Patent Application
20230407298
The instant application contains a Sequence Listing which has been submitted in ASCII format via EFS-Web and is hereby incorporated by reference in its entirety. Said ASCII copy, created on Nov. 10, 2021, is named 38922-601_ST25.txt and is 4,824 bytes in size.
The motor neuron disease Amyotrophic Lateral Sclerosis (ALS) is a devastating neurodegenerative disease affecting multiple neuronal and glial subtypes within the motor cortex and spinal cord. Approximately 10% of ALS cases are familial (fALS) with more than 20 familial mutations identified to date. The most common genetic cause of ALS is a GGGGCC (G4C2) (SEQ ID NO: 1) hexanucleotide repeat expansion (HRE) in the C9orf72 gene, accounting for about 40% of familial ALS and 8% of sporadic ALS. However, 90% of ALS cases are sporadic (sALS) with no known underlying causative genetic mutation. Despite the heterogenous nature of ALS etiology, the nuclear clearing and cytoplasmic mislocalization and/or aggregates of TAR DNA Binding Protein (TDP-43), has emerged as a prominent pathological hallmark of endstage familial and sporadic disease (36-38).
While studies of genetic forms of ALS including C9orf72 have provided novel insights into underlying disease mechanisms and potential therapeutic strategies, these discoveries do not necessarily translate to sALS. The lack of preclinical animal model systems that faithfully reproduce the heterogenous nature of humans ALS highlights a major challenge in understanding 90% of ALS pathophysiology. However, the reprogramming of patient derived fibroblasts and peripheral blood mononuclear cells (PBMCs) into induced pluripotent stem cells (iPSCs) and then differentiated into neuronal and glial cells are being employed to model human disease (39-40). Studies have shown that C9orf72 iPSC derived motor neurons (iPSNs) recapitulate key pathological features of disease seen in postmortem human nervous system (41-42). Collectively, iPSNs provide a useful and relevant platform for studying mechanisms underlying ALS and other neurodegenerative diseases.
Molecular changes to the composition of the nuclear pore complex (NPC) have been identified as an early and key pathomechanism in C9orf72 disease (43). The NPC is comprised of multiple copies of ˜30 distinct Nups and can be classified as either: scaffold Nups and mobile Nups. Scaffold Nups build the 8-fold radial architecture of the NPC and secure it to the nuclear envelope. The NPC scaffold provides anchor points for FG-Nups which fill the central transport channel and mediate the nucleocytoplasmic exchange of macromolecules. Some Nups can also impact gene transcription (44-47). Given the critical roles of the NPC in maintaining overall cellular function, alterations in specific Nups may affect neuronal viability and subsequently give rise to disease pathology.
A subset of 8 Nups are significantly reduced within the NPC and nucleoplasm of C9orf72 and isolated postmortem nuclei. Moreover, steady state Nup mRNA levels, and Nup mRNA stability and association with actively translating polyribosome fractions are not altered in C9orf72 iPSNs (43). Collectively, these data suggest that early alterations in Nup protein homeostasis may underlie reduction of Nups and functional transport in C9orf72 ALS/FTD pathogenesis. However, the molecular pathway that underlies neuronal NPC disruption and whether this pathophysiology is more broadly applicable to sporadic disease remains unknown.
Work in several model systems including yeast supports the existence of molecular pathways that can impact Nup and NPC homeostasis within the nuclear envelope and nucleoplasm. The recruitment of the endosomal sorting complexes required for transport (ESCRT) machinery by LEM family inner nuclear membrane (INM) proteins has been implicated in the proteasomal degradation of misassembled Nups (48) and the sealing of defective NPCs (49-50). Analogous mechanisms likely function in non-neuronal mammalian cells to facilitate the removal of Nups and NPCs (51). Recent work in yeast reveals that both individual Nups and NPCs can also be targets of autophagy (52-53). Critically, the nuclear recruitment and/or retention of CHMP7 appears to be an initiating step in proper Nup and NPC homeostasis (49, 50, 54), although little is known regarding CHMP7 mediated Nup proteostasis in human neurons and altered Nup levels in neurodegeneration.
Using induced pluripotent stem cell (iPSC) derived spinal neurons (iPSNs) and postmortem human tissue the inventors now show that the nuclear envelope-specific ESCRT protein CHMP7 and its downstream effecter AAA-ATPase VPS4, are increased in C9orf72 and sALS nuclei. In accordance with the inventors' previous study suggesting that G4C2 repeat RNA initiates the reduction of key Nups, overexpression of G4C2 repeat RNA alone results in a nuclear increase in CHMP7 and VPS4 in iPSNs.
Importantly, using Trim Away (25) and antisense oligonucleotides (ASOs), the inventors now provide multiple lines of evidence that knockdown of CHMP7 mitigates the reduction of specific Nups from the nucleoplasm and NPCs in C9orf72 iPSNs. Additionally, CHMP7 ASOs mitigate defects in stathmin-2 splicing and alleviate downstream neuronal toxicity. Mechanistically, impaired nuclear export, but not increased nuclear recruitment, of CHMP7 leads to reduced expression of specific Nups and human neurons. Furthermore, impaired nuclear export of CHMP7 may be the result of G4C2 mediated reduction of the presence of CHMP7 in XPO1 complexes within neuronal nuclei. Additionally, CHMP7 mediated reduction in specific Nups results in alterations in stathmin-2 splicing and TDP-43 mislocalization. Collectively, these data show that in human neurons, aberrant activation of the ESCRT-III pathway as a result of pathologic G4C2 repeat RNA is a substantial and early contributor to Nup alterations in ALS. Additionally, these findings highlight the potential for CHMP7 as a therapeutic target in familial and sporadic ALS/FTD and related neurodegenerative diseases characterized by Nup reduction and TDP-43 pathology.
Thus, one embodiment, the present disclosure provides methods for screening compounds which reduce or inhibit CHMP7 in a cell or population of cells, such as a neuronal cell or population of neuronal cells. The methods comprise administering to a cell or population of cells (such as a neuronal cell or population of neuronal cells) at least one compound and determining if the compound reduces or inhibits CHMP7 expression in the cell or population of cells. Compounds that reduce or inhibit CHMP7 expression are then selected. Compounds that can screened and then selected pursuant to the above methods can include one or more of a small molecule or a pharmaceutically acceptable salt thereof, an antibody (such as a monoclonal antibody, a chimeric antibody, a humanized antibody, a fully human antibody, etc.) or antigen-binding fragment thereof, an oligonucleotide (e.g., antisense oligonucleotide or a pharmaceutically acceptable salt thereof), a small-interfering RNA (siRNA), a microRNA (miRNA), a peptide, a peptidomimetic, or any combinations thereof.
In another embodiment, the present disclosure provides methods of inhibiting CHMP7 expression in a cell or population of cells (such as a neuronal cell or population of neuronal cells). The methods comprise administering to the cells an effective amount of a CHMP7 inhibiting agent. In this aspect, the CHMP7 inhibiting agent can be one or more of a small molecule or a pharmaceutically acceptable salt thereof, an antibody (such as a monoclonal antibody, a chimeric antibody, a humanized antibody, a fully human antibody, etc.) or antigen-binding fragment thereof, an oligonucleotide (e.g., antisense oligonucleotide or a pharmaceutically acceptable salt thereof), a small-interfering RNA (siRNA), a microRNA (miRNA), a peptide, a peptidomimetic, or any combinations thereof. In yet further aspects, the CHMP7 inhibiting agent is one or more antisense oligonucleotides or pharmaceutically acceptable salts thereof.
In yet another embodiment, the present disclosure provides methods of treating one or more neurodegenerative diseases in a subject in need thereof. The methods comprise administering to the subject in need of treatment thereof an effective or therapeutically effective amount of at least one CHMP7 inhibiting agent. In this aspect, the CHMP7 inhibiting agent can be one or more of a small molecule or a pharmaceutically acceptable salt thereof, an antibody (such as a monoclonal antibody, a chimeric antibody, a humanized antibody, a fully human antibody, etc.) or antigen-binding fragment thereof, an oligonucleotide (e.g., antisense oligonucleotide or a pharmaceutically acceptable salt thereof), a small-interfering RNA (siRNA), a microRNA (miRNA), a peptide, a peptidomimetic, or any combinations thereof. In yet other aspects, the CHMP7 inhibiting agent is one or more antisense oligonucleotides or pharmaceutically acceptable salts thereof. In yet other further aspects of this method, the subject to be treated is a human. In still yet other aspects, the CHMP7 inhibiting agent is administered to the subject in an amount of about 0.001 mg/kg to about 1000 mg/kg. In yet further aspects, the neurodegenerative disease being treated is Amyotrophic Lateral Sclerosis (ALS), Huntington's disease, Alzheimer's disease, Parkinson's disease, Lewy body dementia, multiple sclerosis, or frontotemporal degeneration (FTD). In still further aspects, the neurodegenerative disease is ALS or FTD.
Section headings as used in this section and the entire disclosure herein are merely for organizational purposes and are not intended to be limiting.
The terms “comprise(s),” “include(s),” “having,” “has,” “can,” “contain(s),” and variants thereof, as used herein, are intended to be open-ended transitional phrases, terms, or words that do not preclude the possibility of additional acts or structures. The singular forms “a,” “and” and “the” include plural references unless the context clearly dictates otherwise. The present disclosure also contemplates other embodiments “comprising,” “consisting of” and “consisting essentially o” the embodiments or elements presented herein, whether explicitly set forth or not.
For the recitation of numeric ranges herein, each intervening number there between with the same degree of precision is explicitly contemplated. For example, for the range of 6-9, the numbers 7 and 8 are contemplated in addition to 6 and 9, and for the range 6.0-7.0, the number 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, and 7.0 are explicitly contemplated.
The term “administering” as used herein means providing a pharmaceutical agent or composition, such as a CHMP7 inhibiting agent (e.g., such as a CHMP7 antisense oligonucleotide), to a subject, and includes, but is not limited to, administering by a medical professional, self-administering, or a combination thereof. As used herein, the term “treating” a disease in a subject or “treating” a subject having a disease refers to subjecting the subject to a pharmaceutical treatment, e.g., the administration of a drug, such as a CHMP7 inhibiting agent (e.g., such as a CHMP7 antisense oligonucleotide or a pharmaceutically acceptable salt of an antisense oligonucleotide), or siRNA, such that at least one symptom of the disease (e.g., such as a neurodegenerative disease) is decreased or prevented from worsening.
The term “antibody” as used herein, refers to a molecule characterized by reacting specifically with an antigen in some way, where the antibody and the antigen are each defined in terms of the other. Antibody may refer to a complete antibody molecule or any fragment or region thereof, such as the heavy chain, the light chain, Fab region, and Fc region.
The term antigen-binding fragment” as used herein refers to antibody fragments that retain the ability to bind specifically to the antigen bound by the full-length antibody, e.g. fragments that retain one or more CDR regions. Examples of antigen-binding fragments include, but are not limited to, Fab, Fab′, F(ab′)2, and Fv fragments; diabodies; single-chain antibody molecules, e.g., sc-Fv; nanobodies and multispecific antibodies formed from antibody fragments.
The term “CHMP7” or “charged multivesicular body protein 7” as used interchangeably herein, refers to a human ESCRT-III-related protein 453 amino acids in length (see, GENBANK Accession No. Q8WUX9). CHMP7 contains an SNF7 domain and a distantly SNF7-related domain in its C-terminal half and N-terminal half. The term “CHMP7” as used herein refers not only to the 453 amino acid protein, but also to fragments of this protein (e.g., such fragments can have a length of 5 amino acids to 400 amino acids, 10 amino acids to 350 amino acids, 10 amino acids to 300 amino acids, 10 amino acids to 250 amino acids, 10 amino acids to 200 amino acids, 10 amino acids to 150 amino acids, 10 amino acids to 100 amino acids, 10 amino acids to 75 amino acids, 10 amino acids to 50 amino acids, 10 amino acids to 40 amino acids, 10 amino acids to 30 amino acids, or 10 amino acids to 20 amino acids) as well as CHMP7 DNA, CHMP7 cDNA, CHMP7 RNA, etc.
The term “CHMP7 inhibiting agent” as used herein refers to any compound or molecule that is capable of inhibiting or reducing CHMP7 (such as a CHMP7 protein or fragment thereof (e.g, such fragments can have a length of 5 amino acids to 400 amino acids, 10 amino acids to 350 amino acids, 10 amino acids to 300 amino acids, 10 amino acids to 250 amino acids, 10 amino acids to 200 amino acids, 10 amino acids to 150 amino acids, 10 amino acids to 100 amino acids, 10 amino acids to 75 amino acids, 10 amino acids to 50 amino acids, 10 amino acids to 40 amino acids, 10 amino acids to 30 amino acids, or 10 amino acids to 20 amino acids), CHMP7 DNA, CHMP7 cDNA, CHMP7 siRNA, CHMP7 miRNA, etc.) in a cell or population of cells, such as a neuronal cell or population of neuronal cells. Examples of CHMP7 inhibiting agents include, but are not limited to, one or more of a small molecule (including pharmaceutically acceptable salts thereof), an antibody (such as a monoclonal antibody, a chimeric antibody, a humanized antibody, a fully human antibody, etc.) or antigen binding fragments thereof, an oligonucleotide (e.g., antisense oligonucleotide or a pharmaceutically acceptable salt of an antisense oligonucleotide), a microRNA (miRNA), small-interfering RNA (siRNA), a peptide, a peptidomimetic, or any combinations thereof.
The term “contiguous” as used herein means immediately adjacent to each other.
The term “immediately adjacent” as used herein means there are no intervening elements between the immediately adjacent elements.
The term “inhibit” or “inhibits” means to decrease, suppress, attenuate, diminish, arrest, or stabilize the development or progression of a disease, disorder, or condition, the activity of a biological pathway, or a biological activity, such as the growth of a solid malignancy, e.g., by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99%, or even 100% compared to an untreated control subject, cell, biological pathway, or biological activity or compared to the target, such as a growth of a solid malignancy, in a subject before the subject is treated. By the term “decrease” is meant to inhibit, suppress, attenuate, diminish, arrest, or stabilize a symptom of a cancer disease, disorder, or condition. It will be appreciated that, although not precluded, treating a disease, disorder or condition does not require that the disease, disorder, condition or symptoms associated therewith be completely eliminated.
The phrase, “neurodegenerative disease” as used herein, refers to a disorder (including a neuropathy) associated with degeneration or dysfunction of neurons or other neural cells such as retinal ganglion cells. A neurodegenerative disease or disorder can be any disease or condition in which decreased function or dysfunction of neurons, or loss or neurons or other neural cells, can occur. Such conditions include, without limitation, glaucoma, and neurodegenerative disorders such as or associated with alcoholism, Alexander's disease, Alper's disease, Alzheimer's disease, Amyotrophic Lateral Sclerosis (Lou Gehrig's Disease), ataxia telangiectasia, Batten disease (also known as Spielmeyer-Vogt-Sjogren-Batten disease), bovine spongiform encephalopathy (BSE), Canavan disease, Cockayne syndrome, corticobasal degeneration, Creutzfeldt-Jakob disease, diabetic neuropathy, frontotemporal degeneration (FTD), Huntington's disease, HIV-associated dementia, Kennedy's disease, Krabbe's disease, Lewy body dementia, neuroborreliosis, Machado-Joseph disease (Spinocerebellar ataxia type 3), wet or dry macular degeneration, Multiple System Atrophy, multiple sclerosis, Niemann Pick disease, Parkinson's disease, Pelizaeus-Merzbacher Disease, photoreceptor degenerative diseases such as retinitis pigmentosa and associated diseases, Pick's disease, primary lateral sclerosis, prion diseases, Progressive Supranuclear Palsy, Refsum's disease, Sandhoffs disease, Schilder's disease, subacute combined degeneration of spinal cord secondary to pernicious anemia, Spielmeyer-Vogt-Sjogren-Batten disease (also known as Batten disease), spinocerebellar ataxia (multiple types with varying characteristics), spinal muscular atrophy, Steele-Richardson-Olszewski disease, and tabes dorsalis. Traumatic injury or other damage to neuronal cells (e.g., trauma due to accident, blunt-force injury, gunshot injury, spinal cord injury, ischemic conditions of the nervous system such as stroke, cell damage due to aging or oxidative stress, and the like) is also intended to be included within the language “neurodegenerative disease or disorder”. In certain embodiments, the neurodegenerative disease or disorder is a disease or disorder that is not associated with excessive angiogenesis, for example, glaucoma that is not neovascular glaucoma.
In some aspects, the neurodegenerative disease is Amyotrophic Lateral Sclerosis (Lou Gehrig's Disease). In other aspects, the neurodegenerative disease is Huntington's disease. In another aspect, the neurodegenerative disease is Alzheimer's disease. In another aspect, the neurodegenerative disease is Parkinson's disease. In yet another aspect, the neurodegenerative disease is Lewy body dementia. In still yet another aspect, the neurodegenerative disease is multiple sclerosis. In still yet another aspect, the neurodegenerative disease is frontotemporal degeneration (FTD).
The term “nucleic acid” as used herein, refers to molecules composed of monomeric nucleotides. A nucleic acid includes, but is not limited to, ribonucleic acids (RNA), deoxyribonucleic acids (DNA), single-stranded nucleic acids, double-stranded nucleic acids, small-interfering ribonucleic acids (siRNA), and microRNAs (miRNA).
As used herein, the term “nucleobase” means a heterocyclic moiety capable of pairing with a base of another nucleic acid.
The term “oligonucleotide” as used herein, refers to an oligomer or polymer of ribonucleic acid or deoxyribonucleic acid. This term includes oligonucleotides composed of naturally-occurring nucleobases, sugars and covalent intersugar (backbone) linkages as well as oligonucleotides having non-naturally-occurring portions which function similarly. Such modified or substituted oligonucleotides are often preferred over native forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced binding to target and increased stability in the presence of nucleases. The oligonucleotides of the present disclosure comprise from about 5 to about 50 contiguous nucleobases. In another aspect, the oligonucleotides comprise from about 8 to about 50 contiguous nucleobases. In yet another aspect, the oligonucleotides comprise from about 10 to about 50 contiguous nucleobases. In still yet another aspect, the oligonucleotides comprise from about 15 to about contiguous nucleobases. In still a further aspect, the oligonucleotides comprise from about 20 to about 50 contiguous nucleobases.
An example of an oligonucleotide is an antisense contiguous oligonucleotide. The antisense oligonucleotides of the present disclosure, including pharmaceutically acceptable salts thereof, comprise from about 5 to about 50 contiguous nucleobases. In another aspect, the antisense oligonucleotides comprise from about 8 to about 50 contiguous nucleobases. In yet another aspect, the antisense oligonucleotides comprise from about 10 to about 50 contiguous nucleobases. In still yet another aspect, the antisense oligonucleotides comprise from about 15 to about 50 contiguous nucleobases. In still a further aspect, the antisense oligonucleotides comprise from about 20 to about 50 contiguous nucleobases.
As is known in the art, a nucleoside is a base-sugar combination. The base portion of the nucleoside is normally a heterocyclic base. The two most common classes of such heterocyclic bases are the purines and the pyrimidines. Nucleotides are nucleosides that further include a phosphate group covalently linked to the sugar portion of the nucleoside. For those nucleosides that include a pentofuranosyl sugar, the phosphate group can be linked to either the 2=, 3= or 5=hydroxyl moiety of the sugar. In forming oligonucleotides, the phosphate groups covalently link adjacent nucleosides to one another to form a linear polymeric compound. In turn the respective ends of this linear polymeric structure can be further joined to form a circular structure, however, open linear structures are generally preferred. Within the oligonucleotide structure, the phosphate groups are commonly referred to as forming the internucleoside backbone of the oligonucleotide. The normal linkage or backbone of RNA and DNA is a 3= to 5=phosphodiester linkage.
Additionally, the antisense oligonucleotides of the present disclosure or pharmaceutically acceptable salts thereof may be single stranded or double-stranded (such as dsRNA molecules).
The terms “parenteral administration” and “administered parenterally” as used herein mean modes of administration other than enteral and topical administration, usually by injection, and includes, without limitation, intravenous, intramuscular, intarterial, intrathecal, intracapsular, intraorbital, intraocular, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, subcapsular, subarachnoid, intraspinal and intrasternal injection and infusion.
The term “peptide” means a molecule formed by linking at least two amino acids by amide bonds. Without limitation, as used herein, peptide refers to polypeptides and proteins. Peptides for use in the present disclosure can have a length of 5 amino acids to 500 amino acids, 10 amino acids to 400 amino acids, 10 amino acids to 300 amino acids, 10 amino acids to 200 amino acids, 10 amino acids to 100 amino acids, 10 amino acids to 90 amino acids, 10 amino acids to 80 amino acids, 10 amino acids to 70 amino acids 10 amino acids to 60 amino acids, 10 amino acids to 50 amino acids or 10 amino acids to 40 amino acids. A “peptidomimetic” is a type of peptide that includes unnatural or synthetic amino acids, including D and L isomers and amino acid analogs linked by amide linkages or other bonds, e.g., ester, ether, etc. “Peptidomimetics” also include organic molecules not obviously analogous to peptides, including, for example, aptamers.
The term “pharmaceutically acceptable” is employed herein to refer to those compounds, materials, compositions, and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio.
The term “pharmaceutically acceptable carrier” as used herein means a pharmaceutically acceptable material, composition or vehicle, such as a liquid or solid filler, diluent, excipient, or solvent encapsulating material, involved in carrying or transporting the subject compound from one organ, or portion of the body, to another organ, or portion of the body. Each carrier must be “acceptable” in the sense of being compatible with the other ingredients of the formulation and not injurious to the patient. Some examples of materials which can serve as pharmaceutically acceptable carriers include: (1) sugars, such as lactose, glucose and sucrose; (2) starches, such as corn starch and potato starch; (3) cellulose, and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; (4) powdered tragacanth; (5) malt; (6) gelatin; (7) talc; (8) excipients, such as cocoa butter and suppository waxes; (9) oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; (10) glycols, such as propylene glycol; (11) polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol; (12) esters, such as ethyl oleate and ethyl laurate; (13) agar; (14) buffering agents, such as magnesium hydroxide and aluminum hydroxide; (15) alginic acid; (16) pyrogen-free water; (17) isotonic saline; (18) Ringer's solution; (19) ethyl alcohol; (20) pH buffered solutions; (21) polyesters, polycarbonates and/or polyanhydrides; and (22) other non-toxic compatible substances employed in pharmaceutical formulations.
The term “pharmaceutically acceptable salts” refers to the relatively non-toxic, inorganic and organic salts of compounds, including small molecules and oligonucleotides, such as antisense oligonucleotides
The terms “prevent,” “preventing,” “prevention,” “prophylactic treatment,” and the like refer to reducing the probability of developing a disease, disorder, or condition in a subject, who does not have, but is at risk of or susceptible to developing a disease, disorder, or condition
A “subject” can include a human subject for medical purposes, such as for the treatment of an existing disease, disorder, condition or the prophylactic treatment for preventing the onset of a disease, disorder, or condition or an animal subject for medical, veterinary purposes, or developmental purposes. Suitable animal subjects include mammals including, but not limited to, primates, e.g., humans, monkeys, apes, gibbons, chimpanzees, orangutans, macaques and the like; bovines, e.g., cattle, oxen, and the like; ovines, e.g., sheep and the like; caprines, e.g., goats and the like; porcines, e.g., pigs, hogs, and the like; equines, e.g., horses, donkeys, zebras, and the like; felines, including wild and domestic cats; canines, including dogs; lagomorphs, including rabbits, hares, and the like; and rodents, including mice, rats, guinea pigs, and the like. An animal may be a transgenic animal. In some embodiments, the subject is a human including, but not limited to, fetal, neonatal, infant, juvenile, and adult subjects. Further, a “subject” can include a patient afflicted with or suspected of being afflicted with a disease, disorder, or condition. Thus, the terms “subject” and “patient” are used interchangeably herein. Subjects also include animal disease models (e.g., rats or mice used in experiments, and the like).
The term “subject suspected of having” means a subject exhibiting one or more clinical indicators of a disease or condition. In certain embodiments, the disease or condition is a neurodegenerative disease.
The term “subject in need thereof” means a subject identified as in need of a therapy or treatment.
The terms “systemic administration,” “administered systemically,” “peripheral administration,” and “administered peripherally” mean the administration of a compound, drug or other material other than directly into the central nervous system, such that it enters the patient's system and, thus, is subject to metabolism and other like processes, for example, subcutaneous administration.
The term “therapeutically effective amount” or “effective amount” as used interchangeably herein refers to an amount sufficient to produce the desired effect, e.g., to reduce or ameliorate the severity, duration, progression, or onset of a disease, condition, or disorder (e.g., a disease, condition, or disorder related to loss of neuronal cells or cell function, such as for example, a neurodegenerative disease), or one or more symptoms thereof; prevent the advancement of a disease, condition, or disorder; cause the regression of a disease, condition, or disorder; prevent the recurrence, development, onset or progression of a symptom associated with a disease, condition, or disorder; or enhance or improve the prophylactic or therapeutic effect(s) of another therapy.
In some aspects, the effective amount or therapeutically effective amount of a compound (such as a CHMP7 inhibiting agent) will depend on its therapeutic index, solubility, and the like. For example, certain compounds discovered by the methods of the present disclosure may be administered in a sufficient amount to produce a reasonable benefit/risk ratio applicable to such treatment. By way of example, a CHMP7 inhibiting agent may be administered in a sufficient amount to produce a reasonable benefit/risk ratio applicable to such treatment.
In some other aspects, an effective amount or therapeutically effective amount of a CHMP7 inhibiting agent (e.g., such as a CHMP7 antisense oligonucleotide and/or siRNA) according to this disclosure can range from, e.g., about 0.001 mg/kg to about 1000 mg/kg, or in certain embodiments, about 0.01 mg/kg to about 100 mg/kg, or in certain embodiments, about 0.1 mg/kg to about 50 mg/kg. Effective doses will also vary, as recognized by those skilled in the art, depending on the disorder treated, route of administration, excipient usage, the age and sex of the subject, and the possibility of co-usage with other therapeutic treatments such as use of other agents.
The term “therapeutic effect” refers to a local or systemic effect in animals, particularly mammals, and more particularly humans, caused by a pharmacologically active substance, such as, for example a CHMP7 inhibiting agent. The term thus means any substance (e.g., such as a CHMP7 inhibiting agent) intended for use in the diagnosis, cure, mitigation, treatment or prevention of disease or in the enhancement of desirable physical or mental development and conditions in an animal, such as a human.
The term “treating” a disease in a subject or “treating” a subject having a disease refers to subjecting the subject to a pharmaceutical treatment, e.g., the administration of a drug, such that at least one symptom of the disease is decreased or prevented from worsening.
The following examples have been included to provide guidance to one of ordinary skill in the art for practicing representative embodiments of the presently disclosed subject matter. In light of the present disclosure and the general level of skill in the art, those of skill can appreciate that the following examples are intended to be exemplary only and that numerous changes, modifications, and alterations can be employed without departing from the scope of the presently disclosed subject matter. The synthetic descriptions and specific examples that follow are only intended for the purposes of illustration, and are not to be construed as limiting in any manner to make compounds of the disclosure by other methods.
In one embodiment, the present disclosure relates to methods for screening compounds which: (a) bind to CHMP7 (such as a CHMP7 protein, CHMP7 DNA, CHMP7 cDNA, CHMP7 RNA, etc.) with a certain binding affinity; (b) inhibit the polymerization of CHMP7, (c) inhibit the intranuclear accumulation of CHMP7 and/or (d) reduce or inhibit CHMP7 expression in at least one cell or a population of cells, such as, for example, at least one neuronal cell or a population of neuronal cells or a population of other nervous system cell such as astrocytes, oligodendroglia or microglia. Compounds that can be screened and selected pursuant to the methods described herein are at least one of a small molecule or a pharmaceutically acceptable salt thereof, an antibody (such as a monoclonal antibody, a chimeric antibody, a humanized antibody, a fully human antibody, etc.) or antigen-binding fragments thereof, an oligonucleotide (such as an antisense oligonucleotide or a pharmaceutically acceptable salt thereof), a small-interfering RNA (siRNA), a microRNA (miRNA), a peptide, a peptidomimetic, or any combinations thereof.
In one aspect, the screening method involves measuring the binding of a compound to CHMP7. In this method, the compound to be tested is contacted with CHMP7 (such as a CHMP7 protein or fragment thereof, CHMP7 DNA, CHMP7 cDNA, CHMP7 RNA, etc.) and the binding (or lack thereof) measured using routine techniques known in the art. A compound may be identified (and selected) as a compound that binds to CHMP7 (such as a CHMP7 protein or fragment thereof, CHMP7 DNA, CHMP7 cDNA, CHMP7 RNA, etc.) if it has a particular binding affinity to CHMP7. In some aspects, the compound may be identified as a compound that specifically binds to CHMP7 (such as a CHMP7 protein, CHMP7 DNA, CHMP7 cDNA, CHMP7 RNA, etc.). For example, a compound that binds to CHMP7 may have a dissociation constant (Kd) in the micromolar range; or, preferably, in the range of 100 nM to 1 pM. As mentioned, the binding of a compound to CHMP7 can be measured by using routine techniques in the art, such as, for example, Biacore, ChemoProteomics, Microscale Thermophoresis or any other techniques or combination of techniques known in the art.
In another aspect, the screening method involves contacting a compound with at least one cell or population of cells (e.g., a neuronal cell or population of neuronal cells) that expresses CHMP7 and determining whether the compound reduces or inhibits CHMP7 expression in the cell or population of cells. The expression of CHMP7 in the presence and absence of the test compound may be measured using routine techniques in the art, such as, for example, (q)PCR, Western Blot, Mass spectroscopy or any other techniques or combination of techniques known in the art. Compounds that reduce or inhibit CHMP7 can be selected for further testing and use in other methods described herein.
The screening methods described herein may additionally comprise the step of comparing the compound being tested to a control. Said control may be an inactive test compound, wherein said inactive test compound is a compound that (a) does not reduce the expression and/or activity of CHMP7; and/or (b) does not bind to CHMP7.
In another aspect, a compound that reduces the expression of CHMP7 in a cell or population of cells (e.g., a neuronal cell or population of neuronal cells) is identified (and can be selected) as a compound that prevents, ameliorates and/or inhibits (i.e., treats) a neurodegenerative disease. In another aspect, a compound that reduces the activity of CHMP7 is identified (and can be selected) as a compound that prevents, ameliorates and/or inhibits (i.e., treats) a neurodegenerative disease.
The above screening methods can lead to the identification of a compound that prevents, ameliorates and/or inhibits a neurodegenerative disease. Such compounds can be selected and used to ameliorate and/or inhibit (namely, treats) a neurodegenerative disease. Thus, the herein provided screening methods are useful in the identification and selection of compounds for treating a neurodegenerative disease.
In another embodiment, the present disclosure relates to at least one CHMP7 inhibiting agent. A CHMP7 inhibiting agent can be a compound which binds to CHMP7 (such as a CHMP7 protein, CHMP7 DNA, CHMP7 cDNA, CHMP7 RNA, etc.) with a certain binding affinity; and/or (b) reduces or inhibits CHMP7 (such as a CHMP7 protein, CHMP7 DNA, CHMP7 cDNA, CHMP7 RNA, etc.) expression in at least one cell or a population of cells. Such compounds can include the compounds identified and selected in Section 2, herein. In another aspect, the CHMP7 inhibiting agent is a CHMP7 inhibiting agent known in the art.
The CHMP7 inhibiting agent can be least one of a small molecule or a pharmaceutically acceptable salt thereof, an antibody (such as a monoclonal antibody, a chimeric antibody, a humanized antibody, a fully human antibody, etc.) or antigen-binding fragment thereof, an oligonucleotide (such as an antisense oligonucleotide or a pharmaceutically acceptable salt thereof), a small interfering RNA (siRNA), a microRNA (miRNA), a peptide, a peptidomimetic, or any combinations thereof. In one aspect, the CHMP7 inhibiting agent is a small molecule or a pharmaceutically acceptable salt thereof. In another aspect, the CHMP7 inhibiting agent is an antibody or an antigen-binding fragment thereof. In yet another aspect, the CHMP7 inhibiting agent is an oligonucleotide. In yet another aspect, the CHMP7 inhibiting agent is an antisense oligonucleotide or a pharmaceutically acceptable salt thereof. In still another aspect, the CHMP7 inhibiting agent is a siRNA. In still another aspect, the CHMP7 inhibiting agent is a small interfering RNA. In still another aspect, the CHMP7 inhibiting agent is a microRNA. In yet a further aspect, the CHMP7 inhibiting agent is a peptide. In yet still a further aspect, the CHMP7 inhibiting agent is a peptidometric. In some aspects, the CHMP7 inhibiting agent is an oligonucleotide. In another aspect, the CHMP7 inhibiting agent is an antisense oligonucleotide or a pharmaceutically acceptable salt thereof. Examples of antisense oligonucleotides which are CHMP7 inhibiting agents and can be used in the methods described herein include those described in Coyne et al., “Nuclear accumulation of CHMP7 initiates nuclear pore complex injury and subsequent TDP-43 dysfunction in sporadic and familial AILS” Science Translational Medicine, Vol. 13, No. 604 (2021) and include one or more of the following: CCTATAGGACTATCCAGGAA (SEQ ID NO:2), GAAAACGGTTTCCACTGTAT (SEQ ID NO:3), TGTTACCCTCAGATACCGCC (SEQ ID NO:4), ATGTGATGCTATTAATAGGA (SEQ ID NO:14) and any combinations thereof.
In some aspects, the CHMP7 inhibiting agent is a siRNA. Examples of siRNA sequences which are CHMP7 inhibiting agents include one or more of the following:
In another aspect, the present disclosure provides pharmaceutically acceptable compositions which comprise a therapeutically effective amount of one or more such CHMP7 inhibiting agents (e.g., an active agent or first active agent) described above, formulated together with one or more pharmaceutically acceptable carriers (additives) and/or diluents.
As described in detail below, the pharmaceutical compositions of the present disclosure may be specially formulated for administration in solid or liquid form, including those adapted for the following: (1) oral administration, for example, drenches (aqueous or non-aqueous solutions or suspensions), tablets, e.g., those targeted for buccal, sublingual, and systemic absorption, boluses, powders, granules, pastes for application to the tongue; (2) parenteral administration, for example, by subcutaneous, intramuscular, intravenous, intrathecal, or epidural injection as, for example, a sterile solution or suspension, or sustained-release formulation; (3) topical application, for example, as a cream, ointment, or a controlled-release patch or spray applied to the skin; (4) intravaginally or intrarectally, for example, as a pessary, cream or foam; (5) sublingually; (6) ocularly; (7) transdermally; or (8) nasally.
Wetting agents, emulsifiers and lubricants, such as sodium lauryl sulfate and magnesium stearate, as well as coloring agents, release agents, coating agents, sweetening, flavoring and perfuming agents, preservatives and antioxidants can also be present in the compositions.
Examples of pharmaceutically acceptable antioxidants include: (1) water soluble antioxidants, such as ascorbic acid, cysteine hydrochloride, sodium bisulfate, sodium metabisulfite, sodium sulfite and the like; (2) oil-soluble antioxidants, such as ascorbyl palmitate, butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), lecithin, propyl gallate, alpha-tocopherol, and the like; and (3) metal chelating agents, such as citric acid, ethylenediamine tetraacetic acid (EDTA), sorbitol, tartaric acid, phosphoric acid, and the like.
CHMP7 inhibiting agent compositions include those suitable for oral, nasal, topical (including buccal and sublingual), rectal, vaginal and/or parenteral administration. The formulations may conveniently be presented in unit dosage form and may be prepared by any methods well known in the art of pharmacy. The amount of CHMP7 inhibiting agent which can be combined with a carrier material to produce a single dosage form will vary depending upon the host being treated and the particular mode of administration. The amount of CHMP7 inhibiting agent which can be combined with a carrier material to produce a single dosage form will generally be that amount of the compound which produces a therapeutic effect.
In certain embodiments, a formulation of CHMP7 inhibiting agent compositions can comprise other carriers to allow more stability, to allow more stability, different releasing properties in vivo, targeting to a specific site, or any other desired characteristic that will allow more effective delivery of the complex to a subject or a target in a subject, such as, without limitation, liposomes, microspheres, nanospheres, nanoparticles, bubbles, micelle forming agents, e.g., bile acids, and polymeric carriers, e.g., polyesters and polyanhydrides. In certain embodiments, an aforementioned composition renders orally bioavailable the CHMP7 inhibiting agent of the present disclosure.
Liquid dosage formulations of CHMP7 inhibiting agent compositions include pharmaceutically acceptable emulsions, microemulsions, solutions, suspensions, syrups and elixirs. In addition to the active ingredient, the liquid dosage forms may contain inert diluents commonly used in the art, such as, for example, water or other solvents, solubilizing agents and emulsifiers, such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, oils (in particular, cottonseed, groundnut, corn, germ, olive, castor and sesame oils), glycerol, tetrahydrofuryl alcohol, polyethylene glycols and fatty acid esters of sorbitan, and mixtures thereof.
Besides inert diluents, the oral compositions can also include adjuvants such as wetting agents, emulsifying and suspending agents, sweetening, flavoring, coloring, perfuming and preservative agents.
Suspensions, in addition to the active compounds, may contain suspending agents as, for example, ethoxylated isostearyl alcohols, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar-agar and tragacanth, and mixtures thereof.
Formulations suitable for oral administration may be in the form of capsules, cachets, pills, tablets, lozenges (using a flavored basis, usually sucrose and acacia or tragacanth), powders, granules, or as a solution or a suspension in an aqueous or non-aqueous liquid, or as an oil-in-water or water-in-oil liquid emulsion, or as an elixir or syrup, or as pastilles (using an inert base, such as gelatin and glycerin, or sucrose and acacia) and/or as mouth washes and the like, each containing a predetermined amount of an active ingredient. A CHMP7 inhibiting agent composition of the present disclosure may also be administered as a bolus, electuary or paste.
In solid dosage forms (e.g., capsules, tablets, pills, dragees, powders, granules and the like), the is mixed with one or more pharmaceutically acceptable carriers, such as sodium citrate or dicalcium phosphate, and/or any of the following: (1) fillers or extenders, such as starches, lactose, sucrose, glucose, mannitol, and/or silicic acid; (2) binders, such as, for example, carboxymethylcellulose, alginates, gelatin, polyvinyl pyrrolidone, sucrose and/or acacia; (3) humectants, such as glycerol; (4) disintegrating agents, such as agar-agar, calcium carbonate, potato or tapioca starch, alginic acid, certain silicates, and sodium carbonate; (5) solution retarding agents, such as paraffin; (6) absorption accelerators, such as quaternary ammonium compounds; (7) wetting agents, such as, for example, cetyl alcohol, glycerol monostearate, and non-ionic surfactants; (8) absorbents, such as kaolin and bentonite clay; (9) lubricants, such a talc, calcium stearate, magnesium stearate, solid polyethylene glycols, sodium lauryl sulfate, and mixtures thereof; and (10) coloring agents. In the case of capsules, tablets and pills, the compositions may also comprise buffering agents. Solid compositions of a similar type may also be employed as fillers in soft and hard-shelled gelatin capsules using such excipients as lactose or milk sugars, as well as high molecular weight polyethylene glycols and the like.
A tablet may be made by compression or molding, optionally with one or more accessory ingredients. Compressed tablets may be prepared using binder (for example, gelatin or hydroxypropylmethyl cellulose), lubricant, inert diluent, preservative, disintegrant (for example, sodium starch glycolate or cross-linked sodium carboxymethyl cellulose), surface-active or dispersing agent. Molded tablets may be made by molding in a suitable machine a mixture of the powdered compound moistened with an inert liquid diluent.
The tablets, and other solid dosage forms, such as dragees, capsules, pills and granules, may optionally be scored or prepared with coatings and shells, such as enteric coatings and other coatings well known in the pharmaceutical-formulating art. They may also be formulated so as to provide slow or controlled release of the active ingredient therein using, for example, hydroxypropylmethyl cellulose in varying proportions to provide the desired release profile, other polymer matrices, liposomes and/or microspheres. Compositions may also be formulated for rapid release, e.g., freeze-dried. They may be sterilized by, for example, filtration through a bacteria-retaining filter, or by incorporating sterilizing agents in the form of sterile solid compositions which can be dissolved in sterile water, or some other sterile injectable medium immediately before use. These compositions may also optionally contain opacifying agents and may be of a composition that they release the active ingredient(s) only, or preferentially, in a certain portion of the gastrointestinal tract, optionally, in a delayed manner. Examples of embedding compositions which can be used include polymeric substances and waxes. The active ingredient can also be in micro-encapsulated form, if appropriate, with one or more of the above-described excipients.
Formulations for rectal or vaginal administration may be presented as a suppository, which may be prepared by mixing one or more compounds of the disclosure with one or more suitable nonirritating excipients or carriers comprising, for example, cocoa butter, polyethylene glycol, a suppository wax or a salicylate, and which is solid at room temperature, but liquid at body temperature and, therefore, will melt in the rectum or vaginal cavity and release the active compound.
Formulations which are suitable for vaginal administration also include pessaries, tampons, creams, gels, pastes, foams or spray formulations containing such carriers as are known in the art to be appropriate.
Dosage forms for the topical or transdermal administration of a CHMP7 inhibiting agent composition of the present disclosure include powders, sprays, ointments, pastes, creams, lotions, gels, solutions, patches and inhalants. The active compound may be mixed under sterile conditions with a pharmaceutically acceptable carrier, and with any preservatives, buffers, or propellants which may be required.
The ointments, pastes, creams and gels may contain, in addition to an active compound of this disclosure, excipients, such as animal and vegetable fats, oils, waxes, paraffins, starch, tragacanth, cellulose derivatives, polyethylene glycols, silicones, bentonites, silicic acid, talc and zinc oxide, or mixtures thereof.
Powders and sprays can contain excipients such as lactose, talc, silicic acid, aluminum hydroxide, calcium silicates and polyamide powder, or mixtures of these substances. Sprays can additionally contain customary propellants, such as chlorofluorohydrocarbons and volatile unsubstituted hydrocarbons, such as butane and propane.
Transdermal patches have the added advantage of providing controlled delivery to the body. Such dosage forms can be made by dissolving or dispersing the compound in the proper medium. Absorption enhancers can also be used to increase the flux of the compound across the skin. The rate of such flux can be controlled by either providing a rate controlling membrane or dispersing the compound in a polymer matrix or gel.
Ophthalmic formulations, eye ointments, powders, solutions and the like, are also contemplated as being within the scope of this disclosure.
Pharmaceutical compositions suitable for parenteral administration can comprise sterile isotonic aqueous or nonaqueous solutions, dispersions, suspensions or emulsions, or sterile powders which may be reconstituted into sterile injectable solutions or dispersions just prior to use, which may contain sugars, alcohols, antioxidants, buffers, bacteriostats, solutes which render the formulation isotonic with the blood of the intended recipient or suspending or thickening agents.
Examples of suitable aqueous and nonaqueous carriers which may be employed in the pharmaceutical compositions of the disclosure include water, ethanol, polyols (such as glycerol, propylene glycol, polyethylene glycol, and the like), and suitable mixtures thereof, vegetable oils, such as olive oil, and injectable organic esters, such as ethyl oleate. Proper fluidity can be maintained, for example, by the use of coating materials, such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants.
In certain embodiments, the above-described pharmaceutical compositions can be combined with other pharmacologically active compounds (“second active agents”) known in the art according to the methods and compositions provided herein. Second active agents can be large molecules (e.g., proteins) or small molecules (e.g., synthetic inorganic, organometallic, or organic molecules). In one embodiment, second active agents independently or synergistically help to treat cancer. Examples of second active agents with mechanism independent of CHMP7 inhibition include one or more of immunotherapy, hormonal therapy, radiation therapy, HER2/neu receptor antagonists, vincristine, cyclophosphamide, cytarabine, etoposide, and/or doxarubicin.
In another embodiment, the present disclosure relates to methods of inhibiting CHMP7 expression in a cell or population of cells, such as a neuronal cell or population of neuronal cells, in a subject in need of treatment thereof. In one aspect, the method involves administering to a cell or population of cells an effective amount or therapeutically effective amount of at least one CHMP7 inhibiting agent or a composition comprising an effective amount or therapeutically effective amount of at least one CHMP7 inhibiting agent to a subject in need of treatment thereof and then determining, detecting and/or measuring the inhibition of CHMP7 expression using routine techniques known in the art, such as, for example, (q)PCR, Western Blot, Mass spectroscopy or any other techniques or combination of techniques known in the art. In some aspects, the subject is suffering from at least one neurodegenerative disease.
An effective amount or therapeutically effective amount of a CHMP7 inhibiting agent (e.g., such as a CHMP7 antisense oligonucleotide and/or siRNA) or a composition containing an effective amount or a therapeutically effective amount of a CHMP7 inhibiting agent used in said methods can range from about 0.001 mg/kg to about 1000 mg/kg, or in certain embodiments, about 0.01 mg/kg to about 100 mg/kg, or in certain embodiments, about 0.1 mg/kg to about 50 mg/kg.
The effective amount or therapeutically effective amount of a CHMP7 inhibiting agent (e.g., such as a CHMP7 antisense oligonucleotide and/or siRNA) or a composition containing an effective amount or a therapeutically effective amount of a CHMP7 inhibiting agent used in the methods herein can be administered orally, parenterally, topically, intravaginally or intrarectally, sublingually, ocularly, transdermally or nasally, using routine techniques known in the art.
In another embodiment, the present disclosure relates to methods of treating at least one neurodegenerative disease in a subject in need of treatment thereof. In one aspect, the method involves administering to a subject suffering or believed to be suffering from at least one neurodegenerative disease (and in need of treatment thereof), an effective amount or therapeutically effective amount of at least one CHMP7 inhibiting agent or a composition comprising an effective or therapeutically effective amount of at least one CHMP7 inhibiting agent to treat the neurodegenerative disease. Any neurodegenerative disease can be treated pursuant to the methods described herein. In some aspects, the neurodegenerative disease is Amyotrophic Lateral Sclerosis (Lou Gehrig's Disease). In other aspects, the neurodegenerative disease is Huntington's disease. In another aspect, the neurodegenerative disease is Alzheimer's disease. In another aspect, the neurodegenerative disease is Parkinson's disease. In yet another aspect, the neurodegenerative disease is Lewy body dementia. In still yet another aspect, the neurodegenerative disease is multiple sclerosis. In still yet another aspect, the neurodegenerative disease is frontotemporal degeneration (FTD).
An effective amount or therapeutically effective amount of a CHMP7 inhibiting agent (e.g., such as a CHMP7 antisense oligonucleotide and/or siRNA) or a composition containing an effective amount or a therapeutically effective amount of a CHMP7 inhibiting agent used in said methods can range from about 0.001 mg/kg to about 1000 mg/kg, or in certain embodiments, about 0.01 mg/kg to about 100 mg/kg, or in certain embodiments, about 0.1 mg/kg to about 50 mg/kg.
The effective amount or therapeutically effective amount of a CHMP7 inhibiting agent (e.g., such as a CHMP7 antisense oligonucleotide and/or siRNA) or a composition containing an effective amount or a therapeutically effective amount of a CHMP7 inhibiting agent used in the methods herein can be administered orally, parenterally, topically, intravaginally or intrarectally, sublingually, ocularly, transdermally or nasally, using routine techniques known in the art.
Materials and Methods
The below materials and methods were used for Examples 2-7
iPSC Derived Neuronal Differentiation
C9orf72 and non-neurological control iPSC lines were obtained from the Answer ALS repository at Cedars-Sinai (See Table A for demographics). Feeder-free iPSCs were maintained on Matrigel with MTeSR and maintained according to Cedars Sinai SOP. iPSCs were differentiated into spinal neurons using the previously described direct induced motor neuron (diMNs) protocol (6). All cells were maintained at 37° C. with 5% CO2. iPSCs and iPSNs routinely tested negative for mycoplasma.
Leptomycin B and ASO Treatment of iPSC Derived Neurons Leptomycin B: On day 18 of differentiation, 10 nM Leptomycin B (LMB, Cayman Chemicals) was added to the culture media and iPSNs were returned to the incubator for ˜18 hours before downstream analyses were conducted. Ethanol was used as vehicle control.
C9orf72 repeat ASO: Sense strand targeting G4C2 ASO (619251) (13) was generously provided by Ionis Pharmaceuticals. On day 20 of differentiation, 5 μM sense targeting ASO was added to the culture media. Media was exchanged and ASO replaced on day 22 of differentiation and downstream analyses were performed on day 25 of differentiation. CHMP7 ASO: Non-targeting scrambled control (676630): CCTATAGGACTATCCAGGAA (SEQ ID NO: 2), CHMP7 ASO 1 (1508916): GAAAACGGTTTCCACTGTAT (SEQ ID NO: 3), CHMP7 ASO 2 (1508917): TGTTACCCTCAGATACCGCC (SEQ ID NO: 4), and CHMP7 ASO 3 (1508918): ATGTGATGCTATTAATAGGA (SEQ ID NO:14) were generously provided by Ionis Pharmaceuticals. On day 25 of differentiation, ASOs were added to the culture media at concentrations of 1, 5, or 10 μM as indicated in Description of the Figures. Media was exchanged and ASO replaced every 3 days until day 40 of differentiation.
Nuclei Isolation
Nuclei were isolated from iPSNs and postmortem human brain and spinal cord tissue using the Nuclei Pure Prep Nuclei Isolation Kit (Sigma Aldrich) following manufacturer protocol as previously described (13). Briefly, iPSN lysates were prepared by rinsing iPSNs with 1×PBS, adding mL supplied lysis buffer supplemented with DTT and Triton X-100 directly to each well, and harvesting iPSNs with a cell scraper. Postmortem brain and spinal cord lysates were prepared by homogenizing 150 mg fresh frozen tissue directly in supplied lysis buffer with a dounce homogenizer. All lysates were transferred to a 50 mL conical tube and vortexed. Sucrose gradients were assembled following manufacturer protocol. A 1.85 M sucrose gradient was used to enrich for neuronal nuclei. Samples were centrifuged at 15,600 rpm and 4° C. using a Swi32T swinging bucket rotor and Beckman ultracentrifuge (Beckman Coulter) for 45 minutes. The supernatant was discarded, and the remaining nuclei pellet was resuspended in 1 mL of supplied nuclei storage buffer to wash the nuclei of any remaining sucrose. Resuspended nuclei were centrifuged at 2500 rpm and 4° C. for 5 minutes. The supernatant was once again discarded, and the resulting nuclei pellet was vortexed in 1 mL of supplied nuclei storage buffer to resuspend for downstream imaging analysis. For western blots, washed nuclei were lysed in RIPA buffer as described below.
Super Resolution Structured Illumination Microscopy
Nuclei staining and super resolution imaging was performed as previously described (6). Following nuclei isolation, 10-50 μL of final nuclei/storage buffer suspension was centrifuged onto collagen coated (1 mg/mL; Advanced Biomatrix) slides with a CytoSpin 4 centrifuge (Thermo Fisher Scientific). Nuclei were immediately fixed with 4% PFA for 5 minutes, washed with 1×PBS 3×10 minutes and permeabilized with 1×PBST containing 0.1% Triton X-100 for 15 minutes. Nuclei were then blocked with 10% normal goat serum diluted in 1×PBS for 1 hour at room temperature and incubated in primary antibody diluted in block (10% normal goat serum in 1×PBS) overnight at 4° C. (See Table B for antibody information). After 16-18 hours, nuclei were washed with 1×PBS 3×10 minutes, incubated in secondary antibody diluted in block (10% normal goat serum in 1×PBS) for 1 hour at room temperature (See Table B for antibody information). Nuclei were washed with 1×PBS 3×10 minutes and cover slipped using Prolong Gold Antifade Reagent (Invitrogen) and 18 mm×18 mm 1.5 high tolerance coverslips (MatTek). NeuN or GFP positive nuclei (see Description of the Figures) were identified via microscope eye pieces. A single z section ˜110 nm thick was acquired by widefield imaging to confirm NeuN or GFP positivity. The immunostained Nup or ESCRT-III protein was subsequently imaged by super resolution structured illumination microscopy (SIM) using a Zeiss ELYRA 51. For each image, 5 grid rotations and optimal z sectioning parameters were employed. Following image acquisition, SIM images were reconstructed using default SIM processing parameters with Zeiss Zen Black 2.3 SP1 software. Automated nucleoporin spot and volume analysis was conducted as previously described (6, 26) using Imaris version 9.2.0 (Bitplane) and the 3D suite plugin in FIJI version 1.52p. Nucleoporin spots were counted using automated spot detection. A Bayesian classifier taking into account volume, average intensity, and contrast features was applied to detect and segment individual spots. The total number of nucleoporin spots was determined using a 3D-rendering of segmented SIM images comprising the entire depth of each nucleus.
When individual nucleoporin spots could not be resolved due to limits of resolution of immunofluorescent SIM, the percent total nuclear volume occupied by the nucleoporin was calculated. To calculate total nuclear volume, X and Y axis length was measured in the center z-slice for each nucleus and Z axis length was estimated from the total z depth of acquired images. To calculate nucleoporin volume, image stacks were processed with automatic thresholding and automatic thresholding the 3D suite plugin in FIJI was used to determine the volume of the thresholded area for each nucleus. Representative images are presented as 3D maximum intensity projections generated in Zeiss Zen Black 2.3 SP1. Images were faux colored green for contrast and display.
Human Tissue Immunofluorescence
Non-neurological control and C9orf72 patient postmortem paraffin embedded motor and occipital cortex sections were obtained through the Target ALS Human Postmortem Tissue Core (See Table C for demographic information).
Tissue sections were gradually rehydrated with xylene 3×5 minutes, 100% ethanol 2×5 minutes, 90% ethanol 5 minutes, 70% ethanol 5 minutes, and finally dH2O 3×5 minutes. Antigen retrieval was performed with Tissue-Tek antigen retrieval solution (IHC World) for 1 hour in a steamer. Slides were cooled for 10 minutes and washed 3×5 minutes with dH2O, 2×5 minutes 1×PBS, and permeabilized with 0.4% Triton X-100 diluted in 1×PBS for 10 minutes on a shaker. Slides were subsequently washed 3×5 minutes in 1×PBS blocked with DAKO protein-free serum block (DAKO) overnight at 4° C. Tissue sections were incubated with primary antibody (See Table B for antibody information) diluted in DAKO antibody diluent reagent with background reducing components for a total of 2 overnights at 4° C. In between the 2 overnight incubations, slides were incubated in primary antibody at room temperature with gentle agitation for 10 hours. Following primary antibody, tissue sections were washed 3×5 minutes with 1×PBS and then incubated with secondary antibody (See Table B for antibody information) diluted in DAKO antibody diluent with background reducing components (DAKO) at room temperature with gentle agitation for 1 hour.
Slides were then washed 3×5 minutes in 1×PBS, rinsed briefly with 2-3 drops autofluorescence eliminator reagent (Millipore), and extensively washed 5×5 minutes in 1×PBS to remove debris. Tissue sections were stained with Hoescht diluted 1:1000 in 1×PBS for 20 minutes, and washed 3×5 mins in 1×PBS. Slides were coverslipped using Prolong Gold Antifade Reagent with DAPI and nuclei from Map2 positive Layer V neurons were imaged with a 20× objective and a Zeiss Axioimager Z2 fluorescent microscope equipped with an apotome2 module.
CHMP7 nuclear/cytoplasmic ratios were quantified using FIJI. Briefly, in focus neurons with visible nuclei were identified by positive Map2 and Hoescht signals. A small pixel box was used to measure fluorescent intensity in the CHMP7 channel. Two integrated density measurements were taken from each cellular compartment (nucleus and cytoplasm), the average of which was used for subsequent analysis. Five background fluorescent intensity mean measurements were taken in areas devoid of cells, the average of which was used for analysis. Nuclear and cytoplasmic intensities were calculated as follows: Intensity=Integrated Density−(Mean Background Intensity*Area Measured Within Cell). The nuclear/cytoplasmic CHMP7 ratio was calculated by dividing resulting nuclear intensity by cytoplasmic intensity for each cell. Images are presented as default apotome processed images generated in Zeiss Zen Blue 2.3.
Immunoprecipitation
XPO1: To couple antibody to beads, 504 Magnetic Dynabeads Protein G were rinsed and equilibrated in 1×PBST (0.02% Tween-20). PBST wash was removed from beads and discarded. Beads were then incubated with 10 μg Mouse Anti-XPO1 (Santa Cruz Biotechnology) or Mouse IgG Isotype control (Thermo Fisher Scientific) antibody diluted in 1×PBST (final volume 200 μL) with end over end rotation for 10 minutes at room temperature. The supernatant was discarded, and antibody coupled beads were washed with 200 μL 1×PBST. Antibody coupled beads were subsequently washed 2× with 200 μL conjugation buffer (20 mM NaPO4, 0.15 M NaCl, pH 7.0). Antibody was then conjugated to the magnetic dynabeads by incubating in 250 μL 5 mM BS3 (Thermo Fisher Scientific) diluted in conjugation buffer with end over end rotation for 30 minutes at room temperature. The coupling reaction was quenched by adding 12.5 μL 1 M Tris HCl pH 7.5 and incubating with end over end rotation for 15 minutes at room temperature. Antibody conjugated beads were washed 3× with IP buffer (IP lysis buffer (Thermo Fisher Scientific), 1× protease inhibitor cocktail (Roche), 0.4 U/4 RNasin Plus (Promega)).
Nuclei were isolated from iPSNs as described above. The resulting nuclei pellet was lysed in 1 mL IP buffer by vortexing for 30-45 seconds. Nuclei lysates were centrifuged for 10 minutes at 2500 rpm and 4° C. to remove debris. Following centrifugation, the supernatant was transferred to a clean Eppendorf tube. 25 μL of the supernatant was added to μL 2× Laemmli buffer (BioRad) and set aside as protein input and an additional 25 μL supernatant was set aside on ice as RNA input. The remainder of the lysate was split equally between IgG and XPO1 antibody conjugated bead tubes. Lysates were incubated with beads with end over end rotation for 2 hours at 4° C. The unbound supernatant was discarded and immunoprecipitated complexes were washed 3×5 minutes in 200 μL IP buffer with end over end rotation at 4° C. Bead-IP complexes were resuspended in 200 μL IP buffer. 100 μL of each bead-IP complex sample was set aside for RNA analysis. For the remaining 100 μL, the supernatant was discarded and 50 μL 1× Laemmli buffer was added to bead-IP complexes. All RNA samples (including input) were added to 500 μL RLT Buffer (QIAGEN) and RNA isolation, cDNA synthesis, and qRT-PCR were performed as described below. Protein samples were analyzed by western blot as described below. Equal volumes of each sample (10 μL) were loaded in acrylamide gels.
NXF1: NXF1 immunoprecipitations were performed as described above without antibody-bead conjugation. Rabbit Anti-NXF1 (Abcam) and Rabbit IgG Isotype control (Thermo Fisher Scientific) antibodies were used.
Nuclear/Cytoplasmic Fractionation
iPSNs were rinsed in 1×PBS and nuclear/cytoplasmic fractionation was performed with the NE-PER Nuclear and Cytoplasmic Extraction Kit (Thermo Fisher Scientific) according to manufacturer protocol. Following the addition of C2 buffer, 25 μL of sample was added to 25 μL 2× Laemmli buffer (BioRad) and set aside as protein input. An additional 25 μL was set aside on ice as RNA input. From each nuclear and cytoplasmic fraction obtained, 25 μL sample was added to 25 μL 2× Laemmli buffer for protein analysis. An additional 25 μL was added to 500 μL RLT buffer (QIAGEN) for RNA analysis. The remainder of each fraction was stored at −80° C. At the completion of the fractionation, 500 μL RLT buffer was added to the RNA input sample. RNA isolation, cDNA synthesis, and qRT-PCR were performed as described below. Western blot analysis was conducted as described below. Equal volume of each sample (10 μL) was loaded in acrylamide gels.
qRT-PCR
RNA from immunoprecipitated complexes or nuclear and cytoplasmic cellular fractions was isolated with a RNeasy kit (QIAGEN) according to manufacturer protocol. RNA concentrations were determined with a NanoDrop 1000 spectrophotometer (Thermo Fisher Scientific). For detection of mRNA transcripts from immunoprecipitated complexes or nuclear and cytoplasmic cellular fractions, 1 μg of RNA was used for cDNA synthesis with random hexamers and the Superscript IV First-Strand cDNA Synthesis Kit (Thermo Fisher Scientific). qRT-PCR reactions were conducted using TaqMan Gene Expression Master Mix (Thermo Fisher Scientific), an Applied Biosystems Step One Plus Real Time PCR Machine (Thermo Fisher Scientific), and TaqMan Gene Expression Assays (See Table D, Thermo Fisher Scientific).
For detection of C9orf72 RNAs from immunoprecipitated complexes or nuclear and cytoplasmic cellular fractions, 1 μg of RNA was used for cDNA synthesis using gene specific primers and the Superscript IV First-Strand cDNA synthesis kit (Thermo Fisher Scientific). qRT-PCR reactions were performed out using TaqMan Gene Expression Master Mix (Thermo Fisher Scientific) and an Applied Biosystems Step One Plus Real Time PCR Machine (Thermo Fisher Scientific) and previously described primer/probe sets (6, 34) (See Table E for sequences). GAPDH was used for normalization in all experiments.
Western Blots
Nuclei Lysates: Following nuclei isolation, nuclei pellets were resuspended in 25 μL RIPA buffer (Millipore) containing 1× protease inhibitor cocktail (Roche). Homogenates were spun at 12,000 g for 15 minutes and 4° C. to remove debris. The supernatant was transferred to a new Eppendorf tube and protein concentrations were determined using the BCA protein estimation assay kit (Thermo Fisher Scientific). 4× Laemmli buffer (BioRad) was added to each sample to a final concentration of 1×, samples were heated at 100° C. for 5 minutes, and 5 μg protein was loaded into 4-20% acrylamide gels (BioRad). Gels were run until the dye front reached the bottom. Protein was transferred onto a nitrocellulose membrane using the Trans-Blot Turbo Transfer System (BioRad). Blots were blocked for 30 minutes with 5% non-fat milk in 1×TBST (0.1% Tween-20) and incubated overnight at 4° C. with primary antibody diluted in block (See Table B for antibody information). The next day, blots were washed 4×10 minutes with 1×TBST and probed with secondary antibody diluted in block (See Table B for antibody information) for 1 hour at room temperature. Blots were subsequently washed 4×10 minutes with 1×TBST and ECL substrate (Thermo Fisher Scientific, Millipore) was applied for 30 seconds. Chemiluminescent images were acquired with the GE Healthcare ImageQuant LAS 4000 system. To sequentially probe membranes without stripping, chemiluminescent signals were quenched by incubating blots in room temperature 30% H2O2 for 15 minutes (35). Analysis was conducted in FIJI. Lamin B1 was used for normalization.
ASO Treated iPSN Lysates: On day 40 of differentiation, iPSNs were rinsed with ice cold 1×DPBS with Ca2+ and Mg2+. 1 mL fresh 1×DPBS was added to each well and iPSNs were harvested with a cell scraper and transferred to an Eppendorf tube. Cells were then pelleted at 2500 rpm, 4° C. for 5 minutes. The supernatant was aspirated, and the resulting cell pellet was lysed in 50 μL RIPA buffer containing 1× protease inhibitor cocktail. Western blots and analysis were performed as described above. GAPDH was used for normalization.
Trim Away Samples: Following aspiration of media, iPSNs were rinsed with ice cold 1×DPBS with Ca2+ and Mg2+. 1 mL fresh 1×DPBS was added to each well and iPSNs were harvested with a cell scraper and transferred to an Eppendorf tube. Samples were centrifuged at 2500 rpm, 4° C. for 5 minutes to pellet cells. The supernatant was aspirated, and the resulting cell pellet was lysed in 25 μL RIPA buffer containing 1× protease inhibitor cocktail. Western blots and analysis were performed as described above. GAPDH was used for normalization.
Plasmids and Nucleofection for CHMP7 and VPS4 Overexpression
The GFP tagged CHMP7 plasmid was obtained from Origene. To generate the CHMP7 NES mutant (CHMP7 NES*) plasmid, a single amino acid substitution (amino acid 430, L to A) was created in the CHMP7 GFP plasmid (Origene) using the Q5 site directed mutagenesis kit (New England BioLabs). VPS4 GFP and VPS4E228Q GFP plasmid were obtained from Addgene. GFP control plasmids were obtained from Origene and Addgene. RNA Only plasmids (12) were a kind gift from Adrian Issacs. See Table F for plasmid information.
On day 18 of differentiation, iPSNs were dissociated with accutase to assist with single cell dissociation and nucleofected in suspension using the Lonza P3 Primary Cell 4D Nucleofector Kit (Lonza) and program DC104 on the Lonza nucleofection system. Each cuvette contained 5×106 iPSNs and 4 μg plasmid DNA. Following nucleofection, iPSNs were plated in Matrigel (Corning) coated cell culture dishes according to Lonza protocol. Media was exchanged on day 19 and 22 of differentiation. Downstream experimentation was carried out on day 25 of differentiation.
Knockdown of CHMP7, LEMD2, and XPO1 by Trim Away
Knockdown of endogenous CHMP7, LEMD2, and XPO1 was carried out using a modified Trim Away protocol (11). CHMP7 (Santa Cruz Biotechnology), LEMD2 (Thermo Fisher Scientific), and XPO1 (Santa Cruz Biotechnology) antibodies were dialyzed in 1×PBS using a Slide-A-Lyzer MINI Dialysis Device, 20K MWCO (Thermo Fisher Scientific). PBS was exchanged after 2 hours and dialysis proceeded with gentle agitation at room temperature overnight. Dialyzed antibodies were concentrated with an Amicon Ulta-0.5 Centrifugal Filter Unit with Ultacell-100 membrane (Millipore). Resulting antibody concentration was calculated with a NanoDrop 1000 spectrophotometer (Thermo Fisher Scientific) as previously described (11). On day 18 of differentiation, iPSNs were dissociated with accutase. Suspension based nucleofection was carried out with the Lonza P3 Primary Cell 4D Nucleofector Kit (Lonza) and the program DC154. Each cuvette contained 5×10 6 iPSNs, 5 μg of antibody and 4 μg Trim21 GFP plasmid DNA (Origene, See Table F). Following nucleofection, iPSNs were replated in Matrigel (Corning) coated cell culture dishes according to Lonza protocol and used for downstream analysis on day 20 of differentiation.
Glutamate Toxicity
On day 12 of differentiation, iPSNs were plated in 24 well optical bottom plates (Cellvis) at a density of 250,000 neurons per well. Neurons were rinsed with 1×PBS and fed with fresh stage 3 media daily remove dead cells and debris until day 25 of differentiation. On day 25 of differentiation, ASO treatment was initiated as described above. Every 3 days, iPSNs were rinsed 3× with 1×PBS and media and ASO were replaced. On day 40 of differentiation, iPSNs were washed with 1×PBS to remove any remaining debris and dead cells. Media was replaced with ACSF (Tocris) containing 0 or 10 μM glutamate (Sigma Aldrich). iPSNs were incubated at 37° C. with 5% CO2 for 4 hours. After 3.5 hours, one drop of NucBlue Live ReadyProbes (Thermo Fisher Scientific) and 1 propidium iodide (Thermo Fisher Scientific) and returned to the incubator for 30 mins. iPSNs were imaged in an environmentally controlled chamber with a Zeiss LSM 800 confocal microscope. 5 images per well were acquired with a 10× objective. PI and DAPI spots were counted using FIJI.
All data analysis was conducted with Imaris or FIJI as described in each experimental section above and was either completely automated or blinded. All statistical analyses were performed using GraphPad Prism version 8 (GraphPad). For imaging experiments where multiple cells or nuclei per iPSC line or patient were quantified, statistical analyses were performed such that the average of all nuclei or cells evaluated per iPSC line or patient represents N=1 with total N per experiment and group as indicated in Description of the Figures. Student's t-test, One-way ANOVA with Tukey's multiple comparison test, or Two-way ANOVA with Tukey's multiple comparison test was used as described in the Description of the Figures. * p<0.05, ** p<0.005, *** p<0.0005, **** p<0.0001. Violin plots are used to display the full spread and variability of large data sets (>10 data points). Center dotted line indicates median value. Two additional dotted lines indicate the 25th and 75th percentiles. For smaller data sets, bar graphs displaying individual data points shown where error bars represent +/−SEM.
Recently, it was established that the protein expression of eight specific Nups is reduced within the nucleoplasm and NPCs of C9orf72 human neurons (13). Given the critical involvement of CHMP7 and VPS4 in NPC homeostasis in yeast (7-9), it was investigated whether the expression of these proteins was pathologically altered in C9orf72 nuclei. Using super resolution structured illumination microscopy (SIM) to visually examine nuclear distribution and expression, we found a significant increase in both CHMP7 and VPS4 immunoreactivity in NeuN positive nuclei isolated from control and C9orf72 iPSNs (
To verify that our result in iPSNs recapitulated human disease pathology, nuclei were isolated from control and C9orf72 postmortem spinal cord, and motor and occipital cortex tissue and performed SIM for CHMP7 and VPS4. In the disease relevant CNS regions (thoracic spinal cord and motor cortex), but not the unaffected occipital cortex, a similar increase was observed in the nuclear expression of CHMP7 and VPS4 (
Nup alterations are known to be a pathological consequence of expanded G4C2 repeat RNA but not DPRs or loss of C9ORF72 protein (6). To determine if the nuclear increase in CHMP7 and VPS4 was similarly mediated by G4C2 repeat RNA, we performed SIM on nuclei isolated from control iPSNs overexpressing stop codon optimized constructs that only produce G4C2 repeat RNA (12). Overexpression of 106 or 288, but not 36 G4C2 repeats resulted in a significant increase in nuclear CHMP7 and VPS4 immunoreactivity (
As CHMP7 has previously been implicated as an early-acting factor that mediates Nup and NPC degradation (7-9), we hypothesized that perhaps the nuclear increase in CHMP7 might lead to reduced Nup expression in C9orf72 neuronal nuclei and NPCs. To test this, the Trim Away method (11) was employed to rapidly degrade endogenous CHMP7 protein in control and C9orf72 iPSNs (
ASOs are now commonly used as a therapeutic strategy to reduce mRNA and protein levels of genes of interests (14, 15). To evaluate if this therapeutic strategy would effectively mitigate NPC injury, ASOs were designed that specifically target human CHMP7 pre-mRNA and induce its degradation via RNase H based mechanisms. Compared to scrambled control ASOs, 2-week exposure to 3 different CHMP7 targeting ASOs, significantly reduced CHMP7 protein levels in control and C9orf72 iPSNs in a dose dependent manner (
Having established that increased nuclear CHMP7 can impact the nuclear expression of VPS4 and specific Nups, it was next sought to determine the mechanism by which this pathology occurred in C9orf72 nuclei. As both the yeast and human CHMP7 orthologues are recruited to the nuclear envelope by the integral INM protein LEMD2 (9, 17), the Trim Away method was used to endogenously knockdown LEMD2 in control and C9orf72 iPSNs (
In unperturbed conditions, both yeast and human CHMP7 cannot accumulate in the nucleus due to its nuclear export by XPO1/CRM1 (8, 18). Therefore, Leptomycin B (LMB) was used to potently inhibit global XPO1 function (19) and performed SIM for CHMP7, VPS4, and specific nucleoporins. Consistent with published data, (8, 18) LMB treatment resulted in a significant increase in CHMP7 in the nucleus (
To determine whether the reduction in Nup levels in LMB treated iPSNs was a direct result of specifically inhibiting CHMP7 nuclear export, the nuclear export sequence (NES) of CHMP7 was mutated by making a single amino acid substitution (L to A, amino acid 430) in the CHMP7 NES sequence (LEAELEKLSLS (SEQ ID NO:21)). As previously described (8), this single point mutation is sufficient to abrogate XPO1 mediated nuclear export of CHMP7 (34). Overexpression of the GFP tagged CHMP7 NES mutant (CHMP7 NES*), but not wildtype GFP tagged CHMP7, in wildtype iPSNs recapitulated C9orf72 mediated alterations in nuclear CHMP7, VPS4, Nup50, POM121, and Nup133 levels as evaluated by SIM (
The data establishes that expression of pathologic G4C2 repeat RNA results in increased nuclear CHMP7 and VPS4 levels (
Using qRT-PCR, we found that both the pathologic G4C2 and G2C4 repeat RNAs are also present in a complex with XPO1 (
It has been previously established that five day treatment with antisense oligonucleotides (ASOs) targeting the intron upstream of the sense strand G4C2 repeat decreases G4C2 repeat RNA but not DPR levels and mitigates alterations in POM121 (6). As a result, it was evaluated whether a reduction in G4C2 repeat RNA could impact the association of CHMP7 with XPO1 complexes. Following short term ASO treatment, we observed a reduction in the presence of both G4C2 and G2C4 repeat RNAs in XPO1 complexes (
Pathological Nup alterations are prevalent in multiple neurodegenerative diseases including ALS, AD, and HD (1, 25-27). However, the molecular mechanisms by which these disruptions occur remain poorly understood. In contrast to the Nup mislocalization observed in artificial overexpression mouse models of C9orf72 ALS/FTD (2-5), it was previously shown that in human neurons, there is a reduction in the nuclear levels of 8 specific Nups spanning multiple subcomplexes of the NPC without corresponding cytoplasmic accumulations (6). As a result, it was hypothesized that altered Nup surveillance and homeostasis may contribute to reduced Nup expression in C9orf72 iPSNs.
Recent work in yeast and non-neuronal cellular systems has identified CHMP7 and ESCRT-III mediated degradation as important mediators of NPC, Nup, and nuclear envelope homeostasis (7, 9, 10, 28). However, the contribution of this pathway to neuronal biology and disease pathophysiology remains unclear. Using an iPSN model of C9orf72 ALS, it was found that CHMP7 contributes to reduced nuclear levels of key Nups located within 3 distinct domains of the NPC as an early event in disease pathogenesis. These data define a functional role for CHMP7 and ESCRT-III mediated Nup proteostasis in human neurons and neurodegeneration. Collectively, our data support a model whereby pathologic G4C2 repeat RNA interferes with the association between CHMP7 and XPO1 (see
Previous studies have suggested that the knockdown of NXT1 increases nuclear G4C2 repeat RNA levels in artificial overexpression non-CNS cellular systems (29). Interestingly, while NXT1 is a critical component of the NXF1-NXT1 nuclear RNA export pathway (21-23), NXT1 has also been shown to associate with CRM1/XPO1 (44). Here it was shown that in human iPSNs expressing endogenous levels of the C9orf72 HRE, G4C2 and G2C4 repeat RNAs strongly associate with XPO1 but not NXF1 nuclear complexes (
Although ESCRT-III mediated NPC and nuclear envelope repair is initiated by the nuclear specific ESCRT adapter protein CHMP7 (31) and catalyzed by VPS4 (7-9, 13, 31, 32), the recruitment and involvement of other CHMPs in this process remains unknown in multiple cellular systems including human neurons. Given that mutations in the ESCRT-III pathway component CHMP2B have been implicated in FTD (33), it will be interesting to evaluate whether or not these mutations are sufficient to induce nucleoporin reduction in a manner similar to that observed in C9orf72 ALS/FTD iPSNs.
Collectively, the present data suggest that increased nuclear CHMP7 is a critical initiator of pathogenic cascades ultimately leading to Nup reduction in the nucleoplasm and NPCs of C9orf72 neurons. Moreover, the present data highlight CHMP7 as a potential therapeutic target for the mitigation of NPC injury in neurodegenerative diseases characterized by nuclear Nup reduction.
The below materials and methods were used for Examples 9-15.
iPSC Derived Neuronal Differentiation
C9orf72 and non-neurological control iPSC lines were obtained from the Answer ALS repository at Cedars-Sinai (see Table G for demographics). Feeder-free iPSCs were maintained on Matrigel with MTeSR and maintained according to Cedars Sinai SOP. iPSCs were differentiated into spinal neurons using the previously described direct induced motor neuron (diMNs) protocol (43). All cells were maintained at 37° C. with 5% CO2. iPSCs and iPSNs routinely tested negative for mycoplasma.
ASO Treatment of iPSC Derived Neurons
Non-targeting scrambled control (676630): CCTATAGGACTATCCAGGAA (SEQ ID NO:2), CHMP7 ASO 1 (1508916): GAAAACGGTTTCCACTGTAT (SEQ ID NO:3), CHMP7 ASO 2 (1508917): TGTTACCCTCAGATACCGCC (SEQ ID NO:4), and CHMP7 ASO 3 (1508918): ATGTGATGCTATTAATAGGA (SEQ ID NO:14) were generously provided by Ionis Pharmaceuticals. On day 25 of differentiation, ASOs were added to the culture media at concentrations of 1, 5, or 101.1M as indicated in Description of the Figures. Media was exchanged and ASO replaced every 3 days until iPSNs were subjected to downstream analyses on day 40 of differentiation for western blot, SIM, and glutamate excitotoxicity and day 46 of differentiation for stathmin-2 qRT-PCR, Ran GTPase localization, and TDP-43 localization.
Nuclei were isolated from iPSNs and postmortem human brain and spinal cord tissue using the Nuclei Pure Prep Nuclei Isolation Kit (Sigma Aldrich) following manufacturer protocol as previously described (43). Briefly, iPSN lysates were prepared by rinsing iPSNs with 1×PBS, adding mL supplied lysis buffer supplemented with DTT and Triton X-100 directly to each well, and harvesting iPSNs with a cell scraper. Postmortem brain and spinal cord lysates were prepared by homogenizing 150 mg fresh frozen tissue directly in supplied lysis buffer with a dounce homogenizer. All lysates were transferred to a mL conical tube and vortexed. Sucrose gradients were assembled following manufacturer protocol. A 1.85 M sucrose gradient was used to enrich for neuronal nuclei. Samples were centrifuged at 15,600 rpm and 4° C. using a Swi32T swinging bucket rotor and Beckman ultracentrifuge (Beckman Coulter) for 45 minutes. The supernatant was discarded, and the remaining nuclei pellet was resuspended in 1 mL of supplied nuclei storage buffer to wash the nuclei of any remaining sucrose. Resuspended nuclei were centrifuged at 2500 rpm and 4° C. for 5 minutes. The supernatant was once again discarded, and the resulting nuclei pellet was vortexed in 1 mL of supplied nuclei storage buffer to resuspend for downstream imaging analysis. For western blots, washed nuclei were lysed in RIPA buffer as described below.
Nuclei staining and super resolution imaging was performed as previously described (43). Following nuclei isolation, 10-50 μL of final nuclei/storage buffer suspension was centrifuged onto collagen coated (1 mg/m; Advanced Biomatrix) slides with a CytoSpin 4 centrifuge (Thermo Fisher Scientific). Nuclei were immediately fixed with 4% PFA for 5 minutes, washed with 1×PBS 3×10 minutes and permeabilized with 1×PBST containing Triton X-100 for 15 minutes. Nuclei were then blocked with 10% normal goat serum diluted in 1×PBS for 1 hour at room temperature and incubated in primary antibody diluted in block (10% normal goat serum in 1×PBS) overnight at 4° C. (See Table H for antibody information). After 16-18 hours, nuclei were washed with 1×PBS 3×10 minutes, incubated in secondary antibody diluted in block (10% normal goat serum in 1×PBS) for 1 hour at room temperature (See Table H for antibody information). Nuclei were washed with 1×PBS 3×10 minutes and coverslipped using Prolong Gold Antifade Reagent (Invitrogen) and 18 mm×18 mm 1.5 high tolerance coverslips (MatTek).
NeuN or GFP positive nuclei (see Brief Description of the Figures) were identified via microscope eye pieces. A single z section ˜110 nm thick was acquired by widefield imaging to confirm NeuN or GFP positivity. The immunostained proteins were subsequently imaged by super resolution structured illumination microscopy (SIM) using a Zeiss ELYRA 51. For each image, 5 grid rotations and optimal z sectioning parameters were employed. For each immunostained protein, all images were acquired with identical laser power and exposure time. Following image acquisition, SIM images were reconstructed using default SIM processing parameters with Zeiss Zen Black 2.3 SP1 software. Automated nucleoporin spot and volume analysis was conducted as previously described (43, 78) using Imaris version 9.2.0 (Bitplane) and the 3D suite plugin in FIJI version 1.52p. Nucleoporin spots were counted using automated spot detection. A Bayesian classifier taking into account volume, average intensity, and contrast features was applied to detect and segment individual spots. The total number of nucleoporin spots was determined using a 3D-rendering of segmented SIM images comprising the entire depth of each nucleus. When individual nucleoporin spots could not be resolved due to limits of resolution of immunofluorescent SIM, the percent total nuclear volume occupied by the nucleoporin was calculated. To calculate total nuclear volume, X and Y axis length was measured in the center z-slice for each nucleus and Z axis length was estimated from the total z depth of acquired images. To calculate nucleoporin volume, image stacks were processed with automatic thresholding and automatic thresholding the 3D suite plugin in FIJI was used to determine the volume of the thresholded area for each nucleus. Representative images are presented as 3D maximum intensity projections generated in Zeiss Zen Black 2.3 SP1. Images were faux colored green for contrast and display.
Immunostaining and Confocal Imaging of iPSNs
On day 12 of differentiation, iPSNs were plated in 24 well optical bottom plates (Cellvis). At day 32 (CHMP7 OE) or 46 of differentiation (CHMP7 ASO), iPSNs were fixed in 4% PFA for 15 minutes, washed with 1×PBS 3×10 minutes, permeabilized with 1×PBST containing 0.3% Triton X-100 for 15 minutes, blocked in 10% normal goat serum diluted in 1×PBS for 1 hour, and incubated in primary antibody for 2 hours at room temperature (See Table H for antibody information). iPSNs were then washed with 1×PBS 3×10 minutes, incubated in secondary antibody (See Table H for antibody information) for 1 hour at room temperature, washed in 1×PBS 2×10 minutes, incubated with Hoescht diluted 1:1000 in 1×PBS for 10 minutes, and washed in 1×PBS 2×10 minutes. iPSNs were mounted using Prolong Gold Antifade Reagent with DAPI. iPSNs were imaged using a Zeiss LSM 800 or Zeiss LSM 980 confocal microscope. All images were acquired using identical imaging parameters (e.g. laser power, gain). Nuclear intensity and N/C ratios were calculated with FIJI as previously described (80). Images presented are maximum intensity projections generated in Zeiss Zen Blue 2.3.
Non-neurological control and C9orf72 patient postmortem paraffin embedded motor and occipital cortex sections were obtained through the Target ALS Human Postmortem Tissue Core (see Table I for demographic information). Tissue sections were gradually rehydrated with xylene 3×5 minutes, 100% ethanol 2×5 minutes, 90% ethanol 5 minutes, 70% ethanol 5 minutes, and finally dH2O 3×5 minutes. Antigen retrieval was performed with Tissue-Tek antigen retrieval solution (IHC World) for 1 hour in a steamer. Slides were cooled for 10 minutes and washed 3×5 minutes with dH2O, 2×5 minutes 1×PBS, and permeabilized with 0.4% Triton X-100 diluted in 1×PBS for 10 minutes on a shaker. Slides were subsequently washed 3×5 minutes in 1×PBS blocked with DAKO protein-free serum block (DAKO) overnight at 4° C. Tissue sections were incubated with primary antibody (see Table H for antibody information) diluted in DAKO antibody diluent reagent with background reducing components for a total of 2 overnights at 4° C. In between the 2 overnight incubations, slides were incubated in primary antibody at room temperature with gentle agitation for 10 hours. Following primary antibody, tissue sections were washed 3×5 minutes with 1×PBS and then incubated with secondary antibody (see Table H for antibody information) diluted in DAKO antibody diluent with background reducing components (DAKO) at room temperature with gentle agitation for 1 hour. Slides were then washed 3×5 minutes in 1×PBS, rinsed briefly with 2-3 drops autofluorescence eliminator reagent (Millipore), and extensively washed 5×5 minutes in 1×PBS to remove debris. Tissue sections were stained with Hoescht diluted 1:1000 in 1×PBS for 20 minutes, and washed 3×5 mins in 1×PBS. Slides were cover slipped using Prolong Gold Antifade Reagent with DAPI and nuclei from Map2 positive Layer V neurons were imaged with a 20× objective and a Zeiss Axioimager Z2 fluorescent microscope equipped with an apotome2 module. All images were acquired using identical exposure times.
CHMP7 and TDP-43 nuclear/cytoplasmic ratios were quantified using FIJI. Briefly, in focus neurons with visible nuclei were identified by positive Map2 and Hoescht signals. A small pixel box was used to measure fluorescent intensity in the CHMP7 channel. Two integrated density measurements were taken from each cellular compartment (nucleus and cytoplasm), the average of which was used for subsequent analysis. Five background fluorescent intensity mean measurements were taken in areas devoid of cells, the average of which was used for analysis. Nuclear and cytoplasmic intensities were calculated as follows: Intensity=Integrated Density−(Mean Background Intensity*Area Measured Within Cell). The nuclear/cytoplasmic CHMP7 ratio was calculated by dividing resulting nuclear intensity by cytoplasmic intensity for each cell. Images are presented as default apotome processed images generated in Zeiss Zen Blue 2.3.
qRT-PCR
RNA from iPSNs was isolated with a RNeasy kit (QIAGEN) according to manufacturer protocol. RNA concentrations were determined with a NanoDrop 1000 spectrophotometer (Thermo Fisher Scientific). For CHMP7 ASO experiments, RNA was isolated on day 46 of differentiation following 3 weeks exposure to 5 μM CHMP7 ASO2 or scrambled control ASO. For CHMP7 overexpression experiments, RNA was isolated on day 32 of differentiation (2 weeks after plasmid nucleofection). 1 μg of RNA was used for cDNA synthesis with random hexamers and the Superscript IV First-Strand cDNA Synthesis Kit (Thermo Fisher Scientific). qRT-PCR reactions were conducted as previously described (70, 71) using Sybr Green Master Mix (Thermo Fisher Scientific), an Applied Biosystems Step One Plus Real Time PCR Machine (Thermo Fisher Scientific). See Table J for primer sequences. GAPDH was used for normalization in all experiments.
Nuclei Lysates: Following nuclei isolation, nuclei pellets were resuspended in 25 μL RIPA buffer (Millipore) containing 1× protease inhibitor cocktail (Roche). Homogenates were spun at 12,000 g for 15 minutes and 4° C. to remove debris. The supernatant was transferred to a new Eppendorf tube and protein concentrations were determined using the BCA protein estimation assay kit (Thermo Fisher Scientific). 4× Laemmli buffer (BioRad) was added to each sample to a final concentration of 1×, samples were heated at 100° C. for 5 minutes, and 5 μg protein was loaded into 4-20% acrylamide gels (BioRad). Gels were run until the dye front reached the bottom. Protein was transferred onto a nitrocellulose membrane using the Trans-Blot Turbo Transfer System (BioRad). Blots were blocked for 30 minutes with 5% non-fat milk in 1×TBST (0.1% Tween-20) and incubated overnight at 4° C. with primary antibody diluted in block (see Table H for antibody information). The next day, blots were washed 4×10 minutes with 1×TBST and probed with secondary antibody diluted in block (see Table H for antibody information) for 1 hour at room temperature. Blots were subsequently washed 4×10 minutes with 1×TBST and ECL substrate (Thermo Fisher Scientific, Millipore) was applied for 30 seconds. Chemiluminescent images were acquired with the GE Healthcare ImageQuant LAS 4000 system. To sequentially probe membranes without stripping, chemiluminescent signals were quenched by incubating blots in room temperature 30% H2O2 for 15 minutes (90). Analysis was conducted in FIJI. Lamin B1 was used for normalization.
ASO Treated iPSN Lysates: On day 40 of differentiation, iPSNs were rinsed with ice cold 1×DPBS with Ca2+ and Mg2+. 1 mL fresh 1×DPBS was added to each well and iPSNs were harvested with a cell scraper and transferred to an Eppendorf tube. Cells were then pelleted at 2500 rpm, 4° C. for 5 minutes. The supernatant was aspirated, and the resulting cell pellet was lysed in 50 μL RIPA buffer containing 1× protease inhibitor cocktail. Western blots and analysis were performed as described above. GAPDH was used for normalization.
The GFP tagged CHMP7 plasmid was obtained from Origene. To generate the CHMP7 NES mutant (CHMP7 NES*) plasmid, a single amino acid substitution (amino acid 430, L to A) was created in the CHMP7 GFP plasmid (Origene) using the Q5 site directed mutagenesis kit (New England BioLabs). A GFP control plasmid was obtained from Origene. See Table K for plasmid information. On day 18 of differentiation, iPSNs were dissociated with accutase to assist with single cell dissociation and nucleofected in suspension using the Lonza P3 Primary Cell 4D Nucleofector Kit (Lonza) and program DC104 on the Lonza nucleofection system. Each cuvette contained 5×106 iPSNs and 4 μg plasmid DNA. Following nucleofection, iPSNs were plated in Matrigel (Corning) coated cell culture dishes according to Lonza protocol. Media was exchanged on day 19 and 22 of differentiation. For overexpression of CHMP7 variants, downstream SIM experimentation was carried out on day 25 of differentiation and TDP-43 localization and stathmin-2 analyses were carried out on day 32 of differentiation. For overexpression of LEMD2, SIM experiments were carried out on day 32 of differentiation.
Knockdown of endogenous POM121 and LEMD2 was carried out using a modified Trim Away protocol (58) as previously described (43). POM121 (Thermo Fisher Scientific) and LEMD2 (Thermo Fisher Scientific) antibodies were dialyzed in 1×PBS using a Slide-A-Lyzer MINI Dialysis Device, 20K MWCO (Thermo Fisher Scientific). PBS was exchanged after 2 hours and dialysis proceeded with gentle agitation at room temperature overnight. Dialyzed antibodies were concentrated with an Amicon Ulta-0.5 Centrifugal Filter Unit with Ultacell-100 membrane (Millipore). Resulting antibody concentration was calculated with a NanoDrop 1000 spectrophotometer (Thermo Fisher Scientific) as previously described (58). On day 18 of differentiation, iPSNs were dissociated with accutase. Suspension based nucleofection was carried out with the Lonza P3 Primary Cell 4D Nucleofector Kit (Lonza) and the program DC154. Each cuvette contained 5×10 6 iPSNs, 5 lag of antibody and 4 μg Trim21 GFP plasmid DNA (Origene, see Table K). Following nucleofection, iPSNs were replated in Matrigel (Corning) coated cell culture dishes according to Lonza protocol and used for downstream analysis on day 20 of differentiation.
On day 12 of differentiation, iPSNs were plated in 24 well optical bottom plates (Cellvis) at a density of 250,000 neurons per well. Neurons were rinsed with 1×PBS and fed with fresh stage 3 media daily remove dead cells and debris until day 25 of differentiation. On day 25 of differentiation, ASO treatment was initiated as described above. Every 3 days, iPSNs were rinsed 3× with 1×PBS and media and ASO were replaced. On day 40 of differentiation, iPSNs were washed with 1×PBS to remove any remaining debris and dead cells. Media was replaced with ACSF (Tocris) containing 0 or 10 μM glutamate (Sigma Aldrich). iPSNs were incubated at 37° C. with 5% CO2 for 4 hours. After 3.5 hours, one drop of NucBlue Live ReadyProbes (Thermo Fisher Scientific) and 1 μM propidium iodide (Thermo Fisher Scientific) and returned to the incubator for 30 minutes. iPSNs were imaged in an environmentally controlled chamber with a Zeiss LSM 800 confocal microscope. 5 images per well were acquired with a 10× objective. PI and DAPI spots were counted using FIJI.
All data analysis was conducted with Imaris or FIJI as described in each experimental section above and was either completely automated or blinded. All statistical analyses were performed using GraphPad Prism version 8 (GraphPad). For imaging experiments where multiple cells or nuclei per iPSC line or patient were quantified, statistical analyses were performed such that the average of all nuclei or cells evaluated per iPSC line or patient represents N=1 with total N per experiment and group as indicated in Description of the Figures. Student's t-test, One-way ANOVA with Tukey's multiple comparison test, or Two-way ANOVA with Tukey's multiple comparison test was used as described in Description of the Figures. * p<0.05, ** p<0.005, *** p<0.0005, **** p<0.0001. Violin plots are used to display the full spread and variability of large data sets (>10 data points). Center dotted line indicates median value. Two additional dotted lines indicate the 25th and 75th percentiles. For smaller data sets, bar graphs displaying individual data points shown where error bars represent +/−SEM.
Recently, it was established that the protein expression of eight specific Nups is reduced within the nucleoplasm and NPCs of C9orf72 human neurons (43). Given that multiple pathologies and molecular pathways are commonly linked to both familial and sporadic disease (36, 38, 55), it was hypothesized that Nup reduction may also be a prominent pathological feature in sporadic disease. Therefore, we selected a subset of candidate Nups spanning multiple sub-domains of the NPC based on our previous studies in C9orf72 disease and visually examined their nuclear distribution and expression using super resolution structured illumination microscopy (SIM) in nuclei isolated from sALS iPSNs. SIM is capable of providing an estimated resolution of 100 nm, approximating the dimensions of an individual human NPC (45, 56, 57), thus providing us the unparalled opportunity to reliably evaluate the ascertain the NPC localization and expression of candidate Nups via conventional immunostaining procedures. Using this methodology, we found that a subset of Nups are reduced from the nucleoplasm and NPCs of NeuN positive sALS iPSN nuclei (
Given the critical involvement of CHMP7 in NPC homeostasis in yeast (48-50), we investigated whether the expression of this protein was pathologically altered in C9orf72 and sALS nuclei. Using SIM, we found a significant increase in CHMP7 immunoreactivity in NeuN positive nuclei isolated from control and C9orf72 and sALS iPSNs (
Given that the nuclear/cytoplasmic partitioning of multiple proteins is disrupted in multiple neurodegenerative diseases (59-62), we next evaluated the nuclear and cytoplasmic distribution of CHMP7 in our disease iPSNs. Using immunostaining and confocal imaging, we observed a significant relocalization of CHMP7 from the cytoplasm to the nucleus in C9orf72 and sALS iPSNs (
Having established that increased nuclear CHMP7 is a robust and prominent molecular feature of sporadic ALS and familial ALS/FTD, we next sought to determine the mechanism by which this pathology occurred in human neuronal nuclei. As both the yeast and human CHMP7 orthologues are recruited to the nuclear envelope by the integral INM protein LEMD2 (50, 63) in non-neuronal cell types, we genetically manipulated LEMD2 levels in control iPSNs using the Trim Away method to reduce endogenous LEMD2 levels or GFP tagged expression plasmids to overexpress LEMD2. We found that neither a small but significant reduction in nuclear LEMD2 (
In unperturbed conditions, both yeast and human CHMP7 cannot accumulate in the nucleus due to its nuclear export by XPO1/CRM1 (49, 64). Therefore, to determine whether specifically inhibiting CHMP7 nuclear export could initiate a reduction in Nup levels in iPSNs, we mutated the nuclear export sequence (NES) of CHMP7 by making a single amino acid substitution (L to A, amino acid 430) in the CHMP7 NES sequence (LEAELEKLSLS). As previously described (49), this single point mutation is sufficient to abrogate XPO1 mediated nuclear export of CHMP7 (65). Overexpression of the GFP tagged CHMP7 NES mutant (CHMP7 NES*), but not wildtype GFP tagged CHMP7, in wildtype iPSNs recapitulated C9orf72 and sALS disease associated alterations in nuclear CHMP7, Nup50, POM121, and Nup133 levels as evaluated by SIM (
TDP-43 is a DNA and RNA binding protein that while normally predominantly nuclear, it is observed to be cleared from the nucleus and/or mislocalized (and in some cases subsequently accumulated) in the cytoplasm within a subset of neurons of ˜97% of ALS. It is thought that the nuclear clearance and cytoplasmic mislocalization leads to a loss of TDP-43 function as a pathogeneic event in multiple neurodegenerative diseases including sporadic ALS (36, 66). Through associations with nuclear transport receptors known as karyopherins, the NPC and its individual Nup components are known to critically govern the nucleocytoplasmic transport (NCT) of protein and RNA species into and out of the nucleus (45, 46, 65). Given that TDP-43 shuttles between the nucleus and cytoplasm to regulate the metabolism of its mRNA targets (68, 69), we hypothesized that perhaps NPC injury may at least in part contribute to TDP-43 mislocalization and dysfunction in human neurons. To test this, we first overexpressed GFP tagged CHMP7 variants in wildtype iPSNs and monitored the localization of endogenous TDP-43 via immunostaining and confocal microscopy. Overexpression of GFP tagged wildtype CHMP7 had no effect on the subcellular localization of endogenous TDP-43 (
Next, to investigate whether CHMP7 and TDP-43 co-pathology could be observed in real human disease, double immunostaining in thin paraffin embedded sections from postmortem patient motor cortex was performed (
Our data suggest that therapeutically reducing CHMP7 could prove beneficial for neurodegenerative disease characterized by Nup alterations and TDP-43 dysfunction. ASOs are now commonly used as a therapeutic strategy to reduce mRNA and protein levels of genes of interests (75, 76). To evaluate if this therapeutic strategy would effectively mitigate NPC injury, ASOs that specifically target human CHMP7 pre-mRNA and induce its degradation via RNase H based mechanisms were designed. Compared to scrambled control ASOs, 2-week exposure to 3 different CHMP7 targeting ASOs, significantly reduced CHMP7 protein levels in control and C9orf72 iPSNs in a dose dependent manner (
A critical function of the NPC is to govern nucleocytoplasmic transport (NCT). It is required that Ran GTPase is maintained at high levels within the nucleus in order to provide sufficient energy to power bidirectional NCT (46,77). As a result, the localization of Ran GTPase is often used as a static metric to evaluate alterations to NCT and multiple neurodegenerative disease models, including ALS/FTD iPSNs, display increased cytoplasmic Ran GTPase immunostaining (43, 78-80). It has previously been established that restoration of nuclear Nup levels significantly restores the localization of Ran GTPase to the nucleus in C9orf72 iPSNs (43). Consistent with this report, knockdown and CHMP7, and subsequent restoration of Nup expression within the nucleoplasm and NPC, restores the proper subcellular distribution of Ran GTPase in C9orf72 and sALS iPSNs (
To determine whether knockdown of CHMP7 and the subsequent restoration of Nup levels within the nucleoplasm and NPCs of C9orf72 and sALS iPSN nuclei was sufficient to mitigate TDP-43 mediated splicing dysfunction, we performed qRT-PCR for full length and truncated stathmin-2 mRNAs. At day 46 of differentiation, about 2 weeks after the emergence of nuclear Nup reduction, a significant decrease in full length stathmin-2 mRNA was observed and a corresponding increase in truncated stathmin-2 mRNA in scrambled control ASO treated C9orf72 and sALS iPSNs (
Collectively, the observed Nup alterations are likely to impact multiple cellular functions and pathways critical to neuronal survival. As a result, we next evaluated the efficacy of CHMP7 ASOs in alleviating deficits in stressor induced neuronal survival. Two week treatment with CHMP7 ASO 2-significantly decreased the sensitivity of C9orf72 and sALS iPSNs to glutamate induced excitotoxicity (
Pathological Nup alterations are prevalent in multiple neurodegenerative diseases including ALS, AD, and HD (78-81). However, the molecular mechanisms by which these disruptions occur remain poorly understood. In contrast to the Nup mislocalization observed in artificial overexpression mouse models of C9orf72 ALS/FTD (82-85), we have previously shown that in human neurons, there is a reduction in the nuclear levels of 8 specific Nups spanning multiple subcomplexes of the NPC without corresponding cytoplasmic accumulations (43). As a result, it was hypothesized that altered Nup surveillance and homeostasis may contribute to reduced Nup expression in C9orf72 and sALS iPSNs.
Recent work in yeast and non-neuronal cellular systems has identified CHMP7 as important mediator of NPC, Nup, and nuclear envelope homeostasis (48, 50, 51, 86). However, the contribution of this pathway to neuronal biology and disease pathophysiology remains unclear. Using an iPSN model of sporadic ALS and familial ALS/FTD, evidence is provided that disease associated increased nuclear CHMP7 expression contributes to reduced nuclear levels of key Nups located within 3 distinct domains of the NPC as an early event in disease pathogenesis. These data define a functional role for CHMP7 mediated Nup homeostasis in human neurons and neurodegeneration.
Although ESCRT-III mediated NPC and nuclear envelope repair is initiated by the nuclear specific ESCRT adapter protein CHMP7 (87), the recruitment and involvement of other CHMPs in this process remains unknown in multiple cellular systems including human neurons. Given that mutations in the ESCRT-III pathway component CHMP2B have been implicated in FTD (88), it will be interesting to evaluate whether or not these mutations are sufficient to induce nucleoporin reduction in a manner similar to that observed in C9orf72 and sALS iPSNs.
The nuclear clearance and mislocalization of TDP-43 has been regarded as a prominent pathological hallmark of ALS and related neurodegenerative diseases including AD and FTD (36, 72, 89). However, the biological events that may contribute to this pathology and/or loss of TDP-43 function in disease are poorly understood. Provided herein are multiple lines of evidence that nuclear retention of CHMP7 can at least in part contribute to TDP-43 mislocalization and dysfunction in disease. Interestingly, altered TDP-43 localization and deficits in stathmin-2 mRNA processing and TDP-43 mislocalization occur at time points well after the emergence of Nup alterations in C9orf72 and sALS iPSNs and control iPSNs artificially overexpressing a nuclear retained CHMP7. These data support our co-pathology analyses whereby 80-90% of postmortem disease neurons display increased CHMP7 immunoreactivity, but only a subset of those are also positive for TDP-43 pathology.
Collectively, this data suggests that increased nuclear CHMP7 is a critical initiator of pathogenic cascades impacting the nuclear levels of specific Nups spanning multiple subcomplexes of the neuronal NPC within C9orf72 and sALS nuclei. Ultimately, this combined “injury” to the NPC appears to contribute to TDP-43 dysfunction and downstream deficits in neuronal survival. Moreover, this data highlights CHMP7 as a potential therapeutic target in neurodegenerative diseases characterized by nuclear Nup reduction and TDP-43 pathology.
Materials and Methods
iPSC Derived Neuronal Differentiation
Mutant C9orf72, sALS, and non-neurological control iPSC lines were obtained from the Answer ALS repository at Cedars-Sinai (See Table L, below for demographics) and maintained on Matrigel with MTeSR according to Cedars Sinai standard operating procedures.
iPSCs were differentiated into mixed spinal neuronal populations using the direct induced motor neuron (diMNs) protocol as previously described in Coyne A N, Baskerville V, Zaepfel B L, Dickson D W, Rigo F, Bennett F, Patrick Lusk C, Rothstein J D, “Nuclear accumulation of CHMP7 initiates nuclear pore complex injury and subsequent TDP-43 dysfunction in sporadic and familial ALS”, Sci Translat. Med. (2021) and Coyne A N, Zaepfel B L, Hayes L, Fitchman B, Salzberg Y, Luo E C, Bowen K, Trost H, Aigner S, Rigo F et al. “G(4)C(2) repeat RNA initiates a POM121-mediated reduction in specific nucleoporins in C9orf72 ALS/FTD, Neuron (2020). All cells were maintained at 37° C. with 5% CO2. iPSCs and iPSNs routinely tested negative for mycoplasma.
ASO Treatment of iPSNs
As previously described in Coyne A N, Baskerville V, Zaepfel B L, Dickson D W, Rigo F, Bennett F, Patrick Lusk C, Rothstein J D, “Nuclear accumulation of CHMP7 initiates nuclear pore complex injury and subsequent TDP-43 dysfunction in sporadic and familial ALS”, Sci Translat. Med. (2021), on day 25 of differentiation, 5 μM scrambled control (676630): CCTATAGGACTATCCAGGAA (SEQ ID NO: 2) or CHMP7 targeting (1508917): TGTTACCCTCAGATACCGCC (SEQ ID NO:4) ASOs were added to the culture media. Media and ASO were exchanged every 3 days until iPSN analyses were carried out on day 40 of differentiation. ASOs were generously provided by Ionis Pharmaceuticals.
Nucleofection of iPSNs
On day 18 of differentiation, iPSNs were dissociated with Accutase following manufacturer protocol to assist with single cell dissociated and subjected to suspension based nucleofection using the Lonza P3 Primary Cell 4D Nucleofector Kit (Lonza) and program DC104. 5 million iPSNs and 4 μg plasmid DNA were used for each nucleofection reaction. Plasmids used are as follows: GFP (Addgene 54759), VPS4 GFP (Addgene 116924), and VPS4E228Q GFP (Addgene 80351). Nucleofected iPSNs were plated in Matrigel (Corning) coated cell culture dishes and media was exchanged the next day and subsequently every 3 days until downstream analyses on day 40 of differentiation.
Nuclei Isolation and Super Resolution Structured Illumination Microscopy
Nuclei were isolated from iPSNs and postmortem human motor and occipital cortex tissue using the Nuclei Pure Prep Nuclei Isolation Kit (Sigma Aldrich) following manufacturer protocol with slight modifications as previously described in Coyne A N, Baskerville V, Zaepfel B L, Dickson D W, Rigo F, Bennett F, Patrick Lusk C, Rothstein J D, “Nuclear accumulation of CHMP7 initiates nuclear pore complex injury and subsequent TDP-43 dysfunction in sporadic and familial ALS”, Sci Translat. Med. (2021) and Coyne A N, Zaepfel B L, Hayes L, Fitchman B, Salzberg Y, Luo E C, Bowen K, Trost H, Aigner S, Rigo F et al. “G(4)C(2) repeat RNA initiates a POM121-mediated reduction in specific nucleoporins in C9orf72 ALS/FTD, Neuron (2020). About 10 million iPSNs or 100 mg of frozen postmortem motor cortex tissue (obtained from the Target ALS Human Postmortem Tissue Core (see Table M for demographics) was used for nuclei isolation.
A 1.85 M sucrose gradient was used to enrich for neuronal nuclei. Following isolation, nuclei were centrifuged onto collagen coated (1 mg/mL; Advanced Biomatrix) slides with a CytoSpin 4 centrifuge (Thermo Fisher Scientific) and immunostained as previously described in Coyne A N, Baskerville V, Zaepfel B L, Dickson D W, Rigo F, Bennett F, Patrick Lusk C, Rothstein J D, “Nuclear accumulation of CHMP7 initiates nuclear pore complex injury and subsequent TDP-43 dysfunction in sporadic and familial ALS”, Sci Translat. Med. (2021) and Coyne A N, Zaepfel B L, Hayes L, Fitchman B, Salzberg Y, Luo E C, Bowen K, Trost H, Aigner S, Rigo F et al. “G(4)C(2) repeat RNA initiates a POM121-mediated reduction in specific nucleoporins in C9orf72 ALS/FTD, Neuron (2020) (see Table N, below).
Isolated nuclei were subsequently imaged by super resolution structured illumination microscopy (SIM) using a Zeiss ELYRA Si as previously described in Coyne A N, Baskerville V, Zaepfel B L, Dickson D W, Rigo F, Bennett F, Patrick Lusk C, Rothstein J D, “Nuclear accumulation of CHMP7 initiates nuclear pore complex injury and subsequent TDP-43 dysfunction in sporadic and familial ALS”, Sci Translat. Med. (2021) and Coyne A N, Zaepfel B L, Hayes L, Fitchman B, Salzberg Y, Luo E C, Bowen K, Trost H, Aigner S, Rigo F et al. “G(4)C(2) repeat RNA initiates a POM121-mediated reduction in specific nucleoporins in C9orf72 ALS/FTD, Neuron (2020). All images were acquired using identical imaging parameters (e.g. laser power, gain) and subjected to default SIM deconvolution and processing in Zeiss Zen Black 2.3 SP1. Representative images are presented as 3D maximum intensity projections generated in Zeiss Zen Black 2.3 SP1. Images were faux colored green for contrast and display.
Western Blots
Nuclei and iPSN lysates were generated as previously described in Coyne A N, Baskerville V, Zaepfel B L, Dickson D W, Rigo F, Bennett F, Patrick Lusk C, Rothstein J D, “Nuclear accumulation of CHMP7 initiates nuclear pore complex injury and subsequent TDP-43 dysfunction in sporadic and familial ALS”, Sci Translat. Med. (2021) and Coyne A N, Zaepfel B L, Hayes L, Fitchman B, Salzberg Y, Luo E C, Bowen K, Trost H, Aigner S, Rigo F et al. “G(4)C(2) repeat RNA initiates a POM121-mediated reduction in specific nucleoporins in C9orf72 ALS/FTD, Neuron (2020) using RIPA lysis buffer. 5 μg protein was subjected to SDS-PAGE using 4-20% acrylamide gels (BioRad) and transferred onto nitrocellulose membranes with the Trans-Blot Turbo Transfer System as previously described in Coyne A N, Baskerville V, Zaepfel B L, Dickson D W, Rigo F, Bennett F, Patrick Lusk C, Rothstein J D, “Nuclear accumulation of CHMP7 initiates nuclear pore complex injury and subsequent TDP-43 dysfunction in sporadic and familial ALS”, Sci Translat. Med. (2021) and Coyne A N, Zaepfel B L, Hayes L, Fitchman B, Salzberg Y, Luo E C, Bowen K, Trost H, Aigner S, Rigo F et al. “G(4)C(2) repeat RNA initiates a POM121-mediated reduction in specific nucleoporins in C9orf72 ALS/FTD, Neuron (2020). Following 30 minutes room temperature incubation in block (5% nonfat milk in 1×TBS containing 0.1% Tween-20), blots were incubated with rotation in primary antibody (See, Table N) diluted in block overnight at 4° C. After 16-18 hours, blots were washed 4×10 minutes with 1×TBST and then incubated with rotation in secondary antibody (See, Table N) diluted in block for 1 hour at room temperature. Blots wee then washed 4×10 minutes with 1×TBST and incubated with ECL substrate (Thermo Fisher Scientific, Millipore) for 30 seconds. The GE Healthcare ImageQuant LAS 400 system was used to acquire chemiluminescent images. Blots were incubated for 15 minutes at room temperature with 30% H2O2 to facilitate sequential probing without stripping (Sennepin A D, Charpentier S, Normand T, Sarre C, Legrand A, Mollet L M, Multiple reprobing of Western blots after inactivation of peroxidase activity by its substrate, hydrogen peroxide, Anal Biochem, 393:129-131 (2009)). Analysis was carried out with FIJI software. GAPDH and Lamin B1 were used for normalization.
Statistical Analysis
All data analysis was conducted with FIJI or Imaris as previously described in Coyne A N, Baskerville V, Zaepfel B L, Dickson D W, Rigo F, Bennett F, Patrick Lusk C, Rothstein J D, “Nuclear accumulation of CHMP7 initiates nuclear pore complex injury and subsequent TDP-43 dysfunction in sporadic and familial ALS”, Sci Translat. Med. (2021) and Coyne A N, Zaepfel B L, Hayes L, Fitchman B, Salzberg Y, Luo E C, Bowen K, Trost H, Aigner S, Rigo F et al. “G(4)C(2) repeat RNA initiates a POM121-mediated reduction in specific nucleoporins in C9orf72 ALS/FTD, Neuron (2020). The analyzer was completely blinded to genotype/treatment/time point/brain region information. All statistical analyses were performed using Prism version 9 (GraphPad). For imaging experiments, statistical analyses were performed whereby the average of all nuclei or cells evaluated per each iPSC line, patient, and treatment condition represents n=1. The total number of nuclei or cells evaluated per experiment is indicated in the description of the figures. Two-tailed Student's t-test, One-way ANOVA with Tukey's multiple comparison test, or Two-way ANOVA with Tukey's multiple comparison test was used as appropriate for experimental design and as indicated in the description of the figures. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. Violin plots are used to display the full spread and variability of large data sets (>10 data points). Center dotted line indicates median value. Two additional dotted lines indicate the 25th and 75th percentiles. Bar graphs with individual data points are used to display summary data sets with <10 data points.
Results
Expression of the ESCRT-III protein VPS4 is increased in C9orf72 and sALS neuronal nuclei
Increased nuclear localization and expression of the ESCRT-III protein CHMP7 was previously identified as an early and consequential pathologic event leading to NPC injury in C9orf72 ALS/FTD and sALS (Coyne A N, Baskerville V, Zaepfel B L, Dickson D W, Rigo F, Bennett F, Patrick Lusk C, Rothstein J D, “Nuclear accumulation of CHMP7 initiates nuclear pore complex injury and subsequent TDP-43 dysfunction in sporadic and familial ALS”, Sci Translat. Med. (2021)). Given the previously reported involvement of additional ESCRT-III proteins (CHMP4B, CHMP2B, and VPS4) in NPC and NE surveillance and homeostasis (Denais C M, Gilbert R M, Isermann P, McGregor A L, to Lindert M, Weigelin B, Davidson P M, Friedl P, Wolf K, Lammerding J, Nuclear envelope rupture and repair during cancer cell migration, Science (New York, NY) 352:353-358, (2016), Toyama B H, Arrojo E D R, Lev-Ram V, Ramachandra R, Deerinck T J, Lechene C, Ellisman M H, Hetzer M W, Visualization of long-lived proteins reveals age mosaicism within nuclei of postmitotic cells, J Cell Biol. (2018), Vietri M, Radulovic M, Stenmark H, The many functions of ESCRTs, Nat Rev Mol Cell Biol. (2019), Vietri M, Schultz S W, Bellanger A, Jones C M, Petersen L I, Raiborg C, Skarpen E, Pedurupillay C R J, Kjos I, Kip E et al, Unrestrained ESCRT-III drives micronuclear catastrophe and chromosome fragmentation, Nat Cell Biol., 22:856-867 (2020)), an examination was conducted to determine whether the nuclear distribution and cellular expression of CHMP4B, CHMP2B, and VPS4 was altered in ALS neuronal nuclei. Using immunostaining SIM, it was found that the amount of VPS4, but not CHMP4B nor CHMP2B, was increased in nuclei isolated from C9orf72 ALS/FTD and sALS iPSNs compared to controls (
To validate that the results from iPSNs recapitulates observations in real human disease tissues, an immunostaining and SIM for CHMP4B, CHMP2B, and VPS4 was performed in nuclei isolated from postmortem human motor and occipital cortex tissues. Consistent with the data in iPSNs, VPS4, but not CHMP4B nor CHMP2B, was increased in neuronal nuclei from C9orf72 ALS/FTD and sALS motor cortex (
ASO Mediated Knockdown of CHMP7 Mitigates VPS4 Pathology in C9orf72 and sALS Neuronal Nuclei
The nuclear relocalization of CHMP7 from the cytoplasm to the nucleus has been proposed to initiate the recruitment of additional ESCRT-III pathway components culminating in scission and removal of NPC and NE components by VPS4 (Denais C M, Gilbert R M, Isermann P, McGregor A L, to Lindert M, Weigelin B, Davidson P M, Friedl P, Wolf K, Lammerding J, Nuclear envelope rupture and repair during cancer cell migration, Science (New York, NY) 352:353-358 (2016), Thaller D J, Allegretti M, Borah S, Ronchi P, Beck M, Lusk C P, An ESCRT-LEM protein surveillance system is poised to directly monitor the nuclear envelope and nuclear transport system, Elife (2019), Toyama B H, Arrojo E D R, Lev-Ram V, Ramachandra R, Deerinck T J, Lechene C, Ellisman M H, Hetzer M W Visualization of long-lived proteins reveals age mosaicism within nuclei of postmitotic cells, J Cell Biol., (2018), Vietri M, Radulovic M, Stenmark H, The many functions of ESCRTs, Nat Rev Mol Cell Biol. (2019), Vietri M, Schultz S W, Bellanger A, Jones C M, Petersen L I, Raiborg C, Skarpen E, Pedurupillay C R J, Kjos I, Kip E et al., Unrestrained ESCRT-III drives micronuclear catastrophe and chromosome fragmentation, Nat Cell Biol., 22:856-867 (2020), Webster B M, Colombi P, Jager J, Lusk C P, Surveillance of nuclear pore complex assembly by ESCRT-III/Vps4, Cell 159:388-401 (2014), Webster B M, Thaller D J, Jager J, Ochmann S E, Borah S, Lusk C P, Chm7 and Heh1 collaborate to link nuclear pore complex quality control with nuclear envelope sealing, EMBO J, 35:2447-2467 (2016)). It has not previously been shown that antisense oligonucleotide (ASO) mediated knockdown of CHMP7 not only alleviates the aberrant nuclear accumulation of CHMP7, but also robustly mitigates NPC injury and downstream NPC and TDP-43 dysfunction in C9orf72 and sALS iPSNs (Coyne AN, Baskerville V, Zaepfel B L, Dickson D W, Rigo F, Bennett F, Patrick Lusk C, Rothstein J D, “Nuclear accumulation of CHMP7 initiates nuclear pore complex injury and subsequent TDP-43 dysfunction in sporadic and familial ALS”, Sci Translat. Med. (2021)). To test whether increased nuclear CHMP7 impacted the nuclear distribution and expression of downstream components of the ESCRT-III pathway in human neurons, a control and ALS iPSNs with CHMP7 targeting ASOs (Coyne A N, Baskerville V, Zaepfel B L, Dickson D W, Rigo F, Bennett F, Patrick Lusk C, Rothstein J D, “Nuclear accumulation of CHMP7 initiates nuclear pore complex injury and subsequent TDP-43 dysfunction in sporadic and familial ALS”, Sci Translat. Med. (2021)) was treated for 2 weeks after the emergence of CHMP7 (Coyne A N, Baskerville V, Zaepfel B L, Dickson D W, Rigo F, Bennett F, Patrick Lusk C, Rothstein J D, “Nuclear accumulation of CHMP7 initiates nuclear pore complex injury and subsequent TDP-43 dysfunction in sporadic and familial ALS”, Sci Translat. Med. (2021)) and VPS4 (
Impaired VPS4 Function is not Sufficient to Alleviate NPC Alterations in C9orf72 and sALS Neuronal Nuclei
It has previously been reported that substantial reduction of the Nup POM121 from NPC and nucleoplasm is an early and consistent injury to the NPC (Coyne A N, Zaepfel B L, Hayes L, Fitchman B, Salzberg Y, Luo E C, Bowen K, Trost H, Aigner S, Rigo F et al. “G(4)C(2) repeat RNA initiates a POM121-mediated reduction in specific nucleoporins in C9orf72 ALS/FTD, Neuron (2020)) as a result of aberrant nuclear accumulation of CHMP7 (Coyne A N, Baskerville V, Zaepfel B L, Dickson D W, Rigo F, Bennett F, Patrick Lusk C, Rothstein J D, “Nuclear accumulation of CHMP7 initiates nuclear pore complex injury and subsequent TDP-43 dysfunction in sporadic and familial ALS”, Sci Translat. Med. (2021)). As VPS4 is a AAA-ATPase that facilitates the removal of NPC and NE components from the nucleus and nuclear membrane (Thaller D J, Allegretti M, Borah S, Ronchi P, Beck M, Lusk C P, Vietri M, Radulovic M, Stenmark H, The many functions of ESCRTs, Nat Rev Mol Cell Biol. (2019), Webster B M, Colombi P, Jager J, Lusk C P, Surveillance of nuclear pore complex assembly by ESCRT-III/Vps4, Cell, 159:388-401 (2014), An ESCRT-LEM protein surveillance system is poised to directly monitor the nuclear envelope and nuclear transport system, Elife (2019), Webster B M, Lusk C P, Border safety: quality control at the nuclear envelope, Trends Cell Biol., 26:29-39 (2016), Webster B M, Thaller D J, Jager J, Ochmann S E, Borah S, Lusk C P, Chm7 and Heh1 collaborate to link nuclear pore complex quality control with nuclear envelope sealing, EMBO J, 35:2447-246 (2016)), it was hypothesized that increased nuclear VPS4 expression might also functionally contribute to NPC injury in C9orf72 ALS/FTD and sALS neurons. To test this, GFP tagged wildtype VPS4 or a GFP tagged dominant negative variant of VPS4 (VPS4E228Q) that has previously been shown to impair ESCRT dependent release events (Votteler J, Ogohara C, Yi S, Hsia Y, Nattermann U, Belnap D M, King N P, Sundquist W I, Designed proteins induce the formation of nanocage-containing extracellular vesicles, Nature, 540:292-295 (2016)) was overexpressed and SIM and immunostaining performed for POM121 in nuclei isolated from control and ALS iPSNs.
Overexpression of VPS4 variants increased the nuclear expression of VPS4 as detected by immunostaining in C9orf72 and sALS, but not control iPSNs (
Nuclear pore complex injury, pathological cytoplasmic accumulations of specific Nups, and defects and nucleocytoplasmic transport have now been reported as prominent pathological features of multiple neurodegenerative diseases including ALS/FTD, AD, and HD (in Coyne A N, Baskerville V, Zaepfel B L, Dickson D W, Rigo F, Bennett F, Patrick Lusk C, Rothstein J D, “Nuclear accumulation of CHMP7 initiates nuclear pore complex injury and subsequent TDP-43 dysfunction in sporadic and familial ALS”, Sci Transla.t Med. (2021), Coyne A N, Zaepfel B L, Hayes L, Fitchman B, Salzberg Y, Luo E C, Bowen K, Trost H, Aigner S, Rigo F et al. “G(4)C(2) repeat RNA initiates a POM121-mediated reduction in specific nucleoporins in C9orf72 ALS/FTD, Neuron (2020), Eftekharzadeh B, Daigle J G, Kapinos L E, Coyne A, Schiantarelli J, Carlomagno Y, Cook C, Miller S J, Dujardin S, Amaral A S et al., Tau protein disrupts nucleocytoplasmic transport in Alzheimer's disease, Neuron 99:925-940.e927 (2018), Grima J C, Daigle J G, Arbez N, Cunningham K C, Zhang K, Ochaba J, Geater C, Morozko E, Stocksdale J, Glatzer J C et al., Mutant huntingtin disrupts the nuclear pore complex, Neuron 94:93-107.e106 (2017), and Zhang K, Donnelly C J, Haeusler A R, Grima J C, Machamer J B, Steinwald P, Daley E L, Miller S J, Cunningham K M, Vidensky S et al., The C9orf72 repeat expansion disrupts nucleocytoplasmic transport, Nature 525:56-61 (2015). However, the molecular mechanisms leading to these disruptions are still poorly understood. It has recently been established that aberrant nuclear accumulation of the ESCRT-III protein CHMP7 is sufficient to initiate a reduction in specific Nups, beginning with POM121, from the NPC and nucleoplasm of C9orf72 ALS/FTD and sALS human neuronal nuclei (Coyne A N, Baskerville V, Zaepfel B L, Dickson D W, Rigo F, Bennett F, Patrick Lusk C, Rothstein J D, “Nuclear accumulation of CHMP7 initiates nuclear pore complex injury and subsequent TDP-43 dysfunction in sporadic and familial ALS”, Sci Translat. Med. (2021)). Ultimately, this nuclear pore injury impacts NCT and subsequent TDP-43 function and localization and downstream neuronal survival in response to glutamate stress (Coyne A N, Zaepfel B L, Hayes L, Fitchman B, Salzberg Y, Luo E C, Bowen K, Trost H, Aigner S, Rigo F et al. “G(4)C(2) repeat RNA initiates a POM121-mediated reduction in specific nucleoporins in C9orf72 ALS/FTD, Neuron (2020)). To further characterize ESCRT-III protein pathology and the contribution to NPC injury in familial and sporadic ALS, this study shows that VPS4, but not CHMP4B or CHMP2B, is increased in a CHMP7 dependent manner in C9orf72 ALS/FTD and sALS human neuronal nuclei. Together, this data supports a critical role for and highlight the complexity of the ESCRT-III pathway in NPC injury in ALS/FTD. All references, including publications, patent applications, and patents, cited herein are hereby incorporated by reference to the same extent as if each reference were individually and specifically indicated to be incorporated by reference and were set forth in its entirety herein.
The use of the terms “a” and “an” and “the” and similar referents in the context of describing the disclosure (especially in the context of the following claims) are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context. The terms “comprising,” “having,” “including,” and “containing” are to be construed as open-ended terms (i.e., meaning “including, but not limited to,”) unless otherwise noted. Recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range, unless otherwise indicated herein, and each separate value is incorporated into the specification as if it were individually recited herein. All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g., “such as”) provided herein, is intended merely to better illuminate the disclosure and does not pose a limitation on the scope of the disclosure unless otherwise claimed. No language in the specification should be construed as indicating any non-claimed element as essential to the practice of the disclosure.
Preferred embodiments of this disclosure are described herein, including the best mode known to the inventors for carrying out the disclosure. Variations of those preferred embodiments may become apparent to those of ordinary skill in the art upon reading the foregoing description. The inventors expect skilled artisans to employ such variations as appropriate, and the inventors intend for the disclosure to be practiced otherwise than as specifically described herein. Accordingly, this disclosure includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law. Moreover, any combination of the above-described elements in all possible variations thereof is encompassed by the disclosure unless otherwise indicated herein or otherwise clearly contradicted by context.
This application claims priority to U.S. Application No. 63/111,882 filed on Nov. 10, 2020, the contents of which is herein incorporated by reference.
This invention was made with government support under grant AG062171 awarded by the National Institutes of Health. The government has certain rights in the invention.
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/US2021/058780 | 11/10/2021 | WO |
| Number | Date | Country | |
|---|---|---|---|
| 63111882 | Nov 2020 | US |
