METHODS FOR ALTERING GENE EXPRESSION FOR GENETIC DISORDERS

Information

  • Patent Application
  • 20200140893
  • Publication Number
    20200140893
  • Date Filed
    October 30, 2019
    6 years ago
  • Date Published
    May 07, 2020
    6 years ago
Abstract
Methods and compositions for modifying the expression of endogenous genes or modifying the coding sequence of endogenous genes using rare-cutting endonucleases and transposases.
Description
SEQUENCE LISTING

The instant application contains a Sequence Listing which has been submitted in ASCII format via EFS-Web and is hereby incorporated by reference in its entirety. Said ASCII copy, named SEQ_LISTING_BA2018-5_P12988 created on Oct. 29, 2019 is named and is 507,904 bytes in size.


TECHNICAL FIELD

The present document is in the field of genome editing and gene therapy. More specifically, this document relates to the targeted modification of endogenous genes, or reduction of endogenous gene expression along with gene expression from a transgene.


BACKGROUND

Monogenic disorders are caused by one or more mutations in a single gene, examples of which include sickle cell disease (hemoglobin-beta gene), cystic fibrosis (cystic fibrosis transmembrane conductance regulator gene), and Tay-Sachs disease (beta-hexosaminidase A gene). Monogenic disorders have been an interest for gene therapy, as replacement of the defective gene with a functional copy could provide therapeutic benefits. However, one bottleneck for generating effective therapies includes the size of the functional copy of the gene. Many delivery methods, including those that use viruses, have size limitations which hinder the delivery of large transgenes. Further, many genes have alternative splicing patterns resulting in a single gene coding for multiple proteins. Methods to correct regions of a defective gene may provide additional means to treat monogenic disorders.


SUMMARY

Gene editing holds promise for correcting mutations found in genetic disorders; however, many challenges remain for creating effective therapies for individual disorders, including those that are caused by gain-of-function mutations, or where precise repair is required. These challenges are seen with disorders such as spinocerebellar ataxia 2 and Parkinson's disease, wherein the disorder is associated with gain-of-function mutations.


In one aspect, the methods described herein provide novel approaches for treating gain-of-function disorders, where the pathogenic allele(s) and non-pathogenic allele(s) are silenced, and protein expression is replaced using a silencing-resistant coding sequence. The methods can be used on genes that produce one or more isoforms. In one embodiment, rare-cutting endonucleases or transposons can be used to integrate a transgene comprising a silencing sequence and a silencing-resistant full or partial coding sequence into an endogenous gene (FIGS. 12-17). If the transgene comprises a silencing-resistant partial coding sequence, then the transgene can further comprise a splice acceptor or splice donor operably linked to the partial coding sequence. The transgene can further comprise a promoter operably linked to the silencing-resistant coding sequence (if targeting the 5′ region of a gene) or a terminator operably linked to the silencing-resistant coding sequence (if targeting the 3′ region of a gene). The gain-of-function mutation can be a mutation that results in a disease selected from the group consisting of HD (Huntington's Disease), SBMA (Spinobulbar Muscular Atrophy), SCA1 (Spinocerebellar Ataxia Type 1), SCA2 (Spinocerebellar Ataxia Type 2), SCA3 (Spinocerebellar Ataxia Type 3 or Machado-Joseph Disease), SCA6 (Spinocerebellar Ataxia Type 6), SCA7 (Spinocerebellar Ataxia Type 7), Fragile X Syndrome, Fragile XE Mental Retardation, Friedreich's Ataxia, Myotonic Dystrophy type 1, Myotonic Dystrophy type 2, Spinocerebellar Ataxia Type 8, Spinocerebellar Ataxia Type 12, spinal and bulbar muscular atrophy, JPH3, Amyotrophic Lateral Sclerosis (ALS), hereditary motor and sensory neuropathy type IIC, postsynaptic slow-channel congenital myasthenic syndrome, PRPS1 superactivity, Parkinson disease, tubular aggregate myopathy, achondroplasia, lubs X-linked mental retardation syndrome, and autosomal dominant retinitis pigmentosa.


In another aspect, the methods described herein provide novel approaches for correcting mutations found at the 5′ end of genes. The method is based in part on the design of bimodule, bidirectional transgenes compatible with integration through multiple repair pathways. The transgenes described herein can be integrated into genes by the homologous recombination pathway, the non-homologous end joining pathway, or both the homologous recombination and non-homologous end joining pathway, or through transposition. Further, the outcome of integration in any case (HR, NHEJ forward, NHEJ reverse; transposition forward, or transposition reverse) can result in precise correction/alteration of the target gene's protein product. The transgenes described herein can be used to fix or introduce mutations in the 5′ region of genes-of-interest. The methods are particularly useful in cases where precise editing of genes is necessary, or where the mutated endogenous gene being targeted cannot be ‘replaced’ by a synthetic copy because it exceeds the size capacity of standard vectors or viral vectors. The methods described herein can be used for applied research (e.g., gene therapy) or basic research (e.g., creation of animal models, or understanding gene function).


The methods described herein are compatible with current in vivo delivery vehicles (e.g., adeno-associated virus vectors and lipid nanoparticles), and they address several challenges with achieving precise alteration of gene products, particularly those with gain-of-function mutations and those that produce multiple isoforms.


In one embodiment, this document features a method for integrating a transgene into an endogenous gene. The method can include delivery of a transgene, where the transgene harbors a first and second splice donor sequence, a first and second coding sequence, and one bidirectional promoter or a first and second promoter (FIG. 1). In another aspect, the transgene can also include a first and second terminator. In some embodiments, the first and second terminators can be replaced with a single bidirectional terminator. The method further includes administering a rare-cutting endonuclease targeted to a site within the endogenous gene. The result of the method is that the transgene is integrated with the endogenous gene, and regardless of the orientations (e.g., forward or reverse) the integration will result in a precise modification of the amino acid sequence of the protein produced from the endogenous gene (FIGS. 3 and 4). The method can include the use of any suitable rare-cutting endonuclease, including CRISPR, TAL effector nuclease, zinc-finger nuclease, or meganuclease. The rare-cutting endonuclease can be targeted to sequence within an intron or exon of the endogenous gene. The endogenous gene can include the ATXN2 gene and the rare cutting endonuclease can target intron 1 or exon 1 of the ATXN2 gene. In some embodiments, the CRISPR nuclease can be the CRISPR/Cas12a nuclease or CRISPR/Cas9 nuclease. In other embodiments, the first and second coding sequences can encode a reporter gene, a purification tag, or amino acids that are homologous to amino acids encoded by the endogenous gene. The first and second coding sequence encode the same amino acids, either by harboring the same nucleic acid sequence, or by harboring different nucleic acids sequences (e.g., using codon degeneracy). The transgene can be synthesized on a viral vector (e.g., an adenovirus vector, an adeno-associated virus vector, or a lentivirus vector). Or the transgene can be synthesized on a non-viral vector. The embodiments described above can result in targeted integration of a transgene in either forward or reverse directions, while still having both products produce a desired outcome.


In one embodiment, this document features a method for integrating a transgene into an endogenous gene. The method can include delivery of a transgene, where the transgene harbors a first and/or second homology arm, a first and second rare-cutting endonuclease target site, a first and second promoter or one bidirectional promoter, a first and second splice donor sequence, a first and second coding sequence, and optionally a first and second terminator. In some embodiments, the first and second terminators can be replaced with a single bidirectional terminator. The method further includes administering a rare-cutting endonuclease targeted to a site within the endogenous gene and two sites within the transgene. The result of the method is that the transgene is integrated with the endogenous gene, and regardless of the orientations (e.g., forward or reverse) the integration will result in a precise modification of the amino acid sequence of the protein produced from the endogenous gene. The method can include the use of any suitable rare-cutting endonuclease, including CRISPR, TAL effector nuclease, zinc-finger nuclease, or meganuclease. The rare-cutting endonuclease can be targeted to sequence within an intron or exon of the endogenous gene. The endogenous gene can include the ATXN2 gene and the rare cutting endonuclease can target intron 1 or exon 1 of the ATXN2 gene. In some embodiments, the CRISPR nuclease can be the CRISPR/Cas12a nuclease or CRISPR/Cas9 nuclease. In other embodiments, the first and second coding sequences can encode a reporter gene, a purification tag, or amino acids that are homologous to amino acids encoded by the endogenous gene. The first and second coding sequence encode the same amino acids, either by harboring the same nucleic acid sequence, or by harboring different nucleic acids sequences (e.g., using codon degeneracy). The transgene can be synthesized on a viral vector (e.g., an adenovirus vector, an adeno-associated virus vector, or a lentivirus vector). Or the transgene can be synthesized on a non-viral vector. The embodiments described above can result in targeted integration of a transgene in either forward or reverse directions, while still having both products produce a desired outcome.


In a further embodiment, this document features a double-stranded polynucleotide. The double-stranded polynucleotide can include a first and second splice donor sequence, a first and second coding sequence, a bidirectional promoter or a first and second promoter. The double-stranded polynucleotide can further include a first and/or second homology arm, a first and second rare-cutting endonuclease target site, and a first and second terminator. In some embodiments, the first and second terminators can be replaced with a single bidirectional terminator. The coding sequences on the double-stranded polynucleotide can be in reverse complementary orientation. The coding sequences can code for the same amino acid sequence. The coding sequences can be comprised of the same nucleotide sequence, or different nucleic acid sequences (e.g., due to codon degeneracy). The first and second promoters can be in reverse complementary orientation to each other.


In a further embodiment, this document features a method for integrating a transgene into the ATXN2. The method can include administering a polynucleotide encoding a rare-cutting endonuclease targeted to a site within the ATXN2 gene and a transgene that integrates within the ATXN2 gene following cleavage by the rare-cutting endonuclease. In another embodiment, the rare-cutting endonuclease can be delivered in the form of protein (e.g., Cas9 or Cas12a protein or TALEN protein) or a ribonucleoprotein complex (e.g., Cas9 or Cas12a along with a corresponding gRNA). The transgene can be integrated in cells including induced pluripotent stem cell, Purkinje cells, granule cells, neuron cells, or glial cells. The transgene being integrated within the ATXN2 gene can harbor the coding sequence of exon 1 of the ATXN2 gene. The transgene can be integrated within intron 1 or exon 1 of the ATXN2 gene. The transgene can further include a promoter upstream of the coding sequence. The integration of the transgene can be facilitated using any suitable rare-cutting endonuclease including CRISPR, TAL effector nuclease, zinc-finger nuclease, or meganuclease. The transgene can be synthesized on a viral vector (e.g., an adenovirus vector, an adeno-associated virus vector, or a lentivirus vector). Alternatively, the transgene can be synthesized on a non-viral vector.


In another embodiment, this document features a method of modifying the expression of an endogenous gene, where the method includes administering a transgene, where the transgene comprises a first and second promoter, or a bidirectional promoter, a first nucleic acid sequence which reduces the expression of said endogenous gene, and a second nucleic acid sequence that encodes a protein with homology to the protein produced by said endogenous gene. The second nucleic acid sequence can comprise a different nucleic acid sequence, compared to the first nucleic acid sequence (e.g., due to codon degeneracy or lack of the sequence). The transgenes described herein can further comprise a first and second terminator operably linked to the first and second nucleic acid sequences. The transgene can be used in cases where at least one allele comprises a gain-of-function mutation. The gain-of-function mutation can be a mutation that results in a disease selected from the group consisting of HD (Huntington's Disease), SBMA (Spinobulbar Muscular Atrophy), SCA1 (Spinocerebellar Ataxia Type 1), SCA2 (Spinocerebellar Ataxia Type 2), SCA3 (Spinocerebellar Ataxia Type 3 or Machado-Joseph Disease), SCA6 (Spinocerebellar Ataxia Type 6), SCA7 (Spinocerebellar Ataxia Type 7), Fragile X Syndrome, Fragile XE Mental Retardation, Friedreich's Ataxia, Myotonic Dystrophy type 1, Myotonic Dystrophy type 2, Spinocerebellar Ataxia Type 8, Spinocerebellar Ataxia Type 12, spinal and bulbar muscular atrophy, JPH3, Amyotrophic Lateral Sclerosis (ALS), hereditary motor and sensory neuropathy type IIC, postsynaptic slow-channel congenital myasthenic syndrome, PRPS1 superactivity, Parkinson disease, tubular aggregate myopathy, achondroplasia, lubs X-linked mental retardation syndrome, and autosomal dominant retinitis pigmentosa. The transgene can be harbored on a viral vector, including an adenovirus vector, an adeno-associated virus vector, or a lentivirus vector. The transgene can be a size of 4.7 kb or less. The transgene can be on a non-viral vector. The transgene can be integrated into the genome of a cell.


Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Although methods and materials similar or equivalent to those described herein can be used to practice the invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.


The details of one or more embodiments of the invention are set forth in the description below. Other features, objects, and advantages of the invention will be apparent from the description and from the claims.





DESCRIPTION OF DRAWINGS


FIG. 1 is an illustration of exemplary transgenes for the targeted insertion into endogenous genes and repair of the 5′ end. TS1, target site 1; SD1, splice donor site 1, CDS1, coding sequence 1; P1, promoter 1, TS2, target site 2; SD2, splice donor site 2, CDS2, coding sequence 2; P2, promoter 2; HA1, homology arm 1; HA2, homology arm 2; T1, terminator 1; T2, terminator 2; AS1, additional sequence 1; AS2, additional sequence 2.



FIG. 2 is an illustration showing integration of a transgene into the intron of an exemplary gene. The transgene comprises two target sites for one or more rare-cutting endonucleases, two splice donor sequences, two coding sequences (1.1 and 1.2) and two promoters. Integration proceeds through non-homologous end joining (NHEJ). ATG, start codon; TAA, stop codon.



FIG. 3 is an illustration showing integration of a transgene into an exemplary gene. The transgene comprises two homology arms, two target sites for one or more rare-cutting endonucleases, two splice donor sequences, two coding sequences (1.1 and 1.2) and two promoters. Integration proceeds through either homologous recombination (HR) or non-homologous end joining (NHEJ).



FIG. 4 is an illustration showing integration of a transgene into an exemplary gene. The transgene comprises two homology arms, two target sites for one or more rare-cutting endonucleases, two splice donor sequences, two coding sequences (1.1 and 1.2) and two promoters. Integration proceeds through either homologous recombination (HR) or non-homologous end joining (NHEJ).



FIG. 5 is an illustration of the gene products produced after integration of a transgene described herein. If the first and second partial coding sequences within the transgene are homologous to the endogenous gene's coding sequence, then RNA hairpins and dsRNA may form (top). If the first and second partial coding sequences are codon adjusted, with reduced homology to the endogenous gene's coding sequence, then RNA pairing can be reduced (bottom). T1, transcript 1; T2, transcript 2; T3, transcript 3; +1, RNA synthesis initiation site; S, sense; AntiS, antisense.



FIG. 6 is an illustration of exon 1-3 of the ATXN2 gene. Also shown is the pB1012-D1 and pBA1141 transgene for integration in the ATXN2 gene.



FIG. 7 is an illustration of the integration outcomes for the pB1012-D1 or pBA1141 transgene within the ATXN2 gene.



FIG. 8 is an illustration showing integration of a transgene into an exon of an exemplary gene. The transgene comprises two homology arms, two target sites for one or more rare-cutting endonucleases, two splice donor sequences, two coding sequences (1.1 and 1.2) and two promoters. Integration proceeds through either homologous recombination (HR) or non-homologous end joining (NHEJ).



FIG. 9 is an illustration of a transgene comprising a silencing sequence and a silencing-resistant coding sequence. Two scenarios are shown. Scenario 1 is an illustration depicting the approach to silence both alleles of an endogenous gene, while producing a WT protein replacement. Scenario 2 is an illustration depicting the approach to silence two alleles: one with a gain of function mutation and the other with a WT sequence, while producing a protein replacement. Silencing sequence can be an RNAi cassette. The silencing-resistant CDS can have mutations within the silencing target sequence to prevent binding. Alternatively, the CDS can have the sequence removed.



FIG. 10 is an illustration showing the structure of a transgene for silencing the SOD1 alleles in a cell with a gain-of-function mutation in one allele. The transgene also comprises a codon-adjusted sequence to express a replacement SOD1 protein.



FIG. 11 is an illustration showing examples of the structure of transgenes for the silencing of an exemplary endogenous gene and replacement of the endogenous gene's protein product.



FIG. 12 is an illustration showing the general approach for silencing a gain-of-function allele, while replacing protein production. A partial coding sequence, which has mutations to prevent silencing by an RNAi cassette, is integrated in a gene. If integrated at the 5′ or 3′ end of a gene, the result can be: outcome 1, silencing of the endogenous genes; outcome 2, modification of one of the alleles in the endogenous gene; outcome 3, production of a new protein from the integration event, wherein the mRNA is resistant to silencing, and the protein product comprises the same or different sequence as the original gene.



FIG. 13 is an illustration of transgenes for silencing expression of an endogenous gene and replacing protein production. The CDS1 and CDS2 can be a partial coding sequence of the endogenous gene. The CDSs can comprises mutations, or exclude the sequence, at the corresponding target for the RNAi cassette. The target for integration can be within an intron, but after the introns endogenous splice donor sequence. Also, the target for integration can be at an intron-exon junction.



FIG. 14 is an illustration of transgenes for silencing expression of an endogenous gene and replacing protein production. The CDS1 and CDS2 can be a full coding sequence of the endogenous gene. The CDSs can comprises mutations, or exclude the sequence, at the corresponding target for the RNAi cassette. The target for integration can be within an intron, but after the introns endogenous splice donor sequence. Also, the target for integration can be at an intron-exon junction.



FIG. 15 is an illustration of transgenes for silencing expression of an endogenous gene and replacing protein production. The CDS1 and CDS2 can be a full coding sequence of the endogenous gene. The CDSs can comprises mutations, or exclude the sequence, at the corresponding target for the RNAi cassette. The target for integration can be within an exon.



FIG. 16 is an illustration of transgenes for silencing expression of an endogenous gene and replacing protein production. The CDS1 and CDS2 can be a full coding sequence of the endogenous gene. The CDSs can comprises mutations, or exclude the sequence, at the corresponding target for the RNAi cassette. The target for integration can be within the 5′ UTR. The target for integration can be an intron in the 5′ UTR region, but there needs to be a splice acceptor operably linked to the CDSs.



FIG. 17 is an illustration of transgenes for silencing expression of an endogenous gene and replacing protein production. The CDS1 and CDS2 can be a partial coding sequence of the endogenous gene. The CDSs can comprises mutations, or exclude the sequence, at the corresponding target for the RNAi cassette. The target for integration can be anywhere between the start and stop codon, but not within the endogenous splice acceptor, or not downstream of the last endogenous slice acceptor.



FIG. 18 is an image of the gel detecting integration of the transgenes described herein. 1, 1 kb ladder; 2, pBA1141 3′ HR junction with expected size of 1594 bp; 3, pBA1141 3′ HR junction with expected size of 1775 bp; 4, pBA1141 3′ HR junction with expected size of 1775 bp; 5, pBA1141 3′ NHEJ-reverse with expected size of 2067 bp; 6, pBA1 142 3′ NHEJ-forward junction with expected size of 813 bp; 7, pBA1143 3′ HR junction with expected size of 1225 bp; 8, pBA1143 3′ HR junction with expected size of 1407 bp; 9, pBA1143 3′ HR junction with expected size of 1225 bp; 10, pBA1143 3′ HR junction with expected size of 1407 bp; 11, 1 kb ladder; 12, WT DNA control with primers oNJB201+oNJB190; 13, WT DNA control with primers oNJB202+oNJB191; 14, WT DNA control with primers oNJB197+oNJB191; 15, WT DNA control with primers oNJB202+oNJB211; 16, 1 kb ladder; 17, genomic DNA control for pBA1141+Cas9 transfection; 18, genomic DNA control for pBA1142 transfection; 19, genomic DNA control for pBA1143+Cas9 transfection; 20, genomic DNA control for pBA1141+Cas12a transfection; 21, genomic DNA control for pBA1142+Cas12a transfection; 22, genomic DNA control for pBA1143+Cas12a transfection; 23, WT control; 24, no-DNA control.





DETAILED DESCRIPTION

Disclosed herein are methods and compositions for modifying the coding sequence of endogenous genes. In some embodiments, the methods include inserting a transgene into an endogenous gene, wherein the transgene provides a partial coding sequence which substitutes for the endogenous gene's coding sequence. Also disclosed herein are methods and compositions for reducing the expression of endogenous genes along with expressing a replacement protein.


In one embodiment, this document features a method of integrating a transgene into an endogenous gene, and modifying the mRNA or protein product. The method includes administering a transgene, wherein the transgene comprises a first and second splice donor sequence, a first and second partial coding sequence, one bidirectional promoter or a first and second promoter, and optionally, a first and second terminator, wherein the transgene is administered with at least one rare-cutting endonuclease targeted to a site within the endogenous gene, and wherein the transgene is integrated within the endogenous gene. The endogenous gene can be within a eukaryotic cell, including a human cell. The transgene can have the first splice donor operably linked to the first partial coding sequence, and the second splice donor can be operably linked to the second partial coding sequence. Also, the first partial coding sequence can be operably linked to the first promoter, and the second partial coding sequence can be operably linked to the second promoter. Alternatively, the first and second partial coding sequences can be operably linked to a bidirectional promoter. The transgenes with a first and second splice donors, first and second partial coding sequences, and first and second promoters can be oriented in a head-to-head orientation. These transgenes can be harbored within an adeno-associated viral vector and integrated into the endogenous gene through NHEJ-mediated integration into a targeted double-strand break. The transgene can further comprise a first and second target site for one or more rare-cutting endonucleases, wherein the target sites flank the first and second splice donors. Alternatively, the transgene can further comprise a left and right homology arm which flank the first and second splice donors. The transgenes can have both a first and second target site for one or more rare-cutting endonucleases, wherein the target sites flank the first and second splice donors. The first and second target sites can flank the first and second homology arms. The transgenes described in this method can be integrated within an intron or at an exon-intron junction of the endogenous gene. The endogenous gene can be ATXN2 or SNCA, and the site for integration can be within an intron, or at an exon-intron junction of the ATXN2 gene or SNCA gene. When integrating into ATXN2, the transgene can comprise a first and second partial coding sequence encoding the peptide produced by exon 1 of a non-pathogenic ATXN2 gene. When integrating into SNCA, the transgene can comprise a first and second partial coding sequence encoding the peptide produced by exon 2 of a non-pathogenic SNCA gene. Integration can occur through the use of a CRISPR/Cas12a nuclease or a CRISPR/Cas9 nuclease. The first and second partial coding sequences can encode the same amino acids. The first and second coding sequences can differ in nucleic acid sequence (e.g., through codon degeneracy), but still encode the same amino acids. The transgenes described in this method can be harbored on a vector, wherein the vector format is selected from double-stranded linear DNA, double-stranded circular DNA, or a viral vector. The transgenes can be harbored on a viral vector selected from an adenovirus vector, an adeno-associated virus vector, or a lentivirus vector. The transgenes can have a total length equal to or less than 4.7 kb. The method can include using a transgene with partial coding sequences that encode a peptide produced by the target endogenous gene. The partial coding sequences can be a WT version of the target endogenous gene, and the target endogenous gene can be an aberrant or gene or a gene comprising a pathogenic mutation. The host gene, in an embodiment, is one in which expression of the protein is aberrant, in other words, is not expressed, is expressed at lower levels or higher levels than a functional protein, or expressed such that the protein or portion thereof is non-functional resulting in a disorder in the host. The transgenes used in this method can have a first and second partial coding sequence that differs in nucleic acid sequence compared to the corresponding endogenous gene. In other words, the partial coding sequences can be modified (via codon degeneracy) to have minimal homology to the endogenous gene. This method can be used to modify genes implicated in gain-of-function disorders, including SOD1, TRPV4, CHRNA1, CHRND, CHRNE, CHRNB1, PRPS1, LRRK2, STIM1, FGFR3, MECP2, SNCA, ATXN1, ATXN2, ATXN3, CACNA1A, ATXN7, TBP, HTT, AR, FXN, DMPK, PABPN1, ATXN8, RHO, or C9orf72.


In another embodiment, this document features a method of integrating a transgene into an endogenous gene, and modifying the mRNA or protein product. The method includes administering a transgene, wherein the transgene comprises a left and right transposon end, a first and second splice donor sequence, a first and second partial coding sequence, one bidirectional promoter or a first and second promoter, and optionally, a first and second terminator, wherein the transgene is administered with at least one transposase targeted to a site within the endogenous gene, and wherein the transgene is integrated within the endogenous gene. The endogenous gene can be within a eukaryotic cell, including a human cell. The transgene can have the first splice donor operably linked to the first partial coding sequence, and the second splice donor can be operably linked to the second partial coding sequence. Also, the first partial coding sequence can be operably linked to the first promoter, and the second partial coding sequence can be operably linked to the second promoter. Alternatively, the first and second partial coding sequences can be operably linked to a bidirectional promoter. The transgenes with a first and second splice donors, first and second partial coding sequences, and first and second promoters can be oriented in a head-to-head orientation. The transgene can further comprise a left and right transposon end which flanks the first and second splice donors. The transposase can be a CRISPR transposase, where the CRISPR transposase comprises the Cas12k or Cas6 protein. These transgenes can be harbored within an adeno-associated viral vector. The transgenes described in this method can be integrated within an intron or at an exon-intron junction of the endogenous gene. The endogenous gene can be ATXN2 or SNCA, and the site for integration can be within an intron, or at an exon-intron junction of the ATXN2 gene or SNCA gene. When integrating into ATXN2, the transgene can comprise a first and second partial coding sequence encoding the peptide produced by exon 1 of a non-pathogenic ATXN2 gene. When integrating into SNCA, the transgene can comprise a first and second partial coding sequence encoding the peptide produced by exon 2 of a non-pathogenic SNCA gene. The first and second partial coding sequences can encode the same amino acids. The first and second coding sequences can differ in nucleic acid sequence (e.g., through codon degeneracy), but still encode the same amino acids. The transgenes described in this method can be harbored on a vector, wherein the vector format is selected from double-stranded linear DNA, double-stranded circular DNA, or a viral vector. The transgenes can be harbored on a viral vector selected from an adenovirus vector, an adeno-associated virus vector, or a lentivirus vector. The transgenes can have a total length equal to or less than 4.7 kb. The method can include using a transgene with partial coding sequences that encode a peptide produced by the target endogenous gene. The partial coding sequences can be a WT version of the target endogenous gene, and the target endogenous gene can be an aberrant or gene or a gene comprising a pathogenic mutation. The transgenes used in this method can have a first and second partial coding sequence that differs in nucleic acid sequence compared to the corresponding endogenous gene. In other words, the partial coding sequences can be modified (via codon degeneracy) to have minimal homology to the endogenous gene. This method can be used to modify genes implicated in gain-of-function disorders, including SOD1, TRPV4, CHRNA1, CHRND, CHRNE, CHRNB1, PRPS1, LRRK2, STIM1, FGFR3, MECP2, SNCA, ATXN1, ATXN2, ATXN3, CACNA1A, ATXN7, TBP, HTT, AR, FXN, DMPK, PABPN1, ATXN8, RHO, or C9orf72.


This document also features a method of integrating a transgene into an endogenous gene, and modifying the mRNA or protein product. The method includes administering a transgene, where the transgene comprises a splice acceptor sequence, a partial coding sequence, a terminator, and one RNA interference cassette, wherein the transgene is administered with at least one rare-cutting endonuclease or transposase targeted to a site within the endogenous gene, and wherein the transgene is integrated within the endogenous gene. The partial coding sequence can comprise mutations that prevent silencing by the RNAi cassette. The endogenous gene can be within a eukaryotic cell, including a human cell. The transgene can have the splice acceptor operably linked to the partial coding sequence. Also, the partial coding sequence can be operably linked to the terminator. The endogenous gene can be within a eukaryotic cell, including a human cell. The transgene can have the splice acceptor operably linked to the partial coding sequence. Also, the partial coding sequence can be operably linked to the terminator. These transgenes can be harbored within an adeno-associated viral vector and integrated into the endogenous gene through NHEJ-mediated integration into a targeted double-strand break or through homologous recombination. The transgene can further comprise a left and right homology arm. The transgenes described in this method can be integrated within an intron or at an intron-exon junction of the endogenous gene. The RNAi cassette can be a promoter operably linked to a sequence that has homology to the endogenous gene. The RNAi cassette can produce an shRNA or siRNA. The RNAi cassette can comprise homologous sequence to the endogenous gene, and the partial coding sequence within the transgene can comprise the same sequence as the endogenous gene, however, the target site for the RNAi cassette can be mutated to prevent silencing of expression with the integrated transgene (e.g., with synonymous single-nucleotide polymorphisms, insertions or deletions). Integration can occur through the use of a CRISPR/Cas12a nuclease or a CRISPR/Cas9 nuclease or with a CRISPR-associated transposase. If a CRISPR-associated transposase is used, then instead of homology arms, the transgene can comprise a left and right transposon end. The CRISPR-associated transpose can comprise a Cas6 protein or a Cas12k protein. The transgenes described in this method can be harbored on a vector, wherein the vector format is selected from double-stranded linear DNA, double-stranded circular DNA, or a viral vector. The transgenes can be harbored on a viral vector selected from an adenovirus vector, an adeno-associated virus vector, or a lentivirus vector. The transgenes can have a total length equal to or less than 4.7 kb. The method can include using a transgene with partial coding sequences that encode a peptide produced by the target endogenous gene. The partial coding sequence can be a WT version of the target endogenous gene, and the target endogenous gene can be an aberrant or gene or a gene comprising a pathogenic mutation. This method can be used to modify genes implicated in gain-of-function disorders, including CACNA1A, ATXN3, SOD1, TRPV4, CHRNA1, CHRND, CHRNE, CHRNB1, PRPS1, LRRK2, STIM1, FGFR3, MECP2, SNCA, ATXN1, ATXN2, CACNA1A, ATXN7, TBP, HTT, AR, FXN, DMPK, PABPN1, ATXN8, RHO, or C9orf72.


This document also features a method of integrating a transgene into an endogenous gene, and modifying the mRNA or protein product. The method includes administering a transgene, where the transgene comprises a splice acceptor sequence, a first and second partial coding sequence, a terminator, and one RNA interference cassette, wherein the transgene is administered with at least one rare-cutting endonuclease or transposase targeted to a site within the endogenous gene, and wherein the transgene is integrated within the endogenous gene. The first and second partial coding sequences can comprise mutations that prevent silencing by the RNAi cassette. The endogenous gene can be within a eukaryotic cell, including a human cell. The transgene can have the first splice acceptor operably linked to the first partial coding sequence, and the second splice acceptor operably linked to the second partial coding sequence. Also, the first partial coding sequence can be operably linked to the first terminator, and the second partial coding sequence can be operably linked to the second terminator. The partial coding sequences can be in a tail-to-tail orientation, with the RNAi cassette between the two terminators. These transgenes can be harbored within an adeno-associated viral vector and integrated into the endogenous gene through NHEJ-mediated integration into a targeted double-strand break or through homologous recombination. The transgene can further comprise a left and right homology arm. The transgenes described in this method can be integrated within an intron or at an intron-exon junction of the endogenous gene. The RNAi cassette can be a promoter operably linked to a sequence that has homology to the endogenous gene. The RNAi cassette can produce an shRNA or siRNA. The RNAi cassette can comprise homologous sequence to the endogenous gene, and the partial coding sequence within the transgene can comprise the same sequence as the endogenous gene, however, the target site for the RNAi cassette can be mutated to prevent silencing. Integration can occur through the use of a CRISPR/Cas12a nuclease or a CRISPR/Cas9 nuclease or with a CRISPR-associated transposase. If a CRISPR-associated transposase is used, then instead of homology arms, the transgene can comprise a left and right transposon end. The CRISPR-associated transpose can comprise a Cas6 protein or a Cas12k protein. The transgenes described in this method can be harbored on a vector, wherein the vector format is selected from double-stranded linear DNA, double-stranded circular DNA, or a viral vector. The transgenes can be harbored on a viral vector selected from an adenovirus vector, an adeno-associated virus vector, or a lentivirus vector. The transgenes can have a total length equal to or less than 4.7 kb. The method can include using a transgene with partial coding sequences that encode a peptide produced by the target endogenous gene. The partial coding sequence can be a WT version of the target endogenous gene, and the target endogenous gene can be an aberrant or gene or a gene comprising a pathogenic mutation. This method can be used to modify genes implicated in gain-of-function disorders, including CACNA1A, ATXN3, SOD1, TRPV4, CHRNA1, CHRND, CHRNE, CHRNB1, PRPS1, LRRK2, STIM1, FGFR3, MECP2, SNCA, ATXN1, ATXN2, CACNA1A, ATXN7, TBP, HTT, AR, FXN, DMPK, PABPN1, ATXN8, RHO, or C9orf72.


This document also features a method of integrating a transgene into an endogenous gene, and modifying the mRNA or protein product. The method includes administering a transgene, where the transgene comprises a splice donor sequence, a partial coding sequence, a promoter, and an RNA interference cassette wherein the transgene is administered with at least one rare-cutting endonuclease or transposase targeted to a site within the endogenous gene, and wherein the transgene is integrated within the endogenous gene. The partial coding sequence can comprise mutations that prevent silencing by the RNAi cassette. For example, if the RNAi cassette is designed to target sequence within the transcripts produced by the endogenous gene, then the partial coding sequence (found within the transgene) may comprise the same coding sequence as the endogenous gene and corresponding RNAi target, thereby subjecting the modified endogenous gene to the same interference by the RNAi cassette. To minimize or prevent silencing of the modified endogenous gene, the partial coding sequence within the transgene can be mutated. The endogenous gene can be within a eukaryotic cell, including a human cell. The transgene can have the splice donor operably linked to the partial coding sequence. Also, the partial coding sequence can be operably linked to the promoter. These transgenes can be harbored within an adeno-associated viral vector and integrated into the endogenous gene through NHEJ-mediated integration into a targeted double-strand break or through homologous recombination. The transgene can further comprise a left and right homology arm. The transgenes described in this method can be integrated within an intron or at an exon-intron junction of the endogenous gene. The RNAi cassette can be a promoter operably linked to a sequence that has homology to the endogenous gene. The RNAi cassette can produce an shRNA or siRNA. The RNAi cassette can comprise homologous sequence to the endogenous gene, and the partial coding sequence within the transgene can comprise the same sequence as the endogenous gene, however, the target site for the RNAi cassette can be mutated to prevent silencing. The endogenous gene can be ATXN2 or SNCA, and the site for integration can be within an intron, or at an exon-intron junction of the ATXN2 gene or SNCA gene. When integrating into ATXN2, the transgene can comprise a partial coding sequence encoding the peptide produced by exon 1 of a non-pathogenic ATXN2 gene. The RNAi cassette can be designed to target transcript sequence from exon 1 of the ATXN2 gene, and the corresponding sequence within the partial coding sequence can be mutated to prevent silencing. When integrating into SNCA, the transgene can comprise a partial coding sequence encoding the peptide produced by exon 2 of a non-pathogenic SNCA gene. The RNAi cassette can be designed to target transcript sequence from exon 2 of the SNCA gene, and the corresponding sequence within the partial coding sequence can be mutated to prevent silencing. Integration can occur through the use of a CRISPR/Cas12a nuclease or a CRISPR/Cas9 nuclease or with a CRISPR-associated transposase. If a CRISPR-associated transposase is used, then instead of homology arms, the transgene can comprise a left and right transposon end. The CRISPR-associated transpose can comprise a Cas6 protein or a Cas12k protein. The transgenes described in this method can be harbored on a vector, wherein the vector format is selected from double-stranded linear DNA, double-stranded circular DNA, or a viral vector. The transgenes can be harbored on a viral vector selected from an adenovirus vector, an adeno-associated virus vector, or a lentivirus vector. The transgenes can have a total length equal to or less than 4.7 kb. The method can include using a transgene with partial coding sequences that encode a peptide produced by the target endogenous gene. The partial coding sequence can be a WT version of the target endogenous gene, and the target endogenous gene can be an aberrant or gene or a gene comprising a pathogenic mutation. This method can be used to modify genes implicated in gain-of-function disorders, including CACNA1A, ATXN3, SOD1, TRPV4, CHRNA1, CHRND, CHRNE, CHRNB1, PRPS1, LRRK2, STIM1, FGFR3, MECP2, SNCA, ATXN1, ATXN2, CACNA1A, ATXN7, TBP, HTT, AR, FXN, DMPK, PABPN1, ATXN8, RHO, or C9orf72.


This document also features a method of integrating a transgene into an endogenous gene, and modifying the mRNA or protein product. The method includes administering a transgene, where the transgene comprises a first and second splice donor sequence, a first and second partial coding sequence, a first and second promoter (or bidirectional promoter), and an RNA interference cassette wherein the transgene is administered with at least one rare-cutting endonuclease or transposase targeted to a site within the endogenous gene, and wherein the transgene is integrated within the endogenous gene. The partial coding sequences can comprise mutations that prevent silencing by the RNAi cassette. The endogenous gene can be within a eukaryotic cell, including a human cell. The transgene can have the first splice donor operably linked to the first partial coding sequence, and the second splice donor operably linked to the second partial coding sequence. Also, the first partial coding sequence can be operably linked to the first promoter, and the second partial coding sequence can be operably linked to the second promoter. The partial coding sequences can be in a head-to-head orientation, and the RNAi cassette can be placed between the first and second promoters. These transgenes can be harbored within an adeno-associated viral vector and integrated into the endogenous gene through NHEJ-mediated integration into a targeted double-strand break or through homologous recombination. The transgene can further comprise a left and right homology arm. The transgenes described in this method can be integrated within an intron or at an exon-intron junction of the endogenous gene. The RNAi cassette can be a promoter operably linked to a sequence that has homology to the endogenous gene. The RNAi cassette can produce an shRNA or siRNA. The RNAi cassette can comprise homologous sequence to the endogenous gene, and the partial coding sequences within the transgene can comprise the same sequence as the endogenous gene, however, the target site for the RNAi cassette can be mutated to prevent silencing. The endogenous gene can be ATXN2 or SNCA, and the site for integration can be within an intron, or at an exon-intron junction of the ATXN2 gene or SNCA gene. When integrating into ATXN2, the transgene can comprise a partial coding sequence encoding the peptide produced by exon 1 of a non-pathogenic ATXN2 gene. The RNAi cassette can be designed to target transcript sequence from exon 1 of the ATXN2 gene, and the corresponding sequence within the partial coding sequence can be mutated to prevent silencing. When integrating into SNCA, the transgene can comprise a partial coding sequence encoding the peptide produced by exon 2 of a non-pathogenic SNCA gene. The RNAi cassette can be designed to target transcript sequence from exon 2 of the SNCA gene, and the corresponding sequence within the partial coding sequence can be mutated to prevent silencing. Integration can occur through the use of a CRISPR/Cas12a nuclease or a CRISPR/Cas9 nuclease or with a CRISPR-associated transposase. If a CRISPR-associated transposase is used, then instead of homology arms, the transgene can comprise a left and right transposon end. The CRISPR-associated transpose can comprise a Cas6 protein or a Cas12k protein. The transgenes described in this method can be harbored on a vector, wherein the vector format is selected from double-stranded linear DNA, double-stranded circular DNA, or a viral vector. The transgenes can be harbored on a viral vector selected from an adenovirus vector, an adeno-associated virus vector, or a lentivirus vector. The transgenes can have a total length equal to or less than 4.7 kb. The method can include using a transgene with partial coding sequences that encode a peptide produced by the target endogenous gene. The partial coding sequences can be a WT version of the target endogenous gene, and the target endogenous gene can be an aberrant or gene or a gene comprising a pathogenic mutation. The transgenes used in this method can have a first and second partial coding sequence that differs in nucleic acid sequence compared to the corresponding endogenous gene. In other words, the partial coding sequences can be modified (via codon degeneracy) to have minimal homology to the endogenous gene. This method can be used to modify genes implicated in gain-of-function disorders, including CACNA1A, ATXN3, SOD1, TRPV4, CHRNA1, CHRND, CHRNE, CHRNB1, PRPS1, LRRK2, STIM1, FGFR3, MECP2, SNCA, ATXN1, ATXN2, CACNA1A, ATXN7, TBP, HTT, AR, FXN, DMPK, PABPN1, ATXN8, RHO, or C9orf72.


Practice of the methods, as well as preparation and use of the compositions disclosed herein employ, unless otherwise indicated, conventional techniques in molecular biology, biochemistry, chromatin structure and analysis, computational chemistry, cell culture, recombinant DNA and related fields as are within the skill of the art. These techniques are fully explained in the literature. See, for example, Sambrook et al. MOLECULAR CLONING: A LABORATORY MANUAL, Second edition, Cold Spring Harbor Laboratory Press, 1989 and Third edition, 2001; Ausubel et al., CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons, New York, 1987 and periodic updates; the series METHODS IN ENZYMOLOGY, Academic Press, San Diego; Wolffe, CHROMATIN STRUCTURE AND FUNCTION, Third edition, Academic Press, San Diego, 1998; METHODS IN ENZYMOLOGY, Vol. 304, “Chromatin” (P. M. Wassarman and A. P. Wolffe, eds.), Academic Press, San Diego, 1999; and METHODS IN MOLECULAR BIOLOGY, Vol. 119, “Chromatin Protocols” (P. B. Becker, ed.) Humana Press, Totowa, 1999.


As used herein, the terms “nucleic acid” and “polynucleotide,” can be used interchangeably. Nucleic acid and polynucleotide can refer to a deoxyribonucleotide or ribonucleotide polymer, in linear or circular conformation, and in either single- or double-stranded form. These terms are not to be construed as limiting with respect to the length of a polymer. The terms can encompass known analogues of natural nucleotides, as well as nucleotides that are modified in the base, sugar and/or phosphate moieties.


The terms “polypeptide,” “peptide” and “protein” can be used interchangeably to refer to amino acid residues covalently linked together. The term also applies to proteins in which one or more amino acids are chemical analogues or modified derivatives of corresponding naturally-occurring amino acids.


The terms “operatively linked” or “operably linked” are used interchangeably and refer to a juxtaposition of two or more components (such as sequence elements), in which the components are arranged such that both components function normally and allow the possibility that at least one of the components can mediate a function that is exerted upon at least one of the other components. By way of illustration, a transcriptional regulatory sequence, such as a promoter, is operatively linked to a coding sequence if the transcriptional regulatory sequence controls the level of transcription of the coding sequence in response to the presence or absence of one or more transcriptional regulatory factors. A transcriptional regulatory sequence is generally operatively linked in cis with a coding sequence, but need not be directly adjacent to it. For example, an enhancer is a transcriptional regulatory sequence that is operatively linked to a coding sequence, even though they are not contiguous.


As used herein, the term “cleavage” refers to the breakage of the covalent backbone of a nucleic acid molecule. Cleavage can be initiated by a variety of methods including, but not limited to, enzymatic or chemical hydrolysis of a phosphodiester bond. Cleavage can refer to both a single-stranded nick and a double-stranded break. A double-stranded break can occur as a result of two distinct single-stranded nicks. Nucleic acid cleavage can result in the production of either blunt ends or staggered ends. In certain embodiments, rare-cutting endonucleases are used for targeted double-stranded or single-stranded DNA cleavage.


An “exogenous” molecule can refer to a small molecule (e.g., sugars, lipids, amino acids, fatty acids, phenolic compounds, alkaloids), or a macromolecule (e.g., protein, nucleic acid, carbohydrate, lipid, glycoprotein, lipoprotein, polysaccharide), or any modified derivative of the above molecules, or any complex comprising one or more of the above molecules, generated or present outside of a cell, or not normally present in a cell. Exogenous molecules can be introduced into cells. Methods for the introduction of exogenous molecules into cells can include lipid-mediated transfer, electroporation, direct injection, cell fusion, particle bombardment, calcium phosphate co-precipitation, DEAE-dextran-mediated transfer and viral vector-mediated transfer.


An “endogenous” molecule is a small molecule or macromolecule that is present in a particular cell at a particular developmental stage under particular environmental conditions. An endogenous molecule can be a nucleic acid, a chromosome, the genome of a mitochondrion, chloroplast or other organelle, or a naturally-occurring episomal nucleic acid. Additional endogenous molecules can include proteins, for example, transcription factors and enzymes.


As used herein, a “gene,” refers to a DNA region encoding that encodes a gene product, including all DNA regions which regulate the production of the gene product. Accordingly, a gene includes, but is not necessarily limited to, promoter sequences, terminators, translational regulatory sequences such as ribosome binding sites and internal ribosome entry sites, enhancers, silencers, insulators, boundary elements, replication origins, matrix attachment sites and locus control regions.


An “endogenous gene” refers to a DNA region normally present in a particular cell that encodes a gene product as well as all DNA regions which regulate the production of the gene product.


“Gene expression” refers to the conversion of the information, contained in a gene, into a gene product. A gene product can be the direct transcriptional product of a gene. For example, the gene product can be, but not limited to, mRNA, tRNA, rRNA, antisense RNA, ribozyme, structural RNA, or a protein produced by translation of an mRNA. Gene products also include RNAs which are modified, by processes such as capping, polyadenylation, methylation, and editing, and proteins modified by, for example, methylation, acetylation, phosphorylation, ubiquitination, ADP-ribosylation, myristilation, and glycosylation.


“Encoding” refers to the conversion of the information contained in a nucleic acid, into a product, wherein the product can result from the direct transcriptional product of a nucleic acid sequence. For example, the product can be, but not limited to, mRNA, tRNA, rRNA, antisense RNA, ribozyme, structural RNA, or a protein produced by translation of an mRNA. Gene products also include RNAs which are modified, by processes such as capping, polyadenylation, methylation, and editing, and proteins modified by, for example, methylation, acetylation, phosphorylation, ubiquitination, ADP-ribosylation, myristilation, and glycosylation.


A “target site” or “target sequence” is a nucleic acid sequence to which a binding molecule will bind, provided sufficient conditions for binding exist, such as an endonuclease or transposase, including for example a rare-cutting endonuclease or a CRISPR-associate transposase. The target site can be an endogenous gene which may be native to the cell or heterologous.


As used herein, the term “recombination” refers to a process of exchange of genetic information between two polynucleotides. The term “homologous recombination (HR)” refers to a specialized form of recombination that can take place, for example, during the repair of double-strand breaks. Homologous recombination requires nucleotide sequence homology present on a “donor” molecule. The donor molecule can be used by the cell as a template for repair of a double-strand break. Information within the donor molecule that differs from the genomic sequence at or near the double-strand break can be stably incorporated into the cell's genomic DNA.


The term “homologous” as used herein refers to a sequence of nucleic acids or amino acids having similarity to a second sequence of nucleic acids or amino acids. In some embodiments, a the homologous sequences can have at least 80% sequence identity (e.g., 81%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity) to one another.


A “target site” or “target sequence” defines a portion of a nucleic acid to which a rare-cutting endonuclease or CRISPR-associated transposase will bind, provided sufficient conditions for binding exist.


The term “transgene” as used herein refers to a sequence of nucleic acids that can be transferred to an organism or cell. The transgene may comprise a gene or sequence of nucleic acids not normally present in the target organism or cell. Additionally, the transgene may comprise a copy of a gene or sequence of nucleic acids that is normally present in the target organism or cell. A transgene can be an exogenous DNA sequence introduced into the cytoplasm or nucleus of a target cell. In one embodiment, the transgenes described herein contain partial coding sequences, wherein the partial coding sequences encodes a portion of a protein produced by a gene in the host cell.


As used herein, the term “pathogenic” refers to anything that can cause disease. A pathogenic mutation can refer to a modification in a gene which causes disease. A pathogenic gene refers to a gene comprising a modification which causes disease. By means of example, a pathogenic ATXN2 gene in patients with spinocerebellar ataxia 2 refers to an ATXN2 gene with an expanded CAG trinucleotide repeat, wherein the expanded CAG trinucleotide repeat causes the disease.


As used herein, the term “tail-to-tail” refers to an orientation of two units in opposite and reverse directions. The two units can be two sequences on a single nucleic acid molecule, where the 3′ end of each sequence are placed adjacent to each other. For example, a first nucleic acid having the elements, in a 5′ to 3′ direction, [splice acceptor 1]-[partial coding sequence 1]-[terminator 1] and a second nucleic acid having the elements [splice acceptor 2]-[partial coding sequence 2]-[terminator 2] can be placed in tail-to-tail orientation resulting in [splice acceptor 1]-[partial coding sequence 1]-[terminator 1]-[terminator 2 RC]-[partial coding sequence 2 RC]-[splice acceptor 2 RC], where RC refers to reverse complement.


As used herein, the term “head-to-head” refers to an orientation of two units in opposite and reverse directions. The two units can be two sequences on a single nucleic acid molecule, where the 5′ end of each sequence are placed adjacent to each other. For example, a first nucleic acid having the elements, in a 5′ to 3′ direction, [promoter 1]-[partial coding sequence 1]-[splice donor 1] and a second nucleic acid having the elements [promoter 2]-[partial coding sequence 2]-[splice donor 2] can be placed in head-to-head orientation resulting in [splice donor 1 RC]-[partial coding sequence 1 RC]-[promoter 1 RC]-[promoter 2]-[partial coding sequence 2]-[splice donor 2] where RC refers to reverse complement.


The term “integrating” as used herein refers to the process of adding DNA to a target region of DNA. As described herein, integration can be facilitated by several different means, including non-homologous end joining, homologous recombination, or targeted transposition. By way of example, integration of a user-supplied DNA molecule into a target gene can be facilitated by non-homologous end joining. Here, a targeted-double strand break is made within the target gene and a user-supplied DNA molecule is administered. The user-supplied DNA molecule can comprise exposed DNA ends to facilitate capture during repair of the target gene by non-homologous end joining. The exposed ends can be present on the DNA molecule upon administration (i.e., administration of a linear DNA molecule) or created upon administration to the cell (i.e., a rare-cutting endonuclease cleaves the user-supplied DNA molecule within the cell to expose the ends). Additionally, the user-supplied DNA molecule can be harbored on a viral vector, including an adeno-associated virus vector. In another example, integration occurs though homologous recombination. Here, the user-supplied DNA can harbor a left and right homology arm. In another example, integration occurs through transposition. Here, the user-supplied DNA harbors a transposon left and right end.


The term “intron-exon junction” refers to a specific location within a gene. The specific location is between the last nucleotide in an intron and the first nucleotide of the following exon. When integrating a transgene described herein, the transgene can be integrated within the “intron-exon junction.” If the transgene comprises cargo, the cargo will be integrated immediately following the last nucleotide in the intron. In some cases, integrating a transgene within the intron-exon junction can result in removal of sequence within the exon (e.g., integration via HR and replacement of sequence within the exon with the cargo within the transgene).


The term “exon-intron junction” refers to a specific location within a gene. The specific location is between the last nucleotide in an exon and the first nucleotide of the following intron. When integrating a transgene described herein, the transgene can be integrated within the “exon-intron junction.” If the transgene comprises cargo, the cargo will be integrated immediately before the first nucleotide in the intron. In some cases, integrating a transgene within the exon-intron junction can result in removal of sequence within the exon (e.g., integration via HR and replacement of sequence within the exon with the cargo within the transgene).


The term “partial coding sequence” as used herein refers to a sequence of nucleic acids that encodes a partial protein. The partial coding sequence can encode a protein that comprises one or less amino acids as compared to the wild type protein or functional protein. The partial coding sequence can encode a partial protein with homology to the wild type protein or functional protein. When referring to a “partial coding sequence” that is operably linked to a promoter, the term “partial coding sequence” refers to a sequence of nucleotides that encodes the N-terminus of a protein-of-interest. For example, a partial coding sequence of the ATXN2 gene, which comprises 25 exons, can include nucleotides encoding the peptide produced by exons 1, 1-2, 1-3, 1-4, 1-5, 1-6, 1-7, 1-8, 1-9, 1-10, 1-11, 1-12, 1-13, 1-14, 1-15, 1-16, 1-17, 1-18, 1-19, 1-20, 1-21, 1-22, 1-23, or 1-24. When referring to a “partial coding sequence” that is operably linked to a terminator, the term “partial coding sequence” refers to a sequence of nucleotides that encodes the C-terminus of a protein-of-interest. For example, a partial coding sequence of the ATXN2 gene, can include nucleotides encoding the peptide produced by exons 2-25, 3-25, 4-25, 5-25, 6-25, 7-25, 8-25, 9-25, 10-25, 11-25, 12-25, 13-25, 14-25, 15-25, 16-25, 17-25, 18-25, 19-25, 20-25, 21-25, 22-25, 23-25, 24-25 or 25.


The term “silencing-resistant coding sequence” or “silencing-resistant partial coding sequence” refers to a sequence of nucleic acids that, when RNA is produced using said sequence as a template, the RNA is unable or less likely to be silenced by a corresponding RNAi molecule. This can be due to mutations within the RNAi target site, or absence of the site.


The methods and compositions described in this document can use transgenes having a cargo sequence. The term “cargo” can refer to elements such as the complete or partial coding sequence of a gene, a partial sequence of a gene harboring single-nucleotide polymorphisms relative to the WT or altered target, a splice acceptor, a splice donor, a promoter, a terminator, a transcriptional regulatory element, an RNAi cassette, purification tags (e.g., glutathione-S-transferase, poly(His), maltose binding protein, Strep-tag, Myc-tag, AviTag, HA-tag, or chitin binding protein) or reporter genes (e.g., GFP, RFP, lacZ, cat, luciferase, puro, neomycin). As defined herein, “cargo” can refer to the sequence within a transgene that is integrated at a target site. For example, “cargo” can refer to the sequence on a transgene between two homology arms, two rare-cutting endonuclease target sites, or a left and right transposon end.


The term “homology sequence” refers to a sequence of nucleic acids that comprises homology to a second nucleic acid. Homology sequence, for example, can be present on a donor molecule as an “arm of homology” or “homology arm.” A homology arm can be a sequence of nucleic acids within a donor molecule that facilitates homologous recombination with the second nucleic acid. In an embodiment, a homology sequence or homology arms have homology to an endogenous gene. As defined herein, a homology arm can also be referred to as an “arm”. In a donor molecule with two homology arms, the homology arms can be referred to as “arm 1” and “arm 2.” In one aspect, a cargo sequence can be flanked with first and second homology arm.


The term “bidirectional terminator” refers to a terminator that can terminate RNA polymerase transcription in either the sense or antisense direction. In contrast to two unidirectional terminators in tail-to-tail orientation, a bidirectional terminator can comprise a non-chimeric sequence of DNA. Examples of bidirectional terminators include the ARO4, TRP1, TRP4, ADH1, CYC1, GAL1, GAL7, and GAL10 terminator.


The term “bidirectional promoter” refers to a promoter that can initiate RNA polymerase transcription in either the sense or antisense direction. In contrast to two unidirectional promoters in head-to-head orientation, a bidirectional promoter can comprise a non-chimeric sequence of DNA. Examples of bidirectional promoters include those described in Trinklein et al., Genome Res. 14:62-66, 2004, the entire disclosure of which, except for any definitions, disclaimers, disavowals, and inconsistencies, is incorporated herein by reference.


A 5′ or 3′ end of a nucleic acid molecule references the directionality and chemical orientation of the nucleic acid. As defined herein, the “5′ end of a gene” can comprise the exon with the start codon, but not the exon with the stop codon. As defined herein, the “3′ end of a gene” can comprise the exon with the stop codon, but not the exon with the start codon.


The term “RNAi” refers to RNA interference, a process that uses RNA molecules to inhibit or reduce gene expression or translation. RNAi can be induced with the use of small interfering RNAs (siRNA) or short hairpin RNAs (shRNA).


The term “ATXN2” gene refers to a gene that encodes the enzyme ataxin-2. A representative sequence of the ATXN2 gene can be found with NCBI Reference Sequence: NG_011572.3 and corresponding SEQ ID NO:56. The exon and intron boundaries can be defined with the sequence provided in SEQ ID NO:56. Specifically, exon 1 includes the sequence from 282 to 532. Exon 2 includes the sequence from 43397 to 43433. Exon 3 includes the sequence from 45099 to 45158. Exon 4 includes the sequence from 46339 to 46410. Exon 5 includes the sequence from 46886 to 47036. Exon 6 includes the sequence from 74000 to 74124. Exon 7 includes the sequence from 78343 to 78434. Exon 8 includes the sequence from 79240 to 79437. Exon 9 includes the sequence from 80889 to 81067. Exon 10 includes the sequence from 82953 to 83162.


Exon 11 includes the sequence from 85777 to 85959. Exon 12 includes the sequence from 88734 to 88931. Exon 13 includes the sequence from 89318 to 89425. Exon 14 includes the sequence from 89697 to 89767. Exon 15 includes the sequence from 110536 to 110840. Exon 16 includes the sequence from 112492 to 112555. Exon 17 includes the sequence from 113451 to 113603. Exon 18 includes the sequence from 113985 to 114051. Exon 19 includes the sequence from 128574 to 128758. Exon 20 includes the sequence from 129076 to 129208. Exon 21 includes the sequence from 134601 to 134654. Exon 22 includes the sequence from 141957 to 142102. Exon 23 includes the sequence from 143060 to 143287. Exon 24 includes the sequence from 145471 to 145639. Exon 25 includes the sequence from 146476 to 146504. Intron 1 includes the sequence from 533 to 43396. Intron 2 includes the sequence from 43434 to 45098. Intron 3 includes the sequence from 45159 to 46338. Intron 4 includes the sequence from 46411 to 46885. Intron 5 includes the sequence from 47037 to 73999. Intron 6 includes the sequence from 74125 to 78342. Intron 7 includes the sequence from 78435 to 79239. Intron 8 includes the sequence from 79438 to 80888. Intron 9 includes the sequence from 81068 to 82952. Intron 10 includes the sequence from 83163 to 85776. Intron 11 includes the sequence from 85960 to 88733. Intron 12 includes the sequence from 88932 to 89317. Intron 13 includes the sequence from 89426 to 89696. Intron 14 includes the sequence from 89768 to 110535. Intron 15 includes the sequence from 110841 to 112491. Intron 16 includes the sequence from 112556 to 113450. Intron 17 includes the sequence from 113604 to 113984. Intron 18 includes the sequence from 114052 to 128573. Intron 19 includes the sequence from 128759 to 129075. Intron 20 includes the sequence from 129209 to 134600. Intron 21 includes the sequence from 134655 to 141956. Intron 22 includes the sequence from 142103 to 143059. Intron 23 includes the sequence from 143288 to 145470. Intron 24 includes the sequence from 145640 to 146475. Examples of pathogenic mutations in ATXN2 include a CAG trinucleotide expansion in exon 1 (32 or more CAG repeats). Examples of non-pathogenic mutations include ClinVar accession number VCV000522367, VCV000522368, VCV000522369, VCV000522370, VCV000128509, VCV000128508, VCV000128507, VCV000218618.


The term “SNCA” gene refers to a gene that encodes the protein synuclein alpha. A representative sequence of the SNCA gene can be found with NCBI Reference Sequence: NG_011851.1 and corresponding SEQ ID NO:55. The exon and intron boundaries can be defined with the sequence provided in SEQ ID NO:55. Specifically, exon 1 includes the sequence from 1 to 200. Exon 2 includes the sequence from 1470 to 1615. Exon 3 includes the sequence from 8978 to 9019. Exon 4 includes the sequence from 14774 to 14916. Exon 5 includes the sequence from 107885 to 107968. Exon 6 includes the sequence from 110502 to 113063. Intron 1 includes the sequence from 201 to 1469. Intron 2 includes the sequence from 1616 to 8977. Intron 3 includes the sequence from 9020 to 14773. Intron 4 includes the sequence from 14917 to 107884. Intron 5 includes the sequence from 107969 to 110501. The start codon is present in intron 2. Examples of pathogenic mutations in SNCA include a duplication or triplication of the gene, A53T, G51D, E46K, and A30P. Examples of non-pathogenic mutations include ClinVar accession number VCV000350063, VCV000350064, VCV000350086, and VCV000350093.


As defined herein, a SOD1 gene refers to a gene that produces the enzyme superoxide dismutase. A representative sequence of the SOD1 gene can be found with NCBI Reference Sequence: NG_008689.1 and corresponding SEQ ID NO:57. The exon and intron boundaries can be defined with the sequence provided in SEQ ID NO:57. Specifically, exon 1 includes the sequence from 5001 to 5220. Exon 2 includes sequence from 9169 to 9265. Exon 3 includes sequence from 11828 to 11897. Exon 4 includes sequence from 12637 to 12754. Exon 5 includes sequence from 13850 to 14310. Intron 1 includes sequence from 5221 to 9168. Intron 2 includes sequence from 9170 to 11827. Intron 3 includes sequence from 11898 to 12636. Intron 4 includes sequence from 12755 to 12849. The methods described herein provide transgenes for integrating into the SOD1 gene. The transgenes can comprise a promoter, partial SOD1 coding sequence and splice donor, and the integration site can be within intron 1, 2, 3 or 4 of the endogenous SOD1 gene. Further the transgenes can comprise an RNAi cassette targeting the endogenous SOD1 transcripts, a promoter, a partial SOD1 coding sequence (resistant to silencing by the RNAi cassette, and a splice donor. The transgene can be integrated within intron 1, 2, 3 or 4 of the endogenous SOD1 gene. Also, the transgenes can comprise a splice acceptor, partial SOD1 coding sequence (resistant to silencing by an RNAi cassette), a terminator, and an RNAi cassette targeting the endogenous SOD1 transcripts. The transgene can be integrated within intron 1, 2, 3, or 4 of the endogenous SOD1 gene. Examples of pathogenic mutations in SOD1 include A5V, C7F, G13R, G17S, E22K, G38R, L39V, G42S, F46C, H47R, G73S, H81R, L85V, G86R, G94R, E101G, I105F, and L107V. Examples of non-pathogenic mutations include ClinVar accession number VCV000440292, VCV000256202, VCV000586633, and VCV000395173.


As defined herein, a RHO gene refers to a gene that produces the protein rhodopsin. A representative sequence of the RHO gene can be found with NCBI Reference Sequence: NC_000003.12 and corresponding SEQ ID NO:58. The exon and intron boundaries can be defined with the sequence provided in SEQ ID NO:58. Specifically, exon 1 includes the sequence from 1 to 456. Exon 2 includes the sequence from 2238 to 2406. Exon 3 includes the sequence from 3613 to 3778. Exon 4 includes the sequence from 3895 to 4134. Exon 5 includes the sequence from 4970 to 6706. Intron 1 includes the sequence from 457 to 2237. Intron 2 includes the sequence from 2407 to 3612. Intron 3 includes the sequence from 3779 to 3894. Intron 4 includes the sequence from 4135 to 4969. The methods described herein provide transgenes for integrating into the RHO gene. The transgenes can comprise a promoter, partial RHO coding sequence and splice donor, and the integration site can be within intron 1, 2, 3 or 4 of the endogenous RHO gene. Further the transgenes can comprise an RNAi cassette targeting the endogenous RHO transcripts, a promoter, a partial RHO coding sequence (resistant to silencing by the RNAi cassette, and a splice donor. The transgene can be integrated within intron 1, 2, 3 or 4 of the endogenous RHO gene. Also, the transgenes can comprise a splice acceptor, partial RHO coding sequence (resistant to silencing by an RNAi cassette), a terminator, and an RNAi cassette targeting the endogenous RHO transcripts. The transgene can be integrated within intron 1, 2, 3, or 4 of the endogenous RHO gene.


Examples of pathogenic mutations in RHO include ClinVar accession number VCV000013039, VCV000013031, VCV000013017, VCV000013042, VCV000013018, VCV000625297, VCV000013055, VCV000013013, VCV000013019, VCV000013047, VCV000013016, VCV000013020, VCV000013021, VCV000013045, VCV000013054, VCV000625301, VCV000013038, VCV000013022, VCV000013035, VCV000013048, VCV000373094, VCV000013028, VCV000279882, VCV000013024, VCV000013046, VCV000029875, VCV000013049, VCV000417867, VCV000013050, VCV000143080, VCV000625303, VCV000013025, VCV000196282, VCV000013033, VCV000590911, VCV000143081, VCV000013023, VCV000013026, VCV000013043, VCV000013027, VCV000013051, VCV000013034, VCV000013036, VCV000636084, VCV000013030, VCV000523376, VCV000013044, VCV000013029, VCV000419250, VCV000013056, VCV000013052, VCV000013015, VCV000013053, VCV000013032, VCV000013014, VCV000605502, VCV000605497, VCV000442401, VCV000442400, VCV000154258, and VCV000145614. Examples of non-pathogenic mutations include ClinVar accession number VCV000343272, VCV000256383, VCV000281512, VCV000256384, VCV000256382, VCV000343286, VCV000343290, VCV000343302, VCV000343303, VCV000343306, and VCV000606153.


As defined herein, a C9orf72 gene refers to a gene that produces a protein in various tissues and has been associated with amyotrophic lateral sclerosis. A representative sequence of the C9orf72 gene can be found with NCBI Reference Sequence: NG_031977.1 and corresponding SEQ ID NO:59. The exon and intron boundaries can be defined with the sequence provided in SEQ ID NO:59. Specifically, exon 1 includes the sequence from 1 to 158. Exon 2 includes the sequence from 6703 to 7190. Exon 3 includes the sequence from 8277 to 8336. Exon 4 includes the sequence from 11391 to 11486. Exon 5 includes the sequence from 12218 to 12282. Exon 6 includes the sequence from 13568 to 13640. Exon 7 includes the sequence from 15260 to 15376. Exon 8 includes the sequence from 17071 to 17306. Exon 9 includes the sequence from 23160 to 23217. Exon 10 includes the sequence from 25201 to 25310. Exon 11 includes the sequence from 25445 to 27321. Intron 1 includes the sequence from 159 to 6702. Intron 2 includes the sequence from 7191 to 8276. Intron 3 includes the sequence from 8337 to 11390. Intron 4 includes the sequence from 11487 to 12217. Intron 5 includes the sequence from 12283 to 13567. Intron 6 includes the sequence from 13641 to 15259. Intron 7 includes the sequence from 15377 to 17070. Intron 8 includes the sequence from 17307 to 23159. Intron 9 includes the sequence from 23218 to 25200. Intron 10 includes the sequence from 25311 to 25444. The methods described herein provide transgenes for integrating into the C9orf72 gene. The transgenes can comprise a promoter, partial C9orf72 coding sequence and splice donor, and the integration site can be within intron 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 of the endogenous C9orf72 gene. Further the transgenes can comprise an RNAi cassette targeting the endogenous C9orf72 transcripts, a promoter, a partial C9orf72 coding sequence (resistant to silencing by the RNAi cassette, and a splice donor. The transgene can be integrated within intron 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 of the endogenous C9orf72 gene. Also, the transgenes can comprise a splice acceptor, partial C9orf72 coding sequence (resistant to silencing by an RNAi cassette), a terminator, and an RNAi cassette targeting the endogenous C9orf72 transcripts. The transgene can be integrated within intron 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 of the endogenous C9orf72 gene. Examples of pathogenic mutations in C9orf72 include the duplication, triplication or quadruplication of the C9or72 gene, or expansion of the GGGGCC repeat. Examples of non-pathogenic mutations include ClinVar accession number VCV000366486, VCV000366521, VCV000366524, VCV000183033, and VCV000611705.


As defined herein, a CHRNA1 gene refers to a gene that produces the protein cholinergic receptor nicotinic alpha 1 subunit. A representative sequence of the CHRNA1 gene can be found with NCBI Reference Sequence: NG_008172.1. As defined herein, a CHRND gene refers to a gene that produces the protein cholinergic receptor nicotinic delta subunit. A representative sequence of the CHRND gene can be found with NCBI Reference Sequence: NG_008028.1. As defined herein, a CHRNE gene refers to a gene that produces the protein cholinergic receptor nicotinic epsilon subunit. A representative sequence of the CHRNE gene can be found with NCBI Reference Sequence: NG_008029.2. As defined herein, a CHRNB1 gene refers to a gene that produces the protein cholinergic receptor nicotinic beta 1 subunit. A representative sequence of the CHRNB1 gene can be found with NCBI Reference Sequence: NG_008026.1. As defined herein, a PRPS1 gene refers to a gene that produces the protein phosphoribosyl pyrophosphate synthetase 1. A representative sequence of the PRPS1 gene can be found with NCBI Reference Sequence: NG_008407.1. As defined herein, a LRRK2 gene refers to a gene that produces the protein leucine rich repeat kinase 2. A representative sequence of the LRRK2 gene can be found with NCBI Reference Sequence: NG_011709.1. As defined herein, a STIM1 gene refers to a gene that produces the protein stromal interaction molecule 1. A representative sequence of the STIM1 gene can be found with NCBI Reference Sequence: NG_016277.1. As defined herein, a FGFR3 gene refers to a gene that produces the protein fibroblast growth factor receptor 3. A representative sequence of the FGFR3 gene can be found with NCBI Reference Sequence: NG_012632.1. As defined herein, a MECP2 gene refers to a gene that produces the protein methyl-CpG binding protein 2. A representative sequence of the MECP2 gene can be found with NCBI Reference Sequence: NG_007107.2. As defined herein, an ATXN1 gene refers to a gene that produces the protein ataxin 1. A representative sequence of the ATXN1 gene can be found with NCBI Reference Sequence: NG_011571.1. As defined herein, an ATXN3 gene refers to a gene that produces the protein ataxin 3. A representative sequence of the ATXN3 gene can be found with NCBI Reference Sequence: NG_008198.2. As defined herein, a CACNA1A gene refers to a gene that produces the protein calcium voltage-gated channel subunit alphal A. A representative sequence of the CACNA1A gene can be found with NCBI Reference Sequence: NG_011569.1. As defined herein, an ATXN7 gene refers to a gene that produces the protein ataxin 7. A representative sequence of the ATXN7 gene can be found with NCBI Reference Sequence: NG_008227.1. As defined herein, a TBP gene refers to a gene that produces the protein TATA-box binding protein. A representative sequence of the TBP gene can be found with NCBI Reference Sequence: NG_008165.1. As defined herein, an HTT gene refers to a gene that produces the protein huntingtin. A representative sequence of the HTT gene can be found with NCBI Reference Sequence: NG_009378.1. As defined herein, an AR gene refers to a gene that produces the protein androgen receptor. A representative sequence of the AR gene can be found with NCBI Reference Sequence: NG_009014.2. As defined herein, an FXN gene refers to a gene that produces the protein frataxin. A representative sequence of the FXN gene can be found with NCBI Reference Sequence: NG_008845.2. As defined herein, a DMPK gene refers to a gene that produces the protein DM1 protein kinase. A representative sequence of the DMPK gene can be found with NCBI Reference Sequence: NG_009784.1. As defined herein, a PABPN1 gene refers to a gene that produces the protein poly(A) binding protein nuclear 1. A representative sequence of the PABPN1 gene can be found with NCBI Reference Sequence: NG_008239.1. As defined herein, an ATXN8 gene refers to a gene that produces the protein ataxin 8. A representative sequence of the ATXN8 gene can be found at the genomic coordinates (GRCh38): 13:54,700,000-72,800,000.


As described herein, the term “silencing-resistant partial coding sequence” refers to a partial coding sequence with mutations compared to the homologous sequence from the corresponding endogenous gene, wherein the mutations are designed to prevent or reduce silencing by a corresponding RNAi cassette. The mutations can be the insertion, substitution, or deletion of nucleotides within the DNA sequence which encodes the target RNA sequence. The mutations can be sufficient to prevent or reduce hybridization of a short RNA molecule to the RNA transcript.


As defined herein, “lack of the sequence” when referring to a silencing-resistant partial coding sequence refers to the deletion of one or more nucleotides within the corresponding RNAi target site. For example, if the RNAi targets the transcript produced by the sequence GGTATCAAGACTACGAAC (within the exon of an endogenous gene), then this sequence can also be present within the partial coding sequence of the transgenes described herein. To prevent silencing of modified genes, the RNAi target sequence within the partial coding sequence within the transgene can be modified. Specifically, the site can be mutated by insertion, substitution or deletion of nucleotides within the site. If the mutation is a deletion, then one or more of the nucleotides can be deleted. In instances where the nucleotides are deleted, it is preferred that the deletion is designed to be an in-frame deletion which doesn't eliminate protein function.


As defined herein, “administering” can refer to the delivery, the providing, or the introduction of exogenous molecules into a cell. If a transgene or a rare-cutting endonuclease is administered to a cell, then the transgene or rare-cutting endonuclease is delivered to, provided to, or introduced into the cell. The rare-cutting endonuclease can be administered as purified protein, nucleic acid, or a mixture of purified protein and nucleic acid. The nucleic acid (i.e., RNA or DNA), can encode for the rare-cutting endonuclease, or a part of a rare-cutting endonuclease (e.g., a gRNA). The administering can be achieved though methods such as lipid-mediated transfer, electroporation, direct injection, cell fusion, particle bombardment, calcium phosphate co-precipitation, DEAE-dextran-mediated transfer, viral vector-mediated transfer, or any means suitable of delivering purified protein or nucleic acids, or a mixture of purified protein and nucleic acids, to a cell.


The percent sequence identity between a particular nucleic acid or amino acid sequence and a sequence referenced by a particular sequence identification number is determined as follows. First, a nucleic acid or amino acid sequence is compared to the sequence set forth in a particular sequence identification number using the BLAST 2 Sequences (Bl2seq) program from the stand-alone version of BLASTZ containing BLASTN version 2.0.14 and BLASTP version 2.0.14. This stand-alone version of BLASTZ can be obtained online at fr.com/blast or at ncbi.nlm.nih.gov. Instructions explaining how to use the Bl2seq program can be found in the readme file accompanying BLASTZ. Bl2seq performs a comparison between two sequences using either the BLASTN or BLASTP algorithm. BLASTN is used to compare nucleic acid sequences, while BLASTP is used to compare amino acid sequences. To compare two nucleic acid sequences, the options are set as follows: -i is set to a file containing the first nucleic acid sequence to be compared (e.g., C:\seq1.txt); -j is set to a file containing the second nucleic acid sequence to be compared (e.g., C:\seq2.txt); -p is set to blastn; -o is set to any desired file name (e.g., C:\output.txt); -q is set to -1; -r is set to 2; and all other options are left at their default setting. For example, the following command can be used to generate an output file containing a comparison between two sequences: C:\Bl2seq -i c:\seq1.txt -j c:\seq2.txt -p blastn -o c:\output.txt -q -1 -r 2. To compare two amino acid sequences, the options of Bl2seq are set as follows: -i is set to a file containing the first amino acid sequence to be compared (e.g., C:\seq1.txt); -j is set to a file containing the second amino acid sequence to be compared (e.g., C:\seq2.txt); -p is set to blastp; -o is set to any desired file name (e.g., C:\output.txt); and all other options are left at their default setting. For example, the following command can be used to generate an output file containing a comparison between two amino acid sequences: C:\Bl2seq -i c:\seq1.txt -j c:\seq2.txt -p blastp -o c:\output.txt. If the two compared sequences share homology, then the designated output file will present those regions of homology as aligned sequences. If the two compared sequences do not share homology, then the designated output file will not present aligned sequences.


Once aligned, the number of matches is determined by counting the number of positions where an identical nucleotide or amino acid residue is presented in both sequences. The percent sequence identity is determined by dividing the number of matches either by the length of the sequence set forth in the identified sequence, or by an articulated length (e.g., 100 consecutive nucleotides or amino acid residues from a sequence set forth in an identified sequence), followed by multiplying the resulting value by 100. The percent sequence identity value is rounded to the nearest tenth.


Bidirectional Gene Repair System with Promoter(s)


In one embodiment, this document features transgenes and methods for modifying the 5′ end of endogenous genes. The transgenes can comprise a first and second promoter, wherein the first promoter is operably linked to a first partial coding sequence, and the second promoter is operably linked to a second partial coding sequence. The first and second partial coding sequences can be operably linked to a first and second splice donor sequence, respectively (FIG. 1). The first promoter, first partial coding sequence and first splice donor can be positioned in a head-to-head orientation with the second promoter, second partial coding sequence and second splice donor. This transgene can be integrated into an endogenous gene within an intron or at an exon-intron junction. In some embodiments, the transgenes can be integrated into an endogenous gene using rare-cutting endonucleases or transposons. In one embodiment, transgenes comprising a first and second promoter, a first and second partial coding sequence, and a first and second splice donor can be flanked by additional sequence, such as viral inverted terminal repeats (e.g., adeno-associated virus inverted repeats). These transgenes can be integrated into endogenous genes through a targeted double-strand break using a rare-cutting endonuclease.


In another embodiment, transgenes comprising a first and second promoter, a first and second partial coding sequence, and a first and second splice donor can be flanked by a first and second rare-cutting endonuclease target site. These transgenes can be integrated into endogenous genes through a targeted double-strand break using one or more rare-cutting endonucleases, wherein the one or more rare-cutting endonucleases cleave a sequence within the endogenous gene and cleave the flanking target sites within the transgene.


In another embodiment, transgenes comprising a first and second promoter, a first and second partial coding sequence, and a first and second splice donor can be flanked by a first and second homology arm. These transgenes can be integrated into endogenous genes through a targeted double-strand break using one or more rare-cutting endonucleases, wherein the one or more rare-cutting endonucleases cleave the endogenous gene.


In another embodiment, transgenes comprising a first and second promoter, a first and second partial coding sequence, and a first and second splice donor can be flanked by a first and second homology arm and a first and second rare-cutting endonuclease target site. These transgenes can be integrated into endogenous genes through a targeted double-strand break using one or more rare-cutting endonucleases, wherein the one or more rare-cutting endonucleases cleave a sequence within the endogenous gene and cleave the flanking target sites within the transgene. The first and second target sites within the vector can flank the first and second homology arm. Alternative, the first target site or second target site, or booth the first and second target sites, can be within a homology arm.


In another embodiment, transgenes comprising a first and second promoter, a first and second partial coding sequence, and a first and second splice donor can be flanked by a left and right transposon end. These transgenes can be integrated into endogenous genes through transposition using a transposase. As described herein, the transposase can be a CRISPR-associated transposase.


In some embodiments, the first and second promoters can be replaced with a bidirectional promoter. In other embodiments, the transgenes can further comprise a first and second terminator positioned in a tail-to-tail orientation between the first and second promoters (FIG. 1). Alternatively, the first and second terminator can be substituted with a bidirectional terminator.


In one embodiment, this document features methods for modifying the 5′ end of endogenous genes, where the endogenous genes have at least one intron between two coding exons. The intron can be any intron which is removed from precursor messenger RNA by normal messenger RNA processing machinery. The intron can be between 20 bp and >500 kb and comprise elements including a splice donor site, branch sequence, and acceptor site. The transgenes disclosed herein for the modification of the 5′ end of endogenous genes can comprise multiple functional elements, including target sites for rare-cutting endonucleases, homology arms, splice acceptor sequences, coding sequences, promoters and transcriptional terminators (FIG. 1).


In embodiments, the location for integration of the transgenes can be an intron or an intron-exon junction. When targeting an intron, the partial coding sequence can comprise sequence encoding the peptide produced by the exons preceding said intron within the endogenous gene. For example, if the transgene is designed to be integrated in intron 2 of an endogenous gene with 12 exons, then the partial coding sequence can encode the peptide produced by exons 1 and 2 of the endogenous gene. When targeting an exon-intron junction, the transgene can be integrated at the exon-intron junction such that the intron sequence is preserved. In one embodiment, following integration, the intron sequence is preserved and the upstream exon sequence is preserved (i.e., the nucleotides from the transgene are added between the last nucleotide in the exon and first nucleotide in the intron). Alternatively, in one embodiment, following integration, the intron sequence is preserved but one or more nucleotides in the exon sequence are removed.


In one embodiment, the transgene comprises two target sites for rare-cutting endonucleases. The target sites can be a suitable sequence and length for cleavage by a rare-cutting endonuclease. The target site can be amenable to cleavage by CRISPR systems, TAL effector nucleases, zinc-finger nucleases or meganucleases, or a combination of CRISPR systems, TALE nucleases, zinc finger nucleases or meganucleases, or any other rare-cutting endonuclease. The target sites can be positioned such that cleavage by the rare-cutting endonuclease results in liberation of a transgene from a vector. The vector can include viral vectors (e.g., adeno-associated vectors) or non-viral vectors (e.g., plasmids, minicircle vectors). If the transgene comprises two target sites, the target sites can be the same sequence (i.e., targeted by the same rare-cutting endonuclease) or they can be different sequences (i.e., targeted by two or more different rare-cutting endonucleases).


In some embodiments, the transgenes provided herein can be integrated with transposases. The transposases can include CRISPR transposases (Strecker et al., Science 10.1126/science.aax9181, 2019; Klompe et al., Nature, 10.1038/s41586-019-1323-z, 2019). The transposases can be used in combination with a transgene comprising, a first and second splice acceptor sequence, a first and second coding sequence, one bidirectional terminator or a first and second terminator (FIG. 1), and a transposon left end and right end. The CRISPR transposases can include the TypeV-U5, C2C5 CRISPR protein, Cas12k, along with proteins tnsB, tnsC, and tniQ. In some embodiments, the Cas12k can be from Scytonema hofmanni (SEQ ID NO:30) or Anabaena cylindrica (SEQ ID NO:31). In one embodiment, the transgenes described herein comprising a left (SEQ ID NO:32) and right transposon end (SEQ ID NO:33) can be delivered to cells along with ShCas12k, tnsB, tnsC, TniQ and a gRNA (SEQ ID NO:44). Alternatively, the CRISPR transposase can include the Cas6 protein, along with helper proteins including Cas7, Cas8 and TniQ. In one embodiment, the transgenes described herein comprising a left (SEQ ID NO:41) and right transposon end (SEQ ID NO:43) can be delivered to eukaryotic cells along with Cas6 (SEQ ID NO:37), Cas7 (SEQ ID NO:36), Cas8 (SEQ ID NO:35), TniQ (SEQ ID NO:34), TnsA (SEQ ID NO:38), TnsB (SEQ ID NO:39), TnsC (SEQ ID NO:40) and a gRNA (SEQ ID NO:42). The proteins can be administered to cells directly as purified protein, or encoded on RNA or DNA. If encoded on RNA or DNA, the sequence can be codon optimized for expression in eukaryotic cells. The gRNA (SEQ ID NO:42) can be placed downstream of an RNA polIII promoter and terminated with a poly(T) terminator.


In one embodiment, the transgene comprises a first and second target site along with a first and second homology arm. The first and second homology arms can include sequence that is homologous to a genomic sequence at or near the desired site of integration. The homology arms can be a suitable length for participating in homologous recombination with sequence at or near the desired site of integration. The length of each homology arm can be between 50 nt and 10,000 nt (e.g., 50 nt, 100 nt, 200 nt, 300 nt, 400 nt, 500 nt, 600 nt, 700 nt, 800 nt, 900 nt, 1,000 nt, 2,000 nt, 3,000 nt, 4,000 nt, 5,000 nt, 6,000 nt, 7,000 nt, 8,000 nt, 9,000 nt, 10,000 nt). In one embodiment, a homology arm can comprise functional elements, including a target site for a rare-cutting endonuclease. In one embodiment, a first homology arm (e.g., a left homology arm) can comprise sequence homologous to the exon or intron being targeted, and a second homology arm can comprise sequence homologous to genomic sequence downstream of the first homology arm. The first homology arm must not possess splice acceptor functions relative to the direction of transcription from the promoter on the transgene. To determine if a sequence comprises splice acceptor functions, several steps can be taken, including in silico analysis and experimental tests. To determine if there is potential for splice acceptor functions, the sequence desired for second homology arm can be searched for consensus branch sequences (e.g., YTRAC) and splice acceptor sites (e.g., Y-rich NCAGG). If branch or splice acceptor sequences are present, single nucleotide polymorphisms can be introduced to destroy function, or a different but adjacent sequence not comprising such sequences can be selected. To experimentally determine if the first homology arm possesses splice acceptor function, a synthetic construct comprising the first homology arm within an intron within a reporter gene can be constructed. The construct can then be administered to an appropriate cell type and monitored for splicing function by assessing reporter gene activity.


In one embodiment, the transgene comprises two splice donor sequences, referred to herein as the first and second splice donor sequence. The first and second splice donor sequences are positioned within the transgene in opposite directions (i.e., in head-to-head orientations) and flanking internal sequences (i.e., partial coding sequences and promoters). When the transgene is integrated into an intron in forward or reverse directions, the splice donor sequences facilitate the initiation of intron splicing within the corresponding pre-mRNA. The first and second splice donor sequences can be the same sequences or different sequences. One or both splice donor sequences can be the splice donor sequence of the intron where the transgene is to be integrated. One or both splice donor sequences can be a synthetic splice donor sequence or a splice donor sequence from an intron from a different gene.


In one embodiment, the transgene comprises a first and second coding sequence operably linked to the first and second splice donor sequences. The first and second coding sequences are positioned within the transgene in opposite directions (i.e., in head-to-head orientations). When the transgene is integrated into an endogenous gene in forward or reverse directions, the first and second coding sequences are transcribed into mRNA by promoters located within the transgene. The coding sequences can be designed to correct defective coding sequences, introduce mutations, or introduce novel peptide sequences. The first and second coding sequence can be the same nucleic acid sequence and code for the same protein. Alternatively, the first and second coding sequence can be different nucleic acid sequences and code for the same protein (i.e., using the degeneracy of codons). The coding sequence can encode purification tags (e.g., glutathione-S-transferase, poly(His), maltose binding protein, Strep-tag, Myc-tag, AviTag, HA-tag, or chitin binding protein) or reporter proteins (e.g., GFP, RFP, lacZ, cat, luciferase, puro, neomycin).


In one embodiment, the methods and compositions described herein can be used to modify the 5′ end of an endogenous gene, thereby resulting in modification of the N-terminus of the protein encoded by the endogenous gene. The modification of the 5′ end of the endogenous gene's coding sequence can include the replacement of the first coding exon up to an exon that is between the first exon and the final exon. For example, if a gene comprises 12 exons, the modification can include replacement of exon 1, or 1-2, or 1-3, or 1-4, or 1-5, or 1-6, or 1-7, or 1-8, or 1-9 or 1-10, or 1-11. In one embodiment, the endogenous exons being replaced can be replaced with similar sequence. For example, the transgene's first or second coding sequence can comprise exon 1, or 1-2, or 1-3, or 1-4, or 1-5, or 1-6, or 1-7, or 1-8, or 1-9 or 1-10, or 1-11. The transgene can be integrated within the endogenous gene in an intron downstream of the exon that is the last exon within the transgene's coding sequence (FIG. 3). Alternatively, the transgene can be integrated within an exon corresponding to the last exon within the transgene's coding sequence (FIG. 8). The transgene can be designed to be 4.7 kb or less, and incorporated into an AAV vector and particle, and delivered in vivo to target cells.


In one embodiment, the transgene can comprise a bidirectional promoter, or a first and second promoter, operably linked to a first and second coding sequence. The bidirectional promoter, or the first and second promoters are positioned within the transgene in opposite directions (i.e., in head-to-head orientations). When the transgene is integrated into an endogenous gene in forward or reverse directions, the bidirectional promoter, or first and second promoters, initiate transcription of the first and second coding sequences. The first and second promoters can be the same promoter or different promoters.


In one embodiment, the transgene can comprise a bidirectional promoter, or a first and second promoter, operably linked to a first and second coding sequence. The bidirectional promoter, or the first and second promoters are positioned within the transgene in opposite directions (i.e., in head-to-head orientations). When the transgene is integrated into an endogenous gene in forward or reverse directions, the bidirectional promoter, or first and second promoters, initiate transcription of the first and second coding sequences. The first and second promoters can be the same promoter or different promoters. The promoters can be, for example, selected from CMV, EF1 alpha, SV40, PGK1, Ubc, human beta actin, CAG, or any promoter with sufficient activity to initiate transcription of the partial coding sequence. Without being bound by theory, the promoter in the reverse direction may cause the creation of double-stranded RNA, thereby resulting in silencing of gene expression upstream of the site of integration. Further, the promoter in forward direction may initiate transcription of RNA that is not subject to the same silencing (e.g., due to codon degeneracy of the coding sequence). Described herein are also methods for reducing potential RNAi from the RNA produced by the promoter in the reverse direction (FIG. 5).


In one embodiment, the transgene can comprise a bidirectional terminator, or a first and second terminator between a first and second promoter (FIG. 1). The bidirectional terminator, or the first and second terminators are positioned within the transgene in opposite directions (i.e., in tail-to-tail orientations). When the transgene is integrated into an endogenous gene in forward or reverse directions, the bidirectional terminator, or first and second terminators, terminate transcription from the endogenous gene's promoter. The first and second terminators can be the same terminators or different terminators.


In one embodiment, this document provides a transgene comprising a first and second rare-cutting endonuclease target site, a first and second splice donor sequence, a first and second coding sequence, and one bidirectional promoter or a first and second promoter. The transgene can be integrated in endogenous genes via non-homology dependent methods, including non-homologous end joining and alternative non-homologous end joining or by microhomology-mediated end joining. In one aspect, the transgene is integrated into an intron within the endogenous gene (FIG. 2).


In another embodiment, this document provides a transgene comprising a first and second homology arm, a first and second rare-cutting endonuclease target site, a first and second splice donor sequence, a first and second coding sequence, and one bidirectional promoter or a first and second promoter. The transgene can be integrated into endogenous genes via both homology dependent methods (e.g., synthesis dependent strand annealing and microhomology-mediated end joining) and non-homology dependent methods (e.g., non-homologous end joining and alternative non-homologous end joining). In one aspect, the transgene is integrated into an intron within the endogenous gene (FIG. 3). In another aspect, the transgene is integrated within an exon of the endogenous gene (FIG. 8).


In another embodiment, this document provides a transgene comprising a first and second homology arm, a first and second splice donor sequence, a first and second coding sequence, and one bidirectional promoter or a first and second promoter (FIG. 1). In another embodiment, this document provides a transgene comprising, a first and second coding sequence, a first and second splice donor sequence, and one bidirectional promoter or a first and second promoter.


In another embodiment, this document provides a transgene comprising a first and second homology arm, a first and second coding sequence, a first and second splice donor sequence, one bidirectional terminator or a first and second terminator, and a first and second additional sequence (FIG. 1). The additional sequence can be any additional sequence that is present on the transgene at the 5′ and 3′ ends, however, the additional sequence should not comprise any element that functions as a splice acceptor or splice donor. The additional sequence can be, for example, inverted terminal repeats of an adeno-associated virus genome, or left and right transposon ends.


In another embodiment, this document provides transgenes within viral vectors, including adeno-associated viruses and adenoviruses, where the transgene comprises a first and second splice donor sequence, a first and second coding sequence, and one bidirectional terminator or a first and second terminator. Due to the inverted terminal repeats of the viral vectors, the transgenes also comprise a first and second additional sequence.


In another embodiment, this document provides transgenes within viral vectors, including adeno-associated viruses and adenoviruses, where the transgene comprises a first and second homology arm, a first and second splice donor sequence, a first and second coding sequence, and one bidirectional promoter or a first and second promoter. Due to the inverted terminal repeats of the viral vectors, the transgenes also comprise a first and second additional sequence.


In another aspect, the transgene for integration can be designed to integrate through multiple repair pathways while creating a desired effect with each outcome. By way of example, a transgene can comprise a first and second arm homology arm, a first and second rare-cutting endonuclease target site, a first and second coding sequence, a first and second promoter, and can be harbored within an AAV genome (i.e., flanked by 145 nucleotide inverted terminal repeats). Following expression by a rare-cutting endonuclease, the following outcomes can occur: 1) integration of the entire AAV genome at the target site by NHEJ in either forward or reverse orientation, 2) integration of the sequence between the first and second rare-cutting endonuclease target sites at the target site by NHEJ in either forward or reverse orientation, 3) integration by HR using the first and second homology arms, or 4) any combination of the above outcomes. Following integration with any of the above-mentioned outcomes, the transgene described herein can correct or alter the protein sequence produced by the endogenous gene.


In some embodiments, the transgenes described herein can have a combination of elements including splice donors, partial coding sequences, promoters, homology arms, left and right transposase ends, and sites for cleavage by rare-cutting endonucleases. In one embodiment, the combination can be, from 5′ to 3′, In some embodiments, the transgenes described herein can have a combination of elements including splice acceptors, partial coding sequences, terminators, homology arms, left and right transposase ends, and sites for cleavage by rare-cutting endonucleases.


In one embodiment, the combination can be, from 5′ to 3′, [splice donor 1 RC]-[partial coding sequence 1 RC]-[promoter 1 RC]-[promoter 2]-[partial coding sequence 2]-[splice donor 2], where RC stands for reverse complement. This combination can be harbored on a linear DNA molecule or AAV molecule and can be integrated by NHEJ through a targeted break in the target gene.


In another embodiment, the combination can be, from 5′ to 3′, [rare-cutting endonuclease cleavage site 1]-[splice donor 1 RC]-[partial coding sequence 1 RC]-[promoter 1 RC]-[promoter 2]-[partial coding sequence 2]-[splice donor 2]-[rare-cutting endonuclease cleavage site 2].


In another embodiment, the combination can be, from 5′ to 3′, [rare-cutting endonuclease cleavage site 1]-[homology arm 1]-[splice donor 1 RC]-[partial coding sequence 1 RC]-[promoter 1 RC]-[promoter 2]-[partial coding sequence 2]-[splice donor 2]-[homology arm 2]-[rare-cutting endonuclease cleavage site 2]. In this combination one or more rare-cutting endonucleases can be used to facilitate HR and NHEJ. For example, a single rare-cutting nuclease can cleave the target gene (i.e., a desired intron) and the cleavage sites flanking the homology arms can be designed to be the same target sequence within the intron.


In another embodiment, the combination can be, from 5′ to 3′, [homology arm 1+rare-cutting endonuclease cleavage site 1]-[splice donor 1 RC]-[partial coding sequence 1 RC]-[promoter 1 RC]-[promoter 2]-[partial coding sequence 2]-[splice donor 2]-[homology arm 2]-[rare-cutting endonuclease cleavage site 2]. In this combination, one or more rare-cutting endonucleases can facilitate HR and NHEJ. For example, a single-rare cutting nuclease can cleave within homology arm 1, downstream of homology arm 2, and at the genomic target site (i.e., at the site with homology to the sequence in the homology arm 1).


In another embodiment, the combination can be from 5′ to 3′, [left end for a transposase]-[splice donor 1 RC]-[partial coding sequence 1 RC]-[promoter 1 RC]-[promoter 2]-[partial coding sequence 2]-[splice donor 2]-[right end for a transposase]. In all embodiments, the splice donor 1 and splice donor 2 can be the same or different sequences; the partial coding sequence 1 and partial coding sequence 2 can be the same or different sequences; the promoter 1 and promoter 2 can be the same or different sequences.


In embodiments, a transgene comprising the structure [rare-cutting endonuclease cleavage site 1]-[homology arm 1]-[splice donor 1 RC]-[partial coding sequence 1]-[promoter 1 RC]-[promoter 2]-[partial coding sequence 2]-[splice donor 2]-[homology arm 2]-[rare-cutting endonuclease cleavage site 2] can be integrated into the DNA through delivery of one or more rare-cutting endonucleases. If one rare-cutting endonuclease is delivered, the rare-cutting endonuclease can liberate the transgene by cleavage at the rare-cutting endonuclease cleavage site 1 and 2. Further, the same rare-cutting endonuclease can create a break within the target gene, simulating insertion through HR or NHEJ.


In other embodiments, a transgene comprising the structure [homology arm 1+rare-cutting endonuclease cleavage site 1]-[splice donor 1 RC]-[partial coding sequence 1]-[promoter 1 RC]-[promoter 2]-[partial coding sequence 2]-[splice donor 2]-[homology arm 2]-[rare-cutting endonuclease cleavage site 1] can be integrated into the DNA thorough delivery of one or more rare-cutting endonucleases. If one rare-cutting endonuclease is delivered, the rare-cutting endonuclease can liberate the transgene by cleavage at the rare-cutting endonuclease cleavage site 1 and 2. Further, the same rare-cutting endonuclease can create a break within the target gene, simulating insertion through HR or NHEJ. Integration by HR can occur when cleavage is upstream of the site of integration (i.e., within a homology arm).


In embodiments, the partial coding sequences can be codon adjusted. The codon adjustment can be aimed at 1) reducing double-stranded RNA pairing (FIG. 5), and 2) optimizing protein expression. If a transgene comprising a first and second partial coding sequence operably linked to a first and second promoter is integrated into an endogenous gene, and the first and second partial coding sequences are homologous to each other and the endogenous gene, then double-stranded RNA may be produced (FIG. 5). The partial coding sequences can be codon adjusted to minimize RNA pairing. In one embodiment, the codon optimization can be complete and different for the first and second partial coding sequences. For example, partial coding sequence 1 can have a different nucleotide sequence than partial coding sequence 2, and both partial coding sequences 1 and 2 can be a different sequence than the corresponding sequence within the endogenous gene-of-interest.


In another embodiment, the codon optimization can be split between the first and second partial coding sequences. For example, the first partial coding sequence can have a mixture of non-codon adjusted sequence (i.e., homologous to the corresponding sequence within the endogenous gene-of-interest) and codon adjusted sequence. In this example, the second partial coding sequence can have the opposite adjustment. For example, within a 200 nucleotide partial coding sequence 1 and 2, the nucleotides 1-100 of partial coding sequence 1 can be homologous to the sequence within the endogenous gene-of-interest, and the nucleotides 101-200 can be codon adjusted to have minimal sequence similarities to the endogenous gene-of-interest; the nucleotides 1-100 of partial coding sequence 2 can be codon adjusted to have minimal sequence similarities to the endogenous gene-of-interest, and nucleotides 101-200 can be homologous to the sequence within the endogenous gene-of-interest.


In one embodiment, the genomic modification is the insertion of a transgene in the endogenous ATXN2 genomic sequence. The transgene can include a partial coding sequence for the ATXN2 protein. The partial coding sequence can be homologous to coding sequence within a wild type ATXN2 gene, or a functional variant of the wild type ATXN2 gene, a codon adjusted version of the ATXN2 gene, or a mutant ATXN2 gene. In one embodiment, the transgene encoding the partial ATXN2 protein is inserted into intron 1 of the endogenous ATXN2 gene (FIGS. 3 and 4).


In one embodiment, the transgenes provided herein comprises a first and second partial coding sequence encoding the peptide produced by exon 1 of the ATXN2 gene (FIG. 7). The transgenes can be integrated within the endogenous ATXN2 gene within intron 1 or at the exon 1 intron 1 junction. This embodiment is particularly useful in cells comprising an expanded trinucleotide repeat in exon 1 of ATXN2.


The methods and compositions provided herein can be used to modify genes encoding proteins within cells. The endogenous proteins can include, fibrinogen, prothrombin, tissue factor, Factor V, Factor VII, Factor VIII, Factor IX, Factor X, Factor XI, Factor XII (Hageman factor), Factor XIII (fibrin-stabilizing factor), von Willebrand factor, prekallikrein, high molecular weight kininogen (Fitzgerald factor), fibronectin, antithrombin III, heparin cofactor II, protein C, protein S, protein Z, protein Z-related protease inhibitor, plasminogen, alpha 2-antiplasmin, tissue plasminogen activator, urokinase, plasminogen activator inhibitor-1, plasminogen activator inhibitor-2, glucocerebrosidase (GBA), α-galactosidase A (GLA), iduronate sulfatase (IDS), iduronidase (IDUA), acid sphingomyelinase (SMPD1), MMAA, MMAB, MMACHC, MMADHC (C2orf25), MTRR, LMBRD1, MTR, propionyl-CoA carboxylase (PCC) (PCCA and/or PCCB subunits), a glucose-6-phosphate transporter (G6PT) protein or glucose-6-phosphatase (G6Pase), an LDL receptor (LDLR), ApoB, LDLRAP-1, a PCSK9, a mitochondrial protein such as NAGS (N-acetylglutamate synthetase), CPS1 (carbamoyl phosphate synthetase I), and OTC (ornithine transcarbamylase), ASS (argininosuccinic acid synthetase), ASL (argininosuccinase acid lyase) and/or ARG1 (arginase), and/or a solute carrier family 25 (SLC25A13, an aspartate/glutamate carrier) protein, a UGT1A1 or UDP glucuronsyltransferase polypeptide A1, a fumarylacetoacetate hydrolyase (FAH), an alanine-glyoxylate aminotransferase (AGXT) protein, a glyoxylate reductase/hydroxypyruvate reductase (GRHPR) protein, a transthyretin gene (TTR) protein, an ATP7B protein, a phenylalanine hydroxylase (PAH) protein, an USH2A protein, an ATXN protein, and a lipoprotein lyase (LPL) protein.


The transgene can include sequence for modifying an endogenous gene that harbors a loss-of-function or gain-of-function mutation. The mutation can include those that result in the following genetic diseases: achondroplasia, achromatopsia, acid maltase deficiency, adenosine deaminase deficiency, adrenoleukodystrophy, aicardi syndrome, alpha-1 antitrypsin deficiency, alpha-thalassemia, androgen insensitivity syndrome, pert syndrome, arrhythmogenic right ventricular dysplasia, ataxia telangictasia, barth syndrome, beta-thalassemia, blue rubber bleb nevus syndrome, canavan disease, chronic granulomatous diseases (CGD), cri du chat syndrome, cystic fibrosis, dercum's disease, ectodermal dysplasia, fanconi anemia, fibrodysplasia ossificans progressive, fragile X syndrome, galactosemis, generalized gangliosidoses (e.g., GM1), hemochromatosis, the hemoglobin C mutation in the 6th codon of beta-globin (HbC), hemophilia, Huntington's disease, hypophosphatasia, Klinefleter syndrome, Krabbes Disease, Langer-Giedion Syndrome, leukocyte adhesion deficiency, leukodystrophy, long QT syndrome, Marfan syndrome, Moebius syndrome, mucopolysaccharidosis (MPS), nail patella syndrome, nephrogenic diabetes insipdius, neurofibromatosis, Neimann-Pick disease, osteogenesis imperfecta, porphyria, Prader-Willi syndrome, progeria, Proteus syndrome, retinoblastoma, Rett syndrome, Rubinstein-Taybi syndrome, Sanfilippo syndrome, severe combined immunodeficiency (SCID), Shwachman syndrome, sickle cell disease (sickle cell anemia), Smith-Magenis syndrome, Stickler syndrome, Tay-Sachs disease, Thrombocytopenia Absent Radius (TAR) syndrome, Treacher Collins syndrome, trisomy, tuberous sclerosis, Turner's syndrome, urea cycle disorder, von Hippel-Landau disease, Waardenburg syndrome, Williams syndrome, Wilson's disease, Wiskott-Aldrich syndrome, X-linked lymphoproliferative syndrome, lysosomal storage diseases (e.g., Gaucher's disease, GM1, Fabry disease and Tay-Sachs disease), von Willebrand disease, usher syndrome, polycystic kidney disease, spinocerebellar ataxia type 2, spinal and bulbar muscular atrophy, Friedreich's ataxia, and myotonic dystrophy type 2.


As described herein, the transgenes can be harbored within a viral or non-viral vector. The vectors can be in the form of circular or linear double-stranded or single stranded DNA. The donor molecule can be conjugated or associated with a reagent that facilitates stability or cellular update. The reagent can be lipids, calcium phosphate, cationic polymers, DEAE-dextran, dendrimers, polyethylene glycol (PEG) cell penetrating peptides, gas-encapsulated microbubbles or magnetic beads. The donor molecule can be incorporated into a viral particle. The virus can be retroviral, adenoviral, adeno-associated vectors (AAV), herpes simplex, pox virus, hybrid adenoviral vector, epstein-bar virus, lentivirus, or herpes simplex virus.


Gene Repair Systems with RNAi Cassettes


In another embodiment, the methods described herein can be used to silencing endogenous genes while simultaneously replacing the lost RNA/protein due to the silencing. In one embodiment, the method can include administering to a cell a transgene, where the transgene comprises two functional elements: 1) a silencing sequence and 2) a full coding sequence that encodes a protein homologous to the silenced protein (FIG. 9) but is resistant to silencing. The two functional elements can be on separate transgenes or on the same transgene. In another embodiment, the method can include administering to a cell a transgene, where the transgene is integrated into an endogenous gene-of-interest and comprises 1) a silencing sequence and 2) a partial or full coding sequence for the repair of a mutant gene, but resistant to silencing (FIGS. 12-17).


The silencing sequence can comprise a promoter, a nucleic acid sequence that functions to silence a target nucleic acid, and a terminator. The nucleic acid sequence can be in a format capable of inducing gene silencing within a target nucleic acid (e.g., microRNA, hairpin RNA, antisense RNA). The nucleic acid sequence can be targeted to different regions in the target gene's mRNA, including the 5′ UTR, coding sequence, or 3′ UTR.


In one embodiment, this document describes methods to silence and replace production of a protein-of-interest by administering to a cell the transgenes described in FIG. 13, and integrating said transgenes into the endogenous gene-of-interest. In one embodiment, the transgenes can comprise a splice acceptor, a partial coding sequence (which is resistant to silencing), a terminator, and an RNAi cassette designed to silence an endogenous gene-of-interest. The splice acceptor can be operably linked to the partial coding sequence which can be operably linked to the terminator. The splice acceptor, partial coding sequence, terminator, and RNAi cassette can be flanked with a first and second homology arm, or a left and right transposon end. The transgenes can be integrated into an intron within the endogenous gene-of-interest or at an intron-exon junction within the endogenous gene-of-interest. The partial coding sequence can encode the remaining peptide sequence, relative to the position where the transgene is integrated. For example, if the transgene is integrated into intron 3 of a gene comprising 5 exons (FIG. 13), then the partial coding sequence can encode the peptide produced by exons 4 and 5 of the endogenous gene. The RNAi cassette within these transgenes can be targeted to sequence within exons 4 or 5 or the 3′ UTR. Accordingly, the corresponding target site within the partial coding sequence within the transgene can be modified to prevent silencing of the modified endogenous allele. In other embodiments, the transgenes can comprise a first and second splice acceptor, a first and second partial coding sequence (which are both resistant to silencing), a first and second terminator, and an RNAi cassette. These transgenes can be flanked by additional sequences (e.g., viral ITRs), a first and second rare-cutting endonuclease target site, a left and right transposon end, or both a first and second homology arm and a first and second rare-cutting endonuclease target site. In one embodiment, the transgene structure can be, from 5′ to 3′, [homology arm 1]-[splice acceptor]-[partial coding sequence]-[terminator]-[RNAi cassette]-[homology arm 2]. In another embodiment, the transgene structure can be, from 5′ to 3′, [left end for transposase]-[splice acceptor]-[partial coding sequence]-[terminator]-[RNAi cassette]-[right end for transposase]. In another embodiment, the transgene structure can be, from 5′ to 3′, [additional sequence 1]-[splice acceptor 1]-[partial coding sequence 1]-[terminator 1]-[RNAi cassette]-[terminator 2 RC]-[partial coding sequence 2 RC]-[splice acceptor 2 RC]-[additional sequence 2]. In another embodiment, the transgene structure can be, from 5′ to 3′, [rare-cutting endonuclease target site 1]-[splice acceptor 1]-[partial coding sequence 1]-[terminator 1]-[RNAi cassette]-[terminator 2 RC]-[partial coding sequence 2 RC]-[splice acceptor 2 RC]-[rare-cutting endonuclease target site 2]. In another embodiment, the transgene structure can be, from 5′ to 3′, [rare-cutting endonuclease target site 1]-[homology arm 1]-[splice acceptor 1]-[partial coding sequence 1]-[terminator 1]-[RNAi cassette]-[terminator 2 RC]-[partial coding sequence 2 RC]-[splice acceptor 2 RC]-[homology arm 2]-[rare-cutting endonuclease target site 2]. In another embodiment, the transgene structure can be, from 5′ to 3′, [left end for transposase]-[splice acceptor 1]-[partial coding sequence 1]-[terminator 1]-[RNAi cassette]-[terminator 2 RC]-[partial coding sequence 2 RC]-[splice acceptor 2 RC]-[right end for transposase].


In one embodiment, this document describes methods to silence and replace production of a protein-of-interest by administering to a cell the transgenes described in FIG. 14, and integrating said transgene into the endogenous gene-of-interest. In one embodiment, the transgenes can comprise a splice acceptor, a 2A sequence, a full coding sequence (which is resistant to silencing), a terminator, and an RNAi cassette designed to silence an endogenous gene-of-interest. The splice acceptor can be operably linked to the 2A sequence, which can be operably linked to the full coding sequence which can be operably linked to the terminator. The splice acceptor, 2A sequence, full coding sequence, terminator, and RNAi cassette can be flanked with a first and second homology arm, or a left and right transposon end. The transgenes can be integrated into an intron within the endogenous gene-of-interest or at an intron-exon junction within the endogenous gene-of-interest (FIG. 14). The RNAi can be designed to silence the expression of the endogenous gene-of-interest, and the full coding sequence within the transgene can be designed to be resistant to silencing. Accordingly, the corresponding target site within the full coding sequence within the transgene can be modified to prevent silencing. In other embodiments, the transgenes can comprise a first and second splice acceptor, a first and second 2A sequence, a first and second coding sequence (which are both resistant to silencing), a first and second terminator, and an RNAi cassette. These transgenes can be flanked by additional sequences (e.g., viral ITRs), a first and second rare-cutting endonuclease target site, a left and right transposon end, or both a first and second homology arm and a first and second rare-cutting endonuclease target site. In one embodiment, the transgene structure can be, from 5′ to 3′, [homology arm 1]-[splice acceptor]-[2A]-[coding sequence]-[terminator]-[RNAi cassette]-[homology arm 2]. In another embodiment, the transgene structure can be, from 5′ to 3′, [left end for transposase]-[splice acceptor]-[2A]-[coding sequence]-[terminator]-[RNAi cassette]-[right end for transposase]. In another embodiment, the transgene structure can be, from 5′ to 3′, [additional sequence 1]-[splice acceptor 1]-[2A 1]-[coding sequence 1]-[terminator 1]-[RNAi cassette]-[terminator 2 RC]-[coding sequence 2 RC]-[2A 2 RC]-[splice acceptor 2 RC]-[additional sequence 2]. In another embodiment, the transgene structure can be, from 5′ to 3′, [rare-cutting endonuclease target site 1]-[splice acceptor 1]-[2A 1]-[coding sequence 1]-[terminator 1]-[RNAi cassette]-[terminator 2 RC]-[coding sequence 2 RC]-[2A 2 RC]-[splice acceptor 2 RC]-[rare-cutting endonuclease target site 2]. In another embodiment, the transgene structure can be, from 5′ to 3′, [rare-cutting endonuclease target site 1]-[homology arm 1]-[splice acceptor 1]-[2A 1]-[coding sequence 1]-[terminator 1]-[RNAi cassette]-[terminator 2 RC]-[coding sequence 2 RC]-[2A 2 RC]-[splice acceptor 2 RC]-[homology arm 2]-[rare-cutting endonuclease target site 2]. In another embodiment, the transgene structure can be, from 5′ to 3′, [left end for transposase]-[splice acceptor 1]-[2A 1]-[coding sequence 1]-[terminator 1]-[RNAi cassette]-[terminator 2 RC]-[coding sequence 2 RC]-[2A 2 RC]-[splice acceptor 2 RC]-[right end for transposase].


In one embodiment, this document describes methods to silence and replace production of a protein-of-interest by administering to a cell the transgenes described in FIG. 15, and integrating said transgene into the endogenous gene-of-interest. In one embodiment, the transgenes can comprise a 2A sequence, a full coding sequence (which is resistant to silencing), a terminator, and an RNAi cassette designed to silence an endogenous gene-of-interest. The 2A sequence can be operably linked to the full coding sequence which can be operably linked to the terminator. The 2A sequence, full coding sequence, terminator, and RNAi cassette can be flanked with a first and second homology arm, or a left and right transposon end. The transgenes can be integrated into an exon within the endogenous gene-of-interest (FIG. 15). The RNAi can be designed to silence the expression of the endogenous gene-of-interest, and the full coding sequence within the transgene can be designed to be resistant to silencing. Accordingly, the corresponding target site within the full coding sequence within the transgene can be modified to prevent silencing. In other embodiments, the transgenes can comprise a first and second 2A sequence, a first and second coding sequence (which are both resistant to silencing), a first and second terminator, and an RNAi cassette. These transgenes can be flanked by additional sequences (e.g., viral ITRs), a first and second rare-cutting endonuclease target site, a left and right transposon end, or both a first and second homology arm and a first and second rare-cutting endonuclease target site. In one embodiment, the transgene structure can be, from 5′ to 3′, [homology arm 1]-[2A]-[coding sequence]-[terminator]-[RNAi cassette]-[homology arm 2]. In another embodiment, the transgene structure can be, from 5′ to 3′, [left end for transposase]-[2A]-[coding sequence]-[terminator]-[RNAi cassette]-[right end for transposase]. In another embodiment, the transgene structure can be, from 5′ to 3′, [additional sequence 1]-[2A 1]-[coding sequence 1]-[terminator 1]-[RNAi cassette]-[terminator 2 RC]-[coding sequence 2 RC]-[2A 2 RC]-[additional sequence 2]. In another embodiment, the transgene structure can be, from 5′ to 3′, [rare-cutting endonuclease target site 1]-[2A 1]-[coding sequence 1]-[terminator 1]-[RNAi cassette]-[terminator 2 RC]-[coding sequence 2 RC]-[2A 2 RC]-[rare-cutting endonuclease target site 2]. In another embodiment, the transgene structure can be, from 5′ to 3′, [rare-cutting endonuclease target site 1]-[homology arm 1]-[2A 1]-[coding sequence 1]-[terminator 1]-[RNAi cassette]-[terminator 2 RC]-[coding sequence 2 RC]-[2A 2 RC]-[homology arm 2]-[rare-cutting endonuclease target site 2]. In another embodiment, the transgene structure can be, from 5′ to 3′, [left end for transposase]-[2A 1]-[coding sequence 1]-[terminator 1]-[RNAi cassette]-[terminator 2 RC]-[coding sequence 2 RC]-[2A 2 RC]-[right end for transposase].


In one embodiment, this document describes methods to silence and replace production of a protein-of-interest by administering to a cell the transgenes described in FIG. 16, and integrating said transgene into the endogenous gene-of-interest. In one embodiment, the transgenes can comprise a full coding sequence (which is resistant to silencing and comprises a start codon), a terminator, and an RNAi cassette designed to silence the endogenous gene-of-interest. The full coding sequence can be operably linked to the terminator. The full coding sequence, terminator, and RNAi cassette can be flanked with a first and second homology arm, or a left and right transposon end. The integration site can be within a 5′ UTR but before the start codon (FIG. 16). An additional integration site can be within an intron within the 5′ UTR, if present; however, the transgenes described within this embodiment then need to comprise a splice acceptor sequence operably linked to the full coding sequence(s). The RNAi can be designed to silence the expression of the endogenous gene-of-interest, and the full coding sequence within the transgene can be designed to be resistant to silencing. Accordingly, the corresponding target site within the full coding sequence within the transgene can be modified to prevent silencing. In other embodiments, the transgenes can comprise a first and second coding sequence (which are both resistant to silencing), a first and second terminator, and an RNAi cassette. These transgenes can be flanked by additional sequences (e.g., viral ITRs), a first and second rare-cutting endonuclease target site, a left and right transposon end, or both a first and second homology arm and a first and second rare-cutting endonuclease target site. In one embodiment, the transgene structure can be, from 5′ to 3′, [homology arm 1]-[coding sequence]-[terminator]-[RNAi cassette]-[homology arm 2]. In another embodiment, the transgene structure can be, from 5′ to 3′, [left end for transposase]-[coding sequence]-[terminator]-[RNAi cassette]-[right end for transposase]. In another embodiment, the transgene structure can be, from 5′ to 3′, [additional sequence 1]-[coding sequence 1]-[terminator 1]-[RNAi cassette]-[terminator 2 RC]-[coding sequence 2 RC]-[additional sequence 2]. In other embodiments, the transgenes can be designed to replace protein production, and not silence the endogenous gene. In an embodiment, the transgene structure can be, from 5′ to 3′, [rare-cutting endonuclease target site 1]-[coding sequence 1]-[terminator 1]-[terminator 2 RC]-[coding sequence 2 RC]-[rare-cutting endonuclease target site 2]. In another embodiment, the transgene structure can be, from 5′ to 3′, [rare-cutting endonuclease target site 1]-[homology arm 1]-[coding sequence 1]-[terminator 1]-[terminator 2 RC]-[coding sequence 2 RC]-[homology arm 2]-[rare-cutting endonuclease target site 2]. In another embodiment, the transgene structure can be, from 5′ to 3′, [left end for transposase]-[coding sequence 1]-[terminator 1]-[terminator 2 RC]-[coding sequence 2 RC]-[right end for transposase]. In another embodiment, the transgene structure can be, from 5′ to 3′, [homology arm 1]-[coding sequence]-[terminator]-[homology arm 2]. In another embodiment, the transgene structure can be, from 5′ to 3′, [left end for transposase]-[coding sequence]-[terminator]-[right end for transposase]. In another embodiment, the transgene structure can be, from 5′ to 3′, [additional sequence 1]-[coding sequence 1]-[terminator 1]-[terminator 2 RC]-[coding sequence 2 RC]-[additional sequence 2]. In another embodiment, the transgene structure can be, from 5′ to 3′, [rare-cutting endonuclease target site 1]-[coding sequence 1]-[terminator 1]-[terminator 2 RC]-[coding sequence 2 RC]-[rare-cutting endonuclease target site 2]. In another embodiment, the transgene structure can be, from 5′ to 3′, [rare-cutting endonuclease target site 1]-[homology arm 1]-[coding sequence 1]-[terminator 1]-[terminator 2 RC]-[coding sequence 2 RC]-[homology arm 2]-[rare-cutting endonuclease target site 2]. In another embodiment, the transgene structure can be, from 5′ to 3′, [left end for transposase]-[coding sequence 1]-[terminator 1]-[terminator 2 RC]-[coding sequence 2 RC]-[right end for transposase].


In one embodiment, this document describes methods to silence and replace production of a protein-of-interest by administering to a cell the transgenes described in FIG. 17, and integrating said transgene into the endogenous gene-of-interest. In one embodiment, the transgenes can comprise an RNAi cassette designed to silence the endogenous gene, a promoter, a partial coding sequence (which is resistant to silencing), and a splice donor sequence. The promoter can be operably linked to the partial coding sequence which can be operably linked to the splice donor. The RNAi cassette, promoter, partial coding sequence and splice donor can be flanked with a first and second homology arm, or a left and right transposon end. The transgenes can be integrated into an exon or an intron within the endogenous gene-of-interest (FIG. 17), but not within a site that destroys an endogenous splice acceptor necessary for producing the full-length protein. The RNAi can be designed to silence the expression of the endogenous gene-of-interest, and the partial coding sequence within the transgene can be designed to be resistant to silencing. Accordingly, the corresponding target site within the full coding sequence within the transgene can be modified to prevent silencing. In other embodiments, the transgenes can comprise a first and second splice donor sequence, a first and second partial coding sequence (which are both resistant to silencing), a first and second promoter, and an RNAi cassette. These transgenes can be flanked by additional sequences (e.g., viral ITRs), a first and second rare-cutting endonuclease target site, a left and right transposon end, or both a first and second homology arm and a first and second rare-cutting endonuclease target site. In one embodiment, the transgene structure can be, from 5′ to 3′, [homology arm 1]-[RNAi cassette]-[promoter]-[partial coding sequence]-[splice donor]-[homology arm 2]. In another embodiment, the transgene structure can be, from 5′ to 3′, [left end for transposon]-[RNAi cassette]-[promoter]-[partial coding sequence]-[splice donor]-[right end for transposon]. In another embodiment, the transgene structure can be, from 5′ to 3′, [additional sequence 1]-[splice donor 1 RC]-[partial coding sequence 1 RC]-[promoter 1 RC]-[RNAi cassette]-[promoter 2]-[partial coding sequence 2]-[splice donor 2]-[additional sequence 2]. In another embodiment, the transgene structure can be, from 5′ to 3′, [rare-cutting endonuclease target site 1]-[splice donor 1 RC]-[partial coding sequence 1 RC]-[promoter 1 RC]-[RNAi cassette]-[promoter 2]-[partial coding sequence 2]-[splice donor 2]-[rare-cutting endonuclease target site 2]. In another embodiment, the transgene structure can be, from 5′ to 3′, [rare-cutting endonuclease target site 1]-[homology arm 1]-[splice donor 1 RC]-[partial coding sequence 1 RC]-[promoter 1 RC]-[RNAi cassette]-[promoter 2]-[partial coding sequence 2]-[splice donor 2]-[rare-cutting endonuclease target site 2]. In another embodiment, the transgene structure can be, from 5′ to 3′, [left end for transposase]-[splice donor 1 RC]-[partial coding sequence 1 RC]-[promoter 1 RC]-[RNAi cassette]-[promoter 2]-[partial coding sequence 2]-[splice donor 2]-[right end for transposase]. The transgenes can be used to modify the SNCA gene. Mutations in SNCA have been found to cause Parkinson's disease. The transgenes described here can be used to correct gene expression of SNCA. In some cases, SNCA is duplicated or triplicated, leading to excess production of alpha-synuclein protein. In other cases, mutations, such as Ala30Pro cause misfolding of the protein. The transgenes described herein provide a method for reducing expression of endogenous SNCA expression (from gene duplications and intragenic mutations), while replacing expression of SNCA with some or all of the SNCA isoforms (at least 6 transcripts for SNCA exist, including the full length 140 aa protein, 126 aa protein, 112 aa protein, 98 aa protein, 67 aa protein, and 115 aa protein). The SNCA gene comprises 6 exons, with the start codon in exon 2. This document provides transgenes for integration into the SNCA gene. The transgenes can comprise an RNAi cassette targeting exon 1 or exon 2 of SNCA, a promoter, a partial coding sequence encoding the peptide produced by exon 2 of SNCA (wherein this partial coding sequence is resistant to silencing by the RNAi cassette), and a splice donor.


In one embodiment, the methods provided herein describe the delivery of a transgene with a full, functional silencing-resistant coding sequence and an RNAi silencing sequence (FIG. 9). The functional coding sequence can comprise a promoter, a nucleic acid sequence that functions to produce an RNA or protein product, and a terminator. The nucleic acid sequence can be customized to avoid silencing by the silencing sequence (FIG. 9). In one embodiment, a transgene can comprise a silencing sequence targeting a transcript's 5′ UTR. The functional coding sequence within the transgene can comprise a coding sequence of the silenced gene (either WT or codon-adjusted) together with an alternative 5′ UTR not derived from the target gene or no 5′ UTR. In another embodiment, a transgene can comprise a silencing sequence targeting a transcript's 3′ UTR. The functional coding sequence within the transgene can comprise a coding sequence of the silenced gene (either WT or codon-adjusted) together with an alternative 3′ UTR not derived from the target gene or no 3′ UTR. In yet another embodiment, a transgene can comprise a silencing sequence targeting a gene's coding sequence. The functional coding sequence can comprise a coding sequence of the silenced gene, wherein the entire coding sequence or a portion of the coding sequence is modified to avoid silencing by the silencing sequence. Modification can be achieved by methods such as codon-optimization/adjusting, or by deleting the target region. In one embodiment, the transgenes described herein comprising a silencing sequence and functional coding sequence can be transiently delivered to cells (e.g., by viral vectors or plasmid DNA), or they can be integrated within a cell's genome. In some embodiments, the transgenes can be delivered to cells comprising one or more genes with a gain-of-function mutation (FIG. 7). Examples of diseases with gain-of-function mutations include HD (Huntington's Disease), SBMA (Spinobulbar Muscular Atrophy), SCA1 (Spinocerebellar Ataxia Type 1), SCA2 (Spinocerebellar Ataxia Type 2), SCA3 (Spinocerebellar Ataxia Type 3 or Machado-Joseph Disease), SCA6 (Spinocerebellar Ataxia Type 6), SCA7 (Spinocerebellar Ataxia Type 7), Fragile X Syndrome, Fragile XE Mental Retardation, Friedreich's Ataxia, Myotonic Dystrophy type 1, Myotonic Dystrophy type 2, Spinocerebellar Ataxia Type 8, Spinocerebellar Ataxia Type 12, spinal and bulbar muscular atrophy, JPH3, Amyotrophic Lateral Sclerosis (ALS), hereditary motor and sensory neuropathy type IIC, postsynaptic slow-channel congenital myasthenic syndrome, PRPS1 superactivity, Parkinson disease, tubular aggregate myopathy, achondroplasia, lubs X-linked mental retardation syndrome, and autosomal dominant retinitis pigmentosa.


In certain embodiments, the transgenes described herein comprising a silencing sequence and functional coding sequence can be used to correct gain-of-function disorders by silencing specific genes and replacing the expression of the genes. The genes can include SOD1, TRPV4, CHRNA1, CHRND, CHRNE, CHRNB1, PRPS1, LRRK2, STIM1, FGFR3, MECP2, SNCA, ATXN1, ATXN2, ATXN3, CACNA1A, ATXN7, TBP, HTT, AR, FXN, DMPK, PABPN1, ATXN8, RHO, and C9orf72.


The transgenes described herein comprising a silencing sequence and functional coding sequence can be delivered to cells using viral (e.g., AAV vectors) or non-viral methods. In certain embodiments, the AAV vectors as described herein can be derived from any AAV. In certain embodiments, the AAV vector is derived from the defective and nonpathogenic parvovirus adeno-associated type 2 virus. All such vectors are derived from a plasmid that retains only the AAV 145 bp inverted terminal repeats flanking the transgene expression cassette. Efficient gene transfer and stable transgene delivery due to integration into the genomes of the transduced cell are key features for this vector system. (Wagner et al., Lancet 351:9117 1702-3, 1998; Kearns et al., Gene Ther. 9:748-55, 1996). Other AAV serotypes, including AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9 and AAVrh. 10 and any novel AAV serotype can also be used in accordance with the present invention. In some embodiments, chimeric AAV is used where the viral origins of the long terminal repeat (LTR) sequences of the viral nucleic acid are heterologous to the viral origin of the capsid sequences. Non-limiting examples include chimeric virus with LTRs derived from AAV2 and capsids derived from AAV5, AAV6, AAV8 or AAV9 (i.e. AAV2/5, AAV2/6, AAV2/8 and AAV2/9, respectively).


The constructs described herein may also be incorporated into an adenoviral vector system. Adenoviral based vectors are capable of very high transduction efficiency in many cell types and do not require cell division. With such vectors, high titer and high levels of expression can been obtained.


The methods and compositions described herein are applicable to any eukaryotic organism in which it is desired to alter the organism through genomic modification. The eukaryotic organisms include plants, algae, animals, fungi and protists. The eukaryotic organisms can also include plant cells, algae cells, animal cells, fungal cells and protist cells.


Exemplary mammalian cells include, but are not limited to, oocytes, K562 cells, CHO (Chinese hamster ovary) cells, HEP-G2 cells, BaF-3 cells, Schneider cells, COS cells (monkey kidney cells expressing SV40 T-antigen), CV-1 cells, HuTu80 cells, NTERA2 cells, NB4 cells, HL-60 cells and HeLa cells, 293 cells (see, e.g., Graham et al. (1977) J. Gen. Virol. 36:59), and myeloma cells like SP2 or NSO (see, e.g., Galfre and Milstein (1981) Meth. Enzymol. 73(B):3 46). Peripheral blood mononucleocytes (PBMCs) or T-cells can also be used, as can embryonic and adult stem cells. For example, stem cells that can be used include embryonic stem cells (ES), induced pluripotent stem cells (iPSC), mesenchymal stem cells, hematopoietic stem cells, liver stem cells, skin stem cells and neuronal stem cells.


The methods and compositions of the invention can be used in the production of modified organisms. The modified organisms can be small mammals, companion animals, livestock, and primates. Non-limiting examples of rodents may include mice, rats, hamsters, gerbils, and guinea pigs. Non-limiting examples of companion animals may include cats, dogs, rabbits, hedgehogs, and ferrets. Non-limiting examples of livestock may include horses, goats, sheep, swine, llamas, alpacas, and cattle. Non-limiting examples of primates may include capuchin monkeys, chimpanzees, lemurs, macaques, marmosets, tamarins, spider monkeys, squirrel monkeys, and vervet monkeys. The methods and compositions of the invention can be used in humans.


Exemplary plants and plant cells which can be modified using the methods described herein include, but are not limited to, monocotyledonous plants (e.g., wheat, maize, rice, millet, barley, sugarcane), dicotyledonous plants (e.g., soybean, potato, tomato, alfalfa), fruit crops (e.g., tomato, apple, pear, strawberry, orange), forage crops (e.g., alfalfa), root vegetable crops (e.g., carrot, potato, sugar beets, yam), leafy vegetable crops (e.g., lettuce, spinach); vegetative crops for consumption (e.g. soybean and other legumes, squash, peppers, eggplant, celery etc), flowering plants (e.g., petunia, rose, chrysanthemum), conifers and pine trees (e.g., pine fir, spruce); poplar trees (e.g. P. tremula×P. alba); fiber crops (cotton, jute, flax, bamboo) plants used in phytoremediation (e.g., heavy metal accumulating plants); oil crops (e.g., sunflower, rape seed) and plants used for experimental purposes (e.g., Arabidopsis). The methods disclosed herein can be used within the genera Asparagus, Avena, Brassica, Citrus, Citrullus, Capsicum, Cucurbita, Daucus, Erigeron, Glycine, Gossypium, Hordeum, Lactuca, Lolium, Lycopersicon, Malus, Manihot, Nicotiana, Orychophragmus, Oryza, Persea, Phaseolus, Pisum, Pyrus, Prunus, Raphanus, Secale, Solanum, Sorghum, Triticum, Vitis, Vigna, and Zea. The term plant cells include isolated plant cells as well as whole plants or portions of whole plants such as seeds, callus, leaves, and roots. The present disclosure also encompasses seeds of the plants described above wherein the seed has the has been modified using the compositions and/or methods described herein. The present disclosure further encompasses the progeny, clones, cell lines or cells of the transgenic plants described above wherein said progeny, clone, cell line or cell has the transgene or gene construct. Exemplary algae species include microalgae, diatoms, Botryococcus braunii, Chlorella, Dunaliella tertiolecta, Gracileria, Pleurochrysis carterae, Sorgassum and Ulva.


The methods described in this document can include the use of rare-cutting endonucleases for stimulating homologous recombination or non-homologous integration of a transgene molecule into an endogenous gene. The rare-cutting endonuclease can include CRISPR, TALENs, or zinc-finger nucleases (ZFNs). The CRISPR system can include CRISPR/Cas9 or CRISPR/Cas12a (Cpfl). The CRISPR system can include variants which display broad PAM capability (Hu et al., Nature 556, 57-63, 2018; Nishimasu et al., Science DOI: 10.1126, 2018) or higher on-target binding or cleavage activity (Kleinstiver et al., Nature 529:490-495, 2016). The gene editing reagent can be in the format of a nuclease (Mali et al., Science 339:823-826, 2013; Christian et al., Genetics 186:757-761, 2010), nickase (Cong et al., Science 339:819-823, 2013; Wu et al., Biochemical and Biophysical Research Communications 1:261-266, 2014), CRISPR-FokI dimers (Tsai et al., Nature Biotechnology 32:569-576, 2014), or paired CRISPR nickases (Ran et al., Cell 154:1380-1389, 2013).


The methods and compositions described in this document can be used in a circumstance where it is desired to modify the 5′ end of the coding sequence of an endogenous gene. For example, patients with SCA2 have expanded CAG repeats in exon 1. Patients with SCA2 may benefit from replacement of exon 1. In other examples, patients with genetic disorders due to loss of function mutations within the 5′ end of an endogenous gene could benefit from replacement of the first exons of said gene.


Further, the methods and compositions described in this document can be used in circumstances where it is desired to treat a gain-of-function genetic disorder while ensuring wild type protein is still produced. For example, patients with retinitis pigmentosa having gain-of-function mutations in the RHO gene may benefit from a therapy comprising a transgene capable of silencing the endogenous RHO gene and simultaneously producing wild type RHO protein. Additional benefits of this approach include the ability to choose a target site for silencing that is not centered around the gain-of-function mutation site. This benefit enables the design of the effective silencing constructs (e.g., low off-targeting and highly effective on-targeting), and enables the design of a single therapy for patients with gain-of-function mutations in different regions of the RHO gene. Further the methods can be particularly useful in gain-of-function disorders with genes that produce multiple isoforms, including Parkinson's and SNCA. Cells with a gain of function mutation in the 5′ end of the SNCA gene can benefit from integration of a transgene comprising an RNAi cassette targeting exon 2, along with a promoter and partial coding sequence that is resistant to the RNAi silencing.


The invention will be further described in the following examples, which do not limit the scope of the invention described in the claims.


EXAMPLES
Example 1: Targeted Integration of DNA in the ATXN2 Gene

Three plasmids were constructed with transgenes designed to integrate into the ATXN2 gene in human cells. All transgenes were designed to be integrated within intron 2 of the ATXN2 gene, and all transgenes were designed to insert a bidirectional partial coding sequence with individual promoters. The partial coding sequences encode the peptide produced by exon 1 of the ATXN2 gene. The first plasmid, designated pBA1 141, comprised a left and right homology arm with sequences homologous to the beginning of intron 1 (i.e., successful gene targeting would result in insertion of the cargo in pBA1 141 in intron 1). Between the homology arms, from 5′ to 3′, included a splice donor in reverse complement orientation, partial coding sequence 1 (encoding the peptide produced by exon 1 of the ATXN2 gene) with codon adjustments in reverse complement orientation, EF 1 alpha promoter in reverse complement orientation, CMV promoter, partial coding sequence 2 (encoding the peptide produced by exon 1 of the ATXN2 gene) with codon adjustments, and a splice donor. The sequence for the pBA1141 transgene is shown in SEQ ID NO: 15 (FIG. 6). Two nucleases were designed to facilitate integration of pBA1 141 into the genome: Cas9 with a target site of (TGTGCAGGAGGGCCTGTTGGGGG; SEQ ID NO: 16) and Cas12a with a target site of (TTTCCCTTGTGCCTCAAGTCCATCCGT; SEQ ID NO:17). The target sites were also included in pBA1 141 to facilitate liberation of the donor molecule from the plasmid. The individual components within pBA1141 are shown in SEQ ID NOS:18-24. SEQ ID NO: 18 is sequence comprising the target site for both Cas9 and Cas12a. SEQ ID NO: 19 comprises the sequence for the left homology arm. SEQ ID NO:20 comprises the reverse-complement, codon-adjusted partial coding sequence (exon 1) of a non-pathogenic ATXN2 gene. SEQ ID NO:21 comprises the reverse complement EF1 alpha promoter. SEQ ID NO:22 comprises the reverse complement CMV promoter. SEQ ID NO:23 comprises the codon-adjusted partial coding sequence (exon 1) of a non-pathogenic ATXN2 gene. SEQ ID NO:24 comprises the sequence for the right homology arm. The second plasmid, designated pBA1142, comprised the same cargo as pBA1135, however, the homology arms were removed. Nuclease target sites were kept to facilitate liberation of the transgene from the plasmid. Successful cleavage of the plasmid was expected to liberate the transgene, thereby enabling the sequence to be used for integration by NHEJ into the ATXN2 gene. The sequence of pBA1 141 is shown in SEQ ID NO:25. The third plasmid, designated pBA1143, comprised the same sequence as pBA1141, except the sequence harboring the nuclease target sites (upstream of the left homology arm) was removed and the right homology arm was shortened to 600 bp.


Transfection was performed using HEK293T cells. HEK293T cells were maintained at 37° C. and 5% CO2 in DMEM high supplemented with 10% fetal bovine serum (FBS). HEK293T cells were transfected with 2 ug of donor, 2 ug of guide RNA (RNA format) and 2 ug of Cas9 (RNA format), or 2 ug of Cas12a plasmid (DNA format). Transfections were performed using electroporation. Genomic DNA was isolated 72 hours post transfection and assessed for integration events. A list of primers used to detect integration or genomic DNA is shown in Table 1.









TABLE 1







Primers for detecting


integration of transgenes in ATXN2.











Primer

SEQ



Name
Sequence (5′ to 3′)
ID NO:






oNJB190
CATCAGAAAGAATAAGGGCTGC
26






oNJB191
TCACCCTTGCTCTCAGAGAC
27






oNJB197
GCGGTGGCAACGGAATCAAG
28






oNJB201
CCCGCTTGCGAACCTGTATATG
29






oNJB202
TGGGCCACTTACGATGAGTTTG
45






oNJB205
CTGTGGAACATCGGTGGGTG
46






oNJB210
TTGGCTAAGTAGTGTTTGGGATGC
47






oNJB211
AGTAGTGTTTGGGATGCTTCAG
48









To detect the integration of pBA1 141, pBA1 142 and pBA1 143, PCRs were performed on the genomic DNA. Regarding pBA1143, the transgene was designed to be integrated precisely by HR. Accordingly, bands were detected in the 3′ junction PCRs for both Cas9 and Cas12a transfection samples, which indicates precise insertion into intron 1 (FIG. 17 lanes 7-10). Expected band sizes were 1,225 bp (lanes 7 and 9) and 1,407 bp (lanes 8 and 10). Primers oNJB201+oNJB190 and oNJB202+oNJB191 were used for the 3′ junction PCRs. Regarding pBA1142, as no homology arms were present, the transgene was predicted to insert via NHEJ insertion. Integration by NHEJ in samples transfected with Cas9 can be seen in FIG. 17 lane 6. Expected band size was 813 bp. Primers oNJB202+oNJB211 were used for the NHEJ-insertion 3′ junction PCR. Regarding pBA1141, both homology arms and nuclease cleavage sites were present on the transgene (FIG. 7). Integration by HR was observed in FIG. 17 lanes 2-4, and integration by NHEJ was observed in FIG. 17 lane 5. Expected sizes for the PCR detecting insertion by HR was 1594 bp (lane 2; primers oNJB201+oNJB190), 1775 bp (lane 3; primers oNJB202+oNJB191), 1775 bp (lane 4; primers oNJB202+oNJB191). Expected size for the PCR detecting insertion by NHEJ was 2067 bp (lane 5; primers oNJB202+oNJB211).


The results show that the described transgenes comprising bidirectional partial coding sequences with promoters can be integrated into genomic DNA through multiple different repair pathways.


Transfection is performed using HEK293T cells. HEK293T cells are maintained at 37° C. and 5% C02 in DMEM high supplemented with 10% fetal bovine serum (FBS). HEK293T cells were transfected with 2 ug of donor, 2 ug of guide RNA (RNA format) and 2 ug of Cas9 (RNA format), or 2 ug of Cas12a plasmid (DNA format). Transfections are performed using electroporation. Single cell clones comprising integrations are isolated and RNA is extracted. RNA sequencing can be used to detect the new transcripts.


Example 2: Silencing of Endogenous SOD1 Gene Expression and Expression of a Replacement SOD1 Protein

This document describes methods to use RNAi, RNAi-resistant coding sequences, and gene editing for the purpose of silencing and replacing endogenous gene expression. These methods are particularly useful for gain-of-function disorders, including amyotrophic lateral sclerosis with mutations in the SOD1 gene.


To validate gene silencing and replacement, transgenes were designed with an RNAi (shRNA) cassette targeting sequence within exon 2 of SOD1. The shRNA comprised the sequence GGCCTGCATGGATTCCATGTTCAAGAGACATGGAATCCATGCAGGCC (SEQ ID NO:49), which was placed downstream of a U6 promoter. The transgene also comprised a SOD1 coding sequence downstream of a CMV promoter. Sequence within the coding sequence was modified to avoid shRNA silencing. The sequence of the transgene (designated pBA1148) is shown in SEQ ID NO: 10. Control vectors were generated comprising a scrambled shRNA (designated pBA1147; SEQ ID NO:53) and WT SOD1 coding sequence (designated pBA1149; SEQ ID NO:54).


Transfection was performed using HEK293T cells. HEK293T cells were maintained at 37° C. and 5% CO2 in DMEM high supplemented with 10% fetal bovine serum (FBS). HEK293T cells were transfected with 2 ug of plasmid. Transfections were performed using electroporation. RNA is isolated 48 hours post transfection and assessed for levels of SOD1 mRNA.


To use gene editing to silence SOD1 gene expression and produce replacement SOD1 protein, two vectors are designed to be integrated into intron 1. The first vector comprises, from 5′ to 3′, a left homology arm, a splice acceptor, a partial coding sequence of SOD1 encoding the peptide produced by exons 2-5 (and also comprising mutations to avoid silencing by an RNAi cassette), a terminator, an RNAi cassette with the shRNA sequence shown in SEQ ID NO:49, and a right homology arm. The second vector comprises, from 5′ to 3′, a nuclease target site, a splice acceptor, a partial coding sequence of SOD1 encoding the peptide produced by exons 2-5 (and also comprising mutations to avoid silencing by an RNAi cassette), a terminator, an RNAi cassette with the shRNA sequence shown in SEQ ID NO:49, a second terminator in reverse complement orientation, a second partial coding sequence of SOD1 in reverse complement orientation encoding the peptide produced by exons 2-5 (and also comprising mutations to avoid silencing by an RNAi cassette), a second splice acceptor in reverse complementary orientation, and a second nuclease target site (FIG. 12).


Two additional vectors are designed to be integrated into intron 3 of the SOD1 gene. The first vector comprises, from 5′ to 3′, a left homology arm, an RNAi cassette with the shRNA sequence shown in SEQ ID NO:49, a promoter, a partial coding sequence of SOD1 encoding the peptide produced by exons 1 and 2 (and also comprising mutations to avoid silencing by an RNAi cassette), a splice donor, and a right homology arm. The second vector comprises, from 5′ to 3′, a nuclease target site, a splice donor in reverse complement orientation, a partial coding sequence of SOD1 in reverse complement orientation encoding the peptide produced by exons 1 and 2 (and also comprising mutations to avoid silencing by an RNAi cassette), a promoter in reverse complement orientation, an RNAi cassette with the shRNA sequence shown in SEQ ID NO:49, a second promoter, a second partial coding sequence of SOD1 encoding the peptide produced by exons 1 and 2 (and also comprising mutations to avoid silencing by an RNAi cassette), a splice donor, and a second nuclease target site (FIG. 16).


Transfection is performed using HEK293T cells. HEK293T cells are maintained at 37° C. and 5% C02 in DMEM high supplemented with 10% fetal bovine serum (FBS). HEK293T cells are transfected with 2 ug of plasmid, 2 ug of guide RNA (RNA format) and 2 ug of Cas9 (RNA format). Transfections are performed using electroporation. DNA is isolated 72 hours post transfection and assessed for integration of the transgenes. Clones comprising integration events are isolated and assessed for SOD1 mRNA levels (both from the endogenous gene and from the modified gene).


Example 3: Silencing of Endogenous SNCA Gene Expression and Expression of Two SNCA Protein Isoforms

Mutations in SNCA have been found to cause Parkinson's disease. The methods described herein can be used to correct gene expression of SNCA. In some cases, SNCA is duplicated or triplicated, leading to excess production of alpha-synuclein protein. In other cases, mutations, such as Ala30Pro cause misfolding of the protein. Described herein is a method for reducing expression of endogenous SNCA expression (from gene duplications and intragenic mutations), while replacing expression of SNCA and some or all of the SNCA isoforms (at least 6 transcripts for SNCA exist, including the full length 140 aa protein, 126 aa protein, 112 aa protein, 98 aa protein, 67 aa protein, and 115 aa protein).


A transgene was designed to harbor an shRNA to silence endogenous SNCA gene expression. The transgene was also designed to replace two SNCA protein isoforms by encoding two open reading frames, one for each isoform. The shRNA comprised a 19nt hairpin sequence targeting the 3′ end of the SNCA coding sequence (GGTATCAAGACTACGAAC; SEQ ID NO: 11). The two SNCA open reading frames within the transgene were designed to harbor mutations at the shRNA target site. SEQ ID NO: 12 shows the nucleic acid sequence of the transgene which was cloned into an expression plasmid (designated pBA1153). Two other transgenes were constructed: one with the shRNA and two wild type SNCA isoforms (without the mutations that prevent shRNA silencing), and the second with a scrambled shRNA and two SNCA isoforms with mutations.


The transgenes are transfected into HEK293 cells. HEK293 cells are maintained at 37° C. and 5% CO2 in DMEM high glucose without L-glutamine without sodium pyruvate medium supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin (PS) solution 100×. HEK293 cells are transfected with each of the plasmid constructs and combinations thereof using Lipofectamine 3000. RNA is extracted 48 hours post transfection and assessed for SNCA transcript levels. Reduced expression of endogenous SNCA RNA, and expression of RNA from the codon-adjusted SNCA sequences indicates functionality of the transgene.


To use gene editing to silence SNCA gene expression and produce replacement SNCA protein while maintaining isoform production, two vectors are designed to be integrated into the exon 2 intron 2 junction. The first vector comprises, from 5′ to 3′, a left homology arm, an RNAi cassette with an shRNA sequence targeting the exon 2 transcript sequence, a promoter (comprising 1,000 bp of the endogenous SNCA promoter), a partial coding sequence encoding a start codon and the peptide produced by exon 2 of the endogenous SNCA gene (and also comprising mutations to avoid silencing by an RNAi cassette), a splice donor and a right homology arm. The splice donor and right homology arm are sequence from the 5′ end of the endogenous intron 2. The second vector comprises, from 5′ to 3′, a nuclease target site, a splice donor in reverse complement orientation, a partial coding sequence of SNCA in reverse complement orientation encoding the peptide produced by exon 2 (and also comprising mutations to avoid silencing by an RNAi cassette), a promoter in reverse complement orientation, an RNAi cassette with the shRNA targeting exon 2, a second promoter, a second partial coding sequence of SNCA encoding the peptide produced by exon 2 (and also comprising mutations to avoid silencing by an RNAi cassette), a splice donor, and a second nuclease target site (FIG. 16). The splice donor sequences are the splice donor sequences from intron 2 of the SNCA gene. Nucleases are designed to facilitate integration of the transgenes into the exon 2 intron 2 junction.


The transgenes and nucleases are transfected into HEK293 cells. HEK293 cells are maintained at 37° C. and 5% CO2 in DMEM high glucose without L-glutamine without sodium pyruvate medium supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin (PS) solution 100×. HEK293 cells are transfected with each of the plasmid constructs and combinations thereof using Lipofectamine 3000. Clones comprising integration events are isolated and RNA is extracted. Reduced expression of endogenous SNCA RNA, and expression of RNA from the modified SNCA gene indicates functionality of the transgenes.


Example 4: Silencing of the Endogenous RHO Gene Expression and Expression of a Replacement RHO Protein

A transgene is designed to harbor an shRNA to silence endogenous RHO gene expression and an open reading frame coding for a wild type RHO protein. The RHO protein sequence is shown in SEQ ID NO: 13. The silencing sequence harbors a hairpin sequence targeting the endogenous RHO transcript. The RHO open reading frame within the transgene is codon-adjusted to comprise minimal sequence homology at the shRNA target site.


The transgene is transfected into HEK293 cells. HEK293 cells are maintained at 37° C. and 5% CO2 in DMEM high glucose without L-glutamine without sodium pyruvate medium supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin (PS) solution 100×. HEK293 cells are transfected with each of the plasmid constructs and combinations thereof using Lipofectamine 3000. Three days post transfection RNA is extracted from the cells and assessed for transcript levels. Reduced expression of endogenous RHO RNA, and expression of RNA from the codon-adjusted RHO sequences indicates functionality of the transgene.


Example 5: Silencing of Endogenous C9orf72 Gene Expression and Expression of a Replacement C9orf72 Protein

A transgene is designed to harbor an shRNA to silence endogenous C9orf72 gene expression and an open reading frame coding for a wild type C9orf72 protein. The C9orf72 protein sequence is shown in SEQ ID NO: 14. The silencing sequence harbors a hairpin sequence targeting the endogenous C9orf72 transcript. The C9orf72 open reading frame within the transgene is codon-adjusted to comprise minimal sequence homology at the shRNA target site.


The transgene is transfected into HEK293 cells. HEK293 cells are maintained at 37° C. and 5% CO2 in DMEM high glucose without L-glutamine without sodium pyruvate medium supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin (PS) solution 100×. HEK293 cells are transfected with each of the plasmid constructs and combinations thereof using Lipofectamine 3000. Three days post transfection RNA is extracted from the cells and assessed for transcript levels. Reduced expression of endogenous C9orf72 RNA, and expression of the codon-adjusted C9orf72 sequence indicates functionality of the transgene.


Example 6: Targeted Integration of DNA in the ATXN2 Gene

An ATXN2-targeting transgene is designed to replace the 5′ end of the ATXN2 coding sequence. A plasmid, designated pBA1012-D1, is constructed with a transgene designed to integrate WT coding sequence into intron 1 of the ATXN2 gene (FIG. 4). The transgene comprises a first homology arm which is homologous to sequence following the splice donor site in intron 1 (SEQ ID NO:2). Adjacent to the first homology arm is a target site for a Cas9 nuclease. The first homology arm is followed by a reverse complemented splice donor sequence and exon 1 of the ATXN2 gene (non-expanded CAG repeat sequence; SEQ ID NO:3). Following the first coding sequence is an EF 1 alpha promoter (SEQ ID NO:4). In a head-to-head orientation, a second set of functional elements is present. The beginning of the second set of elements comprises a CMV promoter (SEQ ID NO:5) driving expression of a codon-adjusted exon 1 coding sequence of the ATXN2 gene (SEQ ID NO:6). The coding sequence is followed by a splice donor site and a second homology arm. The second homology arm comprises a rare-cutting endonuclease target site (SEQ ID NO:8). The transgene sequence is shown in SEQ ID NO:1.


A corresponding Cas9 nuclease is designed to create three double-strand breaks: 1) within intron 1 of the endogenous ATXN2 gene, 2) adjacent to the first homology arm in the pBA1012-D1 transgene, and 3) within the second homology arm in the pBA1012-D1 transgene. The target sequence for the Cas9 nuclease is shown in SEQ ID NO:8.


Confirmation of the function of the transgene and CRISPR vectors is achieved by transfection of HEK293 cells. HEK293 cells are maintained at 37° C. and 5% C02 in DMEM high glucose without L-glutamine without sodium pyruvate medium supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin (PS) solution 100×. HEK293 cells are transfected with each of the plasmid constructs and combinations thereof using Lipofectamine 3000. Two days post transfection, DNA is extracted and assessed for mutations and targeted insertions within the ATXN2 gene. Nuclease activity is analyzed using the Cel-I assay or by deep sequencing of amplicons comprising the CRISPR/Cas9 target sequence. Successful integration of the transgene is analyzed using PCR.


Other Embodiments

It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.

Claims
  • 1. A method of integrating a transgene into an endogenous gene, the method comprising: a. administering a transgene, wherein the transgene comprises i. a first and second splice donor sequence,ii. a first and second partial coding sequence, andiii. one bidirectional promoter or a first and second promoter administering at least one rare-cutting endonuclease targeted to a site within the endogenous gene,wherein the transgene is integrated within the endogenous gene.
  • 2. The method of claim 1, wherein the first splice donor is operably linked to the first partial coding sequence and the second splice donor is operably linked to the second partial coding sequence.
  • 3. The method of claim 2, wherein the first partial coding sequence is operably linked to the first promoter, and the second partial coding sequence is operably linked to the second promoter.
  • 4. The method of claim 2, wherein the first and second partial coding sequences are operably linked to a bidirectional promoter.
  • 5. The method of claim 3, wherein the first and second splice donors, first and second partial coding sequences, and first and second promoters are oriented in a head-to-head orientation.
  • 6. The method of claim 5, wherein the transgene further comprises a first and second target site for one or more rare-cutting endonucleases, wherein the target sites flank the first and second splice donors.
  • 7. The method of claim 5, wherein the transgene further comprises a first and second homology arm which flank the first and second splice donors.
  • 8. The method of claim 5, wherein the transgene is harbored within an adeno-associated viral vector.
  • 9. The method of claim 7, wherein the transgene further comprises a first and second target site for the one or more rare-cutting endonucleases, wherein the target sites flank the first and second splice donors.
  • 10. The method of claim 9, wherein the first and second target sites flank the first and second homology arms.
  • 11. The method of claim 1, wherein the transgene is integrated within an intron or at an exon-intron junction of the endogenous gene.
  • 12. The method of claim 1, wherein the transgene is integrated within an intron, or at an exon-intron junction of, the ATXN2 gene or the SNCA gene.
  • 13. The method of claim 12, wherein the transgene comprises a first and second partial coding sequence encoding the peptide produced by exon 1 of a non-pathogenic ATXN2 gene.
  • 14. The method of claim 12, wherein the transgene comprises a first and second partial coding sequence encoding the peptide produced by exon 2 of a non-pathogenic SNCA gene.
  • 15. The method of claim 1, wherein the nuclease is a CRISPR/Cas12a nuclease or a CRISPR/Cas9 nuclease.
  • 16. The method of claim 1, wherein the first and second partial coding sequences encode the same amino acids.
  • 17. The method of claim 1, wherein the first and second coding sequences differ in nucleic acid sequence, but encode the same amino acids.
  • 18. The method of claim 1, wherein the transgene is harbored on a vector, wherein the vector format is selected from double-stranded linear DNA, double-stranded circular DNA, or a viral vector.
  • 19. The method of claim 18, wherein the viral vector is selected from an adenovirus vector, an adeno-associated virus vector, or a lentivirus vector.
  • 20. The method of claim 19, wherein the transgene is equal to or less than 4.7 kb.
  • 21. The method of claim 1, wherein said endogenous gene is the wild type gene of said partial coding sequences.
  • 22. The method of claim 21, wherein said endogenous gene is aberrant or pathogenic and the partial coding sequences encode a partial protein produced from a functional version of said endogenous gene.
  • 23. The method of claim 22, wherein the first and second partial coding sequences differ in nucleic acid sequence compared to the corresponding endogenous gene.
  • 24. The method of claim 1, wherein the endogenous gene is selected from SOD1, TRPV4, CHRNA1, CHRND, CHRNE, CHRNB1, PRPS1, LRRK2, STIM1, FGFR3, MECP2, SNCA, ATXN1, ATXN2, ATXN3, CACNA1A, ATXN7, TBP, HTT, AR, FXN, DMPK, PABPN1, ATXN8, RHO, or C9orf72.
  • 25. The method of claim 1, wherein the transgene further comprises a first and second terminator.
  • 26. A method of integrating a transgene into an endogenous gene, the method comprising: a. administering a transgene, wherein the transgene comprises i. a splice donor sequence,ii. a partial coding sequence,iii. a promoter,iv. one RNA interference cassette, andv. optionally, a first and second homology arm or left and right transposon endb. administering at least one rare-cutting endonuclease or transposase targeted to a site within the endogenous gene, wherein the transgene is integrated within the endogenous gene.
  • 27. A method of integrating a transgene into an endogenous gene, the method comprising: a. administering a transgene, wherein the transgene comprises i. a left and right transposon endii. a first and second splice donor sequence,iii. a first and second partial coding sequence,iv. one bidirectional promoter or a first and second promoter, andv. optionally, a first and second terminatorb. administering a transposase wherein the transgene is integrated within the endogenous gene.
  • 28. A method of integrating a transgene into an endogenous gene, the method comprising: a. administering a transgene, wherein the transgene comprises i. a splice acceptor sequence,ii. a partial coding sequence,iii. a terminator, andiv. one RNA interference cassette, andv. optionally, a first and second homology arm or a left and right transposon endb. administering at least one rare-cutting endonuclease or transposase targeted to a site within the endogenous gene,
REFERENCE TO RELATED APPLICATIONS

This application claims priority to previously filed and co-pending applications U.S. Ser. No. 62/754,548, filed Nov. 1, 2018; U.S. Ser. No. 62/755,755, filed Nov. 5, 2018; U.S. Ser. No. 62/756,175, filed Nov. 6, 2018, and U.S. Ser. No. 62/799,615 filed Jan. 31, 2019, the contents of each of which are incorporated herein by reference in their entirety.

Provisional Applications (4)
Number Date Country
62754548 Nov 2018 US
62755755 Nov 2018 US
62756175 Nov 2018 US
62799615 Jan 2019 US