Patent Application
20250177570
Checkpoint blockade immunotherapy has transformed cancer medicine. Cancer patients that used to have little to no options can now benefit from this class of powerful drugs that may substantially enhance survival.
However, single agent checkpoint antibodies usually have low response rates in patients. Combinatorial immunotherapy involving single antibodies may improve the therapeutic efficacy compared to single agents. However, the difficulties for the approach of combining more and more antibodies scale exponentially, as development of each specific and potent therapeutic antibody is a daunting task by itself.
A more flexible, versatile, and effective means for combinatorial immunotherapy is urgently needed. The present disclosure addresses this need.
As described herein, the present disclosure relates to methods and compositions useful for providing means for combinatorial immunotherapy through the administration of CRISPR-based gene silencing systems which target immunosuppressive factors expressed by both immune cells and tissues including tumor cells.
As such, in one aspect, the present disclosure includes a method of enhancing an immune response in a subject in need thereof, the method comprising administering to the subject an effective amount of a gene silencing system, wherein the gene silencing system decreases expression of at least one endogenous immunosuppressive gene in a target cell, thereby enhancing the immune response.
In another aspect, the present disclosure includes a method of enhancing an anti-tumor immune response in a subject in need thereof, the method comprising administering to the subject an effective amount of a gene silencing system, wherein the gene silencing system decreases expression of at least one endogenous immunosuppressive gene in a target cell, thereby enhancing the anti-tumor immune response.
In certain embodiments, the gene silencing system is a CRISPR-based gene silencing system which comprises a plurality of AAV-CRISPR vectors, wherein the plurality of AAV-CRISPR vectors comprises a Cas nuclease and a plurality of guide RNAs (gRNAs) homologous to mRNA from a plurality of target genes associated with immune suppression.
In certain embodiments, the gRNA sequences comprise at least one nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1-1657.
In certain embodiments, the plurality of gRNAs comprise the nucleotide sequences consisting of SEQ ID NOs: 1-1657.
In certain embodiments, the gRNA sequences comprise at least one nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1-92.
In certain embodiments, the plurality of gRNAs comprise the nucleotide sequences consisting of SEQ ID NOs: 1-92.
In certain embodiments, the target genes are selected from the group consisting of Pdl1, Galectin9, Galectin3, and Cd47, or any combination thereof.
In certain embodiments, the CRISPR-based gene silencing system is selected from the group consisting of a type III (Cmr/Csm) system, a type VI system, and a type II system.
In certain embodiments, the type VI system comprises a Cas13 nuclease.
In certain embodiments, the Cas nuclease is a Cas13 nuclease.
In certain embodiments, the Cas13 nuclease is selected from the group consisting of Cas13a, Cas13b, Cas13c, and Cas13d.
In certain embodiments, the Cas13 nuclease is Cas13d.
In certain embodiments, the target cell is an immune cell.
In certain embodiments, the target cell is a T cell.
In certain embodiments, the target cell is a tumor cell.
In certain embodiments, the target cell is a immune cell and a tumor cell.
In certain embodiments, the gene silencing system comprises an RNA interference (RNAi) system.
In certain embodiments, the RNAi system is selected from a shRNA-based system, an siRNA-based system, and a miRNA-based system.
In certain embodiments, the RNAi system targets an endogenous RNA sequence comprising the nucleic acid sequence set forth in SEQ ID NOs: 1658-1665.
In certain embodiments, the RNAi system targets a gene selected from the group consisting of CD200, CD66, Galectin 3, CD47, or any combination thereof.
In certain embodiments, the RNAi system is an shRNA system.
In certain embodiments, the shRNA system comprises at least one nucleic acid selected from the group consisting of SEQ ID NO: 1666-1681.
In certain embodiments, the AAV-CRISPR vector is selected from the group consisting of AAV1, AAV2, AAV3, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV12, AAV-B1, AAV-DJ, AAV-Retro, AAVrh8, AAVrh10, AAVrh25, Anc80L65, LK03, AAVrh18, AAVrh74, AAVrh32.33, AAVrh39, AAVrh43, Oligo001, PHP-B, and Spark 100.
In certain embodiments, the AAV-CRISPR vector is AAV9.
In certain embodiments, administering the effective amount of the gene silencing system comprises a one dose, a two dose, a three dose, a four dose, or a multi-dose treatment.
In certain embodiments, the tumor is a cancer selected from the group consisting of breast cancer, lung cancer, pancreatic cancer, melanoma, glioma, hepatoma, colon cancer, and brain cancer.
In certain embodiments, the administration of the gene silencing system results in increased CD8+ T cell infiltration into the tumor.
In certain embodiments, the gene silencing system is administered intratumoraly.
In certain embodiments, further comprising administering an additional anti-tumor treatment.
In certain embodiments, the additional anti-tumor treatment is selected from the group consisting of chemotherapy, radiation, surgery, an immune checkpoint inhibitor, and an immune checkpoint blockade antibody.
In certain embodiments, the subject is a mammal.
In certain embodiments, the subject is a human.
In another aspect, the present disclosure includes a vector comprising an adeno-associated virus (AAV) genome, a U6 promoter sequence, a gRNA sequence, an EFS promoter sequence, and a Cas nuclease gene.
In certain embodiments, the gRNA sequence comprises at least one nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1-1657.
In certain embodiments, the Cas nuclease is a RNA-targeting nuclease.
In certain embodiments, the Cas nuclease is a Cas13 nuclease.
In certain embodiments, the Cas13 nuclease is selected from the group consisting of Cas13a, Cas13b, Cas13c, and Cas13d.
In certain embodiments, the Cas13 nuclease is Cas13d.
In another aspect, the present disclosure includes a composition comprising a gRNA library, wherein the gRNA library comprises a plurality of gRNAs that target a plurality of immunosuppressive genes in a cell.
In certain embodiments, the plurality of gRNAs comprise at least one gRNA selected from the group consisting of SEQ ID NOs: 1-1657.
In certain embodiments, the plurality of gRNAs comprise the nucleic acid sequences of SEQ ID NOs: 1-1657.
In certain embodiments, the plurality of gRNAs comprise the nucleic acid sequences of SEQ ID NOs: 3-92.
In certain embodiments, the plurality of gRNAs comprise the nucleic acid sequences of SEQ ID NOs: 93-1657.
In certain embodiments, the gRNA library is packaged into an AAV vector.
The following detailed description of specific embodiments of the present disclosure will be better understood when read in conjunction with the appended drawings. For the purpose of illustrating the present disclosure, exemplary embodiments are show in the drawings. It should be understood, however, that the present disclosure is not limited to the precise arrangements and instrumentalities of the embodiments shown in the drawings.
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the present disclosure pertains. Although any methods and materials similar or equivalent to those described herein can be used in the practice for testing of the present disclosure, the preferred materials and methods are described herein. In describing and claiming the present disclosure, the following terminology will be used.
It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting.
The articles “a” and “an” are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, “an element” means one element or more than one element.
“About” as used herein when referring to a measurable value such as an amount, a temporal duration, and the like, is meant to encompass variations of +20% or +10%, more preferably +5%, even more preferably +1%, and still more preferably +0.1% from the “Allogeneic” refers to any material derived from a different animal of the same species.
As used herein, the term “autologous” is meant to refer to any material derived from the same individual to which it is later to be re-introduced into the individual.
As used herein, the term “bp” refers to base pair.
The term “complementary” refers to the degree of anti-parallel alignment between two nucleic acid strands. Complete complementarity requires that each nucleotide be across from its opposite. No complementarity requires that each nucleotide is not across from its opposite. The degree of complementarity determines the stability of the sequences to be together or anneal/hybridize. Furthermore various DNA repair functions as well as regulatory functions are based on base pair complementarity.
The term “CRISPR/Cas” or “clustered regularly interspaced short palindromic repeats” or “CRISPR” refers to DNA loci containing short repetitions of base sequences followed by short segments of spacer DNA from previous exposures to a virus or plasmid. Bacteria and archaea have evolved adaptive immune defenses termed CRISPR/CRISPR-associated (Cas) systems that use short RNA to direct degradation of foreign nucleic acids. In bacteria, the CRISPR system provides acquired immunity against invading foreign DNA via RNA-guided DNA cleavage.
The term “CRISPR-Cas13d” system or “CRISPR/Cas13d” system as used herein refers to a type IV-D CRISPR/Cas system that has been modified for editing/engineering gene expression. It is typically comprised of a “guide” RNA (gRNA) and a non-specific CRISPR-associated endonuclease (Cas13d). “Guide RNA (gRNA)” is used interchangeably herein with “short guide RNA (sgRNA)” or “single guide RNA (sgRNA). The gRNA is a short synthetic RNA composed of a “scaffold” sequence necessary for Cas13d-binding and a user-defined ˜20 nucleotide “spacer” or “targeting” sequence which defines the target nucleic acid. Cas13d systems differ from genome-editing CRISPR/Cas systems in that they target RNA (e.g. mRNA) for nucleolytic activity. In this way, the activity of the CRISPR-Cas13d system is to reduce gene expression via degradation of mRNA transcripts rather than mutation of the DNA sequene of the target gene. The RNA target of Cas13d can be changed by changing the targeting sequence present in the gRNA.
A “disease” is a state of health of an animal wherein the animal cannot maintain homeostasis, and wherein if the disease is not ameliorated then the animal's health continues to deteriorate. In contrast, a “disorder” in an animal is a state of health in which the animal is able to maintain homeostasis, but in which the animal's state of health is less favorable than it would be in the absence of the disorder. Left untreated, a disorder does not necessarily cause a further decrease in the animal's state of health.
The term “downregulation” as used herein refers to the decrease or elimination of gene expression of one or more genes.
“Effective amount” or “therapeutically effective amount” are used interchangeably herein, and refer to an amount of a compound, formulation, material, or composition, as described herein effective to achieve a particular biological result or provides a therapeutic or prophylactic benefit. Such results may include, but are not limited to, anti-tumor activity as determined by any means suitable in the art.
The term “therapeutic” as used herein means a treatment and/or prophylaxis. A therapeutic effect is obtained by suppression, remission, or eradication of a disease state.
“Encoding” refers to the inherent property of specific sequences of nucleotides in a polynucleotide, such as a gene, a cDNA, or an mRNA, to serve as templates for synthesis of other polymers and macromolecules in biological processes having either a defined sequence of nucleotides (i.e., rRNA, tRNA and mRNA) or a defined sequence of amino acids and the biological properties resulting therefrom. Thus, a gene encodes a protein if transcription and translation of mRNA corresponding to that gene produces the protein in a cell or other biological system. Both the coding strand, the nucleotide sequence of which is identical to the mRNA sequence and is usually provided in sequence listings, and the non-coding strand, used as the template for transcription of a gene or cDNA, can be referred to as encoding the protein or other product of that gene or cDNA.
As used herein “endogenous” refers to any material from or produced inside an organism, cell, tissue or system.
As used herein, the term “exogenous” refers to any material introduced from or produced outside an organism, cell, tissue or system.
The term “expression” as used herein is defined as the transcription and/or translation of a particular nucleotide sequence driven by its promoter.
“Expression vector” refers to a vector comprising a recombinant polynucleotide comprising expression control sequences operatively linked to a nucleotide sequence to be expressed. An expression vector comprises sufficient cis-acting elements for expression; other elements for expression can be supplied by the host cell or in an in vitro expression system. Expression vectors include all those known in the art, such as cosmids, plasmids (e.g., naked or contained in liposomes) and viruses (e.g., Sendai viruses, lentiviruses, retroviruses, adenoviruses, and adeno-associated viruses) that incorporate the recombinant polynucleotide.
“Homologous” as used herein, refers to the subunit sequence identity between two polymeric molecules, e.g., between two nucleic acid molecules, such as, two DNA molecules or two RNA molecules, or between two polypeptide molecules. When a subunit position in both of the two molecules is occupied by the same monomeric subunit; e.g., if a position in each of two DNA molecules is occupied by adenine, then they are homologous at that position. The homology between two sequences is a direct function of the number of matching or homologous positions; e.g., if half (e.g., five positions in a polymer ten subunits in length) of the positions in two sequences are homologous, the two sequences are 50% homologous; if 90% of the positions (e.g., 9 of 10), are matched or homologous, the two sequences are 90% homologous.
“Identity” as used herein refers to the subunit sequence identity between two polymeric molecules particularly between two amino acid molecules, such as, between two polypeptide molecules. When two amino acid sequences have the same residues at the same positions; e.g., if a position in each of two polypeptide molecules is occupied by an Arginine, then they are identical at that position. The identity or extent to which two amino acid sequences have the same residues at the same positions in an alignment is often expressed as a percentage. The identity between two amino acid sequences is a direct function of the number of matching or identical positions; e.g., if half (e.g., five positions in a polymer ten amino acids in length) of the positions in two sequences are identical, the two sequences are 50% identical; if 90% of the positions (e.g., 9 of 10), are matched or identical, the two amino acids sequences are 90% identical.
As used herein, an “instructional material” includes a publication, a recording, a diagram, or any other medium of expression which can be used to communicate the usefulness of the compositions and methods of the present disclosure. The instructional material of the kit of the present disclosure may, for example, be affixed to a container which contains the nucleic acid, peptide, and/or composition of the present disclosure or be shipped together with a container which contains the nucleic acid, peptide, and/or composition. Alternatively, the instructional material may be shipped separately from the container with the intention that the instructional material and the compound be used cooperatively by the recipient.
“Isolated” means altered or removed from the natural state. For example, a nucleic acid or a peptide naturally present in a living animal is not “isolated,” but the same nucleic acid or peptide partially or completely separated from the coexisting materials of its natural state is “isolated.” An isolated nucleic acid or protein can exist in substantially purified form, or can exist in a non-native environment such as, for example, a host cell.
The term “knockdown” as used herein refers to a decrease in gene expression of one or more genes.
The term “knockout” as used herein refers to the ablation of gene expression of one or more genes.
A “lentivirus” as used herein refers to a genus of the Retroviridae family. Lentiviruses are unique among the retroviruses in being able to infect non-dividing cells; they can deliver a significant amount of genetic information into the DNA of the host cell, so they are one of the most efficient vectors for gene delivery. HIV, SIV, and FIV are all examples of lentiviruses. Vectors derived from lentiviruses offer the means to achieve significant levels of gene transfer in vivo.
By the term “modified” as used herein, is meant a changed state or structure of a molecule or cell of the present disclosure. Molecules may be modified in many ways, including chemically, structurally, and functionally. Cells may be modified through the introduction of nucleic acids.
By the term “modulating,” as used herein, is meant mediating a detectable increase or decrease in the level of a response in a subject compared with the level of a response in the subject in the absence of a treatment or compound, and/or compared with the level of a response in an otherwise identical but untreated subject. The term encompasses perturbing and/or affecting a native signal or response thereby mediating a beneficial therapeutic response in a subject, preferably, a human.
A “mutation” as used herein is a change in a DNA sequence resulting in an alteration from a given reference sequence (which may be, for example, an earlier collected DNA sample from the same subject). The mutation can comprise deletion and/or insertion and/or duplication and/or substitution of at least one deoxyribonucleic acid base such as a purine (adenine and/or thymine) and/or a pyrimidine (guanine and/or cytosine). Mutations may or may not produce discernible changes in the observable characteristics (phenotype) of an organism (subject).
By “nucleic acid” is meant any nucleic acid, whether composed of deoxyribonucleosides or ribonucleosides, and whether composed of phosphodiester linkages or modified linkages such as phosphotriester, phosphoramidate, siloxane, carbonate, carboxymethylester, acetamidate, carbamate, thioether, bridged phosphoramidate, bridged methylene phosphonate, phosphorothioate, methylphosphonate, phosphorodithioate, bridged phosphorothioate or sulfone linkages, and combinations of such linkages. The term nucleic acid also specifically includes nucleic acids composed of bases other than the five biologically occurring bases (adenine, guanine, thymine, cytosine and uracil). In the context of the present disclosure, the following abbreviations for the commonly occurring nucleic acid bases are used. “A” refers to adenosine, “C” refers to cytosine, “G” refers to guanosine, “T” refers to thymidine, and “U” refers to uridine.
Unless otherwise specified, a “nucleotide sequence encoding an amino acid sequence” includes all nucleotide sequences that are degenerate versions of each other and that encode the same amino acid sequence. The phrase nucleotide sequence that encodes a protein or an RNA may also include introns to the extent that the nucleotide sequence encoding the protein may in some version contain an intron(s).
The term “oligonucleotide” typically refers to short polynucleotides, generally no greater than about 60 nucleotides. It will be understood that when a nucleotide sequence is represented by a DNA sequence (i.e., A, T, G, C), this also includes an RNA sequence (i.e., A, U, G, C) in which “U” replaces “T”.
As used herein, the terms “peptide,” “polypeptide,” and “protein” are used interchangeably, and refer to a compound comprised of amino acid residues covalently linked by peptide bonds. A protein or peptide must contain at least two amino acids, and no limitation is placed on the maximum number of amino acids that can comprise a protein's or peptide's sequence. Polypeptides include any peptide or protein comprising two or more amino acids joined to each other by peptide bonds. As used herein, the term refers to both short chains, which also commonly are referred to in the art as peptides, oligopeptides and oligomers, for example, and to longer chains, which generally are referred to in the art as proteins, of which there are many types. “Polypeptides” include, for example, biologically active fragments, substantially homologous polypeptides, oligopeptides, homodimers, heterodimers, variants of polypeptides, modified polypeptides, derivatives, analogs, fusion proteins, among others. The polypeptides include natural peptides, recombinant peptides, synthetic peptides, or a combination thereof.
“Parenteral” administration of an immunogenic composition includes, e.g., subcutaneous (s.c.), intravenous (i.v.), intramuscular (i.m.), or intrasternal injection, or infusion techniques.
As used herein, the terms “peptide,” “polypeptide,” and “protein” are used interchangeably, and refer to a compound comprised of amino acid residues covalently linked by peptide bonds. A protein or peptide must contain at least two amino acids, and no limitation is placed on the maximum number of amino acids that can comprise a protein's or peptide's sequence. Polypeptides include any peptide or protein comprising two or more amino acids joined to each other by peptide bonds. As used herein, the term refers to both short chains, which also commonly are referred to in the art as peptides, oligopeptides and oligomers, for example, and to longer chains, which generally are referred to in the art as proteins, of which there are many types. “Polypeptides” include, for example, biologically active fragments, substantially homologous polypeptides, oligopeptides, homodimers, heterodimers, variants of polypeptides, modified polypeptides, derivatives, analogs, fusion proteins, among others. The polypeptides include natural peptides, recombinant peptides, synthetic peptides, or a combination thereof.
The term “polynucleotide” as used herein is defined as a chain of nucleotides. Furthermore, nucleic acids are polymers of nucleotides. Thus, nucleic acids and polynucleotides as used herein are interchangeable. One skilled in the art has the general knowledge that nucleic acids are polynucleotides, which can be hydrolyzed into the monomeric “nucleotides.” The monomeric nucleotides can be hydrolyzed into nucleosides. As used herein polynucleotides include, but are not limited to, all nucleic acid sequences which are obtained by any means available in the art, including, without limitation, recombinant means, i.e., the cloning of nucleic acid sequences from a recombinant library or a cell genome, using ordinary cloning technology and PCR™, and the like, and by synthetic means. Conventional notation is used herein to describe polynucleotide sequences: the left-hand end of a single-stranded polynucleotide sequence is the 5′-end; the left-hand direction of a double-stranded polynucleotide sequence is referred to as the 5′-direction.
As used herein, a DNA or RNA nucleotide sequence as recited refers to a polynucleotide molecule comprising the indicated bases in a 5′ to 3′ direction, from left to right.
A “sample” or “biological sample” as used herein means a biological material from a subject, including but is not limited to organ, tissue, exosome, blood, plasma, saliva, urine and other body fluid. A sample can be any source of material obtained from a subject.
As used herein, the terms “sequencing” or “nucleotide sequencing” refer to determining the order of nucleotides (base sequences) in a nucleic acid sample, e.g. DNA or RNA. Many techniques are available such as Sanger sequencing and high-throughput sequencing technologies (also known as next-generation sequencing technologies) such as Illumina's HiSeq and MiSeq platforms or the GS FLX platform offered by Roche Applied Science.
The term “subject” is intended to include living organisms in which an immune response can be elicited (e.g., mammals). A “subject” or “patient,” as used therein, may be a human or non-human mammal. Non-human mammals include, for example, livestock and pets, such as ovine, bovine, porcine, canine, feline and murine mammals. Preferably, the subject is human.
As used herein, a “substantially purified” cell is a cell that is essentially free of other cell types. A substantially purified cell also refers to a cell which has been separated from other cell types with which it is normally associated in its naturally occurring state. In some instances, a population of substantially purified cells refers to a homogenous population of cells. In other instances, this term refers simply to cell that have been separated from the cells with which they are naturally associated in their natural state. In some embodiments, the cells are cultured in vitro. In other embodiments, the cells are not cultured in vitro.
A “target site” or “target sequence” refers to a genomic nucleic acid sequence that defines a portion of a nucleic acid to which a binding molecule may specifically bind under conditions sufficient for binding to occur.
The term “therapeutic” as used herein means a treatment and/or prophylaxis. A therapeutic effect is obtained by suppression, remission, or eradication of a disease state.
The term “transfected” or “transformed” or “transduced” as used herein refers to a process by which exogenous nucleic acid is transferred or introduced into the host cell. A “transfected” or “transformed” or “transduced” cell is one which has been transfected, transformed or transduced with exogenous nucleic acid. The cell includes the primary subject cell and its progeny.
To “treat” a disease as the term is used herein, means to reduce the frequency or severity of at least one sign or symptom of a disease or disorder experienced by a subject.
A “vector” is a composition of matter which comprises an isolated nucleic acid and which can be used to deliver the isolated nucleic acid to the interior of a cell. Numerous vectors are known in the art including, but not limited to, linear polynucleotides, polynucleotides associated with ionic or amphiphilic compounds, plasmids, and viruses. Thus, the term “vector” includes an autonomously replicating plasmid or a virus. The term should also be construed to include non-plasmid and non-viral compounds which facilitate transfer of nucleic acid into cells, such as, for example, polylysine compounds, liposomes, and the like. Examples of viral vectors include, but are not limited to, Sendai viral vectors, adenoviral vectors, adeno-associated virus vectors, retroviral vectors, lentiviral vectors, and the like.
As used herein, the term “T cell receptor” or “TCR” refers to a complex of membrane proteins that participate in the activation of T cells in response to the presentation of antigen. The TCR is responsible for recognizing antigens bound to major histocompatibility complex molecules. TCR is composed of a heterodimer of an alpha (α) and beta (β) chain, although in some cells the TCR consists of gamma and delta (γ/δ) chains. TCRs may exist in α/β and γ/δ 30 forms, which are structurally similar but have distinct anatomical locations and functions. Each chain is composed of two extracellular domains, a variable and constant domain. In some embodiments, the TCR can be modified on any cell comprising a TCR, including, for example, a helper T cell, a cytotoxic T cell, a memory T cell, regulatory T cell, natural killer T cell, and/or gamma delta T cell.
The term “immune response” as used herein is defined as a cellular response to an antigen that occurs when lymphocytes identify antigenic molecules as foreign and induce the formation of antibodies and/or activate lymphocytes to remove the antigen.
“Chimeric antigen receptor” or “CAR” refers to an engineered receptor that is expressed on a T cell or any other effector cell type capable of cell-mediated cytotoxicity. The CAR comprises an extracellular domain having an antigen binding domain that is specific for a ligand or receptor. The CAR optionally also includes a transmembrane domain, and a costimulatory signaling domain. In some embodiments, the CAR comprises a hinge. In some embodiments, the antigen binding domain is specific for EGFRvIII. In some embodiments, the costimulatory signaling domain is a 4-1BB signaling domain. In some embodiments, the CAR further comprises a CD3 zeta signaling domain. A CAR-T cell is a T cell engineered to express a CAR.
“Costimulatory ligand,” as the term is used herein, includes a molecule on an antigen presenting cell (e.g., an aAPC, dendritic cell, B cell, and the like) that specifically binds a cognate costimulatory molecule on a T cell, thereby providing a “second” signal which, in addition to the primary signal provided by, for instance, binding of a TCR/CD3 complex with an MHC molecule loaded with peptide, mediates a T cell response, including, but not limited to, proliferation, activation, differentiation, and the like.
A “costimulatory molecule” refers to the cognate binding partner on a T cell that specifically binds with a costimulatory ligand, thereby mediating a costimulatory response by the T cell, such as, but not limited to, proliferation. Costimulatory molecules include, but are not limited to CD28, CD27, and OX40.
Ranges: throughout the present disclosure, various aspects of the present disclosure can be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the present disclosure. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 2.7, 3, 4, 5, 5.3, and 6. This applies regardless of the breadth of the range.
Effective immune responses are a fundamental aspect of immunotherapeutic approaches for the treatment of various diseases. However, clinically-important immune responses are often limited by endogenous inhibitory mechanisms such as the expression of so-called “immune checkpoint” or “immune checkpoint inhibitor” genes and proteins by both immune cells (e.g. T cells) and surrounding tissue/tumor cells. While these complex sets of inhibitory mechanisms normally function to protect self-tissues from harmful, inappropriate autoimmune reactions, or to limit the extent of typical, productive immune responses, these mechanisms can also blunt therapeutic immune responses. This situation applies particularly to anti-tumor immune responses, in which immune tolerance mechanisms, among other inhibitory phenomena, have traditionally limited the efficacy of immunotherapeutic approaches such as cancer vaccines and T cell adoptive transfer.
Development of drugs and biologic molecules (e.g. antibodies) which block and prevent the transduction of inhibitory signals via immune checkpoint proteins has demonstrated significant success in enhancing therapeutic immune responses, particularly antibodies against PD-1 and CTLA-4. However current therapies focus on single or a few gene or protein targets, which may contribute to low response rates in some patients, given the complexity and heterogeneity of immune signaling networks. Likewise, while the use of two or more checkpoint-blockade antibodies has demonstrated clinical effectiveness, the difficulties for the approach of combining more and more antibodies scale exponentially, as development of each specific therapeutic antibody is a daunting task by itself.
The present disclosure provides a more flexible, versatile, and effective means for combinatorial immunotherapy through the administration of CRISPR-based gene silencing systems which target immunosuppressive factors expressed by both immune cells and tissues including tumor cells.
The present disclosure includes methods for enhancing immune responses in vivo. One aspect of the method comprises administering to a subject an effective amount of a gene silencing system, wherein the gene silencing system decreases expression of at least one endogenous immunosuppressive gene in a target cell, thereby enhancing the immune response.
In another aspect, the present disclosure includes a method of enhancing an anti-tumor immune response in a subject in need thereof, comprising administering to the subject an effective amount of a gene silencing system, wherein the gene silencing system decreases expression of at least one endogenous immunosuppressive gene in a target cell, thereby enhancing the anti-tumor immune response.
In certain embodiments, the gene silencing system of the present disclosure comprises a CRISPR-based gene silencing system which comprises a plurality of AAV-CRISPR vectors. In certain embodiments, the AAV-CRISPR vectors comprise a Cas nuclease and a plurality of guide RNAs (gRNAs) homologous to mRNA transcribed from a plurality of target genes associated with immune suppression. In this way, the administration of the AAV-CRISPR vectors of the present disclosure results in the down-regulation and/or silencing of the target genes. In certain embodiments, the AAV-CRISPR vectors of the present disclosure comprise at least one gRNA sequence selected from the group consisting of SEQ ID NOs: 1-1657 or any combination thereof. In certain embodiments, the plurality of gRNAs of the present disclosure comprise the nucleic sequences comprising SEQ ID NOs: 1-1657 or any combination thereof. In certain embodiments, the plurality of gRNAs of the present disclosure are selected from the nucleic acid sequences set forth in SEQ ID NOs: 1-92 or any combination thereof. In certain embodiments, the target genes are selected from the group comprising CD200, CD66, Pdl1, Galectin9, Galectin3, CD47, and any combination thereof.
In certain embodiments, the gene silencing system comprises an RNAi or RNA interference system which comprises a plurality of short-hairpin RNAs (shRNAs) homologous to mRNA transcribed from a plurality of target genes associated with immune suppression. Administration of the plurality of shRNAs to target cells results in the degradation of mRNA transcribed from target genes, thereby silencing or reducing the expression of target genes. In certain preferred embodiments, the target genes are selected from the group comprising CD200, CD66, Pdl1, Galectin9, Galectin3, CD47, and any combination thereof.
Type VI CRISPR-Cas systems such as Cas13d systems are relatively simple CRISPR systems which require only one Cas13 protein and a crispr RNA (crRNA), which is a component of the guide RNA (gRNA), for activity. The RNA-specific nucleolytic activity of these systems is provided by the Cas13 protein, and is mediated by the presence of two HEPN domains within this protein. The guide RNA (gRNA) and the Cas protein form a complex that identifies and cleaves target sequences, with the sequence of the gRNA being complementary to the target sequence. In the case of Cas13-based systems, the target sequences are RNAs including mRNAs, and recognition by the Cas13/gRNA complex cleaves and degrades the target RNA molecules. In this way, Cas13-based CRISPR systems can be used to silence the expression of specific genes via the degradation of mRNA transcribed from those genes. Likewise, CRISPR-Cas13 systems can be used to target one or many genes simultaneously by the inclusion or administration of any number of gRNAs with the Cas13 protein. It is also contemplated that any RNA-targeting CRISPR system can be used in the methods of the present disclosure. Non-exclusive examples of RNA-targeting CRISPR systems include but are not limited to type III (Cmr/Csm) systems, type VI systems including Cas13 proteins Cas13a, Cas13b, Cas13c, and Cas13d, and type II systems.
The guide RNA is specific for a nucleic acid sequence of interest and targets that region for Cas endonuclease-induced double strand breaks and degradation. The target sequence of the guide RNA sequence may be within a loci of a gene or within a non-coding region of the genome or may be RNA molecules including mRNA transcribed from specific genes. In certain embodiments, the guide nucleic acid sequence is at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40 or more nucleotides in length.
Guide RNA (gRNA), also referred to as “short guide RNA” or “sgRNA”, provides both targeting specificity and scaffolding/binding ability for the Cas nuclease. The gRNA can be a synthetic RNA composed of a targeting sequence and scaffold sequence derived from endogenous bacterial crRNA and tracrRNA. gRNA is used to target Cas to a specific target sequence. Guide RNAs can be designed using standard tools well known in the art.
In the context of formation of a CRISPR complex, “target sequence” refers to a sequence to which a guide sequence is designed to have some complementarity, where hybridization between a target sequence and a guide sequence promotes the formation of a CRISPR complex. Full complementarity is not necessarily required, provided there is sufficient complementarity to cause hybridization and promote formation of a CRISPR complex. A target sequence may comprise any polynucleotide, such as DNA or RNA polynucleotides. In certain embodiments, a target sequence is located in the nucleus or cytoplasm of a cell. In other embodiments, the target sequence may be within an organelle of a eukaryotic cell, for example, mitochondrion or nucleus. Typically, in the context of an endogenous CRISPR system, formation of a CRISPR complex (comprising a guide sequence hybridized to a target sequence and complexed with one or more Cas proteins) results in cleavage of one or both strands in or near (e.g., within about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 50 or more base pairs) the target sequence. As with the target sequence, it is believed that complete complementarity is not needed, provided this is sufficient to be functional.
In certain embodiments, one or more vectors driving expression of one or more elements of a CRISPR gene silencing system are introduced into a target cell, such that expression of the elements of the CRISPR system direct formation of a CRISPR complex at one or more target sites. For example, a Cas enzyme, a guide sequence linked to a tracr-mate sequence, and a tracr sequence could each 30 be operably linked to separate regulatory elements on separate vectors. Alternatively, two or more of the elements expressed from the same or different regulatory elements may be combined in a single vector, with one or more additional vectors providing any components of the CRISPR gene silencing system not included in the first vector. CRISPR gene silencing system elements that are combined in a single vector may be arranged in any suitable orientation, such as one element located 5′ with respect to (“upstream” of) or 3′ with respect to (“downstream” of) a second element. The coding sequence 5 of one element may be located on the same or opposite strand of the coding sequence of a second element, and oriented in the same or opposite direction. In certain embodiments, a single promoter drives expression of a transcript encoding a CRISPR enzyme (e.g. Cas13d) and one or more of the guide sequence, tracr mate sequence (optionally operably linked to the guide sequence), and a tracr sequence embedded within one or more intron sequences (e.g., each in a different intron, two or more in at least one intron, or all in a single intron).
In certain embodiments, the CRISPR enzyme is part of a fusion protein comprising one or more heterologous protein domains (e.g. about or more than about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more domains in addition to the CRISPR enzyme). A CRISPR enzyme fusion protein may comprise any additional protein sequence, and optionally a linker sequence between any two domains. Examples of protein domains that may be fused to a CRISPR enzyme include, without limitation, epitope tags, reporter gene sequences, and protein domains having one or more of the following activities: methylase activity, demethylase activity, transcription activation activity, transcription repression activity, transcription release factor activity, histone modification activity, RNA cleavage activity and nucleic acid binding activity. Additional domains that may form part of a fusion protein comprising a CRISPR enzyme are described in U.S. Patent Appl. Publ. No. US20110059502, incorporated herein by reference. In certain embodiments, a tagged CRISPR enzyme is used to identify the location of a target sequence.
Conventional viral and non-viral based gene transfer methods can be used to introduce nucleic acids in mammalian and non-mammalian cells or target tissues. Such methods can be used to administer nucleic acids encoding components of a CRISPR system to cells in culture, or in a host organism. Non-viral vector delivery systems include DNA plasmids, RNA (e.g., a transcript of a vector described herein), naked nucleic acid, and nucleic acid complexed with a delivery vehicle, such as a liposome. Viral vector delivery systems include DNA and RNA viruses, which have either episomal or integrated genomes after delivery to the cell (Anderson, 1992, Science 256:808-813; and Yu, et al., 1994, Gene Therapy 1:13-26).
In certain embodiments, a vector drives the expression of the CRISPR system. The art is replete with suitable vectors that are useful in the present disclosure. The vectors to be used are suitable for replication and, optionally, integration in eukaryotic cells. Typical vectors contain transcription and translation terminators, initiation sequences, and promoters useful for regulation of the expression of the desired nucleic acid sequence. The vectors of the present disclosure may also be used for nucleic acid standard gene delivery protocols. Methods for gene delivery are known in the art (U.S. Pat. Nos. 5,399,346, 5,580,859 & 5,589,466, incorporated by reference herein in their entireties).
Further, the vector may be provided to a cell in the form of a viral vector. Viral vector technology is well known in the art and is described, for example, in Sambrook et al. (4th Edition, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York, 2012), and in other virology and molecular biology manuals. Viruses, which are useful as 10 vectors include, but are not limited to, retroviruses, adenoviruses, adeno-associated viruses, herpes viruses, Sindbis virus, gammaretrovirus and lentiviruses. In general, a suitable vector contains an origin of replication functional in at least one organism, a promoter sequence, convenient restriction endonuclease sites, and one or more selectable markers (e.g., WO 01/96584; WO 01/29058; and U.S. Pat. No. 6,326,193). In certain preferred embodiments, the vector of the present disclosure is an adeno-associated virus (AAV) which comprises the CRISPR gene silencing system of the present disclosure.
AAV are relatively small, non-enveloped viruses with a ˜4 kb genome that is flanked by inverted terminal repeats (ITRs). The genome contains two open reading frames, one of which provides proteins necessary for replication and the other provides components required for construction of the viral capsid. Wild-type AAV is typically found in the presence of adenovirus as the adenoviruses provide helper proteins that are essential for packaging of the AAV genome into virions. Therefore, AAV production piggy-backs on co-infection with adenovirus and relies on three key elements: the ITR-flanked genome, the open-reading frames, and adeno-helper genes. Due to their non-pathogenic ability to readily infect human cells, AAV is well-studied as a vector for gene delivery. AAV may be readily obtained and their use as vectors for gene delivery has been described in, for example, Muzyczka, 1992; U.S. Pat. No. 4,797,368, and PCT Publication WO 91/18088. Construction of AAV vectors is described in a number of publications, including Lebkowski et al., 1988; Tratschin et al., 1985; Hermonat and Muzyczka, 1984; vectors is described in a number of publications, including Lebkowski et al., 1988; Tratschin et al., 1985; Hermonat and Muzyczka, 1984.
AAV-based vector systems typically separate the viral AAV genes, Adenovirus-derived helper genes, and the transgene payload onto two or three separate plasmids. Three plasmid systems consist of an AAV helper plasmid comprising the rep (replication) and cap (capsid) genes, an adenoviral helper plasmid comprising at least the E2a gene, E4 gene, and VA (viral associated) RNA, and a payload plasmid comprising the transgene and associated promoters and enhancers flanked by ITR sequences. The helper plasmid or plasmids do not comprise ITRs in order to prevent packaging of a functional, infectious viral genome. In certain embodiments, the AAV-CRISPR vectors of the present disclosure comprise AAV particles which comprise a transgene payload comprising a nucleic acid encoding a U6, a DR
In certain embodiments, the CRISPR-based gene silencing system of the present disclosure comprises a plurality of AAV-CRISPR vectors, wherein the AAV-CRISPR vectors comprise a Cas nuclease (e.g. a Cas13d nuclease) and a plurality of gRNAs homologous to mRNA from a plurality of target genes associated with immune suppression. In certain embodiments, the AAV-CRISPR vectors comprise AAV particles which comprise a transgene payload comprising an AAV genome, a U6 promoter sequence, a gRNA sequence, an EFS promoter sequence, and a Cas nuclease gene (e.g. a Cas13d nuclease gene).
The tissue tropism of AAV vector particles is influenced by the serotype of the capsid protein, though the receptors and co-receptors that the capsid proteins bind to are often poorly understood and can be expressed by multiple tissue types. For example, AAV2, one of the most well-studied serotypes, has a binding affinity largely for heparan sulfate proteoglycan (HSPG) and as such has a tropism in humans for eye, brain, lung, liver, muscle, and joint tissues. Likewise, AAVs 1, 4, 5, and 6 have a binding affinity largely for sialic acid and a tropism for neuronal tissues and AAVs 5 and 8 which share a tropism for skeletal muscle cell. In this way, the serotype of the AAV capsid protein can be selected to target the payload nucleic acid of the AAV vector to a specific tissue or cell type. Alteration or modification of capsid protein structure can also alter the tissue or cellular tropism and affinity of the resulting AAV vector particles.
In certain embodiments of the present disclosure, the AAV-CRISPR vectors target immune cells including CD4+ T cells, CD8+ T cells, B cells, antigen presenting cells, and the like. In certain embodiments, the AAV-CRISPR vectors target non-immune tissue cells including but not limited to endothelial cells, mesenchymal cells, fibroblasts, and the like, as these cells also express immunosuppressive factors which contribute to immune suppression. In certain embodiments, the target cells are tumor cells. Suppression of anti-tumor immune responses have been demonstrated to be a key factor in tumor development and progression and contribute to poor prognosis and patient survival and tumor cells and tissues have been found to express a complex network of factors including checkpoint inhibitor proteins, which contribute to the immunosuppressive nature of the tumor microenvironment (TME). In certain embodiments, the AAV-CRISPR vectors of the present disclosure target both immune and non-immune cells withing a particular microenvironment simultaneously. By way of a non-exclusive example, the AAV-CRISPR vectors of the present disclosure can be introduced into a tumor microenvironment, where the CRISPR-based gene silencing system of the present disclosure suppresses the expression of one or more immunosuppressive genes expressed by both immune and non-immune cells including tumor cells, the overall effect being the improvement of anti-tumor immune responses.
It is contemplated that the AAV-CRISPR vectors of the present disclosure can be used with any naturally occurring, modified, hybrid, or engineered AAV capsid protein including, but not limited to AAV1, AAV2, AAV3, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV12, AAV-B1, AAV-DJ, AAV-Retro, AAVrh8, AAVrh10, AAVrh25, Anc80L65, LK03, AAVrh18, AAVrh74, AAVrh32.33, AAVrh39, AAVrh43, Oligo001, PHP-B, and Spark 100 among others. In certain embodiments, the AAV-CRISPR vector is AAV9. The skilled artisan would be able to select an appropriate capsid protein for use with the present disclosure based on the desired target tissue or cell type.
In certain embodiments, the present disclosure includes use of “guide RNAs” (gRNAs) which can be utilized in combination with RNA-targeting CRISPR systems to modulate gene expression by targeting and degrading specific mRNA sequences.
In one aspect, the present disclosure includes a guide RNA (gRNA) library that target a plurality of immunosuppressive genes in a target cell. In some embodiments, the gRNA library comprises a plurality of nucleic acids comprising one or more nucleotide sequences selected from the group consisting of SEQ ID NOs. 1-1,657. In further embodiments, the library further comprises at least one nucleotide sequence selected from the group consisting of SEQ ID NOs. 3-92. In further embodiments, the library further comprises at least one nucleotide sequence selected from the group consisting of SEQ ID NOs. 93-1,657. In some embodiments, the gRNA library comprises a plurality of nucleic acids comprising the nucleotide sequences of SEQ ID NOs. 1-1,657. In further embodiments, the library comprises a plurality of nucleic acids comprising the nucleotide sequences of SEQ ID NOs. 3-92. In further embodiments, the library comprises a plurality of nucleic acids comprising the nucleotide sequences of SEQ ID NOs. 93-1,657. In certain embodiments, the library can be packaged into a vector. Any vector known to one of ordinary skill in the art can be used, including but not limited to lentiviral vectors, adenoviral vectors, and adeno-associated viral (AAV) vectors.
With regard to any of the gRNA libraries or lentiviral libraries comprising the SEQ ID NOs. 1-1,657 or any combination thereof, it should be understood by one of ordinary skill in the art that the present disclosure is construed to encompassing every individual SEQ ID NO. in the range and all combinations thereof.
Also included in the present disclosure is a vector, e.g. an AAV-CRISPR vector. The vector comprises a adeno-associated virus (AAV) genome, a U6 promoter sequence, a gRNA sequence, an EFS promoter sequence, and a Cas nuclease gene. The vector can include additional components, including but not limited ot an LTR sequence, aT2A sequence, a linker sequence, an NLS sequence, and a short PA sequence. In certain embodiments, the first promoter is a U6 promoter and/or the second promoter is an EFS promoter.
Any promoter known to one of ordinary skill in the art can be incorporated into any of the vectors of the present disclosure. Suitable promoter and enhancer elements are known to those of skill in the art. For expression in a bacterial cell, suitable promoters include, but are not limited to, lacl, lacZ, T3, T7, gpt, lambda P and trc. For expression in a eukaryotic cell, suitable promoters include, but are not limited to, light and/or heavy chain immunoglobulin gene promoter and enhancer elements; cytomegalovirus immediate early promoter; herpes simplex virus thymidine kinase promoter; early and late SV40 promoters; promoter present in long terminal repeats from a retrovirus; mouse metallothionein-I promoter; and various art-known tissue specific promoters. Suitable reversible promoters, including reversible inducible promoters are known in the art. Such reversible promoters may be isolated and derived from many organisms, e.g., eukaryotes and prokaryotes. Modification of reversible promoters derived from a first organism for use in a second organism, e.g., a first prokaryote and a second a eukaryote, a first eukaryote and a second a prokaryote, etc., is well known in the art. Such reversible promoters, and systems based on such reversible promoters but also comprising additional control proteins, include, but are not limited to, alcohol regulated promoters (e.g., alcohol dehydrogenase I (alcA) gene promoter, promoters responsive to alcohol transactivator proteins (AlcR), etc.), tetracycline regulated promoters, (e.g., promoter systems including TetActivators, TetON, TetOFF, etc.), steroid regulated promoters (e.g., rat glucocorticoid receptor promoter systems, human estrogen receptor promoter systems, retinoid promoter systems, thyroid promoter systems, ecdysone promoter systems, mifepristone promoter systems, etc.), metal regulated promoters (e.g., metallothionein promoter systems, etc.), pathogenesis-related regulated promoters (e.g., salicylic acid regulated promoters, ethylene regulated promoters, benzothiadiazole regulated promoters, etc.), temperature regulated promoters (e.g., heat shock inducible promoters (e.g., HSP-70, HSP-90, soybean heat shock promoter, etc.), light regulated promoters, synthetic inducible promoters, and the like.
Other examples of suitable promoters include the immediate early cytomegalovirus (CMV) promoter sequence. This promoter sequence is a strong constitutive promoter sequence capable of driving high levels of expression of any polynucleotide sequence operatively linked thereto. Other constitutive promoter sequences may also be used, including, but not limited to a simian virus 40 (SV40) early promoter, a mouse mammary tumor virus (MMTV) or human immunodeficiency virus (HIV) long terminal repeat (LTR) promoter, a MoMuLV promoter, an avian leukemia virus promoter, an Epstein-Barr virus immediate early promoter, a Rous sarcoma virus promoter, the EF-1 alpha promoter, as well as human gene promoters such as, but not limited to, an actin promoter, a myosin promoter, a hemoglobin promoter, and a creatine kinase promoter. Further, the present disclosure should not be limited to the use of constitutive promoters. Inducible promoters are also contemplated as part of the present disclosure. The use of an inducible promoter provides a molecular switch capable of turning on expression of the polynucleotide sequence which it is operatively linked when such expression is desired, or turning off the expression when expression is not desired. Examples of inducible promoters include, but are not limited to a metallothionine promoter, a glucocorticoid promoter, a progesterone promoter, and a tetracycline promoter.
In certain embodiments, the vector comprises a U6 promoter and/or an EFS promoter. Certain embodiments of the present disclosure include more than one promoter per vector. It should be known to one of ordinary skill in the art that the when a vector comprises more than one promoter, said promoters can include two or more of the same promoter or two or more different promoters. For example, the vector may comprise a first promoter comprising a U6 promoter and a second promoter comprising an EFS promoter.
In addition, any of the vectors/plasmids of the present disclosure can include additional components. For example, an antibiotic resistance gene/sequence. Any antibiotic resistance gene/sequence or selection marker known to one of ordinary skill in the art can be include in the vector.
The present disclosure should be construed to encompass any type of vector known to one of ordinary skill in the art. For example, the vector can comprise an adeno-associated virus, but can also comprise other viral vectors including but not limited to adenovirus, lentivirus, retrovirus, hybrid viral vectors, or any combinations thereof.
Certain embodiments of the present disclosure include compositions and methods for enhancing an immune response. In other aspects, the present disclosure include compositions and methods for enhancing anti-tumor immune Reponses. It is contemplated that any disease which can be targeted by an immune response can be treated with the compositions of the present disclosure which enhance such immune responses. Diseases/disorder/conditions that can be treated include but are not limited to autoimmune diseases, inflammation, neuroimmune disorders, and other immune system disorders.
The present disclosure includes compositions and methods for enhancing anti-tumor immune responses. Enhancement of such responses results in greater killing of tumor cells by the patient's immune system or by adoptively transferred immune cells which are specific for the cancer, thereby treating the cancer. Types of cancer that can be treated include, but are not limited to, Acute Lymphoblastic Leukemia (ALL), Acute Myeloid Leukemia (AML), Adrenocortical Carcinoma, AIDS-Related Cancers, Kaposi Sarcoma, AIDS-Related Lymphoma, Primary CNS Lymphoma, Anal Cancer, Appendix Cancer (Gastrointestinal Carcinoid Tumors), Astrocytomas, Atypical Teratoid/Rhabdoid Tumor, Brain Cancer, Basal Cell Carcinoma of the Skin, Bile Duct Cancer, Bladder Cancer, Bone Cancer (includes Ewing Sarcoma and Osteosarcoma and Malignant Fibrous Histiocytoma), Brain Tumors, Breast Cancer, Bronchial Tumors, Burkitt Lymphoma, Non-Hodgkin Lymphoma, Carcinoid Tumors, Carcinoma of Unknown Primary, Cardiac (Heart) Tumors, Embryonal Tumors, Germ Cell Tumor, Primary CNS Lymphoma, Cervical Cancer, Cholangiocarcinoma, Chordoma, Chronic Lymphocytic Leukemia (CLL), Chronic Myelogenous Leukemia (CML), Chronic Myeloproliferative Neoplasms, Colorectal Cancer, Craniopharyngioma, Cutaneous T-Cell Lymphoma (Mycosis Fungoides and Sezary Syndrome), Ductal Carcinoma In Situ (DCIS), Endometrial Cancer, Ependymoma, Esophageal Cancer, Esthesioneuroblastoma, Ewing Sarcoma, Extracranial Germ Cell Tumor, Eye Cancer, Intraocular Melanoma, Fallopian Tube Cancer, Fibrous Histiocytoma of Bone, Osteosarcoma, Gallbladder Cancer, Gastric Cancer, Stomach Cancer, Gastrointestinal Carcinoid Tumor, Gastrointestinal Stromal Tumors (GIST), Central Nervous System Germ Cell Tumors, Extracranial Germ Cell Tumors, Extragonadal Germ Cell Tumors, Ovarian Germ Cell Tumors, Testicular Cancer, Gestational Trophoblastic Disease, Hairy Cell Leukemia, Head and Neck Cancer, Heart Tumors, Hepatocellular (Liver) Cancer, Histiocytosis (Langerhans Cell), Hodgkin Lymphoma, Hypopharyngeal Cancer, Intraocular Melanoma, Islet Cell Tumors, Pancreatic Neuroendocrine Tumors, Kidney Cancer, Renal Cell Cancer, Langerhans Cell Histiocytosis, Laryngeal Cancer, Leukemia, Lip and Oral Cavity Cancer, Liver Cancer, Lung Cancer (Non-Small Cell and Small Cell), Lymphoma, Male Breast Cancer, Malignant Fibrous Histiocytoma of Bone and Osteosarcoma, Melanoma, Intraocular (Eye) Melanoma, Merkel Cell Carcinoma (Skin Cancer), Malignant Mesothelioma, Metastatic Cancer, Metastatic Squamous Neck Cancer with Occult Primary, Midline Tract Carcinoma With NUT Gene Changes, Mouth Cancer, Multiple Endocrine Neoplasia Syndromes, Multiple Myeloma/Plasma Cell Neoplasms, Mycosis Fungoides (Lymphoma), Myelodysplastic Syndromes, Myelodysplastic/Myeloproliferative Neoplasms, Nasal Cavity and Paranasal Sinus Cancer, Nasopharyngeal Cancer, Neuroblastoma, Non-Small Cell Lung Cancer, Oral Cancer, and Oropharyngeal Cancer, Ovarian Cancer, Pancreatic Cancer, Papillomatosis, Paraganglioma, Paranasal Sinus and Nasal Cavity Cancer, Parathyroid Cancer, Penile Cancer, Pharyngeal Cancer, Pheochromocytoma, Pituitary Tumor, Plasma Cell Neoplasm/Multiple Myeloma, Pleuropulmonary Blastoma, Primary Central Nervous System (CNS) Lymphoma, Primary Peritoneal Cancer, Prostate Cancer, Rectal Cancer, Recurrent Cancer, Retinoblastoma, Rhabdomyosarcoma, Salivary Gland Cancer, Sarcoma, Vascular Tumors, Uterine Sarcoma, Sezary Syndrome (Lymphoma), Small Cell Lung Cancer, Small Intestine Cancer, Soft Tissue Sarcoma, Squamous Cell Carcinoma, Stomach (Gastric) Cancer, Throat Cancer, Thymoma, Thymic Carcinoma, Thyroid Cancer, Transitional Cell Cancer of the Renal Pelvis and Ureter, Carcinoma of Unknown Primary, Ureter and Renal Pelvis, Transitional Cell Cancer, Urethral Cancer, Uterine Cancer, Vaginal Cancer, Vulvar Cancer, Wilms Tumor, and combinations thereof.
In certain embodiments, the subject can be administered an additional treatment, such as but not limited to an anti-tumor treatment. For example, the subject can be administered a combination of a composition of the present disclosure and an additional treatment, such as but not limited to an anti-tumor treatment. Examples of additional treatments include but are not limited to, chemotherapy, radiation, surgery, medication, immune checkpoint inhibitors, immune checkpoint blockade (ICB) antibodies, immune checkpoint inhibitors that block CTLA-4 or PD1, anti-CTLA4 monoclonal antibody, anti-PD1 monoclonal antibody, anti-PD-LI monoclonal antibody, adoptive cell transfer, human recombinant cytokines, cancer vaccines, immunotherapy, targeted therapy, hormone therapy, stem cell transplant, precision medicine, non-specific immunotherapy (e.g. cytokines and chemokines, such as IL-2, IFNa, IFNb, IFNg), oncolytic virus therapy, T-cell therapy (e.g. adoptive transfer of TILs, CAR-T therapy), cancer vaccines (e.g. conventional DC vaccine), Ipilimumab (Yervoy), Nivolumab (Opdivo), Pembrolizumab (Keytruda), Atezolizumab (Tecentriq), Avelumab (Bavencio), Durvalumab (Imfinzi), Anti-LAG-3, anti-TIM1, Anti-TIM3, Anti-CSF-R, IDO inhibitor, OX-40 agonist, GITR agonist, CD80 agonist, CD86 agonist, ICOS agonist, ICOSLG agonist, CD276 agonist, VTCN1 agonist, TNFSF14 agonist, TNFSF9 agonist, TNFSF4 agonist, CD70 agonist, CD40 agonist, LGALS9 agonist, CD80 inhibitor, CD86 inhibitor, ICOS inhibitor, ICOSLG inhibitor, CD276 inhibitor, VTCN1 inhibitor, TNFSF14 inhibitor, TNFSF9 inhibitor, TNFSF4 inhibitor, CD70 inhibitor, CD40 inhibitor, LGALS9 inhibitor, TLR9 agonist, CD20 antibody, CD80 antibody, TIGIT antibody, B7-H1 antibody, B7-H2 antibody, B7-H3 antibody, B7-H4 antibody, CD28 antibody, CD47 antibody, anti-BTLA, anti-Galetin9, anti-IL 15R, anti-GD2. In some embodiments the monoclonal antibody is fully human, humanized or chimeric.
In certain embodiments an expression system is used for the introduction of gRNAs and Cas13d proteins into the cells of interest. Typically employed options include but are not limited to plasmids and viral vectors such as adeno-associated virus (AAV) vector or lentivirus vector.
Methods of introducing nucleic acids into a cell include physical, biological and chemical methods. Physical methods for introducing a polynucleotide, such as RNA, into a host cell include calcium phosphate precipitation, lipofection, particle bombardment, microinjection, electroporation, and the like. RNA can be introduced into target cells using commercially available methods which include electroporation (Amaxa Nucleofector-II (Amaxa Biosystems, Cologne, Germany)), (ECM 830 (BTX) (Harvard Instruments, Boston, Mass.) or the Gene Pulser II (BioRad, Denver, Colo.), Multiporator (Eppendort, Hamburg Germany). RNA can also be introduced into cells using cationic liposome mediated transfection using lipofection, using polymer encapsulation, using peptide mediated transfection, or using biolistic particle delivery systems such as “gene guns” (see, for example, Nishikawa, et al. Hum Gene Ther., 12(8): 861-70 (2001).
Biological methods for introducing a polynucleotide of interest into a host cell include the use of DNA and RNA vectors. Viral vectors, and especially retroviral vectors, have become the most widely used method for inserting genes into mammalian, e.g., human cells. Other viral vectors can be derived from lentivirus, poxviruses, herpes simplex virus I, adenoviruses and adeno-associated viruses, and the like. See, for example, U.S. Pat. Nos. 5,350,674 and 5,585,362.
Chemical means for introducing a polynucleotide into a host cell include colloidal dispersion systems, such as macromolecule complexes, nanocapsules, microspheres, beads, and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes. An exemplary colloidal system for use as a delivery vehicle in vitro and in vivo is a liposome (e.g., an artificial membrane vesicle).
Lipids suitable for use can be obtained from commercial sources. For example, dimyristyl phosphatidylcholine (“DMPC”) can be obtained from Sigma, St. Louis, MO; dicetyl phosphate (“DCP”) can be obtained from K & K Laboratories (Plainview, NY); cholesterol (“Choi”) can be obtained from Calbiochem-Behring; dimyristyl phosphatidylglycerol (“DMPG”) and other lipids may be obtained from Avanti Polar Lipids, Inc. (Birmingham, AL). Stock solutions of lipids in chloroform or chloroform/methanol can be stored at about −20° C. Chloroform is used as the only solvent since it is more readily evaporated than methanol. “Liposome” is a generic term encompassing a variety of single and multilamellar lipid vehicles formed by the generation of enclosed lipid bilayers or aggregates. Liposomes can be characterized as having vesicular structures with a phospholipid bilayer membrane and an inner aqueous medium. Multilamellar liposomes have multiple lipid layers separated by aqueous medium. They form spontaneously when phospholipids are suspended in an excess of aqueous solution. The lipid components undergo self-rearrangement before the formation of closed structures and entrap water and dissolved solutes between the lipid bilayers (Ghosh et al., 1991 Glycobiology 5:505-10). However, compositions that have different structures in solution than the normal vesicular structure are also encompassed. For example, the lipids may assume a micellar structure or merely exist as nonuniform aggregates of lipid molecules. Also contemplated are lipofectamine-nucleic acid complexes.
Regardless of the method used to introduce exogenous nucleic acids into a host cell or otherwise expose a cell to the inhibitor of the present disclosure, in order to confirm the presence of the nucleic acids in the host cell, a variety of assays may be performed. Such assays include, for example, “molecular biological” assays well known to those of skill in the art, such as Southern and Northern blotting, RT-PCR and PCR; “biochemical” assays, such as detecting the presence or absence of a particular peptide, e.g., by immunological means (ELISAs and Western blots) or by assays described herein to identify agents falling within the scope of the present disclosure.
Moreover, the nucleic acids may be introduced by any means, such as transducing the cells, transfecting the cells, and electroporating the cells. One nucleic acid may be introduced by one method and another nucleic acid may be introduced into the cell by a different method.
In certain embodiments, the nucleic acids introduced into the cell are RNA. In another embodiment, the RNA is mRNA that comprises in vitro transcribed RNA or synthetic RNA.
The RNA is produced by in vitro transcription using a polymerase chain reaction (PCR)-generated template. DNA of interest from any source can be directly converted by PCR into a template for in vitro mRNA synthesis using appropriate primers and RNA polymerase. The source of the DNA can be, for example, genomic DNA, plasmid DNA, phage DNA, cDNA, synthetic DNA sequence or any other appropriate source of DNA.
PCR can be used to generate a template for in vitro transcription of mRNA which is then introduced into cells. Methods for performing PCR are well known in the art. Primers for use in PCR are designed to have regions that are substantially complementary to regions of the DNA to be used as a template for the PCR. “Substantially complementary”, as used herein, refers to sequences of nucleotides where a majority or all of the bases in the primer sequence are complementary, or one or more bases are non-complementary, or mismatched. Substantially complementary sequences are able to anneal or hybridize with the intended DNA target under annealing conditions used for PCR. The primers can be designed to be substantially complementary to any portion of the DNA template. For example, the primers can be designed to amplify the portion of a gene that is normally transcribed in cells (the open reading frame), including 5′ and 3′ UTRs. The primers can also be designed to amplify a portion of a gene that encodes a particular domain of interest. In certain embodiments, the primers are designed to amplify the coding region of a human cDNA, including all or portions of the 5′ and 3′ UTRs. Primers useful for PCR are generated by synthetic methods that are well known in the art. “Forward primers” are primers that contain a region of nucleotides that are substantially complementary to nucleotides on the DNA template that are upstream of the DNA sequence that is to be amplified. “Upstream” is used herein to refer to a location 5, to the DNA sequence to be amplified relative to the coding strand. “Reverse primers” are primers that contain a region of nucleotides that are substantially complementary to a double-stranded DNA template that are downstream of the DNA sequence that is to be amplified. “Downstream” is used herein to refer to a location 3′ to the DNA sequence to be amplified relative to the coding strand.
Chemical structures that have the ability to promote stability and/or translation efficiency of the RNA may also be used. The RNA preferably has 5′ and 3′ UTRs. In certain embodiments, the 5′ UTR is between zero and 3000 nucleotides in length. The length of 5′ and 3′ UTR sequences to be added to the coding region can be altered by different methods, including, but not limited to, designing primers for PCR that anneal to different regions of the UTRs. Using this approach, one of ordinary skill in the art can modify the 5′ and 3′ UTR lengths required to achieve optimal translation efficiency following transfection of the transcribed RNA.
The 5′ and 3′ UTRs can be the naturally occurring, endogenous 5′ and 3′ UTRs for the gene of interest. Alternatively, UTR sequences that are not endogenous to the gene of interest can be added by incorporating the UTR sequences into the forward and reverse primers or by any other modifications of the template. The use of UTR sequences that are not endogenous to the gene of interest can be useful for modifying the stability and/or translation efficiency of the RNA. For example, it is known that AU-rich elements in 3′ UTR sequences can decrease the stability of mRNA. Therefore, 3′ UTRs can be selected or designed to increase the stability of the transcribed RNA based on properties of UTRs that are well known in the art.
In certain embodiments, the 5′ UTR can contain the Kozak sequence of the endogenous gene. Alternatively, when a 5′ UTR that is not endogenous to the gene of interest is being added by PCR as described above, a consensus Kozak sequence can be redesigned by adding the 5′ UTR sequence. Kozak sequences can increase the efficiency of translation of some RNA transcripts, but does not appear to be required for all RNAs to enable efficient translation. The requirement for Kozak sequences for many mRNAs is known in the art. In other embodiments the 5′ UTR can be derived from an RNA virus whose RNA genome is stable in cells. In other embodiments various nucleotide analogues can be used in the 3′ or 5′ UTR to impede exonuclease degradation of the mRNA.
To enable synthesis of RNA from a DNA template, a promoter of transcription should be attached to the DNA template upstream of the sequence to be transcribed. When a sequence that functions as a promoter for an RNA polymerase is added to the 5′ end of the forward primer, the RNA polymerase promoter becomes incorporated into the PCR product upstream of the open reading frame that is to be transcribed. In certain embodiments, the promoter is a T7 polymerase promoter, as described elsewhere herein. Other useful promoters include, but are not limited to, T3 and SP6 RNA polymerase promoters. Consensus nucleotide sequences for T7, T3 and SP6 promoters are known in the art.
In certain embodiments, the mRNA has a cap on the 5′ end and a 3′ poly(A) tail which determine ribosome binding, initiation of translation and stability mRNA in the cell. On a circular DNA template, for instance, plasmid DNA, RNA polymerase produces a long concatameric product which may not be suitable for expression in eukaryotic cells. The transcription of plasmid DNA linearized at the end of the 3′ UTR results in normal sized mRNA which may not be effective in eukaryotic transfection even if it is polyadenylated after transcription.
On a linear DNA template, phage T7 RNA polymerase can extend the 3′ end of the transcript beyond the last base of the template (Schenborn and Mierendorf, Nuc Acids Res., 13:6223-36 (1985); Nacheva and Berzal-Herranz, Eur. J. Biochem., 270:1485-65 (2003)).
The conventional method of integration of polyA/T stretches into a DNA template is by molecular cloning. However polyA/T sequence integrated into plasmid DNA can cause plasmid instability, which is why plasmid DNA templates obtained from bacterial cells are often highly contaminated with deletions and other aberrations. This makes cloning procedures not only laborious and time consuming but often not reliable. That is why a method which allows construction of DNA templates with polyA/T 3′ stretch without cloning highly desirable.
The poly A/T segment of the transcriptional DNA template can be produced during PCR by using a reverse primer containing a polyT tail, such as 100T tail (size can be 50-5000 T), or after PCR by any other method, including, but not limited to, DNA ligation or in vitro recombination. Poly(A) tails also provide stability to RNAs and reduce their degradation. Generally, the length of a poly(A) tail positively correlates with the stability of the transcribed RNA. In certain embodiments, the poly(A) tail is between 100 and 5000 adenosines.
Poly(A) tails of RNAs can be further extended following in vitro transcription with the use of a poly(A) polymerase, such as E. coli polyA polymerase (E-PAP). In certain embodiments, increasing the length of a poly(A) tail from 100 nucleotides to between 300 and 400 nucleotides results in about a two-fold increase in the translation efficiency of the RNA. Additionally, the attachment of different chemical groups to the 3′ end can increase mRNA stability. Such attachment can contain modified/artificial nucleotides, aptamers and other compounds. For example, ATP analogs can be incorporated into the poly(A) tail using poly(A) polymerase. ATP analogs can further increase the stability of the RNA.
5′ caps also provide stability to RNA molecules. In a preferred embodiment, RNAs produced by the methods disclosed herein include a 5′ cap. The 5′ cap is provided using techniques known in the art and described herein (Cougot, et al., Trends in Biochem. Sci., 29:436-444 (2001); Stepinski, et al., RNA, 7:1468-95 (2001); Elango, et al., Biochim. Biophys. Res. Commun., 330:958-966 (2005)).
The RNAs produced by the methods disclosed herein can also contain an internal ribosome entry site (IRES) sequence. The IRES sequence may be any viral, chromosomal or artificially designed sequence which initiates cap-independent ribosome binding to mRNA and facilitates the initiation of translation. Any solutes suitable for cell electroporation, which can contain factors facilitating cellular permeability and viability such as sugars, peptides, lipids, proteins, antioxidants, and surfactants can be included.
In some embodiments, the RNA is electroporated into the cells, such as in vitro transcribed RNA.
The methods also provide the ability to control the level of expression over a wide range by changing, for example, the promoter or the amount of input RNA, making it possible to individually regulate the expression level. Furthermore, the PCR-based technique of mRNA production greatly facilitates the design of the mRNAs with different structures and combination of their domains.
One advantage of RNA transfection methods of the present disclosure is that RNA transfection is essentially transient and vector-free. A RNA transgene can be delivered to a lymphocyte and expressed therein following a brief in vitro cell activation, as a minimal expressing cassette without the need for any additional viral sequences. Under these conditions, integration of the transgene into the host cell genome is unlikely. Cloning of cells is not necessary because of the efficiency of transfection of the RNA and its ability to uniformly modify the entire lymphocyte population.
Genetic modification of cells with in vitro-transcribed RNA (IVT-RNA) makes use of two different strategies both of which have been successively tested in various animal models. Cells are transfected with in vitro-transcribed RNA by means of lipofection or electroporation. It is desirable to stabilize IVT-RNA using various modifications in order to achieve prolonged expression of transferred IVT-RNA.
Some IVT vectors are known in the literature which are utilized in a standardized manner as template for in vitro transcription and which have been genetically modified in such a way that stabilized RNA transcripts are produced. Currently protocols used in the art are based on a plasmid vector with the following structure: a 5′ RNA polymerase promoter enabling RNA transcription, followed by a gene of interest which is flanked either 3′ and/or 5′ by untranslated regions (UTR), and a 3′ polyadenyl cassette containing 50-70 A nucleotides. Prior to in vitro transcription, the circular plasmid is linearized downstream of the polyadenyl cassette by type II restriction enzymes (recognition sequence corresponds to cleavage site). The polyadenyl cassette thus corresponds to the later poly(A) sequence in the transcript. As a result of this procedure, some nucleotides remain as part of the enzyme cleavage site after linearization and extend or mask the poly(A) sequence at the 3′ end. It is not clear, whether this nonphysiological overhang affects the amount of protein produced intracellularly from such a construct.
RNA has several advantages over more traditional plasmid or viral approaches. Gene expression from an RNA source does not require transcription and the protein product is produced rapidly after the transfection. Further, since the RNA has to only gain access to the cytoplasm, rather than the nucleus, and therefore typical transfection methods result in an extremely high rate of transfection. In addition, plasmid based approaches require that the promoter driving the expression of the gene of interest be active in the cells under study.
In another aspect, the RNA construct is delivered into the cells by electroporation. See, e.g., the formulations and methodology of electroporation of nucleic acid constructs into mammalian cells as taught in US 2004/0014645, US 2005/0052630A1, US 2005/0070841A1, US 2004/0059285A1, US 2004/0092907A1. The various parameters including electric field strength required for electroporation of any known cell type are generally known in the relevant research literature as well as numerous patents and applications in the field. See e.g., U.S. Pat. Nos. 6,678,556, 7,171,264, and 7,173,116. Apparatus for therapeutic application of electroporation are available commercially, e.g., the MedPulser™ DNA Electroporation Therapy System (Inovio/Genetronics, San Diego, Calif.), and are described in patents such as U.S. Pat. Nos. 6,567,694; 6,516,223, U.S. Pat. Nos. 5,993,434, 6,181,964, 6,241,701, and 6,233,482; electroporation may also be used for transfection of cells in vitro as described e.g. in US20070128708A1. Electroporation may also be utilized to deliver nucleic acids into cells in vitro. Accordingly, electroporation-mediated administration into cells of nucleic acids including expression constructs utilizing any of the many available devices and electroporation systems known to those of skill in the art presents an exciting new means for delivering an RNA of interest to a target cell.
Pharmaceutical compositions of the present disclosure may comprise an AAV-CRISPR vector or a gene silencing system, as described herein, in combination with one or more pharmaceutically or physiologically acceptable carriers, diluents or excipients. Also provided are pharmaceutical compositions comprising an engineered immune cell of the present disclosure.
Compositions of the present disclosure may comprise buffers such as neutral buffered saline, phosphate buffered saline and the like; carbohydrates such as glucose, mannose, sucrose or dextrans, mannitol; proteins; polypeptides or amino acids such as glycine; antioxidants; chelating agents such as EDTA or glutathione; adjuvants (e.g., aluminum hydroxide); and preservatives. Compositions of the present disclosure are preferably formulated for intravenous administration.
Pharmaceutical compositions of the present disclosure may be administered in a manner appropriate to the disease to be treated (or prevented). The quantity and frequency of administration will be determined by such factors as the condition of the patient, and the type and severity of the patient's disease, although appropriate dosages may be determined by clinical trials.
The administration of the composition of the present disclosure may be carried out in any convenient manner known to those of skill in the art. The composition of the present disclosure may be administered to a subject by aerosol inhalation, injection, ingestion, transfusion, implantation or transplantation. The compositions described herein may be administered to a patient transarterially, subcutaneously, intradermally, intratumorally, intranodally, intramedullarly, intracystically intramuscularly, by intravenous (i.v.) injection, parenterally or intraperitoneally. In other instances, the composition of the present disclosure are injected directly into a site of inflammation in the subject, a local disease site in the subject, a lymph node, an organ, a tumor, and the like.
It should be understood that the methods and compositions that would be useful in the present disclosure are not limited to the particular formulations set forth in the examples. The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how to make and use the cells, expansion and culture methods, and therapeutic methods of the present disclosure, and are not intended to limit the scope of what the inventors regard as their disclosure.
The practice of the present disclosure employs, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry and immunology, which are well within the purview of the skilled artisan. Such techniques are explained fully in the literature, such as, “Molecular Cloning: A Laboratory Manual”, fourth edition (Sambrook, 2012); “Oligonucleotide Synthesis” (Gait, 1984); “Culture of Animal Cells” (Freshney, 2010); “Methods in Enzymology” “Handbook of Experimental Immunology” (Weir, 1997); “Gene Transfer Vectors for Mammalian Cells” (Miller and Calos, 1987); “Short Protocols in Molecular Biology” (Ausubel, 2002); “Polymerase Chain Reaction: Principles, Applications and Troubleshooting”, (Babar, 2011); “Current Protocols in Immunology” (Coligan, 2002). These techniques are applicable to the production of the polynucleotides and polypeptides of the present disclosure, and, as such, may be considered in making and practicing the present disclosure. Particularly useful techniques for particular embodiments will be discussed in the sections that follow.
The present disclosure is now described with reference to the following Examples. These Examples are provided for the purpose of illustration only, and the present disclosure is not limited to these Examples, but rather encompasses all variations that are evident as a result of the teachings provided herein.
The materials and methods employed in these experiments are now described.
Cell lines. E0771 cell was from CH3. Hepa1-6, MC38, Colon26, B16F10, Pan02 were from ATCC. HEK293FT cell was purchased from Thermo Fisher Scientific for producing virus. All cell lines were maintained at 37C with 5% CO2 in D10 medium (Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum).
Mice. Mice of both sexes, between age 6 and 12 weeks, were used for the study. 6-8-week-old C57BL/6Nr mice were purchase from Charles River lab. Female mice were used for breast cancer (E0771) models. Male mice were used for B16F10 and Pan02 mouse model. 6-8-week-old BALB/C mice were purchased from Jackson lab. All animals were housed in standard, individually ventilated, pathogen-free conditions, with a 12 h: 12 h or a 13 h: 11 h light cycle, at room temperature (21-23° C.) and 40-60% relative humidity.
Cas13d cancer cell line generation. For lentivirus production, 20 ug plasmid of PXR001 (EF1a-Cas13d-2A-EGFP, addgene #109049) together with 10 μg pMD2.G and 15 μg psPAX2 were co-transfected into HEK293FT cells in a 150 mm cell culture dish at 80-90% confluency using 135 μl LipoD293 transfection reagent (Signage, SL100668). Virus supernatant was collected 48h post transfection, centrifuged at 3000 g for 15 min to remove the cell debris. The supernatant was then concentrated with Amicon Ultra-15 filter from 20 ml to 2 ml. The virus was aliquoted and stored at −80 C. To generate Cas13d overexpression cell line, the cancer cells were transduced with lentivirus PXR001, and the positive cells which were GFP expressing were flow cytometry sorted.
Transfection and flow cytometry knockdown efficacy test. To test each gRNA knockdown efficacy, gRNAs were cloned into BbsI site of PXR003 plasmid (Cas13d gRNA cloning backbone, addgene #109053) and were transient transfected into Cas13d expressing cancer cell. For the transfection experiments, 5×104 cells per well of a 48 well plate was seeded 12h before transfection. 500 ng gRNA plasmid together with a 1:1 ratio of Lipofectamine 2000 to DNA were transfected into cells. Flow cytometry was performed at 48h post transfection.
Generation of AAV-MUCIG library. An AAV version plasmid expressing U6-mutation direct repeat-gRNA clone site-EFS-Cas13d (pAAV-U6-EFS-Cas13d) was cloned into AAV backbone. All pooled gRNA library were synthesized as single stranded oligonucleotides from Genescript or IDT. The oligos were amplified by PCR and Gibson cloned into pAAV-U6-EFS-Cas13d. The purification and electroporation of Gibson products into Endura electrocompetent cells were performed as previously described, with at least ×100 coverage of colonies represented per sgRNAs. AAV was produced by co-transfecting HEK293FT cells with AAV-MUCIG library together with AAV9 serotype plasmid and helper plasmid PDF6. Briefly, HEK293FT cells were seeded in 150 cm dish or hyper flask 12-18h before transfection. When cells got 80-90% confluency, 6.2 ug AAV-vector or AAV-MUCIG library, 8.7 ug AAV9 serotype, and 10.4 ug PDF6 were transfected with 130 μl PEI, incubating 10-15 min before adding into cells. Replicates collected multiple dishes were pooled to enhance production yield. Cells were collected 72 h post transfection. For AAV purification, chloroform (1:10 by volume) was added and was shaken vigorously for 1 h at 37° C. NaCl was added to a final concentration of IM and shaken until dissolved. The mixture was centrifuges at 20,000 g for 15 min at 4 C. The aqueous layer was transferred to a new tube, and then PEG 8000 (10%, w/v) was added and shaken until dissolved. The mixture was incubated on ice for 1 h. The pellet was spun down at 20,000 g for 15 min at 4° C. The supernatant was discarded, and the pellet was resuspended in DPBS. The resuspension was treated with Benzonase and MgCl2 AT 37 C for 30 min. Chloroform (1:1 by volume) was then added, shaken and spun down at 12,000 g for 15 min at 4° C. The aqueous layer was isolated and concentrated through Ambion Ultra-15 tube. The concentrated solution was washed with PBS and the filtration process repeated. Then AAV was treated with DNase I for 30 min at 37° C. Genomic copy number (GC) of AAV was determined by real-time qPCR using custom TaqMan assays (Thermo Fisher Scientific) targeted to EFS promoter.
Therapeutic testing of AAV-g-MUCIG in syngeneic tumor models. Syngeneic orthotopic breast tumor was established by transplanting 2×106 E0771 cells into mammary fat pad of 6-8-week-old female C57BL/6Nr mice. Then 5, 9, and 14 days after transplantation, 2e11 AAV particles of vector or MUCIG, or PBS were injected intratumorally into tumor bearing mice. The tumor volume was measured every 3-4 days. For the B16F10 melanoma model, 1×106 B16F10 cancer cells were subcutaneously injected into the male left flank of C57BL/6Nr mice. 5, 9, 13 days post transplantation, 2×1011 AAV particles of vector or MUCIG, or PBS were intratumorally administrated into tumor bearing mice. The tumor volume was measured every 2 days. For the pancreatic tumor model, 2×106 Pan02 cells were subcutaneously injected into the left flank of C57BL/6Nr mice. Then, 5, 14, 18 days after transplantation, 2e11 AAV particles of vector or MUCIG, or PBS were intratumorally administrated into tumor bearing mice. The tumor volume was measured every 3-4 days. For the colon tumor model, 2×106 CT26 cells were subcutaneously injected into the left flank of BALB/C mice. Then, 5, 9, 14 days after transplantation, 2e11 AAV particles of vector or MUCIG, or PBS were intratumorally administrated into tumor bearing mice. The tumor volume was measured every 3 days. Tumor volume was calculated with the formula: volume =π/6*xyz. Two-way ANOVA was used to compare growth curves between treatment groups.
In vivo luciferase imaging. The bioluminescent imaging was performed to detect AAV delivery gene expression. Mice were injected with luciferin (150 mg/kg) by intraperitoneal injection and activity quantified in live animal for 10 min later following with 1 min exposure. The photon flux was monitored by the PE IVIS Spectrum in vivo imaging system. The signaling was monitored and quantified by the IVIS software.
Isolation of TILs. Tumors were minced into 1 mm size pieces and then digested with 100U/ml collagenase IV and DNase I for 60 min at 37° C. Tumor suspensions were filtered through 100-μm cell strainer to remove large bulk masses. The cells were washed twice with wash buffer (PBS plus 2% FBS). 1 ml ACK lysis buffer was added to lysis red blood cell by incubating 2-5 min at room temperature. The suspension was then diluted with wash buffer and spin down at 400 g for 5 min at 4° C. Cell pellet was resuspended with wash buffer and followed by passing through a 40 μm cell strainer. Cells were spin down and washed twice with wash buffer. At last, cell pellet was resuspended in MACS buffer (PBS with 0.5% BSA and 2 mM EDTA). The single cell suspensions were used for flow cytometry staining and FACS sorting. TILs were labeled as Cd45 positive cells.
Flow cytometry. For the TILs FACS analysis, single cell suspension from tumor were prepared as described above. For the myeloid cell staining panel, anti-CD45-Percp-Cy5.5, anti-CD11b-FITC, anti-CD11c-PE/Dazzle, anti-F4/80-PE, anti-Ly6G-BV605, anti-Ly6C-APC, and anti-MHCII-PE/Cy7 were used. For lymphoid cell staining panel, anti-CD45-Percp-Cy5.5, anti-CD8-BV605, anti-CD4-PE. All flow antibodies were used at 1:100 dilutions for staining. The LIVE/DEAD Near-IR was diluted 1:1000 to distinguish live or dead cells.
For the in vitro cancer cell line staining, cancer cells were incubated with trypsin and washed twice with PBS. For cell surface staining, surface antibody was diluted 1:100 and stained in MACS buffer on ice for 15 min. Cells were washed twice with MACS buffer. For intracellular staining, Intracellular Fixation & Permeabilization Buffer Set (eBioscience) was used to fix and permeabilize cells. Briefly, after the surface marker staining, cells were resuspended in 100 μl Fixation/Permeabilization working solution, and incubated on ice for 15 min. Then cells were washed with 1× permeabilization buffer by centrifugation at 600 g for 5 min. Then the cell pellet was resuspended in 100 μl of 1× permeabilization buffer with 1:100 intracellular staining antibodies and incubating on ice for 15 min. After staining, cells were centrifuged at 600 g for 5 min, and washed twice with staining buffer before being analyzed or sorted on a BD FACSAria. The data were analyzed using FlowJo software.
Immune cell profiling by scRNA-seq. E0771 or CT26 tumors were collected at the indicated time point post injection. Single cell suspensions were collected as described above. The cells were labeled with Cd45-Percp-Cy5.5 antibody and live/dead dye. FACS sorted cells were gated on CD45+ live cells. Sorted cells were washed with PBS, and cell numbers and viabilities were assessed by trypan blue staining. The 10,000 CD45+ cells isolated from tumors were used for scRNA-seq library prep by following the protocol from 10× Genomics Chromium Next GEM Single Cell 5′ Reagent Kits V2.
scRNA-seq data analysis. Analysis of scRNA-seq was performed using the Seurat v4 package in R. All cells from the three treatment groups (PBS, AAV-Vector, and AAV-PGGC) were merged and integrated by tumor type (E0771 or CT26). The data was filtered to retain cells with <15% mitochondrial counts and 200-3500 unique expressed features. The expression data for each cell was normalized by the total reads and log-transformed. Harmony was utilized to integrate datasets from the same tumor type for the purpose of identifying cell clusters. Each cell cluster was annotated by cell type using canonical marker genes, with higher-resolution subclustering of the lymphocyte populations. To determine differences in cell type frequencies, 2×2 contingency tables were constructed for each cell type, comparing AAV-Vector and AAV-PGGC treatment groups. A two-tailed Fisher's exact test was performed on the contingency table for each cell type. Differentially expressed genes were identified by comparing cells from AAV-Vector vs AAV-PGGC treatment groups using the default settings in Seurat, with statistical significance set at adjusted p<0.05.
Statistical analysis. Data analysis was performed using GraphPad Prism v.9 and R 3.5. The unpaired, two-sided, unpaired/test was used to compare two groups unless indicated otherwise. Two-way ANOVA was used to compare multiple groups in the tumor growth curves with two independent variables. P<0.05 was considered statistically significant.
To assess the efficiency of Cas13d-mediated RNA knockdown, a Hepa1-6 tumor cell line was established which stably expressed Cas13d-GFP. gRNAs were then transfected into the cells, and FACS analysis of gene expression was performed 2 days after transfection (
A computational model to predict Cas13d gRNAs was recently developed (H. H. Wessels et al., Nat Biotechnol 38, 722-727 (2020)). To further improve the Cas13d gRNA design for immune genes, this design tool was applied to design 4 to 5 gRNAs for 4 different immunosuppressive genes of interest: (′d47, Galectin-3, Cd66a, and (d200 (Table 1) To assess the efficiency of these tool-designed gRNAs, an all-in-one vector was generated including gRNA, Cas13d and selection marker EGFP (
G
AAATCCTTTGTCCAGACTCTG
TTTTTG
CTCGA
GAAATCCTTTGTCCAGACTCTG
CC
G
TAGTGAAGGTGTACTATGGGC
TTTTTG
CTCGAG
TAGTGAAGGTGTACTATGGGCC
C
G
TACATGAAATTGCACAGTCGC
TTTTTG
CTCGAG
TACATGAAATTGCACAGTCGC
CC
G
TTCAGCGTTTGTAGACACAGG
TTTTTG
CTCGAG
TTCAGCGTTTGTAGACACAGG
CC
CTCGAG
TTTCCCTTGTACCAAGCAAAG
CC
G
ATGATTGTGATCAGCATGCGG
TTTTTG
CTCGAG
ATGATTGTGATCAGCATGCGG
CC
G
ATATACGATTTGTTCAACTTC
TTTTTG
CTCGAG
ATATACGATTTGTTCAACTTC
CC
G
GATTAAGTCTGAGACTGAGAT
TTTTTG
TCGAG
GATTAAGTCTGAGACTGAGAT
CC
Recently, Cas13d was reported to have collateral activity in human cells. It was reported that when targeting the transfected DsRed in HEK cells, the co-transfected reporter gene GFP would be markedly down-regulated. However, when targeting the endogenous RNAs, the extent of collateral activity could be influenced by the abundance of the target RNA. To test how strong the collateral activity when targeting the endogenous immunosuppressive genes, a GFP and mCherry dual reporter system was generated that would indicate the collateral activity of Cas13d (
Given that gene knockdown is not complete by Cas13d, the natural question is whether such degree of knockdown can lead to effective immune modulation, and thereby anti-tumor immunity, in vivo. Adeno-associated virus (AAVs) is one of the leading vehicles for transgene delivery. To evaluate the feasibility of in vivo Cas13d and gRNA intratumoral delivery, studies first generated an AAV vector expressing firefly luciferase and GFP (AAV-Luci-GFP). AAV-Luci-GFP was intratumorally injected into E0771 tumor-bearing mice and analyzed for luciferase activity by in vivo bioluminescent imaging (
Having evaluated the feasibility of the Cas13d gRNA knockdown system, studies next sought to investigate whether silencing multiple immunosuppressive genes in the TME via AAV delivery of Cas13d and gRNAs could function as a combinatorial immunotherapy. This approach was termed MUCIG (Multiplex Universal Combinatorial Immunotherapy via Gene silencing). First, libraries of different scales were designed which target combinations of immunosuppressive genes (
To facilitate direct delivery of these libraries into tumors, an all-in-one AAV vector was designed (AAV-U6-gRNAs-EFS-Cas13d) (
While two of the AAV-MUCIG libraries had evidence of anti-tumor responses, it was reasoned that further optimization of the library might increase treatment efficacy by reducing the proportion of therapeutically neutral or detrimental gRNAs that are delivered to the tumor. To further refine the MUCIG-lib4 library, protein-level expression of the genes targeted in MUCIG-Lib4 was assessed across a panel of syngeneic cancer cell lines that represent various tumor types. As interest was primarily in assessing tumor-derived factors, the genes that are primarily expressed in non-tumor cells were excluded, such as the T cell checkpoints Pdcd1, Lag3, and Haver2. In addition to the genes targeted in Lib4, these studies also tested other known immunosuppressive genes, such as Tgf-8. Through a combined evaluation of both surface and intracellular expression, 4 genes were pinpointed (Pd-LI Cd247, Cd47, Galectin9 Lgals9, and Galectin3 Lgals3) that were highly expressed at the protein-level across different cancer cell lines (
A gRNA composition was then designed which targeted these four genes as a rational and simplified version of MUCIG (named PGGC). The AAV-PGGC pool was then delivered into E0771 tumor-bearing mice by intratumoral injection (
To assess whether these effects were more broadly applicable to other tumor models, the anti-tumor effect of AAV-PGGC was similarly evaluated in three representative models with different levels of responsiveness to immune checkpoint blockade antibody therapeutics, including B16F10 melanoma (resistant) (
Without wishing to be bound by theory, it was hypothesized that the therapeutic efficacy of AAV-PGGC was based on its modulatory effect on the immune composition of the TME. By FACS analysis, studies then profiled tumor-infiltrating lymphoid and myeloid cell populations in mice that received either PBS, AAV-vector, or AAV-PGGC treatment in two different syngeneic tumor models (E0771 and Colon26) (
To systematically investigate the effect of AAV-PGGC treatment on the immune cell populations and their transcriptomics in the TME, single-cell RNA-seq (scRNA-seq) of tumor-infiltrating immune cells was performed in mice treated with PBS, AAV-Vector, or AAV-PGGC (
These studies subsequently identified differentially expressed genes in the cell types whose abundances were most affected by AAV-PGGC, including CD8+ T cells, neutrophils and macrophages. Many genes associated with key immunosuppressive functions were found to be downregulated across both E0771 and CT26 models, including Arg2, Il1b, Trem1, S100a8, S100a9, Tigit, and Cd37 (
Given the increase of CD8+ T cells and reduction of neutrophils in the tumor microenvironment after AAV-PGGC treatment, studies next tested how these two cell populations influence the therapeutic efficacy of AAV-PGGC. CD8+ T cell or MDSC/neutrophils depletion was performed by in vivo injection of anti-CD8 or anti-GR1 antibody, respectively (
Subsequent studies next sought to determine whether the local AAV-PGGC treatment induced anti-tumor effect could extend to distant tumor site. A dual-sites E0771 tumor model was utilized to evaluate the systemic anti-tumor effect of AAV-PGGC against both the injected and non-injected distant sites (
Without wishing to be bound by theory, it was hypothesized that AAV-PGGC could have a therapeutic effect on metastatic cancer in internal organs. To investigate this possibility, a tumor model was used which comprised the injection of E0771 cells into the fat pad to develop an orthotopic tumor burden, and intravenous injection of luciferase-expressing E0771 to model lung metastatic tumor burden (
Because AAV-PGGC in combination with anti-GRI antibody had synergistic anti-tumor activity, subsequent studies examined whether the combined treatment could have stronger efficacy against metastases. Again the orthoptic injection of primary tumor and intravenous injection to model lung metastasis (
The TME is enriched with immunosuppressive factors that can be derived from tumor cells, tumor-associated fibroblasts or the infiltrating immunosuppressive cells. Immunosuppressive factors produced by immunosuppressive cells can either inhibit effective anti-tumor immunity by their immune checkpoint function, or attract and recruit immature immune cells and induce their differentiation into immune suppressive cells, such as MDSCs, M2 macrophages, or regulatory T cells (Tregs). They can also influence T cell access to the tumor core or inhibit T cell activation and proliferation. Tumor immunosuppressive factors are a prime target for therapeutic intervention, as they enable tumor cells to escape elimination by the immune system. A number of preclinical studies have demonstrated that neutralization of immunosuppressive factors can in certain embodiments reverse the immunosuppressive TME and promote antitumor immunity.
Various strategies have been developed to repress such genes or their activity, including siRNAs, antisense oligos, antagonistic antibodies, and small molecule inhibitors. However, the efficacy of monotherapies targeting immunosuppressive factors is limited to only a subset of patients, prompting the present efforts to explore efficient approaches for combinatorial immunotherapy. In certain embodiments, cancer gene therapy, such as local tumor overexpression of OX40L or other combinational cytokines, has the potential to promote tumor regression. However, because the payloads for transgene overexpression are often sizable, it is difficult to multiplex a large number of transgenes expressing immunostimulatory factors as a combinatorial therapy. Herein, the studies of the present disclosure take the converse approach by simultaneously repressing multiple immunosuppressive genes directly in the TME. The present disclosure leverages the modularity of the CRISPR/Cas13d system to devise multiple combinatorial immunotherapies, demonstrating the anti-tumor efficacy of several different libraries of varying complexity. Because multiplexing gRNAs is simple, it is readily feasible to generate and pool gRNA libraries that target a large number of immunosuppressive genes.
Because the relative abundance of each gRNA will influence its silencing efficiency, optimizing the size of the library is crucial for MUCIG therapy. Thus, the studies disclosed herein rationally refined the library composition and tested five different compositions of libraries at different scales. These studies demonstrated that a simple AAV-PGGC combination therapy against four immune checkpoints, PD-L1, CD47, Galectin-3, and Galectin-9, had significant antitumor activity in several different tumor models, including breast cancer (E0771), melanoma (B16F10), pancreatic cancer (Pan02), and colon cancer (CT26). These results suggest that the concept of MUCIG is not limited to a single tumor type and can potentially be broadly applicable. To understand the mechanisms of action behind the anti-tumor efficacy, the studies disclosed herein investigated the TME change upon AAV-PGGC treatment by FACS and scRNA-seq. It was found that AAV-PGGC therapy enhanced CD8+ T cell infiltration and reduced MDSC abundances. On the transcriptional level, consistent down-regulation of multiple immunosuppressive genes was observed in two different cancer models, and a concordant reduction in the neutrophil chemoattractants Cxcl1 and Cxcl2. These data suggested that AAV-PGGC therapy can attenuate the immunosuppressive TME, thereby enhancing antitumor immune responses.
Key challenges with tumor gene therapy include on-target-specificity and gene delivery efficiency. Cas13d binds and cleaves single-strand RNA, thus avoiding safety concerns stemming from unintended DNA damage caused by Cas9 or Cas12a. In addition, Cas13d is more compact compared to Cas9, Cas12a, and many other Cas13 family members, conferring a key advantage for viral vector delivery. Herein, AAVs were utilized to deliver the Cas13d-gRNA payload into tumors, as AAVs can efficiently deliver foreign genetic materials in vivo with minimal toxicity. Indeed, persistent exogenous gene expression was observed herein up to two weeks after the final intratumoral injection of AAV. While the diversity of immunosuppressive pathways that are engaged across different tumors poses an important challenge for off-the-shelf usage, the MUCIG approach, with the versatility of targeting virtually any reasonable combinations of genes using CRISPR-Cas13d and gRNA pools, offers far greater flexibility and modularity compared to conventional antagonistic antibodies or small molecules. By further customizing the cocktail of immunosuppressive factors that is targeted by MUCIG, or by utilizing more specific delivery vehicles, the therapeutic window can be optimized to minimize off-tumor toxicity while maintaining anti-tumor efficacy.
In summary, the studies presented herein provide a demonstration of MUCIG, a versatile strategy for combinatorial cancer immunotherapy by multiplexed targeting of the immunosuppressive gene collections. By simultaneously unraveling multiple facets of the immunosuppressive TME, MUCIG is able to drive customized anti-tumor immune responses.
The following enumerated embodiments are provided, the numbering of which should not be construed as designating levels of importance.
Embodiment 1. A method of enhancing an immune response in a subject in need thereof, the method comprising administering to the subject an effective amount of a gene silencing system, wherein the gene silencing system decreases expression of at least one endogenous immunosuppressive gene in a target cell, thereby enhancing the immune response.
Embodiment 2. A method of enhancing an anti-tumor immune response in a subject in need thereof, the method comprising administering to the subject an effective amount of a gene silencing system, wherein the gene silencing system decreases expression of at least one endogenous immunosuppressive gene in a target cell, thereby enhancing the anti-tumor immune response.
Embodiment 3. The method of any one of Embodiments 1-2, wherein the gene silencing system is a CRISPR-based gene silencing system which comprises a plurality of AAV-CRISPR vectors, wherein the plurality of AAV-CRISPR vectors comprises a Cas nuclease and a plurality of guide RNAs (gRNAs) homologous to mRNA from a plurality of target genes associated with immune suppression.
Embodiment 4. The method of Embodiment 3, wherein the gRNA sequences comprise at least one nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1-1657.
Embodiment 5. The method of Embodiment 3, wherein the plurality of gRNAs comprise the nucleotide sequences consisting of SEQ ID NOs: 1-1657.
Embodiment 6. The method of Embodiment 3, wherein the gRNA sequences comprise at least one nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1-92.
Embodiment 7. The method of Embodiment 3, wherein the plurality of gRNAs comprise the nucleotide sequences consisting of SEQ ID NOs: 1-92.
Embodiment 8. The method of Embodiment 3, wherein the target genes are selected from the group consisting of Pdl1, Galectin9, Galectin3, and Cd47, or any combination thereof.
Embodiment 9. The method of Embodiment 3, wherein the CRISPR-based gene silencing system is selected from the group consisting of a type III (Cmr/Csm) system, a type VI system, and a type II system.
Embodiment 10. The method of Embodiment 9, wherein the type VI system comprises a Cas13 nuclease.
Embodiment 11. The method of Embodiment 3, wherein the Cas nuclease is a Cas13 nuclease.
Embodiment 12. The method of Embodiment 11, wherein the Cas13 nuclease is selected from the group consisting of Cas13a, Cas13b, Cas13c, and Cas13d.
Embodiment 13. The method of Embodiment 11, wherein the Cas13 nuclease is Cas13d.
Embodiment 14. The method of any one of Embodiments 1-2, wherein the target cell is an immune cell.
Embodiment 15. The method of any one of Embodiments 1-2, wherein the target cell is a T cell.
Embodiment 16. The method of Embodiment 2, wherein the target cell is a tumor cell.
Embodiment 17. The method of Embodiment 2, wherein the target cell is a immune cell and a tumor cell.
Embodiment 18. The method of any one of Embodiments 1-2, wherein the gene silencing system comprises an RNA interference (RNAi) system.
Embodiment 19. The method of Embodiment 18, wherein the RNAi system is selected from a shRNA-based system, an siRNA-based system, and a miRNA-based system.
Embodiment 20. The method of Embodiment 18, wherein the RNAi system targets an endogenous RNA sequence comprising the nucleic acid sequence set forth in SEQ ID NOs: 1658-1665.
Embodiment 21. The method of Embodiment 18, wherein the RNAi system targets a gene selected from the group consisting of CD200, CD66, Galectin 3, CD47, or any combination thereof.
Embodiment 22. The method of Embodiment 18, wherein the RNAi system is an shRNA system.
Embodiment 23. The method of Embodiment 22, wherein the shRNA system comprises at least one nucleic acid selected from the group consisting of SEQ ID NO: 1666-1681.
Embodiment 24. The method of Embodiment 3, wherein the AAV-CRISPR vector is selected from the group consisting of AAV1, AAV2, AAV3, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV12, AAV-B1, AAV-DJ, AAV-Retro, AAVrh8, AAVrh10, AAVrh25, Anc80L65, LK03, AAVrh18, AAVrh74, AAVrh32.33, AAVrh39, AAVrh43, Oligo001, PHP-B, and Spark100.
Embodiment 25. The method of Embodiment 3, wherein the AAV-CRISPR vector is AAV9.
Embodiment 26. The method of any one of Embodiments 1-2, wherein administering the effective amount of the gene silencing system comprises a one dose, a two dose, a three dose, a four dose, or a multi-dose treatment.
Embodiment 27. The method of Embodiment 2, wherein the tumor is a cancer selected from the group consisting of breast cancer, lung cancer, pancreatic cancer, melanoma, glioma, hepatoma, colon cancer, and brain cancer.
Embodiment 28. The method of Embodiment 2, wherein the administration of the gene silencing system results in increased CD8+ T cell infiltration into the tumor.
Embodiment 29. The method of Embodiment 2, wherein the gene silencing system is administered intratumoraly.
Embodiment 30. The method of Embodiment 2, further comprising administering an additional anti-tumor treatment.
Embodiment 31. The method of Embodiment 30, wherein the additional anti-tumor treatment is selected from the group consisting of chemotherapy, radiation, surgery, an immune checkpoint inhibitor, and an immune checkpoint blockade antibody.
Embodiment 32. The method of any one of Embodiments 1-2, wherein the subject is a mammal.
Embodiment 33. The method of any one of Embodiments 1-2, wherein the subject is a human.
Embodiment 34. A vector comprising an adeno-associated virus (AAV) genome, a U6 promoter sequence, a gRNA sequence, an EFS promoter sequence, and a Cas nuclease gene.
Embodiment 35. The vector of Embodiment 34, wherein the gRNA sequence comprises at least one nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1-1657.
Embodiment 36. The vector of Embodiment 34, wherein the Cas nuclease is a RNA-targeting nuclease.
Embodiment 37. The vector of Embodiment 34, wherein the Cas nuclease is a Cas13 nuclease.
Embodiment 38. The vector of Embodiment 37, wherein the Cas13 nuclease is selected from the group consisting of Cas13a, Cas13b, Cas13c, and Cas13d.
Embodiment 39. The vector of Embodiment 37, wherein the Cas13 nuclease is Cas13d.
Embodiment 40. A composition comprising a gRNA library, wherein the gRNA library comprises a plurality of gRNAs that target a plurality of immunosuppressive genes in a cell.
Embodiment 41. The composition of Embodiment 40, wherein the plurality of gRNAs comprise at least one gRNA selected from the group consisting of SEQ ID NOs: 1-1657.
Embodiment 42. The composition of Embodiment 40, wherein the plurality of gRNAs comprise the nucleic acid sequences of SEQ ID NOs: 1-1657.
Embodiment 43. The composition of Embodiment 40, wherein the plurality of gRNAs comprise the nucleic acid sequences of SEQ ID NOs: 3-92.
Embodiment 44. The composition of Embodiment 40, wherein the plurality of gRNAs comprise the nucleic acid sequences of SEQ ID NOs: 93-1657.
Embodiment 45. The composition of Embodiment 40, wherein the gRNA library is packaged into an AAV vector.
The recitation of a listing of elements in any definition of a variable herein includes definitions of that variable as any single element or combination (or subcombination) of listed elements. The recitation of an embodiment herein includes that embodiment as any single embodiment or in combination with any other embodiments or portions thereof.
The disclosures of each and every patent, patent application, and publication cited herein are hereby incorporated herein by reference in their entirety. While the present disclosure has been disclosed with reference to specific embodiments, it is apparent that other embodiments and variations of the present disclosure may be devised by others skilled in the art without departing from the true spirit and scope of the present disclosure. The appended claims are intended to be construed to include all such embodiments and equivalent variations.
The present application claims priority under 35 U.S.C. § 119(e) to U.S. Provisional Patent Application No. 63/312,730, filed Feb. 22, 2022, which is hereby incorporated by reference in its entirety herein.
This invention was made with government support under CA238295, CA231112 and CA225498 awarded by the National Institutes of Health and under W81XWH-20-1-0072 awarded by the United States Army. The government has certain rights in the invention.
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/US2023/062809 | 2/17/2023 | WO |
| Number | Date | Country | |
|---|---|---|---|
| 63312730 | Feb 2022 | US |
