Nucleic acid ligands which bind to hepatocyte growth factor/scatter factor (HGF/SF) or its receptor c-met

Abstract

The invention provides nucleic acid ligands to hepatocyte growth factor/scatter factor (HGF) and its receptor c-met. The nucleic acid ligands of the instant invention are isolated using the SELEX method. SELEX is an acronym for Systematic Evolution of Ligands by EXponential enrichment. The nucleic acid ligands of the invention are useful as diagnostic and therapeutic agents for diseases in which elevated HGF and c-met activity are causative factors.

Description

FIELD OF THE INVENTION

This invention is directed towards obtaining nucleic acid ligands of hepatocyte growth factor/scatter factor (HGF) and its receptor c-met. The method used in the invention is called SELEX, which is an acronym for Systematic Evolution of Ligands by EXponential enrichment. The invention is also directed towards therapeutic and diagnostic reagents for diseases in which elevated HGF and c-met activity are causative factors.

BACKGROUND OF THE INVENTION

Hepatocyte growth factor/scatter factor (abbreviated herein as HGF) is a potent cytokine which, through interaction with its receptor c-met, stimulates proliferation, morphogenesis, and migration of a wide variety of cell types, predominantly epithelial. HGF and c-met are involved in several cellular processes involved in tumorigenesis, notably angiogenesis and motogenesis, the latter having been implicated in the migration of cells required for metastasis (reviewed in references Jiang and Hiscox 1997, Histol Histopathol. 12:537-55; Tamagnone and Comoglio 1997, Cytokine Growth Factor Rev. 8:129-42; Jiang, Hiscox et al. 1999, Crit Rev Oncol Hematol. 29:209-48). Interestingly, proteases that degrade the extracellular matrix also activate HGF, which in turn up-regulates urokinase type plasminogen activator (uPA) and its receptor, resulting in an activating loop feeding the invasive and migratory processes required for metastatic cancer.

HGF and the c-met receptor are expressed at abnormally high levels in a large variety of solid tumors. In addition to numerous demonstrations in vitro of the effects of HGF/c-met on the behavior of tumor cell lines, the levels of HGF and/or c-met have been measured in human tumor tissues (reviewed in reference Jiang 1999, Crit Rev Oncol Hematol. 29:209-48). High levels of HGF and/or c-met have been observed in liver, breast, pancreas, lung, kidney, bladder, ovary, brain, prostate, gallbladder and myeloma tumors in addition to many others.

For several of the cancer types listed above, the prognostic value of measuring HGF/c-met levels has been evaluated and found to be potentially useful for determining the progression and severity of disease. The correlative data are strongest in the case of breast cancer (Ghoussoub, Dillon et al. 1998, Cancer. 82:1513-20; Toi, Taniguchi et al. 1998, Clin Cancer Res. 4:659-64), and non-small cell lung cancer (Siegfried, Weissfeld et al. 1997, Cancer Res. 57:433-9; Siegfried, Weissfeld et al. 1998, Ann Thorac Surg. 66:1915-8).

Elevated levels of HGF and c-met have also been observed in non-oncological settings, such as hypertension (Morishita, Aoki et al. 1997, J Atheroscler Thromb. 4:12-9; Nakamura, Moriguchi et al. 1998, Biochem Biophys Res Commun. 242:238-43), arteriosclerosis (Nishimura, Ushiyama et al. 1997, J Hypertens. 15:1137-42; Morishita, Nakamura et al. 1998, J Atheroscler Thromb. 4:128-34), myocardial infarction (Sato, Yoshinouchi et al. 1998, J Cardiol. 32:77-82), and rheumatoid arthritis (Koch, Halloran et al. 1996, Arthritis Rheum. 39:1566-75), raising the possibility of additional therapeutic and diagnostic applications.

The role of HGF/c-met in metastasis has been elucidated in mice using cell lines transformed with HGF/c-met (reviewed in reference Jeffers, Rong et al. 1996, J Mol Med. 74:505-13). In another metastasis model, human breast carcinoma cells expressing HGF/c-met were injected in the mouse mammary fat pad, resulting in eventual lung metastases in addition to the primary tumor (Meiners, Brinkmann et al. 1998, Oncogene. 16:9-20). Also, transgenic mice which overexpress HGF become tumor-laden at many loci (Takayama, LaRochelle et al. 1997, Proc Natl Acad Sci U S A. 94:701-6).

None of the data mentioned above provide proof of a direct causative role of HGF/c-met in human cancer, although the accumulated weight of the correlative data are convincing. However, a causal connection was established between germ-line c-met mutations, which constitutively activate its tyrosine kinase domain, and the occurrence of human papillary renal carcinoma (Schmidt, Duh et al. 1997, Nat Genet. 16:68-73).

Recent work on the relationship between inhibition of angiogenesis and the suppression or reversion of tumor progression shows great promise in the treatment of cancer (Boehm, Folkman et al. 1997, Nature. 390:404-7). In this report, it was shown that the use of multiple angiogenesis inhibitors confers superior tumor suppression/regression compared to the effect of a single inhibitor. Angiogenesis is markedly stimulated by HGF, as well as vascular endothelial growth factor (VEGF) and basic fibroblast growth factor (bFGF) (Rosen, Lamszus et al. 1997, Ciba Found Symp. 212:215-26). HGF and VEGF were recently reported to have an additive or synergistic effect on mitogenesis of human umbilical vein endothelial cells (HUVECs) (Van Belle, Witzenbichler et al. 1998, Circulation. 97:381-90). Similar combined effects are likely to contribute to angiogenesis and metastasis.

Human HGF protein is expressed as a single peptide chain of 728 amino acids (reviewed in references Mizuno and Nakamura 1993, Exs. 65:1-29; Rubin, Bottaro et al. 1993, Biochim Biophys Acta. 1155:357-71; Jiang 1999, Crit Rev Oncol Hematol. 29:209-48). The amino-terminal 31 residue signal sequence of HGF is cleaved upon export, followed by proteolytic cleavage by uPA and/or other proteases. The mature protein is a heterodimer consisting of a 463 residue α-subunit and a 234 residue β-subunit, linked via a single disulfide bond. HGF is homologous to plasminogen: its α-subunit contains an N-terminal plasminogen-activator-peptide (PAP) followed by four kringle domains, and the β-subunit is a serine protease-like domain, inactive because it lacks critical catalytic amino acids. The recently solved crystal structure of an HGF fragment containing PAP and the first kringle domain indicate that this region is responsible for heparin binding and dimerization (Chirgadze, Hepple et al. 1999, Nat Struct Biol. 6:72-9), in addition to receptor interaction.

Human c-met protein is exported to the cell surface via a 23 amino acid signal sequence (reviewed in references Comoglio 1993, Exs. 65:131-65; Rubin 1993, Biochim Biophys Acta. 1155:357-71; Jiang 1999, Crit Rev Oncol Hematol. 29:209-48). The exported form of c-met is initially a pro-peptide which is proteolytically cleaved. The mature protein is a heterodimer consisting of an extracellular 50 kDa α-subunit bound by disulfide bonds to a 140 kDa β-subunit. In addition to its extracellular domain, the β-subunit has a presumed membrane-spanning sequence and a 435 amino acid intracellular domain containing a typical tyrosine kinase.

HGF is produced primarily by mesenchymal cells, while c-met is mainly expressed on cells of epithelial origin. HGF is very highly conserved at the amino acid level between species. This homology extends into the functional realm as observed in mitogenic stimulation of hepatocytes in culture by HGF across species, including human, rat, mouse, pig and dog. This indicates that human HGF can be used cross-specifically in a variety of assays.

Given the roles of HGF and c-met in disease, it would be desirable to have agents that bind to and inhibit the activity of these proteins. It would also be desirable to have agents that can quantitate the levels of HGF and c-met in individual in order to gather diagnostic and prognostic information.

The dogma for many years was that nucleic acids had primarily an informational role. Through a method known as Systematic Evolution of Ligands by EXponential enrichment, termed the SELEX process, it has become clear that nucleic acids have three dimensional structural diversity not unlike proteins. The SELEX process is a method for the in vitro evolution of nucleic acid molecules with highly specific binding to target molecules and is described in U.S. patent application Ser. No. 07/536,428, filed Jun. 11, 1990, entitled “Systematic Evolution of Ligands by EXponential Enrichment,” now abandoned, U.S. Pat. No. 5,475,096 entitled “Nucleic Acid Ligands”, U.S. Pat. No. 5,270,163 (see also WO 91/19813) entitled “Methods For Identifying Nucleic Acid Ligands” each of which is specifically incorporated by reference herein. Each of these applications, collectively referred to herein as the SELEX Patent Applications, describes a fundamentally novel method for making a nucleic acid ligand to any desired target molecule. The SELEX process provides a class of products which are referred to as nucleic acid ligands or aptamers, each having a unique sequence, and which has the property of binding specifically to a desired target compound or molecule. Each SELEX-identified nucleic acid ligand is a specific ligand of a given target compound or molecule. The SELEX process is based on the unique insight that nucleic acids have sufficient capacity for forming a variety of two- and three-dimensional structures and sufficient chemical versatility available within their monomers to act as ligands (form specific binding pairs) with virtually any chemical compound, whether monomeric or polymeric. Molecules of any size or composition can serve as targets. The SELEX method applied to the application of high affinity binding involves selection from a mixture of candidate oligonucleotides and step-wise iterations of binding, partitioning and amplification, using the same general selection scheme, to achieve virtually any desired criterion of binding affinity and selectivity. Starting from a mixture of nucleic acids, preferably comprising a segment of randomized sequence, the SELEX method includes steps of contacting the mixture with the target under conditions favorable for binding, partitioning unbound nucleic acids from those nucleic acids which have bound specifically to target molecules, dissociating the nucleic acid-target complexes, amplifying the nucleic acids dissociated from the nucleic acid-target complexes to yield a ligand-enriched mixture of nucleic acids, then reiterating the steps of binding, partitioning, dissociating and amplifying through as many cycles as desired to yield highly specific high affinity nucleic acid ligands to the target molecule.

It has been recognized by the present inventors that the SELEX method demonstrates that nucleic acids as chemical compounds can form a wide array of shapes, sizes and configurations, and are capable of a far broader repertoire of binding and other functions than those displayed by nucleic acids in biological systems.

The basic SELEX method has been modified to achieve a number of specific objectives. For example, U.S. patent application Ser. No. 07/960,093, filed Oct. 14, 1992, now abandoned, and U.S. Pat. No. 5,707,796, both entitled “Method for Selecting Nucleic Acids on the Basis of Structure,” describe the use of the SELEX process in conjunction with gel electrophoresis to select nucleic acid molecules with specific structural characteristics, such as bent DNA. U.S. patent application Ser. No. 08/123,935, filed Sep. 17, 1993, entitled “Photoselection of Nucleic Acid Ligands,”, now abandoned, U.S. Pat. No. 5,763,177 entitled “Systematic Evolution of Ligands by Exponential Enrichment: Photoselection of Nucleic Acid Ligands and Solution SELEX” and U.S. patent application Ser. No. 09/093,293, filed Jun. 8, 1998, entitled “Systematic Evolution of Ligands by Exponential Enrichment: Photoselection of Nucleic Acid Ligands and Solution SELEX” describe a SELEX based method for selecting nucleic acid ligands containing photoreactive groups capable of binding and/or photocrosslinking to and/or photoinactivating a target molecule. U.S. Pat. No. 5,580,737 entitled “High-Affinity Nucleic Acid Ligands That Discriminate Between Theophylline and Caffeine,” describes a method for identifying highly specific nucleic acid ligands able to discriminate between closely related molecules, which can be non-peptidic, termed Counter-SELEX. U.S. Pat. No. 5,567,588 entitled “Systematic Evolution of Ligands by EXponential Enrichment: Solution SELEX,” describes a SELEX-based method which achieves highly efficient partitioning between oligonucleotides having high and low affinity for a target molecule.

The SELEX method encompasses the identification of high-affinity nucleic acid ligands containing modified nucleotides conferring improved characteristics on the ligand, such as improved in vivo stability or improved delivery characteristics. Examples of such modifications include chemical substitutions at the ribose and/or phosphate and/or base positions. SELEX process-identified nucleic acid ligands containing modified nucleotides are described in U.S. Pat. No. 5,660,985 entitled “High Affinity Nucleic Acid Ligands Containing Modified Nucleotides,” that describes oligonucleotides containing nucleotide derivatives chemically modified at the 5- and 2′-positions of pyrimidines. U.S. Pat. No. 5,580,737, supra, describes highly specific nucleic acid ligands containing one or more nucleotides modified with 2′-amino (2′-NH 2 ), 2′-fluoro (2′-F), and/or 2′-O-methyl (2′-OMe). U.S. patent application Ser. No. 08/264,029, filed Jun. 22, 1994, entitled “Novel Method of Preparation of Known and Novel 2′ Modified Nucleosides by Intramolecular Nucleophilic Displacement,” now abandoned, describes oligonucleotides containing various 2′-modified pyrimidines.

The SELEX method encompasses combining selected oligonucleotides with other selected oligonucleotides and non-oligonucleotide functional units as described in U.S. Pat. No. 5,637,459 entitled “Systematic Evolution of Ligands by EXponential Enrichment: Chimeric SELEX,” and U.S. Pat. No. 5,683,867 entitled “Systematic Evolution of Ligands by EXponential Enrichment: Blended SELEX,” respectively. These applications allow the combination of the broad array of shapes and other properties, and the efficient amplification and replication properties, of oligonucleotides with the desirable properties of other molecules.

The SELEX method further encompasses combining selected nucleic acid ligands with lipophilic compounds or non-immunogenic, high molecular weight compounds in a diagnostic or therapeutic complex as described in U.S. patent application Ser. No. 08/434,465, filed May 4, 1995, entitled “Nucleic Acid Ligand Complexes”. Each of the above described patent applications which describe modifications of the basic SELEX procedure are specifically incorporated by reference herein in their entirety.

It is an object of the present invention to obtain nucleic acid ligands to HGF and c-met using the SELEX process.

It is a further object of the invention to obtain nucleic acid ligands that act as inhibitors of HGF and c-met.

It is a further object of the invention to provide therapeutic and diagnostic agents for tumorigenic conditions in which HGF and c-met are implicated.

It is yet a further object of the invention to use nucleic acid ligands to HGF and c-met to diagnose and treat hypertension, arteriosclerosis, myocardial infarction, and rheumatoid arthritis.

It is an even further object of the invention to use nucleic acid ligands to HGF singly or in combination with other nucleic acid ligands that inhibit VEGF and/or bFGF, and/or possibly other angiogenesis factors.

SUMMARY OF THE INVENTION

Methods are provided for generating nucleic acid ligands to HGF and c-met. The methods use the SELEX process for ligand generation. The nucleic acid ligands provided by the invention are useful as therapeutic and diagnostic agents for a number of diseases.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 illustrates the template and primer oligonucleotides used 2′-F-pyrimidine RNA SELEX experiments. The 5′ fixed region of the template and primers contains a T7 promoter to facilitate transcription of RNA by T7 RNA polymerase.

FIG. 2 illustrates RNaseH cleavage primers used in hybridization truncate SELEX. Bases depicted in bold-type are 2′-O-methyl modified and bases underlined are deoxyribonucleosides. The random region is designated as “N”. Upon treatment with RNaseH, the fixed regions are removed at the positions indicated by the carets. Note that the there are two possible cleavage sites at the 5-prime end of the fixed region, resulting in RNA which has one or two fixed G residues.

FIG. 3 (A,B) illustrates binding of SELEX pools to HGF. FIG. 3A shows HGF SELEX 1 30N7 pools. FIG. 3B shows HGF SELEX 2 30N8 pools.

FIG. 4 (A,B) illustrates two methods of evaluating HGF SELEX 3 30N7 pool binding to HGF. In FIG. 4A , heparin competes with RNA pools for binding to 2.7 nM HGF. FIG. 4B illustrates conventional pool binding.

FIG. 5 (A,B) illustrates two methods of evaluating HGF SELEX 3 30N7 pool binding to HGF.

FIG. 5A shows that tRNA competes with RNA pools for binding to 2.7 nM HGF.

FIG. 5B shows conventional pool binding.

FIG. 6 (A,B) illustrates inhibition of 10 ng/ml HGF stimulation of starved HUVECs by aptamers.

FIG. 6A shows a 1st set of aptamers. FIG. 6B illustrates a 2nd set of aptamers.

FIG. 7 (A,B) illustrates truncates of aptamer 8-102. FIG. 7A shows predicted two-dimensional structures of full-length and truncated sequences. FIG. 7B shows binding of full-length and truncated aptamers to HGF.

FIG. 8 (A,B) illustrates truncates of aptamer 8-17. FIG. 8A shows a predicted two-dimensional structures of full-length and truncated sequences. FIG. 8B shows binding of full-length and truncated aptamers to HGF.

FIG. 9 (A,B) illustrates binding of HGF truncate SELEX pools. FIG. 9A shows the HGF SELEX 4 30N7 series. FIG. 9B shows the HGF SELEX 5 30N7 series.

FIG. 10 shows aptamer inhibition of 100 ng/ml HGF stimulation of 4MBr-5 cells.

FIG. 11 (A,B) illustrates aptamer inhibition of 50 ng/ml HGF stimulation of 4MBr5 cells.

FIG. 11A shows the effect of PEGylation of 36mer. FIG. 11B shows a comparison of PEGylated 36mer to best full-length inhibitor 8-17.

FIG. 12 shows aptamer inhibition of 50 ng/ml HGF stimulation of 4MBr-5 cells.

FIG. 13 shows HUVEC mitogenesis by 10 ng/ml HGF, 10 ng/ml VEGF, or both HGF and VEGF.

FIG. 14 (A-C) illustrates aptamer-mediated inhibition of HUVEC mitogenesis. FIG. 14A shows stimulation by both HGF and VEGF inhibited by either HGF or VEGF aptamers or both.

FIG. 14B illustrates stimulation by HGF alone inhibited by either HGF or VEGF aptamer or both. FIG. 14C illustrates stimulation by VEGF alone inhibited by either HGF or VEGF aptamer or both.

FIG. 15 depicts ratios of selected to unselected partially 2′-O-methyl substituted purines in aptamer NX22354.

FIG. 16 illustrates 2′-O-methyl substituted derivatives of NX22354 binding to HGF: average of two experiments.

FIG. 17 (A-C) illustrates binding of SELEX pools to c-met. FIG. 17A shows c-Met SELEX 40N7. FIG. 17B shows c-Met SELEX 30N8. FIG. 17C shows both SELEXes: a, c pools, 40N7; b, d pools, 30N8.

FIG. 18 illustrates binding of c-met SELEX pools to c-met and KDR Ig fusion proteins.

FIG. 19 (A,B) shows binding of c-met 40N7 cloned aptamers to c-met and KDR Ig fusion proteins. FIG. 19A shows clone 7c-1. FIG. 19B shows clone7c-3.

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

The central method utilized herein for identifying nucleic acid ligands to HGF and c-met is called the SELEX process, an acronym for Systematic Evolution of Ligands by Exponential enrichment and involves (a) contacting the candidate mixture of nucleic acids with HGF or c-met, or expressed domains or peptides corresponding to HGF or c-met, (b) partitioning between members of said candidate mixture on the basis of affinity to HGF or c-met, and c) amplifying the selected molecules to yield a mixture of nucleic acids enriched for nucleic acid sequences with a relatively higher affinity for binding to HGF or c-met.

Definitions

Various terms are used herein to refer to aspects of the present invention. To aid in the clarification of the description of the components of this invention, the following definitions are provided:

As used herein, “nucleic acid ligand” is a non-naturally occurring nucleic acid having a desirable action on a target. Nucleic acid ligands are often referred to as “aptamers”. The term aptamer is used interchangeably with nucleic acid ligand throughout this application. A desirable action includes, but is not limited to, binding of the target, catalytically changing the target, reacting with the target in a way which modifies/alters the target or the functional activity of the target, covalently attaching to the target as in a suicide inhibitor, facilitating the reaction between the target and another molecule. In the preferred embodiment, the action is specific binding affinity for a target molecule, such target molecule being a three dimensional chemical structure other than a polynucleotide that binds to the nucleic acid ligand through a mechanism which predominantly depends on Watson/Crick base pairing or triple helix binding, wherein the nucleic acid ligand is not a nucleic acid having the known physiological function of being bound by the target molecule. In the present invention, the targets are c-met and HGF or portions thereof. Nucleic acid ligands include nucleic acids that are identified from a candidate mixture of nucleic acids, said nucleic acid ligand being a ligand of a given target, by the method comprising: a) contacting the candidate mixture with the target, wherein nucleic acids having an increased affinity to the target relative to the candidate mixture may be partitioned from the remainder of the candidate mixture; b) partitioning the increased affinity nucleic acids from the remainder of the candidate mixture; and c) amplifying the increased affinity nucleic acids to yield a ligand-enriched mixture of nucleic acids.

As used herein, “candidate mixture” is a mixture of nucleic acids of differing sequence from which to select a desired ligand. The source of a candidate mixture can be from naturally-occurring nucleic acids or fragments thereof, chemically synthesized nucleic acids, enzymatically synthesized nucleic acids or nucleic acids made by a combination of the foregoing techniques. In a preferred embodiment, each nucleic acid has fixed sequences surrounding a randomized region to facilitate the amplification process.

As used herein, “nucleic acid” means either DNA, RNA, single-stranded or double-stranded, and any chemical modifications thereof. Modifications include, but are not limited to, those which provide other chemical groups that incorporate additional charge, polarizability, hydrogen bonding, electrostatic interaction, and fluxionality to the nucleic acid ligand bases or to the nucleic acid ligand as a whole. Such modifications include, but are not limited to, 2′-position sugar modifications, 5-position pyrimidine modifications, 8-position purine modifications, modifications at exocyclic amines, substitution of 4-thiouridine, substitution of 5-bromo or 5-iodo-uracil; backbone modifications, methylations, unusual base-pairing combinations such as the isobases isocytidine and isoguanidine and the like. Modifications can also include 3′ and 5′ modifications such as capping.

“SELEX” methodology involves the combination of selection of nucleic acid ligands which interact with a target in a desirable manner, for example binding to a protein, with amplification of those selected nucleic acids. Optional iterative cycling of the selection/amplification steps allows selection of one or a small number of nucleic acids which interact most strongly with the target from a pool which contains a very large number of nucleic acids. Cycling of the selection/amplification procedure is continued until a selected goal is achieved. In the present invention, the SELEX methodology is employed to obtain nucleic acid ligands to HGF and c-met.

The SELEX methodology is described in the SELEX Patent Applications.

“SELEX target” or “target” means any compound or molecule of interest for which a ligand is desired. A target can be a protein, peptide, carbohydrate, polysaccharide, glycoprotein, hormone, receptor, antigen, antibody, virus, substrate, metabolite, transition state analog, cofactor, inhibitor, drug, dye, nutrient, growth factor, etc. without limitation. In this application, the SELEX targets are HGF and c-met. In particular, the SELEX targets in this application include purified HGF and c-met, and fragments thereof, and short peptides or expressed protein domains comprising HGF or c-met. Also includes as targets are fusion proteins comprising portions of HGF or c-met and other proteins.

As used herein, “solid support” is defined as any surface to which molecules may be attached through either covalent or non-covalent bonds. This includes, but is not limited to, membranes, microtiter plates, magnetic beads, charged paper, nylon, Langmuir-Bodgett films, functionalized glass, germanium, silicon, PTFE, polystyrene, gallium arsenide, gold, and silver. Any other material known in the art that is capable of having functional groups such as amino, carboxyl, thiol or hydroxyl incorporated on its surface, is also contemplated. This includes surfaces with any topology, including, but not limited to, spherical surfaces and grooved surfaces.

As used herein, “HGF” refers to hepatocyte growth factor/scatter factor. This includes purified hepatocyte growth factor/scatter factor, fragments of hepatocyte growth factor/scatter factor, chemically synthesized fragments of hepatocyte growth factor/scatter factor, derivatives or mutated versions of hepatocyte growth factor/scatter factor, and fusion proteins comprising hepatocyte growth factor/scatter factor and another protein. “HGF” as used herein also includes hepatocyte growth factor/scatter factor isolated from species other than humans.

As used herein “c-met” refers to the receptor for HGF. This includes purified receptor, fragments of receptor, chemically synthesized fragments of receptor, derivatives or mutated versions of receptor, and fusion proteins comprising the receptor and another protein. “c-met” as used herein also includes the HGF receptor isolated from a species other than humans.

Note that throughout this application, various references are cited. Every reference cited herein is specifically incorporated in its entirety.

A. Preparing Nucleic Acid Ligands to HGF and c-met

In the preferred embodiment, the nucleic acid ligands of the present invention are derived from the SELEX methodology. The SELEX process is described in U.S. patent application Ser. No. 07/536,428, entitled Systematic Evolution of Ligands by Exponential Enrichment, now abandoned, U.S. Pat. No. 5,475,096 entitled Nucleic Acid Ligands, and U.S. Pat. No. 5,270,163 (see also WO 91/19813) entitled Methods for Identifying Nucleic Acid Ligands. These applications, each specifically incorporated herein by reference, are collectively called the SELEX Patent Applications.

The SELEX process provides a class of products which are nucleic acid molecules, each having a unique sequence, and each of which has the property of binding specifically to a desired target compound or molecule. Target molecules are preferably proteins, but can also include among others carbohydrates, peptidoglycans and a variety of small molecules. SELEX methodology can also be used to target biological structures, such as cell surfaces or viruses, through specific interaction with a molecule that is an integral part of that biological structure.

In its most basic form, the SELEX process may be defined by the following series of steps:

1) A candidate mixture of nucleic acids of differing sequence is prepared. The candidate mixture generally includes regions of fixed sequences (i.e., each of the members of the candidate mixture contains the same sequences in the same location) and regions of randomized sequences. The fixed sequence regions are chosen either: (a) to assist in the amplification steps described below, (b) to mimic a sequence known to bind to the target, or (c) to enhance the concentration of a given structural arrangement of the nucleic acids in the candidate mixture. The randomized sequences can be totally randomized (i.e., the probability of finding a base at any position being one in four) or only partially randomized (e.g., the probability of finding a base at any location can be selected at any level between 0 and 100 percent).

2) The candidate mixture is contacted with the selected target under conditions favorable for binding between the target and members of the candidate mixture. Under these circumstances, the interaction between the target and the nucleic acids of the candidate mixture can be considered as forming nucleic acid-target pairs between the target and those nucleic acids having the strongest affinity for the target.

3) The nucleic acids with the highest affinity for the target are partitioned from those nucleic acids with lesser affinity to the target. Because only an extremely small number of sequences (and possibly only one molecule of nucleic acid) corresponding to the highest affinity nucleic acids exist in the candidate mixture, it is generally desirable to set the partitioning criteria so that a significant amount of the nucleic acids in the candidate mixture (approximately 5-50%) are retained during partitioning.

4) Those nucleic acids selected during partitioning as having the relatively higher affinity for the target are then amplified to create a new candidate mixture that is enriched in nucleic acids having a relatively higher affinity for the target.

5) By repeating the partitioning and amplifying steps above, the newly formed candidate mixture contains fewer and fewer unique sequences, and the average degree of affinity of the nucleic acids to the target will generally increase. Taken to its extreme, the SELEX process will yield a candidate mixture containing one or a small number of unique nucleic acids representing those nucleic acids from the original candidate mixture having the highest affinity to the target molecule.

The basic SELEX method has been modified to achieve a number of specific objectives. For example, U.S. patent application Ser. No. 07/960,093, filed Oct. 14, 1992, now abandoned, and U.S. Pat. No. 5,707,796 both entitled “Method for Selecting Nucleic Acids on the Basis of Structure,” describe the use of the SELEX process in conjunction with gel electrophoresis to select nucleic acid molecules with specific structural characteristics, such as bent DNA. U.S. patent application Ser. No. 08/123,935, filed Sep. 17, 1993, entitled “Photoselection of Nucleic Acid Ligands,”, now abandoned, U.S. Pat. No. 5,763,177 entitled “Systematic Evolution of Ligands by Exponential Enrichment: Photoselection of Nucleic Acid Ligands and Solution SELEX” and U.S. patent application Ser. No. 09/093,293, filed Jun. 8, 1998, entitled “Systematic Evolution of Ligands by Exponential Enrichment: Photoselection of Nucleic Acid Ligands and Solution SELEX” all describe a SELEX based method for selecting nucleic acid ligands containing photoreactive groups capable of binding and/or photocrosslinking to and/or photoinactivating a target molecule. U.S. Pat. No. 5,580,737 entitled “High-Affinity Nucleic Acid Ligands That Discriminate Between Theophylline and Caffeine,” describes a method for identifying highly specific nucleic acid ligands able to discriminate between closely related molecules, termed Counter-SELEX. U.S. Pat. No. 5,567,588 entitled “Systematic Evolution of Ligands by Exponential Enrichment: Solution SELEX,” describes a SELEX-based method which achieves highly efficient partitioning between oligonucleotides having high and low affinity for a target molecule. U.S. Pat. No. 5,496,938 entitled “Nucleic Acid Ligands to HIV-RT and HIV-1 Rev,” describes methods for obtaining improved nucleic acid ligands after SELEX has been performed. U.S. Pat. No. 5,705,337 entitled “Systematic Evolution of Ligands by Exponential Enrichment: Chemi-SELEX,” describes methods for covalently linking a ligand to its target.

The SELEX method encompasses the identification of high-affinity nucleic acid ligands containing modified nucleotides conferring improved characteristics on the ligand, such as improved in vivo stability or improved delivery characteristics. Examples of such modifications include chemical substitutions at the ribose and/or phosphate and/or base positions. SELEX-identified nucleic acid ligands containing modified nucleotides are described in U.S. Pat. No. 5,660,985 entitled “High Affinity Nucleic Acid Ligands Containing Modified Nucleotides,” that describes oligonucleotides containing nucleotide derivatives chemically modified at the 5- and 2′-positions of pyrimidines. U.S. Pat. No. 5,637,459, supra, describes highly specific nucleic acid ligands containing one or more nucleotides modified with 2′-amino (2′-NH 2 ), 2′-fluoro (2′-F), and/or 2′-O-methyl (2′-OMe). U.S. patent application Ser. No. 08/264,029, filed Jun. 22, 1994, entitled “Novel Method of Preparation of Known and Novel 2′ Modified Nucleosides by Intramolecular Nucleophilic Displacement,” now abandoned, describes oligonucleotides containing various 2′-modified pyrimidines.

The SELEX method encompasses combining selected oligonucleotides with other selected oligonucleotides and non-oligonucleotide functional units as described in U.S. Pat. No. 5,637,459 entitled “Systematic Evolution of Ligands by Exponential Enrichment: Chimeric SELEX,” and U.S. Pat. No. 5,683,867 entitled “Systematic Evolution of Ligands by Exponential Enrichment: Blended SELEX,” respectively. These applications allow the combination of the broad array of shapes and other properties, and the efficient amplification and replication properties, of oligonucleotides with the desirable properties of other molecules.

In U.S. Pat. No. 5,496,938 methods are described for obtaining improved nucleic acid ligands after the SELEX process has been performed. This patent, entitled Nucleic Acid Ligands to HIV-RT and HIV-1 Rev, is specifically incorporated herein by reference.

One potential problem encountered in the diagnostic use of nucleic acids is that oligonucleotides in their phosphodiester form may be quickly degraded in body fluids by intracellular and extracellular enzymes such as endonucleases and exonucleases before the desired effect is manifest. Certain chemical modifications of the nucleic acid ligand can be made to increase the in vivo stability of the nucleic acid ligand or to enhance or to mediate the delivery of the nucleic acid ligand. See, e.g., U.S. patent application Ser. No. 08/117,991, filed Sep. 8, 1993, now abandoned, and U.S. Pat. No. 5,660,985, both entitled “High Affinity Nucleic Acid Ligands Containing Modified Nucleotides”, and the U.S. Patent Application entitled “Transcription-free SELEX”, U.S. patent application Ser. No. 09/362,578 filed Jul. 28, 1999, each of which is specifically incorporated herein by reference. Modifications of the nucleic acid ligands contemplated in this invention include, but are not limited to, those which provide other chemical groups that incorporate additional charge, polarizability, hydrophobicity, hydrogen bonding, electrostatic interaction, and fluxionality to the nucleic acid ligand bases or to the nucleic acid ligand as a whole. Such modifications include, but are not limited to, 2′-position sugar modifications, 5-position pyrimidine modifications, 8-position purine modifications, modifications at exocyclic amines, substitution of 4-thiouridine, substitution of 5-bromo or 5-iodo-uracil; backbone modifications, phosphorothioate or alkyl phosphate modifications, methylations, unusual base-pairing combinations such as the isobases isocytidine and isoguanidine and the like. Modifications can also include 3′ and 5′ modifications such as capping. In preferred embodiments of the instant invention, the nucleic acid ligands are RNA molecules that are 2′-fluoro (2′-F) modified on the sugar moiety of pyrimidine residues.

The modifications can be pre- or post-SELEX process modifications. Pre-SELEX process modifications yield nucleic acid ligands with both specificity for their SELEX target and improved in vivo stability. Post-SELEX process modifications made to 2′-OH nucleic acid ligands can result in improved in vivo stability without adversely affecting the binding capacity of the nucleic acid ligand.

Other modifications are known to one of ordinary skill in the art. Such modifications may be made post-SELEX process (modification of previously identified unmodified ligands) or by incorporation into the SELEX process.

The nucleic acid ligands of the invention are prepared through the SELEX methodology that is outlined above and thoroughly enabled in the SELEX applications incorporated herein by reference in their entirety. The SELEX process can be performed using purified HGF or c-met, or fragments thereof as a target. Alternatively, full-length HGF or c-met, or discrete domains of HGF or c-met, can be produced in a suitable expression system. Alternatively, the SELEX process can be performed using as a target a synthetic peptide that includes sequences found in HGF or c-met. Determination of the precise number of amino acids needed for the optimal nucleic acid ligand is routine experimentation for skilled artisans.

In some embodiments, the nucleic acid ligands become covalently attached to their targets upon irradiation of the nucleic acid ligand with light having a selected wavelength. Methods for obtaining such nucleic acid ligands are detailed in U.S. patent application Ser. No. 08/123,935, filed Sep. 17, 1993, entitled “Photoselection of Nucleic Acid Ligands,”, now abandoned, U.S. Pat. No. 5,763,177 entitled “Systematic Evolution of Ligands by Exponential Enrichment: Photoselection of Nucleic Acid Ligands and Solution SELEX” and U.S. patent application Ser. No. 09/093,293, filed Jun. 8, 1998, entitled “Systematic Evolution of Ligands by Exponential Enrichment: Photoselection of Nucleic Acid Ligands and Solution SELEX” each of which is specifically incorporated herein by reference in its entirety.

In preferred embodiments, the SELEX process is carried out using HGF or c-met attached to a solid support. A candidate mixture of single stranded RNA molecules is then contacted with the solid support. In especially preferred embodiments, the single stranded RNA molecules have a 2′-fluoro modification on C and U residues, rather than a 2′-OH group. After incubation for a predetermined time at a selected temperature, the solid support is washed to remove unbound candidate nucleic acid ligand. The nucleic acid ligands that bind to the HGF or c-met protein are then released into solution, then reverse transcribed by reverse transcriptase and amplified using the Polymerase Chain Reaction. The amplified candidate mixture is then used to begin the next round of the SELEX process.

In the above embodiments, the solid support can be a nitrocellulose filter. Nucleic acids in the candidate mixture that do not interact with the immobilized HGF or c-met can be removed from this nitrocellulose filter by application of a vacuum. In other embodiments, the HGF or c-met target is adsorbed on a dry nitrocellulose filter, and nucleic acids in the candidate mixture that do not bind to the HGF or c-met are removed by washing in buffer. In other embodiments, the solid support is a microtiter plate comprised of, for example, polystyrene.

In still other embodiments, the HGF or c-met protein is used as a target for Truncate SELEX, described in U.S. patent application Ser. No. 09/275,850, filed Mar. 24, 1999, entitled “The Truncation SELEX Method”, incorporated herein by reference in its entirety.

In preferred embodiments, the nucleic acid ligands thus obtained are assayed for their ability to inhibit the HGF/c-met interaction. In one embodiment, this is performed by performing a cell migration assay. Certain cell types, such as A549 lung carcinoma cells, will show increased migration through a Matrigel-coated filter insert (Becton Dickinson) in the presence of HGF. Thus, the degree of inhibition of HGF activity in the presence of an HGF or c-met nucleic acid ligand can be assayed by determining the number of cells that have migrated through the filter in the presence of HGF.

B. Methods and Compositions For Using Nucleic Acid Ligands to Treat and Diagnose Disease

Given that elevated levels of c-met and HGF are observed in hypertension, arteriosclerosis, myocardial infarction, and rheumatoid arthritis, nucleic acid ligands will serve as useful therapeutic and diagnostic agents for these diseases. In some embodiments, inhibitory nucleic acid ligands of HGF and c-met are administered, along with a pharmaceutically accepted excipient to an individual suffering from one of these diseases. Modifications of these nucleic acid ligands are made in some embodiments to impart increased stability upon the nucleic acid ligands in the presence of bodily fluids. Such modifications are described and enabled in the SELEX applications cited above.

In other embodiments, nucleic acid ligands to HGF and c-met are used to measure the levels of these proteins in an individual in order to obtain prognostic and diagnostic information. Elevated levels of c-met and HGF are associated with tumors in the liver, breast, pancreas, lung, kidney, bladder, ovary, brain, prostrate, and gallbladder. Elevated levels of HGF and c-met are also associated with myeloma.

In other embodiments, nucleic acid ligands that inhibit the HGF/c-met interaction are used to inhibit tumorigenesis, by inhibiting, for example, angiogenesis and motogenesis.

In one embodiment of the instant invention, a nucleic acid ligand to HGF is used in combination with nucleic acid ligands to VEGF (vascular endothelial growth factor) and/or bFGF (basic fibroblast growth factor) to inhibit tumor metastasis and angiogenesis. The use of multiple nucleic acid ligands is likely to have an additive or synergistic effect on tumor suppression. Nucleic acid ligands that inhibit VEGF are described in U.S. Pat. Nos. 5,849,479, 5,811,533, and U.S. patent application Ser. No. 09/156,824, filed Sep. 18, 1998, each of which is entitled “High Affinity Oligonucleotide Ligands to Vascular Endothelial Growth Factor”, and each of which is specifically incorporated herein by reference in its entirety. Nucleic acid ligands to VEGF are also described in U.S. Pat. No. 5,859,228, U.S. patent application Ser. No. 08/870,930, filed Jun. 6, 1997, U.S. patent application Ser. No. 08/897,351, filed Jul. 21, 1997, and U.S. patent application Ser. No. 09/254,968, filed Mar. 16 1999, each of which is entitled “Vascular Endothelial Growth Factors (VEGF) Nucleic Acid Ligand Complexes, and each of which is specifically incorporated by reference in its entirety. Nucleic acid ligands to bFGF are described in U.S. Pat. No. 5,639,868 entitled “High Affinity RNA ligands for Basic Fibroblast Growth Factor”, and U.S. patent application Ser. No. 08/442,423, filed May 16, 1995, entitled “High Affinity RNA Ligands for Basic Fibroblast Growth Factor”, each of which is specifically incorporated herein by reference in its entirety.

EXAMPLES

The following examples are given by way of illustration only. They are not to be taken as limiting the scope of the invention in any way.

Materials and Methods

In the sections below entitled “Results: HGF” and “Results: c-met”, the following materials and methods were used:

Proteins

The HGF protein and c-met-IgG 1 -His 6 fusion protein, which were used in the SELEX process, and the KDR-IgG 1 -His 6 proteins were purchased from R&D Systems, Inc. (Minneapolis, Minn.). The human c-met-IgG 1 -His 6 fusion protein—described from the amino to the carboxyl terminus—consists of 932 amino acids from the extracellular domains of the α and β chains of c-met, a factor Xa cleavage site, 231 amino acids from human IgG 1 (Fc domain), and a (His) 6 tag. This protein is referred to in the text and figures as c-met. A similar fusion protein containing the vascular endothelial growth factor receptor KDR will be referred to as KDR.

Anti-HGF monoclonal antibody MAB294 was purchased from R&D Systems, Inc. Human IgG 1 was produced in-house by stable expression from Chinese hamster ovary cells.

SELEX Templates and Primers

Standard SELEX templates carrying 30 or 40 random nucleotides flanked by fixed regions of the N7 or N8 series and associated primers ( FIG. 1 ) were used as described (Fitzwater and Polisky 1996, Methods Enzymol. 267:275-301). Truncate SELEX was done by the hybridization method described in U.S. patent application Ser. No. 09/275,850, filed Mar. 24 1999, entitled “The Truncation SELEX Method”, incorporated herein by reference in its entirety, using RNaseH cleavage primers (FIG. 2 ).

SELEX Methods

Initial HGF SELEX experiments were done by two closely-related partitioning methods, both involving separating free from bound RNA on nitrocellulose filters. Conventional SELEX involves mixing target protein and RNA library in HBSMC buffer (hepes-buffered saline, 25 mM hepes, 137 mM NaCl, 5 mM KCl plus 1 mM CaCl 2 , 1 mM MgCl 2 , pH 7.4), followed by filtration on nitrocellulose under vacuum. Maintaining vacuum, the filter is washed in buffer, followed by vacuum release and RNA extraction. In spot filter SELEX, the protein is applied to a dry nitrocellulose 13 mm filter, allowed to adsorb for several minutes, then pre-incubated in Buffer S (HBSMC buffer plus 0.02% each of ficoll, polyvinylpyrrolidone, and human serum albumin) for 10 minutes at 37° C. to remove unbound protein. The wash buffer is removed, and then the RNA library is added in the same buffer, and incubated with the protein-bound filter. The filters are washed by repeated incubations in fresh buffer, followed by RNA extraction.

SELEX was initiated with between 1 and 5 nmoles of 2′-fluoro-pyrimidine RNA sequence libraries containing either a 30 or 40 nucleotide randomized region sequence (FIG. 1 ). The RNA libraries were transcribed from the corresponding synthetic DNA templates that were generated by Klenow extension (Sambrook, Fritsch et al. 1989, 3:B.12). The DNA templates were transcribed in 1 ml reactions, each containing 0.25 nM template, 0.58 μM T7 RNA polymerase, 1 mM each of ATP and GTP, 3 mM each of 2′-F-CTP and 2′-F-UTP, 40 mM Tris-HCl (pH 8.0), 12 mM MgCl 2 , 1 mM spermidine, 5 mM DTT, 0.002% Triton X-100 and 4% polyethylene glycol (w/v) for at least 4 hours at 37° C. The full-length transcription products were purified by denaturing polyacrylamide gel electrophoresis. Radiolabeled RNA was obtained from transcription reactions as described above, but containing 0.2 nM ATP and 100 μCi of α- 32 P-ATP. Alternatively, radiolabeled RNA was obtained by labeling the 5′-end of RNA with α- 32 P-ATP (NEN-DuPont), catalyzed by T4 polynucleotide kinase (New England Biolabs). To prepare RNA containing 5′-OH groups for kinase reactions, transcription reactions included 5 mM guanosine.

For conventional filter SELEX, radiolabeled RNA pools were suspended in HBSMC buffer to which HGF protein was added, and incubated at 37° C for 30 minutes to 3 hours depending on the round. Binding reactions were then filtered under suction through 0.45 μm nitrocellulose filters (Millipore), pre-wet with binding buffer. The filters were immediately washed with at least 5 ml of HBSMC buffer. For each binding reaction, a protein-minus control reaction was done in parallel in order to determine the amount of background binding to the filters. The amount of RNA retained on the filters was quantified by Cherenkov counting, and compared with the amount input into the reactions. Filter-retained RNA was extracted with phenol and chloroform, and isolated by ethanol precipitation in the presence of 1-2 μg glycogen.

The isolated RNA was subsequently used as a template for avian myeloblastosis virus reverse transcriptase (AMV-RT, Life Sciences) to obtain cDNA. One hundred pmoles of the 3′-primer ( FIG. 1 ) was added to the RNA and annealed by heating for 3 minutes at 70° C., followed by chilling on ice. The 50 μl reaction contained 5 U AMV-RT, 0.4 mM each of dNTPs, 50 mM Tris-HCl (pH 8.3), 60 mM NaCl, 6 mM Mg(OAc) 2 , and 10 mM DTT, which was incubated for 45 minutes at 48° C. The cDNA was amplified by PCR with the 5′- and the 3′-primers (FIG. 1 ), and the resulting DNA template was transcribed to obtain RNA for the next round of SELEX.

To minimize selection of undesirable nitrocellulose-binding sequences, beginning in round three, we pre-soaked pools with nitrocellulose filters before incubating with the target protein. This treatment worked well to control background binding and helped ensure that each SELEX round had a positive signal/noise ratio. The progress of SELEX was monitored by nitrocellulose filter-binding analysis of the enriched pools (see below).

Truncate SELEX was performed by the hybridization method described in U.S. patent application Ser. No. 09/275,850, filed Mar. 24 1999, entitled “The Truncation SELEX Method”, incorporated herein by reference in its entirety. Briefly, 2′-F-RNA pools were body-labeled during transcription and cleaved by RNaseH using specific cleavage primers to remove the fixed sequences from the SELEX pool (FIG. 2 ). This RNA was then bound to target protein HGF and recovered following partitioning as in a conventional filter SELEX experiment. The recovered RNA was then biotinlyated at its 3-prime end and hybridized overnight under appropriate conditions with single-stranded full-length complementary strand DNA obtained from the starting SELEX pool, from which the RNA had been transcribed. The RNA/DNA complexes were then captured on streptavidin-coated magnetic beads and extensively washed to remove non-hybridized DNA. The bound DNA in the captured RNA/DNA complexes was then eluted by heat denaturation and amplified using conventional SELEX PCR primers. To complete the cycle, the resulting DNA was then used as a transcription template for generating RNA to be cleaved by RNaseH, and used in the next round of truncate SELEX.

For plate SELEX, a polystyrene well was pre-blocked in 400 μl of blocking agent for 60 minutes at 37° C. The blocking agent was removed and the desired amount of RNA in 100 μl binding buffer was added and incubated for 60 minutes at 37° C. White, polystyrene breakaway wells (catalog #950-2965) used for partitioning were from VWR (Denver, Colo.). The blocking agents, I-block and Superblock, were purchased from Tropix (Bedford, Mass.) and Pierce (Rockford, Ill.), respectively. The preadsorbtion was done to remove any nucleic acids which might bind to the well or the blocking agent. The random and round one libraries were not preadsorbed to plates to avoid loss of unique sequences. C-met protein was diluted in HBSMCK (50 mM HEPES, pH 7.4, 140 mM NaCl, 3 mM KCl, 1 mM CaCl 2 , 1 mM MgCl 2 ), and was adsorbed to polystyrene wells by incubating 100 μl of diluted protein per well for 60 minutes at 37° C. The wells were each washed with three 400 μl aliquots of HIT buffer (HBSMCK, 0.1% I-block, 0.05% Tween 20), and then blocked in 400 μl of blocking agent for 60 minutes at 37° C. SELEX was initiated by incubating 100 μl of RNA in the protein-bound well for 60 minutes at 37° C. The RNA was removed and the wells were washed with 400 μl aliquots of HIT buffer. Increasing numbers of washes were used in later rounds. The wells were then washed twice with 400 μl water. RNA bound to c-met was eluted by adding 100 μl water and heating at 95° C. for 5 minutes and then cooled on ice, followed by reverse transcription.

Nitrocellulose Filter-binding

In binding reactions, RNA concentrations were kept as low as possible—between 1 and 20 pM—to ensure equilibrium in conditions of protein excess. Oligonucleotides were incubated for 15 minutes at 37° C. with varying amounts of the protein in 43 μl of the binding buffer. Thirty-two microliters of each binding mixture placed on pre-wet 0.45 μm nitrocellulose filters under suction. Each well was immediately washed with 0.5 ml binding buffer. The amount of radioactivity retained on the filters was quantitated by imaging. The radioactivity that bound to filters in the absence of protein was used for background correction. The percentage of input oligonucleotide retained on each filter spot was plotted against the corresponding log protein concentration. The nonlinear least square method was used to obtain the dissociation constant (K d ; reference Jellinek, Lynott et al. 1993, Proc. Natl. Acad. Sci. USA. 90:11227-31).

Competitor titration curves were generated essentially as a standard binding curve, except that the protein and RNA concentrations were kept constant, and the competitor concentration was varied. Competitors were also added at a fixed concentration in binding experiments to increase stringency for purposes of comparing pool binding affinities. In these experiments, the competitor concentration was chosen based on the results from the competitor titration curves.

Molecular Cloning and DNA Sequencing

To obtain individual sequences from the enriched pools, we cloned the PCR products from the final SELEX rounds using one of two blunt-end cloning kits, Perfectly Blunt (Novagen, Madison, Wis.), or PCR-Script (Stratagene, La Jolla, Calif.). Clones were sequenced with the ABI Prism Big Dye Terminator Cycle Sequencing kit (Perkin-Elmer Applied Biosystems, Foster City, Calif.). Sequences were obtained from an automated ABI sequencer, and text files were collated and analyzed by computer alignment and inspection.

Boundary Determinations

Five-prime and 3-prime boundaries of RNA aptamers were determined by the method of partial alkaline hydrolysis as described (Jellinek, Green et al. 1994, Biochemistry. 33:10450-6).

Cell Assays

Standard cell culture procedures were employed in the course of performing in vitro experiments to test aptamer-mediated inhibition of HGF activity. For cell migration assays, monolayers of A549 (lung carcinoma) cells were grown on the top-sides of Matrigel-coated filter inserts (Becton Dickinson, Franklin Lakes, N.J.) in 24-well plates. The cells adhere to the upper surface of the filter, which is placed in growth medium containing HGF. After two days, the cells are physically removed from the top surface of the filter. The filter is then removed from the insert and stained with crystal violet. Since all cells on the top of the filter are gone, the only cells that remain are those that are have migrated to the bottom of the filter. In the presence of HGF, significantly more cells are found on the bottom of the filter compared to controls without HGF.

Oligonucleotide Synthesis and Modification

RNA was routinely synthesized by standard cyanoethyl chemistry as modified (Green, Jellinek et al. 1995, Chem Biol. 2:683-95). Two-prime-fluoro-pyrimidine phosphoramidite monomers were obtained from JBL Scientific (San Luis Obispo, Calif.); 2′-OMe purine, 2′-OH purine, hexyl amine, and the dT polystyrene solid support were obtained from Glen Research (Sterling, Va.).

For addition of 40K-PEG, RNA oligomers were synthesized with an amino-linker at the 5′-position. This was subsequently reacted with NHS-ester 40K-PEG manufactured by Shearwater Polymers, Inc. (Huntsville, Ala.), and purified by HPLC on a reverse-phase preparative column.

2′-O-methyl Purine Substitution

Determination of which 2′-OH-purines can be substituted by 2′-O-methyl-purine was done as described (Green 1995, Chem Biol. 2:683-95). Briefly, a set of oligonucleotides was synthesized with a mixture of 2′-O-methyl amidites and 2′-OH amidites at defined purine positions. The set was designed so that each oligonucleotide contains a subset of partially-substituted purines, and the complete set encompasses all purines. Each aptamer was 5′-end labeled and subjected to limited alkaline hydrolysis followed by binding to HGF protein at two different concentrations, 50 and 100 pM. Following binding, protein-bound RNA was separated by standard nitrocellulose filtration. Bound RNA was recovered and analyzed by high-resolution gel electrophoresis. The fragmented alkaline-hydrolyzed aptamers which were not exposed to HGF were run to establish the cleavage patterns of the unselected aptamers. Hydrolysis occurs only at 2′-OH-purines. If a given position requires 2′-OH for optimal binding to HGF, it appears as a relatively darker band compared to the unselected aptamer at that position.

Results—HGF

Five HGF SELEX experiments were done in total. The first three were done by conventional filter SELEX, while the latter two were done by the hybridization truncate SELEX method described in U.S. patent application Ser. No. 09/275,850, filed Mar. 24 1999, entitled “The Truncation SELEX Method”, incorporated herein by reference in its entirety. HGF SELEX 1 was done with 30N7 2′-F-RNA for thirteen rounds of conventional filter binding. HGF SELEX 2 was done with 30N8 2′-F-RNA for thirteen rounds of conventional filter binding. HGF SELEX 3 was done with 30N7 2′-F-RNA for seven rounds by spot filter binding, followed by eight rounds of filter binding. HGF SELEX 4 was done by hybridization filter SELEX for three rounds, starting with pool 8 from HGF SELEX 1. HGF SELEX 5 was done by hybridization filter SELEX for three rounds, starting with pool 11 from HGF SELEX 3. HBSMC buffer was used in conventional SELEX reactions, and in spot filter SELEX, blocking agents were added as described in Materials and Methods.

RNA Pool Binding With and Without Competitors Heparin and tRNA

To evaluate SELEX progress, binding curves with purified HGF protein were routinely done with evolved pools during the course of these experiments. Representative binding curves are shown for HGF SELEX experiments 1 and 2 (FIG. 3 ). These data were used to ascertain when a SELEX was complete in that further progress was not likely to occur by performing additional rounds. HGF SELEX 1 reached its maximal binding by round 8, with a binding affinity of approximately 0.1 nM ( FIG. 3A ; earlier rounds and round 9 were examined in other experiments). HGF SELEX 2 reached its maximal binding by round 10, with a binding affinity of approximately 0.1 nM (FIG. 3 B). HGF SELEX 3 reached its maximal binding by round 11, after seven rounds of spot filter partitioning followed by four rounds of conventional filter SELEX (see FIG. 4 B). A SELEX experiment which was deemed complete was characterized by cloning and sequencing (see below).

HGF, like other proteins which have large clusters of positively charged amino acids, exhibits a high degree of non-specific binding to polyanionic compounds. For example, random RNA pools bind to HGF with low nanomolar affinity, similar to the value reported for HGF binding to heparin, a polyanionic sulfated polysaccharide known to have an important biological role in HGF function (Zioncheck, Richardson et al. 1995, J Biol Chem. 270:16871-8). Competition binding to heparin as well as the non-specific competitor tRNA was done to provide an additional means of evaluating SELEX progress. We did this because the binding of random and evolved RNA pools to HGF occurs in a high-affinity range which makes it difficult to monitor progress. In other words, random RNA binds so well to HGF that the affinity enhancement of the evolved pools may not be adequately assessed in conventional binding experiments in the absence of competitor.

RNA pools from HGF SELEX 3 were subjected to competition with heparin (FIG. 4 A). This experiment demonstrates that random RNA is considerably more sensitive to competition for binding to HGF than are the evolved pools. These data are compared to those obtained from a binding curve with the same three RNA pools (FIG. 4 B). In the absence of heparin competition, binding of random RNA to HGF is nearly as good as that of the evolved pools, whereas the heparin competition reveals that the evolved pools are significantly different in composition from random RNA. In addition, while rounds 8 and 11 are indistinguishable in conventional binding curves, round 11 exhibits improved binding based on increased resistance to heparin competition. These data contributed to the choice of round 11 as the maximally binding pool from which we cloned and sequenced.

A similar, but more pronounced, effect was observed with tRNA as the competitor (FIG. 5 A). These data indicate that the round 11 pool from HGF SELEX 3 are at least four orders of magnitude more resistant to competition for binding to HGF than is random RNA. From these curves, it was determined that 800 nM tRNA is the maximum concentration at which complete binding of evolved RNA persists. Therefore, binding curves were done at this tRNA concentration to compare the binding of different evolved pools (FIG. 5 B). These curves were useful in determining that further SELEX rounds beyond round 11 did not improve binding.

Typical data from a similar set of binding competition experiments done for latter rounds of HGF SELEX 1 are summarized in Table 1.

Cloning and Sequence Analysis of HGF SELEXes 1, 2 and 3

Following determination of pool binding affinities for HGF, we subjected the optimal SELEX pools to cloning and sequencing in order to isolate and characterize individual aptamers. Data from 30N7 HGF SELEXes 1 and 3 are summarized in Table 2, including binding affinities for many of the aptamers. A similar data set was generated for 30N8 HGF SELEX 2 (Table 3). Sequences from HGF SELEX 1, 2 and 3 are designated 8-seq. number, 10-seq. number, and 11-seq. number, respectively, referring to the total number of SELEX rounds each cloned pool was subjected to. Sequences were analyzed and organized into groups with significant homology. Motifs were analyzed and predicted structures were drawn in order to analyze key features responsible for binding to HGF.

Inhibition of HGF-mediated Stimulation of Cell Proliferation

HGF, while not a potent mitogen, does stimulate moderate proliferation of many cell lines, which can be measured by incorporation of 3 H-thymidine. We assayed the inhibitory activity of HGF aptamers by measuring their effect on proliferation of human umbilical vein endothelial cells (HUVECs), or monkey bronchial epithelial (4MBr-5) cells. Based on the binding data and sequence family analysis, fourteen aptamers were chosen for analysis in vitro because they bind to HGF with high affinity and are representative of different sequence families. The sequences are shown in Table 4 aligned by a rough consensus which contains bases in common to several families. All sequences are 30N7 except 10-2 which is 30N8.

HGF stimulates proliferation of HUVECs by about two-to-three-fold (data not shown). The initial experiment indicated that aptamers 8-17, 8-102, 8-104, 8-122, 8-126, 10-2 and 11-208 were effective inhibitors of HGF-induced HUVEC proliferation with K i values in the low nanomolar range (FIG. 6 ). Aptamers 8-113 and 11-222 were less effective and 8-151 exhibited little or no concentration-dependent inhibition. The latter observation is consistent with the fact that aptamer 8-151 does not bind HGF with high affinity and actually binds worse than the random pool.

Several approaches were taken to reduce the length of aptamers which retained significant inhibition of HGF: 1) boundary determinations by biochemical separation of partially hydrolyzed aptamers; 2) sequence motif analysis and educated guessing; and 3) truncate SELEX.

Boundaries and Truncation

Boundary determinations were done for a subset of aptamers that demonstrated in vitro inhibition of HGF activity. Using a standard alkaline hydrolysis procedure with 5′-end-labeled RNA, we examined the 3′-boundaries of 8-17, 8-102, 8-104, 8-126, 10-1, and 10-2. Additionally, 3′-end-labeled RNA was used for 5′-boundary experiments with 8-17 and 8-102. These experiments were mostly uninformative, probably because the high degree of non-specific binding of RNA fragments, regardless of size, obscured the binding of truncated high-affinity aptamers to HGF. Non-specific binding of virtually all fragments gave no boundary information, and reducing the protein concentration did not help. Instead, we tried to use polyanionic competitors tRNA and heparin to eliminate nonspecific binding to reveal the actual boundaries. The competitors reduced non-specific binding, and HGF was predominantly bound only by full-length aptamers, revealing no boundary information beyond the possibility that full-length aptamers are strongly preferred.

The sole exception was aptamer 8-102 which had a plausible 3′-boundary between two possible endpoints which made sense with respect to computer-predicted structures (FIG. 7 A). Based on the boundary data and structural data, two truncates of 8-102 were synthesized and analyzed for binding to HGF. The sequence of the full-length aptamer and the two truncates are shown, with fixed regions underlined:

gggaggacgaugcgg cgagugccuguuuaugucaucguccgucgu cagacgacucgcccga 8-102  SEQ ID NO:12

ggacgaugcgg cgagugccuguuaugucaucgucc (36mer)  SEQ ID NO:13

gacgaugcgg cgagugccuguuuauguc (28mer)  SEQ ID NO:14

In binding to HGF, the 36mer bound almost as well as the full-length aptamer, while the 28mer bound no better than random 30N7 (FIG. 7 B), suggesting that the boundary data were correct.

Truncation By Sequence Structure Prediction

Several attempts were made to base truncation on motif analysis and predicted structures, but these did not succeed in producing truncates which retained binding to HGF. For example, aptamer 8-17 folded into a reasonable predicted structure which suggested two obvious points of truncation from its 3-prime terminus, into a 38mer or 28mer (FIG. 8 A). However, binding analysis revealed that neither of these truncates retained significant binding to HGF (FIG. 8 B). These data suggest either that the predicted structure is incorrect or that some of the 3-prime region past base 38 is critical for high-affinity binding of aptamer 8-17 to HGF. These two hypotheses are not mutually exclusive. Nevertheless, we did not succeed in obtaining a useful truncate of 8-17 by boundary and structural prediction.

Truncate SELEX

In order to generate additional short aptamers, we subjected advanced rounds of the earlier SELEXes to additional rounds of truncate SELEX, using the Truncation SELEX method described in U.S. patent application Ser. No. 09/275,850, filed Mar. 24, 1999, entitled “The Truncation SELEX Method”, incorporated herein by reference in its entirety. Binding of RNaseH cleaved pools was examined to determine which were the appropriate rounds to use to initiate truncate SELEX (data not shown). None of the RNaseH-cleaved evolved pools was clearly superior to another in binding to HGF, therefore, the pools which had been previously cloned were chosen to use in truncate SELEX. The encouraging result from this experiment was that after RNaseH treatment, the evolved pools bound better to HGF than did random RNA, suggesting that even in the absence of the fixed regions, significant binding affinity was retained. This observation was sufficient evidence to suggest that truncate SELEX could enrich for sequences which bound to HGF in the absence of fixed regions.

Three rounds of hybridization truncate SELEX were done in parallel, using as starting pools HGF SELEX 1 round 8 and HGF SELEX 3 round 11. The truncate SELEX rounds were done at equi-molar RNA and protein, starting at 1 nM and decreasing to 0.5 and 0.1 nM. Signal-to-noise ratios were very high during selection. Subsequent manipulations were satisfactory even though the amount or recovered RNA was sub-picomolar.

To evaluate the progress of the SELEX, binding affinities of truncate rounds two and three were determined compared to those of the RNaseH-cleaved starting pools (FIG. 9 ). For both SELEXes, the third round pools bound with improved affinity for HGF compared with the earlier rounds. Interestingly, the second rounds did not bind HGF better than the staring material. The dissociation constants for the third round truncate SELEX pools are 1-2 nM, representing a 2-3 fold improvement. While the magnitude of this improvement is not large, it is probably significant since HGF as a target did not easily yield affinity enrichment, probably because of its intrinsically high affinity for RNA.

The two pools were cloned and sequenced, and binding affinities were determined (Table 5). The truncated aptamer with the best binding affinity, Tr51, is among several sequences which are novel, that is, they were not found in the clones sequenced from the full-length SELEX pools. The emergence of novel sequences suggests that the truncate SELEX succeeded in amplifying aptamers which were relatively rare in the full-length pools. Aptamer Tr51 appeared more frequently than any other sequence, consistent with the observation that it has better binding affinity than any other truncate. Other sequences which appeared multiple times also tend to be those with binding affinities near or better than the pool K d of 1-2 nM.

HGF Inhibition By the 36mer Aptamer Modified With 40K-PEG

The 36mer derivative of aptamer 8-102 described above was tested for inhibition in vitro in a 4MBr-5 cell proliferation assay (FIG. 10 ). Although the 36mer retained high-affinity binding to HGF, it did not retain inhibitory activity in vitro comparable to its parent aptamer 8-102 and aptamer 8-17 (FIG. 10 ).

In order to improve the activity of the 36mer, we tested it in a formulation with a 3′-dT cap and 5′-40K PEG. The modified aptamer, designated NX22354, was tested for inhibition of HGF-mediated proliferation 4MBr-5 cells (FIG. 11 A). The data indicate that the 36mer-PEG aptamer inhibits HGF, and that it performs at least as well as the full-length aptamer 8-17, which had previously exhibited the strongest inhibition of all aptamers tested. As expected, the non-PEGylated 36mer did not inhibit HGF, suggesting that the addition of PEG and/or the 3′-cap contribute to the aptamer's bioactivity. This experiment was also done at lower aptamer concentrations, supporting the previous result and showing more clearly that 36mer-PEG aptamer is a better inhibitor that the 8-17 full-length aptamer (FIG. 11 B). Also tested by this assay was a non-binding aptamer containing a 3′-dT cap and 5′-40K PEG, the VEGF aptamer NX1838, which had no effect on HGF stimulation (FIG. 12 ). In this same experiment, a non-PEGylated version of NX1838 and the truncate SELEX aptamer Tr51 were shown to have no inhibitory effect on HGF (FIG. 12 ). This suggests that Tr51, similar to the 36mer base aptamer of NX22354, may require 5′-40K-PEG to inhibit HGF function.

Inhibition of HGF-mediated Stimulation of Cell Migration

HGF readily stimulates cell movement, hence the name, scatter factor. We assayed the inhibitory effect of HGF aptamers by measuring their effect on A549 cell migration across a Matrigel coated membrane with 8.0 micron pores as described in Materials and Methods (Table 6). The NX22354 aptamer fully inhibited HGF-mediated migration at both 1 and 0.2 μM concentrations, but at 0.04 μM, the effect was negligible. The monoclonal antibody control (sample 3) was moderately effective at the 1 μg/ml dose, which is above its published EC 50 value of 0.1-0.3 μg/ml for inhibition of 4MBr-5 cell proliferation.

Combined Inhibitory Effect of HGF and VEGF Aptamners on HUVEC Proliferation

It was reported that VEGF and HGF have an additive stimulatory effect on HUVEC proliferation (Van Belle 1998, Circulation. 97:381-90). We observed this effect when VEGF and HGF were added, singly and in combination, to HUVECs, and we measured incorporation of 3 H-thymidine (FIG. 13 ). As expected, stimulation by HGF was relatively weak compared with that of VEGF and together, the stimulatory effect was greater than that elicited by VEGF alone.

Based on these curves, we chose to add each cytokine at 10 ng/ml for optimal stimulation in the aptamer inhibition experiments. We then tested the effect of adding one or both aptamers to the doubly-stimulated cells in the presence of both growth factors (FIG. 14 A). We observed that each aptamer partially inhibits the stimulation and that both aptamers result in complete inhibition. Interestingly, the magnitude of the inhibitory effect of each aptamer roughly corresponds with the magnitude of the stimulation conferred by each cytokine. This observation suggests that the stimulatory effect of each cytokine can be inhibited independently, and that the two cytokines stimulate HUVECs independently.

The remaining two panels of FIG. 14 (FIG. 14 B and FIG. 14C ) are controls in which each cytokine being administered separately, demonstrating that the HGF and VEGF aptamers do not cross-react, that is, each aptamer affects only the cytokine against which it was selected. For the HGF stimulated cells, we observed inhibition by the HGF aptamer NX22354, but not by the VEGF aptamer NX1838 (FIG. 14 B). Conversely, stimulation by VEGF was inhibited by the VEGF aptamer NX1838, but was unaffected by the HGF aptamer NX22354 (FIG. 14 C).

These data, along with the fact that HGF, like VEGF, is an angiogenesis factor make it intriguing to consider dual administration of VEGF and HGF aptamers to treat tumors. Furthermore, the availability of aptamers which inhibit other growth factors suggests further combinations of the VEGF or the HGF aptamer in combination with other aptamers, for example, aptamers that inhibit bFGF, platelet-derived growth factor (PDGF), transforming growth factor beta (TGF), keratinocyte growth factor (KGF), and/or their receptors allowing for the possibility that any combination of these inhibitors may be relevant. The goal is to have an array of aptamer-inhibitors of cytokines and their receptors and to be able to tailor combination treatments for specific disease states.

2′-O-methyl-purine Substitution of HGF Aptamer NX22354

To improve the stability and pharmacokinetics of NX223 54, we determined which of the 17 2′-OH purines could be replaced. We did this by synthesizing four partially substituted 2′-O-methyl-purine variants of the base sequence of NX22354 followed by analysis as described in Materials and Methods. The four partially-substituted oligonucleotides were synthesized with a 1:1 ratio of 2′-O-methyl amidite:2′-OH amidite (Table 7). The data analysis measures the ratios of the selected to unselected RNA at each substituted purine position, based on quantitation of bands from the gel. The data are summarized by position (FIG. 15 ). At each position, the three unsubstituted aptamers provide an important comparison, which is expressed as an average of the three unsubstituted aptamers with standard deviation represented by the error bars. Points that occur at ratios higher than that of the nearby positions are likely to require 2′-OH for binding.

The data strongly indicate that two positions, G5 and A25, do not tolerate 2′-OMe substitution. Two other positions, A3 and G10, show a slight preference above the standard deviation of the unselected RNA.

The set of OMe aptamers were also examined for binding to HGF (data not shown). The binding data indicate that the OMe1 and OMe3 bind as well as the parent unsubstituted 36mer, whereas OMe2 and OMe4 bind less well. This suggests that the substitutions in OMe2 and OMe4 are less well tolerated with respect to HGF binding in solution, consistent with the fact that OMe2 and OMe4 are substituted at A25 and G5, respectively.

To confirm these results, two aptamers were synthesized which are fully 2′-O-methyl substituted at the apparently well-tolerated positions. The sequences are shown below, with the 2′-OH-purines shown underlined. All other purines have 2′-OMe and the pyrimidines are 2′-fluoro substituted.

4×Sub 2′-OH. GG A C G AUGC G GCGAGUGCCUGUUU A UGUCAUCGUCC  SEQ ID NO:186

2×Sub 2′-OH. GGAC G AUGCGGCGAGUGCCUGUUU A UGUCAUCGUCC  SEQ ID NO:187

Sequence 4×Sub 2′-OH contains all four of the 2′-OH-purines in question, while 2×Sub 2′-OH has only the two 2′-OH-purines most likely to be required.

Binding of these oligomers to HGF was examined compared to the unsubstituted parent and the fully 2′-O-methyl substituted RNA (FIG. 16 ). Based on these binding curves, NX22354 tolerates 2′-OMe substitution at all purines except G5 and A25 (aptamer 2×Sub 2′-OH) with minimal loss of binding affinity. The other two positions in question apparently are not required to be 2′-OH since aptamer 4×Sub 2′-OH binds no better than aptamer 2×Sub 2′-OH.

Two aptamers have been synthesized with 5′-40K-PEG and a 3′-dT cap: one is fully 2′-O-methyl substituted and the other contains 2′-OH at positions G5 and A25. One of these will presumably supplant NX22354 as the lead HGF aptamer for further testing in vitro and in vivo.

Results—c-met

c-Met SELEX

In the c-Met plate SELEX experiments, the concentration of nucleic acids was lowered initially, but then raised in later rounds so that the ratio of the nucleic acid to protein would be very high. This was done in order to create conditions of high stringency which may select for higher affinity aptamers. Stringency was also applied by increasing the number of washes.

SELEX Pool Binding

Binding of SELEX pools to c-met was assessed through round 7 (FIG. 17 ). The binding data indicate that the SELEX resulted in about a 20 fold improvement in K d from 20 nM to 1 nM for both “a” (40N 7) and “b” (30N8) pools.

Since the c-met protein used in SELEX is an IgG fusion protein, we tested random 40N7 and round 7c RNA pools for binding to human IgG 1 and c-met. The binding dissociation constants obtained are as follows:

TABLE 8
binding and dissociation constants
SELEX round	Protein	K d
random	IgG 1		˜1	μM
7c	IgG 1		23	nM
random	c-met		100	nM
7c	c-met		2	nM

The affinity of round 7c RNA for both IgG 1 and c-met proteins improved about 50-fold. There are several interpretations to this result. Aptamers may have been selected which bind with better affinity to both proteins. This assumes that the difference in binding between IgG 1 and c-met is due to c-met specific aptamers. However, the two proteins were made in different cell lines which may have different glycosylation patterns which could influence binding. Thus, if the differences in affinity are due to differences between the free IgG 1 protein and the IgG 1 domain in c-met, then there might be few if any c-met specific aptamers in the round 7 pool.

In order to address these issues further, random and round 5 RNA pools from both libraries were examined for binding to the c-met and KDR proteins (FIG. 18 ). Both of these proteins were made in the same cell line and contain the same IgG 1 -His 6 sequence. Random RNA from both libraries binds about the same to each protein (K d =˜50 nM). Round 5 from the both libraries of c-met SELEX binds better to c-met than to KDR (˜100-fold better for the 30N8 pool and 3-fold better for the 40N7 pool). However, round 5 RNA pools do bind better than random RNA to KDR. These results imply that, while there are probably aptamers which bind to human IgG 1 or (HIS) 6 tag in the round 5 pools, there may also be c-met aptamers.

Detection of IgG Aptamers By PCR

Another approach for determining if IgG 1 aptamers are present in the SELEX pools was to subject them to PCR. Predominant IgG 1 aptamers have been isolated from N7 type libraries which have a known sequence (Nikos Pagratis and Chinh Dang, personal communication). For the PCR, a DNA oligonucleotide:

ML-124; 5′-ACGAGTTTATCGAAAAAGAACGATGGTTCCAATGGAGCA-3′  SEQ ID NO:188

was used that is complementary to the most prevalent N7-series human IgG 1 aptamer sequence, and differs by only a few bases from most other IgG 1 aptamers. This PCR primer is the same length as the selected sequence of the major IgG 1 so that it can tolerate mismatches and hybridize to similar sequences.

The ML-124 3′-primer:

ML-34; 5′-CGCAGGATCCTAATACGACTCACTATA-3′  SEQ ID NO:189

was used with a 5′-primer containing the T7-promoter sequence present in all cloned aptamers to amplify 40N7 series nucleic acids pools: random, 1a, 2a, 3a and 4a (data not shown). Since IgG 1 aptamers have not been isolated from an N8 type library, this analysis was not done for the 30N8 SELEX. PCR of random and c-met SELEX round 1a pools yielded no signal after 20 cycles. However, rounds 2a, 3a, and 4a had steadily increasing signals that were easily detectable after 10 PCR cycles. Thus IgG 1 aptamers appeared relatively early in the 40N7 SELEX experiment. For a negative control, PCR was done with a nucleic acid pool from a SELEX known to lack IgG 1 aptamers. For positive controls, PCR was done with pools from either an N7-based IgG 1 or CTLA4-IgG 1 SELEX. IgG 1 aptamers were first isolated from both of these SELEXes. The negative control had no detectable IgG 1 aptamers after 20 PCR cycles. The positive controls had detectable signals after 10 PCR cycles.

C-met Aptamers

The sequences of 19 clones from round 7c-40N7 fall into five families with two sequences each, a group with three unrelated members, and six sequences closely related to known IgG 1 aptamer sequences (Table 9). Thus, at least 6 of the 19 clones (32%) are human IgG 1 aptamers. This confirms the results of previous analysis that indicated the presence of IgG 1 aptamers in this SELEX experiment.

Of the 13 clones sequenced from round 7b-30N8, six are almost identical, another five are closely related, and two are distinct (Table 10).

Nine clones were tested for binding to c-met or KDR, six from the 40N7 series and three from the 30N8 series. These clones were chosen for the following reasons. Clone 7b-4 is the most frequent clone in family 1 and is representative of almost all of the sequences isolated from the 7b-30N8 library. Clones 7b-10 and 7b-12 are the two clones from the 7b-30N8 library that bad different sequences. From the 7c-40N7 pool, the chosen representatives were: family 1 (clone 7c-1), family 2 (clone 7c-4), family 3 (clone 7c-23), family 4 (clone 7c-26), family 5 (clone 7c-25), and the presumed IgG1 family (clone 7c-3).

Results are shown for only two clones, including 7c-1 which was the only one observed to bind to c-met better than KDR (FIG. 19 A). Clone 7c-1, which appeared twice in the 40N7 series, may exhibit biphasic binding behavior with a high affinity binding K d of ˜50 pM and a lower affinity binding K d of ˜5 nM. All eight other clones bound to KDR as well as to c-met, including 7c-3, which is shown here as representative example (FIG. 19 B). Clone 7c-3 and all others besides 7c-1 are presumed to be IgG 1 aptamers.

In summary, two clones (identical to 7c-1) out of 32 apparently bind c-met specifically and with high affinity. The remaining clones appear to be IgG 1 aptamers.

TABLE 1
Binding affinities of HGF SELEX 1 pools
with and without competitor tRNA.
	RNA pool	K d (nM)	K d (nM)/tRNA
	random 30N7	1.6	550
	HGF SELEX 1 Rd.8	0.07	0.35
	HGF SELEX 1 Rd.9	0.09	0.42

TABLE 2
HGF 30N7 aptamer sequences and binding affinities.
Seq. no. a	30N7 random region b	SEQ. ID. No.	K d (nM)
8-122 (2,1)	CGGUGUGAACCUGUUUAUGUCCGCGUACCC	18	0.097
8-108	CGGUGUGGACCUGUUUAUGUCCGCGUACCC	19	ND C
8-115	AGUGAUCCUAUUUAUGACAUCGCGGGCUGC	20	ND
8-125	UGUGAACCUGUUUAUGUCAUCUUUUGUCGU	21	0.075
8-155 (1,1)	UGUGAACCUAUUUAUGCCAUCUCGAGUGCC	22	0.093
8-162	CGUGAGCCUAUUUAUGUCAUCAUGUCUGUC	23	ND
8-165	CGAGAGCCUAUUUAUGUCAUCAUGCCUGUG	24	0.100
8-171	CGGGAGCCUUUUUAUGUCAUCAUGUCUGUG	25	0.120
8-114 (4,2)	CGUGAGCCUAUUUAUGUCAUCAUGUCUGUG	26	0.071
8-203	CGCGAGCCUAUUUAUGUCAUCAUGUCUGUG	27	0.140
8-215	CGUGAGCCUAUUUAUGUCAUCAUGUCUGGU	28	0.077
8-217	CGUGAGCCUAUUUACGUCAUCAUGUCUGUG	29	ND
8-222	UGUGAACCUAUUUAUGCCAUUAUGUCUGUG	30	0.130
8-225	CGUGAGCCUAUUUAUGUCAUCAAGUCUGUG	31	ND
8-102	CGAGUGCCUGUUUAUGUCAUCGUCCGUCGU	12	0.060
11-9	CGUGAGCCUGUUUAUGACCUCGUCCAUGGC	32	0.074
11-58	CGUGAGCCUAUUUAUGACAUGUCCCUCGAG	33	ND
11-59	CGUGAGCCUGUAUAUGUCAUUGUUCUCCGG	34	0.110
11-57	UGAGUACCUGUUUAUGUCACCACUUUCCCC	35	ND
11-103	UGAUUACCUA UUAUGUC UCGCCCUCUC	36	0.200
11-110	UGAUUACCUAUUUAUGUCAUGCUCCUCCCC	37	0.086
11-65	UGAUAACCUGUUUAUGCCAUCGUGCUGGGC	38	0.110
11-167	UGAUAACCUGUUUAUGUCAUCGUGCUGGGC	39	ND
11-201	UGAGAACCUAUUUAUGUCAUCGUGUCUGGC	40	ND
11-162	UGAUAACCUAUUUAUGACGUCGUGGCUCCC	41	ND
11-202	UGGGAACCUAUUUAUGUCAUC UCCGUCCC	42	ND
11-106	CGAUGAUGCCUGUUUAUGUCGAUGUCCCCC	43	0.120
11-158	CGAUAGCCUAUUUAUGACCUCGUCCCCGUG	44	0.170
11-112	CGUGAGCCUAUUUAUGACAUCGUUCUUGGC	45	ND
11-124	CGUGAGCCUAUCUAUGUCAUCGUGUGUGCC	46	ND
1l-122	UGAGUACUAUUUAUGUCGUCGUUCGUGCC	47	ND
11-217	CGUGAGCCUUCCAAUGACGUCGUCCUUGGC	48	0.071
8-104	GCGACUCAAUCUGAAUCGUCUUGUCCCGUG	49	0.050
11-76	UCAGCGGCGCGAGCCUGUUUAUGUC UGCUG	50	0.076
“consensus”	CGUGAGCCUAUUUAUGUCAUCGU - C - UG	51
11-8	UCAGUAUGACU UUUAUAGCA CGUUCGCCC	52	0.150
1l-153	ACAGGUAGUCU UCUAUAGCA CUUCCUCCCC	53	0.190
11-157	UCAGAAUGACU UUCAUAGCA CGCUUUCCC	54	0.260
11-222	ACAUAAGUCU UCUAUAGC UCGUCCUUUGUG	55	0.077
11-223	UCAGUAUGGCU UCUAUAGC UCGUUCCUCGG	56	0.120
8-126 (3,1)	GUGACUCAAAAUGGUGAUCCUCG UUUCCGC	57	0.099
8-101	GUGACUCAAAAUGGUGAUCCUCGAUUUCCGC	58	0.095
8-105	GUGACUCAAAAUGGUGAUCCUCGAUUGCCGC	59	ND
8-103	GCCGAAAAU     UCGUCGACAUCUCCCUGUCUG	60	0.120
8-118	GGCGACUUUCCUCCAAUUCUCACCUCUGCA	61	0.160
8-119	GCCAUUCGAUCGA UUCUCCGCCGGAUCGUG	62	0.110
“consensus”	CGUGAGCCUAUUUAUGUCAUCGU-C-UG	51
8-3 (2)	AUCCCGCGAC CAGGGCGUU UCUUCCUCGUCC	63	0.130
8-112 (3)	UCCCGAAUUUAAGUGCGUU UCCUCCGCGUC	64	0.130
8-154 (3)	UCCCAAGAUUCAGGGCGUU UCUUCCUCGUC	65	0.120
8-117	UCCCAAGUUUCAGGGCGUU UCUUCCUCGUC	15	0.130
8-123	UCCCGAGUUUGAGGGCGUU UCUUCUUCGUC	66	0.210
11-121	UCCCAGUUUCAgGGGCGAU UCCUCUUCGUC	67	ND C
8-17 (7,1)	GCGGCU  CGAUG   UCGUCUUAUCCCUUUGCCC	68	0.095
8-16	GCGGGCU  CGAUG   UCGUCUUAUCCCCUUUGCCCC	69	ND
8-158	CCGGCU  CGAUG   UCGUCUUA CCCCUUUGCCC	70	0.310
11-104	GUUUGAG     UGAUG   UCGUCUUGUCCCGCCUGC	71	0.091
11-111	GUUAGAG     UUUUG   UCGUCUUGUCCCAUGUG	72	ND
11-163	GCUUGAGUC    UUUG  AUCGUCUUAUCCCUCGU	73	0.082
11-208	GUUUGAG     UGACG  AUCGUCUUGUCCCAUGUG	74	0.060
11-212	GUUUGAG     UUAAA CAUCGGUUUUCUCCUG	75	0.075
11-6	GACGCG    UUGAUU CAUCGUCUUAUCCUGCUG	76	0.240
11-126	GUUUGGGUCU  UGAUC   UCGUCUUGUCCCGUG	77	0.170
11-165	gUUGAUAGG   AGUCAU  CAUCGUCUUGUCCGC	78	0.073
11-215	GUAGUGAG  UUUUCAUU     GUCUUGUCCCCGUG	79	0.091
11-151	UGAGUCAUAGUGUUG AUCGUCGUAUCCCGU	80	0.170
11-7	GUGGAGUCAA        AUCGUCUUGUCCCUUGUCCU	81	0.110
11-166	GUUUGAG  UUCUGACA    CGUCUUGUCCCAUGC	82	0.079
11-17	GUUAGAGC   GUGACAG  UCGUCUUAUCCCGGGUCA	83	0.130
8-113 (2)	UGAAUUCCUCUGGCUGAAAAU GACUUGUGC	84	0.083
8-60	UGAAUUCCUUUGGCUGAAAAU GACUUGUGC	85	ND
11-221	GCAGAGCGAAAAUCGUCUUGUCCCCGACGC	86	0.062
ORPHANS
11-123	GUGACUCAAAAUGGUGAUCCUCGUUUCGC	87	0.090
8-151	AGGACUAAUCCCUAAGGAAUAGCUUGCCCG	88	8
8-174	UCGAGCUUCUGAGUUAAA   CUGGGGCCUCCU	89	0.230
8-160	GUCCCCGAAUUUAAAGUGCGUUUUCCUCCGGG	90	0.150
11-203	GGUUUUUCUUUUCUUGUUCUCUUCUUUCCCC	91	0.260
11-224	ACAGCGGCGACUAGCCUGUUCAUGCCUGCC	92	0.110
11-107	GUUCUGUGUGUCCACGUUCUUACCCCUGUG	93	0.140
a Clone series 8 is from HGF SELEX 1; series 11 is from HGF SELEX 3. Numbers in parentheses refer to repeat occurrences of the same exact sequence. For the series 8 clones, a second number refers to an exact match which was isolated in series 11.
b N7 fixed sequences are not shown. (5′-GGGAGGACGAUGCGG-N-CAGACGACUCGCCCGA-3′ (SEQ ID NO:2)
c ND, not determined.

TABLE 3
HGF 30N8 aptamer sequences and binding affinities.
Seq. no. a	30N8 random region b	SEQ. ID. No.	k d (nM)
10-28	CCUGUUCUGAAC GCAAAAUGGCGUGGUGGC	94	0.860
10-40	UGUCGUUAGUUUAUUGACAAGGCCCGAAG	95	0.350
10-52	UCUUAUUGUGUCCAGCUUCUCCCUGCAGGC	96	0.160
10-72	UGUGGCAC UGUUGUCCACAAGGGCCUCA	97	0.450
10-8	UUGACAAGGUACCUGUUGCCUGGCGUUUCU	98	0.920
10-76	AGUUAGGCUUUAAAGC  ACG   AUAAUCAGCA	99	0.170
10-47	GUCAAGAGG AAAUGACACGG CUCCACUUUUA	100	0.390
10-2 (10)	GCCUGAGUUAAACAUGACGG  UUUGUGACCC	101	0.069
10-3	GCCUGAGUUAAACAUGACGGGUUUUGUGACCCCU	102	0.072
10-23 (4)	GUCUGAGUUGGACACAACGC  AUUGAGACCC	103	0.330
10-24	GUCUGAGUUgGUCACAACGC  AUUGAGACCC	104	ND C
10-37	GUCUGAGUCCGU AGGGCGA  UUUGUGUCCC	105	3.05
10-7	UGCCUUAAGAGCGGAA  CUCCCUGACCCACC	106	1.45
10-13	GAUCUGUUGGCGU GU    CUACCCGACCCUCCU	107	0.720
10-17	AACCCUGUUGGCGU   GA  CGUCCCGACCCUCC	108	0.560
10-36	CGUUAGCAUCUGAACGAUGCCCAGCCUCAA	109	1.94
10-62	GUUAGACUCAACAUGAGUCCCAGCCUCAA	110	0.440
10-29	UCUGUUGGCGUCGU    UCUCCUGACCCUCCUC	111	1.75
10-48	GAGUUCCCUGUUGAC UCGC    UCUCCUGACCC	112	0.310
10-16	UACAGCGUGUUGGUCCCGGACGGGGACUUAU	113	0.210
10-11	CGCCUGGACCGUUUGUUUAUCCCCGUAGUC	114	0.610
10-18	CGUGAUUCCUACCAUCA   GGUACCUAUCUUG	115	0.300
10-1 (2)	AGUGAUGUGAGAG CGUGCCUCUAGUCGGUG	116	0.094
10-57	CGAGCCUCCUACCGUUU  AGGUACC AUCUUG	117	0.140
10-27	UUAGCCUCCGACCG UAA  GGUCCUUUUCUUG	118	0.830
10-53	GGCCUCCAACCGCUAAA GGUUCCAUUCUUG	119	0.310
10-49	CCCGACCUCCUGUAACUGGUUGA GGCACUA	120	0.240
10-31 (2)	GGGUUCCUGAUUGACCCUGUCUCUAGACCC	121	1.90
10-58	GGGGAGGCCCUUCAGCCGUCUCCUUGACCC	122	0.440
10-63	UGUGAUGUGAGGGC   GUGCUUCCUAACGGUG	123	0.190
40N8 “hitchhiker” sequences
10-19	UUCAUUAUGCAUCGAACAGUAUACCACAGGUGUUCAUGUG	124	ND
10-35	AUCCAAAUUCUGGUCAUGAGGCGCUGCAGAUACUGCUGCG	125	2.33
10-38	UCUGCGGACGGUGAGGUUAAGUUGCAACGACUGCUUGGCG	126	7.38
10-42	CAGACCGUGCAAACCCCCCUUAGAGGGUUUUGUCAUUUAC	127	ND
10-56	CCUUAGGGCUCCCAAAAAUCGGGCC CGUCGGGCCGAUCAC	128	0.280
10-68	CGCGGGAUUCUCUGAGGACGAGGCACGUGUGGGUAAUUCG	129	1.00
10-67	UCGGGCUUGGAUGUGGACGUGUAUUUCUAGCUGUGUACGC	130	0.640
10-4	UUGGGUCGGGACUCGAAAGGAUUUGAUAGGAUACAUGAAU	131	0.610
a Clone series 10 is from HGF SELEX 2. Numbers in parentheses refer to repeat occurrences of the same exact sequence.
b N8 fixed sequences are not shown. (5′-GGGAGAUAAGAAUAAACGCUCAA-N-UUCGACAGGAGGCUCACAACAGGC-3′)(SEQ ID NO:6)
c ND, not detennined.

TABLE 4
List of HGF aptamers and their binding affinities which were
tested in vitro for inhibition of activity.
Seq. no.	random region	Kd (nM)
“consensus”	CGUGAGCCUAUUUAUGUCAUCGU - C - UG
8-17	GCGGCU  CGAUG   UCGU CUUAUCCCUUUGCCC	0.095
8-102	CGAGUGCCUGUUUAUGUCAUCGUCCGUCGU	0.060
8-104	GCGACUCAAUCUGAAUCGUCUUGUCCCGUG	0.050
8-112	UCCCGAAUUUAAGUGCGUU UCCUCCGCGUC	0.130
8-113	UGAAUUCCUCUGGCUGAAAAUGA CUUGUGC	0.083
8-122	CGGUGUGAACCUGUUUAUGUCCGCGUACCC	0.097
8-126	GUGACUCAAAAUGGUGAUCCUCG UUUCCGC	0.099
11-8	UCAGUAUGACU UUUAUAGCA CGUUCGCCC	0.150
11-76	UCAGCGGCGCGAGCCUGUUUAUGUC UGCUG	0.076
11-166	GUUUGAG  UUCUGACA    CGUCU UGUCCCAUGC	0.079
11-208	GUUUGAG     UGACG  AUCGUCU UGUCCCAUGUG	0.060
11-222	ACAUAAGUCU UCUAUAGC UCGUCCUUUGUG	0.077
10-2*	GCCUGAG UUAAACAUGACG  GUUUGUGACCC	0.069
8-151	AGGACUAAUCCCUAAGGAAUAGCUUGCCCG	8
*10-2 contains N8 fixed sequences; all others are N7.

TABLE 5
HGF truncate SELEX 30N sequences.
Trunc	# of	Sequence of random region	Identity to		SEQ. I
Seq# a	hits	(G)G-30N-CA	full-length b	K d (nM)	No.
GGACGAUGCGG CGAGUGCCUGUUUAUGUCAUCGUCC	NX22354	0.1	13
Tr7	(5)	CGGUGUGAACCUGUUUAUGUCCGCGUACCC	8-122	0.67	132
Tr45	(3)	UGGGAACCUAUUUAUGUCAUCUCCGUCCC	11-202	1.7	133
Tr70		UGGGAACCUAUUUAUGUCAUCGUCUGUGCC	New	2.4	134
Tr6		CGUGAGCCUAUUUAUGUCAUCAUGUCUGUG	8-114	9.0	135
Tr20		UGUGAACCUGUUUAUGCCAUCUCGAGUCCC	New	3.4	136
Tr23		UGUGAACCUAUUUAUGCCAUCUCGAGUGCC	8-155	ND c	137
Tr42		UGAUAACCUAUUUAUGACGUCGUGGCUCCC	11-162	6.1	138
Tr44		AGUGAUCCUAUUUAUGCCGUCGCUUCUCGC	New	6.5	139
Tr65		AGAGNUCCUAUUUAUGACAUCCCAUGCCCC	New	1.4	140
Tr48		UGAUCACCUGUUUAUGCCAUCGU U CUGGGC	11-65	1.8	141
Tr28		GGUGACCCUUUUUAUGACAUCGCGUCUGGC	New	4.0	142
Tr51	(6)	AAUCACAGGAAUCAACUUCUAUUCCCGCCC	New	0.06	143
Tr67		AAUCACAGGAAUCGACUUUUAUUCCUGCCC	New	ND	144
Tr17		GC GGCUCGAUGUCGUCUUAUCCCUUUGCCC	8-17	3.0	145
Tr27		UC GGCUCGUUGUCGUCUUAUCCCUUUGCCC	New	ND	146
Tr18		GCUGGCUCGAUGUCAGGUUAUCCCUUUGCCC	New	ND	147
Tr4	(4,2) d	GUGACUCAAAAUGGUGAUCCUCGUUUCCGC	8-126	1.4	148
Tr31	(2)	UGAAUUCCUCUGGCUGAAAAUGACUUGUGC	8-113	9.2	149
Tr15		GUUUGAGUGACGAUCGUCUUGUCCCAUGUG	11-208	8.8	150
Tr1		AUUGAUUCACUGCAUCCUUGACUCUUCCCC	New	7.3	151
Tr5		CAGACGACUCGCCCGAAGGACGAUGCGG	New	28	152
Tr14		GAGUUAUAUUUCGUCACCCGUUCCUUUGCCC	New	2.2	153
Tr59		ACAGUUUGUCUUCUAUAGCUCGUCGCCCC	New	7.2	154
Tr71		UCAGAAUGACUUUCAUAGCUCGCUUUCCCC	New	7.7	155
a Trl-36 and Tr37-72 clones are from series which were carried through 8 and 11 conventional rounds, respectively.
b Sequences indicated are identical to full length aptamers derived from series 8 or 11; NX22354 is a synthetic truncate based on boundary experiments, derived from sequence 8-102, shown here for comparative purposes.
c ND, not determined.
d (4,2) refers to 4 occurrences in the first series and two in the second series.

TABLE 6
Invasion of A549 cells through
Matrigel is inhibited by HGF aptamer NX22354.
Sample	HGF 10 ng/ml	Inhibitor	Cells migrated
1	−	—	40
2	+	—	240
3	+	mAb a ,	1 g/ml	120
4	+	NX22354,	1 uM	40
5	+	NX22354,	0.2 uM	25
6	+	NX22354,	0.04 uM	200
a Anti-HGF antibody was MAB294 from R&D Systems, Inc.

TABLE 6
Invasion of A549 cells through
Matrigel is inhibited by HGF aptamer NX22354.
Sample	HGF 10 ng/ml	Inhibitor	Cells migrated
1	−	—	40
2	+	—	240
3	+	mAb a ,	1 g/ml	120
4	+	NX22354,	1 uM	40
5	+	NX22354,	0.2 uM	25
6	+	NX22354,	0.04 uM	200
a Anti-HGF antibody was MAB294 from R&D Systems, Inc.

TABLE 9
40N7 sequences isolated from a plate SELEX on human c-met.
Clone name:	(number of isolates).	Sequence a	SEQ ID NO:
FAMILY 1:
7C -1:	(2)	UUUGACUAUGUCUGACGGGUCUGUGGUCAAUUCCGCCCC	160
FAMILY 2
7C -4:	(1)	AUCCGUGUUGAUGUCCAUAUAACCUUAUCCCGUCGCUCCC	161
7C -5:	(1)	GUGUUGACUUCUAGCCAGAAUAACAUUUUGUACCCCUCCC	162
FAMILY 3
7C -2:	(1)	UCGUUGAGCUUUUGAUAGGGCUUGUUCUUCGAGCGUCCC	163
7C-23:	(1)	UGAUCUUGGGUUUGAUCGUAAUUACUUCACCCUCCGUCCC	164
FAMILY 4
7C-26:	(2)	CUCCUUUUCCGCUAAACAAGACCACUUUGAGCCCUGCCCC	165
FAMILY 5
7C-25:	(1)	CCACCUCGUUACGUACUGAUUUUGGCAUCGCAGUUUGCCC	166
7C-27:	(1)	GGGCACCUCGAUACGUACUGAUUUUGAAUAUCAGUUAGCCCC	167
OTHERS
7C-21:	(1)	CGAUUCGUCGUAUAGAAAUGAUUUGAAUGCACCUCCUCCC	168
7C-24:	(1)	UGUGUUUGUGUGUUGUGUUUGUUAUUCCUGUUUGUGUCCU	169
7C-32:	(1)	UCGGUCGUAAAAAAUCGUUGGUGUCUAUCUAUUGUUCUCCC	170
Presumed IgG i aptamers
7C -3:	(1)	UGCUCCAGAGGAACCAUCGUUUACUUCAUUUAUUCGCCC	171
7C-22:	(1)	UGCUCCUUAGGAACCAUCGUCUAUAUCCCAUUCUGACUGCC	172
7C-30:	(1)	UGCUCCUCAGGAACCAUCGUUUUUCCCAUGUCCUUCUGCC	173
7C-29:	(3)	UGCUCCUUGGAUUACCAAGGAACCAUUUUCCUCUACCCCC	174
a N7 fixed sequences are not shown. (5′-GGGAGGACGAUGCGG-N-CAGACGACUCGCCCGA-3′)(SEQ ID NO:2)

TABLE 10
30N8 sequences isolated from a plate SELEX on human c-met.
Clone name:	(number of isolates).	Sequence a	SEQ. ID. NO:
FAMILY 1:
7b-1:	(4)	GUGCUCAUUACGAACUUGACCGAUGCCUA	175
7b-9:	(1)	GGUGCUCAUUACGAACUUGACCGAAGCCUA	176
7b-18:	(1)	GGUGCUCAUUACGAACUUGACCGAUGCCUA	177
7b-3:	(1)	AGUGCUCCAAUGAACUUUGCUCGCUGA	178
7b-8:	(1)	GGUGCUCCGUUUGGAACUUGAUCGGUAGGA	179
7b-7:	(1)	GUGCUCAUUCAGAACUUGACGUAUAACCA	180
7b-14	(1)	GGUGCUCCUUAGGAACUUGACCGUCCGCCA	181
7b-16:	(1)	GUGGUGCUCCACUAACCAAGUGGAACCUUG	182
consensus:		GUGCUC-UU--GAACUUGACCG	183
OTHERS:
7b-10:	(1)	ACGAUAAGUGGGAGUGAGUAAGUUUGAGUA	184
7b-12:	(1)	CCUAGACCCCCAGGUUCCUCCCCACUAGUC	185
a N8 fixed sequences are not shown. (5′-GGGAGAUAAGAAUAAACGCUCAA-N-UUCGACAGGAGGCUCACAACAGGC-3′)(SEQ ID NO:6)

192 1 78 DNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 1taatacgact cactataggg augacgaugc ggnnnnnnnn nnnnnnnnnn nnnnnnnnnn 60nncagacgac ucgcccga 78 2 61 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 2gggaggacga ugcggnnnnn nnnnnnnnnn nnnnnnnnnn nnnnncagac gacucgcccg 60a 61 3 32 DNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 3taatacgact cactataggg augacgaugc gg 32 4 16 DNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 4tcgggcgagt cgtctg 16 5 94 DNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 5taatacgact cactataggg agacaagaat aaacgctcaa nnnnnnnnnn nnnnnnnnnn 60nnnnnnnnnn ttcgacagga ggctcacaac aggc 94 6 77 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 6gggagauaag aauaaacgcu caannnnnnn nnnnnnnnnn nnnnnnnnnn nnnuucgaca 60ggaggcucac aacaggc 77 7 26 DNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 7taatacgact cactataggg agacaa 26 8 24 DNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 8gcctgttgtg agcctcctgt cgaa 24 9 15 DNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 9cccuccugcu acgcc 15 10 16 DNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 10gtctgcugag cgggcu 16 11 34 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 11ggnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnca 34 12 61 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 12gggaggacga ugcggcgagu gccuguuuau gucaucgucc gucgucagac gacucgcccg 60a 61 13 36 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 13ggacgaugcg gcgagugccu guuuauguca ucgucc 36 14 28 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 14gacgaugcgg cgagugccug uuuauguc 28 15 88 DNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 15taatacgact cactataggg augacgaugc ggnnnnnnnn nnnnnnnnnn nnnnnnnnnn 60nnnnnnnnnn nncagacgac ucgcccga 88 16 28 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 16ggacgaugcg ggcggcucga ugucgucu 28 17 38 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 17gggaggacga ugcgggcggc ucgaugucgu cuuauccc 38 18 61 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 18gggaggacga ugcggcggug ugaaccuguu uauguccgcg uaccccagac gacucgcccg 60a 61 19 61 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 19gggaggacga ugcggcggug uggaccuguu uauguccgcg uaccccagac gacucgcccg 60a 61 20 61 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 20gggaggacga ugcggaguga uccuauuuau gacaucgcgg gcugccagac gacucgcccg 60a 61 21 61 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 21gggaggacga ugcgguguga accuguuuau gucaucuuuu gucgucagac gacucgcccg 60a 61 22 61 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 22gggaggacga ugcgguguga accuauuuau gccaucucga gugcccagac gacucgcccg 60a 61 23 61 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 23gggaggacga ugcggcguga gccuauuuau gucaucaugu cuguccagac gacucgcccg 60a 61 24 61 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 24gggaggacga ugcggcgaga gccuauuuau gucaucaugc cugugcagac gacucgcccg 60a 61 25 61 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 25gggaggacga ugcggcggga gccuuuuuau gucaucaugu cugugcagac gacucgcccg 60a 61 26 61 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 26gggaggacga ugcggcguga gccuauuuau gucaucaugu cugugcagac gacucgcccg 60a 61 27 61 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 27gggaggacga ugcggcgcga gccuauuuau gucaucaugu cugugcagac gacucgcccg 60a 61 28 61 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 28gggaggacga ugcggcguga gccuauuuau gucaucaugu cuggucagac gacucgcccg 60a 61 29 61 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 29gggaggacga ugcggcguga gccuauuuac gucaucaugu cugugcagac gacucgcccg 60a 61 30 61 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 30gggaggacga ugcgguguga accuauuuau gccauuaugu cugugcagac gacucgcccg 60a 61 31 61 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 31gggaggacga ugcggcguga gccuauuuau gucaucaagu cugugcagac gacucgcccg 60a 61 32 61 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 32gggaggacga ugcggcguga gccuguuuau gaccucgucc auggccagac gacucgcccg 60a 61 33 61 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 33gggaggacga ugcggcguga gccuauuuau gacauguccc ucgagcagac gacucgcccg 60a 61 34 61 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 34gggaggacga ugcggcguga gccuguauau gucauuguuc uccggcagac gacucgcccg 60a 61 35 61 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 35gggaggacga ugcggugagu accuguuuau gucaccacuu ucccccagac gacucgcccg 60a 61 36 58 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 36gggaggacga ugcggugauu accuauuaug ucucgcccuc uccagacgac ucgcccga 58 37 61 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 37gggaggacga ugcggugauu accuauuuau gucaugcucc ucccccagac gacucgcccg 60a 61 38 61 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 38gggaggacga ugcggugaua accuguuuau gccaucgugc ugggccagac gacucgcccg 60a 61 39 61 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 39gggaggacga ugcggugaua accuguuuau gucaucgugc ugggccagac gacucgcccg 60a 61 40 61 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 40gggaggacga ugcggugaga accuauuuau gucaucgugu cuggccagac gacucgcccg 60a 61 41 61 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 41gggaggacga ugcggugaua accuauuuau gacgucgugg cuccccagac gacucgcccg 60a 61 42 60 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 42gggaggacga ugcgguggga accuauuuau gucaucuccg uccccagacg acucgcccga 60 43 59 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 43gggaggacga ugcggcgaug augccuguuu augucgaugu cccccgggag acgaugcgg 59 44 61 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 44gggaggacga ugcggcgaua gccuauuuau gaccucgucc ccgugcagac gacucgcccg 60a 61 45 61 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 45gggaggacga ugcggcguga gccuauuuau gacaucguuc uuggccagac gacucgcccg 60a 61 46 61 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 46gggaggacga ugcggcguga gccuaucuau gucaucgugu gugcccagac gacucgcccg 60a 61 47 60 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 47gggaggacga ugcggugagu acuauuuaug ucgucguucg ugcccagacg acucgcccga 60 48 61 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 48gggaggacga ugcggcguga gccuuccaau gacgucgucc uuggccagac gacucgcccg 60a 61 49 61 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 49gggaggacga ugcgggcgac ucaaucugaa ucgucuuguc ccgugcagac gacucgcccg 60a 61 50 61 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 50gggaggacga ugcggucagc ggcgcgagcc uguuuauguc ugcugcagac gacucgcccg 60a 61 51 57 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 51gggaggacga ugcggcguga gccuauuuau gucaucgucu gcagacgacu cgcccga 57 52 60 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 52gggaggacga ugcggucagu augacuuuua uagcacguuc gccccagacg acucgcccga 60 53 61 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 53gggaggacga ugcggacagg uagucuucua uagcacuucc ucccccagac gacucgcccg 60a 61 54 60 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 54gggaggacga ugcggucaga augacuuuca uagcacgcuu uccccagacg acucgcccga 60 55 61 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 55gggaggacga ugcggacaua agucuucuau agcucguccu uugugcagac gacucgcccg 60a 61 56 61 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 56gggaggacga ugcggucagu auggcuucua uagcucguuc cucggcagac gacucgcccg 60a 61 57 61 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 57gggaggacga ugcgggugac ucaaaauggu gauccucguu uccgccagac gacucgcccg 60a 61 58 62 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 58gggaggacga ugcgggugac ucaaaauggu gauccucgau uuccgccaga cgacucgccc 60ga 62 59 62 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 59gggaggacga ugcgggugac ucaaaauggu gauccucgau ugccgccaga cgacucgccc 60ga 62 60 61 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 60gggaggacga ugcgggccga aaauucgucg acaucucccu gucugcagac gacucgcccg 60a 61 61 61 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 61gggaggacga ugcggggcga cuuuccucca auucucaccu cugcacagac gacucgcccg 60a 61 62 61 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 62gggaggacga ugcgggccau ucgaucgauu cuccgccgga ucgugcagac gacucgcccg 60a 61 63 62 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 63gggaggacga ugcggauccc gcgaccaggg cguuucuucc ucgucccaga cgacucgccc 60ga 62 64 61 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 64gggaggacga ugcggucccg aauuuaagug cguuuccucc gcguccagac gacucgcccg 60a 61 65 61 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 65gggaggacga ugcgguccca agauucaggg cguuucuucc ucguccagac gacucgcccg 60a 61 66 61 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 66gggaggacga ugcggucccg aguuugaggg cguuucuucu ucguccagac gacucgcccg 60a 61 67 61 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 67gggaggacga ugcgguccca guuucagggg cgauuccucu ucguccagac gacucgcccg 60a 61 68 61 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 68gggaggacga ugcgggcggc ucgaugucgu cuuaucccuu ugccccagac gacucgcccg 60a 61 69 64 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 69gggaggacga ugcgggcggg cucgaugucg ucuuaucccc uuugccccca gacgacucgc 60ccga 64 70 61 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 70gggaggacga ugcggccggc ucgaugucgu cuuaccccuu ugccccagac gacucgcccg 60a 61 71 61 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 71gggaggacga ugcggguuug agugaugucg ucuugucccg ccugccagac gacucgcccg 60a 61 72 60 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 72gggaggacga ugcggguuag aguuuugucg ucuuguccca ugugcagacg acucgcccga 60 73 61 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 73gggaggacga ugcgggcuug agucuuugau cgucuuaucc cucgucagac gacucgcccg 60a 61 74 61 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 74gggaggacga ugcggguuug agugacgauc gucuuguccc augugcagac gacucgcccg 60a 61 75 59 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 75gggaggacga ugcggguuug aguuaaacau cgguuuucuc cugcagacga cucgcccga 59 76 61 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 76gggaggacga ugcgggacgc guugauucau cgucuuaucc ugcugcagac gacucgcccg 60a 61 77 61 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 77gggaggacga ugcggguuug ggucuugauc ucgucuuguc ccgugcagac gacucgcccg 60a 61 78 61 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 78gggaggacga ugcggguuga uaggagucau caucgucuug uccgccagac gacucgcccg 60a 61 79 61 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 79gggaggacga ugcggguagu gaguuuucau ugucuugucc ccgugcagac gacucgcccg 60a 61 80 61 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 80gggaggacga ugcggugagu cauaguguug aucgucguau cccgucagac gacucgcccg 60a 61 81 61 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 81gggaggacga ugcgggugga gucaaaucgu cuugucccuu guccucagac gacucgcccg 60a 61 82 61 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 82gggaggacga ugcggguuug aguucugaca cgucuugucc caugccagac gacucgcccg 60a 61 83 64 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 83gggaggacga ugcggguuag agcgugacag ucgucuuauc ccgggucaca gacgacucgc 60ccga 64 84 61 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 84gggaggacga ugcggugaau uccucuggcu gaaaaugacu ugugccagac gacucgcccg 60a 61 85 61 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 85gggaggacga ugcggugaau uccuuuggcu gaaaaugacu ugugccagac gacucgcccg 60a 61 86 61 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 86gggaggacga ugcgggcaga gcgaaaaucg ucuugucccc gacgccagac gacucgcccg 60a 61 87 60 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 87gggaggacga ugcgggugac ucaaaauggu gauccucguu ucgccagacg acucgcccga 60 88 61 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 88gggaggacga ugcggaggac uaaucccuaa ggaauagcuu gcccgcagac gacucgcccg 60a 61 89 61 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 89gggaggacga ugcggucgag cuucugaguu aaacuggggc cuccucagac gacucgcccg 60a 61 90 63 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 90gggaggacga ugcggguccc cgaauuuaaa gugcguuuuc cuccgggcag acgacucgcc 60cga 63 91 62 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 91gggaggacga ugcgggguuu uucuuuucuu guucucuucu uucccccaga cgacucgccc 60ga 62 92 61 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 92gggaggacga ugcggacagc ggcgacuagc cuguucaugc cugcccagac gacucgcccg 60a 61 93 61 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 93gggaggacga ugcggguucu guguguccac guucuuaccc cugugcagac gacucgcccg 60a 61 94 77 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 94gggagauaag aauaaacgcu caaccuguuc ugaacgcaaa auggcguggu ggcuucgaca 60ggaggcucac aacaggc 77 95 76 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 95gggagauaag aauaaacgcu caaugucguu aguuuauuga caaggcccga aguucgacag 60gaggcucaca acaggc 76 96 77 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 96gggagauaag aauaaacgcu caaucuuauu guguccagcu ucucccugca ggcuucgaca 60ggaggcucac aacaggc 77 97 75 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 97gggagauaag aauaaacgcu caauguggca cuguugucca caagggccuc auucgacagg 60aggcucacaa caggc 75 98 77 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 98gggagauaag aauaaacgcu caauugacaa gguaccuguu gccuggcguu ucuuucgaca 60ggaggcucac aacaggc 77 99 76 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 99gggagauaag aauaaacgcu caaaguuagg cuuuaaagca cgauaaucag cauucgacag 60gaggcucaca acaggc 76 100 78 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 100gggagauaag aauaaacgcu caagucaaga ggaaaugaca cggcuccacu uuuauucgac 60aggaggcuca caacaggc 78 101 77 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 101gggagauaag aauaaacgcu caagccugag uuaaacauga cgguuuguga cccuucgaca 60ggaggcucac aacaggc 77 102 81 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 102gggagauaag aauaaacgcu caagccugag uuaaacauga cggguuuugu gaccccuuuc 60gacaggaggc ucacaacagg c 81 103 77 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 103gggagauaag aauaaacgcu caagucugag uuggacacaa cgcauugaga cccuucgaca 60ggaggcucac aacaggc 77 104 77 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 104gggagauaag aauaaacgcu caagucugag uuggucacaa cgcauugaga cccuucgaca 60ggaggcucac aacaggc 77 105 76 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 105gggagauaag aauaaacgcu caagucugag uccguagggc gauuuguguc ccuucgacag 60gaggcucaca acaggc 76 106 77 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 106gggagauaag aauaaacgcu caaugccuua agagcggaac ucccugaccc accuucgaca 60ggaggcucac aacaggc 77 107 77 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 107gggagauaag aauaaacgcu caagaucugu uggcgugucu acccgacccu ccuuucgaca 60ggaggcucac aacaggc 77 108 77 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 108gggagauaag aauaaacgcu caagaucugu uggcgugucu acccgacccu ccuuucgaca 60ggaggcucac aacaggc 77 109 77 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 109gggagauaag aauaaacgcu caacguuagc aucugaacga ugcccagccu caauucgaca 60ggaggcucac aacaggc 77 110 76 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 110gggagauaag aauaaacgcu caaguuagac ucaacaugag ucccagccuc aauucgacag 60gaggcucaca acaggc 76 111 77 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 111gggagauaag aauaaacgcu caaucuguug gcgucguucu ccugacccuc cucuucgaca 60ggaggcucac aacaggc 77 112 77 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 112gggagauaag aauaaacgcu caagaguucc cuguugacuc gcucuccuga cccuucgaca 60ggaggcucac aacaggc 77 113 78 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 113gggagauaag aauaaacgcu caauacagcg uguugguccc ggacggggac uuauuucgac 60aggaggcuca caacaggc 78 114 77 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 114gggagauaag aauaaacgcu caacgccugg accguuuguu uauccccgua gucuucgaca 60ggaggcucac aacaggc 77 115 77 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 115gggagauaag aauaaacgcu caacgugauu ccuaccauca gguaccuauc uuguucgaca 60ggaggcucac aacaggc 77 116 77 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 116gggagauaag aauaaacgcu caaagugaug ugagagcgug ccucuagucg guguucgaca 60ggaggcucac aacaggc 77 117 77 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 117gggagauaag aauaaacgcu caacgagccu ccuaccguuu agguaccauc uuguucgaca 60ggaggcucac aacaggc 77 118 77 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 118gggagauaag aauaaacgcu caauuagccu ccgaccguaa gguccuuuuc uuguucgaca 60ggaggcucac aacaggc 77 119 77 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 119gggagauaag aauaaacgcu caaggccucc aaccgcuaaa gguuccauuc uuguucgaca 60ggaggcucac aacaggc 77 120 77 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 120gggagauaag aauaaacgcu caacccgacc uccuguaacu gguugaggca cuauucgaca 60ggaggcucac aacaggc 77 121 77 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 121gggagauaag aauaaacgcu caaggguucc ugauugaccc ugucucuaga cccuucgaca 60ggaggcucac aacaggc 77 122 77 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 122gggagauaag aauaaacgcu caaggggagg cccuucagcc gucuccuuga cccuucgaca 60ggaggcucac aacaggc 77 123 77 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 123gggagauaag aauaaacgcu caaugugaug ugagggcgug cuuccuaacg guguucgaca 60ggaggcucac aacaggc 77 124 87 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 124gggagauaag aauaaacgcu caauucauua ugcaucgaac aguauaccac agguguucau 60guguucgaca ggaggcucac aacaggc 87 125 87 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 125gggagauaag aauaaacgcu caaauccaaa uucuggucau gaggcgcugc agauacugcu 60gcguucgaca ggaggcucac aacaggc 87 126 87 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 126gggagauaag aauaaacgcu caaucugcgg acggugaggu uaaguugcaa cgacugcuug 60gcguucgaca ggaggcucac aacaggc 87 127 87 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 127gggagauaag aauaaacgcu caacagaccg ugcaaacccc ccuuagaggg uuuugucauu 60uacuucgaca ggaggcucac aacaggc 87 128 87 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 128gggagauaag aauaaacgcu caaccuuagg gcucccaaaa aucgggcccg ucgggccgau 60cacuucgaca ggaggcucac aacaggc 87 129 87 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 129gggagauaag aauaaacgcu caacgcggga uucucugagg acgaggcacg uguggguaau 60ucguucgaca ggaggcucac aacaggc 87 130 87 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 130gggagauaag aauaaacgcu caaucgggcu uggaugugga cguguauuuc uagcugugua 60cgcuucgaca ggaggcucac aacaggc 87 131 87 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 131gggagauaag aauaaacgcu caauuggguc gggacucgaa aggauuugau aggauacaug 60aauuucgaca ggaggcucac aacaggc 87 132 30 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 132cggugugaac cuguuuaugu ccgcguaccc 30 133 29 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 133ugggaaccua uuuaugucau cuccguccc 29 134 30 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 134ugggaaccua uuuaugucau cgucugugcc 30 135 30 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 135cgugagccua uuuaugucau caugucugug 30 136 30 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 136ugugaaccug uuuaugccau cucgaguccc 30 137 30 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 137ugugaaccua uuuaugccau cucgagugcc 30 138 30 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 138ugauaaccua uuuaugacgu cguggcuccc 30 139 30 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 139agugauccua uuuaugccgu cgcuucucgc 30 140 30 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 140agagnuccua uuuaugacau cccaugcccc 30 141 30 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 141ugaucaccug uuuaugccau cguucugggc 30 142 30 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 142ggugacccuu uuuaugacau cgcgucuggc 30 143 30 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 143aaucacagga aucaacuucu auucccgccc 30 144 30 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 144aaucacagga aucgacuuuu auuccugccc 30 145 30 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 145gcggcucgau gucgucuuau cccuuugccc 30 146 30 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 146ucggcucguu gucgucuuau cccuuugccc 30 147 31 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 147gcuggcucga ugucagguua ucccuuugcc c 31 148 30 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 148gugacucaaa auggugaucc ucguuuccgc 30 149 30 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 149ugaauuccuc uggcugaaaa ugacuugugc 30 150 30 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 150guuugaguga cgaucgucuu gucccaugug 30 151 30 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 151auugauucac ugcauccuug acucuucccc 30 152 28 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 152cagacgacuc gcccgaagga cgaugcgg 28 153 31 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 153gaguuauauu ucgucacccg uuccuuugcc c 31 154 29 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 154acaguuuguc uucuauagcu cgucgcccc 29 155 30 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 155ucagaaugac uuucauagcu cgcuuucccc 30 156 37 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 156ggacgaugcg gcgagugccu guuuauguca ucguccg 37 157 37 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 157ggacgaugcg gcgagugccu guuuauguca ucguccg 37 158 37 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 158ggacgaugcg gcgagugccu guuuauguca ucguccg 37 159 37 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 159ggacgaugcg gcgagugccu guuuauguca ucguccg 37 160 70 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 160gggaggacga ugcgguuuga cuaugucuga cgggucugug gucaauuccg cccccagacg 60acucgcccga 70 161 71 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 161gggaggacga ugcggauccg uguugauguc cauauaaccu uaucccgucg cuccccagac 60gacucgcccg a 71 162 71 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 162gggaggacga ugcggguguu gacuucuagc cagaauaaca uuuuguaccc cuccccagac 60gacucgcccg a 71 163 70 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 163gggaggacga ugcggucguu gagcuuuuga uagggcuugu ucuucgagcg uccccagacg 60acucgcccga 70 164 71 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 164gggaggacga ugcggugauc uuggguuuga ucguaauuac uucacccucc guccccagac 60gacucgcccg a 71 165 71 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 165gggaggacga ugcggcuccu uuuccgcuaa acaagaccac uuugagcccu gcccccagac 60gacucgcccg a 71 166 71 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 166gggaggacga ugcggccacc ucguuacgua cugauuuugg caucgcaguu ugccccagac 60gacucgcccg a 71 167 73 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 167gggaggacga ugcgggggca ccucgauacg uacugauuuu gaauaucagu uagcccccag 60acgacucgcc cga 73 168 71 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 168gggaggacga ugcggcgauu cgucguauag aaaugauuug aaugcaccuc cuccccagac 60gacucgcccg a 71 169 71 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 169gggaggacga ugcggugugu uuguguguug uguuuguuau uccuguuugu guccucagac 60gacucgcccg a 71 170 72 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 170gggaggacga ugcggucggu cguaaaaaau cguugguguc uaucuauugu ucuccccaga 60cgacucgccc ga 72 171 70 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 171gggaggacga ugcggugcuc cagaggaacc aucguuuacu ucauuuauuc gccccagacg 60acucgcccga 70 172 72 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 172gggaggacga ugcggugcuc cuuaggaacc aucgucuaua ucccauucug acugcccaga 60cgacucgccc ga 72 173 71 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 173gggaggacga ugcggugcuc cucaggaacc aucguuuuuc ccauguccuu cugcccagac 60gacucgcccg a 71 174 71 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 174gggaggacga ugcggugcuc cuuggauuac caaggaacca uuuuccucua ccccccagac 60gacucgcccg a 71 175 76 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 175gggagauaag aauaaacgcu caagugcuca uuacgaacuu gaccgaugcc uauucgacag 60gaggcucaca acaggc 76 176 77 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 176gggagauaag aauaaacgcu caaggugcuc auuacgaacu ugaccgaagc cuauucgaca 60ggaggcucac aacaggc 77 177 77 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 177gggagauaag aauaaacgcu caaggugcuc auuacgaacu ugaccgaugc cuauucgaca 60ggaggcucac aacaggc 77 178 74 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 178gggagauaag aauaaacgcu caaagugcuc caaugaacuu ugcucgcuga uucgacagga 60ggcucacaac aggc 74 179 77 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 179gggagauaag aauaaacgcu caaggugcuc cguuuggaac uugaucggua ggauucgaca 60ggaggcucac aacaggc 77 180 76 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 180gggagauaag aauaaacgcu caagugcuca uucagaacuu gacguauaac cauucgacag 60gaggcucaca acaggc 76 181 77 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 181gggagauaag aauaaacgcu caaggugcuc cuuaggaacu ugaccguccg ccauucgaca 60ggaggcucac aacaggc 77 182 77 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 182gggagauaag aauaaacgcu caaguggugc uccacuaacc aaguggaacc uuguucgaca 60ggaggcucac aacaggc 77 183 66 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 183gggagauaag aauaaacgcu caagugcucu ugaacuugac cguucgacag gaggcucaca 60acaggc 66 184 77 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 184gggagauaag aauaaacgcu caaacgauaa gugggaguga guaaguuuga guauucgaca 60ggaggcucac aacaggc 77 185 77 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 185gggagauaag aauaaacgcu caaccuagac ccccagguuc cuccccacua gucuucgaca 60ggaggcucac aacaggc 77 186 36 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 186ggacgaugcg gcgagugccu guuuauguca ucgucc 36 187 36 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 187ggacgaugcg gcgagugccu guuuauguca ucgucc 36 188 39 DNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 188acgagtttat cgaaaaagaa cgatggttcc aatggagca 39 189 27 DNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 189cgcaggatcc taatacgact cactata 27 190 71 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 190gggaggacga ugcggnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnncagac 60gacucgcccg a 71 191 104 DNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 191taatacgact cactataggg agacaagaat aaacgctcaa nnnnnnnnnn nnnnnnnnnn 60nnnnnnnnnn nnnnnnnnnn ttcgacagga ggctcacaac aggc 104 192 87 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 192gggagauaag aauaaacgcu caannnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 60nnnuucgaca ggaggcucac aacaggc 87

Claims

1. A method for the isolation of nucleic acid ligands to HGF, comprising:a) preparing a candidate mixture of nucleic acids; b) contacting the candidate mixture of nucleic acids with HGF, wherein nucleic acids having an increased affinity to HGF relative to the candidate mixture may be partitioned from the remainder of the candidate mixture; c) partitioning the increased affinity nucleic acids from the remainder of the candidate mixture; d) amplifying the increased affinity nucleic acids to yield a mixture of nucleic acids enriched for nucleic acids with relatively higher affinity and specificity for binding to HGF, whereby a nucleic acid ligand of HGF may be identified.

2. The method of claim 1 wherein said candidate mixture comprises single-stranded nucleic acids.

3. The method of claim 2 wherein said single-stranded nucleic acids comprise ribonucleic acids.