PACAP receptor protein, method for preparing said protein, and use thereof

FIELD OF THE INVENTION
The present invention relates to a pituitary adenylate cyclase activating polypeptide (hereinafter referred to "PACAP") receptor protein (hereinafter may be referred to "PACAP receptor protein") or a salt thereof which is capable of binding a PACAP, a DNA comprising a DNA fragment coding for said protein, a method for preparing said protin or the salt thereof, and use of said protein and said DNA.
BACKGROUND OF THE INVENTION
PACAP was first isolated from the hypothalami of sheep as a peptide promoting adenylate cyclase activity of the pituitary glands [Biochemical Biophysical Research Communications, 164, 567-574 (1989)]. PACAP first isolated was one consisting of 38 amino acid residues. However, the presence of PACAP consisting of 27 residues on the N-terminal side was also revealed. Both are nearly equal in adenylate cyclase activating ability to each other. The former is referred to as PACAP38, and the latter is referred to as PACAP27. The expression of a PACAP having the same structure as that of sheep was also proved in humans, which suggested that PACAPs are important peptides conserved beyond species [Biochem. Biophys. Res. Commun., 166, 81-89 (1990)]. For the distribution thereof in organs, they are observed not only in the brain hypothalami, but also in the pituitary glands, the testes and the adrenals (Endocrinology, 129, 2787-2789). At present, PACAPs such as PACAP27 to PACAP38 (U.S. Pat. No. 5,128,242) and PACAP23 to PACAP26 (European Patent Publication No. 0467279A3) have been reported.
Physiological actions of PACAPs diversely varies according to their occurrence sites. Various actions of the PACAPs as described below have hitherto been reported:
(1) Promotion of cAMP production in primary culture cells of the rat pituitary glands [A. Miyata et al., Biochem. Biophys. Res. Commun., 164, 567-574 (1989)];
(2) Promotion of secretion of GH, ACTH, PRL and LH in the rat pituitary gland superfusion process [A. Miyata et al., Biochem. Biophys. Res. Commun., 164, 567-574 (1989)];
(3) Production of cAMP in adrenomedullary chromaffinoma-derived cells PC12h and promotion of neurite outgrowth [T. Watanabe et al., Biochem. Biophys. Res. Commun., 173, 252-258 (1990), and K. Okazaki et al., FEBS Letters, 298, 49-56 (1992)];
(4) Promotion of interleukin-6 production in pituitary gland culture cells [I. Tatsuno et al., Endocrinology, 129, 1797-1804 (1991)]; and
(5) Promotion of cAMP production in primary culture of rat astrocytes and promotion of action preventing nerve cell death [Biochem. Biophys. Res. Commun., 168, 1027-1033 (1990)].
In order for PACAP to exhibit its action, the presence of a receptor specific for PACAP in target organs and cells is indispensable.
Receptor binding experiments using radioactive iodine-labeled PACAP27 ([.sup.125 I] PACAP27) have proved the presence of a PACAP receptor. Namely, when a membrane fraction prepared from a tissue is mixed with [.sup.125 I] PACAP27 and reacted for an appropriate period of time, binding of [.sup.125 I] PACAP27 to the membrane fraction is observed. This binding is inhibited by unlabeled PACAP27 or PACAP38, but not inhibited by VIP, an analogous peptide of the PACAPs. This result suggests that a substance specifically binding to the PACAPs occurs in the tissue. Such binding activity is highest in membrane fractions of the brain hypothalami, and also observed in the pituitary glands, the adrenals and the like [Endocrinology, 127, 272-277 (1990)]. Further, a body of PACAP binding activity observed in membrana cerebri fractions, namely a receptor, is deduced to be a protein having a molecular weight of 57,000 from a technique (so-called affinity-label experiment) comprising binding [.sup.125 I] PACAP27 to the membrana cerebri fraction, crosslinking [.sup.125 I] PACAP27 and the body of its binding activity with a crosslinking reagent, then subjecting the product to polyacrylamide gel electrophoresis in the presence of sodium dodecylsulfate, and analyzing by autoradiography [Biochem. Biophys. Res. Commun., 171, 838-844 (1990)].
It is expected that clarification of some fundamental properties of this specific receptor allows elucidation of additional various properties of the PACAP receptor to proceed more than before. In particular, cloning of cDNA coding for the receptor protein and structure analysis thereof enable elucidation of the mechanism of its mutual interaction with a ligand, production of receptor-agonists and antagonists and detailed analysis of sites of action by in situ hybridization using said cDNA. Although cloning of the VIP, secretin and growth hormone releasing factor receptor proteins cDNA has been reported, the cloning of the PACAP receptor has not. These three kinds of bioactive peptides have also showed a capital similarity in the structures of their receptor proteins. For the PACAP receptors, however, cloning of cDNA has hitherto not been carried out.
Recently, the following five documents reported amino acid sequences for a rat PACAP receptor protein and nucleotide sequences of DNAs coding for the protein [Document 1: Biochemical and Biophysical Research Communications, 194, 1, pp. 133-143, 1993; Document 2: Federation of European Biochemical Societies (FEBS), 329, 1 and 2, pp. 99-105; Document 3: Proceedings of the National Academy of Science, USA, 90, pp. 6345-6349, 1993; Document 4: Nature, 365, pp. 170-175, 1993 and Document 5: Neuron, 11, pp. 333-342, 1993). Among them, the amino acid sequences and the nucleotide sequences described in the Documents 1, 2, 4 and 5 are identified with the amino acid sequence for a rat PACAP receptor protein and with the nucleotide sequence for a DNA coding for the protein. The amino acid sequence described in Document 3 is different from the amino acid sequence of the present invention for a rat PACAP receptor protein in one amino acid, and the nucleotide sequence of Document 3 is also different from the nucleotide sequence of the present invention in one nucleotide. All of the five documents were published after Jun. 24, 1993 which is one of the priority dates of the present invention.
In general, when specific binding substances such as receptors are purified, affinity column chromatography applying its mutual interaction with the specific binding substance (for example, ligands for receptors) are frequently used. A process using an affinity column in which a ligand is fixed on a carrier is simplest. However, many successful examples of complicated affinity chromatography are known in which the specific mutual interaction between avidin and biotin is utilized for purification of receptors. This process comprises synthesizing a biotinylated ligand in which biotin is bound to an appropriate site, and specifically capturing a receptor on a carrier on which avidin is fixed through the biotinylated ligand [Methods in Enzymology, 184, 244-274 (1990)]. This process suffers from the problem of designing the biotinylated ligand having affinity for both the receptor and avidin, and examination is required in purifying PACAP receptor.
PACAP38 and PACAP27 are peptides represented by the following amino acid sequences, respectively:
PACAP38 His Ser Asp Gly Ile Phe Thr Asp Ser Tyr Ser Arg Tyr (SEQ ID NO:46-NH.sub.2) 1 5 10 Arg Lys Gln Met Ala Val Lys Lys Tyr Leu Ala Ala Val 15 20 25 Leu Gly Lys Arg Tyr Lys Gln Arg Val Lys Asn Lys-NH.sub.2 30 35PACAP27 His Ser Asp Gly Ile Phe Thr Asp Ser Tyr Ser Arg Tyr (SEQ ID NO:47-NH.sub.2) 1 5 10 Arg Lys Gln Met Ala Val Lys Lys Tyr Leu Ala Ala Val 15 20 25 Leu-NH.sub.2
SUMMARY OF THE INVENTION
In order to further elucidate the properties of the PACAP receptor protein which is a giant protein molecule and to collect useful information for development of drugs, purification of said protein, structure analysis by cDNA cloning and construction of its expression system are indispensable. As described above, the presence of a protein showing high affinity for the PACAP, namely the PACAP receptor protein, has been known in the animal tissues. However, no report has so far been made that the PACAP receptor protein has yet to be obtained.
An object of the present invention is to purify the PACAP receptor protein and to clone a DNA coding for the PACAP receptor protein. If detailed information about the facts of the structure and functions of said protein is obtained, not only development of diagnostic methods for neuropathy such as Alzheimer's disease induced by a decrease in PACAP concentration is enabled by detecting the PACAP concentration in vivo, but also compounds activating PACAP receptor other than the known PACAP proteins or compounds antagonizing binding of a PACAP to a PACAP receptor can be enabled by using the PACAP receptor protein and the DNA cording for said protein. In addition, gene therapeutic composition for neuropathy such as Alzheimer's disease can be enabled by using said DNA.
The present inventors conducted intensive investigations, in view of the above-mentioned situation. As a result, bovine PACAP receptor protein was prepared unexpectedly efficiently by affinity chromatography using biotinylated PACAPs (particularly, biotinylated PACAP27). Further, synthetic DNA was prepared as a probe, based on the N-terminal amino acid sequence of the purified bovine PACAP receptor protein, and a bovine brain cDNA library was screened to clone cDNA of bovine PACAP receptor. As a result, the present inventors first succeeded in cloning a bovine cDNA encoding the receptor protein for PACAP from the bovine brain cDNA library and in determining a nucleotide sequence of a translation region thereof. Further, the present inventors elucidated the amino acid sequence of bovine PACAP receptor protein from this cDNA, and succeeded in pioneering the mass production thereof by recombinant technology.
Furthermore, the present inventors based on the similarity of the structure of PACAPs to that of VIP, secretin and growth hormone releasing factor, and deduced that receptors for the PACAPs would also show a similar structure to these, from the fact that the receptors already elucidated extremely resemble in structure among VIP, secretin and growth hormone releasing factor. Then, using as a probe cDNA of the VIP receptor having a higher similarity in structure as a ligand, cDNA of PACAP receptors was screened by homology screening. As a result, the present inventors first succeeded in cloning cDNA coding for rat PACAP receptor protein from a rat brain cDNA library, and in determining a nucleotide sequence of a translation region thereof. Further, the present inventors elucidated the amino acid sequence of rat PACAP receptor protein from this cDNA, and succeeded in pioneering the mass production thereof by recombinant technology.
In addition, the present inventors succeeded in cloning cDNA coding for human PACAP receptor protein from a human pituitary cDNA library, using as a probe synthetic DNA prepared based on the amino acid sequence (sequence consisting of 16 amino acids) on the N-terminal side of the purified bovine PACAP receptor protein, and in determining a nucleotide sequence of a translation region thereof. Then, the present inventors elucidated the amino acid sequence of human PACAP receptor protein from this cDNA, produced this in large amounts by recombinant technology, and succeeded in pioneering the screening of compounds activating PACAP receptors or compounds antagonizing PACAP receptors by use of human PACAP receptor protein thus produced.
Namely, the present invention provides:
(1) A receptor protein capable of binding a PACAP or a salt thereof;
(2) The receptor protein of (1), wherein the receptor is endogenous to rat, bovine or human;
(3) The receptor protein of (1) which comprises an amino acid sequence containing at least one member selected from the group consisting of the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11 and SEQ ID NO: 12 or a salt thereof;
(4) The receptor protein of (1) which comprises an amino acid sequence containing the amino acid sequence of SEQ ID NO: 13 or a salt thereof;
(5) The receptor protein of (1) which comprises an amino acid sequence having 90 to 100% homology as determined by sequence analysis with at least one member selected from the group consisting of the amino acid sequences of SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26 and SEQ ID NO: 28 or a salt thereof;
(6) The receptor protein of (1) which comprises an amino acid sequence selected from the group consisting of the amino acid sequences of SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28 and SEQ ID NO: 29 or a salt thereof;
(7) A receptor fragment containing a sufficient portion of the receptor of (1) to bind PACAP or a salt thereof;
(8) The receptor fragment of (7) selected from the group consisiting of
(i) peptides having the amino acid sequence consisting of the 38th to 164th, 223rd to 232nd, 303rd to 317th or 416th to 424th amino acid residues of SEQ ID NO: 15,
(ii) peptides having the amino acid sequence consisting of the 38th to 164th, 223rd to 232nd, 303rd to 317th or 388th to 397th amino acid residues of SEQ ID NO: 17,
(iii) peptides having the amino acid sequence consisting of the 20th to 146th, 205th to 214th, 286th to 299th or 369th to 378th amino acid residues of SEQ ID NO: 19,
(iv) peptides having the amino acid sequence consisting of the 20th to 146th, 205th to 214th, 286th to 299th or 397th to 406th amino acid residues of SEQ ID NO: 21, and
(v) peptides having the amino acid sequence consisting of the 78th to 204th, 263rd to 272nd, 342nd to 357th or 427th to 436th amino acid residues of SEQ ID NO: 23; or a salt thereof;
(9) An isolated DNA coding for a receptor protein capable of binding a PACAP;
(10) The DNA of (9) wherein the receptor protein comprises the amino acid sequence of SEQ ID NO: 14, SEQ ID NO 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO 18, SEQ ID NO: 19, SEQ ID NO 20, SEQ ID NO: 21, SEQ ID NO 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO 25, SEQ ID NO: 26, SEQ ID NO 27, SEQ ID NO: 28 or SEQ ID NO 29;
(11) The DNA of (9) comprising the nucleotide sequence of SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO 32,
(13) A vector containing the DNA of (9);
(14) A transformant containing the DNA of (9);
(15) A method for preparing the receptor protein or the salt thereof of (1) comprising cultivating a transformant containing a DNA encoding said protein under conditions suitable for expression of said protein and recovering said protein;
(16) A method for purifying the receptor protein or the salt thereof of (1) comprising subjecting a sample containing unpurified receptor protein to affinity chromatography using a biotinylated PACAP;
(17) The method of (16) comprising the steps of:
(a) preparing a membrane protein fraction from an animal tissue or cell,
(b) solubilizing the membrane protein fraction obtained in step (a),
(c) subjecting the solubilized membrane protein fraction obtained in step (b) to anion exchange chromatography and/or hydroxyapatite chromatography, and
(d) subjecting the active fraction obtained in step (c) to affinity chromatography using a biotinylated PACAP;
(18) The method of (17), in which the animal tissue is a bovine cerebrum;
(19) A method for preparing the receptor protein or the salt thereof of (1) comprising condensing a partial peptide fragment or a single amino acid corresponding to a portion of the protein as claimed in claim 1 with a residual moiety, and removing a protective group as so desired when the product has the protective group, until said protein is obtained;
(20) A diagnostic composition for neuropathy comprising the PACAP receptor protein or the salt thereof of (1), or the receptor fragment or the salt thereof of (7);
(21) The diagnostic composition of (20) which is a diagnostic composition for Alzheimer's disease;
(22) A gene therapeutic composition comprising the DNA of (9);
(23) The gene therapeutic composition of (22) to be administered to a patient whose an amount of PACAP receptor protein is decreased, to increase the amount of PACAP receptor protein;
(24) A method of diagnosis for neuropathy comprising contacting a sample to be tested with a receptor protein capable of binding a PACAP protein and measuring the amount of PACAP binding to the receptor protein;
(25) The method of diagnosis of (24), wherein the receptor protein is a receptor fragment of (7);
(26) The method of (24) wherein a decrease in PACAP concentration is an indication of the presence of Alzheimer's disease;
(27) A method of using the DNA of (9) to transform a cell;
(28) The method of (27) wherein the cell is transformed in vitro;
(29) The method of (27) wherein the cell is transformed in vivo;
(30) The method of (27), in which the expression of the DNA increases the amount of PACAP receptor protein;
(31) A method for determining
(i) an effect of a test compound on PACAP receptor activity comprising comparing PACAP receptor activities in cases of (a) and (b);
(a) contacting PACAP receptor with a PACAP;
(b) contacting PACAP receptor with a PACAP and a test compound, or
(ii) an effect of a test compound on binding of PACAP to PACAP receptor comprising comparing an amount of binding of PACAP to PACAP receptor in cases of (a) and (b);
(a) contacting PACAP receptor with a PACAP;
(b) contacting PACAP receptor with a PACAP and a test compound;
(32) The method of (31) wherein the PACAP receptor is a protein of (1);
(33) The method of (31) wherein the PACAP receptor is a receptor fragment of (7);
(34) The method of (31) wherein the PACAP receptor is a protein produced by cultivating a transformant containing the DNA of (9);
(35) The method of (31) which is a method for screening a compound activating PACAP receptor or a compound antagonizing binding of a PACAP to a PACAP receptor;
(36) An assay for quantifying a test compound's effect
(i) on PACAP receptor activity comprising comparing an amount of PACAP receptor activation in cases of (a) and (b);
(a) contacting PACAP receptor with a PACAP;
(b) contacting PACAP receptor with a PACAP and a test compound, or
(ii) on binding of PACAP to PACAP receptor comprising comparing an amount of binding of PACAP to PACAP receptor in cases of (a) and (b);
(a) contacting PACAP receptor with a PACAP;
(b) contacting PACAP receptor with a PACAP and a test compound;
(37) A compound or a salt thereof obtained by the method of (31);
(38) The compound or a salt thereof of (37) which is a compound activating PACAP receptor or a compound antagonizing binding of a PACAP to a PACAP receptor;
(39) A pharmaceutical composition for neuropathy comprising an effective amount of the compound or the salt thereof of (37);
(40) The pharmaceutical composition of (39), wherein the neuropathy is Alzheimer's disease;
(41) An antibody to a receptor protein capable of binding a PACAP, a partial peptide thereof or a salt thereof;
(42) The antibody of (41) which is a monoclonal antibody selected from the group consisting of PRN1-25a, PRN1-109a and PRN1-159a;
(43) Hybridoma which produces a monoclonal antibody of (42);
(44) A signal peptide selected from the group of peptides consisting of a peptide which has 1st to 37th amino acid sequence of SEQ ID NO:15, a peptide which has 1st to 37th amino acid sequence of SEQ ID NO:17, a peptide which has 1st to 19th amino acid sequence of SEQ ID NO:19, a peptide which has 1st to 19th amino acid sequence of SEQ ID NO:21, a peptide which has 1st to 77th amino acid sequence of SEQ ID NO:23, a peptide which has 1st to 77th amino acid sequence of SEQ ID NO:25, a peptide which has 1st to 77th amino acid sequence of SEQ ID NO:27, a peptide which has 1st to 77th amino acid sequence of SEQ ID NO:29, a peptide which has 58th to 77th amino acid sequence of SEQ ID NO:23, a peptide which has 58th to 77th amino acid sequence of SEQ ID NO:25, a peptide which has 58th to 77th amino acid sequence of SEQ ID NO:27 and a peptide which has 58th to 77th amino acid sequence of SEQ ID NO:29; or a salt thereof;
(45) A DNA which codes for a peptide of (44);
(46) A DNA of (45) which is selected from the group consisting of a DNA which has 1st to 111th nucleotide sequence of SEQ ID NO:30, a DNA which has 1st to 111th nucleotide sequence of SEQ ID NO:31, a DNA which has 1st to 57th nucleotide sequence of SEQ ID NO:32, a DNA which has 1st to 57th nucleotide sequence of SEQ ID NO:33, a DNA which has 1st to 231st nucleotide sequence of SEQ ID NO:34, a DNA which has 1st to 231st nucleotide sequence of SEQ ID NO:35, a DNA which has 1st to 231st nucleotide sequence of SEQ ID NO:36, a DNA which has 1st to 231st nucleotide sequence of SEQ ID NO:37, a DNA which has 172nd to 231st nucleotide sequence of SEQ ID NO:34, a DNA which has 172nd to 231st nucleotide sequence of SEQ ID NO:35, a DNA which has 172nd to 231st nucleotide sequence of SEQ ID NO:36 and a DNA which has 172nd to 231st nucleotide sequence of SEQ ID NO:37;
(47) A biotinylated PACAP;
(48) The biotinylated PACAP of (47) which is represented by the following formula: ##STR1## (49) The biotinylated PACAP of (47) or (48), in which the PACAP is PACAP27; and
(50) A method for preparing the biotinylated PACAP of (47) comprising reacting a PACAP derivative in which a cysteine residue is introduced into the carboxyl terminus of a PACAP with a biotinylating reagent.

BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 shows a restriction enzyme cleavage map of a bovine PACAP receptor cDNA clone, wherein A indicates AvaII, Ac indicates AccI, B indicates BamHI, Ba indicates BalI, and S indicates SmaI;
FIG. 2 shows a nucleotide sequence of a bovine cDNA clone, PBPR-T, encoding receptor protein for PACAP and the predicted amino acid sequence. A signal sequence is deduced to be cleaved at that position indicated by the upward arrow .tangle-solidup.. Disappearance of the region between the open triangles .DELTA. is observed for pBPR-TD;
FIG. 3 shows a nucleotide sequence of a bovine cDNA clone, pBPR-TD, encoding receptor protein for PACAP and the predicted amino acid sequence. A signal sequence is deduced to be cleaved at the position indicated by the upward arrow .tangle-solidup.. Insertion was observed at the position indicated by the open triangle A for pBPR-T;
FIG. 4 shows the N-terminal amino acid sequence of bovine PACAP receptor protein and an amino acid sequence deduced from pBPR-T and PBPR-TD for comparison;
FIGS. 5A and 5B shows graphs in which the degree of hydrophobicity of bovine PACAP receptor protein, encoded by PBPR-T and PBPR-TD, is shown as an index. 5A and 5B corresponds to pBPR-T and pBPR-TD, respectively. The numerals 1 to 7 indicate transmembrane domains presumed from the degree of hydrophobicity. The upward arrow .tangle-solidup. indicates the position of a sequence which does not exist in pBPR-TD, but exists in PBPR-T;
FIG. 6 shows a restriction enzyme cleavage map of a rat PACAP receptor cDNA clone, wherein N indicates NcoI, P indicates PstI, and B indicates BamHI;
FIG. 7 shows a nucleotide sequence of rat PACAP receptor cDNA contained in pRPACAPR46-5 and an amino acid sequence of a translation frame derived therefrom. A signal sequence is deduced to be cleaved at the position indicated by the upward arrow .tangle-solidup.. Insertion is observed at the position indicated by the open triangle .DELTA. for pRPACAPR12;
FIG. 8 is a continuation of FIG. 7;
FIG. 9 shows a nucleotide sequence of rat PACAP receptor cDNA contained in pRPACAPR12 and an amino acid sequence of a translation frame derived therefrom. A signal sequence is deduced to be cleaved at the position indicated by the upward arrow .tangle-solidup.. The sequence between the open triangles .DELTA. is a sequence not existing in pRPACAPR46-5 and characteristic of pRPACAPR12;
FIG. 10 is a continuation of FIG. 9;
FIG. 11 shows the N-terminal amino acid sequence of bovine PACAP receptor protein and the N-terminal amino acid sequence of rat PACAP receptor protein for comparison;
FIG. 12 shows a restriction enzyme cleavage map of a human PACAP receptor cDNA clone, wherein N indicates NcoI, ScI indicates SacI, Bg indicates BglII, Hp indicates HpaI, ScII indicates SacII, ET22 indicates EcoT22I, and Bs indicates BspEI;
FIG. 13 shows a nucleotide sequence of human PACAP receptor Type I-A cDNA coded with pTS847-1 and an amino acid sequence of a translation frame derived therefrom;
FIG. 14 shows the N-terminal amino acid sequence of bovine PACAP receptor protein and the N-terminal amino acid sequence deduced from human PACAP receptor protein cDNA for comparison;
FIG. 15 shows nucleotide sequences of pHPR15A, pHPR55A and pHPR66P encoding a portion of human PACAP receptor Type I-B, Type I-B2 and Type I-C respectively and predicted amino acid sequences of a translation frame. The region between two arrows shows an insertion sequence into human PACAP receptor Type I-A;
FIG. 16 shows a nucleotide sequence of cDNA of human PACAP receptor Type I-B and a predicted amino acid sequence of a translation frame. An underlined region is a sequence inserted by an alternative splicing;
FIG. 17 shows a nucleotide sequence of cDNA of human PACAP receptor Type I-B2 and a predicted amino acid. sequence of a translation frame. An underlined region is a sequence inserted by an alternative splicing;
FIG. 18 shows a nucleotide sequence of cDNA of human PACAP receptor Type I-C and a predicted amino acid sequence of a translation frame. An underlined region is a sequence inserted by an alternative splicing;
FIGS. 19A and 19B shows graphs in which the degree of hydrophobicity of rat PACAP receptor protein encoded by pRPACAPR46-5 and pRPACAPR12 is shown as an index. 19A and 19B correspond to pRPACAPR46-5 and pRPACAPR12, respectively. The numerals 1 to 7 indicate portions deduced to be domains passing through a cell membrane from the degree of hydrophobicity. The upward arrow .tangle-solidup. indicates the position of a sequence which does not exist in pRPACAPR46-5, but exists in pRPACAPR12;
FIG. 20 shows an amino acid sequence of rat PACAP receptor protein encoded by pRPACAPR46-5, and an amino acid sequence of rat VIP receptor protein for comparison. A group of amino acids 1 to 5 shown in the upper portion of the figure are regarded as equivalent to one another. Residues in which agreement is observed, including these amino acids, are given asterisks (*). The upper lines indicate the amino acid sequence of the PACAP receptor protein encoded by pRPACAPR46-5, and the lower lines indicate the sequence of rat VIP receptor. The numerals given above and under the respective sequences indicate the positions from the N-termini;
FIG. 21 shows a graph in which the degree of hydrophobicity of human PACAP receptor protein coded with pTS847-1 is shown as an index. The numerals 1 to 7 indicate portions deduced to be domains passing through a cell membrane from the degree of hydrophobicity;
FIG. 22 shows amino acid sequences of human PACAP receptor protein, bovine PACAP receptor protein and rat PACAP receptor protein for comparison. The arrow indicates a cleavage site of a signal peptide;
FIGS. 23A-23I is a series of graphs in which the degree of hydrophobicity of bovine PACAP receptor protein encoded by PBPR-T is shown as an index;
FIGS. 24A-24I is a series of graphs in which the degree of hydrophobicity of bovine PACAP receptor protein encoded by PBPR-TD is shown as an index;
FIGS. 25A-25H is a series of graphs in which the degree of hydrophobicity of rat PACAP receptor protein encoded by pRPACAPR46-5 is shown as an index;
FIGS. 26A-26I is a series of graphs in which the degree of hydrophobicity of rat PACAP receptor protein encoded by pRPACAPR12 is shown as an index;
FIGS. 27A-27I is a series of graphs in which the degree of hydrophobicity of human PACAP receptor protein encoded by pTS847-1 is shown as an index;
FIG. 28 is a graph showing absorption curves of biotinated PACAP27 by HPLC. Peak 1 of (A) indicates a peak of PACAP27-Cys, peak 3 of (B) indicates a peak of biotinated PACAP27-Cys, and peak 2 of (C) indicates a peak of the biotinating reagent;
FIG. 29 is a graph showing results of the antagonistic binding experiments of PACAP27 (.largecircle.) and biotinated PACAP27 (.circle-solid.). The numerals on the abscissa indicate the concentrations (log M) of PACAP27 and biotinated PACAP27, and the numerals on the ordinate indicate the binding (%) of [.sup.125 I]-PACAP27, taking the specific binding as 100, when each peptide is added so as to give the final concentrations on the abscissa;
FIG. 30 is a graph showing Scatchard plot analysis of results of the saturation binding experiments of purified bovine PACAP receptor protein and membrane binding bovine receptor protein using [.sup.125 I]-PACAP27. Kd indicates the dissociation constant;
FIG. 31 is a graph showing results of the antagonistic binding experiment of purified bovine PACAP receptor protein. The numerals on the abscissa indicate the concentrations (log M) of PACAP38, PACAP27 and VIP, and the numerals on the ordinate indicate the binding (%) of [.sup.125 I]-PACAP27, taking the specific binding as 100, when each peptide is added so as to give the final concentrations on the abscissa;
FIG. 32 shows analysis results of purified bovine PACAP receptor protein by polyacrylamide electrophoresis in the presence of sodium dodecylsulfate;
FIG. 33 is a graph showing results of the saturation binding experiment in a membrane fraction of CHO cells transfected with the bovine PACAP receptor protein cDNA(pBPR-T). The numerals on the abscissa indicate the concentration of [.sup.125 I]-PACAP27 added, and the numerals on the ordinate indicate the concentration of [.sup.125 I]-PACAP27 specifically bound to the membrane fraction;
FIG. 34 is a graph showing Scatchard plot in the membrane fraction of CHO cells transfected with the bovine PACAP receptor protein cDNA (pBPR-T);
FIG. 35 is a graph showing results of the competitive binding experiments of PACAP27, PACAP38 and VIP to [.sup.125 I]-PACAP27 in the membrane fraction of CHO cells transfected with the bovine PACAP receptor protein cDNA (pBPR-T). The numerals on the abscissa indicate the concentrations (log M) of PACAP27, PACAP38 and VIP, and the numerals on the ordinate indicate the binding (%) of [.sup.125 I]-PACAP27, taking the specific binding as 100, when each peptide is added so as to give the final concentrations on the abscissa;
FIG. 36 is a graph showing changes in the amounts of intracellular cyclic AMP of CHO cells transfected with the bovine PACAP receptor protein cDNA (pBPR-T) produced by PACAP27, PACAP38 and VIP. The numerals on the abscissa indicate the concentrations (log M) of PACAP27, PACAP38 and VIP, and the numerals on the ordinate indicate the relative concentrations of cyclic AMP in the transformant CHO cells treated with peptides having respective concentrations, taking the concentration of cyclic AMP in untreated transformant CHO cells as 1;
FIG. 37 is a graph showing changes in the amounts of intracellular inositol phosphate of CHO cells transfected with the bovine PACAP receptor protein cDNA (pBPR-T) produced by PACAP27, PACAP38 and VIP. The numerals on the abscissa indicate the concentrations (log M) of PACAP27, PACAP38 and VIP, and the numerals on the ordinate indicate the relative concentrations of inositol phosphate in transformant CHO cells treated with peptides having respective concentrations, taking the concentration of inositol phosphate in untreated transformant CHO cells as 1;
FIG. 38 shows results of northern hybridization using RNA prepared from the rat brains, lungs, livers, kidneys and testes, and a rat PACAP receptor protein cDNA probe. The bands represent that the RNA prepared from the rat brains, lungs, livers, kidneys and testes, and the rat PACAP receptor protein cDNA probe exhibit cross reaction. The numerals on the left indicate the size of a molecular weight marker;
FIG. 39 shows results of measurements of the radioactivity, wherein each column indicates the binding of each CHO cell product with [.sup.125 I]-PACAP27 when cultured in each of the following combinations:
Column 1: untreated CHO cells+[.sup.125 I]-PACAP27
Column 2: untreated CHO cells+[.sup.125 I]-PACAP27+cold PACAP27
Column 3: untreated CHO cells+[.sup.125 I]-PACAP27+cold VIP
Column 4: pRPR3-A-introduced CHO cells+[.sup.125 I]-PACAP27
Column 5: pRPR3-A-introduced CHO cells+[.sup.125 I]-PACAP27+cold PACAP27
Column 6: pRPR3-A-introduced CHO cells+[.sup.125 I]-PACAP27+cold VIP
Column 7: pRPR4-B-introduced CHO cells+[.sup.125 I]-PACAP27
Column 8: pRPR4-B-introduced CHO cells+[.sup.125 I]-PACAP27+cold PACAP27
Column 9: pRPR4-B-introduced CHO cells+[.sup.125 I]-PACAP27+cold VIP
Column 10: rat VIP receptor cDNA-introduced CHO cells+[.sup.125 I]-PACAP27
Column 11: rat VIP receptor cDNA-introduced CHO cells+[.sup.125 I]-PACAP27+cold PACAP27
Column 12: rat VIP receptor cDNA-introduced CHO cells+[.sup.125 I]-PACAP27+cold VIP;
FIGS. 40A and 40B are graphs showing results of competitive binding experiments. (40A) is a graph showing results of the competitive binding experiments of PACAP27 and VIP to [.sup.125 I]-PACAP27 in a membrane fraction of CHO cells transfected with rat PACAP receptor protein cDNA (pRPR3-A). (40B) is a graph showing results of the competitive binding experiments of PACAP27 and VIP to [.sup.125 I]-PACAP27 in a membrane fraction of CHO cells transfected with rat PACAP receptor protein cDNA (pRPR4-B). The numerals on the abscissa indicate the concentrations (log M) of PACAP27 and VIP, and the numerals on the ordinate indicate the binding (%) of [.sup.125 I]-PACAP27, taking the specific binding as 100, when each peptide is added so as to give the final concentrations on the abscissa;
FIG. 41 shows the binding of [.sup.125 I]-PACAP27 in the membrane fraction of CHO cells transfected with the rat PACAP receptor protein cDNA (pRPR3-A). A indicates CHO cells transfected with a rat PACAP receptor protein cDNA (pRPR3-A), and B indicates CHO cells transfected with a rat PACAP receptor protein cDNA (pRPR4-B). The numerals on the abscissa indicate sample Nos. of transformant CHO cells obtained by separating single clone-derived colonies, and the numerals on the ordinate indicate the binding (cpm) of [.sup.125 I]-PACAP27;
FIG. 42 shows results of examination of reproducibility of clones having much [.sup.125 I] binding in FIG. 37. The numerals 1 and 2 on the abscissa indicate untreated CHO cells, the numerals 3 and 4 VIP cDNA-introduced CHO cells, the numerals 5 and 6 clone B1, the numerals 7 and 8 clone B2, the numerals 9 and 10 clone B17, the numerals 11 and 12 clone A6, the numerals 13 and 14 clone A12, and the numerals 15 and 16 clone A15. The numerals on the ordinate indicate the binding (cpm) of [.sup.125 I]-PACAP27;
FIGS. 43A and 43B are graphs showing the changes in the amounts of intracellular cyclic AMP. 43A (type I-A) indicates changes in the amounts of intracellular cyclic AMP of CHO cells transfected with the rat PACAP receptor protein cDNA (pBPR-T) produced by PACAP27, PACAP38 and VIP. The numerals on the abscissa indicate the concentrations (log M) of PACAP27, PACAP38 and VIP, and the numerals on the ordinate indicate the concentration (ratio (%) to the maximum production amount) of intracellular cyclic AMP.
43B (type I-B) indicates changes in the amounts of intracellular cyclic AMP of CHO cells transfected with the rat PACAP receptor protein cDNA (pBPR-TD) produced by PACAP27, PACAP38 and VIP. The numerals on the abscissa indicate the concentrations (log M) of PACAP27, PACAP38 and VIP, and the numerals on the ordinate indicate the concentration (ratio (%) to the maximum production amount) of intracellular cyclic AMP;
FIG. 44 shows the amount of rat PACAP receptor protein expressed in transformant Sf9 cells with baculoviruses. Sf9 was infected with 10 clones of recombinant viruses at the stage of primary plaque measurement, and 4 days after culture, the binding of the cells to [.sup.125 I]-PACAP27 was assayed. The numerals on the abscissa indicate sample Nos. of the transformant Sf9 cells. Sample Nos. 1 to 3 indicate transformant Sf9 cells containing rat PACAP receptor protein cDNA introduced by a vector modified from pRPR3-A, sample Nos. 4 to 6 indicate transformant Sf9 cells containing rat PACAP receptor protein cDNA introduced by a vector modified from pRPR4-B, and sample No. 7 indicates uninfected Sf9 cells (control). Cold (-) on the ordinate indicates the binding of each sample to [.sup.125 I]-PACAP27 when only 100 pM [.sup.125 I]-PACAP27 is added, and cold (+) indicates the binding of each sample to [.sup.125 I]-PACAP27 when 100 pM [.sup.125 I]-PACAP27 and 1 pm unlabeled PACAP27 are added;
FIG. 45 shows the amount of human PACAP receptor protein expressed in transformant Sf9 cells with baculoviruses. Sf9 was infected with 10 clones of recombinant viruses at the stage of primary purification, and cultured for 4 days after infection. The binding of [.sup.125 I]-PACAP27 on the cells was assayed. The numerals on the abscissa indicate sample Nos., and the numerals on the ordinate indicate the amount of [.sup.125 I]-PACAP27 binding. Sample No. 0 indicates uninfected Sf9 cells (control);
FIG. 46 is a graph showing Scatchard plot in a membrane fraction of CHO-K1 cells transfected with pTS849 which expresses human PACAP receptor protein.
FIG. 47 is a graph showing results of the competitive binding experiments of PACAP27 (.quadrature.), PACAP38 (.largecircle.) and VIP (.DELTA.) to [.sup.125 I]-PACAP27 in a membrane fraction of CHO cells transfected with pTS849 which expresses human PACAP receptor protein. The numerals on the abscissa indicate the concentrations (log M) of PACAP27, PACAP38 and VIP, and the numerals on the ordinate indicate the binding (%) of [.sup.125 I]-PACAP27, taking the specific binding as 100, when each peptide is added so as to give the final concentrations on the abscissa;
FIG. 48 is a graph showing changes in the amounts of intracellular cyclic AMP of CHO cells transfected with human PACAP receptor protein cDNA (pTS847-1) produced by PACAP27 (.quadrature.), PACAP38 (.largecircle.) and VIP (.DELTA.). The numerals on the abscissa indicate the concentrations (log M) of PACAP27, PACAP38 and VIP, and the numerals on the ordinate indicate the relative concentrations of cyclic AMP in transformant CHO cells treated with peptides having respective concentrations, taking the concentration of inositol phosphate in untreated transformant CHO cells as 1;
FIG. 49 shows results of Northern hybridization using RNA prepared from the human brain, lung, liver, thymus, spleen, pancreas and placenta, and a human PACAP receptor protein cDNA probe. The bands represent that the RNA prepared from the human brain, lung, liver, thymus, spleen, pancreas placenta, and the human PACAP receptor protein cDNA probe exhibit cross reaction. The numerals on the left indicate the size of a molecular weight marker;
FIG. 50 shows results of norther hybridization using RNA prepared from the rat olfactory bulbs, amygdalae, cerebral basal ganglia, hippocampi, hypothalamic cerebral cortices, medulla oblongatas, cerebellums, vertebrae and pituitary glands, and a rat PACAP receptor protein cDNA probe. The bands represent that the RNA prepared from the rat olfactory bulbs, amygdalae, cerebral basal ganglia, hippocampi, hypothalami, cerebral cortices, medulla oblongatas, cerebellums, vertebrae and pituitary glands, and the rat PACAP receptor protein cDNA probe exhibit cross reaction. The numerals on the left indicate the size of a molecular weight marker.
FIGS. 51A-51J show a formula of the compound which was found by the screening using the membrane fraction of Sf9 cells which expressed human PACAP receptor Type I-A by baculovirus.
FIG. 52 is a graph which shows a typical sample of screening of hybridomas.
FIG. 53 shows a detection of PACAP receptor by Western blotting with the antibody of the present invention. Lane 1 shows rainbow coloured protein molecular weight markers and lane 2 shows a result of 320 ng of a membrane protein solubilized in an insect cell containing 20 ng of human PACAP receptor.
FIG. 54 is a graph which shows that the antibody of the present invention inhibits binding of PACAP27 and PACAP receptor.

DETAILED DESCRIPTION OF THE INVENTION
The present inventors obtained cDNA clones of the PACAP receptor proteins from the bovine brain cDNA library. Of these, .lambda.BPR35, .lambda.BPR114 and .lambda.BPR68 were cloned, and subcloned into pUC118 to obtain pBPR35, pBPR114 and pBPR68 (FIG. 1). Further, pBPR35 and pBPR68 were recombined at the BamHI site to prepare pBPR-T having a complete translation frame. The complete primary structure of bovine PACAP receptor protein based on PBPR-T was deduced (FIG. 2, pBPR-T). 84 nucleotides were not present in pBPR114, compared with pBPR-T. This is considered to occur by alternative splicing in a transcription product from a common gene.
The PACAP receptor protein which does not contain 84 nucleotides can be prepared by recombinating pBPR-T with pBPR114 at the BamHI and Ava II sites. The amino acid sequence of the recombinant protein was deduced (FIG. 3, pBPR-TD). The total number of amino acid residues and the molecular weight derived from these sequences are 513 residues (58.5 kilodaltons) for pBPR-T, and 485 residues (55.3 kilodaltons) for pBPR-TD. As to both the molecules, the N-terminal sequence up to the 37th Ala residue was deduced to be a signal sequence for passing through a membrane.
Further, the N-terminal sequence after this processing completely agreed with the N-terminal amino acid sequence of bovine PACAP receptor protein purified in this invention (FIG. 4). Analysis of hydrophobicity based on the amino acid sequence revealed in the present invention proved that bovine PACAP receptor protein has 7 hydrophobic amino acid clusters considered to be transmembrane domains in tandem (FIG. 5). Such structural features are common to peptide receptor proteins of the G protein coupling type [European Journal of Pharmacology, 227, 1-8 (1992)].
The present inventors further cloned .lambda.RPACAPR18, .lambda.RPACAPR46, .lambda.RPACAPR5 and .lambda.RPACAPR12 as cDNA clones of the PACAP protein from the rat brain cDNA library, and subcloned into pcDNA I or pUC118 to obtain pRPACAPR18, pRPACAPR46, pRPACAPR5 and pRPACAPR12 (FIG. 6). Further, pRPACAPR46 and pRPACAPR5 were recombined at the BamHI site to prepare pRPACAPR46-5 having a complete translation frame. Based on these, two kinds of complete primary structures of rat PACAP receptor protein were deduced (FIGS. 7 and 8, and FIGS. 9 and 10). The first methionine in each sequence is considered to be an initiation codon. It is conceivable that the difference between two kinds of sequences shown in FIGS. 7 and 8 and FIGS. 9 and 10 arises by alternative splicing in a transcription product from a common gene. The total number of amino acid residues and the molecular weight derived from these sequences are 467 residues (53.2 kilodaltons), and 495 residues (56.4 kilodaltons), respectively. As to both the molecules, the N-terminal sequence up to the 19th Ala residue was deduced to be a signal sequence for passing through a membrane. Further, the N-terminal sequence after this processing completely showed high homology with the N-terminal amino acid sequence of bovine PACAP receptor protein purified (FIG. 11).
In addition, the present inventors cloned .lambda.#14 shown in FIG. 12 as a cDNA clone of the PACAP protein from the human pituitary cDNA library, and subcloned into pUC118 to obtain pTS847-1. Based on this, the complete primary structure of human PACAP receptor protein was deduced (FIG. 13). The first methionine in its sequence is considered to be an initiation codon. The total number of amino acid residues and the molecular weight derived from FIG. 13 are 525 residues and 59.3 kilodaltons, respectively. As to this molecule, the N-terminal sequence up to the 77th Ala residue was deduced to be a signal sequence for passing through a membrane. Further, the N-terminal sequence after this processing completely showed high homology with the N-terminal amino acid sequence of bovine PACAP receptor protein purified by Ohtaki et al (FIG. 14).
The present inventors found out that 84 nucleotides were inserted at the same sites of both rat and bovine Type I-B of PACAP receptor, and therefore deduced that there would also be a similar insertion at the same site of a human PACAP receptor. The inventors prepared a primer from the sequence flanking to the deduced insertion site and conducted PCR methods. As a result, the present inventors succeeded in cloning a cDNA encoding the insertion region of subtype of a human PACAP receptor and in identifying the amino acid sequence of the insertion region, by applying PCR method to cDNAs of human pituitay and amygdaloid nucleus. The present inventors further succeeded in preparing a cDNA encoding whole length of subtype of a human PACAP receptor by recombinating the above cDNAs with the cDNA of Type I-A of a human PACAP receptor. In more detail, the present inventors obtained pHPR15A, pHPR55A and pHPR66P as cDNA clones of the insertion region of a subtype of a human PACAP receptor by applying PCR method to cDNAs of human amygdaloid nucleus and human pituitary (FIG. 15). By recombinating the clones with human PACAP receptor Type I-A at the recognition sites of HpaI and AvaII, a cDNA for each subtype was constructed. The nucleotide sequences of cDNAs of the constructed subtypes and the amino acid sequence deduced therefrom are shown in FIGS. 16 to 18.
Analysis of hydrophobicity based on the amino acid sequence revealed in the present invention proved that rat PACAP receptor protein has 7 hydrophobic amino acid clusters considered to be membrane permeable domains in tandem (FIG. 19(A) indicates a result of analysis of the protein shown in FIGS. 7 and 8, and FIG. 19(B) indicates a result of analysis of the protein shown in FIGS. 9 and 10). Such structural features are common to peptide receptor proteins of the G protein binding type [European Journal of Pharmacolocy, 227, 1-8 (1992)]. The peptides or ligands were extremely similar in structure, and the result of comparison at the amino acid sequence level with the structure of a VIP receptor used as a cDNA probe for cloning revealed extremely high similarity. As a whole, the similarity of the N-terminal portions is very low, whereas regions containing the first to seventh membrane permeable domains and the C-terminal intracellular domains conversely showed high similarity. It was further revealed that human PACAP receptor protein also has 7 hydrophobic amino acid clusters considered to be membrane permeable domains in tandem (FIG. 21).
The amino acid sequences of bovine PACAP receptor protein, rat PACAP receptor protein and human PACAP receptor protein of the present invention showed very high homology (FIG. 22). All of these proteins were proved to have amino acid sequences represented by SEQ ID NOS: 1 to 12.
The present inventors named rat PACAP receptor protein having the amino acid sequence of SEQ ID NO: 19 "Type I-A", and rat PACAP receptor protein having the amino acid sequence of SEQ ID NO: 21 "Type I-B". Bovine PACAP receptor protein having the amino acid sequence of SEQ ID NO: 15 is bovine PACAP receptor protein Type I-A corresponding to rat PACAP receptor protein Type I-A of SEQ ID NO: 19, and bovine PACAP receptor protein having the amino acid sequence of SEQ ID NO: 17 is bovine PACAP receptor protein Type I-B corresponding to rat PACAP receptor protein Type I-B of SEQ ID NO: 21.
Human PACAP receptor protein having the amino acid sequence of SEQ ID NO: 23 is human PACAP receptor protein Type I-A corresponding to rat PACAP receptor protein Type I-A of SEQ ID NO: 19, and human PACAP receptor protein having the amino acid sequence of SEQ ID NO: 25 which clone is obtained by recombinating pHPR15A is human PACAP receptor protein Type I-B. pHPR55A lacks 3 nucleotides, CAG, from pHPR15A, which lacks Ser as an amino acid. The human PACAP receptor protein having an amino acid sequence of SEQ ID NO:27 was named "Type I-B2" since the protein is thought to be a clone resulting from a sliding of the position of a splicing of Type I-B. Further, a human PACAP receptor protein having an amino acid sequence of SEQ ID NO:29, a recombinant clone of pHPR66P, which is thought to result from a transcription product of a common gene by an alternative splicing and the subtype was named Type I-C.
The origin of amino acid sequences of PACAP receptor proteins and nucleotide sequences of DNAs coding for said proteins represented by SEQ ID NO used in this specification are as follows: [SEQ ID NO: 1-SEQ ID NO: 12]
These indicate amino acid sequences which bovine, rat and human PACAP receptor proteins have in common; [SEQ ID NO: 13]
This indicates an N-terminal amino acid sequence of the purified bovine PACAP receptor protein; [SEQ ID NO: 14]
This indicates an amino acid sequence of a protein in which a signal peptide is deleted from bovine PACAP receptor protein Type I-A encoded by in pBPR-T; [SEQ ID NO: 15]
This indicates an amino acid sequence of bovine PACAP receptor protein Type I-A encoded by in PBPR-T; [SEQ ID NO: 16]
This indicates an amino acid sequence of a protein in which a signal peptide is deleted from bovine PACAP receptor protein Type I-B encoded by in pBPR-TD; [SEQ ID NO: 17]
This indicates an amino acid sequence of bovine PACAP receptor protein Type I-B encoded by in pBPR-TD; [SEQ ID NO: 18]
This indicates an amino acid sequence of a protein in which a signal peptide is deleted from rat PACAP receptor protein Type I-A; [SEQ ID NO: 19]
This indicates an amino acid sequence of rat PACAP receptor protein Type I-A; [SEQ ID NO: 20]
This indicates an amino acid sequence of a protein in which a signal peptide is deleted from rat PACAP receptor protein Type I-B; [SEQ ID NO: 21]
This indicates an amino acid sequence of rat PACAP receptor protein Type I-B; [SEQ ID NO: 22]
This indicates an amino acid sequence of a protein in which a signal peptide is deleted from human PACAP receptor protein Type I-A; [SEQ ID NO: 23]
This indicates an amino acid sequence of human PACAP receptor protein Type I-A; [SEQ ID NO: 24]
This indicates an amino acid sequence of a protein in which a signal peptide is deleted from human PACAP receptor protein Type I-B; [SEQ ID NO: 25]
This indicates an amino acid sequence of human PACAP receptor protein Type I-B; [SEQ ID NO: 26]
This indicates an amino acid sequence of a protein in which a signal peptide is deleted from human PACAP receptor protein Type I-B2; [SEQ ID NO: 27]
This indicates an amino acid sequence of human PACAP receptor protein Type I-B2; [SEQ ID NO: 28]
This indicates an amino acid sequence of a protein in which a signal peptide is deleted from human PACAP receptor protein Type I-C; [SEQ ID NO: 29]
This indicates an amino acid sequence of human PACAP receptor protein Type I-C; [SEQ ID NO: 30]
This indicates a nucleotide sequence of cDNA coding for bovine PACAP receptor protein Type I-A; [SEQ ID NO: 31]
This indicates a nucleotide sequence of cDNA coding for bovine PACAP receptor protein Type I-B; [SEQ ID NO: 32]
This indicates a nucleotide sequence of cDNA coding for rat PACAP receptor protein Type I-A; [SEQ ID NO: 33]
This indicates a nucleotide sequence of cDNA coding for rat PACAP receptor protein Type I-B; [SEQ ID NO: 34]
This indicates a nucleotide sequence of cDNA coding for human PACAP receptor protein Type I-A; [SEQ ID NO: 35]
This indicates a nucleotide sequence of cDNA coding for human PACAP receptor protein Type I-B; [SEQ ID NO: 36]
This indicates a nucleotide sequence of cDNA coding for human PACAP receptor protein Type I-B2; [SEQ ID NO: 37]
This indicates a nucleotide sequence of cDNA coding for human PACAP receptor protein Type I-C; [SEQ ID NO: 38]
This indicates a nucleotide sequence of DNA (pBPR-T) containing a nucleotide sequence of cDNA coding for bovine PACAP receptor protein Type I-A; [SEQ ID NO: 39]
This indicates a nucleotide sequence of DNA (pBPR-TD) containing a nucleotide sequence of cDNA coding for bovine PACAP receptor protein Type I-B; [SEQ ID NO: 40]
This indicates a nucleotide sequence of DNA (pRPACAPR 46-5) containing a nucleotide sequence of cDNA coding for rat PACAP receptor protein Type I-A; [SEQ ID NO: 41]
This indicates a nucleotide sequence of DNA (pRPACAPR 12) containing a nucleotide sequence of cDNA coding for rat PACAP receptor protein Type I-B; [SEQ ID NO: 42]
This indicates a nucleotide sequence of DNA (pTS847-1) containing a nucleotide sequence of cDNA coding for human PACAP receptor protein Type I-A; [SEQ ID NO: 43]
This indicates a nucleotide sequence of DNA containing a nucleotide sequence of cDNA coding for human PACAP receptor protein Type I-B; [SEQ ID NO: 44]
This indicates a nucleotide sequence of DNA containing a nucleotide sequence of cDNA coding for human PACAP receptor protein Type I-B2; [SEQ ID NO: 45]
This indicates a nucleotide sequence of DNA containing a nucleotide sequence of cDNA coding for human PACAP receptor protein Type I-C; [SEQ ID NO: 46]
This indicates an amino acid sequence of PACAP38. [SEQ ID NO: 47]
This indicates an amino acid sequence of PACAP27. [SEQ ID NO: 48]
This indicates a nucleotide sequence of an oligonucleotide used for screening of cDNA coding for rat PACAP receptor proteins Type I-A and Type I-B; [SEQ ID NO: 49]
This indicates a nucleotide sequence of an oligonucleotide used for screening of cDNA coding for rat PACAP receptor proteins Type I-A and Type I-B. [SEQ ID NO: 50]
This indicates an N-terminal amino acid sequence (sequence consisting of 16 amino acids) of bovine PACAP receptor protein. [SEQ ID NO: 51]
This indicates a nucleotide sequence of an oligonucleotide used for screening of cDNA encoding bovine and human PACAP receptor proteins. [SEQ ID NO: 52]
This indicates a nucleotide sequence of a primer prepared from cDNA encoding human PACAP receptor protein Type I-A. [SEQ ID NO: 53]
This indicates a nucleotide sequence of a primer prepared from cDNA encoding human PACAP receptor protein Type I-A. [SEQ ID NO: 54]
This indicates a nucleotide sequence of a probe prepared based on the nucleotide sequence at the insertion region of rat PACAP receptor protein Type I-B. [SEQ ID NO: 55]
This indicates a nucleotide sequence of a probe prepared based on the nucleotide sequence at other insertion region than rat PACAP receptor protein Type I-B.
When nucleotides, amino acids and so on are indicated by abbreviations in the specification and drawings, the abbreviations adopted by the IUPAC-IUB Commission on Biochemical Nomenclature or commonly used in the art are employed. For example, the following abbreviations are used. When the amino acids are capable of existing as optical isomers, it is understood that the L-forms are represented unless otherwise specified.
DNA: Deoxyribonucleic acid
cDNA: Complementary deoxyribonucleic acid
A: Adenine
T: Thymine
G: Guanine
C: Cytosine
RNA: Ribonucleic acid
mRNA: Messenger ribonucleic acid
dATP: Deoxyadenosine triphosphate
dTTP: Deoxythymidine triphosphate
dGTP: Deoxyguanosine triphosphate
dCTP: Deoxycytidine triphosphate
ATP: Adenosine triphosphate
EDTA: Ethylenediaminetetraacetic acid
SDS: Sodium dodecyl sulfate
EIA: Enzyme immunoassay
Gly: Glycine
Ala: Alanine
Val: Valine
Leu: Leucine
Ile: Isoleucine
Ser: Serine
Thr: Threonine
Cys: Cysteine
Met: Methionine
Glu: Glutamic acid
Asp: Aspartic acid
Lys: Lysine
Arg: Arginine
His: Histidine
Phe: Phenylalanine
Tyr: Tyrosine
Trp: Tryptophan
Pro: Proline
Asn: Asparagine
Gln: Glutamine
Further, meanings of other abbreviations used in this specification are as follows:
VIP: Vasoactive intestinal peptide
Tris: Tris(hydroxymethyl)aminomethane
EDTA: Ethylenediaminetetraacetic acid
PMSF: Phenylmethylsulfonyl fluoride
BSA: Bovine serum albumin
CHAPS: 3-[(3-Cholamidopropyl)dimethylammonio]-1-propanesulfonate
Biotin-HSDP: N-[6-(biotinamido)hexyl]-3'-(2'-pyridylthio)-propionic acid amide
"TM" used in this specification represents a registered trade mark.
The PACAP receptor proteins which are capable of binding a PACAP of the present invention may be derived from tissues of warm-blooded animals (for example, the cerebrums, pituitary glands and adrenals of rats, mice, hamsters, chickens, dogs, cats, sheep, monkeys, pigs, cattle or humans) or cells [for example, adrenal chromaffin cells, glial cells and established cell lines (such as PC12 cells, NB-OK cells and AR4-2J cells)], or may be produced by chemical synthesis. Any proteins may be used as long as they have PACAP receptor activity ("PACAP receptor activity" means the action of specifically binding to the PACAPs). Examples thereof include proteins having amino acid sequences containing at least one member selected from the group consisting of the amino acid sequences represented by SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11 and SEQ ID NO: 12. Such proteins include, for example, proteins having only the amino acid sequences of SEQ ID NO: 1 to SEQ ID NO: 12, respectively, and proteins in which amino acids and (or) peptides are further bound to said proteins at their N-terminal sites and (or) C-terminal sites. Preferable examples of such proteins include proteins having amino acid sequences containing the amino acid sequences represented by SEQ ID NO:1 to SEQ ID NO:12. Specifically, they include proteins having the amino acid sequences represented by SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28 or SEQ ID NO: 29. Preferably, the proteins having the amino acid sequences represented by SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16 or SEQ ID NO: 17 are bovine-derived proteins, the proteins having the amino acid sequences represented by SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20 or SEQ ID NO: 21 are rat-derived proteins, and the proteins having the amino acid sequences represented by SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28 or SEQ ID NO: 29 are human derived proteins.
The amino acid sequences represented by SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11 and SEQ ID NO: 12 are amino acid sequences which the bovine-, rat- and human-derived PACAP receptors which lack signal peptide, that is PACAP receptors having the amino acid sequences represented by SEQ ID NO: 14, 16, 18, 20, 22, 24, 26 or 28, have in common (FIG. 22). Further, as apparent from FIG. 22, the amino acid sequences of the PACAP receptor proteins exhibit high homology among species of warm-blooded animals, so that proteins having usually 90-100%, preferably 95-100%, and more preferably 97-100% homology with the amino acid sequence(s) represented by SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26 and/or SEQ ID NO: 28 are also included in the PACAP receptor proteins of the present invention.
Further, for example, proteins having amino acid sequences containing the amino acid sequence represented by SEQ ID NO: 13 can also be used. Examples of such proteins include proteins having only the amino acid sequence of SEQ ID NO: 13, and proteins in which amino acids or peptides are further bound to said proteins at their C-terminal sites. Specifically, proteins having the amino acid sequence of SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16 or SEQ ID NO: 17 are used. In particular, bovine-derived proteins are preferred.
Furthermore, the PACAP receptor proteins of the present invention also comprise proteins in which the N-terminal Met residues are protected with protective groups (for example, C.sub.1-6 acyl groups such as formyl and acetyl), proteins in which peptide bond between the 9th Lys residues and the 10th Glu residues in the amino acid sequences represented by SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26 or SEQ ID NO: 28 are cleaved in vivo and the Glu residues are pyroglutaminated, proteins in which side chains of amino acids in molecules are protected with appropriate protective groups, and conjugated proteins such as so-called glicoproteins to which sugar chains are bound.
As used herein, "PACAP receptor protein" also includes a salt of said protein. Salts of the PACAP receptor proteins used in the present invention include, for example, salts with inorganic acids (such as hydrochloric acid, phosphoric acid, hydrobromic acid and sulfuric acid) and salts with organic acids (such as acetic acid, formic acid, propionic acid, fumaric acid, maleic acid, succinic acid, tartaric acid, citric acid, malic acid, oxalic acid, benzoic acid, methanesulfonic acid and benzenesulfonic acid).
In producing the proteins of the present invention, when the proteins are extracted from animal tissues or cells, methods for purifying proteins can generally be employed. In particular, the proteins of the present invention are of the membrane binding type, so that solubilization of membrane fractions is required. Concrete purifying methods are shown below:
(1) Preparation of a membrane fraction suspension
A membrane fraction suspension can be prepared by treating an animal tissue, for example, by the method described in Biochem. Biophys. Res. Commun., 172, 709-714 (1990) or a method based thereon.
(2) Solubilization of a desired protein fraction from the membrane fraction suspension
The membrane fraction obtained in (1) described above is solubilized by the method described in Biochem. Biophys. Res. Commun., 172, 709-714 (1990) or a method based thereon. Examples of solubilizing reagents which can be used therein include detergents having skeletons of bile acid (such as digitonin and CHAPS) and nonionic detergents (such as TWEEN 20.TM. and TRITON-X.TM.). Specifically, the membrane fraction suspension is diluted with an appropriate buffer (for example, Tris buffer) to give a protein concentration of 0.1 to 5.0 mg/ml, preferably 0.5 to 2.0 mg/ml, and more preferably 1.0 mg/ml, the above-mentioned solubilizing reagent is added thereto to yield a concentration of 0.1 to 5.0%, preferably 0.5 to 2.0%, and more preferably 1.0%, and the mixture is stirred usually for 10 minutes to 72 hours, preferably for 30 minutes to 24 hours, followed by ultracentrifugation to obtain a supernatant thereof. The presence or absence of a desired protein can be detected by measuring the activity of said protein. For example, PACAP receptor activity can be supernatant thereof. The presence or absence of a desired protein can be detected by measuring the activity of said protein. For example, PACAP receptor activity can be measured by the method described in Biochem. Biophys. Res. Commun., 172, 709-714 (1990) or methods based thereon.
(3) Purification of the desired protein from the solubilized sample
Purification of the desired protein from the solubilized sample obtained in (2) described above can be conducted by anion-exchange chromatography [for example, DEAE-TOYOPEARL.TM. (Tosoh)], hydroxyapatite chromatography [for example, HCA-100.TM. (Mitsui Toatsu Chemicals)], affinity chromatography [for example, avidin-agarose (Pierce)], gel filtration [for example, SUPERROSE.TM. (Pharmacia)], etc. under appropriate conditions. In particular, the methods for producing the desired protein in the present invention are characterized in that the desired protein can be purified at high efficiency by use of affinity chromatography using the "biotinylated PACAPs" first discovered as ligands in the present invention. As said PACAPs, PACAP27 to PACAP38 described in EP-A-0404652 and PACAP23 to PACAP26 described in EP-A-0467279 are used. In particular, PACAP27 and PACAP38 are preferred. Examples of methods for biotinylating the PACAP include the method of introducing a cysteine residue into the carboxyl terminus of the PACAP to synthesize a PACAP derivative, and easily binding a commercially available biotinylating reagent through the cysteine residue. As the derivatives, for example, PACAP27-Cys and PACAP38-Cys are used. The derivatives can be produced by methods known in the art or methods based thereon, for example, solid phase methods. The biotinylating reagents used include, for example, the following reagents: ##STR2## The binding of the derivatives to the biotinylating reagents can be carried out by the method described in Biochem. Biophys. Res. Commun., 184, 123-160 (1990) or methods based thereon.
Examples of the biotinated PACAPs of the present invention include ones represented by the following formula: ##STR3## In particular, one represented by ##STR4## or ##STR5## are preferred.
Of these biotinylated PACAPs, the method for producing biotinylated PACAP27 is described in detail in Example 1 (5) set out below. Other ligands can also be produced in accordance with the method of Example 1 (5-1).
The biotinylated PACAPs of the present invention thus obtained have binding ability to both PACAP receptor proteins and avidin. They can be therefore used for many purposes such as staining and flow cytophotometry of cells and tissues, as well as purification of PACAP receptor proteins.
On the other hand, when the proteins of the present invention are produced by chemical synthesis, they are produced by methods known in the art or methods based thereon. For example, either solid phase synthesis methods or liquid phase synthesis methods may be employed. Namely, the desired peptides can be produced by condensing partial peptides or amino acids which can constitute the proteins of the present invention with residual moieties, and eliminating protective groups when the products have the protective groups. Known condensing methods and elimination of the protective groups include, for example, methods described in (1) to (5) given below:
(1) M. Bodansky and M. A. Ondetti, Peptide Synthesis, Interscience Publishers, New York (1966);
(2) Schroeder and Luebke, The Peptide, Academic Press, New York (1965);
(3) N. Izumiya et al., Peptide Gosei no Kiso to Jikken (Fundamentals and Experiments of Peptide Synthesis), Maruzen (1985);
(4) H. Yazima, S. Sakakibara et al., Seikagaku Jikken Koza (Course of Biochemical Experiments), 1, Chemistry of Proteins IV, 205 (1977); and
(5) Zoku Ivakuhin no Kaihatu (Development of Drugs) second series), 14, Peptide Synthesis, supervised by H. Yazima, Hirokawa Shoten.
After reaction, the PACAP receptor proteins of the present invention can be isolated by combinations of usual purification methods such as solvent extraction, distillation, reprecipitation, column chromatography, liquid chromatography, and recrystallization.
When the PACAP receptor proteins obtained by the above-mentioned methods are free forms, they can be converted to appropriate salts by known methods. Conversely, when the proteins are obtained in the salt state, they can be converted to the free forms by known methods.
The receptor fragments capable of binding a PACAP of the present invention may be any peptides e.g., a receptor fragment or a truncated receptor, as long as they have PACAP receptor activity. For example, sites of PACAP receptor protein molecules exposed out of cell membranes are used. Specifically, they are partial peptides deduced to be extracellular regions in hydrophobic plot analysis (FIG. 23 to FIG. 27). Examples thereof include:
(1) peptides having the amino acid sequence consisting of the 38th to 164th, 223rd to 232nd, 303rd to 317th or 416th to 424th amino acid residues of SEQ ID NO: 15 (bovine PACAP receptor protein Type I-A) (FIG. 23);
(2) peptides having the amino acid sequence consisting of the 38th to 164th, 223rd to 232nd, 303rd to 317th or 388th to 397th amino acid residues of SEQ ID NO: 17 (bovine PACAP receptor protein Type I-B) (FIG. 24);
(3) peptides having the amino acid sequence consisting of the 20th to 146th, 205th to 214th, 286th to 299th or 369th to 378th amino acid residues of SEQ ID NO: 19 (rat PACAP receptor protein Type I-A) (FIG. 25);
(4) peptides having the amino acid sequence consisting of the 20th to 146th, 205th to 214th, 286th to 299th or 397th to 406th amino acid residues of SEQ ID NO: 21 (rat PACAP receptor protein Type I-B) (FIG. 26); and
(5) peptides having the amino acid sequence consisting of the 78th to 204th, 263rd to 272nd, 342nd to 357th or 427th to 436th amino acid residues of SEQ ID NO: 23 (human PACAP receptor protein Type I-A) (FIG. 27).
The receptor fragments capable of binding a PACAP can be produced by known methods for synthesizing the peptides of (1) to (5) described above or by cleaving the PACAP receptor proteins with appropriate peptidases.
Salts of the receptor fragments capable of binding a PACAP used in the present invention include, for example, salts with inorganic acids (such as hydrochloric acid, phosphoric acid, hydrobromic acid and sulfuric acid) and salts with organic acids (such as acetic acid, formic acid, propionic acid, fumaric acid, maleic acid, succinic acid, tartaric acid, citric acid, malic acid, oxalic acid, benzoic acid, methanesulfonic acid and benzenesulfonic acid).
The DNAs coding for the PACAP receptor proteins of the present invention may be any, as long as they have nucleotide sequences coding for the PACAP receptor proteins. Namely, the DNAs encoding the PACAP receptor proteins of the present invention may be any of cDNA, genomic DNA and synthetic DNA. Further, the DNAs may be ones encoding the PACAP receptor proteins derived from any warm-blooded animals (for example, rats, mice, hamsters, chickens, dogs, cats, sheep, monkeys, pigs, cattle, humans and so on), namely the above-mentioned PACAP receptor proteins of the present invention. Specifically, the DNAs having the nucleotide sequences of SEQ ID NO: 30 to SEQ ID NO: 45, respectively, are used. Screening of the DNAs can be conducted by general genetic engineering techniques or methods based thereon, for example, based on the examples 2 to 4 given below.
Expression vectors for the PACAP receptor proteins can be produced by (a) restricting desired DNA fragments from the DNAs encoding the PACAP receptor proteins, and (b) ligating the DNA fragments downstream from promoters in appropriate vectors.
The cloned DNAs encoding the PACAP receptor proteins can be used as such, or after digestion with restriction enzymes or addition of linkers if desired, depending on their purpose.
The DNA may have ATG as a translation initiation codon on the 5'-terminal side, and TAA, TGA or TAG as a translation termination codon on the 3'-terminal side. The translation initiation codon and translation termination codon may be added by use of an appropriate synthetic DNA adaptor. A promoter is further ligated upstream therefrom to express the DNA.
The vectors include plasmids derived from Escherichia coli (for example, pBR322, pBR325, pUC12 and pUC13), plasmids derived from Bacillus subtilis (for example, pUB110, pTP5 and pC194), plasmids derived from yeast (for example, pSH19 and pSH15, bacteriophages (for example, .lambda. phage), and viruses such as retroviruses, vaccinia viruses and baculoviruses.
As the promoter used in the present invention, any promoter is available as long as it is suitable for expression corresponding to a host cell used for the gene expression.
When the host cell used for transformation is Escherichia, a trp promoter, a lac promoter, a recA promoter, a .lambda.P.sub.L promoter or an lpp promoter is preferred. When the host cell is Bacillus, an SPO1 promoter, an SPO2 promoter or a penP promoter is preferred. When the host cell is yeast, a PHO5 promoter, a PGK promoter, a GAP promoter or an ADH promoter is preferred.
When the host cell is an animal cell, a SV40-derived promoter, a CMV-derived promoter, a retrovirus promoter, a metallothionein promoter, etc. are each usable.
An enhancer is also effectively utilized for expression.
Using the vectors containing the DNAs coding for the PACAP receptor proteins thus constructed, transformants are prepared.
Examples of the host cells include Escherichia, Bacillus, yeast, insects and animal cells.
Examples of the above-mentioned Escherichia include E. coli K12.multidot.DH1 [Proc. Natl. Acad. Sci. U.S.A., 60, 160 (1968)], JM103 [Nucleic Acids Research, 9, 309 (1981)], JA221 [Journal of Molecular Biology, 120, 517, (1978)], HB101 [Journal of Molecular Biology, 41, 459 (1969)] and C600 [Genetics, 39, 440 (1954)].
Examples of the above-mentioned Bacillus include Bacillus subtilis MI114 [Gene, 24, 255 (1983)] and 207-21 [Journal of Biochemistry, 95, 87 (1984)].
Examples of the above-mentioned yeast include Saccharomyces cerevisiae AH22, AH22R.sup.-, NA87-11A, DKD-5D and 20B-12.
Examples of the insects include larvae of silk worms (Maeda et al., Nature, 315, 592 (1985)].
Examples of the animal cells include monkey cell COS-7, Vero, Chinese hamster cell (CHO), mouse L cell and human FL cell.
The transformation of the above-mentioned Escherichia is conducted, for example, according to the method described in Proc. Natl. Acad. Sci. U.S.A., 69, 2110 (1972), Gene, 17, 107 (1982) or the like.
The transformation of the Bacillus is carried out, for example, according to the method described in Molecular & General Genetics, 168, 111 (1979) or the like.
The transformation of the yeast is performed, for example, according to the method described in Proc. Natl. Acad. Sci. U.S.A., 75, 1929 (1978).
The transformation of the insects is conducted, for example, according to the method described in Bio/Technology, 6, 47-55 (1988) or the like.
The transformation of the animal cells is carried out, for example, according to the method described in Virology, 52, 456 (1973).
Thus, the transformants transformed with the expression vectors containing the cDNAs coding for the PACAP receptor proteins are obtained.
When the bacterial transformants are cultivated, a liquid medium is typically used for cultivation. Carbon sources, nitrogen sources, inorganic compounds and other nutrients necessary for growth of the transformants are contained therein. Examples of the carbon sources include glucose, dextrin, soluble starch and sucrose. Examples of the nitrogen sources include inorganic or organic materials such as ammonium salts, nitrates, corn steep liquor, peptone, casein, meat extracts, soybean meal and potato extract solution. The inorganic compounds include, for example, calcium chloride, sodium dihydrogenphosphate and magnesium chloride. Yeast, vitamins and growth promoting factors, etc. may be further added.
The pH of the medium is preferably about 5 to about 8.
When the Escherichia transformants are cultivated, M9 medium containing glucose and Casamino Acids [Miller, Journal of Experiments in Molecular Genetics, 431-433, Cold Spring Harbor Laboratory, New York (1972)] is preferably used to cultivate the transformants. In order to allow the promoters to act more efficiently, for example, drugs such as 3.beta.-indolyl acrylic acid may be added thereto if necessary.
The Escherichia transformants are usually cultivated at about 15 to 43.degree. C. for about 3 to 24 hours with aeration or agitation if necessary.
The Bacillus transformants are usually cultivated at about 30 to 40.degree. C. for about 6 to 24 hours with aeration or agitation if necessary.
When the yeast transformants are cultivated, a preferred medium is Burkholder minimum medium [K. L. Bostian, Proc. Natl. Acad. Sci. U.S.A., 77, 4505 (1980)] or SD medium containing 0.5% Casamino Acids [G. A. Bitter et al., Proc. Natl. Acad. Sci. U.S.A., 81, 5330 (1984)]. The pH of the medium is preferably adjusted to about 5 to 8. The cultivation is usually carried out at about 20 to 35.degree. C. for about 24 to 72 hours with aeration or agitation if necessary.
When the insect transformants are cultivated, examples of media used include Grace's insect medium [(T. C. C. Grace, Nature, 195, 788 (1962)] supplemented with an additive such as 10% inactivated bovine serum. The pH of the medium is preferably adjusted to about 6.2 to 6.4. The cultivation is usually carried out at about 27.degree. C. for about 3 to 5 days with aeration or agitation if necessary.
When the animal cell transformants are cultured, examples of media used include MEM medium containing about 5 to 20% fetal calf serum [Science, 122, 501 (1952)], DMEM medium [Virology, 8, 396 (1959)], RPMI 1640 medium [Journal of the American Medical Association, 199, 519 (1967)] and 199 medium [Proceeding of the Society for the Biological Medicine, 73, 1 (1950)]. The pH is preferably about 6 to 8. The cell culture is usually carried out at about 30 to 40.degree. C. for about 15 to 60 hours, with aeration or agitation if necessary.
The isolation and purification of the PACAP receptor proteins from the above-mentioned culture products can be carried out, for example, according to the following method.
When the PACAP receptor protein is to be extracted from cultured cells, the cells are collected by methods known in the art after cultivation. Then, the collected cells are suspended in an appropriate buffer solution, and disrupted by ultrasonic treatment, lysozyme treatment and/or freeze-thawing thereby releasing the PACAP receptor protein, followed by centrifugation to obtain a crude extract of the PACAP receptor protein. The buffer solution may contain a protein denaturant such as urea or guanidine hydrochloride, or a detergent such as Triton X-100.
When the PACAP receptor protein is secreted in the culture solution, a supernatant is separated from the cells by methods known in the art after termination of cultivation, and then collected. The separation and purification of the PACAP receptor protein contained in the culture supernatant or the extract thus obtained can be carried out by appropriate combinations of well-known separating and purifying methods. These known separating and purifying methods include methods utilizing a difference in solubility such as salting-out and solvent precipitation, methods mainly utilizing a difference in molecular weight such as dialysis, ultrafiltration, gel filtration and SDS-polyacrylamide gel electrophoresis, methods utilizing a difference in electric charge such as ion-exchange chromatography, methods utilizing specific affinity such as affinity chromatography, methods utilizing a difference in hydrophobicity such as reverse phase high performance liquid chromatography, and methods utilizing a difference in isoelectric point such as isoelectric point electrophoresis.
Before or after purification, an appropriate protein modifying enzyme can also be reacted with the PACAP receptor protein produced by a recombinant to arbitrarily modify the protein or to partially eliminate a polypeptide therefrom. The protein modifying enzymes used include trypsin, chymotrypsin, arginyl endopeptidase and protein kinase.
The activity of the PACAP receptor proteins thus obtained can be measured by enzyme immunoassays. When the products have dephosphorylation activity, the measurement can also be conducted based upon said activity.
In the PACAP receptor proteins of the present invention, the amino acid sequences thereof may be partially modified (addition, elimination or substitution with other amino acids).
The PACAP receptor proteins and the DNAs coding for said proteins of the present invention thus obtained can be used for (i) acquisition of antibodies and antisera, (ii) construction of expression systems of recombinant receptor proteins, (iii) development of receptor binding assay preparation of probes and PCR primers in gene diagnosis, and (vi) detection of PACAPs or PACAP receptors in vivo. In particular, the information hitherto obtained suggests that the PACAPs are deeply related to the functions of the hypothalamus-pituitary gland system, the sympathetic nerve system and the central nerve-system. Accordingly, elucidation of the structure and properties of the PACAP receptors can contribute to development of unique drugs acting on these systems.
The PACAP receptor proteins, the PACAP receptor fragments and the DNAs encoding said proteins of the present invention can be used as follows (1) to (3)
(1) The PACAPs are known to exhibit functions such as protection of nerve cells and growth maintenance of the nerve cells in vivo. A decrease in PACAP concentration in vivo is therefore considered to induce death of the nerve cells and to cause neuropathy such as Alzheimer's disease. Accordingly, for the PACAP receptor proteins of the present invention which specifically react with the PACAPs, the partial peptides thereof or the salts thereof, the PACAP concentration in vivo can be determined high sensitively, so that they can be effectively used as diagnostic composition for neuropathy such as Alzheimer's disease. When the PACAP receptor proteins of the present invention, the partial peptides thereof or the salts thereof are used as diagnostic composition which can determine the PACAP composition for neuropathy such as Alzheimer's disease. The diagnosis can be conducted by determining an amount of PACAP which binds to PACAP receptor proteins, the partial peptides thereof or the salts thereof of the present invention when contacting the test sample with PACAP receptor proteins, the partial peptides thereof of the salts thereof of the present invention. When the PACAP receptor proteins of the present invention, the partial peptides thereof of the salts thereof are used as diagnostic composition which can determine the PACAP concentration in test samples, they can be used, for example, in combination with competitive assays. For example, the methods described in the following (i) or (ii), or methods based thereon can be used:
(i) Radioimmunoassay, edited by H. Irie, Kodansha (1974), and
(ii) Radioimmunoassay (second series), edited by H. Irie, Kodansha (1979)
Specifically, standard curves can be prepared by the receptor competitive binding experiment method described in Example 1 (3) given later, thereby measuring the PACAP concentration in test samples. The procedure of the method is shown below.
TABLE 1______________________________________A test sample is mixed A standard sample (un-with receptor protein or labeled PACAP27) issolution [.sup.125 I]PACAP27 mixed with receptor protein solution [.sup.125 I] PACAP27.dwnarw.Incubated for 1 hour.dwnarw.Separation of binding ligands from free ligands:Filtration (a glass fiber filter treated with 0.3%polyethylene).dwnarw.Measurement of the amount of binding ligands.dwnarw.The concentration of the test sample is determined fromthe standard curve obtained from the standard sample.______________________________________
(2) In the case of a patient suffering from neuropathy (for example, Alzheimer's disease) in which the PACAP action is not sufficiently exhibited, because the PACAP can not be bound to the PACAP receptor in vivo due to a reduction in the amount of the PACAP receptor protein on the nerve cell membranes in vivo, causing the tendency of death of the nerve cells, the amount of the PACAP receptor protein in the nerve cells of the patient can be increased by (a) inserting the DNA of the present invention in the patient to express it, or by (b) inserting the DNA of the present invention in the nerve cells to express it, followed by implantation of the nerve cells in the patient, thereby sufficiently exhibiting the PACAP action. That is, the DNAs of the present invention can be used for gene therapy of neuropathy, because we can transform nerve cells in vitro or in vivo by using the DNAs of the present invention.
The above-mentioned gene therapy can be given according to methods known in the art. For example, they can be given orally as tablets, capsules, elixirs and microcpsules, or parenterally in the form of injections such as sterile solutions or suspensions with water or with pharmaceutically acceptable solutions other than water. For example, the DNAs of the present invention can be mixed with carriers, flavoring agents, excipients, vehicles, preservatives, stabilizing agents, binders, etc. in the form of unit dosage required for generally admitted pharmaceutical practice to prepare preparations. The amount of active ingredients in these preparations is adjusted so as to obtain appropriate doses within specified ranges. Additives which can be mixed with tablets, capsules, etc. include, for example, binders such as gelatin, corn starch, tragacanth and gum arabic; excipients such as crystalline cellulose; swelling agents such as corn starch, gelatin and alginic acid; lubricants such as magnesium stearate; sweeteners such as sucrose, lactose and saccharine; and flavoring agents such as peppermint, acamono oil and cherry. When the preparation unit is in the capsule form, liquid carriers such as fat and oil may further be added to materials of the above-mentioned types. Sterile compositions for injection can be formulated according to usual pharmaceutical practice such as dissolution or suspension of active substances and naturally occurring vegetable oils such as sesame oil and coconut oil in vehicles such as water for injection. Aqueous solutions for injection include physiological saline and isotonic solutions containing glucose or other adjuvants (for example, D-sorbitol, D-mannitol and sodium chloride), and may be used in combination with appropriate solubilizing adjuvants such as alcohols (for example, ethanol), polyalcohols (for example, polypropylene glycol and polyethylene glycol) and nonionic surface active agents (for example, Polysolvate 80 and HCO-50). Oily solutions include sesame oil and soybean oil, and may be used in combination with solubilizing adjuvants such as benzyl benzoate, benzyl alcohol, etc. The preparations may further contain buffers (for example, phosphate buffer and sodium acetate buffer), soothing agents (for example, benzalkonium chloride and procaine hydrochloride), stabilizing agents (for example, human serum albumin and polyethylene glycol), preservatives (for example, benzyl alcohol and phenol), antioxidants, etc. The injections thus prepared are usually filled into appropriate ampuls. Although the dosage varies depending upon the symptom, the oral dosage is generally about 0.1 to 100 mg per day, preferably 1.0 to 50 mg, and more preferably 1.0 to 20 mg, for adults (taken as 60 kg). When the preparations are parenterally given, the dosage varies depending upon the object to which the preparations are given, the organ to which they are given, the symptom, the route of administration, etc. For example, when the preparations are given in the injection form, it is advantageous that they are intravenously injected in a dosage of about 0.01 to 30 mg per day, preferably 0.1 to 20 mg, and more preferably 0.1 to 10 mg, for adults (taken as 60 kg).
(3) Example 1 below and FIG. 31 have proved that the PACAP receptor proteins of the present invention bind to the PACAPs. Further, Examples 5, 7 and 8 have revealed that the DNAs coding for bovine, rat and human PACAP receptor proteins can be expressed on cell membranes, and the PACAP receptor proteins expressed can react with the PACAPs to increase the amount of cyclic AMP and (or) the concentration of inositol phosphate in cells. Further Example 11 has revealed that compounds inhibiting the binding of PACAPs to PACAP receptors can be screened by using the membrane fractions of the Sf9 cells in which the human PACAP receptor is expressed by use of Baculoviridae. Accordingly, the present invention gives a method for determining
(i) an effect of a test compound on PACAP receptor activity comprising comparing PACAP receptor activities in cases of (a) and (b);
(a) contacting PACAP receptor with a PACAP;
(b) contacting PACAP receptor with a PACAP and a test compound, or
(ii) an effect of a test compound on binding of PACAP to PACAP receptor comprising comparing an amount of binding of PACAP to PACAP receptor in cases of (a) and (b);
(a) contacting PACAP receptor with a PACAP;
(b) contacting PACAP receptor with a PACAP and a test compound.
The present invention further gives an assay for quantifying a test compound's effect
(i) on PACAP receptor activity comprising comparing an amount of PACAP receptor activation in cases of (a) and (b);
(a) contacting PACAP receptor with a PACAP;
(b) contacting PACAP receptor with a PACAP and a test compound, or
(ii) on binding of PACAP to PACAP receptor comprising comparing an amount of binding of PACAP to PACAP receptor in cases of (a) and (b);
(a) contacting PACAP receptor with a PACAP;
(b) contacting PACAP receptor with a PACAP and a test compound.
As the PACAP receptor in the above screening method, the PACAP receptor of the present invention, the receptor fragment of the present invention or the PACAP receptor produced by cultivating a transformant containing the DNA encoding the PACAP receptor of the present invention.
Compounds or their salts obtained by the above screening method include compounds activating PACAP receptor or compounds antagonizing binding of a PACAP to a PACAP receptor.
As the above mentioned, compounds activating PACAP receptors (for example, peptides, proteins and natural or nonnatural compounds), namely, PACAP receptor antagonists, or compounds antagonistically inhibiting the binding of PACAPs to receptors (for example, peptides, proteins and natural or nonnatural compounds), namely PACAP receptor antagonists, can be screened by using the PACAP receptor proteins of the present invention, the partial peptides thereof or the salts thereof, or by the PACAP receptor proteins which are obtained by cultivating transformants containing a DNA encoding PACAP receptor protein. These PACAP receptor agonists or PACAP receptor antagonists can be further tested for use as drugs useful in protection of nerve cells and growth maintenance of nerve cells in vivo, for example, therapeutic composition for neuropathy such as Alzheimer's disease.
Until human PACAP receptor of the present invention was found, for example, when substances which inhibit a binding of PACAP to human PACAP receptor were screened, the following steps were necessary:
Obtaining a PACAP receptor of other than human such as bovine or porcine; screening substances which inhibit a binding of the bovine or porcine PACAP receptor and PACAP; and checking whether the picked substances have real affinity on human PACAP receptor.
Meanwhile, human PACAP receptor makes the screening of substances which inhibit binding of human PACAP receptor and PACAP easy and effective. The thus obtained PACAP receptor agonists or PACAP receptor antagonists may be further tested drugs useful for protecting nerve cells or maintaining growth of nerve cells in vivo such as for therapeutic composition for nervous diseases such as Alzheimer's disease or for maintaining growth of nerve cell in vitro.
The screening methods of the present invention will be described below in detail.
(I) Methods for Screening Compounds Antagonistically Inhibiting the Binding of PACAPs to PACAP Receptors
PACAP receptor proteins used for screening are preferably membrane fractions of organs of warm-blooded animals. For example, human PACAP receptor protein expressed in large amounts by use of recombinants is suitable, because it is very difficult to obtain humanderived organs.
The above-mentioned methods are used for the production of the PACAP receptor proteins, and performed by expressing DNAs coding for said proteins in animal cells (for example, human cells) or insect cells. In particular, they are preferably expressed in the insect cells.
Complementary DNAs are used as the DNA fragments coding desired portions, but the DNA fragments are not necessarily limited thereto. For example, gene fragments or synthetic DNAs may be used. In order to introduce the DNA fragments coding for the PACAP receptor proteins into host cells and express them efficiently, it is preferred that said DNA fragments are ligated downstream from polyhedrin promoters of insect nuclear polyhedrosis viruses (NPVS) belonging to Baculoviridae. Vectors include two viruses of Autograph California NPV (ACNPV) belonging to Kinuwaba and Bombyx mori NPV (BmNPV) of silk worms. Baculoviridae has cyclic double stranded DNA (130 kb), and shows no infectivity to spinal animals and plants at all. Virus DNA is so long as 130 kb, so that it is difficult to directly insert the DNA fragment wanted to be expressed downstream from the polyhedrin promoter. Then, actually, a polyhedrin gene portion containing a promoter portion is cut out from a virus, and incorporated in an E. coli vector such as pUC18 to prepare a transfer vector. Subsequently, a desired DNA fragment is inserted downstream from a polyhedrin promoter of the transfer vector, and an insect cell is concurrently infected therewith, together with baculovirus DNA, followed by cultivation. Homologous recombination is allowed to take place in the insect cell to obtain a recombinant baculovirus. The recombinant virus forms the desired product freshly introduced, instead of forming a polyhedrin. When the virus is AcNPV, a yatoga caterpillar-derived established cell line (Spodoptera frugiperda cell; Sf cell) is used as a host cell. When the virus is BmNPV, a silk worm-derived established cell line (Bombyx mori N; BmN cell) is used. As expression systems using baculoviruses and insect cells, commercial systems can be employed (for example, MAXBAC.TM., Invitrogen), and procedures described in the experimental descriptions attached thereto and in Bio/Technology, 6, 47-55 (1988) can also be adopted. The amount and quality of the expressed receptor can be examined by methods known per se in the art, for example, the method described in P. Nambi et al. J. Biol. Chem., 267, 19555-19559 (1992).
In the screening methods of the present invention, as the PACAP receptor proteins, either cells containing the proteins or membrane fractions of cells containing the proteins may be used. Further, membrane fractions of insect cells containing the proteins are most preferably used.
Said cells means host cells in which the PACAP receptor proteins are expressed. Said host cells include E. coli, Bacillus subtilis, yeast, insect cells and animal cells (for example, human cells), and the insect cells are preferred among others.
The membrane fractions means fractions in which cell membranes obtained by methods known per se in the art after cell disruption are contained in large amounts. The disruption of the cells is carried out preferably at 0 to 4.degree. C., and physiological saline or a buffer such as 50 mM Tris-HCl is used. A protease inhibitor is preferably added to prevent decomposition of the protein. Methods for disrupting the cells include the method of crushing the cells with a Potter-Elvehjem type homogenizer, disruption with a Working blender or a Polytron homogenizer (Kinematica), disruption by ultrasonication, and disruption by allowing the cells to jet through a fine nozzle under pressing with a French press, etc. Fractionating methods utilizing centrifugal force such as differential centrifugation and density gradient centrifugation are mainly used for fractionation of the cell membranes. For example, a cell disrupted solution is centrifuged at a low speed (500 to 3000 rpm) for a short period of time (usually about 1 to 10 minutes), and the supernatant is further centrifuged at a high speed (15000 to 30000 rpm), usually for 30 minutes to 2 hours. The resulting precipitate is taken as the membrane fraction. In said membrane fraction, the expressed PACAP receptor protein and membrane compositions such as cell-derived phospholipids and membrane proteins are contained in large amounts.
The amount of the PACAP receptor proteins in the cells or the membrane fractions containing the PACAP receptor proteins is preferably 10.sup.3 to 10.sup.8 molecules per cell, and suitably 10.sup.5 to 10.sup.7 molecules per cell. A more expression amount results in higher PACAP binding activity per membrane fraction (specific activity). Not only construction of a high sensitive screening system becomes possible, but also a large amount of samples can be measured in the same lot.
In order to screen compounds antagonistically inhibiting the binding of a PACAP to a PACAP receptor, an appropriate PACAP receptor fraction and a labeled PACAP (for example, PACAP27 or PACAP38, hereinafter referred to as a PACAP) are required. Desirable examples of the PACAP receptor fractions include natural PACAP receptor proteins and recombinant PACAP receptor proteins equivalent thereto. As the labeled PACAPs, PACAP27 labeled with [.sup.125 I] (du Pont), etc. are commercially available. They can therefore be utilized.
When the compounds antagonistically inhibiting the binding of the PACAP to the PACAP receptor is screened, cells or cell membrane fractions containing the PACAP receptor protein are first suspended in a buffer suitable for screening, thereby preparing a receptor sample. The buffer may be any, as long as it is a buffer which does not inhibit the binding of the PACAP to the receptor, such as phosphate buffer or Tris-HCl buffer having a pH of 4 to 10 (preferably a pH of 6 to 8). For the purpose of decreasing non-specific binding, a surface active agent such as CHAPS, Tween-80.TM. (Kao-Atlas), digitonin or deoxycholate may also be added to the buffer. Further, for the purpose of inhibiting decomposition of the receptor or a ligand with a protease, a protease inhibitor such as PMSF, leupeptin, E-67 (Peptide Laboratory) or pepstatin can also be added. A definite amount (5000 to 500000 cpm) of [.sup.125 I]PACAP is added to 0.01 to 10 ml of the receptor solution, and 10.sup.-4 to 10.sup.-10 M specimen compound, fermentation products, etc. are allowed to coexist at the same time. In order to know the non-specific binding (NSB), a reaction tube to which a ligand is added in large excess is prepared. Reaction is conducted at 0 to 50.degree. C., desirably at 4 to 37.degree. C. for 20 minutes to 24 hours, desirably for 30 minutes to 3 hours. After reaction, the reaction product is filtered through a glass fiber filter and washed with an appropriate amount of the same buffer, followed by measurement of [.sup.125 I] remaining on the glass fiber filter with a .alpha.-counter. When the count (B.sub.0 -NSB) obtained by subtracting NSB from the count (B.sub.0) in the absence of an antagonistic substance is taken as 100%, the specimen compound, the fermentation products, etc giving a non-specific binding (B-NSB) of 50% or less can be selected as potential materials having antagonistic ability.
Examples of kits for screening the compounds antagonistically inhibiting the binding of the PACAPs to the PACAP receptors of the present invention include the following:
1. Reagents for Screening
(A) Buffer for Measurement
______________________________________Tris-HCl 2.4 gMagnesium acetate.4H.sub.2 O 1.07 gEGTA 0.76 gNaN.sub.3 0.6 gLeupeptin 20 mgE-64 4 mg______________________________________
These are dissolved in 997 ml of distilled water.
______________________________________ Pepstatin 1 mg PMSF 0.09 g______________________________________
These are dissolved in 1 ml of DMSO, and the resulting solution is added to 997 ml of the above-mentioned water. About 2 ml of 6N HCl is added thereto to adjust to pH 7.2. One gram of BSA is dissolved therein, followed by storage at 4.degree. C.
(B) Buffer for Washing
______________________________________ CHAPS 0.45 g______________________________________
This is dissolved in 900 ml of the buffer for measurement and the solution is stored at 4.degree. C.
(C) PACAP Receptor Sample
A membrane fraction of insect cells (Sf9) in which a PACAP receptor protein is expressed is diluted with the buffer for measurement to 0.5 to 5 .mu.g of protein/ml before use.
(D) [.sup.125 I] Labeled PACAP
______________________________________(3-[.sup.125 I]iodotyrosyl)PACAP (du Pont) 185 kBq______________________________________
Fifty microliters of distilled water is added thereto to dissolve it, and 450 .mu.l of the buffer for measurement is added thereto. The solution is stored at -20.degree. C.
(E) PACAP Standard Solution
The PACAP (Peptide Laboratory) is diluted with 50% DMSO to 10.sup.-4 M, and stored at -20.degree. C. This is diluted 10 times with the buffer for measurement before use.
2. Assays
(i) The membrane fraction of Sf9 cells containing the PACAP receptor protein [J. L. Vaughn et al., In Vitro, 13, 213-217 (1977)] is diluted with the buffer for measurement to give 1 .mu.g of protein/ml, and 100 .mu.l thereof is poured into each tube (Falcon).
(ii) After addition of 3 .mu.l of 10.sup.-4 to 10.sup.-10 M specimen or 10 .mu.l or less of fermentation products, 2 .mu.l of [.sup.125 I] labeled PACAP is added, followed by reaction at 25.degree. C. for 60 minutes. In order to examine the non-specific bonding, 3 .mu.l of 10.sup.-5 M PACAP is added instead of the specimen.
(iii) The buffer for washing (1.5 ml) is added, and filtration is conducted through a glass fiber filter (GF/F, Whatman). Then, 1.5 ml of the same buffer is further added to the residue in the tube, and filtration is conducted again.
(iv) [.sup.125 I] remaining on the glass fiber filter is measured with a .gamma.-counter, and the percent maximum binding (PMB) is determined from the following equation;
PMB=[(B-NBS)/(B.sub.0 -NBS)]X100
PMB: percent maximum binding
B: value when the specimen is added
NBS: non-specific binding
B.sub.0 : maximum binding
(II) Methods for Screening Compounds Activating the PACAP Receptors
The compounds antagonistically inhibiting the binding of the PACAPs to the PACAP receptor proteins selected by the methods of (I) described above is expected to contain compounds activating the PACAP receptor proteins similarly to the PACAPs (compounds having PACAP receptor agonist activity). Such compounds can be evaluated by secondary screening systems based on acceleration of cyclic AMP production as described below.
First, cells in which the PACAP receptor protein is expressed are subcultured to a 48-well plate for tissue culture in a ratio of 1.times.10.sup.5 cells/well, and cultured for 2 days. Then, the medium is removed, and the plate is washed twice with serum-free medium. Subsequently, 300 .mu.l of the same medium is added to each well as a reaction solution. The serum-free medium may be any, as long as it is a medium for cell culture, and bovine serum albumin, etc. may be added for the purpose of preventing the compounds added from being non-specifically adsorbed by the instruments, etc. Further, for the purpose of inhibiting decomposition of cyclic AMP produced to enhance assay sensitivity, addition of 3-isobutyl-1-methylxanthine (IBMX), a phosphodiesterase inhibitor, is effective. The specimen compound having a final concentration of 10.sup.-4 to 10.sup.-10 M and fermentation products are added to each well. In order to know non-specific response, wells containing only the solvent in which the compounds are dissolved are prepared. Reaction is usually conducted at 4 to 42.degree. C. for 10 minutes to 2 hours, preferably at room temperature to 37.degree. C. for 20 minutes to 1 hour. After reaction, the supernatant is removed by suction. After washing with two portions of the reaction solution, cyclic AMP produced is extracted with 200 .mu.l of 100% ethanol. Ethanol is removed with a centrifugal freeze dryer, and the residue is dissolved in 100 .mu.l of a buffer for determination of cyclic AMP. Reagents for determination of cyclic AMP, including the buffer, may be ones commercially available as kits according to either radio immunoassay (RIA) or enzyme immunoassay (EIA) (Amersham, du Pont, etc.). When the production amount of cyclic AMP which has become clear by determination is statistically significantly high, compared with the case where the sample is not added or the case where only the solvent in which the sample is dissolved is added, such compound can be selected as potential compounds having PACAP receptor agonist activity. In order to eliminate the probability that the cyclic AMP production promoting action of the potential compounds is non-specific action to cells or action through receptors other than the PACAP receptor, it is necessary to confirm that the potential compounds exhibit no cyclic AMP production promoting action in cells in which the PACAP receptor protein is not allowed to be expressed. As an indication for PACAP receptor agonist activity, production promotion of inositol triphosphate or diacylglycerol and an increase in intracellular calcium concentration, as well as the production promotion of cyclic AMP, may be employed. However, the production promotion of cyclic AMP is superior from the viewpoint of treating the sample in large amounts. Such screening methods of the present invention are excellent methods by which compounds having action similar to that of the PACAP or higher than the PACAP and excellent in resistance against proteases, compared with the PACAP, a peptide, can be selected.
Antibodies or antiserum to the PACAP receptor proteins of the present invention, the partial peptides thereof or the salts thereof may be any antibodies or antiserum as long as they can recognize the PACAP receptor proteins, the partial peptides thereof or the salts thereof. For example, monoclonal antibodies such as PRN1-25a, PRN1-109a and PRN1-159a against a partial peptide (MHSDAIFKKEQAMC) are preferable. The partial peptide was prepared by substituting the 5th Cys(C) of a partial peptide which has a partial amino acid sequence (lst to 14th amino acid sequence of SEQ ID NO:14) common to bovine, rat or human PACAP receptor which has amino acid sequence of anyone of SEQ ID NO:14 to SEQ ID NO:29 to Ala(A), for the convenience of preparation of immunoantigen complexes.
Antibodies or antiserum to the PACAP receptor proteins of the present invention, the partial peptides thereof or the salts thereof can be produced by methods known per se in the art, using the PACAP receptor proteins, the partial peptides thereof or the salts thereof as antigens. The antibodies or antiserum thus obtained can be used for quantitative analysis or detection of the PACAP receptor proteins of the present invention, the peptides thereof or the salts thereof, more detailed utilities are as follows:
(1) By using the antibodies or antiserum for Western blotting or immune precipitation, the PACAP receptor proteins, the partial peptides thereof or the salts thereof can be detected.
(2) An affinity column to which the antibodies of the present invention are fixed, can purify the PACAP receptor proteins, the partial peptides thereof or the salts thereof.
(3) The antibodies of the present invention can be used as a PACAP receptor antagonist, as shown in Example 12, since the antibodies block PACAP action by inhibiting binding of PACAP and a PACAP receptor.
As a signal peptide of the PACAP receptor protein of the present invention, for example, a peptide which has 1st to 37th amino acid sequence of SEQ ID NO:15, a peptide which has 1st to 37th amino acid sequence of SEQ ID NO:17, a peptide which has 1st to 19th amino acid sequence of SEQ ID NO:19, a peptide which has 1st to 19th amino acid sequence of SEQ ID NO:21, a peptide which has 1st to 77th amino acid sequence of SEQ ID NO:23, a peptide which has 1st to 77th amino acid sequence of SEQ ID NO:25, a peptide which has 1st to 77th amino acid sequence of SEQ ID NO:27, a peptide which has 1st to 77th amino acid sequence of SEQ ID NO:29, a peptide which has 58th to 77th amino acid sequence of SEQ ID NO:23, a peptide which has 58th to 77th amino acid sequence of SEQ ID NO:25, a peptide which has 58th to 77th amino acid sequence of SEQ ID NO:27 or a peptide which has 58th to 77th amino acid sequence of SEQ ID NO:29 may be used. These signal peptides can be synthesized by conventional methods such as a peptide synthesizer or prepared by cutting the amino acid bond of the PACAP receptor of the present invention with an enzyme.
The salts of the signal peptides of the present invention include similar salts as those for PACAP receptors or partial peptides thereof.
A DNA which encodes a signal peptide may be any one which has a nucleotide sequence encoding the signal peptide and includes a DNA which has 1st to 111th nucleotide sequence of SEQ ID NO:30, a DNA which has 1st to 111th nucleotide sequence of SEQ ID NO:31, a DNA which has 1st to 57th nucleotide sequence of SEQ ID NO:32, a DNA which has 1st to 57th nucleotide sequence of SEQ ID NO:33, a DNA which has 1st to 231st nucleotide sequence of SEQ ID NO:34, a DNA which has 1st to 231st nucleotide sequence of SEQ ID NO:35, a DNA which has 1st to 231st nucleotide sequence of SEQ ID NO:36, a DNA which has 1st to 231st nucleotide sequence of SEQ ID NO:37, a DNA which has 172nd to 231st nucleotide sequence of SEQ ID NO:34, a DNA which has 172nd to 231st nucleotide sequence of SEQ ID NO:35, a DNA which has 172nd to 231st nucleotide sequence of SEQ ID NO:36, a DNA which has 172nd to 231st nucleotide sequence of SEQ ID NO:37 or a DNA which comprises one of these DNAs. These DNAs encoding signal peptides of the present invention can be synthesized by conventional method such as a peptide synthesizer or prepared by cutting the DNA (cDNA is preferable) which encodes the PACAP receptor of the present invention with an appropriate restrictive enzyme.
The DNA coding for the signal peptide of the PACAP receptor proteins of the present invention may stimulate an expression of a membrane-bound peptide such as a receptor into a membrane. For example, a protein which does not or rately expresses into a membrane can be expressed on the membrane effectively by linking a DNA coding for a signal peptide of the PACAP receptor proteins of the present invention upstream from the DNA which rarely or does not express the desired protein on the membrane in an expression.
The present invention will be described in more detail through the following examples. It is understood of course that they are not intended to limit the scope of the invention.
Transformant E. coli pBPR-T containing pBPRT and transformant E. coli pBPR114 containing pBPR114 each obtained in Example 2 given later were deposited with the National Institute of Bioscience and Human-technology (NIBH), the Agency of Industrial Science and Technology, the Ministry of International Trade and Industry, Japan, under the accession numbers FERM BP-4338 and FERM BP-4339, respectively, on Jun. 15, 1993, and deposited with Institute for Fermentation, Osaka, Japan (IFO) under the accession numbers IFO 15572 and IFO 15571, respectively, on Nov. 5, 1993.
Transformant E. coli pRPACAPR 12 containing pRPACAPR 12 and transformant E. coli pRPACAPR 46-5 containing pRPACAPR each obtained in Example 3 given later were deposited with NIBH, under the accession numbers FERM BP-4254 and FERM BP-4255, respectively, on Apr. 5, 1993, and deposited with IFO under the accession numbers IFO 15469 and IFO 15470, respectively, on Apr. 15, 1993.
Transformant E. coli MV1184/pTS847-1 containing pTS847-1 obtained in Example 4 given below was deposited with the NIBH under the accession number FERM BP-4280, and deposited with IFO under the accession number IFO 15570 on Nov. 5, 1993.
Transformant E. coli pHPR15A containing pHPR15A obtained in Example 4 given below; Transformant E. coli pHPR55A containing pHPR55A and Transformant E. coli pHPR66P containing pHPR66P were deposited with the NIBH under the accession number FERM BP-4511, FERM BP-4510 and FERM BP-4509, respectively on Dec. 22, 1993, and deposited with IFO under the accession number IFO 15603, 15604 and 15605, respectively on Dec. 20, 1993.
Hybridoma PRN1-159 obtained in Example 12 given below was deposited with NIBH under the accession number FERM BP-4554 on Feb. 8, 1994, and deposited with IFO under the accession number IFO 50427 on Feb. 8, 1994.
EXAMPLES
Example 1
Production (Purification) of Bovine-Derived PACAP Receptor Protein
The following procedure was conducted in a low temperature laboratory at 4.degree. C.
(1) Preparation of Membrane Fractions
Membrane fractions were prepared from the bovine cerebrums according to a method in which the known method described in Biochem. Biophys. Res. Commun., 172, 709-714 (1990) was partially modified. The fresh bovine cerebrums (1.5 kg) were homogenized 3 times in 6 liters of buffer A (20 mM Tris, 10 mM EDTA, 0.25M sucrose, 0.5 mM PMSF, 20 .mu.g/ml leupeptin, 4 .mu.g/ml E-64 and 1 .mu.g/ml pepstatin, pH 7.4) with a Polytron homogenizer (Kinematica) for 30 seconds. The resulting homogenate was centrifuged with a high speed cooling centrifuge CR26H, Roter RR10A (Hitachi, Ltd.) at 680.times.g for 20 minutes to obtain a supernatant. The resulting supernatant was further ultracentrifuged with an ultracentrifuge SCP70H, Roter RPZ35T (Hitachi, Ltd.) at 100,000.times.g for 60 minutes to obtain pellets. The pellets were suspended in 400 ml of buffer B (20 mM Tris, 5 mM EDTA, 0.5 mM PMSF, 20 .mu.g/ml leupeptin, 4 .mu.g/ml E-64 and 1 .mu.g/ml pepstatin, pH 7.4) to prepare a membrane fraction suspension.
(2) Solubilization of the PACAP Receptor Protein from the Membrane Fractions
The membrane fraction suspension obtained in (1) described above (400 ml) was diluted with 5 liters of buffer B to give a membrane protein concentration of 1 mg/ml, and digitonin was added thereto to provide a concentration of 1%. The resulting suspension was slowly stirred for 1 hour, and then, ultracentrifuged with an ultracentrifuge SCP70H, Roter RPZ35T (Hitachi, Ltd.) at 100,000.times.g for 1 hour to obtain a supernatant. The resulting supernatant was used as a solubilized membrane protein fraction.
(3) Assay of Receptor Activity of the PACAP Receptor Protein
PACAP receptor activity was assayed according to the saturation binding experiment method using [.sup.125 I]PACAP27 and the antagonistic binding experiment method [Biochem. Biophys. Res. Commun., 171, 838-844 (1990) and Biochem. Biophys. Res. Commun., 172, 709-714 (1990)]. The test sample (membrane fraction or solubilized membrane protein fraction) was appropriately diluted with buffer D (20 mM Tris, 5 mM magnesium chloride, 0.1% BSA and 0.05% digitonin, pH 7.4). In the saturation binding experiment, 0.1 ml of the diluted test sample was mixed with 10 .mu.l of [.sup.125 I]PACAP27 (final concentration: 20 to 50 pM), and reacted at 25.degree. C. for 1 hour. In the competitive binding experiment, the diluted test sample was mixed with 2 .mu.l of [.sup.125 I]PACAP27 (final concentration: 100 pM) and 3 .mu.l of an unlabeled peptide (PACAP27, PACAP38 or VIP) having a variable concentration, and reacted in a similar manner. To 0.1 ml of this reaction solution, 1.5 ml of buffer E (0.1% BSA, 0.05% CHAPS, 20 mM Tris and 5 mM magnesium chloride, pH 7.4) cooled with ice was added, and immediately, the mixed solution is filtered through a glass fiber filter. The glass fiber filter used had previously been treated with 0.3% polyethylene imine. The radioactivity of the filter was counted with a y-ray counter, thereby determining [.sup.125 I]PACAP27 bound to the receptor. In order to determine the non-specific binding, the above-mentioned experiment was carried out in the presence of 1 .mu.M PACAP27. The specific binding was calculated by subtracting the non-specific binding from the total binding measured in the absence of PACAP27. Results of the saturation binding experiment were subjected to Scatchard plot analysis to determine the dissociation constant and the maximum binding.
(4) Crude Purification of the PACAP Receptor Protein
A method for purifying the PACAP receptor from the solubilized membrane protein fraction by ion exchange chromatography and hydroxyapatite chromatography is described below.
The solubilized membrane protein fraction [2400 mg (4800 ml)] was loaded onto an ion exchange column (for example, anion exchange chromatography such as DEAE-TOYOPEARL) equilibrated with 1 liter of buffer C, at a flow rate of 9 ml/minute. Then, the concentration of sodium chloride in buffer C (20 mM Tris, 1 mM EDTA, 0.5 mM PMSF, 20 .mu.g/ml leupeptin, 4 .mu.g/ml E-64 and 1 .mu.g/ml pepstatin, pH 7.4) supplemented with 0.1% digitonin was gradually increased from 0M to 1M for 170 minutes to elute the PACAP receptor from the column. The PACAP receptor activity of each eluted fraction was assayed by the above-mentioned method. The active fractions eluted from the ion exchange column were further loaded onto a hydroxyapatite column (HCA-100, 5 cm in diameter and 7 cm in length) at a flow rate of 7 ml/minute. This column was washed with 500 ml of 0.1M phosphate buffer containing 0.1% digitonin, and then, the PACAP receptor was eluted with 500 ml of 0.6M phosphate buffer containing 0.1% digitonin at a flow rate of 7 ml/minute. The active fractions were concentrated 10-fold using an ultrafilter, and further desalted by repetition of dilution and concentration with a 6-fold excess of buffer C in relation to the volume of the concentrated sample.
(5) Purification of the PACAP Receptor by Affinity Chromatography
(5-1) Preparation of Affinity Ligand
A method for preparing a biotinated PACAP used in affinity chromatography is described below. One equivalent of the PACAP27 derivative (having cysteine as the 28th amino acid residue, PACAP27-Cys) synthesized by the solid phase method was dissolved in 50 mM phosphate buffer (pH 7.0) supplemented with 3 mM EDTA and 0.5M NaCl to provide a concentration of 2.times.10.sup.-4, and a 10 mM biotinylating reagent (biotin-HSDP) dissolved in DMF was added thereto to give 10 equivalents, followed by reaction overnight. The reaction product, biotinylated PACAP27 (PACAP27-Cys-biotin) represented by the following formula, was purified on a reverse phase HPL chromatography: ##STR6## Namely, the reaction product was loaded onto a reverse phase column (ODS 80-TM, Tosoh) equilibrated with 60 ml of distilled water containing 0.05% TFA, and the concentration of acetonitrile was gradually increased from 20% to 40% for 60 minutes at a flow rate of 1 ml/minute at room temperature to conduct separation. Peak fractions of biotinylated PACAP27 were fractionated, and chromatographed again under the same conditions (FIG. 28) to obtain pure biotinylated PACAP27, followed by lyophilization. It was confirmed by the competitive binding experiment that biotinylated PACAP27 has an affinity similar to that of PACAP (FIG. 29).
(5-2) Affinity Chromatography
Avidin-agarose was suspended in a solution containing the PACAP receptor protein crudely purified by the method described above, and gently stirred overnight. Avidin-agarose was removed by filtration to obtain a filtrate. About 20-fold equivalents of biotinated PACAP27 in relation to the amount of the receptor was added to this filtrate, and allowed to react overnight. Further, 80 ml of avidin-agarose was suspended therein, and gently stirred for 4 days. This avidin-agarose was packed into a column, and washed with 500 ml of buffer C containing 1M sodium chloride and 0.1% digitonin at a flow rate of 1.5 ml/minute, followed by elution of the PACAP receptor protein with 180 ml of a buffer (20 mM magnesium acetate 1M sodium chloride and 10% glycerol, pH 4.0) at a flow rate of 1.5 ml/minute. The eluate was immediately neutralized with 1/4 volume of 1M Tris (pH 7.5) with respect to the eluate.
(6) Final Purification after Affinity Chromatography
The PACAP receptor protein purified by the above-mentioned affinity chromatography was loaded onto a microcolumn (1.8 ml) of hydroxyapatite at a flow rate of 0.3 ml/minute, and washed with 20 ml of 0.1M phosphate buffer containing 0.1% digitonin at a flow rate of 0.3 ml/minute, followed by elution of the PACAP receptor from the column with 20 ml of 0.6M phosphate buffer containing 0.1% digitonin at a flow rate of 0.3 ml/minute. The active fractions eluted were concentrated using an ultrafilter (CENTRICON 10.TM., Amicon). The active fractions concentrated were gel filtered on a gel filtration column (for example, Superrose 6 Column, Pharmacia) equilibrated with 60 ml of buffer C containing 0.1% digitonin and 0.2M NaCl at a flow rate of 0.4 ml/minute. The active fractions eluted were used as a purified PACAP receptor protein sample.
One embodiment of the purification procedure conducted by the above-mentioned methods is summarized in Table 2.
The specific activity (mole number of PACAP binding to unit weight of protein) of the final purified sample determined by the saturation binding experiment using [.sup.125 I]PACAP27 was usually 15,000 pmoles/mg of protein or more. Further, the calculation of the dissociation constant from results of the saturation binding experiment revealed that the dissociation constant of the final purified sample approximately agrees with that of the PACAP receptor existing in the membrane fractions, and that the purified PACAP receptor protein has a sufficiently high affinity for the PACAP (FIG. 30). Furthermore, results of the competitive binding experiment for the purified PACAP receptor protein proved that it has the property of reacting with PACAP27 and PACAP38, but not reacting with VIP (FIG. 31). Analysis results obtained by polyacrylamide electrophoresis for the final purified sample in the presence of sodium dodecylsulfate are shown in FIG. 28. The results indicate that the final purified sample is composed of a substantially pure protein (molecular weight: about 57,000). This protein having a molecular weight of about 57,000 is the PACAP receptor protein occurring in the bovine cerebrums.
TABLE 2______________________________________ Total Total Specific Purifi- Activity activity protein activity cation yield (pmole) (mg) (pmole/mg) (fold) (%)______________________________________Membrane fraction 8115 6400 1.3Solubilized product 4561 2400 1.9 1 100Ion exchange 4700 475 9.9 5.2 103Hydroxyapatite 3349 134 25.0 13.2 73Avidin-agarose 2040 ND ND 45Micro 1717 ND ND 38hydroxyapatiteGel filtration 671 0.042 16000 8400 15______________________________________ Total activity: The maximum binding of [.sup.125 I]PACAP27 obtained by th saturation binding experiment ND: Not determined
Example 2
Screening of Bovine PACAP Receptor Protein cDNA and DNA Sequence Analysis
(1) Preparation of Bovine Hippocampus Poly(A).sup.+ RNA Fractions and Construction of cDNA Library Using the Same
Total RNA fractions were prepared from the bovine hippocampi according to the guanidine-fluoroacetate method [Method in Enzymology, 154, 3 (1987) and Biochemistry, 18, 5294 (1978)], and poly(A).sup.+ RNA fractions were further separated by the use of an oligo(dT) cellulose-spun-column (Pharmacia). Using these fractions as a starting material, a bovine hippocampus cDNA library in which a vector was .lambda.gt11 was constructed by the use of a cDNA cloning kit (Amersham). The library prepared had about 4.times.10.sup.6 pfu (plaque forming unit) of independent clones.
(2) Preparation of Probe
A synthetic DNA was prepared as a probe, based on the N-terminal amino acid sequence having the amino acid sequence represented by SEQ ID NO: 38 of the bovine PACAP receptor protein obtained in Example 1. Sequence:
5' TGGATCTTCTCCAGGTGCATDGCCTGCTCCTTCTTGAAGATGTGGTC 3' (SEQ ID NO: 51)
(D is G, A or T.)
(3) Screening
The .lambda.gt11 phage cDNA library (bovine brain, Clontech) (1.5.times.10.sup.6 pfu) prepared in Example 2 (1) was mixed with magnesium sulfate-treated E. coli Y1090, and incubated at 37.degree. C. for 15 minutes. Then, 0.5% agarose/LB was added thereto, followed by plating on a 1.5% agar/LB plate. A nitrocellulose filter was placed on the plate on which a plaque is formed, and the plaque transferred onto the filter. After alkali treatment of this filter, the DNA was fixed by heating at 80.degree. C. for 3 hours. This filter was hybridized with the labeled probe in a hybridization buffer [0.5M phosphate buffer (pH 7.2), 1% bovine serum albumin, 7% SDS and 1 mM EDTA] overnight at 50.degree. C. The labeling of the probe was conducted according to the method of phosphorylation of the 5'-terminus of the probe with [.gamma.-.sup.32 P]ATP and T4 polynucleotide kinase (Nippon Gene).
Washing was carried out with 2.times. SSC, 0.1% SDS at 48.degree. C. for 1 hour, and then, hybridized clones were detected by autoradiography at -80.degree. C. As a result, a cDNA encoding a N-terminal portion of the PACAP receptor was obtained, and the cDNA designated as .lambda.BPR35.
Further, the bovine brain-derived cDNA library (Clontech) (1.5.times.10.sup.6 pfu) was screened, using the cDNA portion of .lambda.BPR35 as a probe, to obtain a cDNA encoding C-terminal portion of the PACAP receptor. At this time, a buffer was used which comprised 5.times. Denhardt's solution [0.02% bovine serum albumin (Sigma)], 5.times. SSPE (0.15M sodium chloride, 0.01M monosodium phosphate and 1 mM EDTA), 0.1% SDS and 100 .mu.g/ml of heat-denatured salmon sperm DNA (Sigma), and incubation was conducted overnight at 65.degree. C. together with the labeled probe to hybridize. The labeling of the probe was carried out by the use of a multi-prime DNA labeling kit (Amersham). Washing was carried out with 0.2.times. SSC, 0.1% SDS at 60.degree. C. for 1 hour, and then, hybridized clones were detected by autoradiography at -80.degree. C. A cDNA clone which encoded a portion of the PACAP receptor was obtained, and the cDNA was designated as .lambda.BPR114. Using the cDNA portion of the resulting pBPR114 as a probe, the cDNA library (4.times.10.sup.-6 pfu) prepared from the bovine hippocampus poly(A).sup.+ RNA fractions was screened to obtain a cDNA encoding the C-terminal portion of the PACAP receptor. The conditions at this time were the same as those at the time when the above-mentioned .lambda.BPR114 was screened. As a result, a cDNA clone encoding a C-terminal portion of the PACAP receptor was obtained, and the cDNA was designated as .lambda.BPR68.
(4) Subcloning of cDNA Clones and DNA Sequence Analysis
An inserting portion of the resulting cDNA clone was cut out by cleavage with EcoRI, and subcloned into plasmid vector pUC118 to obtain pBPR35, pBPR114 or pBPR68. The plasmid was further cleaved stepwise by exonuclease digestion, or self cyclized or subcloned after cleavage with an appropriate restriction enzyme (NcoI, BamHI, etc.) to prepare a template DNA for sequence analysis. For sequence determination, the dideoxy chain termination method using RI marker dCTP and a fluorescent DNA sequencer (Applied Biosystems) were used, and for data analysis, a DNASIS (Hitachi Software Engineering) was used. Further, pBPR35 and pBPR68 were recombined at the BamHI sites to prepare pBPR-T. The BamHI and AvaII fragments of pBPR114 having disappeared regions can be recombined with PBPR-T by the use of known genetic engineering technique, thereby preparing PACAP receptor cDNA (pBPR-TD) containing no insertion.
Results of analysis revealed that pBPR-T has the nucleotide sequence of SEQ ID NO: 38, and that pBPR-TD has the nucleotide sequence of SEQ ID NO: 39.
Example 3
Screening of Rat PACAP Receptor Protein cDNA and DNA Sequence Analysis
(1) Preparation of Rat Brain Poly(A).sup.+ RNA Fractions and Construction of cDNA Library Using the Same
Total RNA fractions were prepared from the rat brains according to the guanidine-isothiocyanate method [Biochemistry, 18, 5294 (1979)], and poly(A).sup.+ RNA fractions were further separated by the use of an oligo(dT) cellulose-spun-column (Pharmacia). Using these fractions as a starting material, a rat brain cDNA library in which a vector was .lambda.gt11 was constructed by the use of a cDNA cloning kit (Amersham). The library prepared had about 3.times.10.sup.6 pfu (plaque forming unit) of independent clones.
(2) Preparation of Probe
Based on the cDNA nucleotide sequence of rat VIP receptor already reported, primers for PCR were synthesized with a DNA synthesizer (Model 391, PCR-MATE EP, Applied Biosystems).
Sequence: RVIPLR-1S
5' CAGA AAGCTT CGGACCATGCGCCCTCCGAGCCCACCG 3' (SEQ ID NO: 48)
Sequence: RVIPLR-2A
5' GGGC TCTAGA CGGTCAGACCAGGGAGACCTCCGCTTG 3' (SEQ ID NO: 49)
Using 5 .mu.g of rat lung poly(A).sup.+ RNA fractions prepared in a manner similar to that of the brain RNA fractions and a random primer, cDNA having only first strand was synthesized. Then, using this single stranded DNA as a template, and using the above-mentioned primers, rat VIP receptor cDNA fragments were amplified by the PCR method. The sequences of the resulting cDNA fragments were determined, and they are confirmed to be cDNA fragments of rat VIP receptor.
(3) Screening
The .lambda.gt11 cDNA library (3.times.10.sup.6 pfu) prepared in Example 3 (1) was mixed with magnesium sulfate-treated E. coli Y1090, and incubated at 37.degree. C. for 15 minutes. Then, 0.5% agarose/LB was added thereto, followed by plating on a 1.5% agar/LB plate. A nitrocellulose filter was placed on the plate on which a plaque is formed, and the plaque was transferred onto the filter. After alkali treatment of this filter, the DNA was fixed by heating at 80.degree. C. for 3 hours. This filter was hybridized with the probe labeled in hybribuffer S [0.2% poly(vinylpyrrolidone), 0.2% bovine serum albumin, 0.2% ficoll 400, 2.times. SSC and 0.17% yeast RNA) overnight at 55.degree. C. The labeling of the probe was conducted by the use of a multi-prime labeling kit (Amersham). Washing was carried out with 2.times. SSC, 0.1% SDS at 50.degree. C. for 1 hour, and then, hybridized clones were detected by autoradiography at -80.degree. C. As a result, .lambda.RPACAPR18 was obtained.
Further, the rat brain-derived 5'-extended cDNA library (Clontech) (1.7.times.10.sup.6 pfu) was screened, using the cDNA portion of .lambda.RPACAPR18 as a probe, to obtain .lambda.RPACAPR46, .lambda.RPACAPR5, .lambda.RPACAPR12, etc. At this time, a buffer was used which comprised 50% formamide (Bethesda Research Laboratories), 5.times. Denhardt's solution [0.02% bovine serum albumin (Sigma)], 0.02% poly(vinylpyrrolidone (Sigma), 0.02% ficoll (Sigma), 5.times. SSPE (0.15M sodium chloride, 0.01M monosodium phosphate and 1 mM EDTA), 0.1% SDS and 100 .mu.g/ml of heat-denatured salmon sperm DNA (Sigma), and incubation was conducted overnight at 42.degree. C. together with the labeled probe to hybridize. Washing was carried out with 2.times. SSC, 0.1% SDS at 55.degree. C. for 1 hour, and then, hybridized clones were detected by autoradiography at -80.degree. C.
(4) Subcloning of cDNA Clones and DNA Sequence Analysis
An insert portion of the resulting cDNA clone was cut out by cleavage with EcoRI, and subcloned into plasmid vector pcDNAI or pUC118 to obtain pRPACAPR18 (pcDNAI), pRPACAPR46 (pcDNAI), pRPACAPR5 (pcDNAI) or pRPACAPR12 (pUC118). Further, pRPACAPR46 and pRPACAPR5 were recombined at the BamHI sites to prepare pRPACAPR46-5. The plasmid was further cleaved stepwise by exonuclease digestion, or self cyclized or subcloned after cleavage with an appropriate restriction enzyme (NcoI, PstI or BamHI) to prepare a template DNA for sequence analysis. For sequence determination, a fluorescent DNA sequencer (Applied Biosystems) was used, and for data analysis, a DNASIS (Hitachi Software Engineering) was used. Results of analysis revealed that pRPACAPR46-5 has the nucleotide sequence of SEQ ID NO: 40, and that pRPACAPR12 has the nucleotide sequence of SEQ ID NO: 41.
Example 4
Screening of Human PACAP Receptor Protein cDNA and DNA Sequence Analysis
(1) Preparation of Probe
The nucleotide sequence represented by SEQ ID NO: 51 corresponding to a complementary strand of the N-terminal amino acid sequence having the amino acid sequence represented by SEQ ID NO: 50 of the bovine PACAP receptor protein obtained in Example 1 was synthesized with a DNA synthesizer (Model 391, PCR-MATE EP, Applied Biosystems).
(2) Screening
The human pituitary gland-derived cDNA library (.lambda.gt11, Clontech) (1.4.times.10.sup.6 pfu) was mixed with magnesium sulfate-treated E. coli Y1090, and incubated at 37.degree. C. for 30 minutes. Then, 0.6% agarose/LB was added thereto, followed by plating on a 1.5% agar/LB+50 .mu.g/ml ampicillin plate. A nitrocellulose filter was placed on the plate on which a plaque is produced, and the plaque was transferred onto the filter. After alkali treatment and neutralization treatment of this filter, the DNA was fixed by heating at 80.degree. C. for 3 hours. This filter was prehybridized in a hybridization buffer [7% SDS (Nakarai), 1% bovine serum albumin, 0.5M Na-PO .sub.4 (pH 7.2) and 1 mM EDTA (Dojin)], and then hybridized with the probe labeled in the same buffer overnight at 55.degree. C. For the labeling of the probe, terminal labeling was conducted using [.gamma.-.sup.32 P]ATP (Du Pont NEN) and T4 kinase (Takara). Washing was carried out twice with 2.times. SSC, 0.1% SDS at 55.degree. C. for 30 minutes, and then, hybridized clones were detected by autoradiography at -80.degree. C. As a result, .lambda.#14 was obtained.
(3) Subcloning of cDNA Clones and DNA Sequence Analysis
An insert portion of the resulting cDNA clone was cut out by cleavage with EcoRI, and subcloned into plasmid vector pUC118 to obtain pTS847-1. After further cleavage with an appropriate restriction enzyme (SacI, NcoI or HpaI), the plasmid was self cyclized to prepare a template DNA for sequence analysis. For sequence determination, a Bca Best Sequencing Kit (Takara) was used, and for data analysis, a DNASIS (Hitachi Software Engineering) was used. Results of analysis revealed that pTS847-1 has the nucleotide sequence of SEQ ID NO: 42. Among the nucleotide seqeunces, the nucleotide sequence coding for mature human PACAP receptor Type I-A is represented by SEQ ID NO:34. The deduced amino acid sequence of human PACAP receptor Type I-A is represented by SEQ ID NO:23.
(4) Preparation of a primer for PCR based on the nucleotide sequence of human PACAP receptor Type I-A
A region into which the insertion region of human PACAP receptor being deduced to enter was amplified by PCR. Primers of following SEQ ID NO:52 and SEQ ID NO:53 were prepared based on the nucleotide sequence of pTS847 coding for human PACAP receptor Type I-A obtained in Example 4(3).
Sequence:HPRF
5'CTGGGATATGAATGACAGCACAGC 3' (SEQ ID NO:52; a nucleotide sequence of 1132nd to 1155th of pTS847)
Sequence:HPRR
5'TCTGGGGAGAAGGCAAATACTGTG 3' (SEQ ID NO:53; a complementary nucleotide sequence of 1342nd to 1355th of pTS847)
(5) Application of PCR on human pituitary and amigdaloid nucleus
Two(2) ng of cDNA of human pituitary and amigdaloid nucleus (Quick-Clone cDNA, Clonetech) and each 0.5 .mu.M of primers obtained Example 4(4), each 10 mM of dNTP were mixed in a PCR reaction buffer, and Taq polymerase was added thereto. Denaturing was conducted at 94.degree. C. for 45 seconds, anealing was held at 60.degree. C. for 45 seconds and elongation reaction was held at 72.degree. C. for 2.5 minutes to obtain PCR product.
(6) Subcloning of PCR product and DNA sequence analysis
The resulting PCR product was inserted into Hinc II site of a plasmid pUC118 and was subjected to a subcloning. Of the clones subcloned, Southern blotting was conducted to screen subtypes. In order to screen a clone of human PACAP receptor Type I-B, the following probe of SEQ ID NO:54 was synthesized based on the sequence of the insertion region of rat PACAP receptor Type I-B.
5'TGCGTGCAGAAATGCTACTGCAAGCCACAG 3' (SEQ ID NO:54)
In order to screen a clone of human PACAP receptor Type I-C, the following probe of SEQ ID NO:54 was synthesized based on the sequence of the insertion region which is different from Type I-B which was reported in rat (Nature, 365, p170-175, 1993).
5'GACCCCCTGCCTGTGCCCTCAGACCAGCAT 3' (SEQ ID NO:55)
Clones of pHPR15A and pHPR55A were obtained from the Southern blot of SEQ ID NO:54 and a clone of pHRP66P was obtained from the Southern blot of SEQ ID NO:55. (FIG. 15). Dideoxy method using RI labelled dCTP was employed for the determination of the nucleotide sequences of these clones. DNASIS (Hitachi Soft Engineering Co. Ltd.) was used for analysis of the data. The nucleotide sequences of cDNA coding for human PACAP receptor Type I-B, Type I-B2 and Type I-C and the amino acid sequences deduced therefrom are shown in FIGS. 16, 17 and 18, respectively. The nucleotide sequences of cDNA coding for human PACAP receptor Type I-B, Type I-B2 and Type I-C are represented by SEQ ID NO:35, SEQ ID NO:36 and SEQ ID NO:37, respectively. The amino acid sequences deduced therefrom are represented by SEQ ID NO:25, SEQ ID NO:27 and SEQ ID NO:29, respectively.
Example 5
Expression of Bovine PACAP Receptor Protein cDNAs
(1) Preparation of Transformants Containing Bovine PACAP Receptor Protein cDNAs
cDNA clone pBPR35 of the bovine PACAP receptor protein obtained in Example 2 was digested with SmaI and BamHI, thereby cutting out a fragment (about 800 bp) from the plasmid. Then, a HindIII linker was added to the SmaI-digested terminus of this fragment. The resulting fragment was named "fragment A". On the other hand, two kinds of fragments were obtained by digesting pBPR68 with BamHI and SmaI. One of them, a fragment of about 1 kbp (named "fragment B"), was cut out. These fragment A and fragment B were ligated with each other at the respective BamHI-digested sites to prepare recombinant cDNA (pBPR-T). pBPR-T was inserted in the HindIII and EcoRV sites downstream of a CMV promoter of expression vector pRc/CMV to prepare an expression vector. This expression vector was introduced into a CHO cell by the calcium phosphate method using a CellPhect transfection kit (Pharmacia) to obtain a transformant. The transformant cells were selected with 500 .mu.g/ml G-418 (trade mark: Geneticin, Lifetech Oriental).
(2) Preparation of Membrane Fraction of the Transformants
The transformants (CHO cells) cultivated for 3 days after subculture were separated using 0.2 mM EDTA/phosphate buffer, and suspended in 10 mM sodium carbonate buffer supplemented with 1 mM EDTA, 0.5 mM phenylmethylsulfonyl fluoride (PMSA), 20 .mu.g/ml leupeptin, 4 .mu.g/ml E-64 and 1 .mu.g/ml pepstatin. The suspended cells were disrupted with a Polytron homogenizer (Kinematica). The disrupted product was centrifuged with a high speed cooling centrifuge (CR26H, Roter RR18, Hitachi, Ltd.) at 3,000 rpm for 10 minutes to obtain a supernatant. The resulting supernatant was further ultracentrifuged with an ultracentrifuge (SCP70H, Roter RPZ35T, Hitachi, Ltd.) at 30,000 rpm for 60 minutes to obtain pellets. The resulting pellets were suspended in a buffer [20 mM Tris-HCl (pH 7.4), 0.25M sucrose, 2 mM EDTA, 0.5 mM PMSF, 20 .mu.g/ml leupeptin and 1 .mu.g/ml pepstatin] to prepare a membrane fraction suspension.
(3) Saturation Binding Experiment of Bovine PACAP Receptor Protein cDNA-Expressed CHO Cells
The membrane fraction of the transformants obtained in (2) described above was reacted with 100 pM [.sup.125 I]-PACAP27 in a buffer [20 mM Tris-HCl (pH 7.4), 5 mM magnesium acetate, 2 mM EGTA, 0.5 mM PMSF, 20 .mu.g/ml leupeptin, 4 .mu.g/ml E-64 and 1 .mu.g/ml pepstatin] at 25.degree. C. for 75 minutes. Bound ligands were separated from free ligands through a glass fiber filter. The non-specific binding was examined in the presence of 1 .mu.M PACAP27 (FIG. 33). The binding was examined with a a .gamma.-ray counter. The dissociation constant and the maximum binding were examined by Scatchard plot analysis (FIG. 34).
(4) Competitive Binding Experiment of Bovine PACAP Receptor Protein cDNA-Expressed CHO Cells
Under the conditions of the binding experiment of (3) described above, PACAP27, PACAP38 and VIP were added to examine competition with [.sup.125 I]-PACAP27. Bovine PACAP receptor protein on the membrane fraction showed a high reactivity, but low in reactivity with VIP (FIG. 35).
(5) Assay of Intracellular Cyclic AMP Production of Bovine PACAP Receptor Protein cDNA-Expressed CHO Cells
Three days after the transformants (CHO cells) were plated on a 24-well plate, the cells were washed with Hank's buffer (composition: 8 g/l NaCl, 0.4 g/l KCl, 0.06 g/l Na.sub.2 HPO.sub.4, 1.0 g/l glucose, 0.2 g/l MgSO.sub.4, 0.14 g/l CaCl.sub.2 and 0.35 g/l NaHCO.sub.3) supplemented with 0.05% BSA, and treated in the presence of 0.2 mM 3-isobutyl-1-methylxanthine at 37.degree. C. for 1 hour. PACAP27, PACAP38 and VIP of various concentrations were added thereto, followed by cultivation at 37.degree. C. for 30 minutes. After the cells were washed with the above-mentioned Hank's buffer supplemented with 0.05% BSA, intracellular cyclic AMP was extracted by the use of 500 .mu.l of Hank's buffer and 100 .mu.l of 20% perchloric acid, and neutralized with 1.5M KOH. The amount of cyclic AMP was assayed with a cAMP oxygen mmunoassay system (BIOTRAK Amersham). The concentration f intracellular cyclic AMP increased depending on the oncentrations of PACAP27 and PACAP38 (FIG. 36).
(6) Assay of Intracellular Inositol Phosphate of Bovine PACAP Receptor Protein cDNA-Expressed CHO Cells
The pathway of signal transmission of inositol phosphate well known as the pathway of signal transmission together with cyclic AMP was examined. Three days after the transformants (CHO cells) were plated on a 24-well plate, 5 .mu.Ci myo-[.sup.3 H] inositol (19.1 Ci/mmole, Amersham) was added to the cell culture solution, followed by cultivation overnight at 37.degree. C. The cells were washed with an assay buffer (20 mM HEPES, 140 mM NaCl, 4 mM KCl, 1 mM Na.sub.2 HPO.sub.4, 1 mM MgCl.sub.2, 1.25 mM CaCl.sub.2, 10 mM LiCl, 10 mM glucose and 0.1% BSA). Then, PACAP27, PACAP38 and VIP of various concentrations were added to 500 .mu.l of the assay buffer, and the mixtures were added to plates, followed by reaction with the cells at 37.degree. C. for 20 minutes. One hundred microliters of 20% perchloric acid was added thereto to stop the reaction, and intracellular inositol phosphate was extracted. The extract was neutralized with 1.5M KOH. All inositol phosphate was separated from free inositol by the use of ion exchange chromatography (AGI-X8, Bio RAD). Thereafter, inositol phosphate was eluted with 1M ammonium formate/0.1M formic acid, and the amount of inositol phosphate was measured with a scintillation counter. The concentration of inositol phosphate increased depending on the concentrations of PACAP27 and PACAP38 (FIG. 37).
Example 6
Confirmation of Expression Site of Rat PACAP Receptor mRNA
(1) Preparation of Poly(A).sup.+ RNA
Total RNAs were prepared from the brains, lungs, livers, kidneys and testes of 8-week-old Sprague Dawley rats (males, Nippon Charles River) by the guanidine isothiocyanate method [Biochemistry, 18, 5294 (1979) and Method in Enzymology, 154 3 (1987)] and poly(A).sup.+ RNA prepared from the brains, lungs, livers, kidneys and testes was fractionated by formalin-modified agarose gel electrophoresis [Proc. Natl. Acad. Sci. U.S.A., 77, 5794 (1980)] contained 2.2M formalin (Wako Pure Chemical Industries), followed by transfer to a nylon membrane filter (Pole).
(2) Preparation of Probe
374-bp fragment haveing the nucleotide sequence from the 76th to 450th of DNA (rat PACAP receptor cDNA pRPACAPR12) represented by the nucleotide sequence of SEQ ID NO:41 was labeled with .sup.32 P by the use of a multi-prime labeling kit (Amersham) to prepare a probe.
(3) Northern Hybridization
The filter of (1) described above was treated at 80.degree. C. for 2 hours to fix RNA, followed by hybridization in a hybridization buffer [50% formamide deionized, 5.times. SSPE, 5.times. Denhardt's solution, 0.5% SDS, and 100 .mu.g/ml heterologous salmon sperm DNA heat denatured after ultrasonication (Wako Pure Chemical Industries)] overnight at 42.degree. C. Subsequently, the probe obtained in (2) described above was heat denatured, and the heat-denatured probe was added thereto, followed by hybridization overnight at 42.degree. C. Washing was conducted 5 times with 2.times. SSC, 0.1% SDS at 55.degree. C. for 30 minutes, and further twice 0.1.times. SSC, 0.1% SDS at 50.degree. C. for 20 minutes. Autoradiography was carried out for 12 hours using an image analyzer (Fuji BAS-2000) to detect desired bands. Results thereof revealed that PACAP receptor mRNA was most expressed in the brains, that expression thereof was also observed in the lungs and the livers, and that the size of mRNA was about 6.5 kb (FIG. 38).
Example 7
Expression of Rat PACAP Receptor Protein cDNA
(1) Construction of Expression Vector for Animal Cells of Rat PACAP Receptor Protein cDNA
Using plasmids pRPACAPR46-5 and pRPACAPR12 obtained in Example 3, an NcoI fragment having an N-terminal translation initiation codon was prepared. After repair of both ends of this fragment with Klenow fragments (Takara), HindIII linkers (Takara) were added thereto, and further cleaved with BamHI. Of the resulting fragments, a fragment containing the translation initiation codon was recovered by electrophoresis, and ligated with cDNA I obtained by cleaving BamHI-ApoI fragments of pRPACAPR46-5 and pRPACAPR12 with HindIII and EcoRI, respectively, to construct an expression vector in which NcoI-ApoI portions of the respective cDNA fragments were inserted. These plasmids were further cleaved double by the use of HindIII and XbaI, and DNA fragments containing cDNA portions were incorporated into other animal cell expression vectors, pRc/CMV, utilizing the same sites, to obtain expression vectors pRPR3-A (derived from pRPACAPR46-5) and pRPR4-B (derived from pRPACAPR12).
(2) Introduction of Expression Vector into CHO Cells
9.0.times.10.sup.5 CHO cells were subcultured to each tissue culture flask having a bottom area of 25 cm.sup.2 (Corning), and cultivated for 24 hours in a culture solution (culture solution A) composed of Ham's F12 medium (Flow), 10% fetal bovine serum, and penicillin and streptomycin as antibiotics. Expression vectors pRPR3-A (derived from pRPACAPR46-5) and pRPR4-B (derived from pRPACAPR12) obtained in (1) described above were introduced into CHO cells each in an amount of 10 .mu.g with a gene introduction kit (CellPhect, Pharmacia) by the calcium phosphate method according to the formulation of the kit. After 24 hours, the culture solution was exchanged. After further 24 hours, the solution was exchanged by culture solution A supplemented with 500 .mu.g/ml of G418, and cDNA-introduced cells were selected, based on resistance to G418.
(3) Binding Experiment of PACAP Receptor Protein and [.sup.125 I]-PACAP27 on CHO Cell Membrane
CHO cells exhibiting resistance to G418 were recovered by trypsin digestion, and subcultured to a 12-well plate for tissue culture. The cells were incubated until they covered the bottom surface of the tissue culture plates completely. Untreated CHO cells and rat VIP receptor cDNA-introduced CHO cells were also similarly cultivated. The cells were washed twice with a buffer for the binding experiment [Hank's solution (pH 7.4) containing 5 mM HEPES, 5% CHAPS and 0.1% BSA]. Then, the buffer and [.sup.125 I]-PACAP27 were successively added so as to give a final [.sup.125 I]-PACAP27 concentration of 100 pM. The amount of the reaction solution per well was 500 .mu.l. and the radioactivity was about 11.4.times.10.sup.4 cpm. For analysis of specificity, samples containing unlabeled PACAP27 of a final concentration of 1 .mu.m and VIP, in addition to the samples containing only the labeled products, were prepared. After incubation at 37.degree. C. for 1 hour, the cells washed three times with the buffer for the binding experiment were dissolved with 1 ml of 0.5N NaOH and 0.1% SDS for each well, and the radioactivity contained therein was measured with a .gamma.-counter. Results of measurements are shown in FIG. 39. Columns 1 to 12 in FIG. 39 indicate the radioactivity in CHO cells under the following conditions:
Column 1: untreated CHO cells+[.sup.125 I]-PACAP27
Column 2: untreated CHO cells+[.sup.125 I]-PACAP27+cold PACAP27
Column 3: untreated CHO cells+[.sup.125 I]-PACAP27+cold VIP
Column 4: pRPR3-A-introduced CHO cells+[.sup.125 I]-PACAP27
Column 5: pRPR3-A-introduced CHO cells+[.sup.125 I]-PACAP27+cold PACAP27
Column 6: pRPR3-A-introduced CHO cells+[.sup.125 I]-PACAP27+cold VIP
Column 7: pRPR4-B-introduced CHO cells+[.sup.125 I]-PACAP27
Column 8: pRPR4-B-introduced CHO cells+[.sup.125 I]-PACAP27+cold PACAP27
Column 9: pRPR4-B-introduced CHO cells+[.sup.125 I]-PACAP27+cold VIP
Column 10: rat VIP receptor cDNA-introduced CHO cells+[.sup.125 I]-PACAP27
Column 11: rat VIP receptor cDNA-introduced CHO cells+[.sup.125 I]-PACAP27+cold PACAP27
Column 12: rat VIP receptor cDNA-introduced CHO cells+[.sup.125 I]-PACAP27+cold VIP
FIG. 39 indicates that the radioactivities in the pRPR3-A-introduced CHO cells and the pRPR4-B-introduced CHO cells (column 4 and column 7, respectively) are higher than that in the untreated CHO cells (column 1). This fact proved that each of the pRPR3-A-introduced CHO cells and the pRPR4-B-introduced CHO cells produced PACAP receptors.
(4) Analysis of Specificity of Rat PACAP Receptor on CHO Cell Membrane Using [.sup.125 I]-PACAP27
The pRPR3-A-introduced and pRPR4-B-introduced CHO cells obtained in (2) described above were each disrupted in sodium carbonate buffer containing 1 mM EDTA, 0.5 mM PMSF, 20 .mu.g/ml leupeptin, 4 .mu.g/ml E-64 and 1 .mu.g/ml pepstatin with a Polytron homogenizer (Kinematica) to prepare membrane fractions. Using the membrane fractions, complex binding experiments were conducted. For each of the membrane fractions of the pRPR3-A-introduced CHO cells and the pRPR4-B-introduced CHO cells, each of 10 .mu.g and 15 .mu.g (converted to a protein amount) thereof was ligated with 10 100 pM of [.sup.125 I]-PACAP27 in a buffer containing 20 mM Tris (pH 7.4), 1 mM EDTA, 0.05% CHAPS, 0.1% BSA and various protease inhibitors. For the competitive experiments, PACAP27 and VIP having each concentration were added. The reaction was conducted at 25.degree. C. for 1 hour, and bound ligands were separated from free ligands by filtration through a filter. As to non-specific binding, a value in the case that 1 .mu.M unlabeled PACAP27 was added and used as a standard. The amount of bound ligands was measured with a .gamma.-counter. After elimination of the non-specific binding, it was examined whether or not concentration-dependent competition took place. Results thereof revealed that concentration-dependent competition took place. For VIP similar to PACAP27 in structure, competition was observed only at a concentration much higher than that of PACAP27, which showed that the PACAP receptor protein which was allowed to express was PACAP-specific (FIG. 40).
(5) Screening of Clones Highly Producing Rat PACAP Receptor Protein by Binding Experiment with [.sup.125 I]-PACAP27
The rat PACAP receptor protein cDNA-introduced CHO cells obtained in (2) described above were each subcultured to 10-cm diameter dishes at a low density. After cultivated until formation of colonies, each of the colonies was dispersed and recovered by suction. Cells derived from the respective colonies were separately subcultured in 6-well plates for tissue culture, followed by binding experiments using parts thereof in a manner similar to that of (4) described above (FIG. 41). Clones having relatively more bound [.sup.125 I]-PACAP27 when compared among wells were selected, and the reproducibility was further confirmed. As a result, clones A12 and B17 reproducibly binding to [.sup.125 I]-PACAP27 much more were selected from the pRPR3-A-introduced pRPR4-B-introduced CHO cells (FIG. 42).
(6) Assay of Intracellular Cyclic AMP of Rat PACAP Receptor Protein cDNA-Introduced CHO Cells
From the binding experiment with [.sup.125 I]-PACAP27 of (3) described above, using CHO strains A12 and B17 highly producing rat PACAP receptor protein, the production promotion of intracellular cyclic AMP with PACAPs was detected in the following manner. Each 48-well plate for tissue culture was inoculated with each of the cell strains at a density of 1.0.times.10.sup.5 cells/well, followed by cultivation for 3 days. The plate was washed twice with Ham's F12 medium supplemented with 0.1% BSA and 0.5 mM IBMX, and 500 .mu.l/well of the same medium was added thereto. PACAP27, PACAP38 or VIP having each concentration was added thereto in a 1/100 amount, followed by standing at 37.degree. C. for 40 minutes. The supernatant was removed, and extraction was conducted with 100% cold ethanol. The extract was evaporated to dryness with a centrifugal freeze dryer, and redissolved in the buffer attached to an EIA kit for assaying cyclic AMP (Amersham). Then, the amount of cyclic AMP was assayed according to the formulation of the kit. Results thereof revealed that both A12 and B17 promoted the production of intracellular cyclic AMP, depending on the concentrations, for PACAP27 and PACAP38, but a concentration much higher than that of the PACAPs was required to promote the production of intracellular cyclic AMP, for VIP (FIG. 43).
(7) Construction of Rat PACAP Receptor Protein cDNA Expression System Using Baculovirus
Animal cell expression vectors pRPR3-A and pRPR4-B were each cleaved with HindIII, and the termini were repaired with Klenow fragments (Takara), followed by addition of BglII linkers. The resulting fragments were further cleaved with XbaI, and the termini were repaired with Klenow fragments, followed by addition of HindIII linkers. These DNAs were each digested double by the use of HindIII and BglII, thereby obtaining DNA fragments corresponding to translation regions. pBlneBacIII, a baculovirus transfer vector, was similarly digested double with HindIII and BglII, and subjected to ligation reaction with the above-mentioned DNA fragments. According to the formulation of a kit (Maxbac baculovirus expression system, Invitrogen) with which plasmid DNA confirmed in insertion was prepared, the resulting fragments, together with baculovirus genome DNA, were introduced into Sf9 cells. After cultivation at 27.degree. C. for 2 days, virus particles appeared in the supernatant were recovered. Recombinant viruses were selected therefrom by the plaque assay in accordance with the formulation of the kit.
(8) Expression Using Rat PACAP Receptor Protein cDNA-Introduced Baculovirus
The recombinant plaques formed by the plaque assay were extracted with a micropipette, and dispersed in 1 ml of complete medium for Sf9 [Grace medium for insects (Gibco) containing necessary additives, inactivated calf serum and gentamicin]. A 25-cm.sup.2 flask for tissue culture was inoculated with 2.times.10.sup.6 Sf9 cells, together with 5 ml of the medium, and the cells were adhered to a bottom of the flask, followed by addition of 500 .mu.l of the above-mentioned virus solution. After cultivation at 27.degree. C. for 5 days, the cells were recovered by pipetting. The cells were pelletized by centrifugation, and suspended in a small amount of medium. Then, a 1/10 amount of the suspension was poured into each Eppendorf tube. After further centrifugation, the supernatant was replaced by the same buffer as with the binding experiment in animal cells (composition: Hank's solution (pH 7.4) containing 5 mM HEPES, 5% CHAPS and 0.1% BSA]. Then, [.sup.125 I]-PACAP27 was added so as to give a final concentration of 100 pM, and unlabeled PACAP27 of a final concentration of 1 .mu.M was added to a sample for analysis of specificity to make up a total solution amount of 500 .mu.l. After standing at room temperature for 1 hour and binding, bound ligands, together with the cells, were pelletized by centrifugation. The pellets were further resuspended in the same buffer and centrifuged. After this procedure was repeated three times to conduct sufficient washing, the amount of radioligands remaining in the pellets was measured with a .gamma.-counter. As a result, 4 virus clones showing a very high binding were obtained (FIG. 44).
Example 8
Expression of Human PACAP Receptor Protein cDNA
(1) Preparation of Transformant in Baculovirus System Using Human PACAP Receptor Protein cDNA
A fragment cut out by digestion with BamHI and PstI from animal cell expression vector pcDNAI/Amp in which human PACAP receptor protein was subcloned was inserted in the BamHI and PstI sites of transfer vector pBlueBacIII to prepare a recombinant transfer vector. Sf9 cells were transfected with this vector, together with baculovirus DNA (ACMAPV DNA), using the transfection module attached to the kit (MAXBAC, Inbitrogen). After transfection, the viruses appeared in the supernatant, so that the culture supernatant of the fourth day was used as a virus solution. Sf9 cells (2.times.10.sup.6 cells) seeded on a 6-cm.sup.2 dish were infected with this virus solution at room temperature for 30 minutes, and a medium containing 0.6% agarose was poured therein for fixing. Cell culture at a high humidity (a humidity of 100%) for 5 to 6 days resulted in development of virus plaques. Plaques caused by viruses in which human PACAP receptor protein was recombined could be judged by turning blue, and the viruses were recovered. The recombinants were purified by repetition of this plaque assay. Sf9 cells were infected with the purified recombinants, and cultivated for 48 to 72 hours, whereby PACAP receptor protein-expressed transformants could be obtained (FIG. 45).
(2) Construction of Cell Strain Expressing Human PACAP Receptor
An overall length fragment was cut out from human PACAP receptor cDNA-cloned pTS847-1 by digestion with EcoRI, and inserted in the EcoRI site of animal cell expression vector pRc/CMV so as to be arranged in a correct direction, thereby constructing pTS849. The resulting plasmids were introduced into CHO-K1 cells (ICN) by the calcium phosphate method, and plasmid-incorporated clones were selected with 500 .mu.g/ml G-418 (Geneticin).
(3) Scatchard Plot Analysis Using Membrane Fraction of Human PACAP Receptor Protein-Expressed CHO-K1 Cells and Competitive Inhibition Analysis
The human PACAP receptor-expressed CHO-K1 cells obtained in (2) described above were cultivated in ten 175-cm.sup.2 flasks containing a medium supplemented with 500 .mu.g/ml G-418 (trade mark: Geneticin, Lifetech Oriental). When the cells covered almost entire bottom surfaces of the flasks, the CHO-K1 cells were separated with PBS solution containing 1 mM EDTA. After washing with the same buffer, the CHO-K1 cells were suspended in 10 mM NaCO.sub.3 buffer containing 1 mM EDTA, 0.5 mM PMSF, 20 .mu.g/ml leupeptin, 20 .mu.g/ml E-64 and 1 .mu.g/ml pepstatin, and disrupted with a Polytron homogenizer (Kinematica). Then, the disrupted product was centrifuged with a high speed cooling centrifuge (CR26H, Roter RR18, Hitachi, Ltd.) at 3,000 rpm for 10 minutes. The resulting supernatant was further ultracentrifuged with an ultracentrifuge (SCP70H, Roter RP42, Hitachi, Ltd.) at 30,000 rpm for 60 minutes. The resulting pellets were suspended in a buffer containing 20 mM Tris-HCl (pH 7.4), 0.25M sucrose, 2 mM EDTA, 0.5 mM PMSF, 20 .mu.g/ml leupeptin and 1 .mu.g/ml pepstatin. The resulting suspension was used as a membrane fraction.
The preparation of [.sup.125 I]-PACAP27, the Scatchard plot analysis obtained from the saturation binding experiment, and the competitive inhibition experiment were carried out in accordance with the method described in Example 1 (3).
From results of Scatchard plot analysis, a single binding site existed in the membrane fraction of the human PACAP receptor protein-expressed CHO-K1 cells, and the dissociation constant (Kd) was 41.+-.6.9 pM (FIG. 46). Further, results of the competitive inhibition experiment proved that PACAP27 and PACAP38 competed with [.sup.125 I]-PACAP27. On the other hand, it was revealed that VIP was 1,000 times weaker than PACAP27 (FIG. 47).
(4) Assay of Intracellular Cyclic AMP of Human PACAP Receptor Protein-Expressed CHO-K1 Cells
The human PACAP receptor protein-expressed CHO-K1 cells obtained in (2) described above were cultivated in a 24-well plate containing a medium supplemented with 500 .mu.g/ml G-418 (trade mark: Geneticin, Lifetech Oriental) until the cells almost covered an entire surface of the plate. After washing twice with Hank's buffer containing the culture buffer, 10 mM HEPES and 0.05% BSA, the CHO-K1 cells were cultivated in the above-mentioned buffer supplemented with 0.2 mM 3-isobutyl-1-methylxanthine at 37.degree. C. for 60 minutes. Then, PACAP27, PACAP38 or VIP having each concentration was added thereto, followed by further cultivation at 37.degree. C. for 30 minutes. After absorption of the buffer, the cells were washed twice with the culture buffer. Then, cAMP was extracted from the cells with 20% perchloric acid. After transfer to a 1.5-ml Eppendorf tube, the extract was centrifuged with a Tomy microcentrifuge at 12,000 rpm for 5 minutes, and the supernatant was neutralized with 1.5N KOH/60 mM HEPES to prepare a cell eluted solution. The concentration of cyclic AMP was determined by the acetylation method of a cAMP assay system (Amersham). Under these determination conditions, when nothing was added, the amount of intracellular cAMP was 0.7 pmole/well. For PACAP27 and PACAP38, the concentration of intracellular cAMP increased depending on the concentrations. In particular, when 0.1 mM of PACAP38 was added, accumulation of cyclic AMP about 30 times the basal level (about 21 pmoles/well) was observed (FIG. 48). VIP little raised the concentration of intracellular cyclic AMP, compared with PACAP27 and PACAP38 (FIG. 48).
Example 9
Expression of Human PACAP Receptor mRNA
Poly(A).sup.+ RNA (Clontech) from each human tissue was subjected to 1.1% agarose gel-modified gel electrophoresis containing 2.2M formalin for fractionation, followed by transfer to a nylon membrane filter. Then, RNA transferred was fixed to the nylon membrane with UV. A probe of human PACAP receptor cDNA (SacI-BqlII fragment of pTS847-1, nucleotide No. 168-562) was prepared with a random prime labeling kit (Amersham) and [.alpha.-.sup.32 P]dCTP (Du Pont/NEN), and northern hybridization was carried out using this probe. As a result, human PACAP mRNA was most expressed in the brain, and the size thereof was about 7 kb. Expression was also observed in the lung, the liver, the pancreas and other organs, although weak (FIG. 49).
Example 10
Expression of PACAP mRNA in Rat Central Nerve System
All RNAs were prepared from the olfactory bulbs, amygdalae, cerebral basal ganglia, hippocampi, thalami, hypothalami, cerebral cortices, medulla oblongatas, cerebellums, spinal cords and pituitary glands of 8-week-old S. D. rats (.male.) by the guanidine isothiocyanate method, and poly(A).sup.+ RNA was further prepared by the use of an oligo(dT) spun-column (Pharmacia). Five micrograms of poly(A).sup.+ RNA prepared from the above regions of the central nervous system was fractionated by 1.2% formalin-modified agarose gel electrophoresis [Proc. Natl. Acad. Sci. U.S.A., 77, 5794 (1980)] contained 2.2M formalin (Wako Pure Chemical Industries), followed by transfer to a nylon membrane filter (Pole).
(2) Preparation of Probe
374-bp fragment having the nucleotide sequence from the 76th to 450th of DNA (rat PACAP receptor cDNA pRPACAPR12) represented by the nucleotide sequence of SEQ ID NO: 41 was labeled with .sup.32 P by the use of a multi-prime labeling kit (Amersham) to prepare a probe.
(3) Northern Hybridization
The filter of (1) described above was treated at 80.degree. C. for 2 hours to fix RNA, followed by hybridization in a hybridization buffer [50% formamide deionized, 5.times. SSPE, 5.times. Denhardt's solution, 0.5% SDS, and 100 .mu.g/ml heterologous salmon sperm DNA heat denatured after ultrasonication (Wako Pure Chemical Industries)] overnight at 42.degree. C. Subsequently, the probe obtained in (2) described above was heat denatured, and the heat-denatured probe was added thereto, followed by hybridization overnight at 42.degree. C. Washing was conducted 5 times with 2.times. SSC, 0.1% SDS at room temperature for 5 minutes, and further twice 0.1.times. SSC, 0.1% SDS at 50.degree. C. for 20 minutes. Autoradiography was carried out for 7 days using a X-OMAT AR film (Kodak) to detect desired bands.
Results thereof revealed that rat PACAP receptor mRNA was expressed in almost all regions of the central nerve system, and that there was little expression in the cerebellums and pituitary glands (FIG. 50). From these results, the PACAPs are deduced to play an important role in the central nerve system.
Example 11
Screening of Human PACAP Receptor Antagonist Which Uses Cell Membrane Fraction of Sf9 cell Expressing cDNA of Human PACAP Receptor Protein
(1) Preparation of Buffer for Assay
Composition of buffer
20 mM Tris-HCl, 2 mM EGTA, 5 mM (CH.sub.3 COO).sub.2 Mg.multidot.4H.sub.2 O, 0.5 mM PMSF, 1 .mu.g/ml pepstatin, 20 .mu.g/ml leupeptin, 4 .mu.g/ml E-64, 0.03% NaN.sub.3, 0.1% BSA, 0.05% CHAPS, pH7.2
Method for preparation
The agents other than peptidase inhibitor (PMSF, pepstatin, leupeptin, E-64) and BSA were dissolved into distilled water. While controlling pH of the aqueous solution with 6N HCl, peptidase inhibitor was added thereto. Pepstatin and PMSF were dissolved into DMSO and the DMSO solution was added to the distilled water solution with rapid agitation. Final concentration of DMSO was adjusted to 0.1%, thus pepstatin and PMSF were dissolved into 1 ml of DMSO to prepare 1 liter of buffer. Then the solution was mixed and BSA was added thereto.
(2) Sf9 cells which express human PACAP receptor protein obtained in Example 8 were disrupted by Polytron mixer in a buffer for homogenize (20 mM Tris-HCl, 2 mM EDTA, 0.5 mM PMSF, 1 .mu.g/ml pepstatin, 20 .mu.g/ml leupeptin, 4 .mu.g/ml E-64, pH7.4). The disrupted cell solution was centrifuged at 3,000 rpm for 5 minutes and the supernatant was centrifuged at 30,000 rpm for 60 minutes. The resulting precipitate was treated as a membrane fraction. The membrane fraction was diluted with the buffer for assay to 2 .mu.g protein/ml. The diluted solution was applied on a cell strainer (FALCON, 2350) and was divided into 100 .mu.l in each tube (FALCON, 2053) with dispenser.
(3) Each 1 .mu.l of 10 mM of the sample was added to the reaction tubes (final concentration: 100 .mu.M, room temperature). DMF was added thereto for assay of the maximum binding amount, and 1 .mu.l of DMF with 100 .mu.M PACAP27 was added for assay of nonspecific binding amount (final concentration: 1 .mu.M). The maximum binding amount was assayed twice respectively at the beginning and the end of the assay, and the nonspecific binding amount was assayed twice at the end of the assay.
(4) In radio isotope region, each 2 .mu.l of 5 nM [.sup.125 I]-PACAP27 (DuPont) was added in the reaction tubes (final concentration: 100 pM). [.sup.125 I]-PACAP27 was placed on ice.
(5) The reaction tubes were incubated at 25.degree. C. for 1 hour.
(6) 1.5 ml of a detergent buffer was added into the reaction tubes and the mixture was filtered on a glass fiber paper (Whatman, GF/F) using Sampling manifold (Millipore). 1.5 ml of a detergent buffer was further added to the reaction tubes and they were filtered. The glass fiber filtration paper (Whatman, GF/F) was previously immersed in a PEI (polyethyleneimine) solution (20 mM Tris-HCl, 0.3% PE1, pH7.4). The detergent buffer may be similar with the assay buffer but it is not necessary to contain peptidase inhibitor.
(7) [.sup.125 I] remaining on the glass fiber filtration paper was counted by .gamma.-counter. Based on the counts, inhibiting activity on a binding specificity [Percent Maximum Binding] of PACAP27 and a PACAP27 receptor of the samples were determined according to the following formula:
PMB=[(B-NSB)/B.sub.0 -NSB).times.100
PMB: percent Maximum Binding
B: value when the samples are added,
NSB: non-specific binding amount
B.sub.0 : Maximum Binding
As a result, substances No. 1 to 10 as shown in FIG. 51 were obtained as substances which inhibited a specific binding of PACAP27 and PACAP receptor. PMB of the compounds are shown in Table 3.
TABLE 3______________________________________Test compound No. Specific Binding %______________________________________1 572 113 374 155 26 -37 508 159 2010 34______________________________________
Example 12
Preparation of Anti-PACAP Receptor Antibody
(1) Preparation of a Partial Peptide of PACAP Receptor
The 5th Cys(C) of the amino acid sequence, MHSDCIFKKEQAMC, was substituted with Ala(A) for the convenience of a preparation of immunoantigen complexes to obtain a partial peptide, MHSDAIFKKEQAMC, with a conventional method using a autosynthesizer (430A, AppliedBiosystem). The first amino acid sequence corresponds to 1st to 14th amino acid sequence of SEQ ID NO:14, which is a common sequence to bovine, rat or human PACAP receptor represented by the amino acid sequence of anyone of SEQ ID NO:14 to SEQ ID NO:29.
(2) Preparation of Immunogen
A complex of the synthetic peptide (MHSDAIFKKEQAMC) obtained in the above (1) and bovine thyroglobulin (BTG) was made and used as an immunogen. Thus, 21 mg of BTG was dissolved into 1.4 ml of 100 mM phosphate buffer (pH 6.8) and the solution was mixed with 2.35 mg of GMBS in 100 .mu.l of DMF to react at room temperature for 40 minutes. The reactant was applied on Sephadex G-25 column.TM. (1.times.35 cm) equibilliated with 100 mM phosphate buffer and to obtain a fraction containing BTG. A half (1.5 ml) of the fraction was mixed with 2 mg of the synthesized peptide dissolved in 50% DMSO to react at 4.degree. C. for two days. The reactant was dialyzed against physiological saline at 4.degree. C. for two days and the dialyzate was divided into small amount and freezere-stored.
(3) Immunization
100 .mu.g of the immunogen obtained in the above (2) was subcutanously given with a complete Freund's adjuvant to each female BALB/c mouse of 6 to 8 week old. Once or twice additional immunizations was conducted at three weeks intervals.
(4) Preparation of HRP-labelled partial peptide of receptor
HRP (Horse radish peroxidase)-labelled partial peptide necessary for assay for antibody value with EIA was prepared as follows:
Twenty(20) mg of HRP was dissolved into 1.5 ml of phosphate buffer (pH 6.5) and the solution was mixed with 1.4 mg of GMBS [N-(6-maleimidebutylyloxy)succinimide] in 100 .mu.l of DMF to react at room temperature for 40 minutes. The reactant was applied on Sephadex G-25 column.TM. (1.times.35 cm) equibilliated with 100 mM phosphate buffer and to obtain a fraction containing BTG. A half (1.5 ml) of the fraction was mixed with 2 mg of the synthesized peptide dissolved in 50% DMSO to react at 4.degree. C. for two days. The reactant was applied on Ultrogel AcA44 column.TM. (1.times.35 cm) equibilliated with 100 mM phosphate buffer and to obtain a fraction containing HRP-labelled partial peptide. BSA(final concentration: 0.1%) and thimerosal (final concentration: 0.05%) were added to the fraction to be restored at 4.degree. C.
(5) Assay of Antibody Titer
Antibody titer of antiserum of the mice immunized in the above (3) was assayed as follows:
100 .mu.l of 100 .mu.g/ml anti-mouse immunoglobulin antibody (IgG fraction, Cuppel) dissolved in 100 mM carbonate buffer (pH 9.6) was added to a 96-well plate and kept at 4.degree. C. for 24 hours to make an anti-mouse immunoglobulin bound microplate. After the plate was washed with phosphate bufferized physiological saline (PBS, pH 7.4), 300 .mu.l of Blockace (Yukizirushi, Japan) diluted to 25% with PBS was added to the plate to react at 4.degree. C. for at least 24 hours in order to block the remaining binding sites of the plate.
50 .mu.l of Buffer A (0.1% BSA, 0.1M NaCl, 1 mM MgCl.sub.2, 0.05% CHAPS and 0.1% NaN.sub.3 in 20 mM phosphate buffer, pH 7.0) and 100 .mu.l of mouse anti-partial peptide of PACAP receptor-antiserum diluted with Buffer A were added to each of the well of the above anti-mouse immunoglobulin bound microplate and to react at 4.degree. C. for 16 hours. After the plate wase washed with PBS, 100 .mu.l of HRP-labelled peptide diluted to 300 times with Buffer B (0.1% BSA, 0.4M NaCl and 2 mM EDTA in 20 mM phosphate buffer, pH 7.0) was added to react at 4.degree. C. for 7 hours. Then, the plate was washed with PBS and 100 .mu.l of TMB microwell peroxidase substrate system (Kirkegaard & Perry Lab, Inc.) was added to each well to react them at room temperature for 10 minutes. 100 .mu.l of 1M phosphoric acid was added to each well to stop the reaction and their absorptions at 450 nm was assayed with a plate reader (MTP-120, Corona).
(6) Preparation of Anti-partial Peptide of PACAP Receptor Monoclonal Antibody
On mice which show relatively high antibody value, final immunization by intravenous injection of 200 to 300 .mu.g of immunogen in 0.25 to 0.3 ml of physiological saline was conducted. Spleens were enucleated from the mice after 3 to 4 days of the final immunization and pressed and filtered through a stainless mesh and the filtrate was suspended in Eagle's Minimum Essential Medium (MEM) to obtain a spleen cell suspension. Mieloma cell P3X 63.Ag8.U1(P3U1 cell) derived from BALB/c mouse was used as a cell for cell fusion [Current Topics in Microbiology and Immunology, 81, 1(1978)]. The cell fusion was conducted according to the original method. Spleen cells and P3U1 cells were respectively washed 3 times with MEM having no serum, and then they were mixed at 5:1 in the ratio of spleen cells to P3U1 cells followed by centrifugation at 700 rpm for 15 minutes to make the cells precipitate. After thoroughly removing the supernatant, the precipitate was softly mixed and 0.4 ml of 45% polyethyleneglicol (PEG) 6000 (Kochlight) was added thereto and the mixture was maintained in water bath at 37.degree. C. for 7 minutes for the hybridization. 15 ml of MEM was slowly added by 2 ml per minute thereto and the mixture was centrifuged at 750 rpm for 15 minutes to obtain the cell precipitate. The cells were suspended mildly into 200 ml of GIT medium containing 10% fetal calf serum (Wako Pure Chemical Industry, Japan) (GIT- 10% FCS) and a 24 well multidish(Limbro) was seeded with 1 ml of the suspension to each well and incubated in an incubator with 5% carbonic acid at 37.degree. C. After 24 hours of the incubation, 1 ml of GIT- 10% FCS containing HAT (O.lmM hypoxanthine, 0.4 .mu.M aminopterin, 1.6 mM thymidine) (HAT medium) was added to each well and HAT selective cultivation began. After 4 and 8 days from the beginning of the cultivation, 1 ml of the culture solution was changed with new HAT medium. Growth of hybridoma was found after 8 to 10 days from the cell fusion and the supernatant when the culture solution changed yellow was taken and assayed according to the method described in Example 5.
Typical screening of hybridoma derived from mice immunized with a partial peptide of PACAP receptoris shown in FIG. 52. There are a few colonies of hybridoma in the wells and 3 wells were chosen, cloning of an antibody producing strain with limiting dilution analysis was conducted to obtain three hybridomas which produce anti-partial peptide of PACAP receptor (PRN1-25, PRN1-109 and PRN1-159). As a feeder cell for the cloning, thymus cells of BALB/c mouse was employed. One(1) to three(3).times.10.sup.6 cells of these hybridomas were intraabdominally administered to BALB/c mice to which 0.5 ml of mineral oil was intrabdominally administered, and 10 to 15 days after the administration, ascites containing antibodies was collected.
Monoclonal antibodies were purified from the obtained ascites using a column to which Protein A was fixed. Thus, the ascites was diluted with equivalent binding buffer (3.5M NaCl, 0.05% NaN.sub.3 in 1.5M glycine, pH 9.0) and the dilution was applied on Recombinant Protein A-agarose (Repligen) equilibrized with the binding buffer, washed with the buffer and antibodies were eluted with an elution buffer (0.1M citrate buffer with 0.05% NaN.sub.3, pH 3.0). The purified monoclonal antibodies eluted were dialyzed against PBS containing 0.05% NaN.sub.3 at 4.degree. C. for two days and the dialysate was restored at 4.degree. C. The monoclonal antibodies obtained are shown in Table 4.
TABLE 4______________________________________Monoclonal antibodies Type______________________________________PRN1-25a IgG1PRN1-109a IgG1PRN1-159a IgG1______________________________________
(7) Detection of PACAP Receptor by Western Blotting with Anti-partial Peptide of PACAP Receptor Antibody
Human PACAP receptor was expressed in an insect cell using Baculo virus and a membrane fraction was prepared from the cell. Membrane protein was solubilized with digitonin from the membrane fraction and concentrated on DEAE-Toyopearl column. The concentrated membrane protein solution was isolated with SDS-polyacrylamide electrophoresis and transfered to PVDF membrane (Applied Biosystem). The PVDF membrane transfered with protein was immersed in 5% BSA solution at 37.degree. C. for 1 hour to saturate adsorption sites. The PVDF membrane was washed and immersed in 10 .mu.g/ml PRN1-159a antibody solution at room temperature for 1 hour. After washing, the membrane was immersed at room temperature for 2 hour in a solution with golden-colloid-labelled anti-mouse IgG and anti-mouse IgM antibodies (Amershum, Auroprobe BL plus GAM IgG+IgM). After washing, the membrane was treated with a sensitizer (Amershum, Intense BL silver enhancement Kit) and a band of PACAP receptor which was recognized with the antibodies was detected (FIG. 53).
(8) Inhibition of PACAP binding by monoclonal antibodies Membrane protein was solubilized with digitonin from the bovine brain membrane fraction and concentrated on DEAE-Toyopearl column. The concentrated membrane protein solution was diluted with assay buffer (20 mM Tris, 5 mM magnesium acetate, 2mM EGTA, 0.1% BSA, 0.05% digitonin, 0.03% NaN.sub.3, 0.5 mM PMSF, 20 .mu.g/ml leupeptin, 4 .mu.g/ml E-64, 1 .mu.g/ml pepstatin, pH 7.2) to 90 .mu.l and was added with 10 .mu.l of the purified monoclonal antibody solution. After mixing, the solution was kept at 4.degree. C. for 16 hours and 2 .mu.l of 5 nM radioactive iodine-labelled PACAP27 ([.sup.125 I]PACAP27) solution was added thereto to react at 25.degree. C. for 1 hour. After completion of incubation, 1.5 ml of assay buffer detergent (digitonin in assay buffer was substituted with CHAPS of equivalent concentration) was added to the reaction solution and then the solution was filtered on a glass-fiber filter paper which was previously treated with 0.3% polyethyleneimine. The filter paper was further washed with equivalent amount of assay buffer detergent and the captured radio-activity was counted and radio-active PACAP27 bound to the receptor was determined. As shown in FIG. 54, PRN1-159a inhibited binding of [.sup.125 I]PACAP27 to the receptor.
It should be understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled and purview of this Application and the scope of the appended claims.
__________________________________________________________________________# SEQUENCE LISTING- (1) GENERAL INFORMATION:- (iii) NUMBER OF SEQUENCES: 55- (2) INFORMATION FOR SEQ ID NO:1:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 16 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:- Met His Ser Asp Cys Ile Phe Lys Lys Glu Gl - #n Ala Met Cys Leu Glu# 15- (2) INFORMATION FOR SEQ ID NO:2:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 18 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:- Ser Ser Pro Gly Cys Pro Gly Met Trp Asp As - #n Ile Thr Cys Trp Lys# 15- Pro Ala- (2) INFORMATION FOR SEQ ID NO:3:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 11 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:- Val Gly Glu Met Val Leu Val Ser Cys Pro Gl - #u# 10- (2) INFORMATION FOR SEQ ID NO:4:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 16 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:- Phe Arg Ile Phe Asn Pro Asp Gln Val Trp Gl - #u Thr Glu Thr Ile Gly# 15- (2) INFORMATION FOR SEQ ID NO:5:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 21 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:- Arg Asn Cys Thr Glu Asp Gly Trp Ser Glu Pr - #o Phe Pro His Tyr Phe# 15- Asp Ala Cys Gly Phe 20- (2) INFORMATION FOR SEQ ID NO:6:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 21 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:- Asp Gln Asp Tyr Tyr Tyr Leu Ser Val Lys Al - #a Leu Tyr Thr Val Gly# 15- Tyr Ser Thr Ser Leu 20- (2) INFORMATION FOR SEQ ID NO:7:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 50 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:- Thr Leu Thr Thr Ala Met Val Ile Leu Cys Ar - #g Phe Arg Lys Leu His# 15- Cys Thr Arg Asn Phe Ile His Met Asn Leu Ph - #e Val Ser Phe Met Leu# 30- Arg Ala Ile Ser Val Phe Ile Lys Asp Trp Il - #e Leu Tyr Ala Glu Gln# 45- Asp Ser 50- (2) INFORMATION FOR SEQ ID NO:8:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 60 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:- Ser Thr Val Glu Cys Lys Ala Val Met Val Ph - #e Phe His Tyr Cys Val# 15- Val Ser Asn Tyr Phe Trp Leu Phe Ile Glu Gl - #y Leu Tyr Leu Phe Thr# 30- Leu Leu Val Glu Thr Phe Phe Pro Glu Arg Ar - #g Tyr Phe Tyr Trp Tyr# 45- Thr Ile Ile Gly Trp Gly Thr Pro Thr Val Cy - #s Val# 60- (2) INFORMATION FOR SEQ ID NO:9:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 26 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:- Thr Ala Leu Trp Trp Val Ile Lys Gly Pro Va - #l Val Gly Ser Ile Met# 15- Val Asn Phe Val Leu Phe Ile Gly Ile Ile# 25- (2) INFORMATION FOR SEQ ID NO:10:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 19 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:- Ile Leu Val Gln Lys Leu Gln Ser Pro Asp Me - #t Gly Gly Asn Glu Ser# 15- Ser Ile Tyr- (2) INFORMATION FOR SEQ ID NO:11:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 76 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:11:- Leu Arg Leu Ala Arg Ser Thr Leu Leu Leu Il - #e Pro Leu Phe Gly Ile# 15- His Tyr Thr Val Phe Ala Phe Ser Pro Glu As - #n Val Ser Lys Arg Glu# 30- Arg Leu Val Phe Glu Leu Gly Leu Gly Ser Ph - #e Gln Gly Phe Val Val# 45- Ala Val Leu Tyr Cys Phe Leu Asn Gly Glu Va - #l Gln Ala Glu Ile Lys# 60- Arg Lys Trp Arg Ser Trp Lys Val Asn Arg Ty - #r Phe#75- (2) INFORMATION FOR SEQ ID NO:12:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 33 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:12:- Asp Phe Lys His Arg His Pro Ser Leu Ala Se - #r Ser Gly Val Asn Gly# 15- Gly Thr Gln Leu Ser Ile Leu Ser Lys Ser Se - #r Ser Gln Ile Arg Met# 30- Ser- (2) INFORMATION FOR SEQ ID NO:13:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 29 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:13:- Met His Ser Asp Cys Ile Phe Lys Lys Glu Gl - #n Ala Met Cys Leu Glu# 15- Lys Ile Gln Arg Val Asn Asp Leu Met Gly Le - #u Asn Asp# 25- (2) INFORMATION FOR SEQ ID NO:14:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 476 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:14:- Met His Ser Asp Cys Ile Phe Lys Lys Glu Gl - #n Ala Met Cys Leu Glu# 15- Lys Ile Gln Arg Val Asn Asp Leu Met Gly Le - #u Asn Asp Ser Ser Pro# 30- Gly Cys Pro Gly Met Trp Asp Asn Ile Thr Cy - #s Trp Lys Pro Ala His# 45- Val Gly Glu Met Val Leu Val Ser Cys Pro Gl - #u Leu Phe Arg Ile Phe# 60- Asn Pro Asp Gln Val Trp Glu Thr Glu Thr Il - #e Gly Glu Phe Gly Phe#80- Ala Asp Ser Lys Ser Leu Asp Leu Ser Asp Me - #t Arg Val Val Ser Arg# 95- Asn Cys Thr Glu Asp Gly Trp Ser Glu Pro Ph - #e Pro His Tyr Phe Asp# 110- Ala Cys Gly Phe Glu Glu Tyr Glu Ser Glu Th - #r Gly Asp Gln Asp Tyr# 125- Tyr Tyr Leu Ser Val Lys Ala Leu Tyr Thr Va - #l Gly Tyr Ser Thr Ser# 140- Leu Val Thr Leu Thr Thr Ala Met Val Ile Le - #u Cys Arg Phe Arg Lys145 1 - #50 1 - #55 1 -#60- Leu His Cys Thr Arg Asn Phe Ile His Met As - #n Leu Phe Val Ser Phe# 175- Met Leu Arg Ala Ile Ser Val Phe Ile Lys As - #p Trp Ile Leu Tyr Ala# 190- Glu Gln Asp Ser Asn His Cys Phe Val Ser Th - #r Val Glu Cys Lys Ala# 205- Val Met Val Phe Phe His Tyr Cys Val Val Se - #r Asn Tyr Phe Trp Leu# 220- Phe Ile Glu Gly Leu Tyr Leu Phe Thr Leu Le - #u Val Glu Thr Phe Phe225 2 - #30 2 - #35 2 -#40- Pro Glu Arg Arg Tyr Phe Tyr Trp Tyr Ile Il - #e Ile Gly Trp Gly Thr# 255- Pro Thr Val Cys Val Ser Val Trp Ala Met Le - #u Arg Leu Tyr Phe Asp# 270- Asp Thr Gly Cys Trp Asp Met Asn Asp Asn Th - #r Ala Leu Trp Trp Val# 285- Ile Lys Gly Pro Val Val Gly Ser Ile Met Va - #l Asn Phe Val Leu Phe# 300- Ile Gly Ile Ile Val Ile Leu Val Gln Lys Le - #u Gln Ser Pro Asp Met305 3 - #10 3 - #15 3 -#20- Gly Gly Asn Glu Ser Ser Ile Tyr Phe Ser Cy - #s Val Gln Lys Cys Tyr# 335- Cys Lys Pro Gln Arg Ala Gln Gln His Ser Cy - #s Lys Met Ser Glu Leu# 350- Ser Thr Ile Thr Leu Arg Leu Ala Arg Ser Th - #r Leu Leu Leu Ile Pro# 365- Leu Phe Gly Ile His Tyr Thr Val Phe Ala Ph - #e Ser Pro Glu Asn Val# 380- Ser Lys Arg Glu Arg Leu Val Phe Glu Leu Gl - #y Leu Gly Ser Phe Gln385 3 - #90 3 - #95 4 -#00- Gly Phe Val Val Ala Val Leu Tyr Cys Phe Le - #u Asn Gly Glu Val Gln# 415- Ala Glu Ile Lys Arg Lys Trp Arg Ser Trp Ly - #s Val Asn Arg Tyr Phe# 430- Thr Met Asp Phe Lys His Arg His Pro Ser Le - #u Ala Ser Ser Gly Val# 445- Asn Gly Gly Thr Gln Leu Ser Ile Leu Ser Ly - #s Ser Ser Ser Gln Ile# 460- Arg Met Ser Gly Leu Pro Ala Asp Asn Leu Al - #a Thr465 4 - #70 4 - #75- (2) INFORMATION FOR SEQ ID NO:15:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 513 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:15:- Met Arg Gly Gly Arg His Trp Pro Glu Pro Pr - #o Cys Arg Leu Arg Ser# 15- Val Met Ala Ser Ile Ala Gln Val Ser Leu Al - #a Ala Leu Leu Leu Leu# 30- Pro Met Ala Thr Ala Met His Ser Asp Cys Il - #e Phe Lys Lys Glu Gln# 45- Ala Met Cys Leu Glu Lys Ile Gln Arg Val As - #n Asp Leu Met Gly Leu# 60- Asn Asp Ser Ser Pro Gly Cys Pro Gly Met Tr - #p Asp Asn Ile Thr Cys#80- Trp Lys Pro Ala His Val Gly Glu Met Val Le - #u Val Ser Cys Pro Glu# 95- Leu Phe Arg Ile Phe Asn Pro Asp Gln Val Tr - #p Glu Thr Glu Thr Ile# 110- Gly Glu Phe Gly Phe Ala Asp Ser Lys Ser Le - #u Asp Leu Ser Asp Met# 125- Arg Val Val Ser Arg Asn Cys Thr Glu Asp Gl - #y Trp Ser Glu Pro Phe# 140- Pro His Tyr Phe Asp Ala Cys Gly Phe Glu Gl - #u Tyr Glu Ser Glu Thr145 1 - #50 1 - #55 1 -#60- Gly Asp Gln Asp Tyr Tyr Tyr Leu Ser Val Ly - #s Ala Leu Tyr Thr Val# 175- Gly Tyr Ser Thr Ser Leu Val Thr Leu Thr Th - #r Ala Met Val Ile Leu# 190- Cys Arg Phe Arg Lys Leu His Cys Thr Arg As - #n Phe Ile His Met Asn# 205- Leu Phe Val Ser Phe Met Leu Arg Ala Ile Se - #r Val Phe Ile Lys Asp# 220- Trp Ile Leu Tyr Ala Glu Gln Asp Ser Asn Hi - #s Cys Phe Val Ser Thr225 2 - #30 2 - #35 2 -#40- Val Glu Cys Lys Ala Val Met Val Phe Phe Hi - #s Tyr Cys Val Val Ser# 255- Asn Tyr Phe Trp Leu Phe Ile Glu Gly Leu Ty - #r Leu Phe Thr Leu Leu# 270- Val Glu Thr Phe Phe Pro Glu Arg Arg Tyr Ph - #e Tyr Trp Tyr Ile Ile# 285- Ile Gly Trp Gly Thr Pro Thr Val Cys Val Se - #r Val Trp Ala Met Leu# 300- Arg Leu Tyr Phe Asp Asp Thr Gly Cys Trp As - #p Met Asn Asp Asn Thr305 3 - #10 3 - #15 3 -#20- Ala Leu Trp Trp Val Ile Lys Gly Pro Val Va - #l Gly Ser Ile Met Val# 335- Asn Phe Val Leu Phe Ile Gly Ile Ile Val Il - #e Leu Val Gln Lys Leu# 350- Gln Ser Pro Asp Met Gly Gly Asn Glu Ser Se - #r Ile Tyr Phe Ser Cys# 365- Val Gln Lys Cys Tyr Cys Lys Pro Gln Arg Al - #a Gln Gln His Ser Cys# 380- Lys Met Ser Glu Leu Ser Thr Ile Thr Leu Ar - #g Leu Ala Arg Ser Thr385 3 - #90 3 - #95 4 -#00- Leu Leu Leu Ile Pro Leu Phe Gly Ile His Ty - #r Thr Val Phe Ala Phe# 415- Ser Pro Glu Asn Val Ser Lys Arg Glu Arg Le - #u Val Phe Glu Leu Gly# 430- Leu Gly Ser Phe Gln Gly Phe Val Val Ala Va - #l Leu Tyr Cys Phe Leu# 445- Asn Gly Glu Val Gln Ala Glu Ile Lys Arg Ly - #s Trp Arg Ser Trp Lys# 460- Val Asn Arg Tyr Phe Thr Met Asp Phe Lys Hi - #s Arg His Pro Ser Leu465 4 - #70 4 - #75 4 -#80- Ala Ser Ser Gly Val Asn Gly Gly Thr Gln Le - #u Ser Ile Leu Ser Lys# 495- Ser Ser Ser Gln Ile Arg Met Ser Gly Leu Pr - #o Ala Asp Asn Leu Ala# 510- Thr- (2) INFORMATION FOR SEQ ID NO:16:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 448 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:16:- Met His Ser Asp Cys Ile Phe Lys Lys Glu Gl - #n Ala Met Cys Leu Glu# 15- Lys Ile Gln Arg Val Asn Asp Leu Met Gly Le - #u Asn Asp Ser Ser Pro# 30- Gly Cys Pro Gly Met Trp Asp Asn Ile Thr Cy - #s Trp Lys Pro Ala His# 45- Val Gly Glu Met Val Leu Val Ser Cys Pro Gl - #u Leu Phe Arg Ile Phe# 60- Asn Pro Asp Gln Val Trp Glu Thr Glu Thr Il - #e Gly Glu Phe Gly Phe#80- Ala Asp Ser Lys Ser Leu Asp Leu Ser Asp Me - #t Arg Val Val Ser Arg# 95- Asn Cys Thr Glu Asp Gly Trp Ser Glu Pro Ph - #e Pro His Tyr Phe Asp# 110- Ala Cys Gly Phe Glu Glu Tyr Glu Ser Glu Th - #r Gly Asp Gln Asp Tyr# 125- Tyr Tyr Leu Ser Val Lys Ala Leu Tyr Thr Va - #l Gly Tyr Ser Thr Ser# 140- Leu Val Thr Leu Thr Thr Ala Met Val Ile Le - #u Cys Arg Phe Arg Lys145 1 - #50 1 - #55 1 -#60- Leu His Cys Thr Arg Asn Phe Ile His Met As - #n Leu Phe Val Ser Phe# 175- Met Leu Arg Ala Ile Ser Val Phe Ile Lys As - #p Trp Ile Leu Tyr Ala# 190- Glu Gln Asp Ser Asn His Cys Phe Val Ser Th - #r Val Glu Cys Lys Ala# 205- Val Met Val Phe Phe His Tyr Cys Val Val Se - #r Asn Tyr Phe Trp Leu# 220- Phe Ile Glu Gly Leu Tyr Leu Phe Thr Leu Le - #u Val Glu Thr Phe Phe225 2 - #30 2 - #35 2 -#40- Pro Glu Arg Arg Tyr Phe Tyr Trp Tyr Ile Il - #e Ile Gly Trp Gly Thr# 255- Pro Thr Val Cys Val Ser Val Trp Ala Met Le - #u Arg Leu Tyr Phe Asp# 270- Asp Thr Gly Cys Trp Asp Met Asn Asp Asn Th - #r Ala Leu Trp Trp Val# 285- Ile Lys Gly Pro Val Val Gly Ser Ile Met Va - #l Asn Phe Val Leu Phe# 300- Ile Gly Ile Ile Val Ile Leu Val Gln Lys Le - #u Gln Ser Pro Asp Met305 3 - #10 3 - #15 3 -#20- Gly Gly Asn Glu Ser Ser Ile Tyr Leu Arg Le - #u Ala Arg Ser Thr Leu# 335- Leu Leu Ile Pro Leu Phe Gly Ile His Tyr Th - #r Val Phe Ala Phe Ser# 350- Pro Glu Asn Val Ser Lys Arg Glu Arg Leu Va - #l Phe Glu Leu Gly Leu# 365- Gly Ser Phe Gln Gly Phe Val Val Ala Val Le - #u Tyr Cys Phe Leu Asn# 380- Gly Glu Val Gln Ala Glu Ile Lys Arg Lys Tr - #p Arg Ser Trp Lys Val385 3 - #90 3 - #95 4 -#00- Asn Arg Tyr Phe Thr Met Asp Phe Lys His Ar - #g His Pro Ser Leu Ala# 415- Ser Ser Gly Val Asn Gly Gly Thr Gln Leu Se - #r Ile Leu Ser Lys Ser# 430- Ser Ser Gln Ile Arg Met Ser Gly Leu Pro Al - #a Asp Asn Leu Ala Thr# 445- (2) INFORMATION FOR SEQ ID NO:17:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 485 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:17:- Met Arg Gly Gly Arg His Trp Pro Glu Pro Pr - #o Cys Arg Leu Arg Ser# 15- Val Met Ala Ser Ile Ala Gln Val Ser Leu Al - #a Ala Leu Leu Leu Leu# 30- Pro Met Ala Thr Ala Met His Ser Asp Cys Il - #e Phe Lys Lys Glu Gln# 45- Ala Met Cys Leu Glu Lys Ile Gln Arg Val As - #n Asp Leu Met Gly Leu# 60- Asn Asp Ser Ser Pro Gly Cys Pro Gly Met Tr - #p Asp Asn Ile Thr Cys#80- Trp Lys Pro Ala His Val Gly Glu Met Val Le - #u Val Ser Cys Pro Glu# 95- Leu Phe Arg Ile Phe Asn Pro Asp Gln Val Tr - #p Glu Thr Glu Thr Ile# 110- Gly Glu Phe Gly Phe Ala Asp Ser Lys Ser Le - #u Asp Leu Ser Asp Met# 125- Arg Val Val Ser Arg Asn Cys Thr Glu Asp Gl - #y Trp Ser Glu Pro Phe# 140- Pro His Tyr Phe Asp Ala Cys Gly Phe Glu Gl - #u Tyr Glu Ser Glu Thr145 1 - #50 1 - #55 1 -#60- Gly Asp Gln Asp Tyr Tyr Tyr Leu Ser Val Ly - #s Ala Leu Tyr Thr Val# 175- Gly Tyr Ser Thr Ser Leu Val Thr Leu Thr Th - #r Ala Met Val Ile Leu# 190- Cys Arg Phe Arg Lys Leu His Cys Thr Arg As - #n Phe Ile His Met Asn# 205- Leu Phe Val Ser Phe Met Leu Arg Ala Ile Se - #r Val Phe Ile Lys Asp# 220- Trp Ile Leu Tyr Ala Glu Gln Asp Ser Asn Hi - #s Cys Phe Val Ser Thr225 2 - #30 2 - #35 2 -#40- Val Glu Cys Lys Ala Val Met Val Phe Phe Hi - #s Tyr Cys Val Val Ser# 255- Asn Tyr Phe Trp Leu Phe Ile Glu Gly Leu Ty - #r Leu Phe Thr Leu Leu# 270- Val Glu Thr Phe Phe Pro Glu Arg Arg Tyr Ph - #e Tyr Trp Tyr Ile Ile# 285- Ile Gly Trp Gly Thr Pro Thr Val Cys Val Se - #r Val Trp Ala Met Leu# 300- Arg Leu Tyr Phe Asp Asp Thr Gly Cys Trp As - #p Met Asn Asp Asn Thr305 3 - #10 3 - #15 3 -#20- Ala Leu Trp Trp Val Ile Lys Gly Pro Val Va - #l Gly Ser Ile Met Val# 335- Asn Phe Val Leu Phe Ile Gly Ile Ile Val Il - #e Leu Val Gln Lys Leu# 350- Gln Ser Pro Asp Met Gly Gly Asn Glu Ser Se - #r Ile Tyr Leu Arg Leu# 365- Ala Arg Ser Thr Leu Leu Leu Ile Pro Leu Ph - #e Gly Ile His Tyr Thr# 380- Val Phe Ala Phe Ser Pro Glu Asn Val Ser Ly - #s Arg Glu Arg Leu Val385 3 - #90 3 - #95 4 -#00- Phe Glu Leu Gly Leu Gly Ser Phe Gln Gly Ph - #e Val Val Ala Val Leu# 415- Tyr Cys Phe Leu Asn Gly Glu Val Gln Ala Gl - #u Ile Lys Arg Lys Trp# 430- Arg Ser Trp Lys Val Asn Arg Tyr Phe Thr Me - #t Asp Phe Lys His Arg# 445- His Pro Ser Leu Ala Ser Ser Gly Val Asn Gl - #y Gly Thr Gln Leu Ser# 460- Ile Leu Ser Lys Ser Ser Ser Gln Ile Arg Me - #t Ser Gly Leu Pro Ala465 4 - #70 4 - #75 4 -#80- Asp Asn Leu Ala Thr 485- (2) INFORMATION FOR SEQ ID NO:18:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 448 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:18:- Met His Ser Asp Cys Ile Phe Lys Lys Glu Gl - #n Ala Met Cys Leu Glu# 15- Arg Ile Gln Arg Ala Asn Asp Leu Met Gly Le - #u Asn Glu Ser Ser Pro# 30- Gly Cys Pro Gly Met Trp Asp Asn Ile Thr Cy - #s Trp Lys Pro Ala Gln# 45- Val Gly Glu Met Val Leu Val Ser Cys Pro Gl - #u Val Phe Arg Ile Phe# 60- Asn Pro Asp Gln Val Trp Met Thr Glu Thr Il - #e Gly Asp Ser Gly Phe#80- Ala Asp Ser Asn Ser Leu Glu Ile Thr Asp Me - #t Gly Val Val Gly Arg# 95- Asn Cys Thr Glu Asp Gly Trp Ser Glu Pro Ph - #e Pro His Tyr Phe Asp# 110- Ala Cys Gly Phe Asp Asp Tyr Glu Pro Glu Se - #r Gly Asp Gln Asp Tyr# 125- Tyr Tyr Leu Ser Val Lys Ala Leu Tyr Thr Va - #l Gly Tyr Ser Thr Ser# 140- Leu Ala Thr Leu Thr Thr Ala Met Val Ile Le - #u Cys Arg Phe Arg Lys145 1 - #50 1 - #55 1 -#60- Leu His Cys Thr Arg Asn Phe Ile His Met As - #n Leu Phe Val Ser Phe# 175- Met Leu Arg Ala Ile Ser Val Phe Ile Lys As - #p Trp Ile Leu Tyr Ala# 190- Glu Gln Asp Ser Ser His Cys Phe Val Ser Th - #r Val Glu Cys Lys Ala# 205- Val Met Val Phe Phe His Tyr Cys Val Val Se - #r Asn Tyr Phe Trp Leu# 220- Phe Ile Glu Gly Leu Tyr Leu Phe Thr Leu Le - #u Val Glu Thr Phe Phe225 2 - #30 2 - #35 2 -#40- Pro Glu Arg Arg Tyr Phe Tyr Trp Tyr Thr Il - #e Ile Gly Trp Gly Thr# 255- Pro Thr Val Cys Val Thr Val Trp Ala Val Le - #u Arg Leu Tyr Phe Asp# 270- Asp Ala Gly Cys Trp Asp Met Asn Asp Ser Th - #r Ala Leu Trp Trp Val# 285- Ile Lys Gly Pro Val Val Gly Ser Ile Met Va - #l Asn Phe Val Leu Phe# 300- Ile Gly Ile Ile Ile Ile Leu Val Gln Lys Le - #u Gln Ser Pro Asp Met305 3 - #10 3 - #15 3 -#20- Gly Gly Asn Glu Ser Ser Ile Tyr Leu Arg Le - #u Ala Arg Ser Thr Leu# 335- Leu Leu Ile Pro Leu Phe Gly Ile His Tyr Th - #r Val Phe Ala Phe Ser# 350- Pro Glu Asn Val Ser Lys Arg Glu Arg Leu Va - #l Phe Glu Leu Gly Leu# 365- Gly Ser Phe Gln Gly Phe Val Val Ala Val Le - #u Tyr Cys Phe Leu Asn# 380- Gly Glu Val Gln Ala Glu Ile Lys Arg Lys Tr - #p Arg Ser Trp Lys Val385 3 - #90 3 - #95 4 -#00- Asn Arg Tyr Phe Thr Met Asp Phe Lys His Ar - #g His Pro Ser Leu Ala# 415- Ser Ser Gly Val Asn Gly Gly Thr Gln Leu Se - #r Ile Leu Ser Lys Ser# 430- Ser Ser Gln Leu Arg Met Ser Ser Leu Pro Al - #a Asp Asn Leu Ala Thr# 445- (2) INFORMATION FOR SEQ ID NO:19:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 467 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:19:- Met Ala Arg Val Leu Gln Leu Ser Leu Thr Al - #a Leu Leu Leu Pro Val# 15- Ala Ile Ala Met His Ser Asp Cys Ile Phe Ly - #s Lys Glu Gln Ala Met# 30- Cys Leu Glu Arg Ile Gln Arg Ala Asn Asp Le - #u Met Gly Leu Asn Glu# 45- Ser Ser Pro Gly Cys Pro Gly Met Trp Asp As - #n Ile Thr Cys Trp Lys# 60- Pro Ala Gln Val Gly Glu Met Val Leu Val Se - #r Cys Pro Glu Val Phe#80- Arg Ile Phe Asn Pro Asp Gln Val Trp Met Th - #r Glu Thr Ile Gly Asp# 95- Ser Gly Phe Ala Asp Ser Asn Ser Leu Glu Il - #e Thr Asp Met Gly Val# 110- Val Gly Arg Asn Cys Thr Glu Asp Gly Trp Se - #r Glu Pro Phe Pro His# 125- Tyr Phe Asp Ala Cys Gly Phe Asp Asp Tyr Gl - #u Pro Glu Ser Gly Asp# 140- Gln Asp Tyr Tyr Tyr Leu Ser Val Lys Ala Le - #u Tyr Thr Val Gly Tyr145 1 - #50 1 - #55 1 -#60- Ser Thr Ser Leu Ala Thr Leu Thr Thr Ala Me - #t Val Ile Leu Cys Arg# 175- Phe Arg Lys Leu His Cys Thr Arg Asn Phe Il - #e His Met Asn Leu Phe# 190- Val Ser Phe Met Leu Arg Ala Ile Ser Val Ph - #e Ile Lys Asp Trp Ile# 205- Leu Tyr Ala Glu Gln Asp Ser Ser His Cys Ph - #e Val Ser Thr Val Glu# 220- Cys Lys Ala Val Met Val Phe Phe His Tyr Cy - #s Val Val Ser Asn Tyr225 2 - #30 2 - #35 2 -#40- Phe Trp Leu Phe Ile Glu Gly Leu Tyr Leu Ph - #e Thr Leu Leu Val Glu# 255- Thr Phe Phe Pro Glu Arg Arg Tyr Phe Tyr Tr - #p Tyr Thr Ile Ile Gly# 270- Trp Gly Thr Pro Thr Val Cys Val Thr Val Tr - #p Ala Val Leu Arg Leu# 285- Tyr Phe Asp Asp Ala Gly Cys Trp Asp Met As - #n Asp Ser Thr Ala Leu# 300- Trp Trp Val Ile Lys Gly Pro Val Val Gly Se - #r Ile Met Val Asn Phe305 3 - #10 3 - #15 3 -#20- Val Leu Phe Ile Gly Ile Ile Ile Ile Leu Va - #l Gln Lys Leu Gln Ser# 335- Pro Asp Met Gly Gly Asn Glu Ser Ser Ile Ty - #r Leu Arg Leu Ala Arg# 350- Ser Thr Leu Leu Leu Ile Pro Leu Phe Gly Il - #e His Tyr Thr Val Phe# 365- Ala Phe Ser Pro Glu Asn Val Ser Lys Arg Gl - #u Arg Leu Val Phe Glu# 380- Leu Gly Leu Gly Ser Phe Gln Gly Phe Val Va - #l Ala Val Leu Tyr Cys385 3 - #90 3 - #95 4 -#00- Phe Leu Asn Gly Glu Val Gln Ala Glu Ile Ly - #s Arg Lys Trp Arg Ser# 415- Trp Lys Val Asn Arg Tyr Phe Thr Met Asp Ph - #e Lys His Arg His Pro# 430- Ser Leu Ala Ser Ser Gly Val Asn Gly Gly Th - #r Gln Leu Ser Ile Leu# 445- Ser Lys Ser Ser Ser Gln Leu Arg Met Ser Se - #r Leu Pro Ala Asp Asn# 460- Leu Ala Thr465- (2) INFORMATION FOR SEQ ID NO:20:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 476 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:20:- Met His Ser Asp Cys Ile Phe Lys Lys Glu Gl - #n Ala Met Cys Leu Glu# 15- Arg Ile Gln Arg Ala Asn Asp Leu Met Gly Le - #u Asn Glu Ser Ser Pro# 30- Gly Cys Pro Gly Met Trp Asp Asn Ile Thr Cy - #s Trp Lys Pro Ala Gln# 45- Val Gly Glu Met Val Leu Val Ser Cys Pro Gl - #u Val Phe Arg Ile Phe# 60- Asn Pro Asp Gln Val Trp Met Thr Glu Thr Il - #e Gly Asp Ser Gly Phe#80- Ala Asp Ser Asn Ser Leu Glu Ile Thr Asp Me - #t Gly Val Val Gly Arg# 95- Asn Cys Thr Glu Asp Gly Trp Ser Glu Pro Ph - #e Pro His Tyr Phe Asp# 110- Ala Cys Gly Phe Asp Asp Tyr Glu Pro Glu Se - #r Gly Asp Gln Asp Tyr# 125- Tyr Tyr Leu Ser Val Lys Ala Leu Tyr Thr Va - #l Gly Tyr Ser Thr Ser# 140- Leu Ala Thr Leu Thr Thr Ala Met Val Ile Le - #u Cys Arg Phe Arg Lys145 1 - #50 1 - #55 1 -#60- Leu His Cys Thr Arg Asn Phe Ile His Met As - #n Leu Phe Val Ser Phe# 175- Met Leu Arg Ala Ile Ser Val Phe Ile Lys As - #p Trp Ile Leu Tyr Ala# 190- Glu Gln Asp Ser Ser His Cys Phe Val Ser Th - #r Val Glu Cys Lys Ala# 205- Val Met Val Phe Phe His Tyr Cys Val Val Se - #r Asn Tyr Phe Trp Leu# 220- Phe Ile Glu Gly Leu Tyr Leu Phe Thr Leu Le - #u Val Glu Thr Phe Phe225 2 - #30 2 - #35 2 -#40- Pro Glu Arg Arg Tyr Phe Tyr Trp Tyr Thr Il - #e Ile Gly Trp Gly Thr# 255- Pro Thr Val Cys Val Thr Val Trp Ala Val Le - #u Arg Leu Tyr Phe Asp# 270- Asp Ala Gly Cys Trp Asp Met Asn Asp Ser Th - #r Ala Leu Trp Trp Val# 285- Ile Lys Gly Pro Val Val Gly Ser Ile Met Va - #l Asn Phe Val Leu Phe# 300- Ile Gly Ile Ile Ile Ile Leu Val Gln Lys Le - #u Gln Ser Pro Asp Met305 3 - #10 3 - #15 3 -#20- Gly Gly Asn Glu Ser Ser Ile Tyr Phe Ser Cy - #s Val Gln Lys Cys Tyr# 335- Cys Lys Pro Gln Arg Ala Gln Gln His Ser Cy - #s Lys Met Ser Glu Leu# 350- Ser Thr Ile Thr Leu Arg Leu Ala Arg Ser Th - #r Leu Leu Leu Ile Pro# 365- Leu Phe Gly Ile His Tyr Thr Val Phe Ala Ph - #e Ser Pro Glu Asn Val# 380- Ser Lys Arg Glu Arg Leu Val Phe Glu Leu Gl - #y Leu Gly Ser Phe Gln385 3 - #90 3 - #95 4 -#00- Gly Phe Val Val Ala Val Leu Tyr Cys Phe Le - #u Asn Gly Glu Val Gln# 415- Ala Glu Ile Lys Arg Lys Trp Arg Ser Trp Ly - #s Val Asn Arg Tyr Phe# 430- Thr Met Asp Phe Lys His Arg His Pro Ser Le - #u Ala Ser Ser Gly Val# 445- Asn Gly Gly Thr Gln Leu Ser Ile Leu Ser Ly - #s Ser Ser Ser Gln Leu# 460- Arg Met Ser Ser Leu Pro Ala Asp Asn Leu Al - #a Thr465 4 - #70 4 - #75- (2) INFORMATION FOR SEQ ID NO:21:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 495 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:21:- Met Ala Arg Val Leu Gln Leu Ser Leu Thr Al - #a Leu Leu Leu Pro Val# 15- Ala Ile Ala Met His Ser Asp Cys Ile Phe Ly - #s Lys Glu Gln Ala Met# 30- Cys Leu Glu Arg Ile Gln Arg Ala Asn Asp Le - #u Met Gly Leu Asn Glu# 45- Ser Ser Pro Gly Cys Pro Gly Met Trp Asp As - #n Ile Thr Cys Trp Lys# 60- Pro Ala Gln Val Gly Glu Met Val Leu Val Se - #r Cys Pro Glu Val Phe#80- Arg Ile Phe Asn Pro Asp Gln Val Trp Met Th - #r Glu Thr Ile Gly Asp# 95- Ser Gly Phe Ala Asp Ser Asn Ser Leu Glu Il - #e Thr Asp Met Gly Val# 110- Val Gly Arg Asn Cys Thr Glu Asp Gly Trp Se - #r Glu Pro Phe Pro His# 125- Tyr Phe Asp Ala Cys Gly Phe Asp Asp Tyr Gl - #u Pro Glu Ser Gly Asp# 140- Gln Asp Tyr Tyr Tyr Leu Ser Val Lys Ala Le - #u Tyr Thr Val Gly Tyr145 1 - #50 1 - #55 1 -#60- Ser Thr Ser Leu Ala Thr Leu Thr Thr Ala Me - #t Val Ile Leu Cys Arg# 175- Phe Arg Lys Leu His Cys Thr Arg Asn Phe Il - #e His Met Asn Leu Phe# 190- Val Ser Phe Met Leu Arg Ala Ile Ser Val Ph - #e Ile Lys Asp Trp Ile# 205- Leu Tyr Ala Glu Gln Asp Ser Ser His Cys Ph - #e Val Ser Thr Val Glu# 220- Cys Lys Ala Val Met Val Phe Phe His Tyr Cy - #s Val Val Ser Asn Tyr225 2 - #30 2 - #35 2 -#40- Phe Trp Leu Phe Ile Glu Gly Leu Tyr Leu Ph - #e Thr Leu Leu Val Glu# 255- Thr Phe Phe Pro Glu Arg Arg Tyr Phe Tyr Tr - #p Tyr Thr Ile Ile Gly# 270- Trp Gly Thr Pro Thr Val Cys Val Thr Val Tr - #p Ala Val Leu Arg Leu# 285- Tyr Phe Asp Asp Ala Gly Cys Trp Asp Met As - #n Asp Ser Thr Ala Leu# 300- Trp Trp Val Ile Lys Gly Pro Val Val Gly Se - #r Ile Met Val Asn Phe305 3 - #10 3 - #15 3 -#20- Val Leu Phe Ile Gly Ile Ile Ile Ile Leu Va - #l Gln Lys Leu Gln Ser# 335- Pro Asp Met Gly Gly Asn Glu Ser Ser Ile Ty - #r Phe Ser Cys Val Gln# 350- Lys Cys Tyr Cys Lys Pro Gln Arg Ala Gln Gl - #n His Ser Cys Lys Met# 365- Ser Glu Leu Ser Thr Ile Thr Leu Arg Leu Al - #a Arg Ser Thr Leu Leu# 380- Leu Ile Pro Leu Phe Gly Ile His Tyr Thr Va - #l Phe Ala Phe Ser Pro385 3 - #90 3 - #95 4 -#00- Glu Asn Val Ser Lys Arg Glu Arg Leu Val Ph - #e Glu Leu Gly Leu Gly# 415- Ser Phe Gln Gly Phe Val Val Ala Val Leu Ty - #r Cys Phe Leu Asn Gly# 430- Glu Val Gln Ala Glu Ile Lys Arg Lys Trp Ar - #g Ser Trp Lys Val Asn# 445- Arg Tyr Phe Thr Met Asp Phe Lys His Arg Hi - #s Pro Ser Leu Ala Ser# 460- Ser Gly Val Asn Gly Gly Thr Gln Leu Ser Il - #e Leu Ser Lys Ser Ser465 4 - #70 4 - #75 4 -#80- Ser Gln Leu Arg Met Ser Ser Leu Pro Ala As - #p Asn Leu Ala Thr# 495- (2) INFORMATION FOR SEQ ID NO:22:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 448 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:22:- Met His Ser Asp Cys Ile Phe Lys Lys Glu Gl - #n Ala Met Cys Leu Glu# 15- Lys Ile Gln Arg Ala Asn Glu Leu Met Gly Ph - #e Asn Asp Ser Ser Pro# 30- Gly Cys Pro Gly Met Trp Asp Asn Ile Thr Cy - #s Trp Lys Pro Ala His# 45- Val Gly Glu Met Val Leu Val Ser Cys Pro Gl - #u Leu Phe Arg Ile Phe# 60- Asn Pro Asp Gln Val Trp Glu Thr Glu Thr Il - #e Gly Glu Ser Asp Phe#80- Gly Asp Ser Asn Ser Leu Asp Leu Ser Asp Me - #t Gly Val Val Ser Arg# 95- Asn Cys Thr Glu Asp Gly Trp Ser Glu Pro Ph - #e Pro His Tyr Phe Asp# 110- Ala Cys Gly Phe Asp Glu Tyr Glu Ser Glu Th - #r Gly Asp Gln Asp Tyr# 125- Tyr Tyr Leu Ser Val Lys Ala Leu Tyr Thr Va - #l Gly Tyr Ser Thr Ser# 140- Leu Val Thr Leu Thr Thr Ala Met Val Ile Le - #u Cys Arg Phe Arg Lys145 1 - #50 1 - #55 1 -#60- Leu His Cys Thr Arg Asn Phe Ile His Met As - #n Leu Phe Val Ser Phe# 175- Met Leu Arg Ala Ile Ser Val Phe Ile Lys As - #p Trp Ile Leu Tyr Ala# 190- Glu Gln Asp Ser Asn His Cys Phe Ile Ser Th - #r Val Glu Cys Lys Ala# 205- Val Met Val Phe Phe His Tyr Cys Val Val Se - #r Asn Tyr Phe Trp Leu# 220- Phe Ile Glu Gly Leu Tyr Leu Phe Thr Leu Le - #u Val Glu Thr Phe Phe225 2 - #30 2 - #35 2 -#40- Pro Glu Arg Arg Tyr Phe Tyr Trp Tyr Thr Il - #e Ile Gly Trp Gly Thr# 255- Pro Thr Val Cys Val Thr Val Trp Ala Thr Le - #u Arg Leu Tyr Phe Asp# 270- Asp Thr Gly Cys Trp Asp Met Asn Asp Ser Th - #r Ala Leu Trp Trp Val# 285- Ile Lys Gly Pro Val Val Gly Ser Ile Met Va - #l Asn Phe Val Leu Phe# 300- Ile Gly Ile Ile Val Ile Leu Val Gln Lys Le - #u Gln Ser Pro Asp Met305 3 - #10 3 - #15 3 -#20- Gly Gly Asn Glu Ser Ser Ile Tyr Leu Arg Le - #u Ala Arg Ser Thr Leu# 335- Leu Leu Ile Pro Leu Phe Gly Ile His Tyr Th - #r Val Phe Ala Phe Ser# 350- Pro Glu Asn Val Ser Lys Arg Glu Arg Leu Va - #l Phe Glu Leu Gly Leu# 365- Gly Ser Phe Gln Gly Phe Val Val Ala Val Le - #u Tyr Cys Phe Leu Asn# 380- Gly Glu Val Gln Ala Glu Ile Lys Arg Lys Tr - #p Arg Ser Trp Lys Val385 3 - #90 3 - #95 4 -#00- Asn Arg Tyr Phe Ala Val Asp Phe Lys His Ar - #g His Pro Ser Leu Ala# 415- Ser Ser Gly Val Asn Gly Gly Thr Gln Leu Se - #r Ile Leu Ser Lys Ser# 430- Ser Ser Gln Ile Arg Met Ser Gly Leu Pro Al - #a Asp Asn Leu Ala Thr# 445- (2) INFORMATION FOR SEQ ID NO:23:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 525 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:23:- Met Ala Gly Val Val His Val Ser Leu Ala Al - #a His Cys Gly Ala Cys# 15- Pro Trp Gly Arg Gly Arg Leu Arg Lys Gly Ar - #g Ala Ala Cys Lys Ser# 30- Ala Ala Gln Arg His Ile Gly Ala Asp Leu Pr - #o Leu Leu Ser Val Gly# 45- Gly Gln Trp Cys Trp Pro Arg Ser Val Met Al - #a Gly Val Val His Val# 60- Ser Leu Ala Ala Leu Leu Leu Leu Pro Met Al - #a Pro Ala Met His Ser#80- Asp Cys Ile Phe Lys Lys Glu Gln Ala Met Cy - #s Leu Glu Lys Ile Gln# 95- Arg Ala Asn Glu Leu Met Gly Phe Asn Asp Se - #r Ser Pro Gly Cys Pro# 110- Gly Met Trp Asp Asn Ile Thr Cys Trp Lys Pr - #o Ala His Val Gly Glu# 125- Met Val Leu Val Ser Cys Pro Glu Leu Phe Ar - #g Ile Phe Asn Pro Asp# 140- Gln Val Trp Glu Thr Glu Thr Ile Gly Glu Se - #r Asp Phe Gly Asp Ser145 1 - #50 1 - #55 1 -#60- Asn Ser Leu Asp Leu Ser Asp Met Gly Val Va - #l Ser Arg Asn Cys Thr# 175- Glu Asp Gly Trp Ser Glu Pro Phe Pro His Ty - #r Phe Asp Ala Cys Gly# 190- Phe Asp Glu Tyr Glu Ser Glu Thr Gly Asp Gl - #n Asp Tyr Tyr Tyr Leu# 205- Ser Val Lys Ala Leu Tyr Thr Val Gly Tyr Se - #r Thr Ser Leu Val Thr# 220- Leu Thr Thr Ala Met Val Ile Leu Cys Arg Ph - #e Arg Lys Leu His Cys225 2 - #30 2 - #35 2 -#40- Thr Arg Asn Phe Ile His Met Asn Leu Phe Va - #l Ser Phe Met Leu Arg# 255- Ala Ile Ser Val Phe Ile Lys Asp Trp Ile Le - #u Tyr Ala Glu Gln Asp# 270- Ser Asn His Cys Phe Ile Ser Thr Val Glu Cy - #s Lys Ala Val Met Val# 285- Phe Phe His Tyr Cys Val Val Ser Asn Tyr Ph - #e Trp Leu Phe Ile Glu# 300- Gly Leu Tyr Leu Phe Thr Leu Leu Val Glu Th - #r Phe Phe Pro Glu Arg305 3 - #10 3 - #15 3 -#20- Arg Tyr Phe Tyr Trp Tyr Thr Ile Ile Gly Tr - #p Gly Thr Pro Thr Val# 335- Cys Val Thr Val Trp Ala Thr Leu Arg Leu Ty - #r Phe Asp Asp Thr Gly# 350- Cys Trp Asp Met Asn Asp Ser Thr Ala Leu Tr - #p Trp Val Ile Lys Gly# 365- Pro Val Val Gly Ser Ile Met Val Asn Phe Va - #l Leu Phe Ile Gly Ile# 380- Ile Val Ile Leu Val Gln Lys Leu Gln Ser Pr - #o Asp Met Gly Gly Asn385 3 - #90 3 - #95 4 -#00- Glu Ser Ser Ile Tyr Leu Arg Leu Ala Arg Se - #r Thr Leu Leu Leu Ile# 415- Pro Leu Phe Gly Ile His Tyr Thr Val Phe Al - #a Phe Ser Pro Glu Asn# 430- Val Ser Lys Arg Glu Arg Leu Val Phe Glu Le - #u Gly Leu Gly Ser Phe# 445- Gln Gly Phe Val Val Ala Val Leu Tyr Cys Ph - #e Leu Asn Gly Glu Val# 460- Gln Ala Glu Ile Lys Arg Lys Trp Arg Ser Tr - #p Lys Val Asn Arg Tyr465 4 - #70 4 - #75 4 -#80- Phe Ala Val Asp Phe Lys His Arg His Pro Se - #r Leu Ala Ser Ser Gly# 495- Val Asn Gly Gly Thr Gln Leu Ser Ile Leu Se - #r Lys Ser Ser Ser Gln# 510- Ile Arg Met Ser Gly Leu Pro Ala Asp Asn Le - #u Ala Thr# 525- (2) INFORMATION FOR SEQ ID NO:24:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 476 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:24:- Met His Ser Asp Cys Ile Phe Lys Lys Glu Gl - #n Ala Met Cys Leu Glu# 15- Lys Ile Gln Arg Ala Asn Glu Leu Met Gly Ph - #e Asn Asp Ser Ser Pro# 30- Gly Cys Pro Gly Met Trp Asp Asn Ile Thr Cy - #s Trp Lys Pro Ala His# 45- Val Gly Glu Met Val Leu Val Ser Cys Pro Gl - #u Leu Phe Arg Ile Phe# 60- Asn Pro Asp Gln Val Trp Glu Thr Glu Thr Il - #e Gly Glu Ser Asp Phe#80- Gly Asp Ser Asn Ser Leu Asp Leu Ser Asp Me - #t Gly Val Val Ser Arg# 95- Asn Cys Thr Glu Asp Gly Trp Ser Glu Pro Ph - #e Pro His Tyr Phe Asp# 110- Ala Cys Gly Phe Asp Glu Tyr Glu Ser Glu Th - #r Gly Asp Gln Asp Tyr# 125- Tyr Tyr Leu Ser Val Lys Ala Leu Tyr Thr Va - #l Gly Tyr Ser Thr Ser# 140- Leu Val Thr Leu Thr Thr Ala Met Val Ile Le - #u Cys Arg Phe Arg Lys145 1 - #50 1 - #55 1 -#60- Leu His Cys Thr Arg Asn Phe Ile His Met As - #n Leu Phe Val Ser Phe# 175- Met Leu Arg Ala Ile Ser Val Phe Ile Lys As - #p Trp Ile Leu Tyr Ala# 190- Glu Gln Asp Ser Asn His Cys Phe Ile Ser Th - #r Val Glu Cys Lys Ala# 205- Val Met Val Phe Phe His Tyr Cys Val Val Se - #r Asn Tyr Phe Trp Leu# 220- Phe Ile Glu Gly Leu Tyr Leu Phe Thr Leu Le - #u Val Glu Thr Phe Phe225 2 - #30 2 - #35 2 -#40- Pro Glu Arg Arg Tyr Phe Tyr Trp Tyr Thr Il - #e Ile Gly Trp Gly Thr# 255- Pro Thr Val Cys Val Thr Val Trp Ala Thr Le - #u Arg Leu Tyr Phe Asp# 270- Asp Thr Gly Cys Trp Asp Met Asn Asp Ser Th - #r Ala Leu Trp Trp Val# 285- Ile Lys Gly Pro Val Val Gly Ser Ile Met Va - #l Asn Phe Val Leu Phe# 300- Ile Gly Ile Ile Val Ile Leu Val Gln Lys Le - #u Gln Ser Pro Asp Met305 3 - #10 3 - #15 3 -#20- Gly Gly Asn Glu Ser Ser Ile Tyr Phe Ser Cy - #s Val Gln Lys Cys Tyr# 335- Cys Lys Pro Gln Arg Ala Gln Gln His Ser Cy - #s Lys Met Ser Glu Leu# 350- Ser Thr Ile Thr Leu Arg Leu Ala Arg Ser Th - #r Leu Leu Leu Ile Pro# 365- Leu Phe Gly Ile His Tyr Thr Val Phe Ala Ph - #e Ser Pro Glu Asn Val# 380- Ser Lys Arg Glu Arg Leu Val Phe Glu Leu Gl - #y Leu Gly Ser Phe Gln385 3 - #90 3 - #95 4 -#00- Gly Phe Val Val Ala Val Leu Tyr Cys Phe Le - #u Asn Gly Glu Val Gln# 415- Ala Glu Ile Lys Arg Lys Trp Arg Ser Trp Ly - #s Val Asn Arg Tyr Phe# 430- Ala Val Asp Phe Lys His Arg His Pro Ser Le - #u Ala Ser Ser Gly Val# 445- Asn Gly Gly Thr Gln Leu Ser Ile Leu Ser Ly - #s Ser Ser Ser Gln Ile# 460- Arg Met Ser Gly Leu Pro Ala Asp Asn Leu Al - #a Thr465 4 - #70 4 - #75- (2) INFORMATION FOR SEQ ID NO:25:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 553 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:25:- Met Ala Gly Val Val His Val Ser Leu Ala Al - #a His Cys Gly Ala Cys# 15- Pro Trp Gly Arg Gly Arg Leu Arg Lys Gly Ar - #g Ala Ala Cys Lys Ser# 30- Ala Ala Gln Arg His Ile Gly Ala Asp Leu Pr - #o Leu Leu Ser Val Gly# 45- Gly Gln Trp Cys Trp Pro Arg Ser Val Met Al - #a Gly Val Val His Val# 60- Ser Leu Ala Ala Leu Leu Leu Leu Pro Met Al - #a Pro Ala Met His Ser#80- Asp Cys Ile Phe Lys Lys Glu Gln Ala Met Cy - #s Leu Glu Lys Ile Gln# 95- Arg Ala Asn Glu Leu Met Gly Phe Asn Asp Se - #r Ser Pro Gly Cys Pro# 110- Gly Met Trp Asp Asn Ile Thr Cys Trp Lys Pr - #o Ala His Val Gly Glu# 125- Met Val Leu Val Ser Cys Pro Glu Leu Phe Ar - #g Ile Phe Asn Pro Asp# 140- Gln Val Trp Glu Thr Glu Thr Ile Gly Glu Se - #r Asp Phe Gly Asp Ser145 1 - #50 1 - #55 1 -#60- Asn Ser Leu Asp Leu Ser Asp Met Gly Val Va - #l Ser Arg Asn Cys Thr# 175- Glu Asp Gly Trp Ser Glu Pro Phe Pro His Ty - #r Phe Asp Ala Cys Gly# 190- Phe Asp Glu Tyr Glu Ser Glu Thr Gly Asp Gl - #n Asp Tyr Tyr Tyr Leu# 205- Ser Val Lys Ala Leu Tyr Thr Val Gly Tyr Se - #r Thr Ser Leu Val Thr# 220- Leu Thr Thr Ala Met Val Ile Leu Cys Arg Ph - #e Arg Lys Leu His Cys225 2 - #30 2 - #35 2 -#40- Thr Arg Asn Phe Ile His Met Asn Leu Phe Va - #l Ser Phe Met Leu Arg# 255- Ala Ile Ser Val Phe Ile Lys Asp Trp Ile Le - #u Tyr Ala Glu Gln Asp# 270- Ser Asn His Cys Phe Ile Ser Thr Val Glu Cy - #s Lys Ala Val Met Val# 285- Phe Phe His Tyr Cys Val Val Ser Asn Tyr Ph - #e Trp Leu Phe Ile Glu# 300- Gly Leu Tyr Leu Phe Thr Leu Leu Val Glu Th - #r Phe Phe Pro Glu Arg305 3 - #10 3 - #15 3 -#20- Arg Tyr Phe Tyr Trp Tyr Thr Ile Ile Gly Tr - #p Gly Thr Pro Thr Val# 335- Cys Val Thr Val Trp Ala Thr Leu Arg Leu Ty - #r Phe Asp Asp Thr Gly# 350- Cys Trp Asp Met Asn Asp Ser Thr Ala Leu Tr - #p Trp Val Ile Lys Gly# 365- Pro Val Val Gly Ser Ile Met Val Asn Phe Va - #l Leu Phe Ile Gly Ile# 380- Ile Val Ile Leu Val Gln Lys Leu Gln Ser Pr - #o Asp Met Gly Gly Asn385 3 - #90 3 - #95 4 -#00- Glu Ser Ser Ile Tyr Phe Ser Cys Val Gln Ly - #s Cys Tyr Cys Lys Pro# 415- Gln Arg Ala Gln Gln His Ser Cys Lys Met Se - #r Glu Leu Ser Thr Ile# 430- Thr Leu Arg Leu Ala Arg Ser Thr Leu Leu Le - #u Ile Pro Leu Phe Gly# 445- Ile His Tyr Thr Val Phe Ala Phe Ser Pro Gl - #u Asn Val Ser Lys Arg# 460- Glu Arg Leu Val Phe Glu Leu Gly Leu Gly Se - #r Phe Gln Gly Phe Val465 4 - #70 4 - #75 4 -#80- Val Ala Val Leu Tyr Cys Phe Leu Asn Gly Gl - #u Val Gln Ala Glu Ile# 495- Lys Arg Lys Trp Arg Ser Trp Lys Val Asn Ar - #g Tyr Phe Ala Val Asp# 510- Phe Lys His Arg His Pro Ser Leu Ala Ser Se - #r Gly Val Asn Gly Gly# 525- Thr Gln Leu Ser Ile Leu Ser Lys Ser Ser Se - #r Gln Ile Arg Met Ser# 540- Gly Leu Pro Ala Asp Asn Leu Ala Thr545 5 - #50- (2) INFORMATION FOR SEQ ID NO:26:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 475 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:26:- Met His Ser Asp Cys Ile Phe Lys Lys Glu Gl - #n Ala Met Cys Leu Glu# 15- Lys Ile Gln Arg Ala Asn Glu Leu Met Gly Ph - #e Asn Asp Ser Ser Pro# 30- Gly Cys Pro Gly Met Trp Asp Asn Ile Thr Cy - #s Trp Lys Pro Ala His# 45- Val Gly Glu Met Val Leu Val Ser Cys Pro Gl - #u Leu Phe Arg Ile Phe# 60- Asn Pro Asp Gln Val Trp Glu Thr Glu Thr Il - #e Gly Glu Ser Asp Phe#80- Gly Asp Ser Asn Ser Leu Asp Leu Ser Asp Me - #t Gly Val Val Ser Arg# 95- Asn Cys Thr Glu Asp Gly Trp Ser Glu Pro Ph - #e Pro His Tyr Phe Asp# 110- Ala Cys Gly Phe Asp Glu Tyr Glu Ser Glu Th - #r Gly Asp Gln Asp Tyr# 125- Tyr Tyr Leu Ser Val Lys Ala Leu Tyr Thr Va - #l Gly Tyr Ser Thr Ser# 140- Leu Val Thr Leu Thr Thr Ala Met Val Ile Le - #u Cys Arg Phe Arg Lys145 1 - #50 1 - #55 1 -#60- Leu His Cys Thr Arg Asn Phe Ile His Met As - #n Leu Phe Val Ser Phe# 175- Met Leu Arg Ala Ile Ser Val Phe Ile Lys As - #p Trp Ile Leu Tyr Ala# 190- Glu Gln Asp Ser Asn His Cys Phe Ile Ser Th - #r Val Glu Cys Lys Ala# 205- Val Met Val Phe Phe His Tyr Cys Val Val Se - #r Asn Tyr Phe Trp Leu# 220- Phe Ile Glu Gly Leu Tyr Leu Phe Thr Leu Le - #u Val Glu Thr Phe Phe225 2 - #30 2 - #35 2 -#40- Pro Glu Arg Arg Tyr Phe Tyr Trp Tyr Thr Il - #e Ile Gly Trp Gly Thr# 255- Pro Thr Val Cys Val Thr Val Trp Ala Thr Le - #u Arg Leu Tyr Phe Asp# 270- Asp Thr Gly Cys Trp Asp Met Asn Asp Ser Th - #r Ala Leu Trp Trp Val# 285- Ile Lys Gly Pro Val Val Gly Ser Ile Met Va - #l Asn Phe Val Leu Phe# 300- Ile Gly Ile Ile Val Ile Leu Val Gln Lys Le - #u Gln Ser Pro Asp Met305 3 - #10 3 - #15 3 -#20- Gly Gly Asn Glu Ser Ser Ile Tyr Phe Cys Va - #l Gln Lys Cys Tyr Cys# 335- Lys Pro Gln Arg Ala Gln Gln His Ser Cys Ly - #s Met Ser Glu Leu Ser# 350- Thr Ile Thr Leu Arg Leu Ala Arg Ser Thr Le - #u Leu Leu Ile Pro Leu# 365- Phe Gly Ile His Tyr Thr Val Phe Ala Phe Se - #r Pro Glu Asn Val Ser# 380- Lys Arg Glu Arg Leu Val Phe Glu Leu Gly Le - #u Gly Ser Phe Gln Gly385 3 - #90 3 - #95 4 -#00- Phe Val Val Ala Val Leu Tyr Cys Phe Leu As - #n Gly Glu Val Gln Ala# 415- Glu Ile Lys Arg Lys Trp Arg Ser Trp Lys Va - #l Asn Arg Tyr Phe Ala# 430- Val Asp Phe Lys His Arg His Pro Ser Leu Al - #a Ser Ser Gly Val Asn# 445- Gly Gly Thr Gln Leu Ser Ile Leu Ser Lys Se - #r Ser Ser Gln Ile Arg# 460- Met Ser Gly Leu Pro Ala Asp Asn Leu Ala Th - #r465 4 - #70 4 - #75- (2) INFORMATION FOR SEQ ID NO:27:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 552 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:27:- Met Ala Gly Val Val His Val Ser Leu Ala Al - #a His Cys Gly Ala Cys# 15- Pro Trp Gly Arg Gly Arg Leu Arg Lys Gly Ar - #g Ala Ala Cys Lys Ser# 30- Ala Ala Gln Arg His Ile Gly Ala Asp Leu Pr - #o Leu Leu Ser Val Gly# 45- Gly Gln Trp Cys Trp Pro Arg Ser Val Met Al - #a Gly Val Val His Val# 60- Ser Leu Ala Ala Leu Leu Leu Leu Pro Met Al - #a Pro Ala Met His Ser#80- Asp Cys Ile Phe Lys Lys Glu Gln Ala Met Cy - #s Leu Glu Lys Ile Gln# 95- Arg Ala Asn Glu Leu Met Gly Phe Asn Asp Se - #r Ser Pro Gly Cys Pro# 110- Gly Met Trp Asp Asn Ile Thr Cys Trp Lys Pr - #o Ala His Val Gly Glu# 125- Met Val Leu Val Ser Cys Pro Glu Leu Phe Ar - #g Ile Phe Asn Pro Asp# 140- Gln Val Trp Glu Thr Glu Thr Ile Gly Glu Se - #r Asp Phe Gly Asp Ser145 1 - #50 1 - #55 1 -#60- Asn Ser Leu Asp Leu Ser Asp Met Gly Val Va - #l Ser Arg Asn Cys Thr# 175- Glu Asp Gly Trp Ser Glu Pro Phe Pro His Ty - #r Phe Asp Ala Cys Gly# 190- Phe Asp Glu Tyr Glu Ser Glu Thr Gly Asp Gl - #n Asp Tyr Tyr Tyr Leu# 205- Ser Val Lys Ala Leu Tyr Thr Val Gly Tyr Se - #r Thr Ser Leu Val Thr# 220- Leu Thr Thr Ala Met Val Ile Leu Cys Arg Ph - #e Arg Lys Leu His Cys225 2 - #30 2 - #35 2 -#40- Thr Arg Asn Phe Ile His Met Asn Leu Phe Va - #l Ser Phe Met Leu Arg# 255- Ala Ile Ser Val Phe Ile Lys Asp Trp Ile Le - #u Tyr Ala Glu Gln Asp# 270- Ser Asn His Cys Phe Ile Ser Thr Val Glu Cy - #s Lys Ala Val Met Val# 285- Phe Phe His Tyr Cys Val Val Ser Asn Tyr Ph - #e Trp Leu Phe Ile Glu# 300- Gly Leu Tyr Leu Phe Thr Leu Leu Val Glu Th - #r Phe Phe Pro Glu Arg305 3 - #10 3 - #15 3 -#20- Arg Tyr Phe Tyr Trp Tyr Thr Ile Ile Gly Tr - #p Gly Thr Pro Thr Val# 335- Cys Val Thr Val Trp Ala Thr Leu Arg Leu Ty - #r Phe Asp Asp Thr Gly# 350- Cys Trp Asp Met Asn Asp Ser Thr Ala Leu Tr - #p Trp Val Ile Lys Gly# 365- Pro Val Val Gly Ser Ile Met Val Asn Phe Va - #l Leu Phe Ile Gly Ile# 380- Ile Val Ile Leu Val Gln Lys Leu Gln Ser Pr - #o Asp Met Gly Gly Asn385 3 - #90 3 - #95 4 -#00- Glu Ser Ser Ile Tyr Phe Cys Val Gln Lys Cy - #s Tyr Cys Lys Pro Gln# 415- Arg Ala Gln Gln His Ser Cys Lys Met Ser Gl - #u Leu Ser Thr Ile Thr# 430- Leu Arg Leu Ala Arg Ser Thr Leu Leu Leu Il - #e Pro Leu Phe Gly Ile# 445- His Tyr Thr Val Phe Ala Phe Ser Pro Glu As - #n Val Ser Lys Arg Glu# 460- Arg Leu Val Phe Glu Leu Gly Leu Gly Ser Ph - #e Gln Gly Phe Val Val465 4 - #70 4 - #75 4 -#80- Ala Val Leu Tyr Cys Phe Leu Asn Gly Glu Va - #l Gln Ala Glu Ile Lys# 495- Arg Lys Trp Arg Ser Trp Lys Val Asn Arg Ty - #r Phe Ala Val Asp Phe# 510- Lys His Arg His Pro Ser Leu Ala Ser Ser Gl - #y Val Asn Gly Gly Thr# 525- Gln Leu Ser Ile Leu Ser Lys Ser Ser Ser Gl - #n Ile Arg Met Ser Gly# 540- Leu Pro Ala Asp Asn Leu Ala Thr545 5 - #50- (2) INFORMATION FOR SEQ ID NO:28:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 476 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:28:- Met His Ser Asp Cys Ile Phe Lys Lys Glu Gl - #n Ala Met Cys Leu Glu# 15- Lys Ile Gln Arg Ala Asn Glu Leu Met Gly Ph - #e Asn Asp Ser Ser Pro# 30- Gly Cys Pro Gly Met Trp Asp Asn Ile Thr Cy - #s Trp Lys Pro Ala His# 45- Val Gly Glu Met Val Leu Val Ser Cys Pro Gl - #u Leu Phe Arg Ile Phe# 60- Asn Pro Asp Gln Val Trp Glu Thr Glu Thr Il - #e Gly Glu Ser Asp Phe#80- Gly Asp Ser Asn Ser Leu Asp Leu Ser Asp Me - #t Gly Val Val Ser Arg# 95- Asn Cys Thr Glu Asp Gly Trp Ser Glu Pro Ph - #e Pro His Tyr Phe Asp# 110- Ala Cys Gly Phe Asp Glu Tyr Glu Ser Glu Th - #r Gly Asp Gln Asp Tyr# 125- Tyr Tyr Leu Ser Val Lys Ala Leu Tyr Thr Va - #l Gly Tyr Ser Thr Ser# 140- Leu Val Thr Leu Thr Thr Ala Met Val Ile Le - #u Cys Arg Phe Arg Lys145 1 - #50 1 - #55 1 -#60- Leu His Cys Thr Arg Asn Phe Ile His Met As - #n Leu Phe Val Ser Phe# 175- Met Leu Arg Ala Ile Ser Val Phe Ile Lys As - #p Trp Ile Leu Tyr Ala# 190- Glu Gln Asp Ser Asn His Cys Phe Ile Ser Th - #r Val Glu Cys Lys Ala# 205- Val Met Val Phe Phe His Tyr Cys Val Val Se - #r Asn Tyr Phe Trp Leu# 220- Phe Ile Glu Gly Leu Tyr Leu Phe Thr Leu Le - #u Val Glu Thr Phe Phe225 2 - #30 2 - #35 2 -#40- Pro Glu Arg Arg Tyr Phe Tyr Trp Tyr Thr Il - #e Ile Gly Trp Gly Thr# 255- Pro Thr Val Cys Val Thr Val Trp Ala Thr Le - #u Arg Leu Tyr Phe Asp# 270- Asp Thr Gly Cys Trp Asp Met Asn Asp Ser Th - #r Ala Leu Trp Trp Val# 285- Ile Lys Gly Pro Val Val Gly Ser Ile Met Va - #l Asn Phe Val Leu Phe# 300- Ile Gly Ile Ile Val Ile Leu Val Gln Lys Le - #u Gln Ser Pro Asp Met305 3 - #10 3 - #15 3 -#20- Gly Gly Asn Glu Ser Ser Ile Tyr Leu Thr As - #n Leu Ser Pro Arg Val# 335- Pro Lys Lys Ala Arg Glu Asp Pro Leu Pro Va - #l Pro Ser Asp Gln His# 350- Ser Leu Pro Phe Leu Arg Leu Ala Arg Ser Th - #r Leu Leu Leu Ile Pro# 365- Leu Phe Gly Ile His Tyr Thr Val Phe Ala Ph - #e Ser Pro Glu Asn Val# 380- Ser Lys Arg Glu Arg Leu Val Phe Glu Leu Gl - #y Leu Gly Ser Phe Gln385 3 - #90 3 - #95 4 -#00- Gly Phe Val Val Ala Val Leu Tyr Cys Phe Le - #u Asn Gly Glu Val Gln# 415- Ala Glu Ile Lys Arg Lys Trp Arg Ser Trp Ly - #s Val Asn Arg Tyr Phe# 430- Ala Val Asp Phe Lys His Arg His Pro Ser Le - #u Ala Ser Ser Gly Val# 445- Asn Gly Gly Thr Gln Leu Ser Ile Leu Ser Ly - #s Ser Ser Ser Gln Ile# 460- Arg Met Ser Gly Leu Pro Ala Asp Asn Leu Al - #a Thr465 4 - #70 4 - #75- (2) INFORMATION FOR SEQ ID NO:29:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 553 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:29:- Met Ala Gly Val Val His Val Ser Leu Ala Al - #a His Cys Gly Ala Cys# 15- Pro Trp Gly Arg Gly Arg Leu Arg Lys Gly Ar - #g Ala Ala Cys Lys Ser# 30- Ala Ala Gln Arg His Ile Gly Ala Asp Leu Pr - #o Leu Leu Ser Val Gly# 45- Gly Gln Trp Cys Trp Pro Arg Ser Val Met Al - #a Gly Val Val His Val# 60- Ser Leu Ala Ala Leu Leu Leu Leu Pro Met Al - #a Pro Ala Met His Ser#80- Asp Cys Ile Phe Lys Lys Glu Gln Ala Met Cy - #s Leu Glu Lys Ile Gln# 95- Arg Ala Asn Glu Leu Met Gly Phe Asn Asp Se - #r Ser Pro Gly Cys Pro# 110- Gly Met Trp Asp Asn Ile Thr Cys Trp Lys Pr - #o Ala His Val Gly Glu# 125- Met Val Leu Val Ser Cys Pro Glu Leu Phe Ar - #g Ile Phe Asn Pro Asp# 140- Gln Val Trp Glu Thr Glu Thr Ile Gly Glu Se - #r Asp Phe Gly Asp Ser145 1 - #50 1 - #55 1 -#60- Asn Ser Leu Asp Leu Ser Asp Met Gly Val Va - #l Ser Arg Asn Cys Thr# 175- Glu Asp Gly Trp Ser Glu Pro Phe Pro His Ty - #r Phe Asp Ala Cys Gly# 190- Phe Asp Glu Tyr Glu Ser Glu Thr Gly Asp Gl - #n Asp Tyr Tyr Tyr Leu# 205- Ser Val Lys Ala Leu Tyr Thr Val Gly Tyr Se - #r Thr Ser Leu Val Thr# 220- Leu Thr Thr Ala Met Val Ile Leu Cys Arg Ph - #e Arg Lys Leu His Cys225 2 - #30 2 - #35 2 -#40- Thr Arg Asn Phe Ile His Met Asn Leu Phe Va - #l Ser Phe Met Leu Arg# 255- Ala Ile Ser Val Phe Ile Lys Asp Trp Ile Le - #u Tyr Ala Glu Gln Asp# 270- Ser Asn His Cys Phe Ile Ser Thr Val Glu Cy - #s Lys Ala Val Met Val# 285- Phe Phe His Tyr Cys Val Val Ser Asn Tyr Ph - #e Trp Leu Phe Ile Glu# 300- Gly Leu Tyr Leu Phe Thr Leu Leu Val Glu Th - #r Phe Phe Pro Glu Arg305 3 - #10 3 - #15 3 -#20- Arg Tyr Phe Tyr Trp Tyr Thr Ile Ile Gly Tr - #p Gly Thr Pro Thr Val# 335- Cys Val Thr Val Trp Ala Thr Leu Arg Leu Ty - #r Phe Asp Asp Thr Gly# 350- Cys Trp Asp Met Asn Asp Ser Thr Ala Leu Tr - #p Trp Val Ile Lys Gly# 365- Pro Val Val Gly Ser Ile Met Val Asn Phe Va - #l Leu Phe Ile Gly Ile# 380- Ile Val Ile Leu Val Gln Lys Leu Gln Ser Pr - #o Asp Met Gly Gly Asn385 3 - #90 3 - #95 4 -#00- Glu Ser Ser Ile Tyr Leu Thr Asn Leu Ser Pr - #o Arg Val Pro Lys Lys# 415- Ala Arg Glu Asp Pro Leu Pro Val Pro Ser As - #p Gln His Ser Leu Pro# 430- Phe Leu Arg Leu Ala Arg Ser Thr Leu Leu Le - #u Ile Pro Leu Phe Gly# 445- Ile His Tyr Thr Val Phe Ala Phe Ser Pro Gl - #u Asn Val Ser Lys Arg# 460- Glu Arg Leu Val Phe Glu Leu Gly Leu Gly Se - #r Phe Gln Gly Phe Val465 4 - #70 4 - #75 4 -#80- Val Ala Val Leu Tyr Cys Phe Leu Asn Gly Gl - #u Val Gln Ala Glu Ile# 495- Lys Arg Lys Trp Arg Ser Trp Lys Val Asn Ar - #g Tyr Phe Ala Val Asp# 510- Phe Lys His Arg His Pro Ser Leu Ala Ser Se - #r Gly Val Asn Gly Gly# 525- Thr Gln Leu Ser Ile Leu Ser Lys Ser Ser Se - #r Gln Ile Arg Met Ser# 540- Gly Leu Pro Ala Asp Asn Leu Ala Thr545 5 - #50- (2) INFORMATION FOR SEQ ID NO:30:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 1539 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (ix) FEATURE: (A) NAME/KEY: mat.sub.-- - #peptide (B) LOCATION: 1..1539- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:30:- ATGAGAGGCG GGCGGCACTG GCCCGAGCCG CCTTGCAGGC TGAGAAGCGT CA - #TGGCCAGC 60- ATCGCGCAGG TCTCCCTGGC TGCTCTCCTC CTGCTGCCTA TGGCCACCGC CA - #TGCATTCC 120- GACTGCATCT TCAAGAAGGA GCAAGCCATG TGCCTGGAGA AGATCCAGAG GG - #TGAATGAC 180- CTGATGGGCT TGAATGACTC CTCCCCAGGG TGCCCTGGGA TGTGGGACAA CA - #TCACGTGT 240- TGGAAGCCCG CCCACGTGGG TGAGATGGTC CTGGTCAGTT GCCCTGAACT CT - #TCCGAATC 300- TTCAACCCAG ACCAAGTCTG GGAGACGGAA ACCATCGGAG AGTTCGGTTT TG - #CAGACAGT 360- AAATCCTTGG ATCTCTCAGA CATGAGGGTG GTGAGCCGGA ATTGCACGGA GG - #ATGGATGG 420- TCAGAGCCAT TCCCTCATTA TTTCGATGCC TGTGGGTTTG AGGAGTACGA AT - #CTGAGACT 480- GGGGACCAGG ATTACTACTA CCTGTCAGTG AAGGCCCTGT ACACAGTTGG CT - #ACAGCACG 540- TCCCTCGTCA CCCTCACCAC TGCCATGGTC ATCCTGTGTC GTTTCCGGAA GC - #TGCACTGC 600- ACCCGCAACT TCATCCACAT GAACCTCTTC GTGTCGTTTA TGCTGAGGGC CA - #TCTCCGTC 660- TTCATCAAAG ACTGGATCCT CTATGCTGAG CAGGACAGCA ATCACTGCTT TG - #TCTCCACT 720- GTGGAATGCA AGGCTGTGAT GGTTTTCTTC CACTACTGTG TTGTATCCAA CT - #ACTTCTGG 780- CTGTTCATCG AGGGCCTGTA TCTCTTCACC CTGCTGGTGG AGACCTTCTT CC - #CCGAGAGG 840- AGATATTTCT ACTGGTACAT CATCATTGGC TGGGGGACAC CAACTGTGTG TG - #TGTCTGTG 900- TGGGCTATGC TGAGGCTCTA CTTCGATGAC ACAGGCTGCT GGGATATGAA TG - #ACAACACG 960- GCTCTGTGGT GGGTGATCAA AGGCCCTGTA GTTGGCTCCA TAATGGTTAA TT - #TTGTGCTC1020- TTCATCGGCA TCATTGTCAT CCTTGTGCAG AAACTTCAGT CTCCAGACAT GG - #GAGGCAAC1080- GAGTCCAGCA TCTACTTCAG CTGCGTGCAG AAATGCTACT GCAAGCCACA GC - #GGGCTCAG1140- CAGCACTCTT GCAAGATGTC AGAACTGTCC ACCATTACTC TACGGCTCGC CA - #GGTCCACC1200- TTGCTGCTCA TCCCACTCTT TGGAATCCAC TACACTGTCT TTGCTTTCTC CC - #CGGAGAAC1260- GTCAGCAAGA GGGAGAGACT GGTGTTTGAG CTGGGTCTGG GCTCCTTCCA GG - #GCTTTGTG1320- GTGGCTGTTC TCTATTGCTT TCTGAATGGA GAGGTGCAGG CGGAGATCAA GA - #GGAAGTGG1380- CGGAGCTGGA AGGTGAACCG CTACTTCACC ATGGACTTCA AGCACCGGCA CC - #CATCCCTG1440- GCCAGCAGCG GGGTGAACGG GGGCACCCAG CTCTCCATCC TGAGCAAGAG CA - #GCTCCCAG1500# 1539 TTCC GGCCGACAAC CTGGCCACC- (2) INFORMATION FOR SEQ ID NO:31:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 1455 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (ix) FEATURE: (A) NAME/KEY: mat.sub.-- - #peptide (B) LOCATION: 1..1455- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:31:- ATGAGAGGCG GGCGGCACTG GCCCGAGCCG CCTTGCAGGC TGAGAAGCGT CA - #TGGCCAGC 60- ATCGCGCAGG TCTCCCTGGC TGCTCTCCTC CTGCTGCCTA TGGCCACCGC CA - #TGCATTCC 120- GACTGCATCT TCAAGAAGGA GCAAGCCATG TGCCTGGAGA AGATCCAGAG GG - #TGAATGAC 180- CTGATGGGCT TGAATGACTC CTCCCCAGGG TGCCCTGGGA TGTGGGACAA CA - #TCACGTGT 240- TGGAAGCCCG CCCACGTGGG TGAGATGGTC CTGGTCAGTT GCCCTGAACT CT - #TCCGAATC 300- TTCAACCCAG ACCAAGTCTG GGAGACGGAA ACCATCGGAG AGTTCGGTTT TG - #CAGACAGT 360- AAATCCTTGG ATCTCTCAGA CATGAGGGTG GTGAGCCGGA ATTGCACGGA GG - #ATGGATGG 420- TCAGAGCCAT TCCCTCATTA TTTCGATGCC TGTGGGTTTG AGGAGTACGA AT - #CTGAGACT 480- GGGGACCAGG ATTACTACTA CCTGTCAGTG AAGGCCCTGT ACACAGTTGG CT - #ACAGCACG 540- TCCCTCGTCA CCCTCACCAC TGCCATGGTC ATCCTGTGTC GTTTCCGGAA GC - #TGCACTGC 600- ACCCGCAACT TCATCCACAT GAACCTCTTC GTGTCGTTTA TGCTGAGGGC CA - #TCTCCGTC 660- TTCATCAAAG ACTGGATCCT CTATGCTGAG CAGGACAGCA ATCACTGCTT TG - #TCTCCACT 720- GTGGAATGCA AGGCTGTGAT GGTTTTCTTC CACTACTGTG TTGTATCCAA CT - #ACTTCTGG 780- CTGTTCATCG AGGGCCTGTA TCTCTTCACC CTGCTGGTGG AGACCTTCTT CC - #CCGAGAGG 840- AGATATTTCT ACTGGTACAT CATCATTGGC TGGGGGACAC CAACTGTGTG TG - #TGTCTGTG 900- TGGGCTATGC TGAGGCTCTA CTTCGATGAC ACAGGCTGCT GGGATATGAA TG - #ACAACACG 960- GCTCTGTGGT GGGTGATCAA AGGCCCTGTA GTTGGCTCCA TAATGGTTAA TT - #TTGTGCTC1020- TTCATCGGCA TCATTGTCAT CCTTGTGCAG AAACTTCAGT CTCCAGACAT GG - #GAGGCAAC1080- GAGTCCAGCA TCTACTTACG GCTCGCCAGG TCCACCTTGC TGCTCATCCC AC - #TCTTTGGA1140- ATCCACTACA CTGTCTTTGC TTTCTCCCCG GAGAACGTCA GCAAGAGGGA GA - #GACTGGTG1200- TTTGAGCTGG GTCTGGGCTC CTTCCAGGGC TTTGTGGTGG CTGTTCTCTA TT - #GCTTTCTG1260- AATGGAGAGG TGCAGGCGGA GATCAAGAGG AAGTGGCGGA GCTGGAAGGT GA - #ACCGCTAC1320- TTCACCATGG ACTTCAAGCA CCGGCACCCA TCCCTGGCCA GCAGCGGGGT GA - #ACGGGGGC1380- ACCCAGCTCT CCATCCTGAG CAAGAGCAGC TCCCAGATCC GCATGTCTGG GC - #TTCCGGCC1440# 1455- (2) INFORMATION FOR SEQ ID NO:32:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 1401 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (ix) FEATURE: (A) NAME/KEY: mat.sub.-- - #peptide (B) LOCATION: 1..1401- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:32:- ATGGCCAGAG TCCTGCAGCT CTCCCTGACT GCTCTCCTGC TGCCTGTGGC TA - #TTGCTATG 60- CACTCTGACT GCATCTTCAA GAAGGAGCAA GCCATGTGCC TGGAGAGGAT CC - #AGAGGGCC 120- AACGACCTGA TGGGACTAAA CGAGTCTTCC CCAGGTTGCC CTGGCATGTG GG - #ACAATATC 180- ACATGTTGGA AGCCAGCTCA AGTAGGTGAG ATGGTCCTTG TAAGCTGCCC TG - #AGGTCTTC 240- CGGATCTTCA ACCCGGACCA AGTCTGGATG ACAGAAACCA TAGGAGATTC TG - #GTTTTGCC 300- GATAGTAATT CCTTGGAGAT CACAGACATG GGGGTCGTGG GCCGGAACTG CA - #CAGAGGAC 360- GGCTGGTCGG AGCCCTTCCC CCACTACTTC GATGCTTGTG GGTTTGATGA TT - #ATGAGCCT 420- GAGTCTGGAG ATCAGGATTA TTACTACCTG TCGGTGAAGG CTCTCTACAC AG - #TCGGCTAC 480- AGCACTTCCC TCGCCACCCT CACTACTGCC ATGGTCATCT TGTGCCGCTT CC - #GGAAGCTG 540- CATTGCACTC GCAACTTCAT CCACATGAAC CTGTTTGTAT CCTTCATGCT GA - #GGGCTATC 600- TCCGTCTTCA TCAAGGACTG GATCTTGTAC GCCGAGCAGG ACAGCAGTCA CT - #GCTTCGTT 660- TCCACCGTGG AGTGCAAAGC TGTCATGGTT TTCTTCCACT ACTGCGTGGT GT - #CCAACTAC 720- TTCTGGCTGT TCATTGAAGG CCTGTACCTC TTTACACTGC TGGTGGAGAC CT - #TCTTCCCT 780- GAGAGGAGAT ATTTCTACTG GTACACCATC ATCGGCTGGG GGACACCTAC TG - #TGTGTGTA 840- ACAGTGTGGG CTGTGCTGAG GCTCTATTTT GATGATGCAG GATGCTGGGA TA - #TGAATGAC 900- AGCACAGCTC TGTGGTGGGT GATCAAAGGC CCCGTGGTTG GCTCTATAAT GG - #TTAACTTT 960- GTGCTTTTCA TCGGCATCAT CATCATCCTT GTACAGAAGC TGCAGTCCCC AG - #ACATGGGA1020- GGCAACGAGT CCAGCATCTA CTTACGGCTG GCCCGCTCCA CCCTACTGCT CA - #TCCCACTC1080- TTCGGAATCC ACTACACAGT ATTCGCCTTC TCTCCAGAGA ACGTCAGCAA GA - #GGGAAAGA1140- CTTGTGTTTG AGCTTGGGCT GGGCTCCTTC CAGGGCTTTG TGGTGGCTGT AC - #TCTACTGC1200- TTCCTGAATG GGGAGGTACA GGCAGAGATT AAGAGGAAAT GGAGGAGCTG GA - #AGGTGAAC1260- CGTTACTTCA CTATGGACTT CAAGCACCGG CACCCGTCCC TGGCCAGCAG TG - #GAGTAAAT1320- GGGGGAACCC AGCTGTCCAT CCTGAGCAAG AGCAGCTCCC AGCTCCGCAT GT - #CCAGCCTC1380# 1401AC C- (2) INFORMATION FOR SEQ ID NO:33:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 1485 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (ix) FEATURE: (A) NAME/KEY: mat.sub.-- - #peptide (B) LOCATION: 1..1485- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:33:- ATGGCCAGAG TCCTGCAGCT CTCCCTGACT GCTCTCCTGC TGCCTGTGGC TA - #TTGCTATG 60- CACTCTGACT GCATCTTCAA GAAGGAGCAA GCCATGTGCC TGGAGAGGAT CC - #AGAGGGCC 120- AACGACCTGA TGGGACTAAA CGAGTCTTCC CCAGGTTGCC CTGGCATGTG GG - #ACAATATC 180- ACATGTTGGA AGCCAGCTCA AGTAGGTGAG ATGGTCCTTG TAAGCTGCCC TG - #AGGTCTTC 240- CGGATCTTCA ACCCGGACCA AGTCTGGATG ACAGAAACCA TAGGAGATTC TG - #GTTTTGCC 300- GATAGTAATT CCTTGGAGAT CACAGACATG GGGGTCGTGG GCCGGAACTG CA - #CAGAGGAC 360- GGCTGGTCGG AGCCCTTCCC CCACTACTTC GATGCTTGTG GGTTTGATGA TT - #ATGAGCCT 420- GAGTCTGGAG ATCAGGATTA TTACTACCTG TCGGTGAAGG CTCTCTACAC AG - #TCGGCTAC 480- AGCACTTCCC TCGCCACCCT CACTACTGCC ATGGTCATCT TGTGCCGCTT CC - #GGAAGCTG 540- CATTGCACTC GCAACTTCAT CCACATGAAC CTGTTTGTAT CCTTCATGCT GA - #GGGCTATC 600- TCCGTCTTCA TCAAGGACTG GATCTTGTAC GCCGAGCAGG ACAGCAGTCA CT - #GCTTCGTT 660- TCCACCGTGG AGTGCAAAGC TGTCATGGTT TTCTTCCACT ACTGCGTGGT GT - #CCAACTAC 720- TTCTGGCTGT TCATTGAAGG CCTGTACCTC TTTACACTGC TGGTGGAGAC CT - #TCTTCCCT 780- GAGAGGAGAT ATTTCTACTG GTACACCATC ATCGGCTGGG GGACACCTAC TG - #TGTGTGTA 840- ACAGTGTGGG CTGTGCTGAG GCTCTATTTT GATGATGCAG GATGCTGGGA TA - #TGAATGAC 900- AGCACAGCTC TGTGGTGGGT GATCAAAGGC CCCGTGGTTG GCTCTATAAT GG - #TTAACTTT 960- GTGCTTTTCA TCGGCATCAT CATCATCCTT GTACAGAAGC TGCAGTCCCC AG - #ACATGGGA1020- GGCAACGAGT CCAGCATCTA CTTCAGCTGC GTGCAGAAAT GCTACTGCAA GC - #CACAGCGG1080- GCTCAGCAGC ACTCTTGCAA GATGTCAGAA CTATCCACCA TTACTCTACG GC - #TGGCCCGC1140- TCCACCCTAC TGCTCATCCC ACTCTTCGGA ATCCACTACA CAGTATTCGC CT - #TCTCTCCA1200- GAGAACGTCA GCAAGAGGGA AAGACTTGTG TTTGAGCTTG GGCTGGGCTC CT - #TCCAGGGC1260- TTTGTGGTGG CTGTACTCTA CTGCTTCCTG AATGGGGAGG TACAGGCAGA GA - #TTAAGAGG1320- AAATGGAGGA GCTGGAAGGT GAACCGTTAC TTCACTATGG ACTTCAAGCA CC - #GGCACCCG1380- TCCCTGGCCA GCAGTGGAGT AAATGGGGGA ACCCAGCTGT CCATCCTGAG CA - #AGAGCAGC1440# 1485AG CCTCCCGGCC GACAACTTGG CCACC- (2) INFORMATION FOR SEQ ID NO:34:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 1575 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (ix) FEATURE: (A) NAME/KEY: mat.sub.-- - #peptide (B) LOCATION: 1..1575- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:34:- ATGGCTGGTG TCGTGCACGT TTCCCTGGCT GCTCACTGCG GGGCCTGTCC GT - #GGGGCCGG 60- GGCAGACTCC GCAAAGGACG CGCAGCCTGC AAGTCCGCGG CCCAGAGACA CA - #TTGGGGCT 120- GACCTGCCGC TGCTGTCAGT GGGAGGCCAG TGGTGCTGGC CAAGAAGTGT CA - #TGGCTGGT 180- GTCGTGCACG TTTCCCTGGC TGCTCTCCTC CTGCTGCCTA TGGCCCCTGC CA - #TGCATTCT 240- GACTGCATCT TCAAGAAGGA GCAAGCCATG TGCCTGGAGA AGATCCAGAG GG - #CCAATGAG 300- CTGATGGGCT TCAATGATTC CTCTCCAGGC TGTCCTGGGA TGTGGGACAA CA - #TCACGTGT 360- TGGAAGCCCG CCCATGTGGG TGAGATGGTC CTGGTCAGCT GCCCTGAGCT CT - #TCCGAATC 420- TTCAACCCAG ACCAAGTCTG GGAGACCGAA ACCATTGGAG AGTCTGATTT TG - #GTGACAGT 480- AACTCCTTAG ATCTCTCAGA CATGGGAGTG GTGAGCCGGA ACTGCACGGA GG - #ATGGCTGG 540- TCGGAACCCT TCCCTCATTA CTTTGATGCC TGTGGGTTTG ATGAATATGA AT - #CTGAGACT 600- GGGGACCAGG ATTATTACTA CCTGTCAGTG AAGGCCCTCT ACACGGTTGG CT - #ACAGCACA 660- TCCCTCGTCA CCCTCACCAC TGCCATGGTC ATCCTTTGTC GCTTCCGGAA GC - #TGCACTGC 720- ACACGCAACT TCATCCACAT GAACCTGTTT GTGTCGTTCA TGCTGAGGGC GA - #TCTCCGTC 780- TTCATCAAAG ACTGGATTCT GTATGCGGAG CAGGACAGCA ACCACTGCTT CA - #TCTCCACT 840- GTGGAATGTA AGGCCGTCAT GGTTTTCTTC CACTACTGTG TTGTGTCCAA CT - #ACTTCTGG 900- CTGTTCATCG AGGGCCTGTA CCTCTTCACT CTGCTGGTGG AGACCTTCTT CC - #CTGAAAGG 960- AGATACTTCT ACTGGTACAC CATCATTGGC TGGGGGTCCC CAACTGTGTG TG - #TGACAGTG1020- TGGGCTACGC TGAGACTCTA CTTTGATGAC ACAGGCTGCT GGGATATGAA TG - #ACAGCACA1080- GCTCTGTGGT GGGTGATCAA AGGCCCTGTG GTTGGCTCTA TCATGGTTAA CT - #TTGTGCTT1140- TTTATTGGCA TTATCGTCAT CCTTGTGCAG AAACTTCAGT CTCCAGACAT GG - #GAGGCAAT1200- GAGTCCAGCA TCTACTTGCG ACTGGCCCGG TCCACCCTGC TGCTCATCCC AC - #TATTCGGA1260- ATCCACTACA CAGTATTTGC CTTCTCCCCA GAGAATGTCA GCAAAAGGGA AA - #GACTCGTG1320- TTTGAGCTGG GGCTGGGCTC CTTCCAGGGC TTTGTGGTGG CTGTTCTCTA CT - #GTTTTCTG1380- AATGGTGAGG TACAAGCGGA GATCAAGCGA AAATGGCGAA GCTGGAAGGT GA - #ACCGTTAC1440- TTCGCTGTGG ACTTCAAGCA CCGACACCCG TCTCTGGCCA GCAGTGGGGT GA - #ATGGGGGC1500- ACCCAGCTCT CCATCCTGAG CAAGAGCAGC TCCCAAATCC GCATGTCTGG CC - #TCCCTGCT1560# 1575- (2) INFORMATION FOR SEQ ID NO:35:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 1659 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (ix) FEATURE: (A) NAME/KEY: mat.sub.-- - #peptide (B) LOCATION: 1..1659- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:35:- ATGGCTGGTG TCGTGCACGT TTCCCTGGCT GCTCACTGCG GGGCCTGTCC GT - #GGGGCCGG 60- GGCAGACTCC GCAAAGGACG CGCAGCCTGC AAGTCCGCGG CCCAGAGACA CA - #TTGGGGCT 120- GACCTGCCGC TGCTGTCAGT GGGAGGCCAG TGGTGCTGGC CAAGAAGTGT CA - #TGGCTGGT 180- GTCGTGCACG TTTCCCTGGC TGCTCTCCTC CTGCTGCCTA TGGCCCCTGC CA - #TGCATTCT 240- GACTGCATCT TCAAGAAGGA GCAAGCCATG TGCCTGGAGA AGATCCAGAG GG - #CCAATGAG 300- CTGATGGGCT TCAATGATTC CTCTCCAGGC TGTCCTGGGA TGTGGGACAA CA - #TCACGTGT 360- TGGAAGCCCG CCCATGTGGG TGAGATGGTC CTGGTCAGCT GCCCTGAGCT CT - #TCCGAATC 420- TTCAACCCAG ACCAAGTCTG GGAGACCGAA ACCATTGGAG AGTCTGATTT TG - #GTGACAGT 480- AACTCCTTAG ATCTCTCAGA CATGGGAGTG GTGAGCCGGA ACTGCACGGA GG - #ATGGCTGG 540- TCGGAACCCT TCCCTCATTA CTTTGATGCC TGTGGGTTTG ATGAATATGA AT - #CTGAGACT 600- GGGGACCAGG ATTATTACTA CCTGTCAGTG AAGGCCCTCT ACACGGTTGG CT - #ACAGCACA 660- TCCCTCGTCA CCCTCACCAC TGCCATGGTC ATCCTTTGTC GCTTCCGGAA GC - #TGCACTGC 720- ACACGCAACT TCATCCACAT GAACCTGTTT GTGTCGTTCA TGCTGAGGGC GA - #TCTCCGTC 780- TTCATCAAAG ACTGGATTCT GTATGCGGAG CAGGACAGCA ACCACTGCTT CA - #TCTCCACT 840- GTGGAATGTA AGGCCGTCAT GGTTTTCTTC CACTACTGTG TTGTGTCCAA CT - #ACTTCTGG 900- CTGTTCATCG AGGGCCTGTA CCTCTTCACT CTGCTGGTGG AGACCTTCTT CC - #CTGAAAGG 960- AGATACTTCT ACTGGTACAC CATCATTGGC TGGGGGACCC CAACTGTGTG TG - #TGACAGTG1020- TGGGCTACGC TGAGACTCTA CTTTGATGAC ACAGGCTGCT GGGATATGAA TG - #ACAGCACA1080- GCTCTGTGGT GGGTGATCAA AGGCCCTGTG GTTGGCTCTA TCATGGTTAA CT - #TTGTGCTT1140- TTTATTGGCA TTATCGTCAT CCTTGTGCAG AAACTTCAGT CTCCAGACAT GG - #GAGGCAAT1200- GAGTCCAGCA TCTACTTCAG CTGCGTGCAG AAATGCTACT GCAAGCCACA GC - #GGGCTCAG1260- CAGCACTCTT GCAAGATGTC AGAACTGTCC ACCATTACTC TGCGACTGGC CC - #GGTCCACC1320- CTGCTGCTCA TCCCACTATT CGGAATCCAC TACACAGTAT TTGCCTTCTC CC - #CAGAGAAT1380- GTCAGCAAAA GGGAAAGACT CGTGTTTGAG CTGGGGCTGG GCTCCTTCCA GG - #GCTTTGTG1440- GTGGCTGTTC TCTACTGTTT TCTGAATGGT GAGGTACAAG CGGAGATCAA GC - #GAAAATGG1500- CGAAGCTGGA AGGTGAACCG TTACTTCGCT GTGGACTTCA AGCACCGACA CC - #CGTCTCTG1560- GCCAGCAGTG GGGTGAATGG GGGCACCCAG CTCTCCATCC TGAGCAAGAG CA - #GCTCCCAA1620# 1659 TCCC TGCTGACAAT CTGGCCACC- (2) INFORMATION FOR SEQ ID NO:36:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 1656 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (ix) FEATURE: (A) NAME/KEY: mat.sub.-- - #peptide (B) LOCATION: 1..1656- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:36:- ATGGCTGGTG TCGTGCACGT TTCCCTGGCT GCTCACTGCG GGGCCTGTCC GT - #GGGGCCGG 60- GGCAGACTCC GCAAAGGACG CGCAGCCTGC AAGTCCGCGG CCCAGAGACA CA - #TTGGGGCT 120- GACCTGCCGC TGCTGTCAGT GGGAGGCCAG TGGTGCTGGC CAAGAAGTGT CA - #TGGCTGGT 180- GTCGTGCACG TTTCCCTGGC TGCTCTCCTC CTGCTGCCTA TGGCCCCTGC CA - #TGCATTCT 240- GACTGCATCT TCAAGAAGGA GCAAGCCATG TGCCTGGAGA AGATCCAGAG GG - #CCAATGAG 300- CTGATGGGCT TCAATGATTC CTCTCCAGGC TGTCCTGGGA TGTGGGACAA CA - #TCACGTGT 360- TGGAAGCCCG CCCATGTGGG TGAGATGGTC CTGGTCAGCT GCCCTGAGCT CT - #TCCGAATC 420- TTCAACCCAG ACCAAGTCTG GGAGACCGAA ACCATTGGAG AGTCTGATTT TG - #GTGACAGT 480- AACTCCTTAG ATCTCTCAGA CATGGGAGTG GTGAGCCGGA ACTGCACGGA GG - #ATGGCTGG 540- TCGGAACCCT TCCCTCATTA CTTTGATGCC TGTGGGTTTG ATGAATATGA AT - #CTGAGACT 600- GGGGACCAGG ATTATTACTA CCTGTCAGTG AAGGCCCTCT ACACGGTTGG CT - #ACAGCACA 660- TCCCTCGTCA CCCTCACCAC TGCCATGGTC ATCCTTTGTC GCTTCCGGAA GC - #TGCACTGC 720- ACACGCAACT TCATCCACAT GAACCTGTTT GTGTCGTTCA TGCTGAGGGC GA - #TCTCCGTC 780- TTCATCAAAG ACTGGATTCT GTATGCGGAG CAGGACAGCA ACCACTGCTT CA - #TCTCCACT 840- GTGGAATGTA AGGCCGTCAT GGTTTTCTTC CACTACTGTG TTGTGTCCAA CT - #ACTTCTGG 900- CTGTTCATCG AGGGCCTGTA CCTCTTCACT CTGCTGGTGG AGACCTTCTT CC - #CTGAAAGG 960- AGATACTTCT ACTGGTACAC CATCATTGGC TGGGGGACCC CAACTGTGTG TG - #TGACAGTG1020- TGGGCTACGC TGAGACTCTA CTTTGATGAC ACAGGCTGCT GGGATATGAA TG - #ACAGCACA1080- GCTCTGTGGT GGGTGATCAA AGGCCCTGTG GTTGGCTCTA TCATGGTTAA CT - #TTGTGCTT1140- TTTATTGGCA TTATCGTCAT CCTTGTGCAG AAACTTCAGT CTCCAGACAT GG - #GAGGCAAT1200- GAGTCCAGCA TCTACTTCTG CGTGCAGAAA TGCTACTGCA AGCCACAGCG GG - #CTCAGCAG1260- CACTCTTGCA AGATGTCAGA ACTGTCCACC ATTACTCTGC GACTGGCCCG GT - #CCACCCTG1320- CTGCTCATCC CACTATTCGG AATCCACTAC ACAGTATTTG CCTTCTCCCC AG - #AGAATGTC1380- AGCAAAAGGG AAAGACTCGT GTTTGAGCTG GGGCTGGGCT CCTTCCAGGG CT - #TTGTGGTG1440- GCTGTTCTCT ACTGTTTTCT GAATGGTGAG GTACAAGCGG AGATCAAGCG AA - #AATGGCGA1500- AGCTGGAAGG TGAACCGTTA CTTCGCTGTG GACTTCAAGC ACCGACACCC GT - #CTCTGGCC1560- AGCAGTGGGG TGAATGGGGG CACCCAGCTC TCCATCCTGA GCAAGAGCAG CT - #CCCAAATC1620# 1656 CTGC TGACAATCTG GCCACC- (2) INFORMATION FOR SEQ ID NO:37:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 1659 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (ix) FEATURE: (A) NAME/KEY: mat.sub.-- - #peptide (B) LOCATION: 1..1659- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:37:- ATGGCTGGTG TCGTGCACGT TTCCCTGGCT GCTCACTGCG GGGCCTGTCC GT - #GGGGCCGG 60- GGCAGACTCC GCAAAGGACG CGCAGCCTGC AAGTCCGCGG CCCAGAGACA CA - #TTGGGGCT 120- GACCTGCCGC TGCTGTCAGT GGGAGGCCAG TGGTGCTGGC CAAGAAGTGT CA - #TGGCTGGT 180- GTCGTGCACG TTTCCCTGGC TGCTCTCCTC CTGCTGCCTA TGGCCCCTGC CA - #TGCATTCT 240- GACTGCATCT TCAAGAAGGA GCAAGCCATG TGCCTGGAGA AGATCCAGAG GG - #CCAATGAG 300- CTGATGGGCT TCAATGATTC CTCTCCAGGC TGTCCTGGGA TGTGGGACAA CA - #TCACGTGT 360- TGGAAGCCCG CCCATGTGGG TGAGATGGTC CTGGTCAGCT GCCCTGAGCT CT - #TCCGAATC 420- TTCAACCCAG ACCAAGTCTG GGAGACCGAA ACCATTGGAG AGTCTGATTT TG - #GTGACAGT 480- AACTCCTTAG ATCTCTCAGA CATGGGAGTG GTGAGCCGGA ACTGCACGGA GG - #ATGGCTGG 540- TCGGAACCCT TCCCTCATTA CTTTGATGCC TGTGGGTTTG ATGAATATGA AT - #CTGAGACT 600- GGGGACCAGG ATTATTACTA CCTGTCAGTG AAGGCCCTCT ACACGGTTGG CT - #ACAGCACA 660- TCCCTCGTCA CCCTCACCAC TGCCATGGTC ATCCTTTGTC GCTTCCGGAA GC - #TGCACTGC 720- ACACGCAACT TCATCCACAT GAACCTGTTT GTGTCGTTCA TGCTGAGGGC GA - #TCTCCGTC 780- TTCATCAAAG ACTGGATTCT GTATGCGGAG CAGGACAGCA ACCACTGCTT CA - #TCTCCACT 840- GTGGAATGTA AGGCCGTCAT GGTTTTCTTC CACTACTGTG TTGTGTCCAA CT - #ACTTCTGG 900- CTGTTCATCG AGGGCCTGTA CCTCTTCACT CTGCTGGTGG AGACCTTCTT CC - #CTGAAAGG 960- AGATACTTCT ACTGGTACAC CATCATTGGC TGGGGGACCC CAACTGTGTG TG - #TGACAGTG1020- TGGGCTACGC TGAGACTCTA CTTTGATGAC ACAGGCTGCT GGGATATGAA TG - #ACAGCACA1080- GCTCTGTGGT GGGTGATCAA AGGCCCTGTG GTTGGCTCTA TCATGGTTAA CT - #TTGTGCTT1140- TTTATTGGCA TTATCGTCAT CCTTGTGCAG AAACTTCAGT CTCCAGACAT GG - #GAGGCAAT1200- GAGTCCAGCA TCTACTTAAC AAATTTAAGC CCGCGAGTCC CCAAGAAAGC CC - #GAGAGGAC1260- CCCCTGCCTG TGCCCTCAGA CCAGCATTCA CTCCCTTTCC TGCGACTGGC CC - #GGTCCACC1320- CTGCTGCTCA TCCCACTATT CGGAATCCAC TACACAGTAT TTGCCTTCTC CC - #CAGAGAAT1380- GTCAGCAAAA GGGAAAGACT CGTGTTTGAG CTGGGGCTGG GCTCCTTCCA GG - #GCTTTGTG1440- GTGGCTGTTC TCTACTGTTT TCTGAATGGT GAGGTACAAG CGGAGATCAA GC - #GAAAATGG1500- CGAAGCTGGA AGGTGAACCG TTACTTCGCT GTGGACTTCA AGCACCGACA CC - #CGTCTCTG1560- GCCAGCAGTG GGGTGAATGG GGGCACCCAG CTCTCCATCC TGAGCAAGAG CA - #GCTCCCAA1620# 1659 TCCC TGCTGACAAT CTGGCCACC- (2) INFORMATION FOR SEQ ID NO:38:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 2814 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (ix) FEATURE: (A) NAME/KEY: mat.sub.-- - #peptide (B) LOCATION: 498..2036- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:38:- TGGCCTGCAC CCCACCCCCC AGCCTGCGAA GACGGGGGGA GGCGGTGGTC GG - #TCGCCTCC 60- CTCCTGCCCC CGGCCTGGCT TCGCGGTGGA GGCGGTGCCT CTCCGGCAAG GC - #AGACCAGG 120- CTGGGCGGAC GCGCGGCGCG GGGCGGGCTA GGGAAGGCCG GGGGCCTCGC GC - #TCGGGCCC 180- CGGGCGGCGA CTGACAGCGG CGGCGGCGGC GGCAGCGGCT CCAAGGCGAG CG - #TGGTCCCC 240- GCGTGCGCAC AAGCTCGCCG CCGCGCAGGG ACCCACGGAC ACCGGCGCCG GG - #CGGACACA 300- CAGACGCGGA GATCGGGCTC TACGCGCGCT ACTCAGCGCA CGAGCTCCCC AT - #CCCTGGGC 360- GGAGCGGGGC GCGGACTCGC CGCTGCGCGC CCTCCCCGCG GAGTCTGCCC CG - #GGCAGACC 420- CGCAGCCCGC GGCCCCGCCG CGAGGCCCCT GGGTGAGCAG CCTGTAGACA CC - #TGGGGTTG 480- AGCAGTGGCG GCTGTGAATG AGAGGCGGGC GGCACTGGCC CGAGCCGCCT TG - #CAGGCTGA 540- GAAGCGTCAT GGCCAGCATC GCGCAGGTCT CCCTGGCTGC TCTCCTCCTG CT - #GCCTATGG 600- CCACCGCCAT GCATTCCGAC TGCATCTTCA AGAAGGAGCA AGCCATGTGC CT - #GGAGAAGA 660- TCCAGAGGGT GAATGACCTG ATGGGCTTGA ATGACTCCTC CCCAGGGTGC CC - #TGGGATGT 720- GGGACAACAT CACGTGTTGG AAGCCCGCCC ACGTGGGTGA GATGGTCCTG GT - #CAGTTGCC 780- CTGAACTCTT CCGAATCTTC AACCCAGACC AAGTCTGGGA GACGGAAACC AT - #CGGAGAGT 840- TCGGTTTTGC AGACAGTAAA TCCTTGGATC TCTCAGACAT GAGGGTGGTG AG - #CCGGAATT 900- GCACGGAGGA TGGATGGTCA GAGCCATTCC CTCATTATTT CGATGCCTGT GG - #GTTTGAGG 960- AGTACGAATC TGAGACTGGG GACCAGGATT ACTACTACCT GTCAGTGAAG GC - #CCTGTACA1020- CAGTTGGCTA CAGCACGTCC CTCGTCACCC TCACCACTGC CATGGTCATC CT - #GTGTCGTT1080- TCCGGAAGCT GCACTGCACC CGCAACTTCA TCCACATGAA CCTCTTCGTG TC - #GTTTATGC1140- TGAGGGCCAT CTCCGTCTTC ATCAAAGACT GGATCCTCTA TGCTGAGCAG GA - #CAGCAATC1200- ACTGCTTTGT CTCCACTGTG GAATGCAAGG CTGTGATGGT TTTCTTCCAC TA - #CTGTGTTG1260- TATCCAACTA CTTCTGGCTG TTCATCGAGG GCCTGTATCT CTTCACCCTG CT - #GGTGGAGA1320- CCTTCTTCCC CGAGAGGAGA TATTTCTACT GGTACATCAT CATTGGCTGG GG - #GACACCAA1380- CTGTGTGTGT GTCTGTGTGG GCTATGCTGA GGCTCTACTT CGATGACACA GG - #CTGCTGGG1440- ATATGAATGA CAACACGGCT CTGTGGTGGG TGATCAAAGG CCCTGTAGTT GG - #CTCCATAA1500- TGGTTAATTT TGTGCTCTTC ATCGGCATCA TTGTCATCCT TGTGCAGAAA CT - #TCAGTCTC1560- CAGACATGGG AGGCAACGAG TCCAGCATCT ACTTCAGCTG CGTGCAGAAA TG - #CTACTGCA1620- AGCCACAGCG GGCTCAGCAG CACTCTTGCA AGATGTCAGA ACTGTCCACC AT - #TACTCTAC1680- GGCTCGCCAG GTCCACCTTG CTGCTCATCC CACTCTTTGG AATCCACTAC AC - #TGTCTTTG1740- CTTTCTCCCC GGAGAACGTC AGCAAGAGGG AGAGACTGGT GTTTGAGCTG GG - #TCTGGGCT1800- CCTTCCAGGG CTTTGTGGTG GCTGTTCTCT ATTGCTTTCT GAATGGAGAG GT - #GCAGGCGG1860- AGATCAAGAG GAAGTGGCGG AGCTGGAAGG TGAACCGCTA CTTCACCATG GA - #CTTCAAGC1920- ACCGGCACCC ATCCCTGGCC AGCAGCGGGG TGAACGGGGG CACCCAGCTC TC - #CATCCTGA1980- GCAAGAGCAG CTCCCAGATC CGCATGTCTG GGCTTCCGGC CGACAACCTG GC - #CACCTGAG2040- CCCACCCTGC CCCCTCCTCT CCTCTGTACG CAGGCTGGGG CTGTGGTGGG GC - #GCCGGCCC2100- ACGCATGTTG TGCCTCTTCT CGCCTTCGGG CAGGCCCCGG GCTGGGCGCC TG - #GCCCCCGA2160- GGTTGGAGAA GGATGCGGGA CAGGCAGCTG TTTAGCCTTC CTGTTTTGGC GC - #TGGCCCAA2220- CCACCGTGGG TCCCTGGGCC TGCACCCAGA CATGTAATAC TCCTTAATTG GG - #AAGTCATC2280- CATTCTTTCC CTTTCCCAAG TCCTTGCTTA TTAAGAGGTT CAAGTCACCT AC - #CCAATTCA2340- GAAGCTTAAG TAACCACTAA CCACCGTGAC TGCGTGGGAG GCCTCCCATG GG - #CTGAGCTA2400- CTGACTTGGC TTTGGGGGCC TTGGGCTGGG GCCCTCCTTA AAGCCCCCCC TG - #AAATTGTC2460- GGACCTCAAA GTGTGACTCC TTTGAGTCTA CTCGCCACCC CCGTGGCCCT TT - #GCAGCCCT2520- GGTCCAGTCA CCGAGGTTAC TGGAAGTCCA GCTTGGATGG CCAGACAGCT TT - #TTGGCACA2580- GGCAGACCCA TGCTCACCCA ACATTTTAGT GTCCAGGTGC CCAGGTGCCC AG - #GTGCCCAG2640- CTCCTGGGCA TCAGACAGTG GGAAAGCTCC AGGGATCTAC CATTCAGAGA CT - #TCAGTTTG2700- GATGTAGGGC TAAGGCCAGA GAAAAGTTCT GGAGCTTTTC ATTTGGCCCA AG - #AAAAAACT2760- GCCAAGATCC AGAAAAGTGG ATCTGAGTGG AATTTAGATG CAAAGAGCTT GG - #AG2814- (2) INFORMATION FOR SEQ ID NO:39:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 2730 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (ix) FEATURE: (A) NAME/KEY: mat.sub.-- - #peptide (B) LOCATION: 498..1952- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:39:- TGGCCTGCAC CCCACCCCCC AGCCTGCGAA GACGGGGGGA GGCGGTGGTC GG - #TCGCCTCC 60- CTCCTGCCCC CGGCCTGGCT TCGCGGTGGA GGCGGTGCCT CTCCGGCAAG GC - #AGACCAGG 120- CTGGGCGGAC GCGCGGCGCG GGGCGGGCTA GGGAAGGCCG GGGGCCTCGC GC - #TCGGGCCC 180- CGGGCGGCGA CTGACAGCGG CGGCGGCGGC GGCAGCGGCT CCAAGGCGAG CG - #TGGTCCCC 240- GCGTGCGCAC AAGCTCGCCG CCGCGCAGGG ACCCACGGAC ACCGGCGCCG GG - #CGGACACA 300- CAGACGCGGA GATCGGGCTC TACGCGCGCT ACTCAGCGCA CGAGCTCCCC AT - #CCCTGGGC 360- GGAGCGGGGC GCGGACTCGC CGCTGCGCGC CCTCCCCGCG GAGTCTGCCC CG - #GGCAGACC 420- CGCAGCCCGC GGCCCCGCCG CGAGGCCCCT GGGTGAGCAG CCTGTAGACA CC - #TGGGGTTG 480- AGCAGTGGCG GCTGTGAATG AGAGGCGGGC GGCACTGGCC CGAGCCGCCT TG - #CAGGCTGA 540- GAAGCGTCAT GGCCAGCATC GCGCAGGTCT CCCTGGCTGC TCTCCTCCTG CT - #GCCTATGG 600- CCACCGCCAT GCATTCCGAC TGCATCTTCA AGAAGGAGCA AGCCATGTGC CT - #GGAGAAGA 660- TCCAGAGGGT GAATGACCTG ATGGGCTTGA ATGACTCCTC CCCAGGGTGC CC - #TGGGATGT 720- GGGACAACAT CACGTGTTGG AAGCCCGCCC ACGTGGGTGA GATGGTCCTG GT - #CAGTTGCC 780- CTGAACTCTT CCGAATCTTC AACCCAGACC AAGTCTGGGA GACGGAAACC AT - #CGGAGAGT 840- TCGGTTTTGC AGACAGTAAA TCCTTGGATC TCTCAGACAT GAGGGTGGTG AG - #CCGGAATT 900- GCACGGAGGA TGGATGGTCA GAGCCATTCC CTCATTATTT CGATGCCTGT GG - #GTTTGAGG 960- AGTACGAATC TGAGACTGGG GACCAGGATT ACTACTACCT GTCAGTGAAG GC - #CCTGTACA1020- CAGTTGGCTA CAGCACGTCC CTCGTCACCC TCACCACTGC CATGGTCATC CT - #GTGTCGTT1080- TCCGGAAGCT GCACTGCACC CGCAACTTCA TCCACATGAA CCTCTTCGTG TC - #GTTTATGC1140- TGAGGGCCAT CTCCGTCTTC ATCAAAGACT GGATCCTCTA TGCTGAGCAG GA - #CAGCAATC1200- ACTGCTTTGT CTCCACTGTG GAATGCAAGG CTGTGATGGT TTTCTTCCAC TA - #CTGTGTTG1260- TATCCAACTA CTTCTGGCTG TTCATCGAGG GCCTGTATCT CTTCACCCTG CT - #GGTGGAGA1320- CCTTCTTCCC CGAGAGGAGA TATTTCTACT GGTACATCAT CATTGGCTGG GG - #GACACCAA1380- CTGTGTGTGT GTCTGTGTGG GCTATGCTGA GGCTCTACTT CGATGACACA GG - #CTGCTGGG1440- ATATGAATGA CAACACGGCT CTGTGGTGGG TGATCAAAGG CCCTGTAGTT GG - #CTCCATAA1500- TGGTTAATTT TGTGCTCTTC ATCGGCATCA TTGTCATCCT TGTGCAGAAA CT - #TCAGTCTC1560- CAGACATGGG AGGCAACGAG TCCAGCATCT ACTTACGGCT CGCCAGGTCC AC - #CTTGCTGC1620- TCATCCCACT CTTTGGAATC CACTACACTG TCTTTGCTTT CTCCCCGGAG AA - #CGTCAGCA1680- AGAGGGAGAG ACTGGTGTTT GAGCTGGGTC TGGGCTCCTT CCAGGGCTTT GT - #GGTGGCTG1740- TTCTCTATTG CTTTCTGAAT GGAGAGGTGC AGGCGGAGAT CAAGAGGAAG TG - #GCGGAGCT1800- GGAAGGTGAA CCGCTACTTC ACCATGGACT TCAAGCACCG GCACCCATCC CT - #GGCCAGCA1860- GCGGGGTGAA CGGGGGCACC CAGCTCTCCA TCCTGAGCAA GAGCAGCTCC CA - #GATCCGCA1920- TGTCTGGGCT TCCGGCCGAC AACCTGGCCA CCTGAGCCCA CCCTGCCCCC TC - #CTCTCCTC1980- TGTACGCAGG CTGGGGCTGT GGTGGGGCGC CGGCCCACGC ATGTTGTGCC TC - #TTCTCGCC2040- TTCGGGCAGG CCCCGGGCTG GGCGCCTGGC CCCCGAGGTT GGAGAAGGAT GC - #GGGACAGG2100- CAGCTGTTTA GCCTTCCTGT TTTGGCGCTG GCCCAACCAC CGTGGGTCCC TG - #GGCCTGCA2160- CCCAGACATG TAATACTCCT TAATTGGGAA GTCATCCATT CTTTCCCTTT CC - #CAAGTCCT2220- TGCTTATTAA GAGGTTCAAG TCACCTACCC AATTCAGAAG CTTAAGTAAC CA - #CTAACCAC2280- CGTGACTGCG TGGGAGGCCT CCCATGGGCT GAGCTACTGA CTTGGCTTTG GG - #GGCCTTGG2340- GCTGGGGCCC TCCTTAAAGC CCCCCCTGAA ATTGTCGGAC CTCAAAGTGT GA - #CTCCTTTG2400- AGTCTACTCG CCACCCCCGT GGCCCTTTGC AGCCCTGGTC CAGTCACCGA GG - #TTACTGGA2460- AGTCCAGCTT GGATGGCCAG ACAGCTTTTT GGCACAGGCA GACCCATGCT CA - #CCCAACAT2520- TTTAGTGTCC AGGTGCCCAG GTGCCCAGGT GCCCAGCTCC TGGGCATCAG AC - #AGTGGGAA2580- AGCTCCAGGG ATCTACCATT CAGAGACTTC AGTTTGGATG TAGGGCTAAG GC - #CAGAGAAA2640- AGTTCTGGAG CTTTTCATTT GGCCCAAGAA AAAACTGCCA AGATCCAGAA AA - #GTGGATCT2700# 2730 CAAA GAGCTTGGAG- (2) INFORMATION FOR SEQ ID NO:40:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 1869 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (ix) FEATURE: (A) NAME/KEY: mat.sub.-- - #peptide (B) LOCATION: 77..1477- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:40:- CGAGTGGACA GTGGCAGGCG GTGACTGAAT CTCCAAGTCT GGAAACAATA GC - #CAGAGATA 60- GTGGCTGGGA AGCACCATGG CCAGAGTCCT GCAGCTCTCC CTGACTGCTC TC - #CTGCTGCC 120- TGTGGCTATT GCTATGCACT CTGACTGCAT CTTCAAGAAG GAGCAAGCCA TG - #TGCCTGGA 180- GAGGATCCAG AGGGCCAACG ACCTGATGGG ACTAAACGAG TCTTCCCCAG GT - #TGCCCTGG 240- CATGTGGGAC AATATCACAT GTTGGAAGCC AGCTCAAGTA GGTGAGATGG TC - #CTTGTAAG 300- CTGCCCTGAG GTCTTCCGGA TCTTCAACCC GGACCAAGTC TGGATGACAG AA - #ACCATAGG 360- AGATTCTGGT TTTGCCGATA GTAATTCCTT GGAGATCACA GACATGGGGG TC - #GTGGGCCG 420- GAACTGCACA GAGGACGGCT GGTCGGAGCC CTTCCCCCAC TACTTCGATG CT - #TGTGGGTT 480- TGATGATTAT GAGCCTGAGT CTGGAGATCA GGATTATTAC TACCTGTCGG TG - #AAGGCTCT 540- CTACACAGTC GGCTACAGCA CTTCCCTCGC CACCCTCACT ACTGCCATGG TC - #ATCTTGTG 600- CCGCTTCCGG AAGCTGCATT GCACTCGCAA CTTCATCCAC ATGAACCTGT TT - #GTATCCTT 660- CATGCTGAGG GCTATCTCCG TCTTCATCAA GGACTGGATC TTGTACGCCG AG - #CAGGACAG 720- CAGTCACTGC TTCGTTTCCA CCGTGGAGTG CAAAGCTGTC ATGGTTTTCT TC - #CACTACTG 780- CGTGGTGTCC AACTACTTCT GGCTGTTCAT TGAAGGCCTG TACCTCTTTA CA - #CTGCTGGT 840- GGAGACCTTC TTCCCTGAGA GGAGATATTT CTACTGGTAC ACCATCATCG GC - #TGGGGGAC 900- ACCTACTGTG TGTGTAACAG TGTGGGCTGT GCTGAGGCTC TATTTTGATG AT - #GCAGGATG 960- CTGGGATATG AATGACAGCA CAGCTCTGTG GTGGGTGATC AAAGGCCCCG TG - #GTTGGCTC1020- TATAATGGTT AACTTTGTGC TTTTCATCGG CATCATCATC ATCCTTGTAC AG - #AAGCTGCA1080- GTCCCCAGAC ATGGGAGGCA ACGAGTCCAG CATCTACTTA CGGCTGGCCC GC - #TCCACCCT1140- ACTGCTCATC CCACTCTTCG GAATCCACTA CACAGTATTC GCCTTCTCTC CA - #GAGAACGT1200- CAGCAAGAGG GAAAGACTTG TGTTTGAGCT TGGGCTGGGC TCCTTCCAGG GC - #TTTGTGGT1260- GGCTGTACTC TACTGCTTCC TGAATGGGGA GGTACAGGCA GAGATTAAGA GG - #AAATGGAG1320- GAGCTGGAAG GTGAACCGTT ACTTCACTAT GGACTTCAAG CACCGGCACC CG - #TCCCTGGC1380- CAGCAGTGGA GTAAATGGGG GAACCCAGCT GTCCATCCTG AGCAAGAGCA GC - #TCCCAGCT1440- CCGCATGTCC AGCCTCCCGG CCGACAACTT GGCCACCTGA GGCCTGTCTC CC - #TCCTCCTT1500- CTGCACAGGC TGGGGCTGCG GGCCAGTGCC TGAGCATGTT TGTGCCTCTC CC - #CTCTCCTT1560- GGGCAGGCCC TGGGTAGGAA GCTGGGCTCC TCCCCAAAGG GGAAGAGAGA GA - #TAGGGTAT1620- AGGCTGATAT TGCTCCTCCT GTTTGGGTCC CACCTACTGT GATTCATTGA GC - #CTGATTTG1680- ACATGTAAAT ACACCTCAAA TTTGGAAAGT TGCCCCATCT CTGCCCCCAA CC - #CATGCCCC1740- TGCTCACCTC TGCCAGGCCC CAGCTCAACC TACTGTGTCA AGGCCAGCCT CA - #GTGATAGT1800- CTGATCCCAG GTACAAGGCC TTGTGAGCTG AGGCTGAAAG GCCTGTTTTG GA - #GAGGCTGG1860# 1869- (2) INFORMATION FOR SEQ ID NO:41:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 2548 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (ix) FEATURE: (A) NAME/KEY: mat.sub.-- - #peptide (B) LOCATION: 77..1561- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:41:- CGAGTGGACA GTGGCAGGCG GTGACTGAAT CTCCAAGTCT GGAAACAATA GC - #CAGAGATA 60- GTGGCTGGGA AGCACCATGG CCAGAGTCCT GCAGCTCTCC CTGACTGCTC TC - #CTGCTGCC 120- TGTGGCTATT GCTATGCACT CTGACTGCAT CTTCAAGAAG GAGCAAGCCA TG - #TGCCTGGA 180- GAGGATCCAG AGGGCCAACG ACCTGATGGG ACTAAACGAG TCTTCCCCAG GT - #TGCCCTGG 240- CATGTGGGAC AATATCACAT GTTGGAAGCC AGCTCAAGTA GGTGAGATGG TC - #CTTGTAAG 300- CTGCCCTGAG GTCTTCCGGA TCTTCAACCC GGACCAAGTC TGGATGACAG AA - #ACCATAGG 360- AGATTCTGGT TTTGCCGATA GTAATTCCTT GGAGATCACA GACATGGGGG TC - #GTGGGCCG 420- GAACTGCACA GAGGACGGCT GGTCGGAGCC CTTCCCCCAC TACTTCGATG CT - #TGTGGGTT 480- TGATGATTAT GAGCCTGAGT CTGGAGATCA GGATTATTAC TACCTGTCGG TG - #AAGGCTCT 540- CTACACAGTC GGCTACAGCA CTTCCCTCGC CACCCTCACT ACTGCCATGG TC - #ATCTTGTG 600- CCGCTTCCGG AAGCTGCATT GCACTCGCAA CTTCATCCAC ATGAACCTGT TT - #GTATCCTT 660- CATGCTGAGG GCTATCTCCG TCTTCATCAA GGACTGGATC TTGTACGCCG AG - #CAGGACAG 720- CAGTCACTGC TTCGTTTCCA CCGTGGAGTG CAAAGCTGTC ATGGTTTTCT TC - #CACTACTG 780- CGTGGTGTCC AACTACTTCT GGCTGTTCAT TGAAGGCCTG TACCTCTTTA CA - #CTGCTGGT 840- GGAGACCTTC TTCCCTGAGA GGAGATATTT CTACTGGTAC ACCATCATCG GC - #TGGGGGAC 900- ACCTACTGTG TGTGTAACAG TGTGGGCTGT GCTGAGGCTC TATTTTGATG AT - #GCAGGATG 960- CTGGGATATG AATGACAGCA CAGCTCTGTG GTGGGTGATC AAAGGCCCCG TG - #GTTGGCTC1020- TATAATGGTT AACTTTGTGC TTTTCATCGG CATCATCATC ATCCTTGTAC AG - #AAGCTGCA1080- GTCCCCAGAC ATGGGAGGCA ACGAGTCCAG CATCTACTTC AGCTGCGTGC AG - #AAATGCTA1140- CTGCAAGCCA CAGCGGGCTC AGCAGCACTC TTGCAAGATG TCAGAACTAT CC - #ACCATTAC1200- TCTACGGCTG GCCCGCTCCA CCCTACTGCT CATCCCACTC TTCGGAATCC AC - #TACACAGT1260- ATTCGCCTTC TCTCCAGAGA ACGTCAGCAA GAGGGAAAGA CTTGTGTTTG AG - #CTTGGGCT1320- GGGCTCCTTC CAGGGCTTTG TGGTGGCTGT ACTCTACTGC TTCCTGAATG GG - #GAGGTACA1380- GGCAGAGATT AAGAGGAAAT GGAGGAGCTG GAAGGTGAAC CGTTACTTCA CT - #ATGGACTT1440- CAAGCACCGG CACCCGTCCC TGGCCAGCAG TGGAGTAAAT GGGGGAACCC AG - #CTGTCCAT1500- CCTGAGCAAG AGCAGCTCCC AGCTCCGCAT GTCCAGCCTC CCGGCCGACA AC - #TTGGCCAC1560- CTGAGGCCTG TCTCCCTCCT CCTTCTGCAC AGGCTGGGGC TGCGGGCCAG TG - #CCTGAGCA1620- TGTTTGTGCC TCTCCCCTCT CCTTGGGCAG GCCCTGGGTA GGAAGCTGGG CT - #CCTCCCCA1680- AAGGGGAAGA GAGAGATAGG GTATAGGCTG ATATTGCTCC TCCTGTTTGG GT - #CCCACCTA1740- CTGTGATTCA TTGAGCCTGA TTTGACATGT AAATACACCT CAAATTTGGA AA - #GTTGCCCC1800- ATCTCTGCCC CCAACCCATG CCCCTGCTCA CCTCTGCCAG GCCCCAGCTC AA - #CCTACTGT1860- GTCAAGGCCA GCCTCAGTGA TAGTCTGATC CCAGGTACAA GGCCTTGTGA GC - #TGAGGCTG1920- AAAGGCCTGT TTTGGAGAGG CTGGGGTAGT GCCCACCCCA GCAGCCTTTC AG - #CAAATTGA1980- CTTTGGATGT GGACCCTTCT CAGCCTGTAC CAAGTACTGC AGTTGGCTAG GG - #ATGCAGCT2040- CAGTTTCCTG AGCATCCTTT GGAGCAGGTC AACCTGAGGC TCCTTTTGCT TA - #CCCGACAT2100- CTAAGTTGTC CAGGTGCTCG GCTCCTGTGT GCCTGGATGA CGGGAGGGCT CC - #GGGGTCTT2160- TCAGTCAAAG ACTTACATTG AGGTGGGGTG AGAGTCAGAG AAAAGTTCTG GT - #GCTTTTCA2220- TTTGTTCTAA GAGCTGAGAG CCAGGAATGC AGAGTCAATT GGGAAGGAGA TG - #GGATAGCT2280- GATGATCTTA CCATGTCCAT GACTGTGCCC CTGATTCAAG ACCGGATCAT GT - #GGTGGCTT2340- TATTTCTACA CTTCTTGTCC ACAATGGACA GTCTGAGGAA GCTCTTCTTT CA - #GCCACAAC2400- AACCACAGAA AGCCCTTTCT TCTCCCCTCT TGTTTCTCCA TAAGTCAAAG CC - #ATGTTTAG2460- AACGGACCAG CCACCTTGCG ATGAAATCAC TGAGTTCTGA AGCAACTTTC AA - #TTTCCACG2520# 2548 CAGG GACGCCCC- (2) INFORMATION FOR SEQ ID NO:42:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 1664 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (ix) FEATURE: (A) NAME/KEY: mat.sub.-- - #peptide (B) LOCATION: 74..1648- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:42:- AGCCCAGAGA CACATTGGGG CTGACCTGCC GCTGCTGTCA GTGGGAGGCC AG - #TGGTGCTG 60- GCCAAGAAGT GTCATGGCTG GTGTCGTGCA CGTTTCCCTG GCTGCTCACT GC - #GGGGCCTG 120- TCCGTGGGGC CGGGGCAGAC TCCGCAAAGG ACGCGCAGCC TGCAAGTCCG CG - #GCCCAGAG 180- ACACATTGGG GCTGACCTGC CGCTGCTGTC AGTGGGAGGC CAGTGGTGCT GG - #CCAAGAAG 240- TGTCATGGCT GGTGTCGTGC ACGTTTCCCT GGCTGCTCTC CTCCTGCTGC CT - #ATGGCCCC 300- TGCCATGCAT TCTGACTGCA TCTTCAAGAA GGAGCAAGCC ATGTGCCTGG AG - #AAGATCCA 360- GAGGGCCAAT GAGCTGATGG GCTTCAATGA TTCCTCTCCA GGCTGTCCTG GG - #ATGTGGGA 420- CAACATCACG TGTTGGAAGC CCGCCCATGT GGGTGAGATG GTCCTGGTCA GC - #TGCCCTGA 480- GCTCTTCCGA ATCTTCAACC CAGACCAAGT CTGGGAGACC GAAACCATTG GA - #GAGTCTGA 540- TTTTGGTGAC AGTAACTCCT TAGATCTCTC AGACATGGGA GTGGTGAGCC GG - #AACTGCAC 600- GGAGGATGGC TGGTCGGAAC CCTTCCCTCA TTACTTTGAT GCCTGTGGGT TT - #GATGAATA 660- TGAATCTGAG ACTGGGGACC AGGATTATTA CTACCTGTCA GTGAAGGCCC TC - #TACACGGT 720- TGGCTACAGC ACATCCCTCG TCACCCTCAC CACTGCCATG GTCATCCTTT GT - #CGCTTCCG 780- GAAGCTGCAC TGCACACGCA ACTTCATCCA CATGAACCTG TTTGTGTCGT TC - #ATGCTGAG 840- GGCGATCTCC GTCTTCATCA AAGACTGGAT TCTGTATGCG GAGCAGGACA GC - #AACCACTG 900- CTTCATCTCC ACTGTGGAAT GTAAGGCCGT CATGGTTTTC TTCCACTACT GT - #GTTGTGTC 960- CAACTACTTC TGGCTGTTCA TCGAGGGCCT GTACCTCTTC ACTCTGCTGG TG - #GAGACCTT1020- CTTCCCTGAA AGGAGATACT TCTACTGGTA CACCATCATT GGCTGGGGGT CC - #CCAACTGT1080- GTGTGTGACA GTGTGGGCTA CGCTGAGACT CTACTTTGAT GACACAGGCT GC - #TGGGATAT1140- GAATGACAGC ACAGCTCTGT GGTGGGTGAT CAAAGGCCCT GTGGTTGGCT CT - #ATCATGGT1200- TAACTTTGTG CTTTTTATTG GCATTATCGT CATCCTTGTG CAGAAACTTC AG - #TCTCCAGA1260- CATGGGAGGC AATGAGTCCA GCATCTACTT GCGACTGGCC CGGTCCACCC TG - #CTGCTCAT1320- CCCACTATTC GGAATCCACT ACACAGTATT TGCCTTCTCC CCAGAGAATG TC - #AGCAAAAG1380- GGAAAGACTC GTGTTTGAGC TGGGGCTGGG CTCCTTCCAG GGCTTTGTGG TG - #GCTGTTCT1440- CTACTGTTTT CTGAATGGTG AGGTACAAGC GGAGATCAAG CGAAAATGGC GA - #AGCTGGAA1500- GGTGAACCGT TACTTCGCTG TGGACTTCAA GCACCGACAC CCGTCTCTGG CC - #AGCAGTGG1560- GGTGAATGGG GGCACCCAGC TCTCCATCCT GAGCAAGAGC AGCTCCCAAA TC - #CGCATGTC1620# 166 - #4GCCACCTG AGCCATGCTC CCCT- (2) INFORMATION FOR SEQ ID NO:43:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 1748 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (ix) FEATURE: (A) NAME/KEY: mat.sub.-- - #peptide (B) LOCATION: 74..1732- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:43:- AGCCCAGAGA CACATTGGGG CTGACCTGCC GCTGCTGTCA GTGGGAGGCC AG - #TGGTGCTG 60- GCCAAGAAGT GTCATGGCTG GTGTCGTGCA CGTTTCCCTG GCTGCTCACT GC - #GGGGCCTG 120- TCCGTGGGGC CGGGGCAGAC TCCGCAAAGG ACGCGCAGCC TGCAAGTCCG CG - #GCCCAGAG 180- ACACATTGGG GCTGACCTGC CGCTGCTGTC AGTGGGAGGC CAGTGGTGCT GG - #CCAAGAAG 240- TGTCATGGCT GGTGTCGTGC ACGTTTCCCT GGCTGCTCTC CTCCTGCTGC CT - #ATGGCCCC 300- TGCCATGCAT TCTGACTGCA TCTTCAAGAA GGAGCAAGCC ATGTGCCTGG AG - #AAGATCCA 360- GAGGGCCAAT GAGCTGATGG GCTTCAATGA TTCCTCTCCA GGCTGTCCTG GG - #ATGTGGGA 420- CAACATCACG TGTTGGAAGC CCGCCCATGT GGGTGAGATG GTCCTGGTCA GC - #TGCCCTGA 480- GCTCTTCCGA ATCTTCAACC CAGACCAAGT CTGGGAGACC GAAACCATTG GA - #GAGTCTGA 540- TTTTGGTGAC AGTAACTCCT TAGATCTCTC AGACATGGGA GTGGTGAGCC GG - #AACTGCAC 600- GGAGGATGGC TGGTCGGAAC CCTTCCCTCA TTACTTTGAT GCCTGTGGGT TT - #GATGAATA 660- TGAATCTGAG ACTGGGGACC AGGATTATTA CTACCTGTCA GTGAAGGCCC TC - #TACACGGT 720- TGGCTACAGC ACATCCCTCG TCACCCTCAC CACTGCCATG GTCATCCTTT GT - #CGCTTCCG 780- GAAGCTGCAC TGCACACGCA ACTTCATCCA CATGAACCTG TTTGTGTCGT TC - #ATGCTGAG 840- GGCGATCTCC GTCTTCATCA AAGACTGGAT TCTGTATGCG GAGCAGGACA GC - #AACCACTG 900- CTTCATCTCC ACTGTGGAAT GTAAGGCCGT CATGGTTTTC TTCCACTACT GT - #GTTGTGTC 960- CAACTACTTC TGGCTGTTCA TCGAGGGCCT GTACCTCTTC ACTCTGCTGG TG - #GAGACCTT1020- CTTCCCTGAA AGGAGATACT TCTACTGGTA CACCATCATT GGCTGGGGGA CC - #CCAACTGT1080- GTGTGTGACA GTGTGGGCTA CGCTGAGACT CTACTTTGAT GACACAGGCT GC - #TGGGATAT1140- GAATGACAGC ACAGCTCTGT GGTGGGTGAT CAAAGGCCCT GTGGTTGGCT CT - #ATCATGGT1200- TAACTTTGTG CTTTTTATTG GCATTATCGT CATCCTTGTG CAGAAACTTC AG - #TCTCCAGA1260- CATGGGAGGC AATGAGTCCA GCATCTACTT CAGCTGCGTG CAGAAATGCT AC - #TGCAAGCC1320- ACAGCGGGCT CAGCAGCACT CTTGCAAGAT GTCAGAACTG TCCACCATTA CT - #CTGCGACT1380- GGCCCGGTCC ACCCTGCTGC TCATCCCACT ATTCGGAATC CACTACACAG TA - #TTTGCCTT1440- CTCCCCAGAG AATGTCAGCA AAAGGGAAAG ACTCGTGTTT GAGCTGGGGC TG - #GGCTCCTT1500- CCAGGGCTTT GTGGTGGCTG TTCTCTACTG TTTTCTGAAT GGTGAGGTAC AA - #GCGGAGAT1560- CAAGCGAAAA TGGCGAAGCT GGAAGGTGAA CCGTTACTTC GCTGTGGACT TC - #AAGCACCG1620- ACACCCGTCT CTGGCCAGCA GTGGGGTGAA TGGGGGCACC CAGCTCTCCA TC - #CTGAGCAA1680- GAGCAGCTCC CAAATCCGCA TGTCTGGCCT CCCTGCTGAC AATCTGGCCA CC - #TGAGCCAT1740# 1748- (2) INFORMATION FOR SEQ ID NO:44:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 1745 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (ix) FEATURE: (A) NAME/KEY: mat.sub.-- - #peptide (B) LOCATION: 74..1729- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:44:- AGCCCAGAGA CACATTGGGG CTGACCTGCC GCTGCTGTCA GTGGGAGGCC AG - #TGGTGCTG 60- GCCAAGAAGT GTCATGGCTG GTGTCGTGCA CGTTTCCCTG GCTGCTCACT GC - #GGGGCCTG 120- TCCGTGGGGC CGGGGCAGAC TCCGCAAAGG ACGCGCAGCC TGCAAGTCCG CG - #GCCCAGAG 180- ACACATTGGG GCTGACCTGC CGCTGCTGTC AGTGGGAGGC CAGTGGTGCT GG - #CCAAGAAG 240- TGTCATGGCT GGTGTCGTGC ACGTTTCCCT GGCTGCTCTC CTCCTGCTGC CT - #ATGGCCCC 300- TGCCATGCAT TCTGACTGCA TCTTCAAGAA GGAGCAAGCC ATGTGCCTGG AG - #AAGATCCA 360- GAGGGCCAAT GAGCTGATGG GCTTCAATGA TTCCTCTCCA GGCTGTCCTG GG - #ATGTGGGA 420- CAACATCACG TGTTGGAAGC CCGCCCATGT GGGTGAGATG GTCCTGGTCA GC - #TGCCCTGA 480- GCTCTTCCGA ATCTTCAACC CAGACCAAGT CTGGGAGACC GAAACCATTG GA - #GAGTCTGA 540- TTTTGGTGAC AGTAACTCCT TAGATCTCTC AGACATGGGA GTGGTGAGCC GG - #AACTGCAC 600- GGAGGATGGC TGGTCGGAAC CCTTCCCTCA TTACTTTGAT GCCTGTGGGT TT - #GATGAATA 660- TGAATCTGAG ACTGGGGACC AGGATTATTA CTACCTGTCA GTGAAGGCCC TC - #TACACGGT 720- TGGCTACAGC ACATCCCTCG TCACCCTCAC CACTGCCATG GTCATCCTTT GT - #CGCTTCCG 780- GAAGCTGCAC TGCACACGCA ACTTCATCCA CATGAACCTG TTTGTGTCGT TC - #ATGCTGAG 840- GGCGATCTCC GTCTTCATCA AAGACTGGAT TCTGTATGCG GAGCAGGACA GC - #AACCACTG 900- CTTCATCTCC ACTGTGGAAT GTAAGGCCGT CATGGTTTTC TTCCACTACT GT - #GTTGTGTC 960- CAACTACTTC TGGCTGTTCA TCGAGGGCCT GTACCTCTTC ACTCTGCTGG TG - #GAGACCTT1020- CTTCCCTGAA AGGAGATACT TCTACTGGTA CACCATCATT GGCTGGGGGA CC - #CCAACTGT1080- GTGTGTGACA GTGTGGGCTA CGCTGAGACT CTACTTTGAT GACACAGGCT GC - #TGGGATAT1140- GAATGACAGC ACAGCTCTGT GGTGGGTGAT CAAAGGCCCT GTGGTTGGCT CT - #ATCATGGT1200- TAACTTTGTG CTTTTTATTG GCATTATCGT CATCCTTGTG CAGAAACTTC AG - #TCTCCAGA1260- CATGGGAGGC AATGAGTCCA GCATCTACTT CTGCGTGCAG AAATGCTACT GC - #AAGCCACA1320- GCGGGCTCAG CAGCACTCTT GCAAGATGTC AGAACTGTCC ACCATTACTC TG - #CGACTGGC1380- CCGGTCCACC CTGCTGCTCA TCCCACTATT CGGAATCCAC TACACAGTAT TT - #GCCTTCTC1440- CCCAGAGAAT GTCAGCAAAA GGGAAAGACT CGTGTTTGAG CTGGGGCTGG GC - #TCCTTCCA1500- GGGCTTTGTG GTGGCTGTTC TCTACTGTTT TCTGAATGGT GAGGTACAAG CG - #GAGATCAA1560- GCGAAAATGG CGAAGCTGGA AGGTGAACCG TTACTTCGCT GTGGACTTCA AG - #CACCGACA1620- CCCGTCTCTG GCCAGCAGTG GGGTGAATGG GGGCACCCAG CTCTCCATCC TG - #AGCAAGAG1680- CAGCTCCCAA ATCCGCATGT CTGGCCTCCC TGCTGACAAT CTGGCCACCT GA - #GCCATGCT1740# 1745- (2) INFORMATION FOR SEQ ID NO:45:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 1748 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (ix) FEATURE: (A) NAME/KEY: mat.sub.-- - #peptide (B) LOCATION: 74..1732- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:45:- AGCCCAGAGA CACATTGGGG CTGACCTGCC GCTGCTGTCA GTGGGAGGCC AG - #TGGTGCTG 60- GCCAAGAAGT GTCATGGCTG GTGTCGTGCA CGTTTCCCTG GCTGCTCACT GC - #GGGGCCTG 120- TCCGTGGGGC CGGGGCAGAC TCCGCAAAGG ACGCGCAGCC TGCAAGTCCG CG - #GCCCAGAG 180- ACACATTGGG GCTGACCTGC CGCTGCTGTC AGTGGGAGGC CAGTGGTGCT GG - #CCAAGAAG 240- TGTCATGGCT GGTGTCGTGC ACGTTTCCCT GGCTGCTCTC CTCCTGCTGC CT - #ATGGCCCC 300- TGCCATGCAT TCTGACTGCA TCTTCAAGAA GGAGCAAGCC ATGTGCCTGG AG - #AAGATCCA 360- GAGGGCCAAT GAGCTGATGG GCTTCAATGA TTCCTCTCCA GGCTGTCCTG GG - #ATGTGGGA 420- CAACATCACG TGTTGGAAGC CCGCCCATGT GGGTGAGATG GTCCTGGTCA GC - #TGCCCTGA 480- GCTCTTCCGA ATCTTCAACC CAGACCAAGT CTGGGAGACC GAAACCATTG GA - #GAGTCTGA 540- TTTTGGTGAC AGTAACTCCT TAGATCTCTC AGACATGGGA GTGGTGAGCC GG - #AACTGCAC 600- GGAGGATGGC TGGTCGGAAC CCTTCCCTCA TTACTTTGAT GCCTGTGGGT TT - #GATGAATA 660- TGAATCTGAG ACTGGGGACC AGGATTATTA CTACCTGTCA GTGAAGGCCC TC - #TACACGGT 720- TGGCTACAGC ACATCCCTCG TCACCCTCAC CACTGCCATG GTCATCCTTT GT - #CGCTTCCG 780- GAAGCTGCAC TGCACACGCA ACTTCATCCA CATGAACCTG TTTGTGTCGT TC - #ATGCTGAG 840- GGCGATCTCC GTCTTCATCA AAGACTGGAT TCTGTATGCG GAGCAGGACA GC - #AACCACTG 900- CTTCATCTCC ACTGTGGAAT GTAAGGCCGT CATGGTTTTC TTCCACTACT GT - #GTTGTGTC 960- CAACTACTTC TGGCTGTTCA TCGAGGGCCT GTACCTCTTC ACTCTGCTGG TG - #GAGACCTT1020- CTTCCCTGAA AGGAGATACT TCTACTGGTA CACCATCATT GGCTGGGGGA CC - #CCAACTGT1080- GTGTGTGACA GTGTGGGCTA CGCTGAGACT CTACTTTGAT GACACAGGCT GC - #TGGGATAT1140- GAATGACAGC ACAGCTCTGT GGTGGGTGAT CAAAGGCCCT GTGGTTGGCT CT - #ATCATGGT1200- TAACTTTGTG CTTTTTATTG GCATTATCGT CATCCTTGTG CAGAAACTTC AG - #TCTCCAGA1260- CATGGGAGGC AATGAGTCCA GCATCTACTT AACAAATTTA AGCCCGCGAG TC - #CCCAAGAA1320- AGCCCGAGAG GACCCCCTGC CTGTGCCCTC AGACCAGCAT TCACTCCCTT TC - #CTGCGACT1380- GGCCCGGTCC ACCCTGCTGC TCATCCCACT ATTCGGAATC CACTACACAG TA - #TTTGCCTT1440- CTCCCCAGAG AATGTCAGCA AAAGGGAAAG ACTCGTGTTT GAGCTGGGGC TG - #GGCTCCTT1500- CCAGGGCTTT GTGGTGGCTG TTCTCTACTG TTTTCTGAAT GGTGAGGTAC AA - #GCGGAGAT1560- CAAGCGAAAA TGGCGAAGCT GGAAGGTGAA CCGTTACTTC GCTGTGGACT TC - #AAGCACCG1620- ACACCCGTCT CTGGCCAGCA GTGGGGTGAA TGGGGGCACC CAGCTCTCCA TC - #CTGAGCAA1680- GAGCAGCTCC CAAATCCGCA TGTCTGGCCT CCCTGCTGAC AATCTGGCCA CC - #TGAGCCAT1740# 1748- (2) INFORMATION FOR SEQ ID NO:46:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 38 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:46:- His Ser Asp Gly Ile Phe Thr Asp Ser Tyr Se - #r Arg Tyr Arg Lys Gln# 15- Met Ala Val Lys Lys Tyr Leu Ala Ala Val Le - #u Gly Lys Arg Tyr Lys# 30- Gln Arg Val Lys Asn Lys 35- (2) INFORMATION FOR SEQ ID NO:47:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 27 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:47:- His Ser Asp Gly Ile Phe Thr Asp Ser Tyr Se - #r Arg Tyr Arg Lys Gln# 15- Met Ala Val Lys Lys Tyr Leu Ala Ala Val Le - #u# 25- (2) INFORMATION FOR SEQ ID NO:48:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 37 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear#Synthetic DNAECULE TYPE: Other nucleic acid,- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:48:# 37 ATGC GCCCTCCGAG CCCACCG- (2) INFORMATION FOR SEQ ID NO:49:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 37 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear#Synthetic DNAECULE TYPE: Other nucleic acid,- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:49:# 37 GACC AGGGAGACCT CCGCTTG- (2) INFORMATION FOR SEQ ID NO:50:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 16 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:50:- Asp Cys Ile Phe Lys Lys Glu Gln Ala Met Cy - #s Leu Glu Lys Ile Gln# 15- (2) INFORMATION FOR SEQ ID NO:51:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 47 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear#Synthetic DNAECULE TYPE: Other nucleic acid,- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:51:# 47GCAT DGCCTGCTCC TTCTTGAAGA TGTGGTC- (2) INFORMATION FOR SEQ ID NO:52:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 24 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: Other nucleic aci - #d, Synthetic DNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:52:# 24AGCA CAGC- (2) INFORMATION FOR SEQ ID NO:53:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 24 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear#Synthetic DNAECULE TYPE: Other nucleic acid,- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:53:# 24ATAC TGTG- (2) INFORMATION FOR SEQ ID NO:54:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 30 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear#Synthetic DNAECULE TYPE: Other nucleic acid,- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:54:# 30 ACTG CAAGCCACAG- (2) INFORMATION FOR SEQ ID NO:55:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 30 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear#Synthetic DNAECULE TYPE: Other nucleic acid,- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:55:# 30 CCTC AGACCAGCAT__________________________________________________________________________

Number	Date	Country
5-038755	Feb 1993	JPX
5-078290	Apr 1993	JPX
5-100669	Apr 1993	JPX
5-114446	May 1993	JPX
5-153963	Jun 1993	JPX
5-281413	Nov 1993	JPX
5-333175	Dec 1993	JPX

PACAP receptor protein, method for preparing said protein, and use thereof

Information

Patent Number

Date Filed

Date Issued

Inventors

Original Assignees

Examiners

Agents

CPC

US Classifications

Field of Search

US

International Classifications

Abstract

Description

Claims

Priority Claims (7)

Parent Case Info

US Referenced Citations (1)

Non-Patent Literature Citations (14)

Continuations (1)

Entry
Schafer et al. 1991. Eur. J. Biochem. 202: 951-8.
Bowie et al. 1990. Science 247: 1306-1310.
Reeck et al. 1987. Cell 50: 667.
Lewin. 1987. Science 237: 1570.
Ohtaki, et al., Biochemical and Biophysical Research Communications 171:838-844 (1990).
Finn and Hofmann, Methods In Enzymology, [27] vol. 184, pp. 245 (1990).
Hosoya, et al., Biochemical and Biophysical Research Communications 194(1):133-143 (1993).
Pisegna, et al., Proc. Natl. Acad. Sci. USA, 90:6345-6349 (1993).
Morrow, et al., Federation of European Biochemical Societies 329(1,2):99-105 (1993).
Spengler, et al., Nature, 365:170 (1993).
Hashimoto, et al., Neuron, 11:333-342 (1993).
Schafer, et al., Eur. J. Biochem., 217:823-830 (1993).
Larsson. 1994. Histology & Histopathology 9:615-629.
Neuron. vol. 8, 811-819 (1992).