Patent Application
20240229027
The present invention relates to the fields of molecular biology and medicine. Specifically, the present invention relates to a nucleic acid molecule that can treat diseases, a delivery system and use thereof in disease treatment.
RNA interference (RNAi) therapy has been considered a promising strategy to treat human diseases since its invention. However, it has faced numerous issues during clinical practice, and the progress of the therapy's development has fallen short of expectations.
It is generally believed that RNA cannot remain stable outside the cell for a long time, because RNA will be degraded into fragments due to the abundance of RNase in the extracellular environment. It is therefore crucial to find a method that can stabilize RNA outside the cell and enable it to enter targeted tissues, thereby enhancing the effect of RNAi therapy.
There are currently many studies concerning siRNA, mainly focusing on the following aspects: 1. Designing siRNA with therapeutic effects. 2. Chemically modifying siRNA in order to enhance its stability in vivo and increase the yield. 3. Designing various artificial carriers, including lipid nanoparticles, cationic polymers and plasmids, to improve the efficiency of siRNA delivery in vivo. Among them, there are a number of patents regarding the third aspect. The primary cause for this is that researchers have realized the absence of suitable siRNA delivery systems for safely, accurately and efficiently deliver siRNA to target tissues. This challenge has become the fundamental limitation of RNAi therapy.
Chinese patent CN108624590A discloses an siRNA capable of inhibiting the expression of DDR2 gene. Chinese patent CN108624591A discloses an siRNA capable of silencing ARPC4 gene, and the siRNA is modified with α-phosphorus-selenium. Chinese patent CN108546702A discloses an siRNA targeting a long non-coding RNA, DDX11-AS1. Chinese patent CN106177990A discloses an siRNA precursor that can be used for the treatment of various tumors. These patents devise specific siRNAs and target certain diseases caused by genetic mutations.
Chinese patent CN108250267A discloses a polypeptide and a polypeptide-siRNA induced co-assembly, where the polypeptide acts as a carrier of siRNA. Chinese patent CN108117585A discloses a polypeptide to target and to introduce siRNA for promoting apoptosis of breast cancer cells, also utilizing the polypeptide as a carrier of siRNA. Chinese patent CN108096583A discloses a nanoparticle carrier, which can be loaded with siRNA that has curative effect on breast cancer while containing chemotherapeutic drugs. These patents are all inventions on siRNA carriers, whose technical solutions share the common feature of pre-assembling the carrier and siRNA in vitro before introducing them to the host. In fact, this is characteristic for most of the currently designed delivery techniques. However, these delivery systems pose a common issue that such artificially synthesized exogenous delivery system is prone to be cleared by the host's circulatory system, cause immunogenic reactions, and even potentially be toxic to certain cell types and tissues.
The research team of the present invention found that endogenous cells can encapsulate miRNAs into exosomes. Exosomes can deliver miRNA to receptor cells, and the secreted miRNA can effectively block the expression of target genes at a relatively low concentration. Exosomes are biocompatible with the host immune system and possess the inherent ability to protect and transport miRNA across biological barriers in vivo, thereby having the potential to overcome problems associated with siRNA delivery. For example, Chinese patent CN110699382A discloses a method for preparing exosomes delivering siRNA, which involves techniques of isolating exosomes from plasma and encapsulating siRNA into exosomes by electroporation.
However, such techniques for isolating or preparing exosomes in vitro often necessitate obtaining a large amount of exosomes through cell culture, together with the step of siRNA encapsulation, which makes the clinical cost of large-scale application of the product too high for patients to afford. More importantly, the intricate production/purification process of exosomes makes it almost impossible to comply with GMP standards.
So far, medicinal products containing exosomes as active ingredients have not received approval from CFDA. The main challenge lies in ensuring the consistency of exosome products, which results in these products failing to obtain drug production licenses. If this issue can be resolved, it would significantly advance RNAi therapy.
Therefore, the development of a safe, precise and efficient siRNA delivery system is a crucial part to improve the efficacy of RNAi therapy and advance it further.
The present invention provides an effective, safe and convenient method and medicament for assembling RNA that inhibits gene expression in an organ or tissue to form a complex structure and delivering it to a target tissue or its cells to treat diseases as needed.
Specifically, in one aspect of the present invention, an isolated nucleic acid is provided, which comprises a nucleotide sequence encoding an RNA capable of inhibiting gene expression, comprising
(a) a nucleotide sequence encoding one or more RNAs that inhibit gene expression, and the RNA is selected from the group consisting of miRNA, shRNA, siRNA, mRNA, ncRNA, sgRNA, and a combination thereof.
In one embodiment of the present invention, the above-mentioned isolated nucleic acid further comprises: (b) a nucleotide sequence encoding a targeting protein. In one embodiment of the present invention, the targeting protein is a tissue-specific protein.
In one embodiment of the present invention, (a) is a nucleotide sequence encoding an RNA that inhibits gene expression.
In one embodiment of the present invention, (a) is a nucleotide sequence encoding a plurality of RNAs that inhibit gene expression. For example, the plurality of RNAs that inhibit gene expression are 2-4 RNAs that inhibit gene expression
As used herein, “isolated” means that a substance has been separated from its original environment (in the case of a natural substance, the original environment is the natural environment). For example, polynucleotides and polypeptides in their natural state within living cells are not isolated and purified. However, if the same polynucleotide or polypeptide is separated from other substances that exist in its natural state, it is isolated and purified.
In one embodiment of the present invention, the RNA that inhibits gene expression is RNA that inhibits the expression of the following genes: EGFR gene, KRAS gene, VEGFR gene, mTOR gene, TNF-α gene, integrin-α gene, B7 gene, TGF-β1 gene, H2-K gene, H2-D gene, H2-L gene, HLA gene, GDF15 gene, miRNA-21, miRNA-214, TNC gene, PTP1B gene, mHTT gene, Lrrk2 gene, and/or α-synuclein gene.
In one embodiment of the present invention, (a) is siRNA. siRNA, also known as short interfering RNA or silencing RNA, is a type of double-stranded RNA molecule, generally 20-29 base pairs in length, with its double strands extending 2 nucleotides beyond the other end at both ends of the RNA. siRNA is generally produced by simulating the production mechanism of miRNA. Such siRNA can be processed from precursor RNA (Pre-RNA). Precursor RNA can be folded into a stable stem-loop (hairpin) structure, and the length of the stem-loop structure is generally between 50-100 bp. The stem of a stem-loop structure contains two substantially complementary sequences on either side.
The siRNA can be substantially complementary to at least a portion of the sequence of the mRNA encoding the gene. “Substantially complementary” means that the sequences of the nucleotides are sufficiently complementary to interact in a predictable manner, such as to form secondary structure. Generally, at least 70% of the nucleotides in two “substantially complementary” nucleotide sequences are complementary to each other; preferably, at least 80% of the nucleotides are complementary; more preferably, at least 90% of the nucleotides are complementary; further preferably, at least 95% of the nucleotides are complementary; such as 98%, 99% or 100%. Functionally, siRNA interferes with post-transcriptional degradation of the mRNA expressed by a specific gene with a complementary nucleotide sequence, thereby preventing translation.
In one embodiment of the present invention, (a) is selected from the group consisting of siRNA of EGFR gene, siRNA of KRAS gene, siRNA of VEGFR gene, siRNA of mTOR gene, siRNA of TNF-α gene, siRNA of integrin-α gene, siRNA of B7 gene, siRNA of TGF-β1 gene, siRNA of H2-K gene, siRNA of H2-D gene, siRNA of H2-L gene, siRNA of HLA gene, siRNA of GDF15 gene, an antisense strand of miRNA-21, an antisense strand of miRNA-214, siRNA of TNC gene, siRNA of PTP1B gene, siRNA of mHTT gene, siRNA of Lrrk2 gene, and siRNA of α-synuclein gene.
The siRNAs of the above-mentioned genes are RNA sequences that have the function of inhibiting the expression of the gene. Any RNA sequence that has the function of inhibiting the expression of the above-mentioned genes can be used in the present invention. The following are some RNA sequences with better effects:
The siRNA of the EGFR gene includes UGUUGCUUCUCUUAAUUCCU, AAAUGAUCUUCAAAAGUGCCC, UCUUUAAGAAGGAAAGAUCAU, AAUAUUCGUAGCAUUUAUGGA, UAAAAAUCCUCACAUAUACUU.
The siRNA of the KRAS gene includes UGAUUUAGUAUUAUUUAUGGC, AAUUUGUUCUCUAUAAUGGUG, UAAUUUGUUCUCUAUAAUGGU, UUAUGUUUUCGAAUUUCUCGA, and UGUAUUUACAUAAUUACACAC.
The siRNA of the VEGFR gene includes AUUUGAAGAGUUGUAUUAGCC, UAAUAGACUGGUAACUUUCAU, ACAACUAUGUACAUAAUAGAC, UUUAAGACAAGCUUUUCUCCA, and AACAAAAGGUUUUUCAUGGAC.
The siRNA of the mTOR gene includes AGAUAGUUGGCAAAUCUGCCA, ACUAUUUCAUCCAUAUAAGGU, AAAAUGUUGUCAAAGAAGGGU, AAAAAUGUUGUCAAAGAAGGG, and UGAUUUCUUCCAUUUCUUCUC.
The siRNA of the TNF-α gene includes AAAACAUAAUCAAAAGAAGGC, UAAAAAACAUAAUCAAAAGAA, AAUAAUAAAUAAUCACAAGUG, UUUUCACGGAAAACAUGUCUG, and AAACAUAAUCAAAAGAAGGCA.
The siRNA of the integrin-α gene includes AUAAUCAUCUCCAUUAAUGUC, AAACAAUUCCUUUUUUAUCUU, AUUAAAACAGGAAACUUUGAG, AUAAUGAAGGAUAUACAACAG, and UUCUUUAUUCAUAAAAGUCUC.
The siRNA of the B7 gene includes UUUUCUUUGGGUAAUCUUCAG, AGAAAAAUUCCACUUUUUCUU, AUUUCAAAGUCAGAUAUACUA, ACAAAAAUUCCAUUUACUGAG, and AUUAUUGAGUUAAGUAUUCCU.
The siRNA of the TGF-β1 gene includes ACGGAAAUAACCUAGAUGGGC, UGAACUUGUCAUAGAUUUCGU, UUGAAGAACAUAUAUAUGCUG, UCUAACUACAGUAGUGUUCCC, and UCUCAGACUCUGGGGCCUCAG.
The siRNA of the H2-K gene includes AAAAACAAAUCAAUCAAACAA, UCAAAAAAACAAAUCAAUCAA, UAUGAGAAGACAUUGUCUGUC, AACAAUCAAGGUUACAUUCAA, and ACAAAACCUCUAAGCAUUCUC.
The siRNA of the H2-D gene includes AAUCUCGGAGAGACAUUUCAG, AAUGUUGUGUAAAGAGAACUG, AACAUCAGACAAUGUUGUGUA, UGUUAACAAUCAAGGUCACUU, and AACAAAAAAACCUCUAAGCAU.
The siRNA of the H2-L gene includes GAUCCGCUCCCAAUACUCCGG, AUCUGCGUGAUCCGCUCCCAA, UCGGAGAGACAUUUCAGAGCU, UCUCGGAGAGACAUUUCAGAG, and AAUCUCGGAGAGACAUUUCAG.
The siRNA of the HLA gene includes AUCUGGAUGGUGUGAGAACCG, UGUCACUGCUUGCAGCCUGAG, UCACAAAGGGAAGGGCAGGAA, UUGCAGAAACAAAGUCAGGGU, and ACACGAACACAGACACAUGCA.
The siRNA of the GDF15 gene includes UAUAAAUACAGCUGUUUGGGC, AGACUUAUAUAAAUACAGCUG, AAUUAAUAAUAAAUAACAGAC, AUCUGAGAGCCAUUCACCGUC, and UGCAACUCCAGCUGGGGCCGU.
The siRNA of the TNC gene includes AUGAAAUGUAAAAAAAGGGA, AAUCAUAUCCUUAAAAUGGAA, UAAUCAUAUCCUUAAAAUGGA, UGAAAAAUCCUUAGUUUUCAU, and AGAAGUAAAAAACUAUUGCGA.
The siRNA of the PTP1B UGAUAUAGUCAUUAUCUUCUU, UCCAUUUUUAUCAAACUAGCG, AUUGUUUAAAUAAAUAUGGAG, AAUUUUAAUACAUUAUUGGUU, and UUUAUUAUUGUACUUUUUGAU.
The siRNA of the mHTT gene includes UAUGUUUUCACAUAUUGUCAG, AUUUAGUAGCCAACUAUAGAA, AUGUUUUUCAAUAAAUGUGCC, UAUGAAUAGCAUUCUUAUCUG, and UAUUUGUUCCUCUUAAUACAA.
The siRNA of the Lrrk2 gene includes AUUAACAUGAAAAUAUCACUU, UUAACAAUAUCAUAUAAUCUU, AUCUUUAAAAUUUGUUAACGC, UUGAUUUAAGAAAAUAGUCUC, and UUUGAUAACAGUAUUUUUCUG.
The siRNA of the α-synuclein gene includes AUAUAUUAACAAAUUUCACAA, AAGUAUUAUAUAUAUUAACAA, AUAACUUUAUAUUUUUGUCCU, UAACUAAAAAAUUAUUUCGAG, and UCGAAUAUUAUUUAUUGUCAG.
Those skilled in the art can understand that the RNA sequences that can be used in the present invention also include RNA sequences that have a homology of more than 80% with the aforementioned RNA. For example, the homology is 85%, 88%, 90%, 95%, 98%, etc.
In one embodiment of the present invention, the nucleotide sequence encoding one or more RNAs that inhibit gene expression in the isolated nucleic acid comprises an RNA fragment sequence targeting the gene. The RNA fragment sequence is usually an RNA sequence complementary to the target nucleotide sequence of the gene. In the case where the RNA is siRNA, the RNA fragment sequence is the sense strand sequence of the siRNA.
In one embodiment of the present invention, the one or more RNAs that inhibit gene expression in the isolated nucleic acid has 15-29 nucleotides (nt) in length, preferably 18-22 nt, such as 18 nt, 19 nt, 20 nt, 21 nt, or 22 nt. A large number of experiments have proved that in the case where the length of the RNA sequence is less than 18 nt, especially less than 15 nt, the RNA sequence is mostly invalid and will not play a role. In the case where the length of the RNA sequence is greater than 22 nt, especially greater than 25 nt, not only does the cost of the circuit increase greatly, but the effect is no better than that of an RNA sequence with a length of 18-22 nt, and the economic benefits are poor. Therefore, in the case where the length of the RNA sequence is 15-25 nt, especially 18-22 nt, the cost and function can be balanced with the best effect.
In the present invention, the isolated nucleic acid also includes variants and derivatives thereof. Those skilled in the art can use common methods to modify the nucleic acid. Such modification includes (but not limited to) methylation modification, hydrocarbon modification, glycosylation modification (such as 2-methoxy-glycosyl modification, hydroxyl-glycosyl modification, saccharide ring modification), nucleic acid modification, peptide fragment modification, lipid modification, halogen modification, and nucleic acid modification (such as “TT” modification). In one embodiment of the present invention, the modification is an internucleotide linkage, for example selected from the group consisting of phosphorothioate, 2′-O methoxyethyl (MOE), 2′-fluoro, alkyl phosphonate, phosphorodithioate, alkyl phosphonothioate, phosphoramidate, carbamate, carbonate, phosphotriester, acetamidate, carboxymethyl ester, and combinations thereof. In one embodiment of the present invention, the modification is a modification of nucleotides, for example, selected from the group consisting of peptide nucleic acid (PNA), locked nucleic acid (LNA), arabinose nucleic acid (FANA), analogs and derivatives thereof, and combinations thereof. Preferably, the modification is 2′ fluoropyrimidine modification. 2′ Fluoropyrimidine modification is to replace the 2′-OH of the pyrimidine nucleotide of RNA with 2′-F. 2′-F modification can make RNA difficult to be recognized by RNase in vivo, thereby increasing the stability of RNA fragment during transportation in vivo.
In one embodiment of the present invention, the nucleotide sequence encoding one or more RNAs that inhibit gene expression in the isolated nucleic acid also comprises one or more of a flanking sequence (such as a 5′ flanking sequence and a 3′ flanking sequence), a stem-loop sequence and a compensation sequence of the RNA sequence.
The compensation sequence is the reverse complementary sequence of the RNA fragment sequence. In one embodiment of the present invention, the compensation sequence is the reverse complementary sequence of the RNA fragment sequence with any 1-5 bases deleted. In another embodiment of the present invention, the compensation sequence is the reverse complementary sequence of the RNA fragment sequence with any 1-3 bases deleted, especially 1-3 contiguous bases deleted. Most preferably, the compensation sequence is the reverse complementary sequence of the RNA fragment with the base at position 9 and/or 10 deleted. Generally speaking, the RNA sequence can be expressed in the target receptor, and the compensation sequence cannot be expressed in the target receptor.
The flanking sequence is a sequence used to help RNA molecules such as siRNA molecules be sheared into the correct final sequence. In the present invention, the flanking structure of the natural miRNA precursor can be used as the flanking structure of the RNA molecule of the present invention. For example, the flanking structure of pre-miR-155 is used.
In one embodiment of the present invention, the 5′ flanking sequence is ggatcctggaggcttgctgaaggctgtatgctgaattc or a sequence with more than 80% homology thereto, for example, 85%, 90%, 92%, 95%, 98%, 99% homology thereto.
In one embodiment of the present invention, the 3′ flanking sequence is accggtcaggacacaaggcctgttactagcactcacatggaacaaatggcccagatctggccgcactcgag or a sequence with more than 80% homology thereto, for example, 85%, 90%, 92%, 95%, 98%, 99% homology thereto.
The stem-loop structure is a spacer sequence encoding a hairpin structure that maintains the stability of the RNA. In one embodiment of the present invention, the sequence of the stem-loop structure is preferably gttttggccactgactgac or a sequence with more than 80% homology thereto.
In one embodiment of the present invention, the one or more RNAs that inhibit gene expression in the isolated nucleic acid comprises successively: 5′ flanking sequence, RNA fragment sequence, stem-loop sequence, compensation sequence and 3′ flanking sequence. In one embodiment of the present invention, the RNA has a promoter at 5′ end.
The inventor of the present application unexpectedly discovered and proved through experiments that with the cooperation of the above-mentioned specific flanking sequence, compensation sequence, and stem-loop sequence, the required RNA sequence can be transcribed and sheared to the greatest extent, and encapsulated in exosomes.
In one embodiment of the present invention, (a) in the nucleic acid is a nucleotide sequence encoding a plurality of RNAs that inhibit gene expression. For example, the plurality of RNAs that inhibit gene expression are 2-4 RNAs that inhibit gene expression. In the case where (a) is a nucleotide sequence encoding a plurality of RNAs that inhibit gene expression, the plurality of RNAs are linked via a linker. The linker has a structure of, for example, sequence 1-sequence 2-sequence 3. Wherein, sequence 1 is preferably CAGATC; sequence 2 may be a sequence of 5-80 bases, preferably a sequence of 10-50 bases, more preferably a sequence of 20-40 bases; and sequence 3 is preferably TGGATC. In one embodiment of the present invention, the sequence of the linker is CAGATCTGGCCGCACTCGAGGTAGTGAGTCGACCAGTGGATC.
In one embodiment of the present invention, the targeting protein is a target tissue-specific targeting peptide.
In one embodiment of the present invention, the targeting protein is a fusion protein of a target tissue-specific targeting peptide and a membrane protein.
In one embodiment of the present invention, the specific targeting peptide is selected from the group consisting of RVG targeting peptide, GE11 targeting peptide, PTP targeting peptide, TCP-1 targeting peptide, and MSP targeting peptide.
In one embodiment of the present invention, the targeting protein is a membrane protein, which is, for example, selected from the group consisting of a receptor protein (such as a growth factor receptor), LAMP1 or LAMP2 (such as LAMP2B), and an antibody or an antigen-binding fragment thereof.
In one embodiment of the present invention, the targeting protein is RVG-LAMP2B fusion protein, GE11-LAMP2B fusion protein, PTP-LAMP2B fusion protein, TCP-1-LAMP2B fusion protein, or MSP-LAMP2B fusion protein.
In one embodiment of the present invention, the target or tissue is the brain, pineal gland, pituitary gland, eye, ear, nose, mouth, pharynx, parotid gland, tonsil, esophagus, trachea, thyroid, thymus, breast, lung, heart, stomach, intestines, appendix, liver, gallbladder, spleen, pancreas, kidney, ureter, bladder, urethra, uterus, ovary, fallopian tube, vagina, vas deferens, prostate, penis, testicle, anus, bone, muscle, connective tissue, nerve, lymph, colorectum, blood, bone marrow and/or skin, etc. In one embodiment of the present invention, the target cells are cells of the above-mentioned target or tissue.
In one aspect of the present invention, after the nucleic acid is administered to a mammal, it is enriched in tissues (including liver, lung, gastrointestinal tract, breast, kidney, brain, spleen, lymph, thyroid, reproductive organ, blood cells or lymphocytes, especially liver), and its expressed products are encapsulated in exosomes produced and secreted by cells in these tissues and delivered to target tissues to exert therapeutic effects. Therefore, on the one hand, it is necessary to select available targeting tags according to the target tissue for the targeting protein encoded by the nucleic acid, and on the other hand, it is also necessary to ensure that the targeting tag can stably appear on the surface of exosomes to achieve targeting function.
Targeting peptides suitable for use in the present invention include, but are not limited to, RVG targeting peptide (with the nucleotide sequence as shown in SEQ ID No: 1), GE11 targeting peptide (with the nucleotide sequence as shown in SEQ ID No: 2), PTP targeting peptide (with the nucleotide sequence as shown in SEQ ID No: 3), TCP-1 targeting peptide (with the nucleotide sequence as shown in SEQ ID No: 4), or MSP targeting peptide (with the nucleotide sequence as shown in SEQ ID No: 5); targeting proteins include but are not limited to RVG-LAMP2B fusion protein (with the nucleotide sequence as shown in SEQ ID No: 6), GE11-LAMP2B fusion protein (with the nucleotide sequence as shown in SEQ ID No: 7), PTP-LAMP2B fusion protein (with the nucleotide sequence as shown in SEQ ID No: 8), TCP-1-LAMP2B fusion protein (with the nucleotide sequence as shown in SEQ ID No: 9), or MSP-LAMP2B fusion protein (with the nucleotide sequence as shown in SEQ ID No: 10).
Among them, RVG targeting peptide and RVG-LAMP2B fusion protein can precisely target brain tissue; GE11 targeting peptide and GE11-LAMP2B fusion protein can precisely target organs or tissues with high expression of EGFR, such as lung cancer tissue with EGFR mutation; PTP targeting peptide and PTP-LAMP2B fusion protein can precisely target the pancreas, especially the plectin-1 protein specifically expressed in human and mouse pancreatic cancer tissues; TCP-1 targeting peptide and TCP-1-LAMP2B fusion protein can precisely target the colon; and MSP targeting peptide and MSP-LAMP2B fusion protein can precisely target muscle tissue.
In practical applications, the targeting protein can be combined with various RNAs that inhibit gene expression to inhibit their specific target genes in different tissues. For example, RVG targeting peptide and RVG-LAMP2B fusion protein can be combined with siRNA of EGFR gene, siRNA of TNC gene or a combination of the two to treat glioblastoma, be combined with siRNA of PTP1B gene to treat obesity, be combined with siRNA of mHTT gene to treat Huntington's disease, or be combined with siRNA of LRRK2 gene to treat Parkinson's disease; GE11 targeting peptide and GE11-LAMP2B fusion protein can be combined with siRNA of EGFR gene to treat lung cancer and other diseases induced by high expression or mutation of EGFR gene; TCP-1 targeting peptide or TCP-1-LAMP2B fusion protein can be combined with siRNA of TNF-α gene, siRNA of integrin-α gene, siRNA of B7 gene or any combination of the above three to treat colitis or colon cancer.
In one embodiment of the present invention, (a) in the nucleic acid is a nucleotide sequence encoding a plurality of RNAs that inhibit gene expression. The plurality of RNAs that inhibit gene expression can be administered to the subject in need of treatment simultaneously or separately. In one embodiment of the present invention, the plurality of RNAs can be located in different plasmid vectors or viral vectors. For example, one of the plasmids or viral vectors contains a promoter and targeting tag, and the other plasmid contains a promoter and an RNA fragment. That is, the targeting tag and the RNA fragment are loaded into different vectors, and two or more vectors are injected into the body simultaneously or separately. More preferably, in the case where the two or more different vectors are injected into the host, the vector containing the RNA sequence can be injected first, and then (such as after 1-2 hours) the vector containing the targeting tag is injected, so that a better targeting effect can be achieved.
In one embodiment of the present invention, the nucleic acid is enriched in the liver of a mammalian and its product is encapsulated in exosomes in hepatocytes.
In one aspect of the present invention, a vector of RNA that inhibits gene expression is provided, which comprises:
In one embodiment of the present invention, the vector comprises the aforementioned isolated nucleic acid provided by the present invention, which encodes a nucleotide sequence of RNA capable of inhibiting gene expression.
In one embodiment of the present invention, the vector is a plasmid. In one embodiment of the present invention, after the plasmid is administered to a mammal, it can be expressed in tissues (including liver, lung, gastrointestinal tract, breast, kidney, brain, spleen, lymph, thyroid, reproductive organ, blood cells or lymphocytes, especially liver), and the RNA fragment of the present invention is transcribed and/or expressed, and encapsulated in exosomes in the cells of the tissue.
In one embodiment of the present invention, the vector is a viral vector. For example, it may be a baculovirus expression vector, an adenoviral vector, a retroviral vector, a herpes viral vector or a lentiviral vector.
In one embodiment of the present invention, the vector is an adenoviral vector. Preferably, the adenovirus is adenovirus-associated virus type 5, adenovirus-associated virus type 8 or adenovirus-associated virus type 9. More preferably, the adenovirus is adenovirus-associated virus type 5.
In one embodiment of the present invention, the plasmid or viral vector is enriched and expressed in the liver after administration to mammals, and its products are encapsulated in exosomes in large quantities.
In one aspect of the present invention, an exosome with RNA that inhibits gene expression is provided, which comprises the nucleic acid or vector as described above. In one embodiment of the present invention, the exosome is an exosome derived from human tissues or cells. The tissue includes liver, lung, gastrointestinal tract, breast, kidney, brain, spleen, lymph, thyroid, reproductive organ, blood cells or lymphocytes. In one embodiment of the present invention, the exosomes is an exosome derived from liver or liver cells.
In one aspect of the present invention, a pharmaceutical composition is provided, which comprises the nucleic acid, vector or exosome as described above. The pharmaceutical composition further comprises a pharmaceutically acceptable carrier or excipient for delivering the nucleic acid, vector or exosome to a subject.
The administration methods of the pharmaceutical composition include oral administration, inhalation, subcutaneous injection, intramuscular injection, and intravenous injection. That is, the pharmaceutical composition can be administered orally, inhaled, subcutaneously, intramuscularly or intravenously. The dosage form of the pharmaceutical composition may be tablets, capsules, powders, granules, pills, suppositories, ointments, solutions, suspensions, lotions, gels, pastes, etc. After the plasmid or viral vector in the pharmaceutical composition is administered to a mammal, it will be enriched in tissues (including liver, lung, gastrointestinal tract, breast, kidney, brain, spleen, lymph, thyroid, reproductive organ, blood cells or lymphocytes, especially liver), and its expressed products are encapsulated in exosomes in large quantities in the cells of the tissue and delivered to the target tissue to exert a therapeutic effect.
The pharmaceutical composition can be used to treat various diseases, including tumors, acute and chronic infectious diseases, or other acute and chronic diseases. The acute and chronic infectious diseases mentioned therein include viral influenza, viral hepatitis, AIDS, SARS viral diseases, bacterial diseases (such as tuberculosis, bacterial pneumonia), and other acute and chronic infectious diseases caused by various pathogenic microorganisms. The other acute and chronic diseases include respiratory diseases, immune system diseases, blood and hematopoietic system diseases, circulatory system diseases such as cardiovascular and cerebrovascular diseases, endocrine system metabolic diseases, digestive system diseases, nervous system diseases, urinary system diseases, reproductive system diseases and motor system diseases. For example, the disease is cancer, pulmonary fibrosis, colitis, obesity, cardiovascular disease caused by obesity, type 2 diabetes, Huntington's disease, Parkinson's disease, myasthenia gravis, Alzheimer's disease or graft-versus-host disease.
In one aspect of the present invention, a method of treating a disease is provided, comprising administering to a subject a nucleic acid, vector or exosome as described above. The diseases include tumors, acute and chronic infectious diseases, or other acute and chronic diseases.
It will be understood by those skilled in the art that the actual dosage administered will vary depending on various factors such as the vector, target cells or tissues, the general condition of the subject to be treated, the degree of transformation/modification sought, the administration route, mode of administration, type of transformation/modification sought, etc.
The essence and beneficial effects of the present invention will be further described below in conjunction with examples. The examples are only used to illustrate the present invention but not to limit the present invention.
Hematoxylin-eosin staining is referred to as HE staining. Hematoxylin stain is alkaline and can stain the basophilic structures of tissues (such as ribosomes, nuclei and ribonucleic acid in the cytoplasm, etc.) into blue-purple, and eosin is an acidic dye that can stain eosinophilic structures of tissues (such as intracellular and intercellular proteins, Lewy bodies, Mallory bodies, and most of the cytoplasm) into pink, making the morphology of the entire cell tissue clearly visible.
The specific steps of HE staining include: sample tissue fixation and sectioning; tissue sample deparaffinizing; tissue sample hydration; hematoxylin staining of tissue sections, differentiation and anti-blue; eosin staining of tissue sections and dehydration; air-drying and sealing tissue sample sections; and finally, observation and taking pictures under a microscope.
Masson's staining makes collagen fibers blue (stained by aniline blue) or green (stained by bright green), and muscle fibers red (stained by acid fuchsin and ponceau). The fixated tissue is stained sequentially or mixed with a series of anionic water-soluble dyes. It can be found that red blood cells are stained by the smallest molecular anionic dyes, muscle fibers and cytoplasm are stained by medium-sized anionic dyes, and collagen fibers are stained by macromolecular anionic dyes. This shows that red blood cells are the least permeable to anionic dyes, followed by muscle fibers and cytoplasm, while collagen fibers have the greatest permeability. Type I and type III collagen are green (GBM, TBM, mesangial matrix and renal interstitium are green), and eosinophilic proteins, renal tubular cytoplasm and red blood cells are red.
The specific steps of Masson's staining include: fixing the tissue in Bouin's solution, rinsing with running water overnight, and routinely dehydrating and embedding; deparaffinizing and dehydrating sections (deparaffinizing in xylene for 10 min×3 times, absorbing the liquid with absorbent paper; 100% ethanol for 5 min×2 times, absorbing the liquid with absorbent paper; 95% ethanol for 5 min×2 times, absorbing the liquid with absorbent paper; rinsing with running water for 2 min, absorbing the liquid with absorbent paper); staining with Weigert's iron hematoxylin for 5-10 min; washing slightly with running water; differentiating with 0.5% hydrochloric acid and alcohol for 15 seconds; rinsing with running water for 3 min; staining with ponceau-fuchsin solution for 8 min; rinsing slightly with distilled water; treating with 1% phosphomolybdic acid aqueous solution for about 5 min; directly counterstaining with aniline blue solution or bright green solution for 5 min without washing with water; treating with 1% glacial acetic acid for 1 min; dehydrating in 95% ethanol for 5 min×2 times, absorbing the liquid with absorbent paper; 100% ethanol for 5 min×2 times, absorbing the liquid with absorbent paper; clearing in xylene for 5 min×2 times, absorbing the liquid with absorbent paper; and sealing with neutral gum.
Western Blot transfers proteins to a membrane and then uses antibodies for detection. For known expressed proteins, the corresponding antibodies can be used as primary antibodies for detection. For the expression products of new genes, the antibodies against the fusion part can be used for detection.
In Western Blot, polyacrylamide gel electrophoresis is employed, where the detected object is protein, the “probe” is an antibody, and the “color development” uses a labeled secondary antibody. The protein sample separated by PAGE is transferred to a solid-phase carrier (such as nitrocellulose film), where it is absorbed through non-covalent bonds without changing the type or biological activity of the polypeptide separated by electrophoresis. The protein or peptide on the solid-phase carrier acts as an antigen and reacts immunologically with the corresponding antibody. Then, it reacts with the second antibody labeled with either enzyme or isotope. The protein component expressed by the specific target gene is separated through electrophoresis and detected through substrate color development or autoradiography. The process primarily comprises of extracting proteins, quantifying proteins, preparing gels, running electrophoresis, transferring membranes, performing immunolabeling, and developing.
Immunohistochemistry (also known as immunocytochemistry), based on the antigen-antibody reaction, is the process of identifying antigens (polypeptides or proteins) in tissue cells, determining their localization, and studying them qualitatively and relative quantitatively by chemical reaction of the chromogenic agent (fluorescein, enzyme, metal ion, or isotope) of the labeled antibody to develop color.
The main steps of immunohistochemistry include soaking sections, airing overnight, deparaffinizing in xylene followed by alcohol of gradient concentrations (100%, 95%, 90%, 80%, 75%, 70%, 50%, 3 min each time), using double distilled water, adding dropwise 3% hydrogen peroxide solution to remove catalase, washing with water, repairing antigen, adding dropwise 5% BSA, blocking for 1 h, diluting primary antibody, washing with PBS buffer, incubating with secondary antibody, washing with PBS buffer, developing color with chromogenic solution, washing with water, staining with hematoxylin, dehydrating with ethanol of gradient concentrations, and sealing with neutral gum.
The inventor designed a system that delivers RNA that inhibits gene expression to an organ or tissue as needed, and the RNA is enriched and assembled in cells to form cellular microvesicles including exosomes, and then delivered to a target tissue for disease treatment after being released by the cells. The system comprises one or more RNAs that inhibit gene expression and a protein that targets a target tissue.
For the core gene circuit construct, the inventors optimized the siRNA expression backbone part encoded under the control of a promoter part to maximize guide strand expression while minimizing undesired passenger strand expression.
In one embodiment, epidermal growth factor receptor (EGFR) is used as the siRNA target of the core circuit. EGFR is one of the most potent oncogenes that is frequently mutated and highly expressed in a variety of human cancers (e.g., lung cancer and glioblastoma). In addition, human embryonic kidney 293T cells (HEK293T) and mouse hepatoma cells (Hepa 1-6) were chosen as the cell chassis for in vitro assembly of siRNA. To optimize the siRNA production efficiency, two design strategies were compared: one is to drive the expression of an miRNA precursor (pre-miRNA) by the CMV promoter and substitute the miRNA sequence with siRNA, thus constructing the plasmid EGFR siRNA (CMV-siRE) (the structure of the plasmid is shown in
The other is to use the U6 promoter to drive the expression of a short hairpin RNA (shRNA), thus constructing the plasmid EGFR shRNA (U6-siRE) (the structure of the plasmid is shown in
The siRNA production efficiency of a CMV-directed pre-miRNA encoding an EGFR siRNA (CMV-siRE) and a U6-directed EGFR shRNA (U6-shRE) was compared, see
Whether the core gene circuit directed the loading of siRNA into exosomes was examined.
CMV-scrR was constructed. CMV-scrR has the same nucleotide type and number as the siRNA encoding sequence in CMV-siRE but a different nucleotide arrangement, serving as a blank control for encoding CMV-siRE.
HEK293T cells were transfected with CMV-scrR or CMV-siRE, and the exosomes in cell culture medium were characterized. Nanoparticle tracking analysis (NTA) revealed that similar amounts of exosomes were secreted in each group with similar size and distribution, peaking at 128-131 nm. Transmission electron microscopy (TEM) confirmed that the purified exosomes exhibited a typical round-shaped vesicular morphology and had correct size. Moreover, enrichment of specific exosome markers (CD63, TSG101 and CD9) was only detected in purified exosomes but not in cell culture medium. These results demonstrate that transfection with gene circuits did not affect the size, structure or number of exosomes generated by HEK293T cells. Finally, a significant amount of EGFR siRNA was detected in exosomes derived from HEK293T and Hepa 1-6 cells transfected with the CMV-siRE gene circuit, see
In one embodiment, exosomes are introduced into the brain using the RVG-Lamp2b fusion protein (the RVG targeting peptide linked to the N-terminus of the Lamp2b protein) as the anchoring protein. Rabies virus glycoprotein (RVG) is a neurotropic protein that can bind to acetylcholine receptors expressed in nerve cells. RVG has been shown to help exosomes cross the blood-brain barrier and enter nerve cells. In CMV-RVG-siRE, the sequence encoding the RVG-Lamp2b fusion protein is inserted downstream of the CMV promoter and upstream of the siRNA. Wherein, the amino acid sequence of RVG is shown in SEQ ID NO.: 17. The amino acid sequence of the entire RVG-Lamp2b fusion protein is shown in SEQ ID NO.: 18.
The efficiency of the promoters in initiating the expression of the RVG-Lamp2b fusion protein was assessed. The CMV promoter generates RVG-Lamp2b mRNA and marker protein eGFP in HEK293T cells. The correct display of the targeting tag on the exosome surface was then verified using immunoprecipitation. A Flag tag was used to temporarily replace RVG in the experiment. After transfection of HEK293T and Hepa 1-6 cells with CMV-directed Flag-Lamp2b, intact exosomes were successfully immunoprecipitated with anti-Flag beads, see
In one embodiment, tenascin-C (TNC), a critical oncogene associated with many cancers, especially glioblastoma, was selected as the second siRNA target. TNC-siRNA comprises siRNA sequence that inhibits TNC and is expressibly linked after the CMV promoter, and is also embedded in the pre-miR-155 backbone to obtain plasmid CMV-siRT. Wherein, the siRNA of the TNC gene has the nucleotide sequence of UAUGAAAUGUAAAAAAAGGGA (SEQ ID NO. 5).
In addition, the siRNA inhibiting EGFR and the siRNA inhibiting TNC were constructed in tandem on the same plasmid. TNC-siRNA was inserted downstream of EGFR-siRNA, and cagatctggccgcactcgaggtagtgagtcgaccagtggatc (SEQ ID NO.: 6) was used as the linker between the sequences encoding EGFR-siRNA and TNC-siRNA, to obtain plasmid CMV siRE+T. In the experiment, it was found that regardless of the individual (CMV siRE or CMV siRT) or tandem (CMV siRE+T) transcription, equal amounts of EGFR and TNC siRNA were detected, see
Another immunoprecipitation experiment was performed to assess the association of AGO2 with siRNAs in exosomes. Experiments demonstrated that EGFR and TNC siRNAs were readily detected in the exosomes precipitated with anti-AGO2 antibody, suggesting that the loading of siRNA into the RNA-induced silencing complex (RISC) can be guaranteed and facilitates the efficient transport of AGO2-bound siRNA into exosomes. Finally, to investigate whether the in vitro assembled siRNAs are functional, exosomes derived from HEK293T cells transfected with the CMV-RVG-siRE+T gene circuit were incubated with the U87MG glioblastoma cells. A dose-dependent downregulation of EGFR and TNC expression in U87MG cells was achieved, see
Herein, unless otherwise specified, CMV-siRgene abbreviation or initials represents a plasmid, which has the construction structure of CMV-siRE as described above but differs only in the RNA sequence of the encoded gene to be inhibited. For example, “plasmid CMV-siRT” or “CMV-siRT” refers to a plasmid in which an siRNA sequence that inhibits TNC is expressibly linked after a CMV promoter as described above, with ggatcctggaggcttgctgaaggctgtatgctgaattc (SEQ ID NO.: 2) as 5′ flanking sequence, gttttggccactgactgac (SEQ ID NO.: 4) as the stem loop sequence, accggtcaggacacaaggcctgttactagcactcacatggaacaaatggcccagatctggccgcactcgag (SEQ ID NO.: 3) as the 3′ flanking sequence, and the reverse complement sequence of the RNA fragment with base at position 9 and/or 10 of the RNA fragment deleted. In addition, CMV-siRthe first letter of the first gene+the first letter of the second gene represents a plasmid carrying both the siRNA sequence that inhibits the first gene and the siRNA that inhibits the second gene, which has a construction structure as CMV-siRE T but differs only in the RNA sequence of the encoded gene to be inhibited, and the siRNA sequence inhibiting the second gene is inserted downstream of the siRNA sequence inhibiting the first gene, with cagatctggccgcactcgaggtagtgagtcgaccagtggatc (SEQ ID NO.: 6) as the linker between the sequences encoding TNC-siRNA and EGFR-siRNA. By analogy, it can represent a plasmid carrying siRNA sequences that inhibit multiple genes at the same time. In addition, CMV—abbreviation or initials of targeting peptide—siRgene abbreviation or initials represents that a targeting peptide, such as RVG, is present downstream of the CMV promoter and upstream of the siRNA.
As shown in
CMV eGFP siRE co-expressing eGFP protein and EGFR siRNA was injected intravenously into C57BL/6J mice. The results are shown in
The control plasmid (CMV-scrR) and the plasmid expressing EGFR siRNA (CMV-siRE) were injected into the mice respectively, and an in vitro model of mouse hepatocytes was established. The related siRNA levels in the hepatocyte exosomes of mice injected with CMV-scrR and CMV-siRE were respectively detected. The results are shown in
Ago2 immunoprecipitation experiments were performed, and the results are shown in
After intravenous injection of the plasmid into mice, the distribution of mature siRNA in different tissues is shown in
Mice were injected with control plasmid (CMV-scrR), 0.05 mg/kg CMV-siRE plasmid, 0.5 mg/kg CMV-siRE plasmid, and 5 mg/kg CMV-siRE plasmid, respectively, and the level of absolute siRNA (EGFR siRNA) was detected in the mouse liver, spleen, heart, lung, kidney, pancreas, brain, skeletal muscle, and CD4 cells. The results are shown in
After the plasmid enters the body, it will express the precursor and then process it into a mature body (siRNA). Therefore, the metabolism of the precursor and mature body (siRNA) were detected in the liver of mice injected with the plasmid, and the result is shown in
After injecting exogenous siRNA into the common bile duct of mice, the levels of absolute siRNA in exosome-free plasma, exosomes, and plasma were detected respectively. The results are shown in
Mice were intravenously injected with siRNA with albumin ALB as promoter, siRNA with CMV as promoter, and siRNA without any promoter respectively. The absolute siRNA levels in mice were detected at 0 h, 3 h, 6 h, 9 h, 12 h, 24 h, 36 h, and 48 h after injection, and the results are shown in
Fluorescence experiments were performed to observe the inhibition of eGFP levels in mice by self-assembled eGFP siRNA. The process was as follows: eGFP transgenic mice were intravenously injected with PBS, or 5 mg/kg CMV-siRG or CMV-RVG-siRG plasmid, and treated for 24 h. The mice were then sacrificed, and their eGFP fluorescence levels were detected in frozen sections.
The alanine aminotransferase (ALT), aspartate aminotransferase (AST), total bilirubin (TBIL), blood urea nitrogen (BUN), serum alkaline phosphatase (ALP), creatinine (CREA) contents, thymus weight, spleen weight, and percentage in peripheral blood cells were detected in mice injected with PBS, CMV-scrR, and CMV-siRE respectively. The results are shown in
Therefore, the RNA delivery system provided in this example uses a plasmid as a carrier, and as a mature injection, the plasmid has safety and reliability that have been fully verified, and has a very good druggability. The RNA sequence that exerts the final effect is encapsulated and transported by endogenous exosomes, with no immune responses, and there is no need to verify the safety of the exosomes. The delivery system can deliver all kinds of small molecule RNAs and has strong versatility. Moreover, the preparation of plasmids is much cheaper than the preparation of exosomes, proteins, polypeptides and the like, with good economy. The RNA delivery system provided in this example can tightly bind to AGO2 and be enriched into a complex (exosomes) after self-assembly in vivo, which not only prevents its premature degradation and maintains its stability in circulation, but also facilitates receptor cell absorption, intracytoplasmic release and lysosomal escape, and only a low dose is required.
As shown in
As shown in
In summary, CMV-siRE had a significant therapeutic effect on EGFR-mutated lung cancer tumors.
HE staining and immunohistochemical staining were performed on mice injected with PBS buffer/CMV-scrR/gefitinib/CMV-siRE respectively. The results are shown in
As shown in
As shown in
In summary, CMV-siRK had a significant therapeutic effect on KRAS-mutated lung cancer tumors.
HE staining and immunohistochemical staining were performed on mice injected with CMV-scrR/CMV-siRK. The results are shown in
The 5′ flanking sequence preferably has a sequence that is identical to or more than 80% homologous with ggatcctggaggcttgctgaaggctgtatgctgaattc, including sequences with 85%, 90%, 92%, 95%, 98%, or 99% homology with ggatcctggaggcttgctgaaggctgtatgctgaattc.
The loop sequence preferably has a sequence that is identical to or more than 80% homologous with gttttggccactgactgac, including sequences with 85%, 90%, 92%, 95%, 98%, 99% homology with gttttggccactgactgac.
The 3′ flanking sequence preferably has a sequence that is identical to or more than 80% homologous with accggtcaggacacaaggcctgttactagcactcacatggaacaaatggcccagatctggccgcactcgag, including sequences with 85%, 90%, 92%, 95%, 98%, 99% homology with accggtcaggacacaaggcctgttactagcactcacatggaacaaatggcccagatctggccgcactcgag.
The compensation sequence is the reverse complementary sequence of the RNA fragment with any 1-5 bases deleted. In the case where the RNA fragment contains only one RNA sequence, the compensation sequence may be the reverse complementary sequence of the RNA sequence with any 1-5 bases deleted.
Preferably, the compensation sequence is the reverse complementary sequence of the RNA fragment with any 1-3 bases deleted. In the case where the RNA fragment contains only one RNA sequence, the compensation sequence may be the reverse complementary sequence of the RNA sequence with any 1-3 bases deleted.
More preferably, the compensation sequence is the reverse complementary sequence of the RNA fragment with any 1-3 contiguous bases deleted. In the case where the RNA fragment contains only one RNA sequence, the compensation sequence may be the reverse complementary sequence of the RNA sequence with any 1-3 contiguous bases deleted.
Most preferably, the compensation sequence is the reverse complementary sequence of the RNA fragment with the base at position 9 and/or 10 deleted. In the case where the RNA fragment contains only one RNA sequence, the compensation sequence may be a reverse complementary sequence of the RNA sequence with the base at position 9 and/or 10 deleted. Deleting the base at position 9 and/or 10 has the best effect.
It should be noted that the above-mentioned flanking sequence, compensation sequence, and loop sequence are not randomly selected, but are determined based on a large number of theoretical studies and experiments. With the cooperation of the above-mentioned certain flanking sequence, compensation sequence, and loop sequence, the expression rate of RNA fragments can be maximized.
The optional two homologous 5′ flanking sequences, two homologous loop sequences and two homologous 3′ flanking sequences are as shown in the table below.
In the case where the plasmid carries two or more circuits, adjacent circuits can be linked via sequence 1-sequence 2-sequence 3; wherein, sequence 1 is preferably CAGATC, sequence 2 may be a sequence of 5-80 bases, such as 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75 bases, preferably a sequence of 10-50 bases, more preferably a sequence of 20-40 bases, and sequence 3 is preferably TGGATC.
Sequence 2 is specifically shown in the table below.
More preferably, in the case where the plasmid carries two or more circuits, adjacent gene circuits are linked via sequence 4 or a sequence with more than 80% homology to sequence 4; wherein sequence 4 is CAGATCTGGCCGCACTCGAGGTAGTGAGTCGACCAGTGGATC.
siRNA levels of EGFR in the lung after 9 h of intravenous injection of sequence 4 or two sequences with more than 80% homology to sequence 4.
The sequences are specifically shown in the table below.
Construction of virus carrying EGFR siRNA/KRAS-siRNA.
The AAV-5 adeno-associated virus with high-affinity for the liver was used to encapsulate the nucleic acid construct fragment expressing siRNA that inhibited gene.
The required virus was constructed by using the adenovirus packaging kit and services provided by Hanheng Biotechnology (Shanghai) Co., Ltd. The packaging steps include:
The vector plasmids pAAV-RC and pHelper provided by Hanheng Biotechnology (Shanghai) Co., Ltd., as well as the vector plasmid AAV051 carrying the target nucleic acid construct fragment were used, in which the nucleic acid construct fragment was cloned from plasmids CMV-siRE or CMV-siRK comprising the nucleic acid fragment encoding the siRNA initiated by CMV as described above, wherein the siRNA sequence (the nucleotide sequence shown in SEQ ID NO.: 1: UGUGGCUUCUCUUAACUCCU) inhibiting EGFR or the siRNA sequence (the nucleotide sequence shown in SEQ ID NO.: 7: UGAUUUAGUAUUAUUUAUGGC) inhibiting KRAS was operably linked after the CMV promoter, with ggatcctggaggcttgctgaaggctgtatgctgaattc (SEQ ID NO.: 2) as the 5′ flanking sequence, gttttggccactgactgac (SEQ ID NO.: 4) as the stem-loop sequence, and accggtcaggacacaaggcctgttactagcactcacatggaacaaatggcccagatctggccgcactegag (SEQ ID NO.: 3) as the 3′ flanking sequence, and the reverse complement sequence of the RNA fragment with base at position 9 and/or 10 of the RNA fragment deleted.
The AAV-5 viral vector carrying EGFR siRNA or KRAS-siRNA thus obtained was named AAV-CMV-EGFR siRNA or AAV-CMV-KRAS siRNA, respectively.
Herein, unless otherwise specified, AAV-CMV-gene siRNA or AAV-CMV-siRgene abbreviation or initials represents a viral vector, which has the structure of the AAV-CMV-EGFR siRNA as described above, but differs only in the sequence of the carried RNA that inhibits gene.
Mice were injected with 100 μL of AAV solution with a titer of 1012 V·g/ml through the tail vein. The in vivo expression of the AAV system was monitored by small animal in vivo imaging. After 3 weeks, it was found that the AAV system was stably expressed in the body, especially in the liver.
In the second experiment, one experimental group and two control groups were set up, wherein the experimental group was the AAV-CMV-KRAS-siRNA group, and the control groups were the PBS group and the AAV-CMV-scrR group.
The same number of mice were selected from each group. Mouse lung cancer cells (LLC cells) were injected into the mice, and CT scanning technology was used to observe the progress of mouse model establishment. After 30 days, the successfully established mice were administered once every two days. Specifically, mice in the PBS group/AAV-CMV-scrR group/AAV-CMV-KRAS siRNA group were injected with PBS buffer/AAV-CMV-scrR/AAV-CMV-KRAS siRNA once every two days for treatment. Survival analysis and tumor evaluation were performed on the mice. Treatment was stopped after 7 administrations.
The survival of mice in each group was counted within 100 days after treatment, and the results are shown in
CT scanning was performed on mice in each group before and after administration. 3D modeling of mouse lung tissue was performed based on the CT images, and the tumor volume was calculated. The results are shown in
The expression levels of KRAS protein and mRNA in the lung of mice in each group were detected by RT-qPCR and Western blotting, respectively, and the results are shown in
The above experiments show that AAV-CMV-KRAS siRNA had a significant therapeutic effect on lung cancer tumors in mice.
In the third experiment, one experimental group and two control groups were set up, wherein the experimental group was the AAV-CMV-EGFR-siRNA group, and the control groups were the PBS group and the AAV-CMV-scrR group.
EGFR-DEL 19 mouse model was constructed and fed with doxycycline feed to induce tumor occurrence. After 30 days, the successfully constructed mice were administered once every two days. Specifically, mice in the PBS group/AAV-CMV-scrR group/AAV-CMV-EGFR siRNA group were injected with PBS buffer/AAV-CMV-scrR/AAV-CMV-EGFR siRNA once every two days for treatment. Survival analysis and tumor evaluation were performed on the mice. Treatment was stopped after 7 administrations.
The survival of mice in each group was counted within 100 days after treatment, and the results are shown in
CT scanning was performed on mice in each group before and after administration, and the CT images are shown in
The expression levels of EGFR protein and mRNA in the lung of mice in each group were detected by RT-qPCR and Western blotting, respectively, and the results are shown in
The above experiments show that AAV-CMV-EGFR siRNA had a significant therapeutic effect on EGFR-mutated lung cancer tumors in mice.
In the fourth experiment, two experimental groups and two control groups were set up, wherein the experimental groups were the AAV-CMV-KRAS-siRNA group the AAV-CMV-EGFR-siRNA group, and the control groups were the PBS group and the AAV-CMV-scrR group.
EGFR-DEL 19 mouse model was constructed and fed with doxycycline feed to induce tumor occurrence. After 30 days, the successfully constructed mice were administered once every two days. Specifically, mice in the PBS group/AAV-CMV-scrR group/AAV-CMV-EGFR siRNA group/AAV-CMV-KRAS siRNA group were injected with PBS buffer/AAV-CMV-scrR/AAV-CMV-EGFR siRNA/AAV-CMV-KRAS siRNA once every two days for treatment.
After treatment, alanine aminotransferase (ALT), aspartate aminotransferase (AST), total bilirubin (TBIL), serum alkaline phosphatase (ALP), creatinine (CREA) and blood urea nitrogen (BUN) were detected in each group of mice, and the results are shown in
The above experiments demonstrate that the EGFR siRNA system (AAV-CMV-EGFR siRNA) and KRAS siRNA system (AAV-CMV-KRAS siRNA) encapsulated with AAV-5 type adeno-associated virus with high affinity for the liver is safe and reliable and will not produce negative effects.
The viral vector can also comprise a flanking sequence, a compensation sequence and a loop sequence that facilitate the correct folding and expression of the circuit, and the flanking sequence comprises 5′ flanking sequence and 3′ flanking sequence; the viral vector comprises a circuit selected from the group consisting of 5′ promoter-5′ flanking sequence-RNA fragment-loop sequence-compensation sequence-3′ flanking sequence, 5′-promoter-targeting tag, and 5′ promoter-targeting tag-5′ flanking sequence-RNA fragment-loop sequence-compensation sequence-3′ flanking sequence, or a combination thereof.
Wherein, the 5′ flanking sequence preferably has a sequence that is identical to or more than 80% homologous with ggatcctggaggcttgctgaaggctgtatgctgaattc, including sequences with 85%, 90%, 92%, 95%, 98%, or 99% homology with ggatcctggaggcttgctgaaggctgtatgctgaattc.
The loop sequence preferably has a sequence that is identical to or more than 80% homologous with gttttggccactgactgac, including sequences with 85%, 90%, 92%, 95%, 98%, 99% homology with gttttggccactgactgac.
The 3′ flanking sequence preferably has a sequence that is identical to or more than 80% homologous with accggtcaggacacaaggcctgttactagcactcacatggaacaaatggcccagatctggccgcactcgag, including sequences with 85%, 90%, 92%, 95%, 98%, 99% homology with accggtcaggacacaaggcctgttactagcactcacatggaacaaatggcccagatctggccgcactcgag.
The compensation sequence is the reverse complementary sequence of the RNA fragment with any 1-5 bases deleted. In the case where the RNA fragment contains only one RNA sequence, the compensation sequence may be the reverse complementary sequence of the RNA sequence with any 1-5 bases deleted.
Preferably, the compensation sequence is the reverse complementary sequence of the RNA fragment with any 1-3 bases deleted. In the case where the RNA fragment contains only one RNA sequence, the compensation sequence may be the reverse complementary sequence of the RNA sequence with any 1-3 bases deleted.
More preferably, the compensation sequence is the reverse complementary sequence of the RNA fragment with any 1-3 contiguous bases deleted. In the case where the RNA fragment contains only one RNA sequence, the compensation sequence may be the reverse complementary sequence of the RNA sequence with any 1-3 contiguous bases deleted.
Most preferably, the compensation sequence is the reverse complementary sequence of the RNA fragment with the base at position 9 and/or 10 deleted. In the case where the RNA fragment contains only one RNA sequence, the compensation sequence may be a reverse complementary sequence of the RNA sequence with the base at position 9 and/or 10 deleted. Deleting the base at position 9 and/or 10 has the best effect.
It should be noted that the above-mentioned flanking sequence, compensation sequence, and loop sequence are not randomly selected, but are determined based on a large number of theoretical studies and experiments. With the cooperation of the above-mentioned certain flanking sequence, compensation sequence, and loop sequence, the expression rate of RNA fragments can be maximized.
In the case where the viral vector carries two or more circuits, adjacent gene circuits can be linked via sequence 1-sequence 2-sequence 3; wherein, sequence 1 is preferably CAGATC, sequence 2 may be a sequence of 5-80 bases, such as 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75 bases, preferably a sequence of 10-50 bases, more preferably a sequence of 20-40 bases, and sequence 3 is preferably TGGATC.
Sequence 2 is specifically shown in the table below.
More preferably, in the case where the viral vector carries two or more circuits, adjacent gene circuits are linked via sequence 4 or a sequence with more than 80% homology to sequence 4; wherein sequence 4 is CAGATCTGGCCGCACTCGAGGTAGTGAGTCGACCAGTGGATC.
siRNA levels of EGFR in the lung after 9 h of intravenous injection of the delivery system in which sequence 4 or two sequences 4-1 and 4-2 with more than 80% homology to sequence 4 was constructed into an AAV vector.
The sequences are specifically shown in the table below.
The plasmid CMV-siRV carrying VEGFR siRNA that inhibits VEGFR expression and the plasmid CMV-siRmT carrying mTOR siRNA that inhibits mTOR expression were constructed according to the method described in Example 2. Wherein, the siRNA of the VEGFR gene has the nucleotide sequence of AUUUGAAGAGUUGUAUUAGCC (SEQ ID NO.: 8), and the siRNA of the mTOR gene has the nucleotide sequence of AGAUAGUUGGCAAAUCUGCCA (SEQ ID NO. 9).
Different mice were injected with PBS buffer/control plasmid/VEGFR siRNA plasmid/mTOR siRNA plasmid/MIX siRNA plasmid (combined use of VEGFR siRNA and mTOR siRNA)/sunitinib/everolimus. The development of kidney cancer tumors in mice was observed, and the results are shown in
In summary, the combined use of VEGFR siRNA and mTOR siRNA had a significant therapeutic effect on kidney cancer tumors.
In the case where the viral vector carries two or more circuits, adjacent gene circuits can be linked via sequence 1-sequence 2-sequence 3; wherein, sequence 1 is preferably CAGATC, sequence 2 may be a sequence of 5-80 bases, such as 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75 bases, preferably a sequence of 10-50 bases, more preferably a sequence of 20-40 bases, and sequence 3 is preferably TGGATC.
Sequence 2 is specifically shown in the table below.
More preferably, in the case where the viral vector carries two or more circuits, adjacent gene circuits are linked via sequence 4 or a sequence with more than 80% homology to sequence 4; wherein sequence 4 is CAGATCTGGCCGCACTCGAGGTAGTGAGTCGACCAGTGGATC.
In the case where the linker is the above sequence 4, or sequence 4-1 and sequence 4-2 with more than 80% homology with sequence 4, detection after 9 h of the injection of the delivery system containing the above sequence shows that it also has the enrichment, self-assembly and therapeutic effects on cancers.
The sequences are specifically shown in the table below.
The plasmid CMV-siRTNF-α carrying TNF-α siRNA that inhibits TNF-α expression, the plasmid CMV-siRintegrin-α carrying anti-integrin-α siRNA that inhibits integrin-α expression, and the plasmid CMVsiRB7 carrying B7 siRNA that inhibits B7 expression were constructed according to the method described in Example 2. Wherein, TNF-α siRNA has the nucleotide sequence of AAAACAUAAUCAAAAGAAGGC (SEQ ID NO. 10, integrin-α siRNA has the nucleotide sequence of AUAAUCAUCUCCAUUAAUGUC (SEQ ID NO. 11), and B7 siRNA has the nucleotide sequence of UUUUCUUUGGGUAAUCUUCAG (SEQ ID NO. 12).
In addition, the plasmid CMV-simix, that is, CMV-SiRTNF-α+integrin-α+B7 carrying siRNAs of TNF-α siRNA, integrin-α siRNA and B7 siRNA simultaneously was constructed according to the method described in Example 2.
In the first experiment, 3 experimental groups and 3 control groups were set up. The experimental groups were anti-TNF-α (0.5) group, anti-TNF-α (5) group and anti-TNF-α (20) group; and the control groups were mock group, scr-RNA group and IFX group.
Among them, the anti-TNF-α (0.5) group, anti-TNF-α (5) group, and anti-TNF-α (20) group were plasmids carrying TNF-α siRNA (CMV-siRTNF-α). 0.5 μL, 5 μL, and 20 μL of CMV-siRTNF-α solutions were injected into the mice through the tail vein.
The mock group was the negative control group, and the scr-RNA group and IFX group were injected with scr-RNA plasmid and IFX (infliximab) through the tail vein of mice respectively.
DSS-induced chronic colitis model was then constructed, during which weights were recorded every day. The results are shown in
After the model was constructed, the in vivo expression of the plasmid system was monitored by small animal in vivo imaging, and then the mice were sacrificed for observation of the colon. The results are shown in
The disease activity index of the mice was evaluated, and the results are shown in
TNF-α mRNA was detected in mouse colon, and the results are shown in
HE staining of mouse colon sections and pathological score statistics were performed, and the results are shown in
The above experiments can prove that the use of plasmid-encapsulated TNF-α siRNA system treatment provided by the present invention was more effective than IFX in improving the manifestations of colitis.
In the second experiment, 4 experimental groups and 3 control groups were set up. The experimental groups were anti-TNF-α group, anti-integrin-α group, anti-B7 group, and anti-mix group. The control groups were mock group, PBS group, and scr-RNA group.
The anti-TNF-α group, anti-integrin-α group, anti-B7 group, and anti-mix group used plasmids to carry TNF-α siRNA (CMV-siRTNF-α), integrin-α siRNA (CMV-siRintegrin-α), B7 siRNA (CMV-siRB7), and siRNAs of TNF-α siRNA, integrin-α siRNA and B7 siRNA simultaneously (CMV-simix, i.e., CMV-siRTNF-α+integrin-α+B7). 20 μL was injected into the mice through tail vein, and the expression of the system was monitored in vivo in small animals. It can be seen that the above system was stably expressed in vivo, especially in the liver.
The mock group was the negative control group, and mice in the scr-RNA group and PBS group were injected with scr-RNA plasmid and PBS solution (phosphate buffered saline solution) through the tail vein, respectively.
DSS-induced chronic colitis model was then constructed, during which weights were recorded every day. The results are shown in
After the model construction was completed, the in vivo expression of the plasmid system was monitored by small animal in vivo imaging, and then the mice were sacrificed for observation of the colon. The results are shown in
The disease activity index of mice was evaluated, and the results are shown in
TNF-α mRNA, integrin mRNA and B7 mRNA were detected in mouse plasma, liver and colon. The results are shown in
HE staining was performed on mouse colon sections. The results are shown in
The virus AAV-CMV-siRTNF-α carrying TNF-α siRNA that inhibits TNF-α expression, the virus AAV-CMVsiRintegrin-α carrying anti-integrin-α siRNA that inhibits integrin-α expression, and the virus AAV-CMV-siRB7 carrying B7 siRNA that inhibits B7 expression were constructed according to the method described in Example 5. Virus. Wherein, TNF-α siRNA has the nucleotide sequence of AAAACAUAAUCAAAAGAAGGC (SEQ ID NO. 10), integrin-α siRNA has the nucleotide sequence of AUAAUCAUCUCCAUUAAUGUC (SEQ ID NO. 11), and B7 siRNA has the nucleotide sequence of UUUUCUUUGGGUAAUCUUCAG (SEQ ID NO. 12). In addition, a virus carrying TNF-α siRNA, integrin-α siRNA and B7 siRNA simultaneously was constructed (AAV-CMV-simix, i.e., CMV-siRTNF-α+integrin-α+B7).
In the first experiment, we set up 3 experimental groups and 2 control groups. The experimental groups were AAV-CMV-siRTNF-α (low) group, AAV-CMV-siRTNF-α (medium) group, and AAV-CMV-siRTNF-α (high) group; and the control groups were Normal group and AAV-CMV-scrR group.
The experimental protocol is shown in
The in vivo expression of the AAV system was monitored by small animal in vivo imaging. The results are shown in
DSS-induced chronic colitis model was then constructed, during which weights was recorded every two days. The results are shown in
At the end of the tenth week of model construction, the in vivo expression of the AAV system was monitored by small animal in vivo imaging, and then the mice were sacrificed for observation of the colon. The results are shown in
The disease index of mice in each group was scored and counted, and the results are shown in
The levels of TNF-α siRNA in mice of each group were detected, and the results are shown in
The levels of TNF-α mRNA in mice of each group were detected, and the results are shown in
The pro-inflammatory cytokines IL-6, IL-12 and IL-23 in the mouse colon were detected, and the results are shown in
HE staining and pathological scoring statistics were performed on mouse colon sections, and the results are shown in
The above experiments show that the use of AAV with high affinity for the liver to encapsulate CMV-siRTNF-α can achieve long-term expression of TNF-α siRNA and long-term TNF-α silencing, and can alleviate colitis to a certain extent, with great drug potential and clinical research value.
In the second experiment, we set up three experimental groups and two control groups. Wherein, the experimental groups were AAV-CMV-siRT+B+I (low) group, AAV-CMV-siRT+B+I (medium) group, and AAV-CMV-siRT+B+I (high) group; and the control groups were Normal group and AAV-CMV-scrR group.
The AAV-CMV-siRT+B+I (low) group, AAV-CMV-siRT+B+I (medium) group, and AAV-CMV-siRT+B+I (high) group used AAV-5 type adeno-associated virus with high affinity for the liver to encapsulate the TNF-α siRNA, B7-siRNA and Integrin α4 siRNA element tandem drug delivery system (AAV-CMV-siRT+B+I). Mice were injected with 25 μL, 50 μL and 100 μL of AAV solution with a titer of 1012 V·g/ml through the tail vein.
The in vivo expression of the AAV system was monitored by small animal in vivo imaging. The results are shown in
DSS-induced chronic colitis model was then constructed, during which weights was recorded every two days. The results are shown in
At the end of the tenth week of model construction, the in vivo expression of the AAV system was monitored by small animal in vivo imaging, and then the mice were sacrificed for observation of the colon. The results are shown in
The disease index of mice in each group was scored and counted, and the results are shown in
The levels of TNF-α siRNA, B7 siRNA and integrin α4 siRNA were detected in mouse plasma, and the results are shown in
The levels of TNF-α siRNA, B7 siRNA and integrin α4 siRNA were detected in mouse liver, and the results are shown in
The levels of TNF-α siRNA, B7 siRNA and integrin α4 siRNA were detected in mouse colon, and the results are shown in
The levels of TNF-α mRNA, B7 mRNA and integrin α4 mRNA were detected in mouse colon, and the results are shown in
HE staining and pathological scoring statistics were performed on mouse colon sections, and the results are shown in
The above experiments show that the use of AAV with high affinity for the liver to encapsulate CMV-siRT+B+I can achieve long-term expression of TNF-α siRNA, B7 siRNA and integrinα4 siRNA and multiple target gene silencing, and can significantly alleviate the degree of colon inflammation, with great drug potential and clinical research value.
The sequences involved above are specifically shown in the table below.
homologous-1
homologous-2
-1
-2
-3
-4
-5
-6
-7
-homologous-1
-homologous-2
indicates data missing or illegible when filed
The plasmid CMV-siRmiR-21 carrying the miR-21 siRNA that inhibits miR-21 expression and the plasmid CMV-siRTGF-β1 carrying the TGF-β1 siRNA that inhibits TGF-β1 expression were constructed according to the method described in Example 2. Wherein, miR-21 siRNA has the antisense strand of miR-21, and TGF-β1 siRNA has the nucleotide sequence of ACGGAAAUAACCUAGAUGGGC (SEQ ID NO. 13).
In addition, the plasmid CMV-siRmiR-21+TGF-β1 carrying both miR-21 siRNA and TGF-β1 siRNA was constructed according to the method described in Example 2.
In this example, 8 experimental groups and 3 control groups were set up. The experimental groups were Anti-miR-21 (1 mg/kg) group, Anti-miR-21 (5 mg/kg) group, Anti-miR-21 (10 mg/kg) group, TGF-β1 siRNA (1 mg/kg) group, TGF-β1 siRNA (5 mg/kg) group, TGF-β1 siRNA (10 mg/kg) group, Anti-miR-21+TGF-β1 siRNA (10 mg/kg) group, Pirfenidone (300 mg/kg) group; and the control group were Normal group, PBS group and scrRNA group.
Among them, mice with pulmonary fibrosis in the Anti-miR-21 (1 mg/kg) group, Anti-miR-21 (5 mg/kg) group, and Anti-miR-21 (10 mg/kg) group were injected into the tail vein with 1 mg/kg, 5 mg/kg, 10 mg/kg of miR-21 siRNA plasmid; mice with pulmonary fibrosis in TGF-β1 siRNA (1 mg/kg) group, TGF-β1 siRNA (5 mg/kg) group, TGF-β1 siRNA (10 mg/kg) group were injected into the tail vein with 1 mg/kg, 5 mg/kg, 10 mg/kg of TGF-β1 siRNA plasmid; mice with pulmonary fibrosis in Anti-miR-21+TGF-β1 siRNA (10 mg/kg) group were injected into the tail vein with 10 mg/kg Anti-miR-21 and TGF-1 siRNA plasmids; and mice with pulmonary fibrosis in Pirfenidone (300 mg/kg) group was injected into the tail vein with 300 mg/kg Pirfenidone. The Normal group was the normal control group, and mice with pulmonary fibrosis in the PBS group and the scrRNA group were injected into the tail vein with PBS solution and control plasmid, respectively.
The hydroxyproline content of mice in each group was detected respectively, and the results are shown in
Fluorescent staining was performed on the lung of mice in each group, and the results are shown in
Masson's trichrome staining was performed on the lung of mice in each group, and the results are shown in
H&E staining was performed on the lung of mice in each group, and the results are shown in
The TGF-β1 protein level and TGF-β1 mRNA level were detected in mice in the Normal group, PBS group, scrRNA group, TGF-β1 siRNA (1 mg/kg) group, TGF-β1 siRNA (5 mg/kg) group, TGF-β1 siRNA (10 mg/kg) group, and Pirfenidone (300 mg/kg) by western blot, and the results are shown in
The relative miR-21 level was detected in mice in the Normal group, PBS group, scrRNA group, Anti-miR-21 (1 mg/kg) group, Anti-miR-21 (5 mg/kg) group, and Anti-miR-21 (10 mg/kg) group, and the results are shown in
The above experiments show that the use of the plasmid with high affinity for the liver to encapsulate CMV-siRmiR-21, CMV-siRTGF-β1, and CMV-siRmiR-21+TGF-β1 can significantly alleviate the degree of pulmonary fibrosis, with great drug potential and clinical research value.
Plasmids comprising sequence fragments of three different 5′ flanking sequences, loop sequences and 3′ flanking sequences also have in vivo enrichment, self-assembly and therapeutic effects on pulmonary fibrosis. The sequences include:
In the case where the RNA plasmid delivery system carries multiple circuits, the linker between adjacent circuits is sequence 2, which can be composed of multiple bases. In this case, the plasmid also has an enrichment effect after injection. Sequence 2 is specifically shown in the table below.
The sequences are specifically shown in the table below, in which sequence 4-1 is the above-mentioned sequence 4, and sequences 4-2/4-3/4-4 are homologous sequences with more than 80% homology to sequence 4-1.
The plasmid delivery system comprising RNA sequence of lengths 18, 19, and 21 have in vivo enrichment, self-assembly, and therapeutic effects on pulmonary fibrosis.
The sequences are specifically shown in the table below.
The plasmid delivery system, in the case of carrying the RNA fragment, has in vivo enrichment effect, effect of spontaneously forming into a complex and therapeutic effects on pulmonary fibrosis. The grouping of RNA fragments includes but is not limited to:
The sequences are specifically shown in the table below.
The virus AAV-CMV-siRmiR-21 carrying miR-21 siRNA that inhibits miR-21 expression and the virus AAV-CMVsiRTGF-β1 carrying TGF-β1 siRNA that inhibits TGF-β1 expression were constructed according to the methods described in Example 5 and Example 9. Wherein, miR-21 siRNA has the antisense strand of miR-21, and TGF-β1 siRNA has the nucleotide sequence of ACGGAAAUAACCUAGAUGGGC (SEQ ID NO. 13). In addition, the virus AAV-CMV-MIX, that is, AAV-CMV-siRmiR-21+TGF-β1 carrying both miR-21 siRNA and TGF-β1 siRNA was constructed.
Mice were injected with 100 μL of AAV solution with a titer of 1012 V·g/ml through the tail vein. The in vivo expression of the AAV system was monitored by small animal in vivo imaging, and after 3 weeks, the AAV system was stably expressed in the body, especially in the liver.
Mice were then selected for modeling. After the modeling was successful, PBS buffer/AAV-scrR/AAV-anti-miR21/AAV-TGF-β1 siRNA/AAV-MIX (10 mg/kg) was injected into mice to obtain PBS group/AAV-scrR group/AAV-anti-miR21 group/AAV-TGF-β1 siRNA group/AAV-MIX group, respectively.
The relative TGF-β1 mRNA level was detected in mice in the Normal group, PBS group, AAV-scrR group, and AAV-TGF-β1 siRNA group, and the results are shown in
The relative miR21 mRNA level was detected in mice in the Normal group, PBS group, AAV-scrR group, and AAV-anti-miR21 group, and the results are shown in
The hydroxyproline content of mice in each group was detected, and the results are shown in
Further, the viral vector can also comprise a flanking sequence, a compensation sequence and a loop sequence that facilitate the correct folding and expression of the circuit, and the flanking sequence comprises 5′ flanking sequence and 3′ flanking sequence; the viral vector comprises a circuit selected from the group consisting of 5′ promoter-5′ flanking sequence-RNA fragment-loop sequence-compensation sequence-3′ flanking sequence, 5′-promoter-targeting tag, and 5′ promoter-targeting tag-5′ flanking sequence-RNA fragment-loop sequence-compensation sequence-3′ flanking sequence, or a combination thereof.
Wherein, the 5′ flanking sequence preferably has a sequence that is identical to or more than 80% homologous with ggatcctggaggcttgctgaaggctgtatgctgaattc, including sequences with 85%, 90%, 92%, 95%, 98%, or 99% homology with ggatcctggaggcttgctgaaggctgtatgctgaattc.
The loop sequence preferably has a sequence that is identical to or more than 80% homologous with gttttggccactgactgac, including sequences with 85%, 90%, 92%, 95%, 98%, 99% homology with gttttggccactgactgac.
The 3′ flanking sequence preferably has a sequence that is identical to or more than 80% homologous with accggtcaggacacaaggcctgttactagcactcacatggaacaaatggcccagatctggccgcactcgag, including sequences with 85%, 90%, 92%, 95%, 98%, 99% homology with accggtcaggacacaaggcctgttactagcactcacatggaacaaatggcccagatctggccgcactcgag.
The compensation sequence is the reverse complementary sequence of the RNA fragment with any 1-5 bases deleted. In the case where the RNA fragment contains only one RNA sequence, the compensation sequence may be the reverse complementary sequence of the RNA sequence with any 1-5 bases deleted.
Preferably, the compensation sequence is the reverse complementary sequence of the RNA fragment with any 1-3 bases deleted. In the case where the RNA fragment contains only one RNA sequence, the compensation sequence may be the reverse complementary sequence of the RNA sequence with any 1-3 bases deleted.
More preferably, the compensation sequence is the reverse complementary sequence of the RNA fragment with any 1-3 contiguous bases deleted. In the case where the RNA fragment contains only one RNA sequence, the compensation sequence may be the reverse complementary sequence of the RNA sequence with any 1-3 contiguous bases deleted.
Most preferably, the compensation sequence is the reverse complementary sequence of the RNA fragment with the base at position 9 and/or 10 deleted. In the case where the RNA fragment contains only one RNA sequence, the compensation sequence may be a reverse complementary sequence of the RNA sequence with the base at position 9 and/or 10 deleted. Deleting the base at position 9 and/or 10 has the best effect.
It should be noted that the above-mentioned flanking sequence, compensation sequence, and loop sequence are not randomly selected, but are determined based on a large number of theoretical studies and experiments. With the cooperation of the above-mentioned certain flanking sequence, compensation sequence, and loop sequence, the expression rate of RNA fragments can be maximized.
Adenoviral vectors comprising three homologous sequences also have in vivo enrichment, self-assembly and therapeutic effects on pulmonary fibrosis. The sequences are grouped as follows:
In the case where the viral vector carries two or more circuits, adjacent gene circuits can be linked via sequence 1-sequence 2-sequence 3; wherein, sequence 1 is preferably CAGATC, sequence 2 may be a sequence of 5-80 bases, such as 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75 bases, preferably a sequence of 10-50 bases, more preferably a sequence of 20-40 bases, and sequence 3 is preferably TGGATC.
In the case where the adenoviral vector carries multiple circuits and adjacent circuits are linked via sequence 1-sequence 2-sequence 3, with sequence 2 containing multiple bases, the constructed delivery system also has in vivo enrichment, self-assembly and therapeutic effects on pulmonary fibrosis.
Sequence 2 is specifically shown in the table below.
More preferably, in the case where the viral vector carries two or more circuits, adjacent gene circuits are linked via sequence 4 or a sequence with more than 80% homology to sequence 4; wherein sequence 4 is CAGATCTGGCCGCACTCGAGGTAGTGAGTCGACCAGTGGATC.
In the case where the linker is sequence 4, or sequence with more than 80% homology with sequence 4, the constructed delivery system also has in vivo enrichment, self-assembly and therapeutic effects on pulmonary fibrosis, wherein sequence 4-1 is the above-mentioned sequence 4, and sequences 4-2/4-3/4-4 are homologous sequences to sequence 4-1. The sequences are specifically shown in the table below.
The RNA fragment may comprise one, two or more RNA sequences with medical significance. The RNA sequence can be expressed in the target receptor, and the compensation sequence cannot be expressed in the target receptor. The RNA sequence may be an siRNA sequence, shRNA sequence or miRNA sequence, preferably an siRNA sequence.
The length of an RNA sequence is 15-25 nucleotides (nt), preferably 18-22 nt, such as 18 nt, 19 nt, 20 nt, 21 nt, or 22 nt. The range of the sequence length is not chosen arbitrarily but was determined after repeated trials. A large number of experiments have proved that in the case where the length of the RNA sequence is less than 18 nt, especially less than 15 nt, the RNA sequence is mostly invalid and will not play a role. In the case where the length of the RNA sequence is greater than 22 nt, especially greater than 25 nt, not only does the cost of the circuit increase greatly, but the effect is no better than that of an RNA sequence with a length of 18-22 nt, and the economic benefits are poor. Therefore, in the case where the length of the RNA sequence is 15-25 nt, especially 18-22 nt, the cost and function can be balanced with the best effect.
The constructed delivery system constructed with RNA sequence of lengths 18, 19, and 21 have in vivo enrichment, self-assembly, and therapeutic effects on pulmonary fibrosis.
The sequences are specifically shown in the table below.
The viral vector system, in the case of carrying multiple RNA fragments, has in vivo enrichment, self-assembly and therapeutic effects on pulmonary fibrosis, as shown in
The RNA sequences are specifically shown in the table below.
The effect of the plasmid carrying RVG targeting peptide prepared according to Example 2 on glioblastoma was detected.
In the first experiment, 5 experimental groups and 3 control groups were set up. The experimental groups were CMV-siRE group, CMV-siRT group, CMV-RVG-siRE+T group, CMV-siRE+T group, CMV-Flag-siRE+T group, where “E” represents EGFR, “T” represents TNC, and the control groups were PBS group, CMV-scrR group, and CMV-Flag-scrR group. The specific experimental protocol is shown in
The expression levels of CD63 protein and siRNA of mice in each group were detected. The results are shown in
In the second experiment, 2 experimental groups and 2 control groups were set up. The experimental groups were CMV-RVG-siRE group and CMV-RVG-siRE+T group, and the control groups were PBS group and CMV-scrR group.
The specific experimental protocol is shown in
The above experimental data demonstrate that intravenous injection of CMV-RVG-siRE+T plasmid can deliver siRNA to the brain and inhibit the growth of glioblastoma.
The brains of mice in each group were subjected to immunohistochemical staining, and the proportion of EGFR, TNC, and PCNA staining in each visual field was counted. The results are shown in
The plasmid does have the effect of enriching in vivo and spontaneously forming a complex structure containing an RNA fragment. The present invention provides a random group of experimental data of plasmids carrying four of the circuits, in which the adjacent circuits are linked via sequence 1-sequence 2-sequence 3, with sequence 2 of 5 bases, 10 bases, 20 bases, 30 bases, 40 bases, 50 bases or 80 bases. The enrichment and self-assembly effects of the plasmids were verified through experiments.
Sequence 2 is specifically shown in the table below.
More preferably, in the case where the plasmid carries two or more circuits, adjacent gene circuits are linked via sequence 4 or a sequence with more than 80% homology to sequence 4; wherein sequence 4 is CAGATCTGGCCGCACTCGAGGTAGTGAGTCGACCAGTGGATC.
In order to prove that the plasmid does have the effects of in vivo enrichment and spontaneously forming a complex structure containing an RNA fragment, the present invention provides a random group of experimental data of plasmids containing the linker of sequence 4 or at least two sequences with a homology of more than 80% to sequence 4. The enrichment and self-assembly effects of the plasmids were verified through experiments.
The sequences are specifically shown in the table below.
The effects of viruses carrying RVG targeting peptide prepared as described in Examples 2 and 5 on glioblastoma were detected.
Material: AAV-CMV-RVG-siRE and AAV-CMV-RVG-siRE+T. Mice were injected with 100 μL of AAV solution with a titer of 1012 V·g/ml through the tail vein. The in vivo expression of the AAV system was monitored by small animal in vivo imaging, and after 3 weeks, the AAV system was stably expressed in the body, especially in the liver.
Mice were selected and injected with glioblastoma cells (U-87 MG-Luc cells). From the 7th day to the 21st day, mice were injected with PBS buffer/AAV-CMV-scrR/AAV-CMV-RVG-siRE/AAV-CMV-RVG-siRE+T (5 mg/kg) every two days for treatment, to obtain PBS group/AAV-scrR group/AAV-CMV-RVG-siRE group/AAV-CMV-RVG-siRE+T group, respectively.
Survival analysis was performed on mice in each group, and the survival rate of mice in each group was counted at 20 days, 40 days, 60 days, and 80 days after receiving treatment. The results are shown in
Tumor evaluation was performed on mice in each group. Specifically, BLI in vivo imaging was performed on mice on days 7, 14, 28, and 35. The results are shown in
In order to prove that the viral vector does have the effects of in vivo enrichment and self-assembly, the present invention provides a random group of experimental data of viral vectors carrying four of the circuits, in which the adjacent circuits are linked via sequence 1-sequence 2-sequence 3, with sequence 2 of 5 bases, 10 bases, 20 bases, 30 bases, 40 bases, 50 bases or 80 bases. The enrichment and self-assembly effects of the viral vectors were verified through experiments.
Sequence 2 is specifically shown in the table below.
More preferably, in the case where the viral vector carries two or more circuits, adjacent gene circuits are linked via sequence 4 or a sequence with more than 80% homology to sequence 4; wherein sequence 4 is CAGATCTGGCCGCACTCGAGGTAGTGAGTCGACCAGTGGATC.
In order to prove that the viral vector does have the effects of in vivo enrichment and self-assembly, the present invention provides a random group of experimental data of viral vectors containing the linker of sequence 4 or at least two sequences with a homology of more than 80% to sequence 4. The enrichment and self-assembly effects of the viral vectors were verified through experiments.
The sequences are specifically shown in the table below.
The plasmid CMV-siRP carrying PTP1B siRNA that inhibits PTP1B expression, and the plasmid CMV-RVG-siRP carrying targeting peptide RVG and PTP1B siRNA were constructed according to the method described in Example 2. Similarly, the virus AAV-CMV-siRP carrying PTP1B siRNA that inhibits PTP1B expression and the virus AAV-CMV-RVG-siRP carrying targeting peptide RVG were constructed according to the method described in Example 5. Wherein, the siRNA of PTP1B gene has the nucleotide sequence of UGAUAUAGUCAUUAUCUUCUU (SEQ ID NO. 14).
In the first experiment, 2 experimental groups and 1 control group were set up. The experimental groups were CMV-siRP group and CMV-RVG-siRP group, and the control group was CMV-scrR group, where “P” means PTP1B.
Mice in the CMV-siRP group, CMV-RVG-siRP group, and CMV-scrR group were injected with 5 mg/kg CMV-siRP plasmid, CMV-RVG-siRP plasmid, and CMV-scrR plasmid respectively, and then fluorescence microscope images of the hypothalamus and liver of mice in each group were obtained respectively. The results are shown in
In the second experiment, 2 experimental groups and 2 control groups were set up. The experimental groups were CMV-siRP group the comparison of the body weights of mice in each group. It can be seen that the body weight of mice in the CMV-RVG-siRP group was the most stable.
The oxygen consumption, respiratory exchange ratio, activity volume, and heat production of differently treated mice were continuously detected for 72 h using metabolic cages, and then the average values were drawn for statistical analysis. The results are shown in
From the above experiments, it can be concluded that intravenous injection of CMV-RVG-siRP plasmid can reduce obesity in obese mouse models.
The serum total cholesterol (TC), triglycerides (TG), and low-density lipoprotein (LDL) of mice in each group were measured, and the results are shown in
The body length of mice in each group was measured, and the results are shown in
The HFD food intake of mice in each group was counted, and the results are shown in
The liver tissue of mice in each group was collected after treatment and compared with the normal control. The results are shown in
The above experiments show that intravenous injection of CMV-RVG-siRP plasmid can reduce fatty liver in obese mice.
In addition, C57BL/6 mice were selected and injected with PBS buffer/AAV-CMV-scrR/AAV-CMV-siRP/AAV-CMV-RVG-siRP 12 weeks later, and once every two days for 24 days to obtain PBS group/AAV-CMV-scrR group/AAV-CMV-siRP group/AAV-CMV-RVG-siRP group, respectively. The changes in body weight, weight of epididymal fat pads, initial food intake, serum leptin content, blood sugar content, basal glucose content, serum total cholesterol (TC), triglyceride (TG), low-density lipoprotein protein (LDL), body length, and food intake of mice in each group were detected and counted. The results are as follows.
The above experiments can demonstrate that AAV-CMV-siRP and AAV-CMV-RVG-siRP had inhibitory effect on obesity.
Adenoviral vectors comprising three homologous sequences also have in vivo enrichment, self-assembly and therapeutic effects on obesity, as shown in
In the case where the viral vector carries two or more circuits, adjacent gene circuits can be linked via sequence 1-sequence 2-sequence 3; wherein, sequence 1 is preferably CAGATC, sequence 2 may be a sequence of 5-80 bases, such as 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75 bases, preferably a sequence of 10-50 bases, more preferably a sequence of 20-40 bases, and sequence 3 is preferably TGGATC.
In the case where the adenoviral vector carries multiple circuits and adjacent circuits are linked via sequence 1-sequence 2-sequence 3, with sequence 2 containing multiple bases, the constructed delivery system also has in vivo enrichment, self-assembly and therapeutic effects on obesity.
Sequence 2 is specifically shown in the table below.
More preferably, in the case where the viral vector carries two or more circuits, adjacent gene circuits are linked via sequence 4 or a sequence with more than 80% homology to sequence 4; wherein sequence 4 is CAGATCTGGCCGCACTCGAGGTAGTGAGTCGACCAGTGGATC.
In the case where the linker is sequence 4, or sequence with more than 80% homology with sequence 4, the constructed delivery system also has in vivo enrichment, self-assembly and therapeutic effects on obesity, wherein sequence 4-1 is the above-mentioned sequence 4, and sequences 4-2/4-3/4-4 are homologous sequences to sequence 4-1. The sequences are specifically shown in the table below.
The RNA fragment may comprise one, two or more RNA sequences with medical significance. The RNA sequence can be expressed in the target receptor, and the compensation sequence cannot be expressed in the target receptor. The RNA sequence may be an siRNA sequence, shRNA sequence or miRNA sequence, preferably an siRNA sequence.
The length of an RNA sequence is 15-25 nucleotides (nt), preferably 18-22 nt, such as 18 nt, 19 nt, 20 nt, 21 nt, or 22 nt. The range of the sequence length is not chosen arbitrarily but was determined after repeated trials. A large number of experiments have proved that in the case where the length of the RNA sequence is less than 18 nt, especially less than 15 nt, the RNA sequence is mostly invalid and will not play a role. In the case where the length of the RNA sequence is greater than 22 nt, especially greater than 25 nt, not only does the cost of the circuit increase greatly, but the effect is no better than that of an RNA sequence with a length of 18-22 nt, and the economic benefits are poor. Therefore, in the case where the length of the RNA sequence is 15-25 nt, especially 18-22 nt, the cost and function can be balanced with the best effect.
The constructed delivery system constructed with RNA sequence of lengths 18, 20, and 21 have in vivo enrichment, self-assembly, and therapeutic effects on obesity.
The sequences are specifically shown in the table below.
The viral vector system, in the case of carrying multiple RNA fragments, has in vivo enrichment, self-assembly and therapeutic effects on obesity, as shown in
The RNA sequences are specifically shown in the table below.
The plasmid CMV-siRmHTT carrying mHTT siRNA that inhibits mHTT expression, and the plasmid CMV-RVG-siRP carrying targeting peptide RVG and mHTT siRNA were constructed according to the method described in Example 2. Similarly, the virus AAV-CMV-siRmHTT carrying mHTT siRNA that inhibits mHTT expression and the virus AAV-CMV-RVG-siRmHTT carrying targeting peptide RVG were constructed according to the method described in Example 5. Wherein, the siRNA of mHTT gene has the nucleotide sequence of UAUGUUUUCACAUAUUGUCAG (SEQ ID NO. 15).
In the first experiment, 2 experimental groups and 2 control groups were set up. The experimental groups were CMV-siRmHTT group and CMV-RVG-siRmHTT group, and the control groups were PBS group and CMV-scrR group.
The experimental protocol is shown in
After injecting plasmid/solution into mice in each group, plasma exosomes were extracted, labeled with PKH26, co-cultured with cells and photographed using a confocal microscope. The results are shown in
After co-culturing the extracted plasma exosomes from mice in each group with cells, the changes in HTT protein levels and mRNA levels of mice in each group were detected. As shown in
After co-culturing the extracted plasma exosomes from mice in each group with cells, the aggregation of HTT protein of mice in each group was observed and counted. As shown in
The absolute siRNA expression levels in the liver, plasma, cortex, and striatum of mice in each group were detected respectively.
In the second experiment, 2 experimental groups and 2 control groups were set up. The experimental groups were CMV-siRGFP group and CMV-RVG-siRGFP group, and the control groups were PBS group and CMV-scrR group. GFP transgenic mice in the CMV-siRGFP group, CMV-RVG-siRGFP group, PBS group, and CMV-scrR group were injected with CMV-siRGFP plasmid, CMV-RVG-siRGFP plasmid, PBS solution, and CMV-scrR plasmid through the tail vein, respectively.
In the third experiment, two experimental groups and one control group were set up. The experimental groups were CMV-siRmHTT group and CMV-RVG-siRmHTT group, and the control group was CMV-scrR group.
The experimental protocol is shown in
In the fourth experiment, one experimental group and one control group were set up. The experimental group was CMV-RVG-siRmHTT group, and the control group was CMV-scrR group.
The experimental protocol is shown in
The above experiments demonstrate that intravenous injection of CMV-RVG-siRmHTT plasmid helps suppress mHTT in the striatum and cortex, thereby improving exercise capacity and alleviating neuropathology in HD mice.
In the fifth experiment, one experimental group and one control group were set up. The experimental group was the CMV-RVG-siRmHTT group, and the control group was the CMV-scrR group.
The experimental protocol is shown in
The above experiments can demonstrate that intravenous injection of CMV-RVG-siRmHTT plasmid can help reduce mHTT protein and toxic aggregates in the striatum and cortex, thereby improving behavioral defects and neuropathology in the striatum and cortex.
In addition, similar experiments were performed on viral vectors. Mice were injected with 100 μL of AAV solution with a titer of 1012 V·g/ml through the tail vein. The in vivo expression of the AAV system was monitored by small animal in vivo imaging, and after 3 weeks, the AAV system was stably expressed in the body, especially in the liver.
Mice were then selected for modeling. After the completion of modeling, mice were injected with PBS buffer/AAV-CMV-scrR/AAV-CMV-siRmHTT/AAV-CMV-RVG-siRmHTT to obtain PBS group/AAV-CMV-scrR group/AAV-CMV-siRmHTT group/AAV-CMV-RVG-siRmHTT group. After the above solution was injected into the tail vein, the plasma exosomes were isolated, labeled with PKH26 dye, and co-cultured with cells to observe the absorption of exosomes by cells. The results are as follows.
The above experiments can demonstrate that intravenous injection of AAV-CMV-RVG-siRmHTT can help reduce mHTT protein and toxic aggregates in the striatum and cortex, thereby exerting a therapeutic effect on Huntington's disease.
In the case where the viral vector carries two or more circuits, adjacent gene circuits can be linked via sequence 1-sequence 2-sequence 3; wherein, sequence 1 is preferably CAGATC, sequence 2 may be a sequence of 5-80 bases, such as 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75 bases, preferably a sequence of 10-50 bases, more preferably a sequence of 20-40 bases, and sequence 3 is preferably TGGATC.
Sequence 2 is specifically shown in the table below.
More preferably, in the case where the viral vector carries two or more circuits, adjacent gene circuits are linked via sequence 4 or a sequence with more than 80% homology to sequence 4; wherein sequence 4 is CAGATCTGGCCGCACTCGAGGTAGTGAGTCGACCAGTGGATC.
The sequences are specifically shown in the table below.
The plasmid CMV-siRLRRK2 carrying LRRK2 siRNA that inhibits LRRK2 expression, and the plasmid CMV-RVG-siRLRRK2 carrying targeting peptide RVG and LRRK2 siRNA were constructed according to the method described in Example 2. Wherein, the siRNA of LRRK2 gene is AUUAACAUGAAAAUAUCACUU (SEQ ID NO. 16).
Use of the vector system in the treatment of Parkinson's disease was investigated.
In this experiment, LRRK2R1441G transgenic mice were selected for the experiment when they were 3 months old, and an LPS intervention group and an LPS non-intervention group were set up. The LPS intervention group was treated with CMV-scrR/CMV-RVG-siRLRRK2 7 days after LPS intervention.
The above experiments can demonstrate that intravenous injection of CMV-RVG-siRLRRK2 plasmid helps suppress LRRK2 in dopaminergic neurons, thereby reducing the development of neuropathology in mice with Parkinson's disease.
In the case where the plasmid carries two or more circuits, adjacent circuits can be linked via sequence 1-sequence 2-sequence 3; wherein, sequence 1 is preferably CAGATC, sequence 2 may be a sequence of 5-80 bases, such as 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75 bases, preferably a sequence of 10-50 bases, more preferably a sequence of 20-40 bases, and sequence 3 is preferably TGGATC.
Sequence 2 is specifically shown in the table below.
More preferably, in the case where the plasmid carries two or more circuits, adjacent gene circuits are linked via sequence 4 or a sequence with more than 80% homology to sequence 4; wherein sequence 4 is CAGATCTGGCCGCACTCGAGGTAGTGAGTCGACCAGTGGATC.
The sequences are specifically shown in the table below.
In the case where the viral vector carries two or more circuits, adjacent gene circuits can be linked via sequence 1-sequence 2-sequence 3; wherein, sequence 1 is preferably CAGATC, sequence 2 may be a sequence of 5-80 bases, such as 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75 bases, preferably a sequence of 10-50 bases, more preferably a sequence of 20-40 bases, and sequence 3 is preferably TGGATC.
Sequence 2 is specifically shown in the table below.
More preferably, in the case where the viral vector carries two or more circuits, adjacent gene circuits are linked via sequence 4 or a sequence with more than 80% homology to sequence 4; wherein sequence 4 is CAGATCTGGCCGCACTCGAGGTAGTGAGTCGACCAGTGGATC.
The sequences are specifically shown in the table below.
The RNA delivery vector system provided by the present invention was studied in more detail in Macaca fascicularis, a well-known non-human primate model used in safety assessment studies.
With ethical approval, 4 adult macaques were used for intravenous injection of 5 mg/kg CMV-siRE plasmid, and blood samples were collected before injection or at different time points after injection. One month later, these macaques were intravenously injected with 5 mg/kg CMV-siRE plasmid daily for a total of 5 times, and blood samples were collected before injection or at different time points after the last injection.
The above experiments can show that CMV-siRE plasmid can be safe and effective for primates such as Macaca fascicularis.
The above is a description of the present invention, and it cannot be regarded as a limitation of the present invention. Unless otherwise indicated, the practice of the present invention will employ conventional techniques of organic chemistry, polymer chemistry, biotechnology, etc. It will be apparent that the present invention may be carried out in other ways than those specifically described in the above description and examples. Other aspects and modifications within the scope of the invention will be apparent to those skilled in the art to which this invention belongs. Many modifications and variations are possible in light of the teachings of the present invention and are therefore within the scope of the present invention.
| Number | Date | Country | Kind |
|---|---|---|---|
| 202110335617.9 | Mar 2021 | CN | national |
| 202110336982.1 | Mar 2021 | CN | national |
| 202110336983.6 | Mar 2021 | CN | national |
This present application is a continuation application of International Patent Application No. PCT/CN2022/083876, filed on Mar. 29, 2022, and titled “NUCLEIC ACID DELIVERY SYSTEM AND APPLICATION THEREOF,” which claims priority to Chinese Patent Application No. 202110335617.9, filed with the China National Intellectual Property Administration on Mar. 29, 2021, and titled with “RNA PLASMID DELIVERY SYSTEM AND USE THEREOF,” Chinese Patent Application No. 202110336982.1, filed with the China National Intellectual Property Administration on Mar. 29, 2021, and titled with “VIRAL VECTOR-BASED RNA DELIVERY SYSTEM AND USE THEREOF,” and Chinese Patent Application No. 202110336983.6, filed with the China National Intellectual Property Administration on Mar. 29, 2021, and titled with “GENE CIRCUIT, RNA DELIVERY SYSTEM AND USE THEREOF,” which are hereby incorporated by reference in their entireties. Sequence Listing: Applicant hereby incorporates the sequence listing by reference. The sequence listing is in XML format. The file name is DOP2322876020PUS.xml. The file is 230 KB in size.
| Number | Date | Country | |
|---|---|---|---|
| Parent | PCT/CN2022/083876 | Mar 2022 | WO |
| Child | 18373605 | US |
