Patent Application
20230407296
Arachidonate 12-lipoxygenase (ALOX12) is a member of the lipoxygenase family of proteins originally discovered in blood platelets [1, 2] and highly expressed in the epidermal cells of human [3, 4] and murine skin [5]. ALOX12, a non-heme iron-containing dioxygenase, catalyzes the stereo-specific addition of oxygen onto polyunsaturated fatty acids, e.g. linoleic, arachidonic, and docosahexaenoic (DHA) acids, generating bioactive lipids that regulate a variety of biological processes [6-9]. Abnormal ALOX12 expression and altered ALOX12-mediated metabolites are linked to multiple human pathologies [10], including cardiovascular disease [6, 11], skin disorders [12], non-alcoholic fatty liver disease [13, 14], diabetic nephropathy [15], cancer [16-19] and Alzheimer's disease [20]. Despite its role in metabolic regulation and association with human diseases, the tissue and cell-type-specific regulation of ALOX is not clearly understood. However, there is limited evidence that the transcription factor p63 induces ALOX12 expression in epidermal cells [21] while the hematopoietic transcription factor RUNX1 attenuates ALOX12 expression in platelets [22].
The ALOX12 gene is located in a cluster with several other arachidonate lipoxygenase genes (ALOXE3, ALOX12B, ALOX15, and ALOX15B) in an ˜7 Mbp region on the short arm (petite) of human chromosome 17 (Chr.17p13.1) [23]. Interestingly, a gene antisense to ALOX12 and designated as ALOX12 antisense-1 (ALOX12-AS1) has been identified within this cluster [24]. Based on the human genome assembly GRCh38/hg38 [25], ALOX12-AS1 generates multiple long-noncoding RNAs (lncRNAs) antisense to the ALOX12 gene [24]. The existence of ALOX12-AS1 lncRNA is supported by cloned cDNAs using poly-A RNAs derived from human embryos (GeneBank ID: AK074580.1 [26] and DA571112.1 [27]), and human cell lines (GeneBank ID: BU596417.1 [27]). However, there has been no report in the literature characterizing the tissue and cell-type-specific expression of ALOX12-AS1 lncRNA, except that, Human protein atlas-based transcriptome analysis listed expression of ALOX12 in a large variety of organs/tissues [28], The functionality of ALOX12-AS1 lncRNA is not known [24]. Antisense lncRNAs that overlap with a protein-coding gene typically interfere with sense transcription through direct polymerase II transcriptional interference in cis [29, 30]. Antisense lncRNA can also post-transcriptionally regulate the sense gene by a variety of mechanisms including regulation of mRNA stability, microRNA accessibility, and recruitment of polysome or translational activators/repressors [31].
According to a first aspect of the invention, there is provided a method for treating a disease or disorder associated with Arachidonate 12-lipoxygenase (ALOX12) protein levels, said method comprising:
According to another aspect of the invention, there is provided a method for determining if a patient is a candidate for further screening for a disease characterized by abnormal ALOX12 protein levels comprising:
According to another aspect of the invention, there is provided a method for determining if a compound of interest is an ALOX12 modulating compound comprising:
The compound identified in step (d) may then be characterized for ALOX12-AS1 lncRNA nucleo-cytoplasm translocation activation.
The compound identified in step (e) may then be characterized for ALOX12-AS1 lncRNA nucleo-cytoplasm translocation inhibition.
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods and materials are now described. All publications mentioned hereunder are incorporated herein by reference.
The arachidonate 12-lipoxygenase (ALOX12) enzyme catalyzes polyunsaturated fatty acids and facilitates generation of bioactive lipid mediators associated with various biological processes and disease pathologies. The human genome assembly revealed that the ALOX12 gene overlaps an antisense non-coding gene designated as ALOX12-antisense 1 (ALOX12-AS1). This arrangement indicates that the uncharacterized ALOX12-AS1 long non-coding RNA (lncRNA) may bind to the sense coding ALOX12 mRNA to form an antisense-sense duplex providing the basis of a novel ALOX12 regulatory mechanism. Therefore, this study was designed to determine whether the interaction of ALOX12-AS1 with ALOX12 mRNA functions as an anti-sense/sense duplex-mediated regulatory mechanism controlling the cellular content of ALOX12. Our findings indicate that two major isoforms of ALOX12-AS1 lncRNA are ubiquitously expressed in a variety of primary adult human tissues and different transformed cell types. RNA-FISH revealed cell-type-specific cytosolic as well as nuclear and nucleolar localization of the lncRNA. Interestingly, Phorbol ester-induced nucleo-cytoplasmic translocation of the lncRNA in monocytic THP-1 cells resulted in a reduction of ALOX12 protein without a concomitant change in its mRNA level. This indicated ALOX12-AS1 operates via an antisense-sense duplex-mediated translational downregulation mechanism. This deduction was validated by demonstrating sense/antisense duplex formation and an association of the duplex with ribosomal proteins in HEK293 cells. Overall, this study revealed a hitherto unknown mechanism of antisense lncRNA-mediated translational downregulation of ALOX12 that adds to the existing regulatory mechanisms for the modulation of potent bioactive lipid mediators that contribute to both health and disease.
As discussed above, the findings reported in this study indicate a previously uncharacterized ALOX12-AS1 lncRNA that is ubiquitously expressed in human tissues and differentially distributed within the cell depending on cell-type and isoform-specificity. A functional role for this antisense lncRNA in translational regulation of the overlapping ALOX12 gene provides a mechanism by which the generation of potent lipid mediators by ALOX12 might be regulated, thus making this process biologically relevant within a broader context. It is also important to realize that apart from this regulatory role of the antisense lncRNA, the enzymatic activity of ALOX12 and subsequent production of bioactive lipids can be constrained by the availability of the precursor polyunsaturated fatty acids and downstream effectors such as glutathione peroxidase, which reduces 12S-HpETE to 12S-HETE [9].
This is the first study to report that ALOX12 protein level can be decreased by an overlapping antisense lncRNA ALOX12-AS1 through translational downregulation which leads to functional consequence in terms of reduced lipoxygenase enzymatic activity. Furthermore, this mechanism involves nucleo-cytoplasmic translocation of ALOX12-AS1 in response to the physiological stimulus (phorbol ester) that controls PKC signaling pathways. The tissue-specific expression and cell-type-specific intracellular localization of this lncRNA indicates that ALOX12-AS1 may have a diverse and ubiquitous functional role beyond controlling ALOX12. In this context, the abundance of ALOX12-AS1 lncRNA in different intracellular compartments, including cytosol, nucleolus, and nuclear speckles, indicates subcellular localization may specify function. Our findings also suggest that it may be possible to therapeutically target ALOX12-AS1 to manipulate ALOX12 protein level in various metabolic tissues, such as adipose and liver, as well as blood vessels. The clinical implication is evident in light of our recent finding that bioactive lipids generated by ALOX12 influence cardiovascular disease risk in relation to sex and obesity [33]. Overall, the findings of this study open up a hitherto unknown avenue of research involving antisense lncRNA-mediated regulation of an important lipoxygenase.
ALOXs are a heterogeneous class of stereo-specific lipid peroxidizing enzymes [24]. There are six functional ALOX genes (ALOXE3, ALOX5, ALOX12, ALOX12B, ALOX15, and ALOX15B) and all, except ALOX5, are clustered on chromosome 17p13.1-13.2 within a 3.5 Mbp (4.6 Mbp-8.2 Mbp) region [34]. Most of the ALOX genes are successively arranged and do not overlap each other, however, ALOX12-AS1 and the protein-coding ALOX12 gene are overlapped (
ALOX12-AS1 cytoplasmic abundance is a deterministic factor for translational downregulation of ALOX12. The functional involvement of the duplex in mediating translational interference was supported by the presence of ribosomal protein and ALOX12 mRNA in the ALOX12-AS1-201 lncRNA pulldown fraction indicating potential association of the ribosome in the duplex (
Our extensive RNA-FISH and RT-PCR-based study provides comprehensive insight into the tissue-specific expression and cell-type-specific differential intracellular distribution of ALOX12-AS1 lncRNA isoforms. The ALOX12-AS1 lncRNA was found in different adult human tissues as well as in all five human cell lines tested. This indicates that ALOX12-AS1 genes are ubiquitously expressed, and this conclusion is supported by the GTEx human gene expression studies [54]. Multiple transcriptome profiling studies have shown that few lncRNAs are ubiquitously present across all tissue or cell types [55] and those that are ubiquitously present are often highly abundant. In contrast, lncRNAs present in one tissue or cell type tend to be expressed at low levels [56]. These suggest that ALOX12-AS1 lncRNA may have an important housekeeping function in mammalian cells in different subcellular compartments involving cytosol, nucleolus, and nuclear speckles. Another important observation in our RNA-FISH study is that ALOX12-AS1 lncRNA exhibited differential abundance during cell division, specifically during metaphase, depending on cell type (
The in vitro cell-free protein extract-based ALOX12 enzymatic activity assay revealed that the lncRNA-mediated regulation of ALOX12 protein level may have functional consequences and, therefore, be biologically relevant. Though we have not compared the relative abundance of ALOX12 protein level between platelets and other cell-types, a relatively high level of ALOX12 protein has been reported in rat platelets compared to different transformed rodent (3LL and W256) and human cancer (A431 and HEL) cell types. Therefore, it is expected that high ALOX12 in the platelets would translate to a higher enzymatic conversion of arachidonate to 12S-HETE which is reflected in our ELISA-based study. Platelet-mediated catalysis of arachidonic acid to 12S-HETE has been previously reported, justifying our use of platelet lysates as a positive control for ALOX12 enzymatic activity [59, 60]. The ELISA-based detection of 12S-HETE in arachidonate-treated THP-1 and MLC cell lysates supports our previous findings involving the metabolism of α-linolenic acid in THP-1 and TPA-induced MLC cells and subsequent detection of arachidonate-derived oxylipins including 12S-HETE using high pressure liquid chromatography (HPLC) with tandem mass spectrometry (MS-MS) [61].
Validation of research antibodies is an important issue [62]. Well-characterized antibody reagents play a key role in the reproducibility of research findings [63]. We used three anti-ALOX12 antibodies including two rabbit polyclonal antibodies raised against different N (186-231 aa) and C-terminal (609-628 aa) epitopes and one mouse monoclonal antibody raised using overlapping N-terminal epitopes (131-230 aa). The antibodies exhibited a considerable difference in their ability to detect different species of ALOX12 including native versus recombinant proteins in a cell-type-specific manner. This difference may be due to the recognition of different conformations (PTM forms) in a cell-type-specific manner. High throughput mass spectrometric analysis detected phosphorylation of ALOX12 at multiple serine, threonine, and tyrosine residues including S244 and S246 residues as archived in the PhosphositePlus database [64, 65]. ALOX12 phosphorylation (Y19 and Y614)-dependent modulation of its enzymatic activity has been demonstrated in an overexpression-based study using HEK293 [43]. The S244/246 residues are in close proximity to the rabbit/mouse ALOX12 N-terminal epitope. Phosphorylation of ALOX5 at multiple residues has been reported [66] that significantly alters molecular structure [67]. Therefore, it is conceivable that the cell-type-specific phosphorylation of ALOX12 in these residues may induce a conformational change in ALOX12 affecting antibody-based detection. The conformation-specificity of antibodies is an inherent limitation of immuno-detection methods and is highlighted in a recent study [68] that showed that an antibody raised against P-Tyr307 residue of protein phosphatase 2A catalytic subunit (PP2Ac) that has been extensively used in several studies, is sensitive to additional protein modifications that occur near Tyr307, including Thr304 phosphorylation and Leu309 methylation, when these PTMs are present. Thus, it has been suggested that the studies that used these antibodies to report PP2Ac hyper-phosphorylation require reinterpretation, as these antibodies cannot be reliably used as readouts for a single PP2Ac PTM change. Besides, our preliminary mass spectrometric analysis of ALOX12 identified a Lysine 217-E-Gly-Gly modification (data deposited in the Global Proteome Machine database, identification number: GPM10000003125) that is typically generated following trypsin digestion of ubiquitinated proteins [69]. Therefore, the higher molecular weight fractions of ALOX12 may represent PTMs that imparted additional mass, for example, ubiquitination. Thus, our study followed the guidelines of standard immunoblotting-based detection [70] and sets a high standard. Besides, this study also provides insight into the complexity of antibody-based detection of ALOX12 and sets the direction for future studies to identify the PTMs of ALOX12 and their functional relevance, which is lacking in the existing literature. Moreover, the above deliberation may provide an interpretation to the difference between our study vs other studies [41-45] in terms of the presence or absence of ALOX12 protein in HEK293 cells.
The biological relevance of the phorbol-ester (TPA) induced lncRNA transcytosis and ALOX12 regulation is an important aspect of this study. Murine 8S-lipoxygenase is a TPA inducible lipoxygenase [71] and genetic deletion of murine 12R-lipoxygenase resulted in ichthyosis, a cornified skin phenotype [72]. TPA treatment as well as epidermal growth factor (EGF)-PKC signaling increased the expression of ALOX12 mRNA in a time-dependent manner in skin epidermal carcinoma-derived A431 cells [73, 74]. Moreover, alteration in PKC activity has been suggested to underlie the pathophysiology of psoriasis, a hyperplastic skin disorder [75]. The human protein atlas database documented high-level ALOX12 protein expression in skin epidermal cells [28]. Taking together all this information it is possible to realize that our observations of the lack of ALOX12-AS1 lncRNA expression in primary human skin tissue vs expression of the lncRNA in transformed A431 cells and the abundance of ALOX12 proteins in both skin and A431 cells as well as TPA induced increase of ALOX12 mRNA expression in A431 cells makes these tissue/cell-based system an ideal model for further study of the biological relevance of lncRNA mediated regulation of ALOX12 and its potential therapeutic exploitation in the future. Similarly, the significance of the TPA-induced lncRNA transcytosis and ALOX12 regulation cannot be ignored. This is relevant due to the observation that TPA-induced adhesion of cancer cells/neutrophils to endothelial cells along with concomitant production of lipoxygenase catalytic products (LTB4 and 5-HETE) has been reported and this phenomenon was inhibited by lipoxygenase inhibitors [76-78]. Besides, a TPA-PKC pathway-dependent and 12S-HETE-stimulated expression of the cell surface integrin in vascular endothelial cells was identified as a mechanism for cell adhesion and expansion [79]. ALOX12 mRNA expression has been reported in HepG2 cells and treatment of HepG2 cells [80] with elaidic acid, the most abundant trans fatty acid, led to a 1.8 fold reduction of ALOX12 mRNA expression suggesting a potential link between fatty acid metabolism and ALOX12 [81]. Thus, apart from the existing model of the regulation of bioactive lipid mediators, our findings of a lncRNA-mediated downregulation of ALOX12 may serve as an alternative cell-type-specific mechanism in a tissue-specific context.
According to an aspect of the invention, there is provided a method for treating a disease or disorder associated with Arachidonate 12-lipoxygenase (ALOX12) protein levels, said method comprising:
The ALOX12-AS1 modulating compound may promote or enhance or increase nucleo-cytoplasmic translocation of ALOX12-AS1 lncRNA.
The ALOX12-AS1 modulating compound may be a protein kinase C inhibitor, for example, a phorbol ester.
The ALOX12-AS1 modulating compound may be an ALOX12-AS1 lncRNA antisense oligonucleotide.
The disease or disorder may be selected from the group consisting of: cardiovascular disease, a skin disorder, a skin inflammatory disease, non-alcoholic fatty liver disease, psoriasis, diabetic nephropathy, platelet agglutination, cancer and Alzheimer's disease.
While not wishing to be bound or limited to or by a particular theory or hypothesis, the inventor believes that an equimolar ratio of the lncRNA:ALOX12 mRNA in the cytoplasm is required for the maintenance of basal ALOX12 protein level. Accordingly, inhibition of ALOX12 mRNA by this mechanism is not “all or nothing” but rather may be considered to exist as a continuum that is influenced by changes in ALOX12-AS1 lncRNA concentration in the cytoplasm. Specifically, it is believed that the ratio of the lncRNA:ALOX12 mRNA is important. If an equimolar ratio is maintained then a basal ALOX12 protein level is maintained. If the ratio is disturbed by any means, for example, TPA induced nucleo-cytoplasmic translocation or ASO-mediated degradation of the lncRNA, then ALOX12 protein level is affected. In some embodiments, the antisense oligonucleotides are 15-25 nucleotide long DNA sequences. ASO sequences are modified for increased stability and binding affinity.
The most widely used modifications are phosphorothioate (PS) bonds, which are added throughout the oligonucleotide backbone to provide nuclease resistance. PS bonds have the potential to increase toxicity, which can be minimized by including an additional 2′-O-Methyl (2′OMe) RNA to create a “gapmer” ASO. DNA with these modifications display more nuclease resistance, lower toxicity, and increased hybridization affinities within cells and in vivo. Some examples of suitable ASOs include but are by no means limited to:
In this table, 2-O-Methyl bases are represented with a lower case “m” in front of each base and an asterisk “*” between the bases indicates phosphorothioate bonds.
Alternatively, the lncRNA can be targeted by designing ASOs targeted to the embedded repeat elements in ALOX12-AS1 lncRNA. For example, a long interspersed element (LINE) in ALOX12-AS1-201 isoform is “TTATTGAACTCCCATTCCGTATATGACATTATAGTCAGCATTCTTGGGGAAACAG AGATGACTAAGTAAGATTATTGCCTTCTAGGAGGTTATAGTCTAGCAGGAG” (SEQ ID NO:10) and a SVA-retroposon/short interspersed element (SINE)-in the same isoform is “GAGACCGGGACTTGCTGTGTTGCCCAGGCTGGTCTTGAACTCCTGGTCTTAAGCA ATCATACTGCTTTGGCCACCCAAAGCACTGGGATTACAGGCGTGAACCACCACAC CCAGCTCTTAA” (SEQ ID NO:11).
The RNA interference via synthetic small interfering RNA (siRNA) silences the target gene by degrading the mRNA through Drosha/Dicer processing pathways which occurs in the cytoplasm. Most noncoding RNAs (lncRNA) are localized to the nucleus, limiting the use of siRNA for their silencing due to the low prevalence of the requisite enzymes (Drosha/Dicer etc) in the nucleus. However, RNase H, which is present in the nucleus, can be engaged to mediate RNA degradation, enabling the use of chemically modified antisense DNA oligonucleotides (ASO) to downregulate targeted nuclear noncoding RNAs. RNase H is non-sequence-specific endonuclease enzymes that catalyze the cleavage of RNA in an RNA/DNA substrate via a hydrolytic mechanism. Therefore, ASOs are particularly useful for silencing nuclear lncRNAs, because ASOs engage RNase H, which is prevalent in the nucleus and binds and cleaves DNA/RNA hetero-duplexes. Thus, when ASOs are used as a therapeutic means, it will go inside the nucleus and bind to the ALOX12-AS1 lncRNA creating a DNA/RNA hybrid which be degraded by RNase H and thus, it will then shift the balance of cellular lncRNA: ALOX12 mRNA molar ratio and would downregulate ALOX12 protein level. The ASO mediated downregulation is different from drug induced down regulation, both alters the lncRNA:ALOX12 mRNA molar ratio but in an opposite way.
As will be appreciated by one of skill in the art, in those embodiments in which the ALOX12-AS1 modulating compound is a small RNA molecule, compounds such as these can get inside the cell by at least two pathways:
As will be apparent to those of skill in the art, when the ALOX12-AS1 modulating compound is for example an ASO, the administration can be systemic or targeted. In targeted approach, the ASOs can be for example ligated to a specific ligand that is bound by receptors that are specifically located on the target cells. In contrast, if the modulating compound is for example a PKC inhibitor, the administration is systemic or targeted, depending on the target organ/tissue. For example, if the target organ is skin, then a targeted delivery of the drug to skin in the form of skin ointment or formulated as a skin ointment will serve the purpose. Other suitable delivery methods will be apparent to those of skill in the art and are within the scope of the invention.
As discussed herein, the ALOX12-AS1 modulating compounds of the invention can be used for the treatment of any disease or disorder associated with abnormal expression of ALOX12 protein. Suitable diseases and/or disorders include but are by no means limited to acute or chronic inflammatory disease, for example atherosclerosis, obesity and the like. In addition, suitable compounds can be used as an anti-platelet therapy for the deregulation of ALOX12 in the platelet. As discussed herein, these compounds can also be used for reducing skin inflammatory diseases, more specifically, Psoriasis as ALOX12 is highly expressed in skin epidermal cells.
A method for determining if a patient is a candidate for further screening for a disease characterized by abnormal ALOX12 protein levels comprising:
In some embodiments, the lncRNA is screened in the blood as a serum or exosome-based biomarker for chronic inflammatory diseases (for example, cardiovascular diseases including atherosclerosis) and malignancies. The serum/Exosome RNA will be extracted and then the lncRNA will be quantified using RT-PCR and compared with the same serum/exosomal housekeeping reference lncRNA, for example, RNA Component Of Signal Recognition Particle 7SL1 (RN7SL1), Metastasis Associated Lung Adenocarcinoma Transcript 1 (MALAT1), H19 Imprinted Maternally Expressed Transcript (H19), and Taurine Up-Regulated 1 (TUG1).
If elevated or decreased ALOX12-AS1 lncRNA is detected in the serum/exosomes, then the subject may go for a detailed screening for signs of for example Atherosclerosis or Cancer, as discussed herein.
According to another aspect of the invention, there is provided a method for determining if a compound of interest is an ALOX12 modulating compound comprising:
As will be apparent to one of skill in the art, ALOX12 activation/upregulation/downregulation can be detected by any of a variety of means known in the art. For example, one method is the measuring of ALOX12 lipoxygenase activity which has been demonstrated in
The compound identified in step (d) may be characterized for ALOX12-AS1 lncRNA nucleo-cytoplasm translocation activation.
The compound identified in step (e) may be characterized for ALOX12-AS1 lncRNA nucleo-cytoplasm translocation inhibition.
In some embodiments, the ALOX12-AS1 modulating compound, for example, a PKA inhibitor or activator drug can be screened for ALOX12-AS1-mediated down-regulation or upregulation of ALOX12. As will be appreciated by one of skill in the art, initially, it is not necessary to measure lncRNA nucleo-cytoplasmic or reverse translocation during the assay because such translocation will eventually be manifested in increased/decreased ALOX12 protein turnover. Therefore, measurement of the ALOX12 protein levels will be a parameter for drug selection.
However, the fact that the ALOX12-AS1 modulating compound acts through nucleo-cytoplasmic transport is important because other inhibitory mechanisms that do not involve AS1 may have undesirable side effects. For example, ALOX12 can be inhibited by a small molecule Baicalein 5,6,7-Trihydroxyflavone, known as baicalein [111], known for its anti-inflammatory properties [112, 113], however such inhibition is not selective for ALOX12 as it inhibits other ALOXs which is not desirable and may have toxic side effects [114]. Therefore, our ASO-mediated approach would provide a better alternative to selectively regulate ALOX12 through the lncRNA.
Such drugs will be useful for the diseases which require upregulation or downregulation of the inflammatory pathway. Increased ALOX12 will enhance inflammatory response and decreased ALOX12 will reduce inflammatory response thorough increased/decreased production of bioactive lipids. PKA is activated by cAMP pathway, therefore, drugs that increase/decrease intracellular cAMP or cAMP analogs will be effective in PKA-lncRNA-mediated regulation of ALOX12.
The invention will now be further explained and/or elucidated by way of examples; however, the invention is not necessarily limited to or by the examples.
Based on the Ensemble genome database (version GRCh38/hg38), the ALOX12 gene is located on the sense (+) strand of chr17: 6,994,196-7,010,754, whereas the overlapping ALOX12-AS1 is localized on the antisense (−) strand of chr17: 6,876,635-7,012,349 (
Based on the tissue-specific expression of ALOX12-AS1 isoforms, five transformed human cell lines were selected to further examine cell-type-specific expression of the ALOX12-AS1-201/202 lncRNAs: A431 (skin epithelial [83]), EA.Hy926 (endothelial [84]), THP-1 (monocyte [85]), HEK293 (human embryonic kidney [86]) and HepG2 (hepatoma [87]). In all five cell lines, Northern blotting using isoform-specific fluorescently labeled RNA probes revealed the presence of ˜1.8 kb and 0.7 kb full-length transcripts corresponding to the previously reported ALOX12-AS1-201 and -202 lncRNA isoforms, respectively (
RNA-FISH using fluorescent-labeled probes revealed the presence and intracellular localization of ALOX12-AS1-201/202 lncRNAs in adipose, PBMs and liver tissues. High-magnification images revealed both cytosolic and nuclear localization of the lncRNA isoforms in the different tissues. The RNA-FISH wide-field tissue-based images showed the extent of cell-type-specific expression and intracellular localization within each tissue, as discussed herein. With respect to their presence in the nucleus, both lncRNAs appeared to be primarily in the nucleolus and nuclear speckles in a tissue-specific manner. Interestingly, both lncRNAs were predominantly in the cytosol in a fraction of PBMs exhibiting intense Hoechst staining. This staining pattern may be due to the state of the chromatin, which appears condensed and thus may be indicative of apoptotic cells.
The tissue and cell-type/organelle-specific localization of ALOX12-AS1 lncRNA validated the effectiveness of the FISH probes. In addition, two different experimental approaches were used to further validate the FISH probes. First, adult human abdominal skin tissue which tested negative for RT-PCR based amplification of ALOX12-AS1 specific products (
RNA-FISH was performed to determine the subcellular localization of ALOX12-AS1-201/202 isoforms in A431 (Fig S8A-C), HEK293 (
We performed subcellular fractionation to study the nucleo-cytoplasmic distribution of the ALOX12-AS1 lncRNAs. The nucleoli in adherent cells are clearly visible in bright-field images but not in suspension cells, for example THP-1 cells (
Immunofluorescence using the nucleolus-specific markers, NCL and nucleophosmin (NPM1), revealed an effective enrichment of the nucleoli (
To see if antisense ALOX12-AS1 lncRNA regulates the expression of ALOX12, ALOX12 protein levels were characterized using two N-terminal (N) and one C-terminal (C) epitope-based anti-ALOX12 antibodies (Table 1). The theoretical molecular mass of the consensus ALOX12 protein (ID: ENSP00000251535) is 75.6 kDa as calculated by the ExPASy Compute pI/MW tool [88]. The anti-ALOX12-(N) and -(C) antibodies recognized a 75 kDa Flag-tagged ALOX12 protein transiently expressed in HEK293 cells. The rabbit polyclonal anti-ALOX12-(N) antibody recognized a 110 kDa protein in EA.hy926, A431, and THP-1 cells. This band was less abundant in THP-1 and EA.hy926 cells compared to A431 cells. The possibility that a transcriptional isoform is responsible for the appearance of the p60 kDa ALOX12 in THP-1 cells was verified by performing a long-range amplification of the full-length ALOXs cDNAs in A431 and THP-1 cells. Long-range PCR revealed the amplification of ALOXE3, ALOX5, ALOX12, and ALOX12B cDNAs of expected amplicon lengths, specifically in the case of ALOX12 where the expected amplicon size (1992 nucleotides) matched to the observed 1.9 kb band. Interestingly, a shorter ˜1500 nucleotide long amplicon was observed in THP-1 cells along with the ALOX5 and ALOX12 amplicons of expected lengths. This result indicates the possibility of the existence of a shorter transcriptional isoform of ALOX12 in THP-1 cells which may be responsible for the appearance of p60 kDa ALOX12 in THP-1 cells. Furthermore, recombinant Flag-ALOXs were overexpressed in HEK293 cells to check the specificity of anti-ALOX antibodies. The anti-Flag antibody detected all recombinant Flag-ALOX proteins at around 75 kDa. Based on these results, we used the anti-ALOX12-(C) antibody in subsequent experiments. Overall, these data indicate differential expression of native ALOX12 proteins and some higher/lower molecular weight fractions in the five cell lines tested.
Phorbol ester (12-O-Tetradecanoylphorbol 13-acetate: TPA) is an activator of protein kinase C (PKC) that has been frequently used for inducing the differentiation of different cell types, including myeloid cells [35]. Activation of human monocytic cells affects ALOX expression [89, 90]. Therefore, we induced differentiation of monocytic THP-1 cells to macrophage-like cells (MLCs) with 100 nM TPA [91, 92] and monitored the ALOX12 protein level as well as nucleo-cytoplasmic translocation of ALOX12-AS1-201. Over the TPA treatment period (1-72 h), ALOX12 protein levels were dramatically reduced (
We measured ALOX12 enzyme activity of THP-1 and TPA-induced MLC cell lysates and compared them to establish the biological relevance of lncRNA-mediated downregulation of ALOX12 protein level. We used a cell-free system to avoid any limitations of intracellular arachidonic acid uptake by an in vitro cell-based system. As well, we used a platelet-derived protein-lysate as a positive control for ALOX12 enzyme activity [59]. ALOX12 was originally discovered and characterized as an arachidonic acid peroxidizing enzyme in platelets [96]. Treatment with 50 μM arachidonic acid for 15 min at 37° C. resulted in the production of ˜124, ˜6, and ˜1.3 ng 12S-HETE by the platelet, THP-1, and MLC cell lysates, respectively. These data indicate there is more ALOX12 in platelets compared to the other transformed cell-types as reported in the literature [97]. Interestingly, the lower amounts of 12S-HETE produced by the MLC lysate compared to the THP-1 lysate (˜1.3 vs ˜6 ng) correlated with the reduced levels of ALOX12 protein in these cell-types. Overall, these results establish a functional link between the ALOX12 protein level and the reduced lipid peroxidizing activity in these different cell-types.
Post-transcriptional control of gene function by lncRNAs is mediated through a variety of mechanisms including regulation of mRNA decay, activation of mRNA translation, sequestration of miRNA and miRNA-mediated repression, to name a few [98]. To achieve direct contact-based post-transcriptional regulation, lncRNA must physically interact with its target sequence to form an RNA duplex. The ALOX12-AS1-201/202 isoforms contain 52 nucleotide sequence motifs complementary to exon 14 of the ALOX12 gene (
A 3′-Biotin-dA10 oligonucleotide ligated ALOX12-AS1-201 isoform was transfected into HEK293 cells and the transfected lncRNAs were crosslinked and pulled down using streptavidin-coated magnetic beads (
HEK293 cells were transiently transfected with plasmids expressing ALOX12-AS1-201/202 to study lncRNA-mediated suppression of ALOX12. Multiplex RT-PCR revealed relatively high expression of both lncRNA isoforms in the overexpressed cells (
The antisense-mediated regulation of ALOX12 may be exerted by the two overlapping sequence regions involving antisense ALOX121-AS1 201 and sense ALOX12 consisting of a 210 base-pair (bp) segment in ALOX12 exon 8 and a 52 bp segment in ALOX12 exon 12 respectively. In order to see the effect of this overlapping sequences on lncRNA-mediated ALOX12 transcriptional suppression, we generated mutant ALOX12-AS1-201 with interstitially deleted (A) 201 and 52 bp segments and then in vitro transcribed poly-A tailed (dA-10 nucleotides) AALOX12-As1-201 mRNA was transfected in HEK293 cells. Truncated AALOX12-AS-201 was found ˜3 fold less effective in reducing ALOX12 protein level compared to the full-length ALOX12-AS1-201 (71% vs 25% respectively). This indicated that the overlapping sequence element is to some extent responsible for mediating antisense-sense translational regulation.
Small interfering RNA (siRNA)-mediated knockdown of ALOX12-AS1 in HEK293 cells was ineffective possibly because of the nuclear localization of the lncRNA. As an alternative approach, multiple isoform-specific oligonucleotides (ASOs) complementary to different regions of ALOX12-AS1-201/202 were designed (
Three ALOX12-AS1-202-specific ASOs were designed and two of them (ASO-2 and -3) reduced ALOX12-AS1-202 mRNA levels within 24 hours of transfection (
Phorbol ester (12-O-Tetradecanoylphorbol 13-acetate: TPA) is an activator of protein kinase C (PKC) that has been frequently used for inducing differentiation in different cell types including myeloid cells [35]. Recently, in a separate study, we observed that during TPA-mediated differentiation of monocytic THP-1 cells to macrophage like cells, ALOX12 level is dramatically reduced (data not shown). Therefore, we treated HEK293 cells with 10 μM TPA for 1 hour and observed ALOX12-AS1-201 nucleo-cytoplasmic translocation as well as measured ALOX12 protein level. FISH revealed that TPA treatment caused dramatic nucleo-cytoplasmic translocation of ALOX12-AS1-201 compared of the vehicle (DMSO) treated cells. Subcellular fractionation and quantitative RT-PCR revealed a significant increase of cytosolic ALOX12-AS1-201 lncRNA abundance in the TPA-treated cells compared to the vehicle treatment. As anticipated, the drug-induced nucleo-cytoplasmic translocation of ALOX12-AS1-201 correlated to a significant reduction in ALOX12 protein level in TPA-treated cells compared to vehicle treatment.
The primary adult human tissue cryosections and total RNA samples were purchased from Zyagen Life Science, USA (Frozen section catalogue numbers: HF-101/103/314/413; total RNA catalogue numbers: HR-101/102/103/306/413/704/810/3014). Human blood for peripheral blood CD14+ monocyte (PBM) isolation was obtained by informed consent as per a protocol approved by the University of Manitoba Research Ethics Board and the St. Boniface Hospital Research Review Committee. The CD14+ PBMs were isolated via a two-step process involving preparation of peripheral blood mononuclear cells (SepMate-50 tubes, catalogue number: 85460) from which CD14+CD16− monocytes were obtained (EasySep™ Human Monocyte Isolation Kit, Stemcell Technologies, catalogue number: 19359) according to the manufacturers' protocols [61].
A431, EA.hy926, HEK293, and HepG2 cells were grown in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% heat-inactivated FBS and 1× antibiotic-antimycotic solution (A5955, Sigma). The THP-1 cells were grown in RPMI-1640 medium supplemented with 0.05 mM 2-mercaptoethanol and 10% FBS.
RNA Extraction, cDNA Synthesis, Singleplex/Multiplex Reverse-Transcription PCR (RT-PCR) and Quantitative Real-Time PCR (qPCR)
Total RNA from different cell lines was extracted with Trizol reagent (Catalog number: 15596026; ThermoFisher Scientific, Canada) as per the manufacturer's recommended protocol. Total RNA (1-5 μg) was treated with RNase-free DNase I (Catalog number: M0303, New England Biolabs Inc., USA) at 37° C. for 15 min, subsequently heat-inactivated at 75° C. for 10 min and used for cDNA synthesis. The first-strand cDNA was synthesized using the SuperScript™ first-strand synthesis system (Catalog number: 11904018; ThermoFisher Scientific, Canada). Multiplex RT-PCR and regular RT-PCR were performed in a 20 μL reaction mix containing 1× DreamTaq buffer, 2 mM dNTP mix, 0.2 μM oligonucleotide primers, cDNAs equivalent to 100 ng total RNA, and 1.25 units DreamTaq™ Hot Start DNA Polymerase (Catalog number: EP1701; ThermoFisher Scientific) and amplified using 95° C. for 1 min, 35 cycles of 95° C. for 10 sec, 62°-65° C. for 10 sec and 72° C. for 30 sec. The RT-PCR products were separated using agarose gel electrophoresis and visualized. Absolute quantification of ALOX12-AS1 lncRNA isoforms was performed in a Mastercycler®ep realplex real-time PCR system (Eppendorf, Hamburg, Germany) using SYBR green dye (Catalog number: S7563; ThermoFisher Scientific). To determine the absolute copy number of the target transcripts, cloned plasmid DNAs containing the ALOX12-AS1201/202 isoforms were used to generate calibration curves, which also permitted evaluation of PCR efficiencies using the formula E=10[−1/slope]. The efficiency of amplification was checked for all targets by performing a series of serial dilutions of the template for each primer pair in triplicate. Real-time PCR data quality control calculations were determined by the SAS program as described previously [101] and the calculated PCR efficiency was between 95%-99%. Quantitative RT-PCR was conducted for different cell-line derived RNAs, and the specificity of each amplified product was confirmed by melting curve analysis. Results were expressed as copy number of specific isoforms per 100 ng of total RNA.
Extraction of RNA from Subcellular Fractions and Validation
Nucleoli were purified from a confluent monolayer of EA.hy926 cells using a modified version [102] of the original method described by Busch et al. [103]. Briefly, cells were incubated in a hypotonic solution containing 10 mM HEPES (pH 7.9), 1.5 mM MgCl2, 2.5 mM KCl, and 0.5 mM DTT for 5 min, and then scraped and homogenized using a pre-chilled dounce homogenizer to break the cells and to release the nucleus. The homogenized subcellular fractions were centrifuged at 300 g for 5 min and the supernatant was collected as a cytosolic fraction. The nuclear pellet was resuspended in solution S1 containing 0.25 M sucrose/10 mM MgCl2 and slowly layered onto solution S2 containing 0.35 M sucrose/10 mM MgCl2. After centrifugation at 1500 g for 5 min, the nuclear pellet was resuspended in solution S2 and subsequently sonicated to completely disrupt the nuclear membrane. The sub-nuclear fractions were then layered on top of solution S3 containing 0.88 M sucrose/10 mM MgCl2 and centrifuged at 2800 g for 5 min to obtain the nucleolar pellet. The supernatant was collected as the nucleoplasm fraction (nucleus-nucleolus). The nucleolar pellet was washed once with solution S2 and frozen immediately. For immunofluorescence-based evaluation, the purified nucleoli were immobilized on poly-L-lysine (Sigma) coated slides and air-dried. After rehydration with phosphate-buffered saline (PBS: 137 mM NaCl, 2.7 mM KCl and 10 mM phosphate buffer solution, pH 7.4) and a brief fixation (10 min) with freshly prepared 2% paraformaldehyde in PBS, the nucleoli were incubated with monoclonal anti-NCL/NLM1 antibody for 30 min, then washed and incubated with FITC conjugated secondary antibodies for 30 min. The slides were washed with PBS and counterstained with an anti-fade reagent containing DAPI. Images were captured using an Axiovision 4.1 Zeiss microscope.
Genomic DNA-free nuclear and nucleolar RNA were extracted from the harvested pellets using the Monarch Total RNA miniprep kit (catalogue number: T2010G, New England Biolabs). The cytosol and nucleoplasm fractions were in a large volume and the total RNAs from these fractions were harvested by the method of Max et al. [104]. Briefly, the cytosol/nucleoplasm fractions were mixed with an equal volume of a buffer containing 4 M citric acid, 4 M NaOH, 0.8% (w/v) sarkosyl, 3 M guanidium thiocyanate, and 80% (v/v) 0.1 M citrate buffer (pH 4.3)-saturated Phenol solution. The solution was briefly vortexed and mixed with 100 μL/mL chloroform and incubated at room temperature for 5 min. Subsequently, the suspension was centrifuged at 5000 g for 10 min and the supernatant was collected. RNA from the supernatant was harvested by isopropanol-mediated precipitation followed by washing with 70% ethanol. The RNA pellet was dissolved in RNase free water and stored.
The full-length ALOX12-AS1-201 and ALOX12-AS1-202 transcripts (Transcript ID: ENST00000399540.2 and ENST00000399541.6, respectively) were cloned into the BamH1/EcoRI restriction sites of the pcDNA3.1(+) vector. During cloning, T7 and Sp6 promoter sequences were inserted into the 5′ and 3′ end of the lncRNA transcripts for in vitro transcription. The plasmids were used for the generation of FISH probes by in vitro transcription using T7/Sp6 polymerases. The ALOX12-AS1201/202 lncRNA-specific RT-PCR products were agarose gel-purified and cloned into a pCR2.1-TOPO TA Vector using the TOPO-TA cloning kit (Catalog number: 450641; ThermoFisher Scientific, Canada) as per the manufacturer's protocol. Sanger sequencing was performed at the sequencing facility of the Hospital for Sick Children, Toronto, Canada. Transfection of mRNAs was achieved using Lipofectamine® MessengerMAX™ reagent (Catalog number: LMRNA001; ThermoFisher Scientific).
Northern blotting was performed using the NorthernMax Kit (Catalog number: AM1940, ThermoFisher Scientific) as per the manufacturer's instructions. Briefly, total RNA (20 μg) was separated using a 1% agarose gel and transferred to BrightStar™-Plus Positively Charged Nylon membranes (Catalog number: AM10104; ThermoFisher Scientific) using a downward transfer assembly. A denatured single-strand RNA ladder (Catalog number: N0362S, New England Biolabs) was used as a reference for RNA size. The transferred RNA was crosslinked by exposure to 254 nm UV light for 1 min using a UV crosslinker (model FV-UVXL1000; Fisher Scientific). Fluorescence-conjugated ALOX12-AS1 isoform-specific RNA Northern blotting probes (Table 1) were synthesized using the FISH Tag™ RNA Multicolor Kit (Catalog number: F32956; ThermoFisher Scientific). The labeled probes were hybridized for 4 hours at 60° C. in a rotating hybridization oven and subsequently visualized and imaged using the ChemiDoc MP imaging System (Bio-Rad).
For RNA-FISH, cells were grown on coverslips and human tissue cryosections were adhered to glass slides. Human PBMs were harvested from whole blood. The harvested PBMs were suspended in RPMI media (Catalog number: 61870127; ThermoFisher Scientific) supplemented with 10% FBS and plated onto a Matrigel growth factor reduced (GFR) basement membrane matrix (catalogue number: 356238; Corning) coated glass coverslip which had been placed at the bottom of a 6 well culture dish. The plate containing the cells was centrifuged at 600 g for 10 min and incubated in a CO2 incubator for 2 hours. The cells were then fixed and analyzed by RNA-FISH. THP-1 cells were prepared in a similar way for RNA-FISH. The cells/cryosections were fixed in 4% freshly prepared paraformaldehyde (PFA) in PBS for 20 min, followed by sequential incubations in absolute ethanol (2×5 min), xylene (30 min), absolute ethanol (2×5 min), methanol (2×5 min), 50% methanol+2% PFA+PBS+0.1% Tween-20 (5 min), 2% PFA/PBS+0.1% Tween-20 (2×10 min), 2×5 min in PBT (PBS+0.1% Tween-20), PBT+20 μg/mL proteinase K (10 min), PBT (2×5 min), 2% PFA+PBT (2×10 min), PBT (4×5 min), PBT+50% hybridization buffer (10 min), and hybridization buffer (1×30 min at 55° C.). The hybridization buffer was prepared with 50% formamide, 5×SSC, 100 μg/mL fragmented salmon sperm DNA, 50 μg/mL heparin, and 0.1% Tween-20. The labeled FISH probes were prepared as mentioned in the Northern blotting probe preparation method. In addition, fluorescein-12-UTP (Catalog number: 11427857910; Roche). was used to label probes generated by Sp6 polymerase mediated in vitro transcription. The RNA FISH probe was used as both non-fragmented and fragmented. The FISH probe was fragmented by mixing (1:1) fluorescent-labeled RNA with 2× carbonate buffer (127 mg Na2CO3+67.2 mg NaHCO3, pH 10.2 with NaOH) followed by incubation at 42° C. for 30 min and subsequent addition of an equal volume of stop solution (164.1 mg sodium acetate, pH 6 with acetic acid). The fragmented as well as non-fragmented labeled FISH probes were precipitated with ethanol and dissolved in RNase free water and subsequently mixed with hybridization buffer and incubated overnight with the cells/tissues at 50° C. Following hybridization, the cells/tissues were stained with Hoechst in PBST and mounted using SlowFade™ Gold Antifade Mountant (Catalog number: 536936; ThermoFisher Technologies) and visualized using a Zeiss LSM410 confocal microscope and a Nikon Eclipse Ti2 inverted microscope. The sense templates of the ALOX12-AS1 lncRNA were used as a control for the RNA-FISH and no specific signal was detected (data not shown).
The antisense (−) and sense (+) transcripts of ALOX12-AS1 isoforms were transcribed in vitro using the HiScribe™ T7/Sp6 High Yield RNA Synthesis Kit (Catalog number: E2040S & E2070S; New England Biolabs) and BamH1/EcoRI digested linearized plasmid DNA as templates, respectively. The sense strand of the antisense lncRNAs was used as a control for transfection as well as RNA-FISH experiments. The in vitro transcribed lncRNAs were 3′ end labelled with a 3′Biotin-dA(10)-5′-PO4 oligonucleotide RNA probe using T4 RNA Ligase 1 (ssRNA Ligase, catalog number: M0204S, NEB). A 20 μl reaction was set up at 16° C. for 16 hours using 1×T4 RNA ligase reaction buffer (50 mM Tris-HCl, pH 7.5, 10 mM MgCl2, 1 mM DTT), 15% (w/v) polyethylene glycol (PEG) 8000, 0.5 μl RNase Inhibitor, 1 μl (10 units) T4 RNA ligase 1, 1 mM ATP, 20 pmol RNA, 100 pmol RNA oligo. The reaction was stopped by column clean up with Monarch RNA clean up kit (catalog number T2040S; NEB) that filtered the excess unincorporated biotin-dAs. The purified A-tailed 3′ Biotin labeled lncRNAs were transfected into the cells using Lipofectamine® MessengerMAX™ reagent (Catalog number: LMRNA001; ThermoFisher Scientific).
Formaldehyde Crosslinked lncRNA Purification Using Streptavidin C1 Beads
The biotin-dA labelled ALOX12-AS1-201 lncRNA was transfected into HEK293 cells. The transfected cells were crosslinked for 10 mins using 4% freshly prepared paraformaldehyde in PBS. The crosslinking was stopped by addition of 50 mM Tris-HCl pH 7.5 and the cells were lysed in a buffer containing 50 mM Tris-HCl pH7, 75 mM NaCl, 10 mM EDTA, 1% SDS, 1× protease inhibitor cocktail, and 30 units/μl RNAse inhibitor (catalog no:R1158, Sigma). The cell lysate was subsequently sonicated. The MyOne Streptavidin C1 (catalog number: 65001, Invitrogen) beads were resuspended 3-4 times in a binding and washing buffer containing 10 mM Tris-HCl pH 7.5, 1 mM EDTA and 2 M NaCl and then incubated with the cell lysate for 30 min at room temperature with gentle rotation of the tube. The beads were then washed 3-4 times in washing buffer. During the final wash cycle, the resuspended beads were separated into two aliquots and subsequently used for RNA and protein isolation. The RNA was isolated by resuspending the beads in a buffer (100 μl) containing 100 mM NaCl, 10 mM Tris-HCl pH 7.5, 1 mM EDTA, 0.5% SDS and treating with 5 μl proteinase K (10 mg/mL). Incubation was performed at 50° C. for 1 hour with end to end shaking in a hybridization oven. Subsequently, the RNA was eluted using Monarch RNA clean up kit (catalog number T2040S; NEB). The eluted RNA was used for cDNA preparation and subsequent RT-PCR applications. The ALOX12-AS1-201 crosslinked proteins were eluted as described previously [105].
The in vitro transcribed and purified ALOX12 mRNA and ALOX12-AS1-201/202 lncRNAs were denatured and mixed in an equimolar ratio in a duplex formation buffer containing 50% formamide, 10 mM Tris-HCl pH 7.5, 300 mM NaCl and 5 mM EDTA pH 7.5, followed by overnight incubation at 37° C. in a rotating shaker. The mixture was subsequently incubated with RNaseA/T1 (1 unit/μg RNA; catalogue number: EN0551, ThermoFisher Technologies) for 2 hours and the products were separated in a denaturing 1% agarose gel and visualized.
Relative quantification of proteins was performed as described previously [35, 106]. Table 1 lists the primary antibodies used in this study. The cell lysates were prepared in 1×RIPA lysis and extraction buffer (catalogue number: 89900, ThermoFisher Scientific) supplemented with 1× Halt protease and phosphatase inhibitor cocktail (catalogue number: 78441, ThermoFisher Scientific). The protein lysates were denatured in Laemmli buffer containing 2% SDS, 10% glycerol, 0.002% bromophenol blue, 0.75 M Tris-HCl pH 6.8, and 100 mM DTT. The immunoblots were imaged using a ChemiDoc XRS+ system (Bio-Rad) and band intensities were quantified using ImageJ (version 1.48) Software [107]. Due to the possibility of inconsistency in the relative expression of housekeeping genes, we normalized all proteins of interest based on the intensity of the Oriole-stained protein profile [92].
The THP-1 cells were differentiated on glass cover slips for immunofluorescence-base studies. The THP-1 cell suspension was briefly centrifuged at 600 g for 5 min on a coverslip in a 6 well plate. The cells were fixed for 10 min in 4% paraformaldehyde, permeabilized using 0.25% Triton X-100 in 1×PBS, blocked (1% BSA), and immunostained using appropriate primary antibodies and fluorescent-conjugated secondary antibodies. Finally, the cells were washed, counter-stained (Hoechst), mounted in SlowFade™ Gold Antifade mounting media (Thermo Fisher Scientific, S36936) and visualized.
ALOX12 catalytic activity was measured in a cell-free system using cell lysates derived from unactivated human platelets (positive control) and Phorbol ester (12-O-Tetradecanoylphorbol 13-acetate: TPA)/vehicle (DMSO/ethanol)-treated THP-1. ALOX12 converts arachidonate to the bioactive lipid 12(S)-hydroperoxyeicosatetraenoate (12S-HpETE) [59]. The 12S-HpETE is subsequently reduced by cellular peroxidases to 12(S)-hydroxyeicosatetraenoic acid (12S-HETE) [59]. The cell lysates prepared in 1×PBS supplemented with 0.5% NP40, 1× Halt protease and phosphatase inhibitor cocktail 1 were incubated with 50 μM arachidonic acid (catalogue number: A0781, Tokyo Chemical Industry, USA) for 15 min at 37° C. and the amount of 12S-HETE was quantitatively measured using a commercially available Enzyme-Linked ImmunoAssay (ELISA) kit (catalogue number: ADI-900-050, Enzo Life Sciences Inc., USA) as per the manufacturer's instructions [108]. Freshly harvested unactivated platelet-derived protein lysates served a positive control for ALOX12 enzyme activity [59]. The lysates were prepared from freshly harvested platelets obtained from consented healthy human donors as part of an ongoing study which is approved by the Biomedical Research Ethics Board of the University of Manitoba. The platelets were resuspended and lysed in Tyrode's buffer (134 mM NaCl, 12 mM NaHCO3, 2.9 mM KCl, 0.34 mM Na2HPO4, 1 mM MgCl2, 10 mM HEPES, pH 7.4), with freshly added BSA (3 mg/ml). The platelet lysate reaction product was diluted (1:16) to fit within the range of the assay.
Statistical analysis was performed using Prism version 7.00 (GraphPad Software). The means of more than 2 groups were compared using one-way ANOVA (randomized) [109, 110], followed by Dunnett's post hoc multiple comparison test to compare the means of multiple experimental groups against a control group mean [109]. Comparisons between two groups were performed using Student's t-test (unpaired). Differences were considered significant at P<0.05.
While the preferred embodiments of the invention have been described above, it will be recognized and understood that various modifications may be made therein, and the appended claims are intended to cover all such modifications which may fall within the spirit and scope of the invention.
D261-70.
The instant application claims the benefit of U.S. Provisional Patent Application Ser. No. 63/209,072, filed Jun. 10, 2021, and entitled “A method to regulate ALOX12-AS1 lncRNA-mediated alteration of ALOX12 protein and to screen for novel drugs to alter ALOX12 protein level”, the entire contents of which are incorporated herein by reference for all purposes.
| Number | Date | Country | |
|---|---|---|---|
| 63209072 | Jun 2021 | US |
