arg Gly Ala Ala 275 280 285Leu His Gly Met Arg Arg Tyr Asp Asp Ala Ile Ala Ala Tyr Glu Lys 290 295 300Gly Leu Lys Val Asp Pro Ser Asn Ser Gly Cys Ala Gln Gly Val Lys305 310 315 320Asp Val Gln Val Ala Lys Ala Arg Glu Ala Arg Asp Pro Ile Ala Arg 325 330 335Val Phe Thr Pro Glu Ala Phe Arg Lys Ile Gln Glu Asn Pro Lys Leu 340 345 350Ser Leu Leu Met Leu Gln Pro Asp Tyr Val Lys Met Val Asp Thr Val 355 360 365Ile Arg Asp Pro Ser Gln Gly Arg Leu Tyr Met Glu Asp Gln Arg Phe 370 375 380Ala Leu Thr Leu Met Tyr Leu Ser Gly Met Lys Ile Pro Asn Asp Gly385 390 395 400Asp Gly Glu Glu Glu Glu Arg Pro Ser Ala Lys Ala Ala Glu Thr Ala 405 410 415Lys Pro Lys Glu Glu Lys Pro Leu Thr Asp Asn Glu Lys Glu Ala Leu 420 425 430Ala Leu Lys Glu Glu Gly Asn Lys Leu Tyr Leu Ser Lys Lys Phe Glu 435 440 445Glu Ala Leu Thr Lys Tyr Gln Glu Ala Gln Val Lys Asp Pro Asn Asn 450 455 460Thr Leu Tyr Ile Leu Asn Val Ser Ala Val Tyr Phe Glu Gln Gly Asp465 470 475 480Tyr Asp Lys Cys Ile Ala Glu Cys Glu His Gly Ile Glu His Gly Arg 485 490 495Glu Asn His Cys Asp Tyr Thr Ile Ile Ala Lys Leu Met Thr Arg Asn 500 505 510Ala Leu Cys Leu Gln Arg Gln Arg Lys Tyr Glu Ala Ala Ile Asp Leu 515 520 525Tyr Lys Arg Ala Leu Val Glu Trp Arg Asn Pro Asp Thr Leu Lys Lys 530 535 540Leu Thr Glu Cys Glu Lys Glu His Gln Lys Ala Val Glu Glu Ala Tyr545 550 555 560Ile Asp Pro Glu Ile Ala Lys Gln Lys Lys Asp Glu Gly Asn Gln Tyr 565 570 575Phe Lys Glu Asp Lys Phe Pro Glu Ala Val Ala Ala Tyr Thr Glu Ala 580 585 590Ile Lys Arg Asn Pro Ala Glu His Thr Ser Tyr Ser Asn Arg Ala Ala 595 600 605Ala Tyr Ile Lys Leu Gly Ala Phe Asn Asp Ala Leu Lys Asp Ala Glu 610 615 620Lys Cys Ile Glu Leu Lys Pro Asp Phe Val Lys Gly Tyr Ala Arg Lys625 630 635 640Gly His Ala Tyr Phe Trp Thr Lys Gln Tyr Asn Arg Ala Leu Gln Ala 645 650 655Tyr Asn Glu Gly Leu Lys Val Asp Pro Ser Asn Ala Asp Cys Lys Asp 660 665 670Gly Arg Tyr Arg Thr Ile Met Lys Ile Gln Glu Met Ala Ser Gly Gln 675 680 685Ser Ala Asp Gly Asp Glu Ala Ala Arg Arg Ala Met Asp Asp Pro Glu 690 695 700Ile Ala Ala Ile Met Gln Asp Ser Tyr Met Gln Leu Val Leu Lys Glu705 710 715 720Met Gln Asn Asp Pro Thr Arg Ile Gln Glu Tyr Met Lys Asp Ser Gly 725 730 735Ile Ser Ser Lys Ile Asn Lys Leu Ile Ser Ala Gly Ile Ile Arg Phe 740 745 750Gly Gln Glu Phe Met Ala Gln Asn Asp Lys Ile Ala Pro Gln Asp Gln 755 760 765Asp Ser Phe Leu Asp Asp Gln Pro Gly Val Arg Pro Ile Pro Ser Phe 770 775 780Asp Asp Met Pro Leu His Gln Asn Leu Leu Arg Gly Ile Tyr Ser Tyr785 790 795 800Gly Phe Glu Lys Pro Ser Ser Ile Gln Gln Arg Ala Ile Ala Pro Phe 805 810 815Thr Arg Gly Gly Asp Ile Ile Ala Gln Ala Gln Ser Gly Thr Gly Lys 820 825 830Thr Gly Ala Phe Ser Ile Gly Leu Leu Gln Arg Leu Asp Phe Arg His 835 840 845Asn Leu Ile Gln Gly Leu Val Leu Ser Pro Thr Arg Glu Leu Ala Leu 850 855 860Gln Thr Ala Glu Val Ile Ser Arg Ile Gly Glu Phe Leu Ser Asn Ser865 870 875 880Ser Lys Phe Cys Glu Thr Phe Val Gly Gly Thr Arg Val Gln Asp Asp 885 890 895Leu Arg Lys Leu Gln Ala Gly Val Ile Val Ala Val Gly Thr Pro Gly 900 905 910Arg Val Ser Asp Val Ile Lys Arg Gly Ala Leu Arg Thr Glu Ser Leu 915 920 925Arg Val Leu Val Leu Asp Glu Ala Asp Glu Met Leu Ser Gln Gly Phe 930 935 940Ala Asp Gln Ile Tyr Glu Ile Phe Arg Phe Leu Pro Lys Asp Ile Gln945 950 955 960Val Ala Leu Phe Ser Ala Thr Met Pro Glu Glu Val Leu Glu Leu Thr 965 970 975Lys Lys Phe Met Arg Asp 980 96 1641 PRT Artificial Sequence Fusion (poly-protein) constructs comprising multiple Leishmania antigens 96Met His His His His His His Met Ser Cys Gly Asn Ala Lys Ile Asn 5 10 15Ser Pro Ala Pro Ser Phe Glu Glu Val Ala Leu Met Pro Asn Gly Ser 20 25 30Phe Lys Lys Ile Ser Leu Ser Ser Tyr Lys Gly Lys Trp Val Val Leu 35 40 45Phe Phe Tyr Pro Leu Asp Phe Thr Phe Val Cys Pro Thr Glu Val Ile 50 55 60Ala Phe Ser Asp Ser Val Ser Arg Phe Asn Glu Leu Asn Cys Glu Val 65 70 75 80Leu Ala Cys Ser Ile Asp Ser Glu Tyr Ala His Leu Gln Trp Thr Leu 85 90 95Gln Asp Arg Lys Lys Gly Gly Leu Gly Thr Met Ala Ile Pro Met Leu 100 105 110Ala Asp Lys Thr Lys Ser Ile Ala Arg Ser Tyr Gly Val Leu Glu Glu 115 120 125Ser Gln Gly Val Ala Tyr Arg Gly Leu Phe Ile Ile Asp Pro His Gly 130 135 140Met Leu Arg Gln Ile Thr Val Asn Asp Met Pro Val Gly Arg Ser Val145 150 155 160Glu Glu Val Leu Arg Leu Leu Glu Ala Phe Gln Phe Val Glu Lys His 165 170 175Gly Glu Val Cys Pro Ala Asn Trp Lys Lys Gly Ala Pro Thr Met Lys 180 185 190Pro Glu Pro Asn Ala Ser Val Glu Gly Tyr Phe Ser Lys Gln Gly Ser 195 200 205Met Asp Ala Thr Glu Leu Lys Asn Lys Gly Asn Glu Glu Phe Ser Ala 210 215 220Gly Arg Tyr Val Glu Ala Val Asn Tyr Phe Ser Lys Ala Ile Gln Leu225 230 235 240Asp Glu Gln Asn Ser Val Leu Tyr Ser Asn Arg Ser Ala Cys Phe Ala 245 250 255Ala Met Gln Lys Tyr Lys Asp Ala Leu Asp Asp Ala Asp Lys Cys Ile 260 265 270Ser Ile Lys Pro Asn Trp Ala Lys Gly Tyr Val Arg Arg Gly Ala Ala 275 280 285Leu His Gly Met Arg Arg Tyr Asp Asp Ala Ile Ala Ala Tyr Glu Lys 290 295 300Gly Leu Lys Val Asp Pro Ser Asn Ser Gly Cys Ala Gln Gly Val Lys305 310 315 320Asp Val Gln Val Ala Lys Ala Arg Glu Ala Arg Asp Pro Ile Ala Arg 325 330 335Val Phe Thr Pro Glu Ala Phe Arg Lys Ile Gln Glu Asn Pro Lys Leu 340 345 350Ser Leu Leu Met Leu Gln Pro Asp Tyr Val Lys Met Val Asp Thr Val 355 360 365Ile Arg Asp Pro Ser Gln Gly Arg Leu Tyr Met Glu Asp Gln Arg Phe 370 375 380Ala Leu Thr Leu Met Tyr Leu Ser Gly Met Lys Ile Pro Asn Asp Gly385 390 395 400Asp Gly Glu Glu Glu Glu Arg Pro Ser Ala Lys Ala Ala Glu Thr Ala 405 410 415Lys Pro Lys Glu Glu Lys Pro Leu Thr Asp Asn Glu Lys Glu Ala Leu 420 425 430Ala Leu Lys Glu Glu Gly Asn Lys Leu Tyr Leu Ser Lys Lys Phe Glu 435 440 445Glu Ala Leu Thr Lys Tyr Gln Glu Ala Gln Val Lys Asp Pro Asn Asn 450 455 460Thr Leu Tyr Ile Leu Asn Val Ser Ala Val Tyr Phe Glu Gln Gly Asp465 470 475 480Tyr Asp Lys Cys Ile Ala Glu Cys Glu His Gly Ile Glu His Gly Arg 485 490 495Glu Asn His Cys Asp Tyr Thr Ile Ile Ala Lys Leu Met Thr Arg Asn 500 505 510Ala Leu Cys Leu Gln Arg Gln Arg Lys Tyr Glu Ala Ala Ile Asp Leu 515 520 525Tyr Lys Arg Ala Leu Val Glu Trp Arg Asn Pro Asp Thr Leu Lys Lys 530 535 540Leu Thr Glu Cys Glu Lys Glu His Gln Lys Ala Val Glu Glu Ala Tyr545 550 555 560Ile Asp Pro Glu Ile Ala Lys Gln Lys Lys Asp Glu Gly Asn Gln Tyr 565 570 575Phe Lys Glu Asp Lys Phe Pro Glu Ala Val Ala Ala Tyr Thr Glu Ala 580 585 590Ile Lys Arg Asn Pro Ala Glu His Thr Ser Tyr Ser Asn Arg Ala Ala 595 600 605Ala Tyr Ile Lys Leu Gly Ala Phe Asn Asp Ala Leu Lys Asp Ala Glu 610 615 620Lys Cys Ile Glu Leu Lys Pro Asp Phe Val Lys Gly Tyr Ala Arg Lys625 630 635 640Gly His Ala Tyr Phe Trp Thr Lys Gln Tyr Asn Arg Ala Leu Gln Ala 645 650 655Tyr Asn Glu Gly Leu Lys Val Asp Pro Ser Asn Ala Asp Cys Lys Asp 660 665 670Gly Arg Tyr Arg Thr Ile Met Lys Ile Gln Glu Met Ala Ser Gly Gln 675 680 685Ser Ala Asp Gly Asp Glu Ala Ala Arg Arg Ala Met Asp Asp Pro Glu 690 695 700Ile Ala Ala Ile Met Gln Asp Ser Tyr Met Gln Leu Val Leu Lys Glu705 710 715 720Met Gln Asn Asp Pro Thr Arg Ile Gln Glu Tyr Met Lys Asp Ser Gly 725 730 735Ile Ser Ser Lys Ile Asn Lys Leu Ile Ser Ala Gly Ile Ile Arg Phe 740 745 750Gly Gln Glu Phe Ser Leu Thr Asp Pro Ala Val Leu Gly Glu Glu Thr 755 760 765His Leu Arg Val Arg Val Val Pro Asp Lys Ala Asn Lys Thr Leu Thr 770 775 780Val Glu Asp Asn Gly Ile Gly Met Thr Lys Ala Asp Leu Val Asn Asn785 790 795 800Leu Gly Thr Ile Ala Arg Ser Gly Thr Lys Ala Phe Met Glu Ala Leu 805 810 815Glu Ala Gly Gly Asp Met Ser Met Ile Gly Gln Phe Gly Val Gly Phe 820 825 830Tyr Ser Ala Tyr Leu Val Ala Asp Arg Val Thr Val Val Ser Lys Asn 835 840 845Asn Ser Asp Glu Ala Tyr Val Trp Glu Ser Ser Ala Gly Gly Thr Phe 850 855 860Thr Ile Thr Ser Val Pro Glu Ser Asp Met Lys Arg Gly Thr Arg Ile865 870 875 880Thr Leu His Leu Lys Glu Asp Gln Gln Glu Tyr Leu Glu Glu Arg Arg 885 890 895Val Lys Glu Leu Ile Lys Lys His Ser Glu Phe Ile Gly Tyr Asp Ile 900 905 910Glu Leu Met Val Glu Lys Thr Ala Glu Lys Glu Val Thr Asp Glu Asp 915 920 925Glu Glu Glu Asp Glu Ser Lys Lys Lys Ser Cys Gly Asp Glu Gly Glu 930 935 940Pro Lys Val Glu Glu Val Thr Glu Gly Gly Glu Asp Lys Lys Lys Lys945 950 955 960Thr Lys Lys Val Lys Glu Val Thr Lys Thr Tyr Glu Val Gln Asn Lys 965 970 975His Lys Pro Leu Trp Thr Arg Asp Pro Lys Asp Val Thr Lys Glu Glu 980 985 990Tyr Ala Ala Phe Tyr Lys Ala Ile Ser Asn Asp Trp Glu Asp Pro Ala 995 1000 1005Ala Thr Lys His Phe Ser Val Glu Gly Gln Leu Glu Phe Arg Ala Ile 1010 1015 1020Ala Phe Val Pro Lys Arg Ala Pro Phe Asp Met Phe Glu Pro Asn Lys1025 1030 1035 1040Lys Arg Asn Asn Ile Lys Leu Tyr Val Arg Arg Val Phe Ile Met Asp 1045 1050 1055Asn Cys Glu Asp Leu Cys Pro Asp Trp Leu Gly Phe Val Lys Gly Val 1060 1065 1070Val Asp Ser Glu Asp Leu Pro Leu Asn Ile Ser Arg Glu Asn Leu Gln 1075 1080 1085Gln Asn Lys Ile Leu Lys Val Ile Arg Lys Asn Ile Val Lys Lys Cys 1090 1095 1100Leu Glu Leu Phe Glu Glu Ile Ala Glu Asn Lys Glu Asp Tyr Lys Gln1105 1110 1115 1120Phe Tyr Glu Gln Phe Gly Lys Asn Ile Lys Leu Gly Ile His Glu Asp 1125 1130 1135Thr Ala Asn Arg Lys Lys Leu Met Glu Leu Leu Arg Phe Tyr Ser Thr 1140 1145 1150Glu Ser Gly Glu Glu Met Thr Thr Leu Lys Asp Tyr Val Thr Arg Met 1155 1160 1165Lys Pro Glu Gln Lys Ser Ile Tyr Tyr Ile Thr Gly Asp Ser Lys Lys 1170 1175 1180Lys Leu Glu Ser Ser Pro Phe Ile Glu Lys Ala Arg Arg Cys Gly Leu1185 1190 1195 1200Glu Val Leu Phe Met Thr Glu Pro Ile Asp Glu Tyr Val Met Gln Gln 1205 1210 1215Val Lys Asp Phe Glu Asp Lys Lys Phe Ala Cys Leu Thr Lys Glu Gly 1220 1225 1230Val His Phe Glu Glu Ser Glu Glu Glu Lys Lys Gln Arg Glu Glu Lys 1235 1240 1245Lys Ala Ala Cys Glu Lys Leu Cys Lys Thr Met Lys Glu Val Leu Gly 1250 1255 1260Asp Lys Val Glu Lys Val Thr Val Ser Glu Arg Leu Ser Thr Ser Pro1265 1270 1275 1280Cys Ile Leu Val Thr Ser Glu Phe Gly Trp Ser Ala His Met Glu Gln 1285 1290 1295Ile Met Arg Asn Gln Ala Leu Arg Asp Ser Ser Met Ala Gln Tyr Met 1300 1305 1310Val Ser Lys Lys Thr Met Glu Val Asn Pro Asp His Pro Ile Ile Lys 1315 1320 1325Glu Leu Arg Arg Arg Val Glu Ala Asp Glu Asn Asp Lys Ala Val Lys 1330 1335 1340Asp Leu Val Phe Leu Leu Phe Asp Thr Ser Leu Leu Thr Ser Gly Phe1345 1350 1355 1360Gln Leu Asp Asp Pro Thr Gly Tyr Ala Glu Arg Ile Asn Arg Met Ile 1365 1370 1375Lys Leu Gly Leu Ser Leu Asp Glu Glu Glu Glu Glu Val Ala Glu Ala 1380 1385 1390Pro Pro Ala Glu Ala Ala Pro Ala Glu Val Thr Ala Gly Thr Ser Ser 1395 1400 1405Met Glu Gln Val Asp Asp Ile Met Ala Gln Asn Asp Lys Ile Ala Pro 1410 1415 1420Gln Asp Gln Asp Ser Phe Leu Asp Asp Gln Pro Gly Val Arg Pro Ile1425 1430 1435 1440Pro Ser Phe Asp Asp Met Pro Leu His Gln Asn Leu Leu Arg Gly Ile 1445 1450 1455Tyr Ser Tyr Gly Phe Glu Lys Pro Ser Ser Ile Gln Gln Arg Ala Ile 1460 1465 1470Ala Pro Phe Thr Arg Gly Gly Asp Ile Ile Ala Gln Ala Gln Ser Gly 1475 1480 1485Thr Gly Lys Thr Gly Ala Phe Ser Ile Gly Leu Leu Gln Arg Leu Asp 1490 1495 1500Phe Arg His Asn Leu Ile Gln Gly Leu Val Leu Ser Pro Thr Arg Glu1505 1510 1515 1520Leu Ala Leu Gln Thr Ala Glu Val Ile Ser Arg Ile Gly Glu Phe Leu 1525 1530 1535Ser Asn Ser Ser Lys Phe Cys Glu Thr Phe Val Gly Gly Thr Arg Val 1540 1545 1550Gln Asp Asp Leu Arg Lys Leu Gln Ala Gly Val Ile Val Ala Val Gly 1555 1560 1565Thr Pro Gly Arg Val Ser Asp Val Ile Lys Arg Gly Ala Leu Arg Thr 1570 1575 1580Glu Ser Leu Arg Val Leu Val Leu Asp Glu Ala Asp Glu Met Leu Ser1585 1590 1595 1600Gln Gly Phe Ala Asp Gln Ile Tyr Glu Ile Phe Arg Phe Leu Pro Lys 1605 1610 1615Asp Ile Gln Val Ala Leu Phe Ser Ala Thr Met Pro Glu Glu Val Leu 1620 1625 1630Glu Leu Thr Lys Lys Phe Met Arg Asp 1635 1640 97 1427 PRT Artificial Sequence Fusion (poly-protein) constructs comprising multiple Leishmania antigens 97Met His His His His His His Met Ser Cys Gly Asn Ala Lys Ile Asn 5 10 15Ser Pro Ala Pro Ser Phe Glu Glu Val Ala Leu Met Pro Asn Gly Ser 20 25 30Phe Lys Lys Ile Ser Leu Ser Ser Tyr Lys Gly Lys Trp Val Val Leu 35 40 45Phe Phe Tyr Pro Leu Asp Phe Thr Phe Val Cys Pro Thr Glu Val Ile 50 55 60Ala Phe Ser Asp Ser Val Ser Arg Phe Asn Glu Leu Asn Cys Glu Val 65 70 75 80Leu Ala Cys Ser Ile Asp Ser Glu Tyr Ala His Leu Gln Trp Thr Leu 85 90 95Gln Asp Arg Lys Lys Gly Gly Leu Gly Thr Met Ala Ile Pro Met Leu 100 105 110Ala Asp Lys Thr Lys Ser Ile Ala Arg Ser Tyr Gly Val Leu Glu Glu 115 120 125Ser Gln Gly Val Ala Tyr Arg Gly Leu Phe Ile Ile Asp Pro His Gly 130 135 140Met Leu Arg Gln Ile Thr Val Asn Asp Met Pro Val Gly Arg Ser Val145 150 155 160Glu Glu Val Leu Arg Leu Leu Glu Ala Phe Gln Phe Val Glu Lys His 165 170 175Gly Glu Val Cys Pro Ala Asn Trp Lys Lys Gly Ala Pro Thr Met Lys 180 185 190Pro Glu Pro Asn Ala Ser Val Glu Gly Tyr Phe Ser Lys Gln Gly Ser 195 200 205Met Asp Ala Thr Glu Leu Lys Asn Lys Gly Asn Glu Glu Phe Ser Ala 210 215 220Gly Arg Tyr Val Glu Ala Val Asn Tyr Phe Ser Lys Ala Ile Gln Leu225 230 235 240Asp Glu Gln Asn Ser Val Leu Tyr Ser Asn Arg Ser Ala Cys Phe Ala 245 250 255Ala Met Gln Lys Tyr Lys Asp Ala Leu Asp Asp Ala Asp Lys Cys Ile 260 265 270Ser Ile Lys Pro Asn Trp Ala Lys Gly Tyr Val Arg Arg Gly Ala Ala 275 280 285Leu His Gly Met Arg Arg Tyr Asp Asp Ala Ile Ala Ala Tyr Glu Lys 290 295 300Gly Leu Lys Val Asp Pro Ser Asn Ser Gly Cys Ala Gln Gly Val Lys305 310 315 320Asp Val Gln Val Ala Lys Ala Arg Glu Ala Arg Asp Pro Ile Ala Arg 325 330 335Val Phe Thr Pro Glu Ala Phe Arg Lys Ile Gln Glu Asn Pro Lys Leu 340 345 350Ser Leu Leu Met Leu Gln Pro Asp Tyr Val Lys Met Val Asp Thr Val 355 360 365Ile Arg Asp Pro Ser Gln Gly Arg Leu Tyr Met Glu Asp Gln Arg Phe 370 375 380Ala Leu Thr Leu Met Tyr Leu Ser Gly Met Lys Ile Pro Asn Asp Gly385 390 395 400Asp Gly Glu Glu Glu Glu Arg Pro Ser Ala Lys Ala Ala Glu Thr Ala 405 410 415Lys Pro Lys Glu Glu Lys Pro Leu Thr Asp Asn Glu Lys Glu Ala Leu 420 425 430Ala Leu Lys Glu Glu Gly Asn Lys Leu Tyr Leu Ser Lys Lys Phe Glu 435 440 445Glu Ala Leu Thr Lys Tyr Gln Glu Ala Gln Val Lys Asp Pro Asn Asn 450 455 460Thr Leu Tyr Ile Leu Asn Val Ser Ala Val Tyr Phe Glu Gln Gly Asp465 470 475 480Tyr Asp Lys Cys Ile Ala Glu Cys Glu His Gly Ile Glu His Gly Arg 485 490 495Glu Asn His Cys Asp Tyr Thr Ile Ile Ala Lys Leu Met Thr Arg Asn 500 505 510Ala Leu Cys Leu Gln Arg Gln Arg Lys Tyr Glu Ala Ala Ile Asp Leu 515 520 525Tyr Lys Arg Ala Leu Val Glu Trp Arg Asn Pro Asp Thr Leu Lys Lys 530 535 540Leu Thr Glu Cys Glu Lys Glu His Gln Lys Ala Val Glu Glu Ala Tyr545 550 555 560Ile Asp Pro Glu Ile Ala Lys Gln Lys Lys Asp Glu Gly Asn Gln Tyr 565 570 575Phe Lys Glu Asp Lys Phe Pro Glu Ala Val Ala Ala Tyr Thr Glu Ala 580 585 590Ile Lys Arg Asn Pro Ala Glu His Thr Ser Tyr Ser Asn Arg Ala Ala 595 600 605Ala Tyr Ile Lys Leu Gly Ala Phe Asn Asp Ala Leu Lys Asp Ala Glu 610 615 620Lys Cys Ile Glu Leu Lys Pro Asp Phe Val Lys Gly Tyr Ala Arg Lys625 630 635 640Gly His Ala Tyr Phe Trp Thr Lys Gln Tyr Asn Arg Ala Leu Gln Ala 645 650 655Tyr Asn Glu Gly Leu Lys Val Asp Pro Ser Asn Ala Asp Cys Lys Asp 660 665 670Gly Arg Tyr Arg Thr Ile Met Lys Ile Gln Glu Met Ala Ser Gly Gln 675 680 685Ser Ala Asp Gly Asp Glu Ala Ala Arg Arg Ala Met Asp Asp Pro Glu 690 695 700Ile Ala Ala Ile Met Gln Asp Ser Tyr Met Gln Leu Val Leu Lys Glu705 710 715 720Met Gln Asn Asp Pro Thr Arg Ile Gln Glu Tyr Met Lys Asp Ser Gly 725 730 735Ile Ser Ser Lys Ile Asn Lys Leu Ile Ser Ala Gly Ile Ile Arg Phe 740 745 750Gly Gln Glu Phe Ser Leu Thr Asp Pro Ala Val Leu Gly Glu Glu Thr 755 760 765His Leu Arg Val Arg Val Val Pro Asp Lys Ala Asn Lys Thr Leu Thr 770 775 780Val Glu Asp Asn Gly Ile Gly Met Thr Lys Ala Asp Leu Val Asn Asn785 790 795 800Leu Gly Thr Ile Ala Arg Ser Gly Thr Lys Ala Phe Met Glu Ala Leu 805 810 815Glu Ala Gly Gly Asp Met Ser Met Ile Gly Gln Phe Gly Val Gly Phe 820 825 830Tyr Ser Ala Tyr Leu Val Ala Asp Arg Val Thr Val Val Ser Lys Asn 835 840 845Asn Ser Asp Glu Ala Tyr Val Trp Glu Ser Ser Ala Gly Gly Thr Phe 850 855 860Thr Ile Thr Ser Val Pro Glu Ser Asp Met Lys Arg Gly Thr Arg Ile865 870 875 880Thr Leu His Leu Lys Glu Asp Gln Gln Glu Tyr Leu Glu Glu Arg Arg 885 890 895Val Lys Glu Leu Ile Lys Lys His Ser Glu Phe Ile Gly Tyr Asp Ile 900 905 910Glu Leu Met Val Glu Lys Thr Ala Glu Lys Glu Val Thr Asp Glu Asp 915 920 925Glu Glu Glu Asp Glu Ser Lys Lys Lys Ser Cys Gly Asp Glu Gly Glu 930 935 940Pro Lys Val Glu Glu Val Thr Glu Gly Gly Glu Asp Lys Lys Lys Lys945 950 955 960Thr Lys Lys Val Lys Glu Val Thr Lys Thr Tyr Glu Val Gln Asn Lys 965 970 975His Lys Pro Leu Trp Thr Arg Asp Pro Lys Asp Val Thr Lys Glu Glu 980 985 990Tyr Ala Ala Phe Tyr Lys Ala Ile Ser Asn Asp Trp Glu Asp Pro Ala 995 1000 1005Ala Thr Lys His Phe Ser Val Glu Gly Gln Leu Glu Phe Arg Ala Ile 1010 1015 1020Ala Phe Val Pro Lys Arg Ala Pro Phe Asp Met Phe Glu Pro Asn Lys1025 1030 1035 1040Lys Arg Asn Asn Ile Lys Leu Tyr Val Arg Arg Val Phe Ile Met Asp 1045 1050 1055Asn Cys Glu Asp Leu Cys Pro Asp Trp Leu Gly Phe Val Lys Gly Val 1060 1065 1070Val Asp Ser Glu Asp Leu Pro Leu Asn Ile Ser Arg Glu Asn Leu Gln 1075 1080 1085Gln Asn Lys Ile Leu Lys Val Ile Arg Lys Asn Ile Val Lys Lys Cys 1090 1095 1100Leu Glu Leu Phe Glu Glu Ile Ala Glu Asn Lys Glu Asp Tyr Lys Gln1105 1110 1115 1120Phe Tyr Glu Gln Phe Gly Lys Asn Ile Lys Leu Gly Ile His Glu Asp 1125 1130 1135Thr Ala Asn Arg Lys Lys Leu Met Glu Leu Leu Arg Phe Tyr Ser Thr 1140 1145 1150Glu Ser Gly Glu Glu Met Thr Thr Leu Lys Asp Tyr Val Thr Arg Met 1155 1160 1165Lys Pro Glu Gln Lys Ser Ile Tyr Tyr Ile Thr Gly Asp Ser Lys Lys 1170 1175 1180Lys Leu Glu Ser Ser Pro Phe Ile Glu Lys Ala Arg Arg Cys Gly Leu1185 1190 1195 1200Glu Val Leu Phe Met Thr Glu Pro Ile Asp Glu Tyr Val Met Gln Gln 1205 1210 1215Val Lys Asp Phe Glu Asp Lys Lys Phe Ala Cys Leu Thr Lys Glu Gly 1220 1225 1230Val His Phe Glu Glu Ser Glu Glu Glu Lys Lys Gln Arg Glu Glu Lys 1235 1240 1245Lys Ala Ala Cys Glu Lys Leu Cys Lys Thr Met Lys Glu Val Leu Gly 1250 1255 1260Asp Lys Val Glu Lys Val Thr Val Ser Glu Arg Leu Ser Thr Ser Pro1265 1270 1275 1280Cys Ile Leu Val Thr Ser Glu Phe Gly Trp Ser Ala His Met Glu Gln 1285 1290 1295Ile Met Arg Asn Gln Ala Leu Arg Asp Ser Ser Met Ala Gln Tyr Met 1300 1305 1310Val Ser Lys Lys Thr Met Glu Val Asn Pro Asp His Pro Ile Ile Lys 1315 1320 1325Glu Leu Arg Arg Arg Val Glu Ala Asp Glu Asn Asp Lys Ala Val Lys 1330 1335 1340Asp Leu Val Phe Leu Leu Phe Asp Thr Ser Leu Leu Thr Ser Gly Phe1345 1350 1355 1360Gln Leu Asp Asp Pro Thr Gly Tyr Ala Glu Arg Ile Asn Arg Met Ile 1365 1370 1375Lys Leu Gly Leu Ser Leu Asp Glu Glu Glu Glu Glu Val Ala Glu Ala 1380 1385 1390Pro Pro Ala Glu Ala Ala Pro Ala Glu Val Thr Ala Gly Thr Ser Ser 1395 1400 1405Met Glu Gln Val Asp Asp Ile His His Thr Gly Gly Arg Ser Ser Arg 1410 1415 1420Ser Gly Cys1425 98 4929 DNA Artificial Sequence DNA sequence encoding fusion (poly-protein) constructs comprising multiple Leishmania antigens 98catatgcacc accaccacca ccacatgtcc tgcggtaacg ccaagatcaa ctctcccgcg 60ccgtccttcg aggaggtggc gctcatgccc aacggcagct tcaagaagat cagcctctcc 120tcctacaagg gcaagtgggt cgtgctcttc ttctacccgc tcgacttcac cttcgtgtgc 180ccgacagagg tcatcgcgtt ctccgacagc gtgagtcgct tcaacgagct caactgcgag 240gtcctcgcgt gctcgataga cagcgagtac gcgcacctgc agtggacgct gcaggaccgc 300aagaagggcg gcctcgggac catggcgatc ccaatgctag ccgacaagac caagagcatc 360gctcgttcct acggcgtgct ggaggagagc cagggcgtgg cctaccgcgg tctcttcatc 420atcgaccccc atggcatgct gcgtcagatc accgtcaatg acatgccggt gggccgcagc 480gtggaggagg ttctacgcct gctggaggct tttcagttcg tggagaagca cggcgaggtg 540tgccccgcga actggaagaa gggcgccccc acgatgaagc cggaaccgaa tgcgtctgtc 600gagggatact tcagcaagca gggatccatg gacgcaactg agctgaagaa caaggggaac 660gaagagttct ccgccggccg ctatgtggag gcggtgaact acttctcaaa ggcgatccag 720ttggatgagc agaacagtgt cctctacagc aaccgctccg cctgttttgc agccatgcag 780aaatacaagg acgcgctgga cgacgccgac aagtgcatct cgatcaagcc gaattgggcc 840aagggctacg tgcgccgagg agcagctctc catggcatgc gccgctacga cgatgccatt 900gccgcgtatg aaaaggggct caaggtggac ccttccaaca gcggctgcgc gcagggcgtg 960aaggacgtgc aggtagccaa ggcccgcgaa gcacgtgacc ccatcgctcg cgtcttcacc 1020ccggaggcgt tccgcaagat ccaagagaat cccaagctgt ctctacttat gctgcagccg 1080gactacgtga agatggtaga caccgtcatc cgcgaccctt cgcagggccg gctgtacatg 1140gaagaccagc gctttgccct gacgctcatg tacctgagcg gaatgaagat tcccaacgat 1200ggtgatggcg aggaggagga acgtccgtct gcgaaggcgg cagagacagc gaagccaaaa 1260gaggagaagc ctctcaccga caacgagaag gaggccctgg cgctcaagga ggagggcaac 1320aagctgtacc tctcgaagaa gtttgaggag gcgctgacca agtaccaaga ggcgcaggtg 1380aaagacccca acaacacttt atacattctg aacgtgtcgg ccgtgtactt cgagcagggt 1440gactacgaca agtgcatcgc cgagtgcgag cacggtatcg agcacggtcg cgagaaccac 1500tgcgactaca caatcattgc gaagctcatg acccggaacg ccttgtgcct ccagaggcag 1560aggaagtacg aggctgctat cgacctttac aagcgcgccc ttgtcgagtg gcgtaaccct 1620gacaccctca agaagctgac ggagtgcgag aaggagcacc aaaaggcggt ggaggaagcc 1680tacatcgatc ctgagatcgc gaagcagaag aaagacgaag gtaaccagta cttcaaggag 1740gataagttcc ccgaggccgt ggcagcgtac acggaggcca tcaagcgcaa ccctgccgag 1800cacacctcct acagcaatcg cgcggccgcg tacatcaagc ttggagcctt caacgacgcc 1860ctcaaggacg cggagaagtg cattgagctg aagcccgact ttgttaaggg ctacgcgcgc 1920aagggtcatg cttacttttg gaccaagcag tacaaccgcg cgctgcaggc gtacaatgag 1980ggcctcaagg tggacccgag caatgcggac tgcaaggatg ggcggtatcg cacaatcatg 2040aagattcagg agatggcatc tggccaatcc gcggatggcg acgaggcggc gcgccgggcc 2100atggacgatc ctgaaatcgc ggcaatcatg caagatagct acatgcaact agtgttgaag 2160gagatgcaga acgatcccac gcgcattcag gagtacatga aggactccgg gatctcatcg 2220aagatcaaca agctgatttc agctggcatc attcgttttg gtcaggaatt cagcctgacg 2280gacccggcgg tgctgggcga ggagactcac ctgcgcgtcc gcgtggtgcc ggacaaggcg 2340aacaagacgc tgacggtgga ggataacggc atcggcatga ccaaggcgga cctcgtgaac 2400aatctgggca cgatcgcgcg ctccggcacg aaggcgttca tggaggcact ggaggccggc 2460ggcgacatga gcatgatcgg ccagttcggt gtcggcttct actccgcgta ccttgtggcg 2520gaccgcgtga cggtggtgtc gaagaacaac tcggacgagg cgtacgtatg ggagtcgtcc 2580gcgggcggca cgttcaccat cacgagcgtg ccggagtcgg acatgaagcg cggcacgcgc 2640atcacgctgc acctaaagga ggaccagcag gagtacctgg aggagcgccg ggtgaaggag 2700ctgatcaaga agcactccga gttcatcggc tacgacatcg agctgatggt ggagaagacg 2760gcggagaagg aggtgacgga cgaggacgag gaggaggacg agtcgaagaa gaagtcctgc 2820ggggacgagg gcgagccgaa ggtggaggag gtgacggagg gcggcgagga caagaagaag 2880aagacgaaga aggtgaagga ggtgacgaag acgtacgagg tccagaacaa gcacaagccg 2940ctctggacgc gcgacccgaa ggacgtgacg aaggaggagt acgcggcctt ctacaaggcc 3000atctccaacg actgggagga cccggcggcg acgaagcact tctcggtgga gggccagctg 3060gagttccgcg cgatcgcgtt cgtgccgaag cgcgcgccgt tcgacatgtt cgagccgaac 3120aagaagcgca acaacatcaa gctgtacgtg cgccgcgtgt tcatcatgga caactgcgag 3180gacctgtgcc cggactggct cggcttcgtg aagggcgtcg tggacagcga ggacctgccg 3240ctgaacatct cgcgcgagaa cctgcagcag aacaagatcc tgaaggtgat ccgcaagaac 3300atcgtgaaga agtgcctgga gctgttcgaa gagatagcgg agaacaagga ggactacaag 3360cagttctacg agcagttcgg caagaacatc aagctgggca tccacgagga cacggcgaac 3420cgcaagaagc tgatggagtt gctgcgcttc tacagcaccg agtcggggga ggagatgacg 3480acactgaagg actacgtgac gcgcatgaag ccggagcaga agtcgatcta ctacatcact 3540ggcgacagca agaagaagct ggagtcgtcg ccgttcatcg agaaggcgag acgctgcggg 3600ctcgaggtgc tgttcatgac ggagccgatc gacgagtacg tgatgcagca ggtgaaggac 3660ttcgaggaca agaagttcgc gtgcctgacg aaggaaggcg tgcacttcga ggagtccgag 3720gaggagaaga agcagcgcga ggagaagaag gcggcgtgcg agaagctgtg caagacgatg 3780aaggaggtgc tgggcgacaa ggtggagaag gtgaccgtgt cggagcgcct gtcgacgtcg 3840ccgtgcatcc tggtgacgtc ggagtttggg tggtcggcgc acatggaaca gatcatgcgc 3900aaccaggcgc tgcgcgactc cagcatggcg cagtacatgg tgtccaagaa gacgatggag 3960gtgaaccccg accaccccat catcaaggag ctgcgccgcc gcgtggaggc ggacgagaac 4020gacaaggccg tgaaggacct cgtcttcctg ctcttcgaca cgtcgctgct cacgtccggc 4080ttccagctgg atgaccccac cggctacgcc gagcgcatca accgcatgat caagctcggc 4140ctgtcgctcg acgaggagga ggaggaggtc gccgaggcgc cgccggccga ggcagccccc 4200gcggaggtca ccgccggcac ctccagcatg gagcaggtgg acgatatcat ggcgcagaat 4260gataagatcg ccccccagga ccaggactcc ttcctcgatg accagcccgg cgttcgcccg 4320atcccgtcct tcgacgacat gccgctgcac cagaacctgc tgcgtggcat ctactcgtac 4380gggttcgaga agccgtccag catccagcag cgcgcgatag cccccttcac gcgcggcggc 4440gacatcatcg cgcaggccca gtccggtacc ggcaagacgg gtgccttctc catcggtctg 4500ctgcagcgcc tggacttccg ccacaacctg atccagggcc tcgtgctctc ccccactcgc 4560gagctggccc tgcagacggc ggaggtgatc agccgcatcg gtgagttcct gtcgaacagc 4620tccaagttct gcgagacctt tgtcggcggc acgcgcgtgc aggatgacct gcgcaagctg 4680caggccggcg tcatcgttgc cgtgggcacg ccgggccgcg tgtccgacgt gatcaagcgt 4740ggcgcgctgc gcacagagtc gctgcgcgtg ctggtgctcg acgaggctga tgagatgctg 4800tctcagggct tcgcggacca gatttacgag atcttccgct tcctgccgaa ggacatccag 4860gtcgcgctct tctccgccac gatgccggag gaggtactgg agctgacgaa gaagttcatg 4920cgcgactaa 4929 99 4233 DNA Artificial Sequence DNA sequence encoding fusion (poly-protein) constructs comprising multiple Leishmania antigens 99ccagtgtggt ggatgtcctg cggtaacgcc aagatcaact ctcccgcgcc gtccttcgag 60gaggtggcgc tcatgcccaa cggcagcttc aagaagatca gcctctcctc ctacaagggc 120aagtgggtcg tgctcttctt ctacccgctc gacttcacct tcgtgtgccc gacagaggtc 180atcgcgttct ccgacagcgt gagtcgcttc aacgagctca actgcgaggt cctcgcgtgc 240tcgatagaca gcgagtacgc gcacctgcag tggacgctgc aggaccgcaa gaagggcggc 300ctcgggacca tggcgatccc aatgctagcc gacaagacca agagcatcgc tcgttcctac 360ggcgtgctgg aggagagcca gggcgtggcc taccgcggtc tcttcatcat cgacccccat 420ggcatgctgc gtcagatcac cgtcaatgac atgccggtgg gccgcagcgt ggaggaggtt 480ctacgcctgc tggaggcttt tcagttcgtg gagaagcacg gcgaggtgtg ccccgcgaac 540tggaagaagg gcgcccccac gatgaagccg gaaccgaatg cgtctgtcga gggatacttc 600agcaagcagg gatccatgga cgcaactgag ctgaagaaca aggggaacga agagttctcc 660gccggccgct atgtggaggc ggtgaactac ttctcaaagg cgatccagtt ggatgagcag 720aacagtgtcc tctacagcaa ccgctccgcc tgttttgcag ccatgcagaa atacaaggac 780gcgctggacg acgccgacaa gtgcatctcg atcaagccga attgggccaa gggctacgtg 840cgccgaggag cagctctcca tggcatgcgc cgctacgacg atgccattgc cgcgtatgaa 900aaggggctca aggtggaccc ttccaacagc ggctgcgcgc agggcgtgaa ggacgtgcag 960gtagccaagg cccgcgaagc acgtgacccc atcgctcgcg tcttcacccc ggaggcgttc 1020cgcaagatcc aagagaatcc caagctgtct ctacttatgc tgcagccgga ctacgtgaag 1080atggtagaca ccgtcatccg cgacccttcg cagggccggc tgtacatgga agaccagcgc 1140tttgccctga cgctcatgta cctgagcgga atgaagattc ccaacgatgg tgatggcgag 1200gaggaggaac gtccgtctgc gaaggcggca gagacagcga agccaaaaga ggagaagcct 1260ctcaccgaca acgagaagga ggccctggcg ctcaaggagg agggcaacaa gctgtacctc 1320tcgaagaagt ttgaggaggc gctgaccaag taccaagagg cgcaggtgaa agaccccaac 1380aacactttat acattctgaa cgtgtcggcc gtgtacttcg agcagggtga ctacgacaag 1440tgcatcgccg agtgcgagca cggtatcgag cacggtcgcg agaaccactg cgactacaca 1500atcattgcga agctcatgac ccggaacgcc ttgtgcctcc agaggcagag gaagtacgag 1560gctgctatcg acctttacaa gcgcgccctt gtcgagtggc gtaaccctga caccctcaag 1620aagctgacgg agtgcgagaa ggagcaccaa aaggcggtgg aggaagccta catcgatcct 1680gagatcgcga agcagaagaa agacgaaggt aaccagtact tcaaggagga taagttcccc 1740gaggccgtgg cagcgtacac ggaggccatc aagcgcaacc ctgccgagca cacctcctac 1800agcaatcgcg cggccgcgta catcaagctt ggagccttca acgacgccct caaggacgcg 1860gagaagtgca ttgagctgaa gcccgacttt gttaagggct acgcgcgcaa gggtcatgct 1920tacttttgga ccaagcagta caaccgcgcg ctgcaggcgt acaatgaggg cctcaaggtg 1980gacccgagca atgcggactg caaggatggg cggtatcgca caatcatgaa gattcaggag 2040atggcatctg gccaatccgc ggatggcgac gaggcggcgc gccgggccat ggacgatcct 2100gaaatcgcgg caatcatgca agatagctac atgcaactag tgttgaagga gatgcagaac 2160gatcccacgc gcattcagga gtacatgaag gactccggga tctcatcgaa gatcaacaag 2220ctgatttcag ctggcatcat tcgttttggt caggaattca gcctgacgga cccggcggtg 2280ctgggcgagg agactcacct gcgcgtccgc gtggtgccgg acaaggcgaa caagacgctg 2340acggtggagg ataacggcat cggcatgacc aaggcggacc tcgtgaacaa tctgggcacg 2400atcgcgcgct ccggcacgaa ggcgttcatg gaggcactgg aggccggcgg cgacatgagc 2460atgatcggcc agttcggtgt cggcttctac tccgcgtacc ttgtggcgga ccgcgtgacg 2520gtggtgtcga agaacaactc ggacgaggcg tacgtatggg agtcgtccgc gggcggcacg 2580ttcaccatca cgagcgtgcc ggagtcggac atgaagcgcg gcacgcgcat cacgctgcac 2640ctaaaggagg accagcagga gtacctggag gagcgccggg tgaaggagct gatcaagaag 2700cactccgagt tcatcggcta cgacatcgag ctgatggtgg agaagacggc ggagaaggag 2760gtgacggacg aggacgagga ggaggacgag tcgaagaaga agtcctgcgg ggacgagggc 2820gagccgaagg tggaggaggt gacggagggc ggcgaggaca agaagaagaa gacgaagaag 2880gtgaaggagg tgacgaagac gtacgaggtc cagaacaagc acaagccgct ctggacgcgc 2940gacccgaagg acgtgacgaa ggaggagtac gcggccttct acaaggccat ctccaacgac 3000tgggaggacc cggcggcgac gaagcacttc tcggtggagg gccagctgga gttccgcgcg 3060atcgcgttcg tgccgaagcg cgcgccgttc gacatgttcg agccgaacaa gaagcgcaac 3120aacatcaagc tgtacgtgcg ccgcgtgttc atcatggaca actgcgagga cctgtgcccg 3180gactggctcg gcttcgtgaa gggcgtcgtg gacagcgagg acctgccgct gaacatctcg 3240cgcgagaacc tgcagcagaa caagatcctg aaggtgatcc gcaagaacat cgtgaagaag 3300tgcctggagc tgttcgaaga gatagcggag aacaaggagg actacaagca gttctacgag 3360cagttcggca agaacatcaa gctgggcatc cacgaggaca cggcgaaccg caagaagctg 3420atggagttgc tgcgcttcta cagcaccgag tcgggggagg agatgacgac actgaaggac 3480tacgtgacgc gcatgaagcc ggagcagaag tcgatctact acatcactgg cgacagcaag 3540aagaagctgg agtcgtcgcc gttcatcgag aaggcgagac gctgcgggct cgaggtgctg 3600ttcatgacgg agccgatcga cgagtacgtg atgcagcagg tgaaggactt cgaggacaag 3660aagttcgcgt gcctgacgaa ggaaggcgtg cacttcgagg agtccgagga ggagaagaag 3720cagcgcgagg agaagaaggc ggcgtgcgag aagctgtgca agacgatgaa ggaggtgctg 3780ggcgacaagg tggagaaggt gaccgtgtcg gagcgcctgt cgacgtcgcc gtgcatcctg 3840gtgacgtcgg agtttgggtg gtcggcgcac atggaacaga tcatgcgcaa ccaggcgctg 3900cgcgactcca gcatggcgca gtacatggtg tccaagaaga cgatggaggt gaaccccgac 3960caccccatca tcaaggagct gcgccgccgc gtggaggcgg acgagaacga caaggccgtg 4020aaggacctcg tcttcctgct cttcgacacg tcgctgctca cgtccggctt ccagctggat 4080gaccccaccg gctacgccga gcgcatcaac cgcatgatca agctcggcct gtcgctcgac 4140gaggaggagg aggaggtcgc cgaggcgccg ccggccgagg cagcccccgc ggaggtcacc 4200gccggcacct ccagcatgga gcaggtggac taa 4233 100 4917 DNA Artificial Sequence DNA sequence encoding fusion (poly-protein) constructs comprising multiple Leishmania antigens 100ccagtgtggt ggatgtcctg cggtaacgcc aagatcaact ctcccgcgcc gtccttcgag 60gaggtggcgc tcatgcccaa cggcagcttc aagaagatca gcctctcctc ctacaagggc 120aagtgggtcg tgctcttctt ctacccgctc gacttcacct tcgtgtgccc gacagaggtc 180atcgcgttct ccgacagcgt gagtcgcttc aacgagctca actgcgaggt cctcgcgtgc 240tcgatagaca gcgagtacgc gcacctgcag tggacgctgc aggaccgcaa gaagggcggc 300ctcgggacca tggcgatccc aatgctagcc gacaagacca agagcatcgc tcgttcctac 360ggcgtgctgg aggagagcca gggcgtggcc taccgcggtc tcttcatcat cgacccccat 420ggcatgctgc gtcagatcac cgtcaatgac atgccggtgg gccgcagcgt ggaggaggtt 480ctacgcctgc tggaggcttt tcagttcgtg gagaagcacg gcgaggtgtg ccccgcgaac 540tggaagaagg gcgcccccac gatgaagccg gaaccgaatg cgtctgtcga gggatacttc 600agcaagcagg gatccatgga cgcaactgag ctgaagaaca aggggaacga agagttctcc 660gccggccgct atgtggaggc ggtgaactac ttctcaaagg cgatccagtt ggatgagcag 720aacagtgtcc tctacagcaa ccgctccgcc tgttttgcag ccatgcagaa atacaaggac 780gcgctggacg acgccgacaa gtgcatctcg atcaagccga attgggccaa gggctacgtg 840cgccgaggag cagctctcca tggcatgcgc cgctacgacg atgccattgc cgcgtatgaa 900aaggggctca aggtggaccc ttccaacagc ggctgcgcgc agggcgtgaa ggacgtgcag 960gtagccaagg cccgcgaagc acgtgacccc atcgctcgcg tcttcacccc ggaggcgttc 1020cgcaagatcc aagagaatcc caagctgtct ctacttatgc tgcagccgga ctacgtgaag 1080atggtagaca ccgtcatccg cgacccttcg cagggccggc tgtacatgga agaccagcgc 1140tttgccctga cgctcatgta cctgagcgga atgaagattc ccaacgatgg tgatggcgag 1200gaggaggaac gtccgtctgc gaaggcggca gagacagcga agccaaaaga ggagaagcct 1260ctcaccgaca acgagaagga ggccctggcg ctcaaggagg agggcaacaa gctgtacctc 1320tcgaagaagt ttgaggaggc gctgaccaag taccaagagg cgcaggtgaa agaccccaac 1380aacactttat acattctgaa cgtgtcggcc gtgtacttcg agcagggtga ctacgacaag 1440tgcatcgccg agtgcgagca cggtatcgag cacggtcgcg agaaccactg cgactacaca 1500atcattgcga agctcatgac ccggaacgcc ttgtgcctcc agaggcagag gaagtacgag 1560gctgctatcg acctttacaa gcgcgccctt gtcgagtggc gtaaccctga caccctcaag 1620aagctgacgg agtgcgagaa ggagcaccaa aaggcggtgg aggaagccta catcgatcct 1680gagatcgcga agcagaagaa agacgaaggt aaccagtact tcaaggagga taagttcccc 1740gaggccgtgg cagcgtacac ggaggccatc aagcgcaacc ctgccgagca cacctcctac 1800agcaatcgcg cggccgcgta catcaagctt ggagccttca acgacgccct caaggacgcg 1860gagaagtgca ttgagctgaa gcccgacttt gttaagggct acgcgcgcaa gggtcatgct 1920tacttttgga ccaagcagta caaccgcgcg ctgcaggcgt acaatgaggg cctcaaggtg 1980gacccgagca atgcggactg caaggatggg cggtatcgca caatcatgaa gattcaggag 2040atggcatctg gccaatccgc ggatggcgac gaggcggcgc gccgggccat ggacgatcct 2100gaaatcgcgg caatcatgca agatagctac atgcaactag tgttgaagga gatgcagaac 2160gatcccacgc gcattcagga gtacatgaag gactccggga tctcatcgaa gatcaacaag 2220ctgatttcag ctggcatcat tcgttttggt caggaattca gcctgacgga cccggcggtg 2280ctgggcgagg agactcacct gcgcgtccgc gtggtgccgg acaaggcgaa caagacgctg 2340acggtggagg ataacggcat cggcatgacc aaggcggacc tcgtgaacaa tctgggcacg 2400atcgcgcgct ccggcacgaa ggcgttcatg gaggcactgg aggccggcgg cgacatgagc 2460atgatcggcc agttcggtgt cggcttctac tccgcgtacc ttgtggcgga ccgcgtgacg 2520gtggtgtcga agaacaactc ggacgaggcg tacgtatggg agtcgtccgc gggcggcacg 2580ttcaccatca cgagcgtgcc ggagtcggac atgaagcgcg gcacgcgcat cacgctgcac 2640ctaaaggagg accagcagga gtacctggag gagcgccggg tgaaggagct gatcaagaag 2700cactccgagt tcatcggcta cgacatcgag ctgatggtgg agaagacggc ggagaaggag 2760gtgacggacg aggacgagga ggaggacgag tcgaagaaga agtcctgcgg ggacgagggc 2820gagccgaagg tggaggaggt gacggagggc ggcgaggaca agaagaagaa gacgaagaag 2880gtgaaggagg tgacgaagac gtacgaggtc cagaacaagc acaagccgct ctggacgcgc 2940gacccgaagg acgtgacgaa ggaggagtac gcggccttct acaaggccat ctccaacgac 3000tgggaggacc cggcggcgac gaagcacttc tcggtggagg gccagctgga gttccgcgcg 3060atcgcgttcg tgccgaagcg cgcgccgttc gacatgttcg agccgaacaa gaagcgcaac 3120aacatcaagc tgtacgtgcg ccgcgtgttc atcatggaca actgcgagga cctgtgcccg 3180gactggctcg gcttcgtgaa gggcgtcgtg gacagcgagg acctgccgct gaacatctcg 3240cgcgagaacc tgcagcagaa caagatcctg aaggtgatcc gcaagaacat cgtgaagaag 3300tgcctggagc tgttcgaaga gatagcggag aacaaggagg actacaagca gttctacgag 3360cagttcggca agaacatcaa gctgggcatc cacgaggaca cggcgaaccg caagaagctg 3420atggagttgc tgcgcttcta cagcaccgag tcgggggagg agatgacgac actgaaggac 3480tacgtgacgc gcatgaagcc ggagcagaag tcgatctact acatcactgg cgacagcaag 3540aagaagctgg agtcgtcgcc gttcatcgag aaggcgagac gctgcgggct cgaggtgctg 3600ttcatgacgg agccgatcga cgagtacgtg atgcagcagg tgaaggactt cgaggacaag 3660aagttcgcgt gcctgacgaa ggaaggcgtg cacttcgagg agtccgagga ggagaagaag 3720cagcgcgagg agaagaaggc ggcgtgcgag aagctgtgca agacgatgaa ggaggtgctg 3780ggcgacaagg tggagaaggt gaccgtgtcg gagcgcctgt cgacgtcgcc gtgcatcctg 3840gtgacgtcgg agtttgggtg gtcggcgcac atggaacaga tcatgcgcaa ccaggcgctg 3900cgcgactcca gcatggcgca gtacatggtg tccaagaaga cgatggaggt gaaccccgac 3960caccccatca tcaaggagct gcgccgccgc gtggaggcgg acgagaacga caaggccgtg 4020aaggacctcg tcttcctgct cttcgacacg tcgctgctca cgtccggctt ccagctggat 4080gaccccaccg gctacgccga gcgcatcaac cgcatgatca agctcggcct gtcgctcgac 4140gaggaggagg aggaggtcgc cgaggcgccg ccggccgagg cagcccccgc ggaggtcacc 4200gccggcacct ccagcatgga gcaggtggac gatatcatgg cgcagaatga taagatcgcc 4260ccccaggacc aggactcctt cctcgatgac cagcccggcg ttcgcccgat cccgtccttc 4320gacgacatgc cgctgcacca gaacctgctg cgtggcatct actcgtacgg gttcgagaag 4380ccgtccagca tccagcagcg cgcgatagcc cccttcacgc gcggcggcga catcatcgcg 4440caggcccagt ccggtaccgg caagacgggt gccttctcca tcggtctgct gcagcgcctg 4500gacttccgcc acaacctgat ccagggcctc gtgctctccc ccactcgcga gctggccctg 4560cagacggcgg aggtgatcag ccgcatcggt gagttcctgt cgaacagctc caagttctgc 4620gagacctttg tcggcggcac gcgcgtgcag gatgacctgc gcaagctgca ggccggcgtc 4680atcgttgccg tgggcacgcc gggccgcgtg tccgacgtga tcaagcgtgg cgcgctgcgc 4740acagagtcgc tgcgcgtgct ggtgctcgac gaggctgatg agatgctgtc tcagggcttc 4800gcggaccaga tttacgagat cttccgcttc ctgccgaagg acatccaggt cgcgctcttc 4860tccgccacga tgccggagga ggtactggag ctgacgaaga agttcatgcg cgactaa 4917 101 2735 DNA Artificial Sequence DNA sequence encoding fusion (poly-protein) constructs comprising multiple Leishmania antigens 101catatgcacc accaccacca ccacatgtcc tgcggtaacg ccaagatcaa ctctcccgcg 60ccgtccttcg aggaggtggc gctcatgccc aacggcagct tcaagaagat cagcctctcc 120tcctacaagg gcaagtgggt cgtgctcttc ttctacccgc tcgacttcac cttcgtgtgc 180ccgacagagg tcatcgcgtt ctccgacagc gtgagtcgct tcaacgagct caactgcgag 240gtcctcgcgt gctcgataga cagcgagtac gcgcacctgc agtggacgct gcaggaccgc 300aagaagggcg gcctcgggac catggcgatc ccaatgctag ccgacaagac caagagcatc 360gctcgttcct acggcgtgct ggaggagagc cagggcgtgg cctaccgcgg tctcttcatc 420atcgaccccc atggcatgct gcgtcagatc accgtcaatg acatgccggt gggccgcagc 480gtggaggagg ttctacgcct gctggaggct tttcagttcg tggagaagca cggcgaggtg 540tgccccgcga actggaagaa gggcgccccc acgatgaagc cggaaccgaa tgcgtctgtc 600gagggatact tcagcaagca gggatccatg gacgcaactg agctgaagaa caaggggaac 660gaagagttct ccgccggccg ctatgtggag gcggtgaact acttctcaaa ggcgatccag 720ttggatgagc agaacagtgt cctctacagc aaccgctccg cctgttttgc agccatgcag 780aaatacaagg acgcgctgga cgacgccgac aagtgcatct cgatcaagcc gaattgggcc 840aagggctacg tgcgccgagg agcagctctc catggcatgc gccgctacga cgatgccatt 900gccgcgtatg aaaaggggct caaggtggac ccttccaaca gcggctgcgc gcagggcgtg 960aaggacgtgc aggtagccaa ggcccgcgaa gcacgtgacc ccatcgctcg cgtcttcacc 1020ccggaggcgt tccgcaagat ccaagagaat cccaagctgt ctctacttat gctgcagccg 1080gactacgtga agatggtaga caccgtcatc cgcgaccctt cgcagggccg gctgtacatg 1140gaagaccagc gctttgccct gacgctcatg tacctgagcg gaatgaagat tcccaacgat 1200ggtgatggcg aggaggagga acgtccgtct gcgaaggcgg cagagacagc gaagccaaaa 1260gaggagaagc ctctcaccga caacgagaag gaggccctgg cgctcaagga ggagggcaac 1320aagctgtacc tctcgaagaa gtttgaggag gcgctgacca agtaccaaga ggcgcaggtg 1380aaagacccca acaacacttt atacattctg aacgtgtcgg ccgtgtactt cgagcagggt 1440gactacgaca agtgcatcgc cgagtgcgag cacggtatcg agcacggtcg cgagaaccac 1500tgcgactaca caatcattgc gaagctcatg acccggaacg ccttgtgcct ccagaggcag 1560aggaagtacg aggctgctat cgacctttac aagcgcgccc ttgtcgagtg gcgtaaccct 1620gacaccctca agaagctgac ggagtgcgag aaggagcacc aaaaggcggt ggaggaagcc 1680tacatcgatc ctgagatcgc gaagcagaag aaagacgaag gtaaccagta cttcaaggag 1740gataagttcc ccgaggccgt ggcagcgtac acggaggcca tcaagcgcaa ccctgccgag 1800cacacctcct acagcaatcg cgcggccgcg tacatcaagc ttggagcctt caacgacgcc 1860ctcaaggacg cggagaagtg cattgagctg aagcccgact ttgttaaggg ctacgcgcgc 1920aagggtcatg cttacttttg gaccaagcag tacaaccgcg cgctgcaggc gtacaatgag 1980ggcctcaagg tggacccgag caatgcggac tgcaaggatg ggcggtatcg cacaatcatg 2040aagattcagg agatggcatc tggccaatcc gcggatggcg acgaggcggc gcgccgggcc 2100atggacgatc ctgaaatcgc ggcaatcatg caagatagct acatgcaact agtgttgaag 2160gagatgcaga acgatcccac gcgcattcag gagtacatga aggactccgg gatctcatcg 2220aagatcaaca agctgatttc agctggcatc attcgttttg gtcaggaatt ctgcagatat 2280ccatcacact ggcggccgct cgagcagatc cggctgctaa caaagcccga aaggaagctg 2340agttggctgc tgccaccgct gagcaataac tagcataacc ccttggggcc tctaaacggg 2400tcttgagggg ttttttgctg aaaggaggaa ctatatccgg ataattcttg aagacgaaag 2460ggcctcgtga tacgcctatt tttataggtt aatgtcatga taataatggt ttcttagacg 2520tcaggtggca cttttcgggg aaatgtgcgc ggaaccccta tttggttatt tttctaaata 2580cattcaaata tgtatccgct catgagacaa taacccytga taaatgcttc aataatattg 2640aaaaaaggaa gaatatgaag tatttcaaca tttcccgggt cccccttatt cccttttttt 2700gccgccattt tgcctttctg tttttggttc accca 2735 102 1713 DNA Leishmania major 102atggcgcagt gcgtgcgtcg gctggtgctg gcggcgacgc tcgccgctgc ggtggcgctg 60ctgctgtgca cgagcagtgc gccggtggcg cgtgctgctg ggacgaacga cttcactgcg 120gcgcagcgga cgaacacgct ggcggtgctg caggcgtttg ggcgtgcgat ccctgagctt 180ggggagaagt gggcgggcaa cgacttctgc tcatgggagt ttatcgtgtg taatgttata 240ggtgtgaacg tacggggaat cagtccgacg tatgccggca cgctgccgga gatacctgtg 300aacgtcgact acaggcacgt cgtgatcaag cagctcgact tttccgaaat ggggccgggg 360ctgagcggga cgctgccgga cagctggagc aagctggaag gactgacttc ccttacgttg 420tcgggcaaca aagtgagcgg tacgctgccc gcctcatggc acttgatgaa gcggttgaca 480tctttggtaa ttgcagactt tgacagtatc accggcagcc tgccgcctga gtggagctcg 540atgcctaatt taaacgctgt ggagctgaag cgactaaaac tgagcggtac gttgcctgcg 600gactggagct ctttgaaatc actgtcgaac gtcgttcttg aggacacgcc gatcacaggc 660ttgttgcccc cggagtgggc ctcgctggag agaatacagc agctggttct acggaaattg 720aagctgaccg gccctctccc tcctcagtgg agctcaatga agatattgca gtatcttact 780ctggatggca ctcaggtctc cggcacgctg ccgccccagt ggagcgcgat ggcatcggtg 840cgaattctta acctggaggg tactgaggtc tctggtacgc tgccgcctga gtggatatcg 900atgagcaggc tgcaaactct gaatctgcgg cgcacgaaag tatccggcac tctgccgccc 960gaatggagtt ctatgagcag cctggagtac tttcaccttt atcttactca ggtctccggc 1020acgctgccgc ccgagtggag tgggatgtcg aaggccgcat acttctggct ggaatactgc 1080gacctgtccg gcagtctgcc gcccgagtgg tcgtcgatgc caaagctgcg cggtatctca 1140ctgagcggca acaagttctg cgggtgtgtg ccggactcgt gggatcagaa ggctggtctt 1200gttgtgggca tcgaggacaa gcacaagggc agcgactgct tggctgctaa ggactgcaca 1260acgaccacca caaaaccccc caccacgaca acgaccccca ctaagccgcc tgccacaacc 1320accactgagg caccggctga acccacgacc accactgagg caccggctga acccacgacc 1380accactgagg caccggctga acccacgacc accactgagg caccggctga acccacaacc 1440accactgagg caccggctga acccacgacc actgctaccc caacaaacac gccgactcct 1500gcaccagaga cggagtgcga ggtggatggg tgtgaggtgt gcgaggggga ctccgctgcg 1560aggtgcgcga ggtgccgtga ggactacttc ctgacggacg agaggacgtg cctggtgtac 1620tgcgatggcg gtgttgctgc tgtgtcgagc ggagtggcag cagcagctgt tgtgtgcgtg 1680gctgtgctgt tcagcgtggg gctggcggcg tga 1713 103 2421 DNA Leishmania major misc_feature (1)...(2421) n=A,T,C or G 103tcgaattcgg cacgagggca cgcacaagac gaagagttcc aaacagcaac gagtatacgc 60cactgtcgaa aaacagacac gcagtagaga gaaggaggag gaggaggagg aggggggaga 120gcaagaggcg ggtgggggtt ggagggacag cgctgcgtgc cgccgtctga catgtccgtt 180ttgatgcgtc ttcgcagagt ggagggagga caccactggc gctgttggcg tgtangcaga 240gcatcgctcg gctcgtgccg aattcggcac gagcggcacg agccctcgct ctgcctggta 300agctcagcag acaccgacgc ccgagcaatc ccgcccacgg acctgctgcc gccccgctct 360gctcgtgacc ctggctgcga atggcgcagt gcgtgcgtcg gctggtgctg gcggcgacgc 420tcgccgctgc ggtggcgctg ctgctgtgca cgagcagtgc gccggtggcg cgtgctgctg 480ggacgaacga cttcactgcg gcgcagcgga cgaacacgct ggcggtgctg caggcgtttg 540ggcgtgcgat ccctgagctt ggggagaagt gggcgggcaa cgacttctgc tcatgggagt 600ttatcgtgtg taatgttata ggtgtgaacg tacggggaat cagtccgacg tatgccggca 660cgctgccgga gatacctgtg aacgtcgact acaggcacgt cgtgatcaag cagctcgact 720tttccgaaat ggggccgggg ctgagcggga cgctgccgga cagctggagc aagctggaag 780gactgacttc ccttacgttg tcgggcaaca aagtgagcgg tacgctgccc gcctcatggc 840acttgatgaa gcggttgaca tctttggtaa ttgcagactt tgacagtatc accggcagcc 900tgccgcctga gtggagctcg atgcctaatt taaacgctgt ggagctgaag cgactaaaac 960tgagcggtac gttgcctgcg gactggagct ctttgaaatc actgtcgaac gtcgttcttg 1020aggacacgcc gatcacaggc ttgttgcccc cggagtgggc ctcgctggag agaatacagc 1080agctggttct acggaaattg aagctgaccg gccctctccc tcctcagtgg agctcaatga 1140agatattgca gtatcttact ctggatggca ctcaggtctc cggcacgctg ccgccccagt 1200ggagcgcgat ggcatcggtg cgaattctta acctggaggg tactgaggtc tctggtacgc 1260tgccgcctga gtggatatcg atgagcaggc tgcaaactct gaatctgcgg cgcacgaaag 1320tatccggcac tctgccgccc gaatggagtt ctatgagcag cctggagtac tttcaccttt 1380atcttactca ggtctccggc acgctgccgc ccgagtggag tgggatgtcg aaggccgcat 1440acttctggct ggaatactgc gacctgtccg gcagtctgcc gcccgagtgg tcgtcgatgc 1500caaagctgcg cggtatctca ctgagcggca acaagttctg cgggtgtgtg ccggactcgt 1560gggatcagaa ggctggtctt gttgtgggca tcgaggacaa gcacaagggc agcgactgct 1620tggctgctaa ggactgcaca acgaccacca caaaaccccc caccacgaca acgaccccca 1680ctaagccgcc tgccacaacc accactgagg caccggctga acccacgacc accactgagg 1740caccggctga acccacgacc accactgagg caccggctga acccacgacc accactgagg 1800caccggctga acccacaacc accactgagg caccggctga acccacgacc actgctaccc 1860caacaaacac gccgactcct gcaccagaga cggagtgcga ggtggatggg tgtgaggtgt 1920gcgaggggga ctccgctgcg aggtgcgcga ggtgccgtga ggactacttc ctgacggacg 1980agaggacgtg cctggtgtac tgcgatggcg gtgttgctgc tgtgtcgagc ggagtggcag 2040cagcagctgt tgtgtgcgtg gctgtgctgt tcagcgtggg gctggcggcg tgaggacgct 2100gctgctgttg cgcgcaggca gcggcccccg ctgcgtggca cacgactgtc tgcgtgcttg 2160cgtgcagcgc cgccccctgc gttggcgtgc gcgtgcgtgt ctctgtgagc atggctgcca 2220gtggtgccct cgctcctgcc tctcggtgcc tctgcctctc tcggcgtgtt gatgctgtgg 2280gctgtgtgtg gggctctcat gcggcgctgc tgctcccgcg gtgtcgctcn tctgccccga 2340ctctctctgc tgccctcctc tctcgcatgc gggagaggga ggggtggcac gtgcgcgcgc 2400gcmgttgcgc ttgcgattgt g 2421 104 570 PRT Leishmania major 104Met Ala Gln Cys Val Arg Arg Leu Val Leu Ala Ala Thr Leu Ala Ala 5 10 15Ala Val Ala Leu Leu Leu Cys Thr Ser Ser Ala Pro Val Ala Arg Ala 20 25 30Ala Gly Thr Asn Asp Phe Thr Ala Ala Gln Arg Thr Asn Thr Leu Ala 35 40 45Val Leu Gln Ala Phe Gly Arg Ala Ile Pro Glu Leu Gly Glu Lys Trp 50 55 60Ala Gly Asn Asp Phe Cys Ser Trp Glu Phe Ile Val Cys Asn Val Ile 65 70 75 80Gly Val Asn Val Arg Gly Ile Ser Pro Thr Tyr Ala Gly Thr Leu Pro 85 90 95Glu Ile Pro Val Asn Val Asp Tyr Arg His Val Val Ile Lys Gln Leu 100 105 110Asp Phe Ser Glu Met Gly Pro Gly Leu Ser Gly Thr Leu Pro Asp Ser 115 120 125Trp Ser Lys Leu Glu Gly Leu Thr Ser Leu Thr Leu Ser Gly Asn Lys 130 135 140Val Ser Gly Thr Leu Pro Ala Ser Trp His Leu Met Lys Arg Leu Thr145 150 155 160Ser Leu Val Ile Ala Asp Phe Asp Ser Ile Thr Gly Ser Leu Pro Pro 165 170 175Glu Trp Ser Ser Met Pro Asn Leu Asn Ala Val Glu Leu Lys Arg Leu 180 185 190Lys Leu Ser Gly Thr Leu Pro Ala Asp Trp Ser Ser Leu Lys Ser Leu 195 200 205Ser Asn Val Val Leu Glu Asp Thr Pro Ile Thr Gly Leu Leu Pro Pro 210 215 220Glu Trp Ala Ser Leu Glu Arg Ile Gln Gln Leu Val Leu Arg Lys Leu225 230 235 240Lys Leu Thr Gly Pro Leu Pro Pro Gln Trp Ser Ser Met Lys Ile Leu 245 250 255Gln Tyr Leu Thr Leu Asp Gly Thr Gln Val Ser Gly Thr Leu Pro Pro 260 265 270Gln Trp Ser Ala Met Ala Ser Val Arg Ile Leu Asn Leu Glu Gly Thr 275 280 285Glu Val Ser Gly Thr Leu Pro Pro Glu Trp Ile Ser Met Ser Arg Leu 290 295 300Gln Thr Leu Asn Leu Arg Arg Thr Lys Val Ser Gly Thr Leu Pro Pro305 310 315 320Glu Trp Ser Ser Met Ser Ser Leu Glu Tyr Phe His Leu Tyr Leu Thr 325 330 335Gln Val Ser Gly Thr Leu Pro Pro Glu Trp Ser Gly Met Ser Lys Ala 340 345 350Ala Tyr Phe Trp Leu Glu Tyr Cys Asp Leu Ser Gly Ser Leu Pro Pro 355 360 365Glu Trp Ser Ser Met Pro Lys Leu Arg Gly Ile Ser Leu Ser Gly Asn 370 375 380Lys Phe Cys Gly Cys Val Pro Asp Ser Trp Asp Gln Lys Ala Gly Leu385 390 395 400Val Val Gly Ile Glu Asp Lys His Lys Gly Ser Asp Cys Leu Ala Ala 405 410 415Lys Asp Cys Thr Thr Thr Thr Thr Lys Pro Pro Thr Thr Thr Thr Thr 420 425 430Pro Thr Lys Pro Pro Ala Thr Thr Thr Thr Glu Ala Pro Ala Glu Pro 435 440 445Thr Thr Thr Thr Glu Ala Pro Ala Glu Pro Thr Thr Thr Thr Glu Ala 450 455 460Pro Ala Glu Pro Thr Thr Thr Thr Glu Ala Pro Ala Glu Pro Thr Thr465 470 475 480Thr Thr Glu Ala Pro Ala Glu Pro Thr Thr Thr Ala Thr Pro Thr Asn 485 490 495Thr Pro Thr Pro Ala Pro Glu Thr Glu Cys Glu Val Asp Gly Cys Glu 500 505 510Val Cys Glu Gly Asp Ser Ala Ala Arg Cys Ala Arg Cys Arg Glu Asp 515 520 525Tyr Phe Leu Thr Asp Glu Arg Thr Cys Leu Val Tyr Cys Asp Gly Gly 530 535 540Val Ala Ala Val Ser Ser Gly Val Ala Ala Ala Ala Val Val Cys Val545 550 555 560Ala Val Leu Phe Ser Val Gly Leu Ala Ala 565 570 105 1688 DNA Leishmania major 105taacgctata taagtatcag tttctgtact ttattgctca tcactgccgt ttgactgccg 60cgggcattgg cgctaccact ttcctcactc tttatccctt cagcattgtt tcgtacacac 120gcacgcgcac gtgaaagagc cgcacgccga cagagcagcc gttccggact ctccgataac 180tgaacgccac ccacccaaaa aaaatgtcaa agaacgctga ccaggaggag tgggaggatt 240acggcgacga ggaggtgcag gatgaagaag aggaggacac caccatcaac aactccgacg 300tggtggtgcg ctacaagaag gccgcaacgt ggtgcaatga aacgttgcgc gtgcttatcg 360atgccacaaa acctggcgcc aaggtgtgcg acctgtgccg cctcggtgat gacaccatca 420ccgccaaggt caagacaatg ttcaaaggca cggaaaaagg catcgctttc ccgacctgca 480tctcggtcaa caactgcgta tgccacaaca gccctggcgt gtcggacgag acgacgcagc 540aagagatcgc gatgggtgac gtcgtgcact acgacctggg catccacgtg gacggctact 600gcgccgtcgt cgcgcacacc attcaggtga cagaggacaa tgagcttggc aaggacgaga 660aggcggcgcg cgtcattaca gcggcgtaca acatcctgaa cacggcgctg cgccagatgc 720gtcccggtac gaccatctac caggtgacag acgtagttga gaaggctgcg gagcactaca 780aggtgactcc ggtagacggc gtcctctcgc atatgatgaa gcgctacatc atagacggat 840accgctgtat cccgcagcgc agggtcgcgg agcacatggt gcacgactac gatctcgaga 900aagcgcaggt gtggacgcta gacattgtca tgacctccgg caagggcaag ctgaaggagc 960gcgatgcgcg gccgtgcgtg ttcaaggtgg ctctggactc caactactct gtgaaaatgg 1020aaagcgcgaa ggaggttcag aaggaaatcg actccaagta tgccaccttc ccctttgcca 1080tccgcaacct ggaggccaag aaggcccgcc tcggtctcaa cgagatggcg aagcacggtg 1140ctgtcatccc gtaccctatt ctcttcgaaa aggaaggcga ggtcgtcgcc catttcaaga 1200ttacggtgct catcagcaac aagaagattg agccgattac cggcctgaag ccgcagaagg 1260ccccggcgct cgagccatac acggacgaga tgctgcttgc gacgaacaag ctctcgctgt 1320cgctagagaa gaaggcggcg aagtagacgg ccgtggcatc cgtgacgctg tactgcgagc 1380tttcgtaggc gtacgcctct tgtgaggcgt acacgtgtgc tgtttgcgga cgaggaggca 1440cccattctgt tccccttctt cgctaatctc cgcgtttcct ctgacgctgg cttctctgcc 1500ggagtgtggt gaggcgcgtg ggggagaaac ggcccactcg catgcctgtg catacgcgag 1560cacggtaggg agcgcggtgt gtgtgtgtgt gggggggcgt gttacgagta caaaagaggc 1620tcgatctctg cgactctttt ctttctgtaa acagggaaca taagtaacca aaaaaaaaaa 1680aaaaaaaa 1688 106 380 PRT Leishmania major 106Met Ser Lys Asn Ala Asp Gln Glu Glu Trp Glu Asp Tyr Gly Asp Glu 1 5 10 15Glu Val Gln Asp Glu Glu Glu Glu Asp Thr Thr Ile Asn Asn Ser Asp 20 25 30Val Val Val Arg Tyr Lys Lys Ala Ala Thr Trp Cys Asn Glu Thr Leu 35 40 45Arg Val Leu Ile Asp Ala Thr Lys Pro Gly Ala Lys Val Cys Asp Leu 50 55 60Cys Arg Leu Gly Asp Asp Thr Ile Thr Ala Lys Val Lys Thr Met Phe65 70 75 80Lys Gly Thr Glu Lys Gly Ile Ala Phe Pro Thr Cys Ile Ser Val Asn 85 90 95Asn Cys Val Cys His Asn Ser Pro Gly Val Ser Asp Glu Thr Thr Gln 100 105 110Gln Glu Ile Ala Met Gly Asp Val Val His Tyr Asp Leu Gly Ile His 115 120 125Val Asp Gly Tyr Cys Ala Val Val Ala His Thr Ile Gln Val Thr Glu 130 135 140Asp Asn Glu Leu Gly Lys Asp Glu Lys Ala Ala Arg Val Ile Thr Ala145 150 155 160Ala Tyr Asn Ile Leu Asn Thr Ala Leu Arg Gln Met Arg Pro Gly Thr 165 170 175Thr Ile Tyr Gln Val Thr Asp Val Val Glu Lys Ala Ala Glu His Tyr 180 185 190Lys Val Thr Pro Val Asp Gly Val Leu Ser His Met Met Lys Arg Tyr 195 200 205Ile Ile Asp Gly Tyr Arg Cys Ile Pro Gln Arg Arg Val Ala Glu His 210 215 220Met Val His Asp Tyr Asp Leu Glu Lys Ala Gln Val Trp Thr Leu Asp225 230 235 240Ile Val Met Thr Ser Gly Lys Gly Lys Leu Lys Glu Arg Asp Ala Arg 245 250 255Pro Cys Val Phe Lys Val Ala Leu Asp Ser Asn Tyr Ser Val Lys Met 260 265 270Glu Ser Ala Lys Glu Val Gln Lys Glu Ile Asp Ser Lys Tyr Ala Thr 275 280 285Phe Pro Phe Ala Ile Arg Asn Leu Glu Ala Lys Lys Ala Arg Leu Gly 290 295 300Leu Asn Glu Met Ala Lys His Gly Ala Val Ile Pro Tyr Pro Ile Leu305 310 315 320Phe Glu Lys Glu Gly Glu Val Val Ala His Phe Lys Ile Thr Val Leu 325 330 335Ile Ser Asn Lys Lys Ile Glu Pro Ile Thr Gly Leu Lys Pro Gln Lys 340 345 350Ala Pro Ala Leu Glu Pro Tyr Thr Asp Glu Met Leu Leu Ala Thr Asn 355 360 365Lys Leu Ser Leu Ser Leu Glu Lys Lys Ala Ala Lys 370 375 380 107 1565 DNA Leishmania major 107taacgctata taagtatcag tttctgtact ttattgctct tcgctctcgt tcttcgaaca 60aacaccttta aaccgccttc caacccctct ttcttctttt tcagccatgc gtgaggctat 120ctgcatccac atcggccagg ccggctgcca ggtcggtaac gcgtgctggg agctgttctg 180ccttgagcac ggcatccagc ctgatggctc catgccctct gacaagtgca tcggtgttga 240ggatgacgcg ttcaacacgt tcttctcgga gaccggtgct ggcaagcacg ttccgcgctg 300catcttcctg gacctcgagc ctacggtcgt ggatgaggtg cgcaccggca cgtaccgcca 360gctgttcaac cccgagcagc tggtgtctgg caaggaggat gcggcgaaca actacgctcg 420tggccactac acgatcggca aggagatcgt cgaccttgcg ctggaccgca ttcgcaagct 480ggcggacaac tgcactggtc tccagggctt tatggtgttc cacgctgtgg gtggcggcac 540cggctctggc ctcggtgcgc tgctgctgga gcgcctgtct gtggactacg gcaagaagtc 600caagctcggc tacaccgtgt acccgagccc gcaggtgtcg actgccgtcg tggagccgta 660caactgcgtg ctgtcgacgc actcgctgct cgagcacacc gatgttgcga cgatgctcga 720caatgaggcc atctacgacc tcactcgtcg ttctctcgac attgagcgcc cgtcgtacac 780gaacgtgaac cgcctgatcg gccaggtggt gtcgtctctg acggcgtcgc tgcgcttcga 840tggtgcgctg aacgtggacc tgacggagtt ccagacgaac cttgtgccgt acccgcgcat 900ccacttcgtg ctgacgagct acgctccggt ggtgtctgcc gagaaggcgt accacgagca 960gctgtccgtc gcggacatca cgaactcggt gtttgagcct gctggcatgc tgacgaagtg 1020cgatcctcgc cacggcaagt acatgtcgtg ctgcctcatg taccgcggtg atgtcgtgcc 1080gaaggatgtc aacgccgcga ttgcgacgat caagacgaag cgcacaattc agttcgtgga 1140ctggtgcccg accggcttca agtgcggcat caactaccag ccgccgaccg ttgtgcccgg 1200cggtgacctc gcgaaggtgc agcgcgccgt gtgcatgatt gccaactcga ccgcgatcgc 1260tgaggtgttt gcccgcatcg accacaagtt cgacctgatg tacagcaagc gcgcgtttgt 1320gcactggtac gtgggtgagg gcatggagga gggcgagttc tccgaggcgc gcgaggatct 1380cgctgcgctg gagaaggact acgaggaggt tggcgccgag tccgccgacg acatgggcga 1440ggaggacgtc gaggagtact aaggtagact cgtgccgcgc gctgatgatg taggtgcacg 1500cgtgcgtgtg ctgcagcgga gccgccgcca ccgcgactgt gtgtgtgtgc gcgcgtgacg 1560accgg 1565 108 451 PRT Leishmania major 108Met Arg Glu Ala Ile Cys Ile His Ile Gly Gln Ala Gly Cys Gln Val 1 5 10 15Gly Asn Ala Cys Trp Glu Leu Phe Cys Leu Glu His Gly Ile Gln Pro 20 25 30Asp Gly Ser Met Pro Ser Asp Lys Cys Ile Gly Val Glu Asp Asp Ala 35 40 45Phe Asn Thr Phe Phe Ser Glu Thr Gly Ala Gly Lys His Val Pro Arg 50 55 60Cys Ile Phe Leu Asp Leu Glu Pro Thr Val Val Asp Glu Val Arg Thr65 70 75 80Gly Thr Tyr Arg Gln Leu Phe Asn Pro Glu Gln Leu Val Ser Gly Lys 85 90 95Glu Asp Ala Ala Asn Asn Tyr Ala Arg Gly His Tyr Thr Ile Gly Lys 100 105 110Glu Ile Val Asp Leu Ala Leu Asp Arg Ile Arg Lys Leu Ala Asp Asn 115 120 125Cys Thr Gly Leu Gln Gly Phe Met Val Phe His Ala Val Gly Gly Gly 130 135 140Thr Gly Ser Gly Leu Gly Ala Leu Leu Leu Glu Arg Leu Ser Val Asp145 150 155 160Tyr Gly Lys Lys Ser Lys Leu Gly Tyr Thr Val Tyr Pro Ser Pro Gln 165 170 175Val Ser Thr Ala Val Val Glu Pro Tyr Asn Cys Val Leu Ser Thr His 180 185 190Ser Leu Leu Glu His Thr Asp Val Ala Thr Met Leu Asp Asn Glu Ala 195 200 205Ile Tyr Asp Leu Thr Arg Arg Ser Leu Asp Ile Glu Arg Pro Ser Tyr 210 215 220Thr Asn Val Asn Arg Leu Ile Gly Gln Val Val Ser Ser Leu Thr Ala225 230 235 240Ser Leu Arg Phe Asp Gly Ala Leu Asn Val Asp Leu Thr Glu Phe Gln 245 250 255Thr Asn Leu Val Pro Tyr Pro Arg Ile His Phe Val Leu Thr Ser Tyr 260 265 270Ala Pro Val Val Ser Ala Glu Lys Ala Tyr His Glu Gln Leu Ser Val 275 280 285Ala Asp Ile Thr Asn Ser Val Phe Glu Pro Ala Gly Met Leu Thr Lys 290 295 300Cys Asp Pro Arg His Gly Lys Tyr Met Ser Cys Cys Leu Met Tyr Arg305 310 315 320Gly Asp Val Val Pro Lys Asp Val Asn Ala Ala Ile Ala Thr Ile Lys 325 330 335Thr Lys Arg Thr Ile Gln Phe Val Asp Trp Cys Pro Thr Gly Phe Lys 340 345 350Cys Gly Ile Asn Tyr Gln Pro Pro Thr Val Val Pro Gly Gly Asp Leu 355 360 365Ala Lys Val Gln Arg Ala Val Cys Met Ile Ala Asn Ser Thr Ala Ile 370 375 380Ala Glu Val Phe Ala Arg Ile Asp His Lys Phe Asp Leu Met Tyr Ser385 390 395 400Lys Arg Ala Phe Val His Trp Tyr Val Gly Glu Gly Met Glu Glu Gly 405 410 415Glu Phe Ser Glu Ala Arg Glu Asp Leu Ala Ala Leu Glu Lys Asp Tyr 420 425 430Glu Glu Val Gly Ala Glu Ser Ala Asp Asp Met Gly Glu Glu Asp Val 435 440 445Glu Glu Tyr 450 109 1908 DNA Leishmania major misc_feature (1)...(1908) n = A,T,C or G 109taacgctata taagtatcag tttctgtact ttattgtaag cgcaatcgag tttcaacagc 60taacaaaatg gtgaacttta ccgtcgatca ggtccgcgag ctgatggact atccggacca 120gatccggaac atgtccgtga ttgctcacgt cgaccacggc aagtcgacgc tgtccgactc 180tctcgttggt gctgccggca tcatcaagat ggaggaggct ggcgataagc ggatcatgga 240tacacgcgcg gatgagatcg cgcgtggtat cacgatcaag tccaccgcca tctccatgca 300ctaccacgtg ccgaaggaga tgatcggcga tctggatgac gacaagcgcg acttcctgat 360caacctgatc gactcccccg gacacgtcga cttcagctcc gaggtgactg ccgctcttcg 420tgtgacggac ggcgcgctgg tcgtggtgga ctgcgtggag ggcgtgtgcg tgcagacgga 480gacggtgctg cgccaggcgc tgacggagcg catccgccct gttgtgttca tcaacaaggt 540ggaccgcgcc atccttgagc tccaactgga ccccgaggag gcgtaccagg gcttcgtgaa 600gacgctgcag aacgtgaacg tggtggttgc cacgtacaat gaccccagca tgggcgacgt 660gcaggtgtcc cccgagaagg gcactgtggc gatcggctct ggcctgcagg cgtgggcgtt 720ctcgctgacc cgctttgcga acatgtatgc ggcgaagttc ggcgtggacg agctgaagat 780gcgcgagcgc ctgtggggcg acaacttctt tgacgcgaag aacaagaagt ggatcaagca 840ggagacgaac gccgatggcg agcgcgtgcg ccgcgcgttc tgccagttct gcctagaccc 900catctaccag atcttcgacg ctgtgatgaa cgagaagaag gacaaggtgg acaagatgct 960caagtcgctg cacgtgacgc tgacggctga ggagcgcgag caggtgccga agaagcttct 1020gaagacggtg atgatgaagt tcctgccggc tgctgagacg ctgctacaga tgatcgtggc 1080gcacctgccg tcgcccaaga aggcgcaggc gtaccgtgcg gagatgctgt actctggcga 1140ggcgtcgccg gaggacaagt acttcatggg tatcaagaac tgcgaccccg ctgcgccgct 1200catgctgtac atcagcaaga tggtgccgac ggccgaccgc ggccgcttct tcgcctttgg 1260ccgcatcttc tccggtaagg tgcgcagcgg ccagaaggtg cgcatcatgg gtaacaacta 1320cgtctacggc aagaagcagg acctgtacga ggacaagcct gtgcagcgct ccgtgctgat 1380gatgggccgc taccaggagg ccgtggagga catgccgtgc ggtaacgtgg tgggccttgt 1440gggcgtggac aagtacatcg tgaagtccgc gacgatcacg gacgatggcg agagcccgca 1500cccgctgcgc gacatgaagt actctgtgtc gcccgtcgtg cgtgtggccg tggaggcgaa 1560gaacccgtcc gacctgccga agcttgtgga gggcctgaag cgccttgcca agtccgaccc 1620gctggtggtg tgcagcattg aggagtctgg cgagcacatt gttgccggcg ctggcgagct 1680tcaccttgag atttgcctga aggatctcca ggaggacttc atgaacggcg cgccgctnaa 1740gatctccgag ccggtggtgt cgttccgcga gacggtgacg gatgtgtcgt cgcagcagtg 1800cctgtcgaag tctgcgaaca agcacaaccg tctcttctgc cgcggtgcgc cgctnacaga 1860gganctggcg ctggcgatng angaaggcac cgctggtccc gangcgga 1908 110 845 PRT Leishmania major VARIANT (1)...(845) Xaa = Any Amino Acid 110Met Val Asn Phe Thr Val Asp Gln Val Arg Glu Leu Met Asp Tyr Pro 1 5 10 15Asp Gln Ile Arg Asn Met Ser Val Ile Ala His Val Asp His Gly Lys 20 25 30Ser Thr Leu Ser Asp Ser Leu Val Gly Ala Ala Gly Ile Ile Lys Met 35 40 45Glu Glu Ala Gly Asp Lys Arg Ile Met Asp Thr Arg Ala Asp Glu Ile 50 55 60Ala Arg Gly Ile Thr Ile Lys Ser Thr Ala Ile Ser Met His Tyr His65 70 75 80Val Pro Lys Glu Met Ile Gly Asp Leu Asp Asp Asp Lys Arg Asp Phe 85 90 95Leu Ile Asn Leu Ile Asp Ser Pro Gly His Val Asp Phe Ser Ser Glu 100 105 110Val Thr Ala Ala Leu Arg Val Thr Asp Gly Ala Leu Val Val Val Asp 115 120 125Cys Val Glu Gly Val Cys Val Gln Thr Glu Thr Val Leu Arg Gln Ala 130 135 140Leu Thr Glu Arg Ile Arg Pro Val Val Phe Ile Asn Lys Val Asp Arg145 150 155 160Ala Ile Leu Glu Leu Gln Leu Asp Pro Glu Glu Ala Tyr Gln Gly Phe 165 170 175Val Lys Thr Leu Gln Asn Val Asn Val Val Val Ala Thr Tyr Asn Asp 180 185 190Pro Ser Met Gly Asp Val Gln Val Ser Pro Glu Lys Gly Thr Val Ala 195 200 205Ile Gly Ser Gly Leu Gln Ala Trp Ala Phe Ser Leu Thr Arg Phe Ala 210 215 220Asn Met Tyr Ala Ala Lys Phe Gly Val Asp Glu Leu Lys Met Arg Glu225 230 235 240Arg Leu Trp Gly Asp Asn Phe Phe Asp Ala Lys Asn Lys Lys Trp Ile 245 250 255Lys Gln Glu Thr Asn Ala Asp Gly Glu Arg Val Arg Arg Ala Phe Cys 260 265 270Gln Phe Cys Leu Asp Pro Ile Tyr Gln Ile Phe Asp Ala Val Met Asn 275 280 285Glu Lys Lys Asp Lys Val Asp Lys Met Leu Lys Ser Leu His Val Thr 290 295 300Leu Thr Ala Glu Glu Arg Glu Gln Val Pro Xaa Lys Leu Leu Lys Thr305 310 315 320Val Met Met Xaa Phe Leu Pro Ala Ala Glu Thr Leu Leu Gln Met Ile 325 330 335Val Ala His Leu Pro Ser Pro Lys Lys Ala Gln Ala Tyr Arg Ala Glu 340 345 350Met Leu Tyr Ser Gly Glu Ala Ser Pro Glu Asp Lys Tyr Phe Met Gly 355 360 365Ile Lys Asn Cys Asp Pro Ala Ala Pro Leu Met Leu Tyr Ile Ser Lys 370 375 380Met Val Pro Thr Ala Asp Arg Gly Arg Phe Phe Ala Phe Gly Arg Ile385 390 395 400Phe Ser Gly Lys Val Arg Ser Gly Gln Lys Val Arg Ile Met Gly Asn 405 410 415Asn Tyr Val Tyr Gly Lys Lys Gln Asp Leu Tyr Glu Asp Lys Pro Val 420 425 430Gln Arg Ser Val Leu Met Met Gly Arg Tyr Gln Glu Ala Val Glu Asp 435 440 445Met Pro Cys Gly Asn Val Val Gly Leu Val Gly Val Asp Lys Tyr Ile 450 455 460Val Lys Ser Ala Thr Ile Thr Asp Asp Gly Glu Ser Pro His Pro Leu465 470 475 480Arg Asp Met Lys Tyr Ser Val Ser Pro Val Val Arg Val Ala Val Glu 485 490 495Ala Lys Asn Pro Ser Asp Leu Pro Lys Leu Val Glu Gly Leu Lys Arg 500 505 510Leu Ala Lys Ser Asp Pro Leu Val Val Cys Ser Ile Glu Glu Ser Gly 515 520 525Glu His Ile Val Ala Gly Ala Gly Glu Leu His Leu Glu Ile Cys Leu 530 535 540Lys Asp Leu Gln Glu Asp Phe Met Asn Gly Ala Pro Leu Lys Ile Ser545 550 555 560Glu Pro Val Val Ser Phe Arg Glu Thr Val Thr Asp Val Ser Ser Gln 565 570 575Gln Cys Leu Ser Lys Ser Ala Asn Lys His Asn Arg Leu Phe Cys Arg 580 585 590Gly Ala Pro Leu Thr Glu Glu Leu Ala Leu Ala Met Glu Glu Gly Thr 595 600 605Ala Gly Pro Glu Ala Asp Pro Lys Val Arg Ala Arg Phe Leu Ala Asp 610 615 620Asn Tyr Glu Trp Asp Val Gln Glu Ala Arg Lys Ile Trp Cys Tyr Gly625 630 635 640Pro Asp Asn Arg Gly Pro Asn Val Val Val Asp Val Thr Lys Gly Val 645 650 655Gln Asn Met Ala Glu Met Lys Asp Ser Phe Val Ala Ala Trp Gln Trp 660 665 670Ala Thr Arg Glu Gly Val Leu Cys Asp Glu Asn Met Arg Gly Val Arg 675 680 685Val Asn Val Glu Asp Val Thr Met His Ala Asp Ala Ile His Arg Gly 690 695 700Gly Val Gln Ile Ile Pro Thr Ala Arg Arg Val Phe Tyr Ala Cys Cys705 710 715 720Leu Thr Ala Ser Pro Arg Leu Met Glu Pro Met Phe Val Val Asp Ile 725 730 735Gln Thr Val Glu His Ala Met Gly Gly Ile Tyr Gly Val Leu Thr Arg 740 745 750Arg Arg Gly Val Ile Ile Gly Glu Glu Asn Arg Pro Gly Thr Pro Ile 755 760 765Tyr Asn Val Arg Ala Tyr Leu Pro Val Ala Glu Ser Phe Gly Phe Thr 770 775 780Ala Asp Leu Arg Ala Gly Thr Gly Gly Gln Ala Phe Pro Gln Cys Val785 790 795 800Phe Asp His Trp Gln Glu Tyr Pro Gly Asp Pro Leu Glu Pro Lys Ser 805 810 815Leu Ala Asn Thr Thr Thr Leu Gly Ile Arg Thr Arg Lys Gly Leu Lys 820 825 830Pro Asp Ile Pro Gly Leu Asp Gln Phe Met Asp Lys Leu 835 840 845 111 997 DNA Leishmania major 111ggatccgccg ccaccatggt gaacgtgtgc gttgttggtg ctgccggcgg cattggccag 60tcgctgtcgc tgctgttggt gcgccagctg ccgtacggga gcacgttgtc gctgttcgac 120gttgtgggcg ctgcaggcgt cgcagcagac ctgtcgcatg tggacaacgc cggtgtgcag 180gtgaagtttg cggagggcaa gatcggccat aagcgcgacc ctgcgctggc agagcttgcg 240aagggcgtgg atgtgtttgt aatggtggct ggcgttccac gcaagccggg catgacgcgc 300gacgaccttt tcaaaatcaa cgccggaatc atcctggacc ttgtgctgac gtgcgcgtcg 360tcgagtccaa aggcggtgtt ctgcattgtg acgaaccctg tgaacagcac ggtcgcgatc 420gcggcagagg cgctgaagag ccttggcgta tacgaccgaa accggctgct tggcgtgtcg 480ctgctggacg ggctgcgcgc gacgtgcttc atcaacgagg cgcgcaagcc cttagtcgtg 540tcgcaggtac cagttgttgg cgggcacagc gacacaacga ttgtgccgtt gttctaccag 600ctaccggggc cgttgccgga gcaggcgacg ctggacaaga tcgtgaagcg cgtgcaggtc 660gcaggcacag aagtggtgaa ggcgaaggcc gggcgcgggt ctgcgacgct gtcgatggcg 720gaggctggcg cgcggttcgc gttgaaggtt gtggagggtc tgaccggcac gggtaacccg 780ctggtgtacg catatgtaga cacagacggg cagcacgaga cgacgttcct cgcgatccct 840gtggtgcttg gcatgaatgg aatcgagaag cgcctgccga ttggtccgct gcactcgacg 900gaggaaacgc tgctgaaggc ggcactgccg gtgatcaaga agaatatcgt gaagggcagc 960gagttcgcgc gctcacacct gtagcacctc agaattc 997 112 322 PRT Leishmania major 112Met Val Asn Val Cys Val Val Gly Ala Ala Gly Gly Ile Gly Gln Ser 1 5 10 15Leu Ser Leu Leu Leu Val Arg Gln Leu Pro Tyr Gly Ser Thr Leu Ser 20 25 30Leu Phe Asp Val Val Gly Ala Ala Gly Val Ala Ala Asp Leu Ser His 35 40 45Val Asp Asn Ala Gly Val Gln Val Lys Phe Ala Glu Gly Lys Ile Gly 50 55 60His Lys Arg Asp Pro Ala Leu Ala Glu Leu Ala Lys Gly Val Asp Val65 70 75 80Phe Val Met Val Ala Gly Val Pro Arg Lys Pro Gly Met Thr Arg Asp 85 90 95Asp Leu Phe Lys Ile Asn Ala Gly Ile Ile Leu Asp Leu Val Leu Thr 100 105 110Cys Ala Ser Ser Ser Pro Lys Ala Val Phe Cys Ile Val Thr Asn Pro 115 120 125Val Asn Ser Thr Val Ala Ile Ala Ala Glu Ala Leu Lys Ser Leu Gly 130 135 140Val Tyr Asp Arg Asn Arg Leu Leu Gly Val Ser Leu Leu Asp Gly Leu145 150 155 160Arg Ala Thr Cys Phe Ile Asn Glu Ala Arg Lys Pro Leu Val Val Ser 165 170 175Gln Val Pro Val Val Gly Gly His Ser Asp Thr Thr Ile Val Pro Leu 180 185 190Phe Tyr Gln Leu Pro Gly Pro Leu Pro Glu Gln Ala Thr Leu Asp Lys 195 200 205Ile Val Lys Arg Val Gln Val Ala Gly Thr Glu Val Val Lys Ala Lys 210 215 220Ala Gly Arg Gly Ser Ala Thr Leu Ser Met Ala Glu Ala Gly Ala Arg225 230 235 240Phe Ala Leu Lys Val Val Glu Gly Leu Thr Gly Thr Gly Asn Pro Leu 245 250 255Val Tyr Ala Tyr Val Asp Thr Asp Gly Gln His Glu Thr Thr Phe Leu 260 265 270Ala Ile Pro Val Val Leu Gly Met Asn Gly Ile Glu Lys Arg Leu Pro 275 280 285Ile Gly Pro Leu His Ser Thr Glu Glu Thr Leu Leu Lys Ala Ala Leu 290 295 300Pro Val Ile Lys Lys Asn Ile Val Lys Gly Ser Glu Phe Ala Arg Ser305 310 315 320His Leu

Claims

1. A fusion protein comprising the amino acid sequence of SEQ ID NO:24.

2. A fusion protein comprising an immunogenic portion of SEQ ID NO:24, wherein said immunogenic portion selectively binds to anti-Leishmania antibodies specific for SEQ ID NO: 24.