Patent Application
20230079757
This document relates to methods and materials involved in assessing and/or treating mammals (e.g., humans) having cancer. For example, methods and materials provided herein can be used to determine whether or not a cancer is likely to be responsive to a particular cancer treatment (e.g., a cancer immunotherapy or a cancer chemotherapy). In some cases, the methods and materials provided herein can be used to treat a mammal by administering, to the mammal, one or more cancer treatments that is/are selected based, at least in part, on whether or not the mammal is likely to be responsive to a particular cancer treatment.
Infiltration of lymphocytes in tumors is an essential step in immune attack of cancer cells. Indeed, the abundance of tumor-infiltrating lymphocytes (TILs) is a valuable prognostic factor for both chemotherapy and immune checkpoint inhibitor (ICI) therapy (Adams et al., J Clin Oncol 32:2959-2966 (2014); Loi et al., Ann Oncol 25:1544-1550 (2014); and Denkert et al., J Clin Oncol 28:105-113 (2010)). Cytotoxic lymphocytes (CTL), mainly cytotoxic T (Tc) and natural killer (NK) cells utilize granule exocytosis as a common mechanism to destroy cancer cells by expressing and releasing the pore forming proteins including perforin 1 (PRF1), granule-associated enzymes (granzymes (GZMs)) and natural killer cell granule protein 7 (NKG7) (Martinez-Lostao, Clinical Cancer Research 21:5047-5056 (2015)). Prostate and breast cancer are generally immunologically “cold.”
This document provides methods and materials involved in assessing and/or treating mammals (e.g., humans) having cancer. In some cases, this document provides methods and materials for determining whether or not a mammal having cancer is likely to be responsive to a particular cancer treatment (e.g., one or more cancer immunotherapies and/or one or more cancer chemotherapies), and, optionally, administering one or more cancer therapies that is/are selected based, at least in part, on whether or not the mammal is likely to be responsive to a particular cancer treatment to the mammal. For example, a sample (e.g., a sample containing one or more cancer cells) obtained from a mammal (e.g., a human) having cancer can be assessed to determine if the mammal is likely to be responsive to a particular cancer treatment based, at least in part, on the presence, absence, or level of Forkhead box protein A1 (FOXA1) polypeptide expression in the sample.
As demonstrated herein, overexpression of a FOXA1 coding sequence (e.g., resulting in an increased level of FOXA1 polypeptides) can be used to identify cancer patients (e.g., breast cancer patients such as triple negative breast cancer (TNBC) patients, prostate cancer patients, and/or bladder cancer patients) as having immunotherapy resistance and/or chemo-resistance. These results demonstrate that increased expression of a FOXA1 polypeptide can used to determine immunotherapy (e.g., immune checkpoint inhibitor (ICI)-based immunotherapy) responsiveness. These results also demonstrate that a FOXA1 polypeptide (and/or nucleic acid encoding a FOXA1 polypeptide) can be used as a therapeutic target to overcome immunotherapy resistance and/or chemotherapy resistance in a cancer.
Having the ability to determine whether or not a particular patient is likely to respond to a particular cancer treatment (e.g., a cancer immunotherapy or a cancer chemotherapy) allows clinicians to provide an individualized approach in selecting cancer treatments for that patient. Further, having the ability to convert “cold” tumors (e.g., tumors that are not recognized by the immune system) into “hot” tumors (e.g., tumors that can be recognized by the immune system) as described herein (e.g., by administering one or more inhibitors of a FOXA1 polypeptide) can allow clinicians and patients use new and unique ways to treat cancers that are otherwise resistant to immunotherapies and/or chemotherapies.
In general, one aspect of this document features a method for assessing a mammal having cancer. The method comprises, consists essentially of, or consists of (a) detecting a presence or absence of an increased level of Forkhead box protein A1 (FOXA1) polypeptide expression in a sample from the mammal; (b) classifying the mammal as not being likely to respond to an immunotherapy or a chemotherapy if the presence of the increased level is detected, and (c) classifying the mammal as being likely to respond to the immunotherapy or the chemotherapy if the absence of the increased level is detected. The mammal can be a human. The sample can comprise cancer cells of the cancer. The cancer can be selected from the group consisting of a prostate cancer, a breast cancer, a bladder cancer, a lung cancer, a liver cancer, a cervical cancer, a bile duct cancer, a colon cancer, a rectal cancer, a pancreatic cancer, a uterine cancer, a head and neck cancer, a testicular cancer, a ovarian cancer, a thyroid cancer, a bone cancer, a skin cancer, an adrenal gland cancer, a kidney cancer, a lymphoma, a thymus cancer, a brain cancer, a leukemia, and a cancer of the eye. The method can comprise detecting the presence of the increased level. The method can comprise classifying the mammal as not being likely to respond to the immunotherapy or the chemotherapy. The method can comprise detecting the absence of the increased level. The method can comprise classifying the mammal as being likely to respond to the immunotherapy or the chemotherapy. The detecting step can comprise performing a method that detects FOXA1 polypeptides in the sample using an anti-FOXA1 polypeptide antibody. The detecting step can comprise performing a method that detects mRNA encoding an FOXA1 polypeptide.
In another aspect, this document features a method for treating a mammal having cancer. The method comprises, consists essentially of, or consists of (a) detecting an increased level of FOXA1 polypeptide expression in a sample obtained from the mammal; and (b) administering a cancer treatment to the mammal, wherein the cancer treatment is not an immunotherapy or a chemotherapy. The mammal can be a human. The sample can comprise cancer cells of the cancer. The cancer can be selected from the group consisting of a prostate cancer, a breast cancer, a bladder cancer, a lung cancer, a liver cancer, a cervical cancer, a bile duct cancer, a colon cancer, a rectal cancer, a pancreatic cancer, a uterine cancer, a head and neck cancer, a testicular cancer, a ovarian cancer, a thyroid cancer, a bone cancer, a skin cancer, an adrenal gland cancer, a kidney cancer, a lymphoma, a thymus cancer, a brain cancer, a leukemia, and a cancer of the eye. The cancer treatment can comprise surgery. The cancer treatment can comprise radiation treatment.
In another aspect, this document features a method for treating cancer. The method comprises, consists essentially of, or consists of administering a cancer treatment to a mammal identified as having an increased level of FOXA1 polypeptide expression in a sample obtained from the mammal, wherein the cancer treatment is not an immunotherapy or a chemotherapy. The mammal can be a human. The sample can comprise cancer cells of the cancer. The cancer can be selected from the group consisting of a prostate cancer, a breast cancer, a bladder cancer, a lung cancer, a liver cancer, a cervical cancer, a bile duct cancer, a colon cancer, a rectal cancer, a pancreatic cancer, a uterine cancer, a head and neck cancer, a testicular cancer, a ovarian cancer, a thyroid cancer, a bone cancer, a skin cancer, an adrenal gland cancer, a kidney cancer, a lymphoma, a thymus cancer, a brain cancer, a leukemia, and a cancer of the eye. The cancer treatment can comprise surgery. The cancer treatment can comprise radiation treatment.
In another aspect, this document features a method for treating a mammal having cancer. The method comprises, consists essentially of, or consists of (a) detecting an absence of an increased level of FOXA1 polypeptide expression in a sample obtained from the mammal; and (b) administering a cancer treatment to the mammal, wherein the cancer treatment is an immunotherapy or a chemotherapy. The mammal can be a human. The sample can comprise cancer cells of the cancer. The cancer can be selected from the group consisting of a prostate cancer, a breast cancer, a bladder cancer, a lung cancer, a liver cancer, a cervical cancer, a bile duct cancer, a colon cancer, a rectal cancer, a pancreatic cancer, a uterine cancer, a head and neck cancer, a testicular cancer, a ovarian cancer, a thyroid cancer, a bone cancer, a skin cancer, an adrenal gland cancer, a kidney cancer, a lymphoma, a thymus cancer, a brain cancer, a leukemia, and a cancer of the eye. The cancer treatment can comprise an immunotherapy selected from the group consisting of pembrolizumab, nivolumab, cemiplimab, spartalizumab, camrelizumab, sintilimab, tislelizumab, toripalimab, AMP-224, AMP-514, atezolizumab, avelumab, durvalumab, KN035, CK-301, AUNP12, CA-170, and BMS-986189. The cancer treatment can comprise a chemotherapy selected from the group consisting of actinomycin, all-trans retinoic acid, azacitidine, azathioprine, bleomycin, bortezomib, carboplatin, capecitabine, cisplatin, chlorambucil, cyclophosphamide, cytarabine, daunorubicin, docetaxel, doxifluridine, doxorubicin, epirubicin, epothilone, etoposide, fluorouracil, gemcitabine, hydroxyurea, idarubicin, imatinib, irinotecan, mechlorethamine, mercaptopurine, methotrexate, mitoxantrone, oxaliplatin, paclitaxel, pemetrexed, teniposide, tioguanine, topotecan, valrubicin, vemurafenib, vinblastine, vincristine, and vindesine.
In another aspect, this document features a method for treating cancer. The method comprises, consists essentially of, or consists of administering a cancer treatment to a mammal identified as lacking an increased level of FOXA1 polypeptide expression in a sample obtained from the mammal, wherein the cancer treatment is an immunotherapy or a chemotherapy. The mammal can be a human. The sample can comprise cancer cells of the cancer. The cancer can be selected from the group consisting of a prostate cancer, a breast cancer, a bladder cancer, a lung cancer, a liver cancer, a cervical cancer, a bile duct cancer, a colon cancer, a rectal cancer, a pancreatic cancer, a uterine cancer, a head and neck cancer, a testicular cancer, a ovarian cancer, a thyroid cancer, a bone cancer, a skin cancer, an adrenal gland cancer, a kidney cancer, a lymphoma, a thymus cancer, a brain cancer, a leukemia, and a cancer of the eye. The cancer treatment can comprise an immunotherapy selected from the group consisting of pembrolizumab, nivolumab, cemiplimab, spartalizumab, camrelizumab, sintilimab, tislelizumab, toripalimab, AMP-224, AMP-514, atezolizumab, avelumab, durvalumab, KN035, CK-301, AUNP12, CA-170, and BMS-986189. The cancer treatment can comprise a chemotherapy selected from the group consisting of actinomycin, all-trans retinoic acid, azacitidine, azathioprine, bleomycin, bortezomib, carboplatin, capecitabine, cisplatin, chlorambucil, cyclophosphamide, cytarabine, daunorubicin, docetaxel, doxifluridine, doxorubicin, epirubicin, epothilone, etoposide, fluorouracil, gemcitabine, hydroxyurea, idarubicin, imatinib, irinotecan, mechlorethamine, mercaptopurine, methotrexate, mitoxantrone, oxaliplatin, paclitaxel, pemetrexed, teniposide, tioguanine, topotecan, valrubicin, vemurafenib, vinblastine, vincristine, and vindesine.
In another aspect, this document features a method for treating a mammal having cancer. The method comprises, consists essentially of, or consists of (a) detecting an increased level of FOXA1 polypeptide expression in a sample obtained from the mammal; (b) administering an inhibitor of a FOXA1 polypeptide; and (c) administering a cancer treatment to the mammal, wherein the cancer treatment is an immunotherapy or a chemotherapy. The mammal can be a human. The sample can comprise cancer cells of the cancer. The cancer can be selected from the group consisting of a prostate cancer, a breast cancer, a bladder cancer, a lung cancer, a liver cancer, a cervical cancer, a bile duct cancer, a colon cancer, a rectal cancer, a pancreatic cancer, a uterine cancer, a head and neck cancer, a testicular cancer, a ovarian cancer, a thyroid cancer, a bone cancer, a skin cancer, an adrenal gland cancer, a kidney cancer, a lymphoma, a thymus cancer, a brain cancer, a leukemia, and a cancer of the eye. The inhibitor of the FOXA1 polypeptide can be an inhibitor of FOXA1 polypeptide activity. The inhibitor of the FOXA1 polypeptide activity can be SNS-032 (BMS-387032), Ro 31-8220, Aurora A Inhibitor I, WZ8040, Dasatinib, Lapatinib, Saracatinib (AZD0530), JNK-IN-8, BI 2536, Crenolanib (CP-868596), Herceptin, CYT387, BEZ235 (Dactolisib), PHA-793887, NVP-BSK805 2HCl, Cediranib (AZD2171), PF-00562271, Flavopiridol, AT7519, Apicidin, or Volasertib (BI 6727). The inhibitor of the FOXA1 polypeptide can be an inhibitor of FOXA1 polypeptide expression. The inhibitor of the FOXA1 polypeptide expression can be a small interfering RNA (siRNA) molecule or an antisense oligo. The siRNA can comprise or consist of nucleic acid selected from the group consisting of GAGAGAAAAAAUCAACAGC (SEQ ID NO:1) and GCACUGCAAUACUCGCCUU (SEQ ID NO:2). Administering the inhibitor of the FOXA1 polypeptide can comprise administering a viral particle comprising the shRNA to the mammal. The antisense oligo can comprise or consist of nucleic acid selected from the group consisting of SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:42, SEQ ID NO:43, ATCAGCATGGCCATCCA (SEQ ID NO:45), ACCACCCGTTCTCCATCAA (SEQ ID NO:46), ACTCGCCTTACGGCTCTACG (SEQ ID NO:47), CCATTTTAATCATTGCCATCGTG (SEQ ID NO:48), GGTAGCGCCATAAGGAGAGT (SEQ ID NO:49), and TGGATGGCCATCGTGA (SEQ ID NO:50). The cancer treatment can comprise an immunotherapy selected from the group consisting of pembrolizumab, nivolumab, cemiplimab, spartalizumab, camrelizumab, sintilimab, tislelizumab, toripalimab, AMP-224, AMP-514, atezolizumab, avelumab, durvalumab, KN035, CK-301, AUNP12, CA-170, and BMS-986189. The cancer treatment can comprise a chemotherapy selected from the group consisting of actinomycin, all-trans retinoic acid, azacitidine, azathioprine, bleomycin, bortezomib, carboplatin, capecitabine, cisplatin, chlorambucil, cyclophosphamide, cytarabine, daunorubicin, docetaxel, doxifluridine, doxorubicin, epirubicin, epothilone, etoposide, fluorouracil, gemcitabine, hydroxyurea, idarubicin, imatinib, irinotecan, mechlorethamine, mercaptopurine, methotrexate, mitoxantrone, oxaliplatin, paclitaxel, pemetrexed, teniposide, tioguanine, topotecan, valrubicin, vemurafenib, vinblastine, vincristine, and vindesine.
In another aspect, this document features a method for treating cancer. The method comprises, consists essentially of, or consists of administering an inhibitor of a FOXA1 polypeptide to a mammal identified as having an increased level of FOXA1 polypeptide expression in a sample obtained from the mammal, and administering a cancer treatment to the mammal, wherein the cancer treatment is an immunotherapy or a chemotherapy. The mammal can be a human. The sample can comprise cancer cells of the cancer. The cancer can be selected from the group consisting of a prostate cancer, a breast cancer, a bladder cancer, a lung cancer, a liver cancer, a cervical cancer, a bile duct cancer, a colon cancer, a rectal cancer, a pancreatic cancer, a uterine cancer, a head and neck cancer, a testicular cancer, a ovarian cancer, a thyroid cancer, a bone cancer, a skin cancer, an adrenal gland cancer, a kidney cancer, a lymphoma, a thymus cancer, a brain cancer, a leukemia, and a cancer of the eye. The inhibitor of the FOXA1 polypeptide can be an inhibitor of FOXA1 polypeptide activity. The inhibitor of the FOXA1 polypeptide activity can be SNS-032 (BMS-387032), Ro 31-8220, Aurora A Inhibitor I, WZ8040, Dasatinib, Lapatinib, Saracatinib (AZD0530), JNK-IN-8, BI 2536, Crenolanib (CP-868596), Herceptin, CYT387, BEZ235 (Dactolisib), PHA-793887, NVP-BSK805 2HCl, Cediranib (AZD2171), PF-00562271, Flavopiridol, AT7519, Apicidin, or Volasertib (BI 6727). The inhibitor of the FOXA1 polypeptide can be an inhibitor of FOXA1 polypeptide expression. The inhibitor of the FOXA1 polypeptide expression can be a siRNA molecule or an antisense oligo. The siRNA can comprise or consist of nucleic acid selected from the group consisting of GAGAGAAAAAAUCAACAGC (SEQ ID NO:1) and GCACUGCAAUACUCGCCUU (SEQ ID NO:2). Administering the inhibitor of the FOXA1 polypeptide can comprise administering a viral particle comprising the shRNA to the mammal. The antisense oligo can comprise or consist of nucleic acid selected from the group consisting of SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:42, SEQ ID NO:43, ATCAGCATGGCCATCCA (SEQ ID NO:45), ACCACCCGTTCTCCATCAA (SEQ ID NO:46), ACTCGCCTTACGGCTCTACG (SEQ ID NO:47), CCATTTTAATCATTGCCATCGTG (SEQ ID NO:48), GGTAGCGCCATAAGGAGAGT (SEQ ID NO:49), and TGGATGGCCATCGTGA (SEQ ID NO:50). The cancer treatment can comprise an immunotherapy selected from the group consisting of pembrolizumab, nivolumab, cemiplimab, spartalizumab, camrelizumab, sintilimab, tislelizumab, toripalimab, AMP-224, AMP-514, atezolizumab, avelumab, durvalumab, KN035, CK-301, AUNP12, CA-170, and BMS-986189. The cancer treatment can comprise a chemotherapy selected from the group consisting of actinomycin, all-trans retinoic acid, azacitidine, azathioprine, bleomycin, bortezomib, carboplatin, capecitabine, cisplatin, chlorambucil, cyclophosphamide, cytarabine, daunorubicin, docetaxel, doxifluridine, doxorubicin, epirubicin, epothilone, etoposide, fluorouracil, gemcitabine, hydroxyurea, idarubicin, imatinib, irinotecan, mechlorethamine, mercaptopurine, methotrexate, mitoxantrone, oxaliplatin, paclitaxel, pemetrexed, teniposide, tioguanine, topotecan, valrubicin, vemurafenib, vinblastine, vincristine, and vindesine.
Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Although methods and materials similar or equivalent to those described herein can be used to practice the invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting. The details of one or more embodiments of the invention are set forth in the accompanying drawings and the description below. Other features, objects, and advantages of the invention will be apparent from the description and drawings, and from the claims.
This document provides methods and materials involved in assessing and/or treating mammals (e.g., humans) having cancer. For example, the methods and materials provided herein can be used to determine whether or not a mammal having cancer is likely to be responsive to a particular cancer treatment (e.g., one or more cancer immunotherapies and/or one or more cancer chemotherapies). In some cases, the methods and materials provided herein also can include administering one or more cancer treatments to a mammal having cancer to treat the mammal (e.g., one or more cancer treatments that is/are selected based, at least in part, on whether or not the mammal is likely to be responsive to a particular cancer treatment).
Any appropriate mammal having a cancer can be assessed and/or treated as described herein. Examples of mammals having a cancer that can be assessed and/or treated as described herein include, without limitation, humans, non-human primates (e.g., monkeys), dogs, cats, horses, cows, pigs, sheep, mice, and rats. In some cases, a human having a cancer can be assessed and/or treated as described herein.
When assessing and/or treating a mammal (e.g., a human) having a cancer as described herein, the cancer can be any type of cancer. In some cases, a cancer can be a blood cancer. In some cases, a cancer can include one or more solid tumors. In some cases, a cancer can be a luminal cancer. In some cases, a cancer can be a primary cancer. In some cases, a cancer can be a metastatic cancer. Examples of cancers that can be assessed and/or treated as described herein include, without limitation, prostate cancers (e.g., prostate adenocarcinoma), breast cancers (e.g., breast invasive carcinomas and TNBCs), bladder cancers (e.g., bladder urothelial carcinomas), lung cancers (e.g., lung adenocarcinomas, lung squamous cell carcinomas, and mesotheliomas), liver cancers (e.g., liver hepatocellular carcinomas), cervical cancers (e.g., cervical squamous cell carcinomas and endocervical adenocarcinomas), bile duct cancers (e.g., cholangiocarcinomas), colon cancers (colon adenocarcinomas), rectal cancers (e.g., rectum adenocarcinomas), pancreatic cancers (e.g., pancreatic adenocarcinomas), uterine cancers (e.g., uterine corpus endometrial carcinomas and uterine carcinosarcomas), head and neck cancers (e.g., head and neck squamous cell carcinomas), testicular cancers (e.g., testicular germ cell tumors), ovarian cancers (e.g., ovarian serous cystadenocarcinoma), thyroid cancers (e.g., thyroid carcinomas), bone cancers (e.g., sarcomas), skin cancers (e.g., skin cutaneous melanoma), adrenal gland cancers (e.g., adrenocortical carcinomas, pheochromocytoma, and paraganglioma), kidney cancers (e.g., kidney renal clear cell carcinoma, kidney renal papillary cell carcinoma, and kidney chromophobes), lymphomas (e.g., lymphoid neoplasm diffuse large B-cell lymphoma), thymus cancers (e.g., thymoma), brain cancers (e.g., brain lower grade glioma and glioblastoma multiforme), leukemias (acute myeloid leukemia), and cancers of the eye (e.g., uveal melanoma).
In some cases, the methods described herein can include identifying a mammal (e.g., a human) as having a cancer. Any appropriate method can be used to identify a mammal as having a cancer. For example, imaging techniques and/or biopsy techniques can be used to identify mammals (e.g., humans) having cancer. A mammal having cancer can be assessed to determine whether or not the cancer is likely to respond to a particular cancer treatment (e.g., one or more cancer immunotherapies and/or one or more cancer chemotherapies). In some cases, a sample (e.g., a sample containing one or more cancer cells) obtained from a mammal having cancer can be assessed for the presence, absence, or level of FOXA1 polypeptide expression. As described herein, the level of FOXA1 polypeptide expression in a sample obtained from a mammal having a cancer can be used to determine whether or not the mammal is likely to respond to a particular cancer treatment. For example, the presence of an increased level of FOXA1 polypeptide expression in a sample obtained from a mammal having cancer can indicate that the mammal is not likely to be responsive to one or more cancer immunotherapies and/or one or more cancer chemotherapies. The term “increased level” as used herein with respect to FOXA1 polypeptide expression refers to any level that is higher than a reference level of FOXA1 polypeptide expression. The term “reference level” as used herein with respect to FOXA1 polypeptide expression refers to the level of FOXA1 polypeptide expression typically observed in a sample (e.g., a control sample) from one or more healthy mammals (e.g., mammals that do not have a cancer). Control samples can include, without limitation, samples from normal (e.g., healthy) mammals, primary cell lines derived from normal (e.g., healthy mammals), and non-tumorigenic cells lines. In some cases, an increased level of FOXA1 polypeptide expression can be a level that is at least >1 (e.g., at least 2, at least 5, at least 10, at least 15, at least 20, at least 25, at least 35, or at least 50) fold greater relative to a reference level of FOXA1 polypeptide expression. In some cases, when control samples have an undetectable level of FOXA1 polypeptide expression, an increased level can be any detectable level of FOXA1 polypeptide expression. It will be appreciated that levels from comparable samples are used when determining whether or not a particular level is an increased level.
Any appropriate sample from a mammal (e.g., a human) having cancer can be assessed as described herein (e.g., for the presence, absence, or level of FOXA1 polypeptide expression). In some cases, a sample can be a biological sample. In some cases, a sample can contain one or more cancer cells. In some cases, a sample can contain one or more biological molecules (e.g., nucleic acids such as DNA and RNA, polypeptides, carbohydrates, lipids, hormones, and/or metabolites). Examples of samples that can be assessed as described herein include, without limitation, tissue samples (e.g., tumor tissues such as those obtained by biopsy), fluid samples (e.g., whole blood, serum, plasma, urine, and saliva), cellular samples (e.g., buccal samples), and samples from surgery. A sample can be a fresh sample or a fixed sample (e.g., a formaldehyde-fixed sample or a formalin-fixed sample). In some cases, a sample can be a processed sample (e.g., an embedded sample such as a paraffin or OCT embedded sample). In some cases, one or more biological molecules can be isolated from a sample. For example, nucleic acid (e.g., DNA and RNA such as messenger RNA (mRNA)) can be isolated from a sample and can be assessed as described herein. For example, one or more polypeptides can be isolated from a sample and can be assessed as described herein.
Any appropriate method can be used to detect the presence, absence, or level of FOXA1 polypeptide expression within a sample (e.g., a sample containing one or more cancer cells) obtained from a mammal (e.g., a human). In some cases, the presence, absence, or level of FOXA1 polypeptide expression within a sample can be determined by detecting the presence, absence, or level of FOXA1 polypeptides in the sample. For example, immunoassays (e.g., immunohistochemistry (IHC) techniques and western blotting techniques), mass spectrometry techniques (e.g., proteomics-based mass spectrometry assays or targeted quantification-based mass spectrometry assays), enzyme-linked immunosorbent assays (ELISAs), radio-immunoassays, and immunofluorescent cytochemistry (IFC) can be used to determine the presence, absence, or level of FOXA1 polypeptides in a sample. When an immunoassay is used to determine the presence, absence, or level of FOXA1 polypeptides in a sample, the immunoassay can include using any appropriate anti-FOXA1 polypeptide antibody. Examples of representative anti-FOXA1 polypeptide antibodies that can be used in an immunoassay (e.g., IFC or ELISA) to determine the presence, absence, or level of FOXA1 polypeptides in a sample include, without limitation, Abcam # ab23738, Santa Cruz Biotechnology # sc-101058, Abcam # ab170933, Abcam # ab170933, Abcam # ab23738, Abcam # ab55178, Abcam # ab236011, Abcam # ab5089, Abcam # ab151522, Abcam # ab173287, Abcam # ab240935, Abcam # ab99892, Abcam # ab218885, Abcam # ab197235, Abcam # ab249749, Abcam # ab226380, Abcam # ab218201, Abcam # ab227785, and Abcam # ab196908. In some cases, the presence, absence, or level of FOXA1 polypeptide expression within a sample can be determined by detecting the presence, absence, or level of mRNA encoding a FOXA1 polypeptide in the sample. For example, polymerase chain reaction (PCR)-based techniques such as quantitative RT-PCR techniques, gene expression panel (e.g., next generation sequencing (NGS) such as RNA-seq), in situ hybridization, and microarray gene expression profiling can be used to determine the presence, absence, or level of mRNA encoding a FOXA1 polypeptide in the sample.
In some cases, a mammal having cancer and assessed as described herein (e.g., to determine whether or not the cancer is likely to respond to a particular cancer treatment based, at least in part, on the level of FOXA1 polypeptide expression), can be administered or instructed to self-administer any one or more (e.g., 1, 2, 3, 4, 5, 6, or more) cancer treatments, where the one or more cancer treatments are effective to treat the cancer within the mammal. For example, a mammal having cancer can be administered or instructed to self-administer any one or more cancer treatments that is/are selected based, at least in part, on whether or not the mammal is likely to be responsive to a particular cancer treatment (e.g., based, at least in part, on the level of FOXA1 polypeptide expression). In some cases, the level of FOXA1 polypeptide expression within a sample (e.g., a sample containing one or more cancer cells) obtained from a mammal can be used to determine whether or not the mammal is likely to be responsive to a particular cancer treatment. For example, the level of FOXA1 polypeptide expression in a sample can be used as a predictor of response to an immunotherapy (e.g., an anti-PD1 therapy and an anti-CTLA-4 therapy). For example, the presence or absence of an increased level of FOXA1 polypeptide expression in a sample can be used as a predictor of response to a chemotherapy (e.g., cisplatin).
When treating a mammal (e.g., a human) having cancer and identified as being likely to respond to one or more cancer immunotherapies and/or one or more cancer chemotherapies as described herein (e.g., based, at least in part, on the absence of an increased level of FOXA1 polypeptide expression), the mammal can be administered or instructed to self-administer any one or more (e.g., 1, 2, 3, 4, 5, 6, or more) cancer immunotherapies. For example, a mammal having cancer and identified as lacking an increased level of FOXA1 polypeptide expression in a sample (e.g., a sample obtained from the mammal) can be administered or instructed to self-administer any one or more cancer immunotherapies. A cancer immunotherapy can include administering any appropriate molecule(s) that can enhance an immune response against a cancer within a mammal. Examples of molecules that can enhance an immune response against a cancer within a mammal include, without limitation, polypeptides (e.g., antibodies such as monoclonal antibodies), T-cells (e.g., a chimeric antigen receptor (CAR) T-cells), immune checkpoint inhibitors (e.g., PD1 inhibitors, PD-L1 inhibitors, and CTLA-4 inhibitors), cancer vaccines, cytokines, immunomodulators, and adoptive transfer of tumor infiltrated lymphocytes (TILs). Examples of cancer immunotherapies that can be administered to a mammal having cancer and identified as being likely to be responsive to one or more cancer immunotherapies include, without limitation, pembrolizumab (formerly MK-3475 or lambrolizumab; e.g., KEYTRUDA), nivolumab (OPDIVO®), cemiplimab)(LIBTAY®), spartalizumab (PDR001), camrelizumab (SHR1210), sintilimab (IBI308), tislelizumab (BGB-A317), toripalimab (JS 001), AMP-224, AMP-514, atezolizumab (TECENTRIQ®), avelumab (BAVENCIO®), durvalumab (IMFINZI®), KN035, CK-301, AUNP12, CA-170, and BMS-986189.
When treating a mammal (e.g., a human) having cancer and identified as being likely to respond to one or more cancer immunotherapies and/or one or more cancer chemotherapies as described herein (e.g., based, at least in part, on the absence of an increased level of FOXA1 polypeptide expression), the mammal can be administered or instructed to self-administer any one or more (e.g., 1, 2, 3, 4, 5, 6, or more) cancer chemotherapies. For example, a mammal having cancer and identified as lacking an increased level of FOXA1 polypeptide expression in a sample (e.g., a sample obtained from the mammal) can be administered or instructed to self-administer any one or more cancer chemotherapies. A cancer chemotherapy can include administering any appropriate compound that is cytotoxic to one or more cancer cells within a mammal. Examples of compounds that are cytotoxic to one or more cancer cells within a mammal include, without limitation, alkylating agents, antimetabolites, anti-microtubule agents, topoisomerase inhibitors, and cytotoxic antibiotics. Examples of cancer chemotherapies that can be administered to a mammal having cancer and identified as being likely to be responsive to one or more cancer chemotherapies include, without limitation, actinomycin, all-trans retinoic acid, azacitidine, azathioprine, bleomycin, bortezomib, carboplatin, capecitabine, cisplatin, chlorambucil, cyclophosphamide, cytarabine, daunorubicin, docetaxel, doxifluridine, doxorubicin, epirubicin, epothilone, etoposide, fluorouracil, gemcitabine, hydroxyurea, idarubicin, imatinib, irinotecan, mechlorethamine, mercaptopurine, methotrexate, mitoxantrone, oxaliplatin, paclitaxel, pemetrexed, teniposide, tioguanine, topotecan, valrubicin, vemurafenib, vinblastine, vincristine, and vindesine.
When treating a mammal (e.g., a human) having cancer and identified as not being likely to respond to one or more cancer immunotherapies and/or one or more cancer chemotherapies as described herein (e.g., based, at least in part, on the presence of an increased level of FOXA1 polypeptide expression), the mammal can be administered or instructed to self-administer any one or more (e.g., 1, 2, 3, 4, 5, 6, or more) alternative cancer treatments (e.g., one or more cancer treatments that are not a cancer immunotherapy or a cancer chemotherapy). For example, a mammal having cancer and identified as having an increased level of FOXA1 polypeptide expression in a sample (e.g., a sample obtained from the mammal) can be administered or instructed to self-administer any one or more cancer treatments that are not a cancer immunotherapy or a cancer chemotherapy. An alternative cancer treatment can include any appropriate cancer treatment. Examples of alternative cancer treatments include, without limitation, surgery, radiation treatment, targeted therapies, hormone therapies, and stem cell transplants.
When treating a mammal (e.g., a human) having cancer and identified as not being likely to respond to one or more cancer immunotherapies and/or one or more cancer chemotherapies as described herein (e.g., based, at least in part, on the presence of an increased level of FOXA1 polypeptide expression), the mammal can be administered or instructed to self-administer any one or more (e.g., 1, 2, 3, 4, 5, 6, or more) inhibitors of a FOXA1 polypeptide, and, optionally, can be administered or instructed to self-administer any one or more (e.g., 1, 2, 3, 4, 5, 6, or more) cancer immunotherapies and/or one or more (e.g., 1, 2, 3, 4, 5, 6, or more) cancer chemotherapies. For example, a mammal having cancer and identified as having an increased level of FOXA1 polypeptide expression in a sample (e.g., a sample obtained from the mammal) can be administered or instructed to self-administer any one or more inhibitors of a FOXA1 polypeptide, and, optionally, can be administered or instructed to self-administer any one or more cancer immunotherapies and/or one or more cancer chemotherapies. In some cases, one or more inhibitors of a FOXA1 polypeptide can be administered to a mammal having cancer and identified as not being likely to respond to one or more cancer immunotherapies and/or one or more cancer chemotherapies to sensitize the cancer cells to one or more cancer immunotherapies, and, optionally one or more cancer immunotherapies can be administered to the mammal. In some cases, one or more inhibitors of a FOXA1 polypeptide can be administered to a mammal having cancer and identified as not being likely to respond to one or more cancer immunotherapies and/or one or more cancer chemotherapies to sensitize the cancer cells to one or more cancer chemotherapies, and, optionally one or more cancer chemotherapies can be administered to the mammal.
In some cases, one or more inhibitors of a FOXA1 polypeptide described herein can be administered to a mammal (e.g., a human) to alter (e.g., increase or decrease) the level of one or more interferons (IFNs) in one or more cancer cells within the mammal. For example, one or more inhibitors of a FOXA1 polypeptide provided herein can be administered to a mammal in need thereof (e.g., a human having cancer) as described herein to alter the amount of one or more IFNs in one or more cancer cells within the mammal by, for example, 10, 20, 30, 40, 50, 60, 70, 80, 90, 95, or more percent. An IFN can be any appropriate IFN (e.g., type I IFN, type II IFN, or type III IFN). An example of an IFN whose level can be increased in one or more cancer cells following administration of one or more inhibitors of a FOXA1 polypeptide provided herein can include, without limitation, an IFN-y polypeptide. An example of an IFN whose level can be decreased in one or more cancer cells following administration of one or more inhibitors of a FOXA1 polypeptide provided herein can include, without limitation, an IFN-a polypeptide.
In some cases, one or more inhibitors of a FOXA1 polypeptide described herein can be administered to a mammal (e.g., a human) to increase the amount of one or more lymphocytes (e.g., tumor-infiltrating lymphocytes) in the tumor microenvironment of a tumor within the mammal. For example, one or more inhibitors of a FOXA1 polypeptide provided herein can be administered to a mammal in need thereof (e.g., a human having cancer) as described herein to recruit one or more lymphocytes to the tumor microenvironment (e.g., to increase the amount of one or more lymphocytes in the tumor microenvironment) of a tumor within the mammal by, for example, 10, 20, 30, 40, 50, 60, 70, 80, 90, 95, or more percent. Examples of lymphocytes that can be increased in a tumor microenvironment following administration of one or more inhibitors of a FOXA1 polypeptide provided herein can include, without limitation, T cells such as CD4+T cells, CD8+T cells (e.g., CD8+ T effector cells (CD8+ Teff cells)), CTLs (e.g., Tcs), and NK cells.
An inhibitor of a FOXA1 polypeptide can be any appropriate inhibitor of a FOXA1 polypeptide. An inhibitor of a FOXA1 polypeptide can be an inhibitor of FOXA1 polypeptide activity or an inhibitor of FOXA1 polypeptide expression. Examples of compounds that can reduce FOXA1 polypeptide activity include, without limitation, small molecules (e.g., a pharmaceutically acceptable salt of a small molecule) such as SNS-032 (BMS-387032; CAS No.: 345627-80-7), Ro 31-8220 (CAS No.: 138489-18-6), Aurora A Inhibitor I (CAS No.: 1158838-45-9), WZ8040 (CAS No.: 1214265-57-2), Dasatinib, Lapatinib, Saracatinib (AZD0530), JNK-IN-8 (CAS No.: 1410880-22-6), BI 2536 (CAS No.: 755038-02-9), Crenolanib (CP-868596), Herceptin, Momelotinib (CYT387), Dactolisib (BEZ235), PHA-793887 (CAS No.: 718630-59-2), NVP-BSK805 2HC1 (CAS No.: 1092499-93-8), Cediranib (AZD2171), PF-00562271 (CAS No.: 898044-15-0 (free base); CAS No.: 1279034-84-2 (HCl)), Alvocidib (Flavopiridol), AT7519 (CAS No.: 844442-38-2), Apicidin (CAS No.: 183506-66-3), or Volasertib (BI 6727). See, e.g., Wang et al., Int. J. Mol. Sci., 19:4123 (2018)). Examples of compounds that can reduce FOXA1 polypeptide expression and be used as described herein include, without limitation, nucleic acid molecules designed to induce RNA interference (RNAi) against FOXA1 polypeptide expression (e.g., a small interfering RNA (siRNA) molecule or a short hairpin RNA (shRNA) molecule), antisense molecules against FOXA1 polypeptide expression such as antisense oligoes (ASOs) against FOXA1 polypeptide expression, and miRNAs against FOXA1 polypeptide expression. In some cases, a nucleic acid molecule designed to induce RNAi against FOXA1 polypeptide expression or an antisense molecule against FOXA1 polypeptide expression can be a locked nucleic acid (LNA). For example, a nucleic acid molecule designed to induce RNAi against FOXA1 polypeptide expression or an antisense molecule against FOXA1 polypeptide expression can include one or more ribose moieties that are modified with an extra methylene bridge connecting the 2′ oxygen and 4′ carbon. In some cases, a nucleic acid molecule designed to induce RNAi against FOXA1 polypeptide expression or an antisense molecule against FOXA1 polypeptide expression can include a phosphorothioate (PS) backbone. For example, a nucleic acid molecule designed to induce RNAi against FOXA1 polypeptide expression or an antisense molecule against FOXA1 polypeptide expression can include at least one (e.g., one, two, three, four, five, six, seven, eight, nine, ten, eleven, or more) inter-nucleotide phosphorothioate bond. Examples of nucleic acid molecules designed to induce RNAi against FOXA1 polypeptide expression that can be used as described herein include, without limitation, nucleic acid comprising or consisting of the sequence GAGAGAAAAAAUCAACAGC (SEQ ID NO:1) and nucleic acid comprising or consisting of the sequence GCACUGCAAUACUCGCCUU (SEQ ID NO:2). Additional nucleic acid molecules designed to induce RNAi against FOXA1 polypeptide expression can be designed based on any appropriate nucleic acid encoding a FOXA1 polypeptide sequence. Examples of nucleic acids encoding a FOXA1 polypeptide sequence include, without limitation, those set forth in National Center for Biotechnology Information (NCBI) accession no. NM_004496.5, accession no. XM_017021246.1, accession no. NM_008259.4, accession no. XM_017314962.2, accession no. XM_006515483.1, accession no. XM_006515479.4, accession no. XM_006515481.2, and accession no. XM_0302465621 Examples of ASOs that can be used to reduce FOXA1 polypeptide expression as described herein include, without limitation, those set forth in Table 5.
Any appropriate method can be used to administer one or more inhibitors of a FOXA1 polypeptide to a mammal (e.g., a mammal having cancer). In some cases, an inhibitor of a FOXA1 polypeptide can be administered directly to a mammal. In some cases, one or more vectors (e.g., one or more expression vectors or one or more viral vectors such a retroviral vector, a lentiviral vector, a measles viral vector, or an oncolytic viral vector such as herpes simplex virus viral vector) containing (e.g., engineered to contain) nucleic acid encoding an inhibitor of a FOXA1 polypeptide can be administered to a mammal. In some cases, one or more viral particles containing (e.g., engineered to contain) nucleic acid encoding an inhibitor of a FOXA1 polypeptide can be administered to a mammal.
When nucleic acid encoding an inhibitor of a FOXA1 polypeptide is contained in a viral particle, the viral particle can be any appropriate viral particle. A viral particle described herein (e.g., a viral particle containing nucleic acid encoding an inhibitor of a FOXA1 polypeptide) can include viral components (e.g., genetic material (e.g., a viral genome), a capsid, and/or an envelope) from any appropriate virus. A virus can be an infectious virus or an oncolytic virus. A virus can be a chimeric virus. A virus can be a recombinant virus. In some cases, a viral particle can include viral components from the same virus. In some cases, a viral particle can be a recombinant viral particle. For example, a recombinant viral particle can include viral components from different viruses (e.g., two or more different viruses). Examples of viruses from which viral components can be obtained include, without limitation, retroviruses, (e.g., lentiviruses), measles viruses, and oncolytic viruses such as herpes simplex viruses.
In some cases, a viral particle described herein (e.g., a viral particle containing nucleic acid encoding an inhibitor of a FOXA1 polypeptide) can be used to target one or more cancer cells within a mammal having cancer. For example, a viral particle described herein can be used to target cancer cells presenting an antigen (e.g., a tumor antigen) associated with a particular cancer. Examples of antigens associated with a particular cancer include, without limitation, CD19 (associated with B cell lymphomas, acute lymphoblastic leukemia (ALL), and chronic lymphocytic leukemia (CLL)), AFP (associated with germ cell tumors and/or hepatocellular carcinoma), CEA (associated with bowel cancer, lung cancer, and/or breast cancer), CA-125 (associated with ovarian cancer), MUC-1 (associated with breast cancer), ETA (associated with breast cancer), and MAGE (associated with malignant melanoma).
In some cases, when treating a mammal (e.g., a human) having cancer as described herein, the treatment can be effective to reduce the number of cancer cells present within a mammal. For example, the size (e.g., volume) of one or more tumors present within a mammal can be reduced using the materials and methods described herein. In some cases, the materials and methods described herein can be used to reduce the size of one or more tumors present within a mammal having cancer by, for example, 10, 20, 30, 40, 50, 60, 70, 80, 90, 95, or more percent. In some cases, the size (e.g., volume) of one or more tumors present within a mammal does not increase.
In some cases, when treating a mammal (e.g., a human) having cancer as described herein, the treatment can be effective to improve survival of the mammal. For example, disease-free survival (e.g., relapse-free survival) can be improved using the materials and methods described herein. For example, progression-free survival can be improved using the materials and methods described herein. In some cases, the materials and methods described herein can be used to improve the survival of a mammal having cancer by, for example, 10, 20, 30, 40, 50, 60, 70, 80, 90, 95, or more percent.
The invention will be further described in the following examples, which do not limit the scope of the invention described in the claims.
Infiltration of lymphocytes in tumors is an essential step in immune attack of cancer cells. Indeed, the abundance of tumor-infiltrating lymphocytes (TILs) is a valuable prognostic factor for both chemotherapy and immune checkpoint inhibitor (ICI) therapy (Adams et al., J Clin Oncol 32:2959-2966 (2014); Loi et al., Ann Oncol 25:1544-1550 (2014); and Denkert et al., J Clin Oncol 28:105-113 (2010)). Cytotoxic lymphocytes (CTL), mainly cytotoxic T (Tc) and natural killer (NK) cells utilize granule exocytosis as a common mechanism to destroy cancer cells by expressing and releasing the pore forming proteins including perforin 1 (PRF 1), granule-associated enzymes (granzymes (GZMs)) and natural killer cell granule protein 7 (NKG7) (Martinez-Lostao, Clinical Cancer Research 21:5047-5056 (2015)). Prostate and breast cancer are generally immunologically “cold.”
Results
To identity the molecules and signaling pathways that contribute to immune evasion by blocking tumor infiltration of CTLs in prostate and breast cancers, meta-analysis of The Cancer Genome Atlas (TCGA) RNA-seq datasets was performed to search for genes that are negatively correlated with expression of the granule exocytosis genes PRF 1, GZMA and NKG7. It was demonstrated that among the top 10 genes negatively correlated with expression of PRF 1, GZMA and NKG7, FOXA1 is the only one gene commonly expressed in prostate and breast cancer (
Presentation of cancer-specific neoantigens is a factor affecting Tc cell activity and ICI therapy efficacy. This step is governed by class I human leukocyte antigen (HLA) or major histocompatibility complex (MHC) that presents intra-cellular peptides on the cell surface for recognition by T cell receptors. FOXA1 level was unanimously inversely associated with the expression of antigen presentation machinery (APM) genes (
Activation of interferon (IFN) (including type I, II and III IFN) signaling in tumor is essential in CTL-mediated cancer cell killing. By utilizing the interferon stimulation response element-based luciferase reporter (ISRE-luc) for type I and III IFN and IFN-γ-activated sequence-based luciferase reporter (GAS-luc) for type II IFN as readouts, it was examined whether FOXA1 exerts any inhibitory effect on IFN signaling. It was found that ectopic expression of FOXA1 in 293T cells, which express little or no endogenous FOXA1, strongly inhibited type I/III IFN reporter gene activity in a dose-dependent manner and modestly suppressed type II IFN reporter activity at a high dose (
To explore the molecular mechanism underlying FOXA1 inhibition of IFN signaling, the effect of FOXA1 on phosphorylation of STAT1 and STAT2, two major effectors of type I/III and II IFNs, was examined. It was found that FOXA1 expression resulted in little or no changes in STAT1 and STAT2 phosphorylation in 293T cells (
It was next sought to determine which region in STAT and FOXA1 mediates their interaction. Mutagenesis and glutathione S-transferase (GST) pull down assays showed that a forkhead domain (FKHD, a.a. 168-269)-containing region (FKCR, a.a. 141-294) in FOXA1 binds to the STAT2 DNA binding domain (a.a. 312-486) (
Next, it was sought to determine whether DNA binding ability of FOXA1 is essential to inhibit IFN signaling. The α-helix 3 (aH3, a.a. 212-225), especially residues N216, H220 and N225 in the FKHD domain of FOXA1 have direct contact with DNA. Expression vectors for FOXA1-N216A/H220A/N225A (FOXA1-aH3m) and FOXA1A212-225 (FOXA1ΔαH3), two DNA binding-deficient mutants in FOXA1 α-helix 3, were generated. The inability of these mutants to bind to the cognate FOXA1-targeting DNA sequence was confirmed using different methods (
The role of cancer-associated FOXA1 mutants in regulating IFN activity was investigated. FOXA1 prostate cancer-derived ‘hotspot’ mutants, including FOXA1-H247Q, FOXA1-R261G, and FOXA1-F266L, bound to and inhibited IFN reporter gene activities to an extent similar to the WT counterpart (
To directly explore the role of FOXA1 in inhibiting cancer immune response, stable murine prostate cancer TRAMP-C2 cell lines overexpressing FOXA1-WT, cancer-associated mutant FOXA1-R261G and DNA binding-deficient mutant FOXA1ΔαH3, were established. Similar to the results in human prostate cancer cells (
To validate the findings from the TRAMP-C2 mouse prostate cancer model, the correlation between Foxa1 expression and anti-PD1 and anti-CTLA-4 therapy response was further examined in a cohort of 204 murine triple-negative breast cancers (TNBCs). RNA-seq data analysis showed that increased Foxal expression significantly associated with tumor resistance to ICI therapy in mice (
The findings in the present study demonstrate that FOXA1 plays an important role in promoting cancer progression by suppressing IFN signaling, APM gene expression, and cancer immunity in a manner independent of its DNA binding function (
FOXA1 is known as a pioneer factor for steroid hormone receptors such as androgen receptor (AR) and estrogen receptor (ER) and its expression is often associated with luminal phenotype of prostate and breast cancer. This study in breast cancers from patients shows that high levels expression of FOXA1 associate not only with lower rates of tumor response to neoadjuvant chemotherapy, but also with the lower numbers of TILs. Therefore, these findings provide a mechanistic explanation for the clinical observation that basal-like TNBC (FOXA1 low or none) have much higher rates of pathologic complete response (pCR) than luminal androgen-receptor (LAR)-positive TNBC and luminal types of breast cancer (FOXA1 high). This study identifies a new vulnerability for aggressive breast cancer (e.g. TNBC) and prostate cancer (e.g. NEPC), majority of which express little or none FOXA1. These findings also suggest that targeting FOXA1 could be an option to improve the efficacy of therapeutics such as chemotherapy on FOXA1-high tumor types such as luminal types of prostate and breast cancer.
In support of the findings in cancer cells in culture and in mice, it was demonstrated that increased FOXA1 expression significantly associates with ICI-based immunotherapy resistance in both murine TNBC tumors and bladder cancers in patients. Thus, these results suggest that FOXA1 expression level can be a strong biomarker to predict tumor response to immunotherapy. Additionally, exploration of a druggable approach to deplete FOXA1 level could be a viable strategy to convert the FOXA1-positve ‘immune-cold’ tumors to ‘immune-hot’ tumors in clinic.
To identify which factors contribute to suppression of infiltration of cytotoxic lymphocytes in immunologically “cold” tumors, RNA-seq expression data from prostate cancer (TCGA Provisional, n =490) and breast cancer (TCGA Provisional, n =960) were used to generate a list of genes whose expression negatively correlated with level of cytotoxic lymphocyte makers (PRF1, GZMs and NKG7) by performing Spearman's rho rank analysis (Table 1 (
To explore signaling pathways negatively regulated by FOXA1, using the cBioPortal platform (www.cbioportal.org/) and by gene set enrichment analysis online software (software.broadinstitute.org/gsea/msigdb/annotate.jsp), Gene Ontology Biological Process (GO-BP) analysis was performed by examining negative correlation of FOXA1 expression with expression of signaling pathway signature genes in prostate cancer (TCGA Provisional, n=490), metastatic prostate cancer (SU2C/PCF Dream Team, n =270), breast cancer (TCGA Provisional (n=960), and breast cancer from METABRIC database (n=1904).
To investigate the expression correlation between FOXAJ level and expression of CD8+ T effector cell (CD8+ Teff) signature genes, antigen presentation machinery (APM) genes and type I IFN response signature genes, RNA-seq data of these genes were ranked by increased FOXA1 transcript levels in prostate cancer (n=490, TCGA Provisional), metastatic prostate cancer (n=270, SU2C/PCF Dream Team, source of file: data mRNA seq fpkmpolya.txt), bone metastatic prostate cancer (n=54, dbGaP: phs001141.v1.p1), breast cancer from TCGA Provisional (n=960), breast cancer from METABRIC database (n=1904), and bladder cancer from TCGA (n=404) and heatmaps were generated accordingly. The expression level of CD8+ Teff signature genes, APM genes and type I IFN response signature genes were scored as described elsewhere (see, e.g., He et al., Nucleic Acids Res 46:1895-1911 (2018)) and the Pearson's r-values and P-values the correlation with FOXA1 expression were calculated respectively. The CD8+ Teff signature genes (BCL11B, CD3D, CD3E, CD8A, CXCR3, GZMA, GZMB, GZMK, IL7R, KLRG1, NKG7, PRF1, TBX21), APM genes (B2M, HLA-A, HLA-B HLA-C, HLA-DPA1, HLA-DPB1, HLA-DQB1, HLA-DRA, HLA-DRB1, HLA-DRB5, HLA-DRB6, HLA-E, HLA-F, HLA-G, HLA-H, HLA-J, PSMB8, PSMB9, TAP1, TAP2, TAPBP) and type I IFN response signature genes (ACACB, BIRC3, BST2, CXCL1, CXCL2, DDX60, DHX58, GBP1, HERC5, IFI16, IFI27, IFI44, IFI44L, IFIH1, IFIT3, IFITM1, IRF7, ISG15, ISG20 ,LGALS9, MX1, OAS1, OAS2, PARP12, RASGRP3 , SAMD9 , SERPING1, SLC15A3, SP110, STAT1, XAF1) were included as much as possible unless the expression data is not available from the dataset. The gene expression data from TCGA were all downloaded from GDC database using R package “TCGAbiolinks,” which is the normalized RSEM expression.
Cell Lines and Cell Culture
LNCaP, VCaP, PC3, DU145, 22RV1, C4-2, C4-2B, LAPC4, BPH1, RWPE-1, TRAMP-C2, MCF7, RT4 and 293T cell lines were purchased from ATCC. LNCaP-RF cell line was derived from LNCaP and cultured in charcoal-stripped medium. LNCaP, VCaP, PC3, DU145, 22RV1, C4-2, C4-2B and LAPC4 cells were maintained in RPMI 1640 containing 10% fetal bovine serum (FBS) and 1% antibiotic/antimycotic (Thermo Fisher Scientific). BPH1, TRAMP-C2, MCF7and 293T cells were maintained in DMEM medium with 10% FBS and 1% antibiotic/antimycotic (Thermo Fisher Scientific). RT4 cells were maintained in McCoy's 5A medium with 10% FBS and 1% antibiotic/antimycotic (Thermo Fisher Scientific). RWPE-1 cells were maintained in keratinocyte serum-free medium (# 17005042, Thermo Fisher Scientific) and 1% antibiotic/antimycotic (Thermo Fisher Scientific). All cells were incubated in an environment of 5% CO2 at 37° C.
To analyze the interferon-stimulated response activity, 293T cells were transfected, using lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions, with the following plasmids: interferon-stimulated response element luciferase reporter (ISRE-luc) containing type I and III IFN response elements, IFN-γ-activated sequence luciferase reporter (GAS-luc) containing type II IFN response elements, Renilla-luc (phRL-TK) as internal control reporter, FOXA1-WT or FOXA1 mutants. At 24 hours after transfection, the transfected cells were treated with 50 ng/L or 100 ng/L IFNα (Sigma-Aldrich, # 14276) or IFNγ (Sigma-Aldrich, # SRP3058) for 5 hours. Renilla and firefly activities were measured with luminometry using the Dual-Luciferase Reporter Assay System (Promega) and the ratio was calculated. Results were expressed as the ratio of firefly to Renilla luciferase activity.
LNCaP, VCaP, PC3, DU145, 22RV1, LNCaP-RF, C4-2, C4-2B, LAPC4, BPH1, RWPE-1 and 293T cell lines were treated with or without 10 μg/L IFNα (SigmaAldrich, # 14276) for 24 hours and RNA was isolated using Trizol Reagent (Thermo Fisher Scientific, # 15596018). RNA was eluted in RNase-Free H2O and reverse-transcribed to cDNA following the kit protocol (Thermo Fisher Scientific, # FERK1672). Gene expression was determined by real-time quantitative PCR (qPCR) using Power SYBR Green (Thermo Fisher Scientific, # 4368708). Primer sequences used for RT-qPCR were as listed in Table 2.
Wild-type V5-tagged FOXA1 lentiviral plasmid was purchased from Addgene (# 70090) and cloned into the SFB-tagged pcDNA3.1 or Flag-tagged pcDNA3.1 or pTSIN lentiviral vector using the Phusion High-Fidelity DNA Polymerase (New England Biolabs, # M0530L). FOXA1 hotspot mutations (H247Q, R261G and F266L) and FOXA1 truncation mutations were engineered from the wild-type FOXA1 vector using the KOD-Plus-Mutagenesis Kit (TOYOBO, # KOD-201) according to the manufacturer's instructions. For the FOXA1 luciferase reporter (FOXA1-luc) construct, the DNA fragment 5′-tcgaTGTTTACTTAcagtaTGTTTACTTTatccgTGTTTACATAgtctaTATTTACTTAccata TGTTTGCTTAgtcaTGTTTACTCA-3′ (SEQ ID NO:34) was inserted into pGL4.28 luc2CP/minP/hygro (Pomega). All plasmids were confirmed using Sanger sequencing. Mutant plasmids were further transfected in 293T cells to confirm expression of the mutant proteins.
293T cells were co-transfected with pTSIN-Vector or pTSIN-FOXA1 WT or mutants lentiviral plasmids along with packing and envelop plasmids by Lipofectamine 2000 according to the manufacturer's instructions. At two days post-transfection, virus particles containing shRNAs were used to infect cells according to the protocol provided by Sigma-Aldrich. The indicated cells were transduced by culturing with a 1:1 mixture of fresh medium and virus supernatant with Polybrene (4 μg/ml final concentration) for 24 hours. For knockdown of FOXA1, cells were transfected using Lipofectamine 2000 with 50 nM FOXA1 siRNA 5′-GAGAGAAAAAAUCAACAGC-3′ (SEQ ID NO:1; siFOXA1# 1, at 3′ UTR region) or 5′-GCACUGCAAUACUCGCCUU-3′ (SEQ ID NO:2; siFOXA1#2, at CDS region)) or non-targeting control siRNA (siCon) 5′-UAGCGACUAAACACAUCAA-3′ (SEQ ID NO:3). Knockdown or transfection efficiency was determined using Western blotting analysis.
Cells were lysed and boiled for 10 minutes in sample buffer (2% SDS, 10% glycerol, 10% β-mercaptoethanol, bromophenol blue and Tris-HCl, pH 6.8). Equal amounts of protein (50-100 μg) from cell lysate were denatured in sample buffer (Thermo Fisher Scientific), subjected to SDS-polyacrylamide gel electrophoresis, and transferred to nitrocellulose membranes (Bio-Rad). The membranes were immunoblotted with specific primary antibodies, horseradish peroxidase-conjugated secondary antibodies, and visualized by SuperSignal West Pico Stable Peroxide Solution (# 34577, Thermo Fisher Scientific). The primary antibodies are AR (dilution 1:1000; #sc-816, Santa Cruz Biotechnology), FOXA1 (dilution 1:2000; # ab23738, Abcam), FOXA1 (dilution 1:1000, # sc-101058, Santa Cruz Biotechnology), STAT1 (dilution 1:1000; # 14994S, Cell Signaling Technology), STAT2 (dilution 1:1000; # 72604S, Cell Signaling Technology), Phospho-STAT1 (Tyr701) (dilution 1:1000; # 9167S, Cell Signaling Technology), Phospho-STAT2 (Tyr690) (dilution 1:1000; # 88410S, Cell Signaling Technology), IRF9 (dilution 1:1000; # 76684S, Cell Signaling Technology), ISG15 (dilution 1:500; # sc-166755, Santa Cruz Biotechnology), PARP1 (dilution 1:1000; # 9532S, Santa Cruz Biotechnology), HSP70 (dilution 1:1000; #4873S, Santa Cruz Biotechnology), MHC class I (MHC-I) (dilution 1:500; #sc-55582, Santa Cruz Biotechnology), Flag (dilution 1:1000; # F1804, Sigma-Aldrich) and V5 (dilution 1:1000; # A190-120A, Bethyl Laboratories), HA (dilution 1:1000; # MMS-101R, Covance), and ERK2 (dilution 1:2000; # sc-1647, Santa Cruz Biotechnology).
For extraction of nuclear and cytoplasmic proteins from cells, NE-PER Nuclear and Cytoplasmic Extraction Kit (# 78835, Thermo Fisher Scientific) was used according to the manufacturer's instructions. IP buffer (50 mM Tris-HCl pH7.5, 150 mM NaCl, 1% NP40, 0.5% Sodium Deoxycholate) was used to extract whole cell lysate. P rotein A/G agarose (# 20421, Thermo Fisher Scientific) was used for immunoprecipitation of FOXA1 (# ab23738, Abcam) and Flag-tag (dilution 1:1000; # F1804, Sigma-Aldrich). Monoclonal anti-HA agarose (# A2095, Sigma-Aldrich) was used for HA-tag Co-IP. For glutathione-S-transferase (GST) pulldown assay, GST-tagged STAT2 fragment expressed at E. coli was purified by Glutathione Sepharose 4B beads (# 84-239, Genesee Scientific) and incubated with lysate from 293T cells expressing interested proteins, and GST pulldown assays were performed. For protein co-IP, samples eluted in IP butter were incubated with agarose beads and antibodies overnight at 4° C. and washed with 6 times with IP buffer in the following day. Samples were boiled for 10 minutes in 50 μl sample buffer (2% SDS, 10% glycerol, 10% β-mercaptoethanol, bromophenol blue and Tris-HCl, pH 6.8) and subjected to Western blotting.
ChIP experiments were performed as described elsewhere (see, e.g., He et al., Nucleic acids research 46:1895-1911 (2018)). In brief, chromatin was cross-linked for 15 minutes at room temperature with 11% formaldehyde/PBS solution added to cell culture medium. Cross-linked chromatin was sonicated, diluted and immunoprecipitated with Protein A/G agarose (# 20421, Thermo Fisher Scientific) prebound with antibodies at 4° C. overnight. Antibodies for ChIP were STAT2 (2 μg/sample; # 72604S, Cell Signaling Technology), FOXA1 (2 μg/sample; # ab23738, Abcam). Precipitated protein-DNA complexes were eluted and cross-linking was reversed at 65° C. for 12 hours. ChIP-seq libraries were prepared. High-throughput sequencing (51 nt, pair-end) was performed using the Illumina HiSeg™ 4000 platforms. All short reads were mapped to the human reference genome (GRCh38/hg38) using bowtie2 (version 2.1.0) with default configurations. Reads mapped to multiple positions greater than 2 were discarded, and the remained reads were used for peak calling using MACS2 (version 2.0.10) with a P value cutoff of 1e-5 (macs2 call peak -bdg -SPTMR -f BAM -p 1e-5). Peaks located in the blacklists such as centromere regions were removed (sites.google.com/site/anshulkundaje/projects/blacklists). ChIP-seq tag intensity tracks (bedGraph files) were generated by MACS2, and converted into bigWig files using UCSC “wigToBigWig” tool. H eat maps were drawn by deepTools 2.0.
For FOXA1 transcriptional activity analysis, 293T cells were transfected with the SFB-tagged pcDNA3.1 vector (control) or different mutants of FOXA1, KLK3 enhancer luciferase reporter and Renilla-luc (phRL-TK, purchased from Promega, as internal control reporter). At 48 hours after transfection, the renilla and firefly luciferase activities were measured with luminometry using the Dual-Luciferase Reporter Assay System (Promega) and the ratio was calculated. Results were expressed as the ratio of firefly to Renilla luciferase activity. For EMSA, 60 base pairs of forkhead response element in the KLK3 enhancer (centered at the FOXA1 consensus binding motif 5′-GTAAACAA-3′: 5′-ACATATTGTATCGATTGTCCTTGACAGTAAACAAATCTGTTGTAAGAGACATT ATCTTTA-3′; SEQ ID NO:35) and ISRE probe (5′-CTCCCCTGAGTTTCACTTCTTCTCCCAACTTG-3′; SEQ ID NO:36) were synthesized from Integrated Device Technology (IDT) and labelled with biotin using Biotin 3′-End DNA labelling kit (# 89818, Thermo Fisher Scientific) and annealed to generate a labelled double stranded DNA duplex. Binding reactions were carried out in 20 μl volumes containing 2 μl of the nuclear lysates, 50 ng/μl poly(dI.dC), 1.25% glycerol, 0.025% Nonidet P-40 and 5 mM MgCl2. Biotin labelled KLK3 enhancer probe (10 fmol) was added and incubated for 1 hour at room temperature, size-separated on a 6% DNA retardation gel at 100 V for 1 hour in 0.5×TBE buffer, and transferred on the Biodyne Nylon membrane (# 77015, Thermo Fisher Scientific) and crosslinked to the membrane using the UV light at 120 mJ/cm2 for 2 minutes. Biotin-labelled free and protein-bound DNA was detected using horseradish peroxidase-conjugated and developed using Chemiluminescent Nucleic Acid Detection Module Kit (# 89880, Thermo Fisher Scientific) according to the manufacturer's protocol.
TRAMP-C2-Vector or TRAMP-C2-FOXA1ΔαH3 cells (3×106) were injected subcutaneously into the right flank of 8-week old male C57BL/6 on day 0. Tumors were measured twice per week with calipers and the volume calculated (length×width×width×0.5). Poly I:C (2.5 mg/kg, 100 pl) purchased from Sigma-Aldrich (# P1530) or vehicle (PBS, 100 pl) was administered by intratumoral injection twice per week (five doses in total) and tumors were measured twice per week until the tumor volume reached the maximum allowed size (1,000 cm3). For CyTOF and Immunofluorescence experiments, mice were euthanized at 48 hours post the last administration.
Single tumor cells were isolated using the Mouse Tumor Dissociation Kit (Miltenyi Biotec, # 130-096-730) following standard protocol. CyTOF staining panels are detailed in Table 3.
Digested tumors were mashed through 40 μm filters into RPMI-1640 and were centrifuged at 300 g for 5 minutes at 4° C. All single cells were depleted of erythrocytes by hypotonic lysis for 1 minute at room temperature. Cells were washed once with PBS and incubated with 0.5 mM cisplatin by diluting 5 mM Cell-IDTM Cisplatin (Fluidigm, # 201064) at for 5 minutes. 5 x 106 or fewer cells per tumor were blocked with FcR Blocking Reagent (Miltenyl Biotec, # 130-059-901) for 10 minutes and incubated with surface antibody mix for 45 minutes at room temperature. Cells were washed with MaxPar Cell Staining Buffer (Fluidigm, # 201068). For intracellular staining, cells were incubated with FOXP3 Fixation/Permeabilization 1× working solution by diluting 4×Fixation/Permeabilization Concentrate (eBioscience, # 00-5123-43) with Fixation/Permeabilization Diluent (eBioscience, # 00-5223-56) at 1:4 dilution for 45 minutes at room temperature (keep in dark). Cells were washed twice with 1× working solution of Permeabilization Buffer (eBioscience, # 00-8333-56). Centrifuge at 800×g for 5 minutes and supernatant was carefully aspirated and re-suspend in 500 μL CyPBS diluted from 10×PBS (Rockland Immunochemicals, # MB-008) in Maxpar water (Fluidigm, # 201069). Samples were fixed with 500 μl 2×fixation solution 4% Paraformaldehyde diluted from 16% Paraformaldehyde Aqueous Solution (Electron Microscopy Sciences, # 915710S) in CyPBS and incubated at 4° C. overnight. Cells were washed with 1 mL Maxpar Cell Staining Buffer (Fluidigm; # 201068) and spin down at 800×g for 5 minutes at room temperature and re-suspended in 1 mL 12.5 nM intercalation solution by diluting 125 μM intercalator stock (Cell-IDTM lntercalator-Ir- 125 μM, Fluidigm, Part No. 201192A) 1:10,000 in Maxpar Fix and Perm Buffer-100 mL (Fluidigm; # 201067). Samples were washed with 1 mL CyPBS and the EQ beads (Fluidigm; # 201078) were added and cells were counted on Countess II and re-suspended to approximately 5×105 cells/mL. Samples were filtered through 35 μm blue cap FACS tube (Falcon, # 352235) and were analyzed with a CyTOF instrument (Fluidigm). Data were analyzed with PhenoGraph by following the instruction. The 1.0.153 version of R studio was downloaded from the official R website (r-project.org/). Data were analyzed with PhenoGraph by following the program instructions. R studio (Version 1.0.136) was downloaded from the official R website (www.r-project.org/). The cytofkit package (Release 3.6) was downloaded from Bioconductor (https://www.bioconductor.org/packages/release/bioc/html/cytofkit.html) and opened in the R studio. Manually gated singlet (19Ir+193Ir+), viable (195Pt +) events were imported into cytofkit, subjected to PhenoGraph analysis, and clustered on the basis of markers, with the following settings: merge each file, transformation: cytofAsinh, cluster method: Rphenograph, visualization method: tSNE (t-distributed stochastic neighbor embedding), and cellular progression: NULL. PhenoGraph identified unique clusters were visualized via the R package “Shiny,” where labels, dot size, and cluster color were customized. Clusters were colored according to phenotype based on the median expression of various markers. The frequency of each cluster was determined via csv files generated by the algorithm. Percentages of each cell populations were analyzed with FlowJo and GraphPad Prism 7 software.
Formalin-fixed paraffin-embedded TRAMP-C2 tumor samples were deparaffinized, rehydrated and subjected to heat-mediated antigen retrieval. Sections were incubated with 1% Sudan Black (dissolved in 70% ethanol) for 20 minutes at room temperature to reduce autofluorescence. Slides were washed with 0.02% Tween 20, incubated with 0.1 M Glycine for 10 minutes, and immersed slides in 10 mg/mL Sodium Borohydride in ice cold Hanks Buffer on ice for 40 minutes. After washing with two times PBS, slides were blocked by 1% BSA in PBS for 30 minutes and incubated with FOXA1 antibody (1:1000 dilution; Abcam, # ab170933) at 4° C. overnight. The sections were washed three times in 1X PBS and treated for 30 minutes with goat anti-Rabbit IgG (H+L) Highly Cross-Adsorbed Secondary Antibody-Alexa Fluor 594 (1:500 dilution; Invitrogen, # A-11037). Prior to imaging, samples were mounted with VECTASHIELD Antifade Mounting Medium with DAPI (Fisher Scientific, # NC9524612). Samples were imaged using Nikon spinning disk confocal.
Analysis of FOXA1 mRNA Expression and Immune Cell Markers in Murine TNBC Samples Treated with Immunotherapy and Breast Cancer of Patients Treated with Chemotherapy
To evaluate the mRNA expression level of Foxal and immune cell markers (CD3e, CD8a and Gzmb) in immunotherapy resistant and sensitive samples, RNA-seq data (GSE124821) from triple-negative breast cancer murine models treated with anti-PD1 and anti-CTLA-4 combination therapy was analyzed. To evaluate the mRNA expression level of FOXA1, CD3E, CD8A and GZMB in patients with pathological complete response (pCR with residual cancer burden (RCB) 0 or I) and no pathological complete response (No pCR with RCB II or III) to neoadjuvant chemotherapy (NAC) in breast cancer, RNA-seq data from Breast Cancer Genome-Guided Therapy (BEAUTY) (Goetz et al., J Natl Cancer Inst 109(7): djw306 (2017)) project was analyzed. To further validate the data from this cohort, RNA-microarray data from NAC-treated breast cancer (NCT00455533; GSE41998) from an independent cohort (Horak et al., Clin Cancer Res 19:1587-1595 (2013)) was also analyzed.
Clinical Data and Patient Information of Urothelial Carcinomas Treated with Immunotherapy
Tumor samples and medical records from a cohort of 23 patients (20 males and 3 females; Age from 44 to 77 years; Median age 65 years) with urothelial carcinoma (cancers in bladder, renal pelvis, ureter or urethra that showed predominantly transitional-cell features on histologic testing) were analyzed. Urothelial carcinoma samples were obtained from the primary or metastatic lesions of 23 patients before they underwent therapy with anti-PD1 treatment until disease progression according to the Response Evaluation Criteria in Solid Tumors (RECIST) version 1.1,15 (Eisenhauer et al., Eur J Cancer 45:228-247 (2009)). Formalin-fixed paraffin-embedded (FFPE) tumor specimens with sufficient viable tumor content were required before the start of the study. One sample (patient 7) was excluded for immunohistochemistry (IHC) staining evaluation because the specimen was too small. The total specimens for the FOXA1 IHC staining evaluation are 22 (see Table 4 (
Urothelial carcinoma FFPE samples were deparaffinized, rehydrated and subjected to heat-mediated antigen retrieval. Sections were incubated with 3% H2O2 for 15 minutes at room temperature to quench endogenous peroxidase activity. After antigen retrieval using unmasking solution (Vector Labs), slides were blocked with normal goat serum for 1 hour and incubated with primary antibody at 4° C. overnight. IHC analysis of tumor samples was performed using primary antibodies for FOXA1 (dilution 1:500; Abcam, # ab170933). The sections were washed three times in 1X PBS and treated for 30 minutes with biotinylated goat-anti-rabbit IgG secondary antibodies (#BA-9200, Vector Labs). After washing three times in 1× PBS, sections were incubated with streptavidin-conjugated HRP (# 3999S, Cell Signaling Technology). After washing three times in 1X PBS for 5 minutes each, specific detection was developed with 3,3′3diaminobenzidine (# D4168-50SET, Sigma-Aldrich). For IHC staining score (IS) or intensity, 0=<1% positive cells, 1=1-20% positive cells, 2=20-50% positive cells, 3 =>50% positive cells. FOXA1 expression levels with IS=0 or 1 are considered as “low” and IS =2 or 3 are considered as “high” (see Table 4 (
Statistical Analysis
GraphPad Prism 7 was used for statistical analyses of results from RT-qPCR, luciferase reporter and cell proliferation assays. P values from unpaired two-tailed Student's t tests were used for comparisons between two groups and one-way ANOVA with Bonferroni's post hoc test was used for multiple comparisons. Statistical analysis is specifically described in figure legends. P value <0.05 was considered significant.
The GEO accession number for the ChIP-seq data is GSE142221: www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE142221; Code: yderayksdtazlsr.
MyC-CaP murine prostate cancer cells were transfected with control ASO (Con ASO) or two Foxal-specific ASOs (Foxal ASO1 and Foxal ASO2). As shown in
MyC-CaP cells (3×106) were injected subcutaneously into the right flank of 6-week-old wild-type intact FVB male mice. When the average tumor volume reached approximately 100 mm3, mice were randomized into groups subsequently treated with intraperitoneal injection of anti-PD-L1 or non-specific control IgG (10 mg/kg) in combination with control antisense oligonucleotides (12.5 mg/kg), Foxal ASO1 (12.5 mg/kg), or Foxal-ASO2 (12.5 mg/kg). As shown in
The MyC-CaP murine prostate cancer cell line, originally derived from prostate tumors of Hi-Myc transgenic mice in FVB genetic background, was purchased from ATCC (Manassas, Va.).
Antibodies used include anti-FOXA1 antibody (# ab23738, Abcam), anti-ERK2 (# sc-1647, Santa Cruz Biotechnology), anti-mouse PD-L1 mAb (clone 10B5), and InVivoMAb mouse IgG1 isotype control (clone MOPC-21) (# BE0083, Bio X Cell).
Thirty six 6-week-old wild-type intact FVB mice were purchased from Jackson Laboratories (Bar Harbor, Me.). Tumor volume was measured by digital caliper and calculated using a formula of length×width×width×0.5.
It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.
This application claims the benefit of U.S. Patent Application Ser. No. 62/978,208, filed on Feb. 18, 2020. The disclosure of the prior application is considered part of (and is incorporated by reference in) the disclosure of this application.
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/US2021/018484 | 2/18/2021 | WO |
| Number | Date | Country | |
|---|---|---|---|
| 62978208 | Feb 2020 | US |
