Claims
- 1. A chimeric antibody V.sub.H chain against a Rhesus D antigen or an antigen binding fragment thereof comprising a CDR1, CDR2 and a CDR3 region, said V.sub.H chain selected from the group consisting of:
- (i) a V.sub.H chain comprising a CDR1 region encoded by the DNA sequence of AGTGGTGGTCTCTACTGGGGC �SEQ ID NO:1!; a CDR2 region encoded by the DNA sequence of AGTATATTTTATAGTGGGAGCACCTACTACAATCCCTC CCTCAAGAGC �SEQ ID NO: 12!; and a CDR3 region encoded by the DNA sequence of CCAGGCTATGGCGACACCTCGGTACGGAAGAGGGTTTGGAATATGGACCTC �SEQ ID NO:23!;
- (ii) a V.sub.H chain comprising a CDR1 region encoded by the DNA sequence of AGTTCCTACTGGAGC �SEQ ID NO:2!; a CDR2 region encoded by the DNA sequence of TATATCTATTACAGTGGGAGCACCAACTACAACCCCTCCCTC AGGAGT �SEQ ID NO:13!; and a CDR3 region encoded by the DNA sequence of GTTTTGGTTTCCCGTACGATTTCACAGTACTCCTATTACATGGACGTC �SEQ ID NO:25!;
- (iii) a V.sub.H chain comprising a CDR1 region encoded by the DNA sequence of GTTTACTACTGGACC �SEQ ID NO:4!; a CDR2 region encoded by the DNA sequence of GAAATCAATCATAGTGGAGGCGCCAACTACAATCCGTCC CTCAAGAGT �SEQ ID NO: 15!; and a CDR3 region encoded by the DNA sequence of GGCCGGTCCCGTTATAGTGGTTACGGCTTCTACTCCGGCATGGACGTC �SEQ ID NO:27!;
- (iv) a V.sub.H chain comprising a CDR1 region encoded by the DNA sequence of GGTTACTACTGGAGC �SEQ ID NO:6!; a CDR2 region encoded by the DNA sequence of GAAATCAGTCGTCGTGGAAGCACCAACTACAACCCGTCCCTC AAGAGT �SEQ ID NO: 17!; and a CDR3 region encoded by the DNA sequence of GCCTTGGACTACATCTCCTTGGATTACGGTATGGACGTC �SEQ ID NO:29!;
- (v) a V.sub.H chain comprising a CDR1 region encoded by the DNA sequence of AGCTATGGCATGCAC �SEQ ID NO:7!; a CDR2 region encoded by the DNA sequence of CTTATATGGTATGATGGAAGTAATAAAGAATATGCAGACTTC GTGAAGGGC �SEQ ID NO:18!; and a CDR3 region encoded by the DNA sequence of GATAGTCCCAAAATGAGGGCTGGAAGTATGTTTCGCTACTACTACATGGACGTC �SEQ ID NO:30!;
- (vi) a V.sub.H chain comprising a CDR1 region encoded by the DNA sequence of AGTTACTGGATGCAC �SEQ ID NO:8!; a CDR2 region encoded by the DNA sequence of CGTATTAATAGTTATGGAATTAGCACAAGTTACGCGAACTCC GTGAAGGGC �SEQ ID NO:19!; and a CDR3 region encoded by the DNA sequence of GGAGAGCGCATAGCAGCTCGTCTCTTGTCGGGCGGGTACGGTATGGACGTC �SEQ ID NO:31!;
- (vii) a V.sub.H chain comprising a CDR1 region encoded by the DNA sequence of AGCTATGGCATGCAC �SEQ ID NO:9!; a CDR2 region encoded by the DNA sequence of GTGATATGGTATGATGGAAGTAATAAGTACTATGCAGAGTCC GTGAAGGGC �SEQ ID NO:20!; and a CDR3 region encoded by the DNA sequence of GTCGTTAGCAGCAACCGGTACTCTCTAAGCTACTATTATTACTACATGGACGTC �SEQ ID NO:32!;
- (viii) a V.sub.H chain comprising a CDR1 region encoded by the DNA sequence of AATTATGGCATGCAC �SEQ ID NO: 10!; a CDR2 region encoded by the DNA sequence of GTTATATGGTATGATGGAAGTAATAAAAACTATGCAGACTCC GTGAAGGGC �SEQ ID NO:21!; and a CDR3 region encoded by the DNA sequence of GAACGTACTACGATGTCTGGAGTGATCATTCCTCGCCGGTATTTTGACTAC; �SEQ ID NO:33!; and
- (ix) a V.sub.H chain comprising a CDR1 region encoded by the DNA sequence of AGCTATGGCATGCAC �SEQ ID NO:11!; a CDR2 region encoded by the DNA sequence of GTTATTTGGTATGATGGAAGTAATAAATACTATGCAGACTCC GTGAAGGGC �SEQ ID NO:22!; and a CDR3 region encoded by the DNA sequence of GAAGTTACTATGGTTCGGGGAGTTAGGCGTTACTACGGTATGGACGTC �SEQ ID NO:34!,
- or a V.sub.H chain wherein at least one of said sequences has extended terminal regions.
- 2. The chimeric antibody V.sub.H chain according to claim 1, wherein said V.sub.H chain comprises a CDR1 region encoded by the DNA sequence of AGTGGTGGTCTCTACTGGGGC �SEQ ID NO: 1!; a CDR2 region encoded by the DNA sequence of AGTATATTTTATAGTGGGAGCACCTACTACAATCCCTC CCTCAAGAGC �SEQ ID NO:12!; and a CDR3 region encoded by the DNA sequence of CCAGGCTATGGCGACACCTCGGTACGGAAGAGGGTTTGGAATATGGACCTC �SEQ ID NO:23!.
- 3. The chimeric antibody V.sub.H chain according to claim 1, wherein said V.sub.H chain comprises a CDR1 region encoded by the DNA sequence of AGTTCCTACTGGAGC �SEQ ID NO:2!; a CDR2 region encoded by the DNA sequence of TATATCTATTACAGTGGGAGCACCAACTACAACCCCTCCCTC AGGAGT �SEQ ID NO: 13!; and a CDR3 region encoded by the DNA sequence of GTTTTGGTTTCCCGTACGATTTCACAGTACTCCTATTACATGGACGTC �SEQ ID NO:25!.
- 4. The chimeric antibody V.sub.H chain according to claim 1, wherein said V.sub.H chain comprises a CDR1 region encoded by the DNA sequence of GTTTACTACTGGACC �SEQ ID NO:4!; a CDR2 region encoded by the DNA sequence of GAAATCAATCATAGTGGAGGCGCCAACTACAATCCGTCC CTCAAGAGT �SEQ ID NO: 15!; and a CDR3 region encoded by the DNA sequence of GGCCGGTCCCGTTATAGTGGTTACGGCTTCTACTCCGGCATGGACGTC �SEQ ID NO:27!.
- 5. The chimeric antibody V.sub.H chain according to claim 1, wherein said V.sub.H chain comprises a CDR1 region encoded by the DNA sequence of GGTTACTACTGGAGC �SEQ ID NO:6!; a CDR2 region encoded by the DNA sequence of GAAATCAGTCGTCGTGGAAGCACCAACTACAACCCGTCCCTCAAGAGT �SEQ ID NO: 17!; and a CDR3 region encoded by the DNA sequence of GCCTTGGACTACATCTCCTTGGATTACGGTATGGACGTC �SEQ ID NO:29!.
- 6. The chimeric antibody V.sub.H chain according to claim 1, wherein said V.sub.H chain comprises a CDR1 region encoded by the DNA sequence of AGCTATGGCATGCAC �SEQ ID NO:7!; a CDR2 region encoded by the DNA sequence of CTTATATGGTATGATGGAAGTAATAAAGAATATGCAGACTTC GTGAAGGGC �SEQ ID NO: 18!; and a CDR3 region encoded by the DNA sequence of GATAGTCCCAAAATGAGGGCTGGAAGTATGTTTCGCTACTACTACATGGACGTC �SEQ ID NO:30!.
- 7. The chimeric antibody V.sub.H chain according to claim 1, wherein said V.sub.H chain comprises a CDR1 region encoded by the DNA sequence of AGTTACTGGATGCAC �SEQ ID NO:8!; a CDR2 region encoded by the DNA sequence of CGTATTAATAGTTATGGAATTAGCACAAGTTACGCGAACTCC GTGAAGGGC �SEQ ID NO: 19!; and a CDR3 region encoded by the DNA sequence of GGAGAGCGCATAGCAGCTCGTCTCTTGTCGGGCGGGTACGGTATGGACGTC �SEQ ID NO:31!.
- 8. The chimeric antibody V.sub.H chain according to claim 1, wherein said V.sub.H chain comprises a CDR1 region encoded by the DNA sequence of AGCTATGGCATGCAC �SEQ ID NO:9!; a CDR2 region encoded by the DNA sequence of GTGATATGGTATGATGGAAGTAATAAGTACTATGCAGAGTCC GTGAAGGGC �SEQ ID NO:20!; and a CDR3 region encoded by the DNA sequence of GTCGTTAGCAGCAACCGGTACTCTCTAAGCTACTATTATTACTACATGGACGTC �SEQ ID NO:32!.
- 9. The chimeric antibody V.sub.H chain according to claim 1, wherein said V.sub.H chain comprises a CDR1 region encoded by the DNA sequence of AATTATGGCATGCAC �SEQ ID NO: 10!; a CDR2 region encoded by the DNA sequence of GTTATATGGTATGATGGAAGTAATAAAAACTATGCAGACTCC GTGAAGGGC �SEQ ID NO:21!; and a CDR3 region encoded by the DNA sequence of GAACGTACTACGATGTCTGGAGTGATCATTCCTCGCCGGTATTTTGACTAC; �SEQ ID NO:33!.
- 10. The chimeric antibody V.sub.H chain according to claim 1, wherein said V.sub.H chain comprises a CDR1 region encoded by the DNA sequence of AGCTATGGCATGCAC �SEQ ID NO:11!; a CDR2 region encoded by the DNA sequence of GTTATTTGGTATGATGGAAGTAATAAATACTATGCAGACTCC GTGAAGGGC �SEQ ID NO:22!; and a CDR3 region encoded by the DNA sequence of GAAGTTACTATGGTTCGGGGAGTTAGGCGTTACTACGGTATGGACGTC �SEQ ID NO:34!.
- 11. A chimeric antibody V.sub.L chain against a Rhesus D antigen or an antigen binding fragment thereof comprising a CDR1, CDR2 and a CDR3 region, wherein said V.sub.L chain is selected from the group consisting of:
- (i) a V.sub.L chain comprising a CDR1 region encoded by the DNA sequence TCCGGAACCAGCTCCAACATTGGGAATAATTATGTATCC �SEQ ID NO:35!; a CDR2 region encoded by the DNA sequence GACAATAATAAGCGACCC TCA �SEQ ID NO:38!; and a CDR3 region encoded by the DNA sequence GCAACATGGGATAGCAGCCTGAGTGCTGTGGTG �SEQ ID NO:41!; and
- (ii) a V.sub.L chain comprising a CDR1 region encoded by the DNA sequence GGGGGAAACAACATTGGACGTAAAAGTGTGCAC �SEQ ID NO:37!; a CDR2 region encoded by the DNA sequence GGTGCTAGCGACCGGCCCTCA �SEQ ID NO:40!; and a CDR3 region encoded by the DNA sequence CAGGTGTGGGATAGTAGT AGTGCTCATCCGGGGGTGGTA �SEQ ID NO:42!,
- or a V.sub.L chain wherein at least one of said sequences has extended terminal regions.
- 12. The chimeric antibody V.sub.L chain according to claim 11, wherein said V.sub.L chain comprises a CDR1 region encoded by the DNA sequence TCCGGAACCAGCTCCAACATTGGGAATAATTATGTATCC �SEQ ID NO:35!; a CDR2 region encoded by the DNA sequence GACAATAATAAGCGACCC TCA �SEQ ID NO:38!; and a CDR3 region encoded by the DNA sequence GCAACATGGGATAGCAGCCTGAGTGCTGTGGTG �SEQ ID NO:41!.
- 13. The chimeric antibody V.sub.L chain according to claim 11, wherein said V.sub.L chain comprises a CDR1 region encoded by the DNA sequence GGGGGAAACAACATTGGACGTAAAAGTGTGCAC �SEQ ID NO:37!; a CDR2 region encoded by the DNA sequence GGTGCTAGCGACCGGCCCTCA �SEQ ID NO:40!; and a CDR3 region encoded by the DNA sequence CAGGTGTGGGATAGTAGTAGTGCTCAT CCGGGGGTGGTA �SEQ ID NO:42!.
- 14. A chimeric antibody molecule against the Rhesus (D) antigen or an antigen binding fragment thereof comprising a V.sub.H chain as defined in claim 1.
- 15. A chimeric antibody molecule against the Rhesus (D) antigen or an antigen binding fragment thereof comprising a V.sub.L chain as defined in claim 11.
- 16. A chimeric antibody molecule against the Rhesus (D) antigen or an antigen binding fragment thereof comprising a V.sub.H chain according to claim 1, and a chimeric antibody V.sub.L chain selected from the group consisting of:
- (i) a V.sub.L chain comprising a CDR1 region encoded by the DNA sequence TCCGGAACCAGCTCCAACATTGGGAATAATTATGTATCC �SEQ ID NO:35!; a CDR2 region encoded by the DNA sequence GACAATAATAAGCGACCC TCA �SEQ ID NO:38!; and a CDR3 region encoded by the DNA sequence GCAACATGGGATAGCAGCCTGAGTGCTGTGGTG �SEQ ID NO:41!; and
- (ii) a V.sub.L chain comprising a CDR1 region encoded by the DNA sequence GGGGGAAACAACATTGGACGTAAAAGTGTGCAC �SEQ ID NO:37!; a CDR2 region encoded by the DNA sequence GGTGCTAGCGACCGGCCCTCA �SEQ ID NO:40!; and a CDR3 region encoded by the DNA sequence CAGGTGTGGGATAGTAGT AGTGCTCATCCGGGGGTGGTA �SEQ ID NO:42!,
- or a V.sub.L chain wherein at least one of said sequences has extended terminal regions.
- 17. A chimeric antibody molecule against the Rhesus (D) antigen or an antigen binding fragment thereof comprising a V.sub.L chain according to claim 11 and a V.sub.H chain selected from the group consisting of:
- (i) a V.sub.H chain comprising a CDR1 region encoded by the DNA sequence of AGTGGTGGTCTCTACTGGGGC �SEQ ID NO:1!; a CDR2 region encoded by the DNA sequence of AGTATATTTTATAGTGGGAGCACCTACTACAATCCCTC CCTCAAGAGC �SEQ ID NO:12!; and a CDR3 region encoded by the DNA sequence of CCAGGCTATGGCGACACCTCGGTACGGAAGAGGGTTTGGAATATGGACCTC �SEQ ID NO:23!;
- (ii) a V.sub.H chain comprising a CDR1 region encoded by the DNA sequence of AGTTCCTACTGGAGC �SEQ ID NO:2!; a CDR2 region encoded by the DNA sequence of TATATCTATTACAGTGGGAGCACCAACTACAACCCCTCCCTC AGGAGT �SEQ ID NO:13!; and a CDR3 region encoded by the DNA sequence of GTTTTGGTTTCCCGTACGATTTCACAGTACTCCTATTACATGGACGTC �SEQ ID NO:25!;
- (iii) a V.sub.H chain comprising a CDR1 region encoded by the DNA sequence of GTTTACTACTGGACC �SEQ ID NO:4!; a CDR2 region encoded by the DNA sequence of GAAATCAATCATAGTGGAGGCGCCAACTACAATCCGTCC CTCAAGAGT �SEQ ID NO:15!; and a CDR3 region encoded by the DNA sequence of GGCCGGTCCCGTTATAGTGGTTACGGCTTCTACTCCGGCATGGACGTC �SEQ ID NO:27!;
- (iv) a V.sub.H chain comprising a CDR1 region encoded by the DNA sequence of GGTTACTACTGGAGC �SEQ ID NO:6!; a CDR2 region encoded by the DNA sequence of GAAATCAGTCGTCGTGGAAGCACCAACTACAACCCGTCCCTC AAGAGT �SEQ ID NO:17!; and a CDR3 region encoded by the DNA sequence of GCCTTGGACTACATCTCCTTGGATTACGGTATGGACGTC �SEQ ID NO:29!;
- (v) a V.sub.H chain comprising a CDR1 region encoded by the DNA sequence of AGCTATGGCATGCAC �SEQ ID NO:7!; a CDR2 region encoded by the DNA sequence of CTTATATGGTATGATGGAAGTAATAAAGAATATGCAGACTTC GTGAAGGGC �SEQ ID NO:18!; and a CDR3 region encoded by the DNA sequence of GATAGTCCCAAAATGAGGGCTGGAAGTATGTTTCGCTACTACTACATGGACGTC �SEQ ID NO:30!;
- (vi) a V.sub.H chain comprising a CDR1 region encoded by the DNA sequence of AGTTACTGGATGCAC �SEQ ID NO:8!; a CDR2 region encoded by the DNA sequence of CGTATTAATAGTTATGGAATTAGCACAAGTTACGCGAACTCC GTGAAGGGC �SEQ ID NO:19!; and a CDR3 region encoded by the DNA sequence of GGAGAGCGCATAGCAGCTCGTCTCTTGTCGGGCGGGTACGGTATGGACGTC �SEQ ID NO:31!;
- (vii) a V.sub.H chain comprising a CDR1 region encoded by the DNA sequence of AGCTATGGCATGCAC �SEQ ID NO:9!; a CDR2 region encoded by the DNA sequence of GTGATATGGTATGATGGAAGTAATAAGTACTATGCAGAGTCC GTGAAGGGC �SEQ ID NO:20!; and a CDR3 region encoded by the DNA sequence of GTCGTTAGCAGCAACCGGTACTCTCTAAGCTACTATTATTACTACATGGACGTC �SEQ ID NO:32!;
- (viii) a V.sub.H chain comprising a CDR1 region encoded by the DNA sequence of AATTATGGCATGCAC �SEQ ID NO:10!; a CDR2 region encoded by the DNA sequence of GTTATATGGTATGATGGAAGTAATAAAAACTATGCAGACTCC GTGAAGGGC �SEQ ID NO:21!; and a CDR3 region encoded by the DNA sequence of GAACGTACTACGATGTCTGGAGTGATCATTCCTCGCCGGTATTTTGACTAC; �SEQ ID NO:33!; and
- (ix) a V.sub.H chain comprising a CDR1 region encoded by the DNA sequence of AGCTATGGCATGCAC �SEQ ID NO:11!; a CDR2 region encoded by the DNA sequence of GTTATTTGGTATGATGGAAGTAATAAATACTATGCAGACTCC GTGAAGGGC �SEQ ID NO:22!; and a CDR3 region encoded by the DNA sequence of GAAGTTACTATGGTTCGGGGAGTTAGGCGTTACTACGGTATGGACGTC �SEQ ID NO:34!,
- or a V.sub.H chain wherein at least one of said sequences has extended terminal regions.
- 18. An anti-Rhesus (D) reagent comprising a chimeric antibody as claimed in claim 14.
- 19. An anti-Rhesus (D) reagent comprising a chimeric antibody as claimed in claim 15.
- 20. An anti-Rhesus (D) reagent comprising a chimeric antibody as claimed in claim 16.
- 21. An anti-Rhesus (D) reagent comprising a chimeric antibody as claimed in claim 17.
- 22. A pharmaceutical composition comprising an antibody as claimed in claim 14 together with a pharmaceutically acceptable carrier or excipient.
- 23. A pharmaceutical composition comprising an antibody as claimed in claim 15 together with a pharmaceutically acceptable carrier or excipient.
- 24. A pharmaceutical composition comprising an antibody as claimed in claim 16 together with a pharmaceutically acceptable carrier or excipient.
- 25. A pharmaceutical composition comprising an antibody as claimed in claim 17 together with a pharmaceutically acceptable carrier or excipient.
- 26. A chimeric antibody molecule against the Rhesus (D) antigen or an antigen binding fragment thereof comprising a V.sub.H chain as defined in claim 1 and a V.sub.L chain of an antibody against the human RhD antigen.
- 27. A chimeric antibody molecule against the Rhesus (D) antigen or an antigen binding fragment thereof comprising a V.sub.L chain as defined in claim 11 and a V.sub.H chain of an antibody against the human RhD antigen.
- 28. An anti-Rhesus (D) reagent comprising a chimeric antibody as claimed in claim 26.
- 29. An anti-Rhesus (D) reagent comprising a chimeric antibody as claimed in claim 27.
- 30. A pharmaceutical composition comprising an antibody as claimed in claim 26 together with a pharmaceutically acceptable carrier or excipient.
- 31. A pharmaceutical composition comprising an antibody as claimed in claim 27 together with a pharmaceutically acceptable carrier or excipient.
Priority Claims (1)
Number |
Date |
Country |
Kind |
8925590 |
Nov 1989 |
GBX |
|
Parent Case Info
This application is a divisional of application Ser. No. 07/856,034, filed Jun. 23, 1992, now U.S. Pat. No. 5,831,063, which is the national phase of PCT/EP90/01964 filed Nov. 13, 1990.
Foreign Referenced Citations (2)
Number |
Date |
Country |
A-0239400 |
Sep 1987 |
EPX |
2189506 |
Oct 1987 |
GBX |
Non-Patent Literature Citations (3)
Entry |
Morrison et al., Clin. Chem., 34(9):1668 (Sep. 1988). |
Riechmann et al., Nature, 332:323-327 (Mar. 1988). |
Verhoeyen et al., Bio Essays, 8(2):74-78 (Feb.-Mar. 1988). |
Divisions (1)
|
Number |
Date |
Country |
Parent |
856034 |
|
|