Patent Application
20220144913
The present invention deals with methods and compositions for use in engineering cells to secrete therapeutic biomolecules into the blood stream in vivo in response to an individual's clinical needs.
Protein based therapeutics are powerful medicines, however their use is often hampered by very short half-lives and the necessity for intravenous or subcutaneous injections. Cell based therapeutics are ushering in the next wave of biomedical breakthroughs, with a predicted market size of 7.92 billion dollars by 2025 (Cell Therapy Market Size, Share, & Trends Analysis Report By Use (Clinical, Research), By Type (Stem & Non-stem Cells) By Therapy Type (Autologous, Allogenic), By Region, And Segment Forecasts, 2018-2025, Grand View Research, Report ID: GVR-2-68038-701-8; November 2018).
Described herein are methods and compositions for engineering cells (via gene therapy, e.g., using AAV) or cell-based therapies that have been genetically engineered ex vivo to dynamically secrete therapeutic proteins and/or peptides in one of three ways: 1.) As a response to a normal physiological cue for optimal drug delivery; 2.) In response to disease related molecular signals; and/or 3.) In response to an external stimuli. To date, no cell or gene therapeutic offers therapeutic peptide release dictated by the unique biology of the patient or the self-administration of a drug release trigger. Additionally, this invention obviates the need for recombinant protein production and frequent intravenous or subcutaneous injections; a common method of administration of therapeutic proteins or peptides due to poor stability as compared to small molecule drugs.
Thus, described herein are isolated nucleic acids comprising a sequence encoding a therapeutic protein, a promoter for expression of the therapeutic protein, and a response element that directs expression of the therapeutic protein in response to a physiological stimulus, optionally wherein the therapeutic protein further comprises a secretion signal, e.g., a secretion signal from Guassia princeps or Cypridina noctiluca luciferase, erythropoietin, follicle stimulating hormone, or insulin. The protein, promoter, and response element are not naturally associated in a living organism, and/or the secretion signal is exogenous, not normally associated with the protein, as a fusion protein.
Also provided herein are methods of treating a subject who has had or will have an organ transplant, the method comprising administering to the subject an organ that has been perfused with an effective amount of isolated cells comprising an isolated nucleic acid comprising a sequence encoding a therapeutic protein, a promoter for expression of the therapeutic protein, and a response element that directs expression of the therapeutic protein in response to a physiological stimulus, optionally wherein the therapeutic protein further comprises a secretion signal, e.g., a secretion signal from Guassia princeps or Cypridina noctiluca luciferase, erythropoietin, follicle stimulating hormone, or insulin.
Also provided are methods of monitoring post-transplantation surgical outcome in a subject who has had an organ transplant, the method comprising administering to the subject an organ that has been perfused with an effective amount of isolated cells comprising an isolated nucleic acid comprising a sequence encoding a therapeutic protein, a promoter for expression of the therapeutic protein, and a response element that directs expression of the therapeutic protein in response to a physiological stimulus, optionally wherein the therapeutic protein further comprises a secretion signal, e.g., a secretion signal from Guassia princeps or Cypridina noctiluca luciferase, erythropoietin, follicle stimulating hormone, or insulin.
Also provided herein are organs for implantation into a subject undergoing a solid organ transplant comprising, wherein the organ comprises an effective amount of isolated cells comprising an isolated nucleic acid comprising a sequence encoding a therapeutic protein, a promoter for expression of the therapeutic protein, and a response element that directs expression of the therapeutic protein in response to a physiological stimulus, optionally wherein the therapeutic protein further comprises a secretion signal, e.g., a secretion signal from Guassia princeps or Cypridina noctiluca luciferase, erythropoietin, follicle stimulating hormone, or insulin.
In some embodiments, the therapeutic protein is GLP1 (glucagon-like petide-1), IL-1RA (Interleukin-1 receptor antagonist), GP130, EPO (erythropoietin), or PTH (parathyroid hormone). Also provided is the use thereof, or an isolated cell comprising the isolated nucleic acid, in treating a subject who has rheumatoid arthritis, or who has had or will have an organ transplant.
In some embodiments, the therapeutic protein is IL-1RA or GP130 and the response element is from NFkB or Heat Shock Factor. Also provided is the use thereof, or an isolated cell comprising the isolated nucleic acid, in treating a subject who has rheumatoid arthritis, or who has had or will have an organ transplant. In subjects who will have an organ transplant, the organ can be treated with the nucleic acids or exogenously administered genetically-modified cells expressing the nucleic acids.
In some embodiments, the therapeutic protein is GLP1 and the response element is from Core Clock (i.e., the mammalian circadian clock transcriptional feedback loop). Also provided is the use thereof, or an isolated cell comprising the isolated nucleic acid, in treating a subject who has diabetes.
In some embodiments, the therapeutic protein is EPO and the response element is from Hypoxia Inducible Factor. Also provided is the use thereof, or an isolated cell comprising the isolated nucleic acid, in treating a subject who has chronic kidney disease-related anemia.
In some embodiments, the therapeutic protein is PTH and the response element is a calcium response element. Also provided is the use thereof, or an isolated cell comprising the isolated nucleic acid, in treating a subject who has hypoparathyroidism.
Also provided herein are vectors comprising the isolated nucleic acids described herein, and isolated cells comprising the isolated nucleic acids, and optionally expressing the therapeutic proteins.
Also provided are methods comprising administering to the subject an effective amount of the isolated nucleic acid, or isolated cells comprising the isolated nucleic acid, for treating diabetes, chronic kidney disease-related anemia, hypoparathyroidism, rheumatoid arthritis, or organ transplant rejection.
Also provided herein are methods of treating a subject who will have an organ transplant, the method comprising administering to the subject an effective amount of isolated cells comprising the isolated nucleic acids described herein, and isolated cells comprising the isolated nucleic acids, and optionally expressing the therapeutic proteins.
Also provided are methods of monitoring post-transplantation surgical outcome in a subject who has had an organ transplant, the method comprising administering to the subject an effective amount of isolated cells comprising the isolated nucleic acids described herein, and isolated cells comprising the isolated nucleic acids, and optionally expressing the therapeutic proteins, prior to receiving the organ transplant.
Herein, a “subject” and a “patient” are interchangeable and refer to any mammalian subject, e.g., a human or non-human (e.g., veterinary) subject.
Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Methods and materials are described herein for use in the present invention; other, suitable methods and materials known in the art can also be used. The materials, methods, and examples are illustrative only and not intended to be limiting. All publications, patent applications, patents, sequences, database entries, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control.
Other features and advantages of the invention will be apparent from the following detailed description and figures, and from the claims.
Described herein are methods and composition for use with cell therapeutics that dynamically deliver therapeutic peptides by engineering cells and viral vectors with genetic constructs (
Described herein are cell therapeutics capable of adapting to a patient's body clock by using genetic sensors of circadian rhythms to drive expression of therapeutic peptides that regulate appetite and glucose levels (
Table 1 provides sequences of exemplary response elements.
Table 2 provides sequences of exemplary therapeutic peptides.
Exemplary combinations of response elements and therapeutic peptides are shown in
Also provided herein are therapeutic peptides engineered for secretion from cell therapeutics. The molecules are created by fusing therapeutic peptides to secretion signals of previously characterized luciferases (
Table 3 provides sequences of exemplary peptide secretion signals.
Guassia
princeps
Cypridina
noctiluca
The peptide secretion signal can be fused to the N or C terminus of therapeutic peptide.
Nucleic Acids
Also described herein are nucleic acid molecules comprising response elements and sequences encoding a therapeutic peptide sequence, optionally including a peptide secretion signal, as described herein. Nucleic acid molecules comprising expression vectors can be used, e.g., for in vitro expression of the therapeutic peptide.
The nucleic acids encoding the selected therapeutic peptide can be inserted in an expression vector, to make an expression construct. A number of suitable vectors are known in the art, e.g., viral vectors including recombinant retroviruses, adenovirus, adeno-associated virus, and herpes simplex virus 1, adenovirus-derived vectors, or recombinant bacterial or eukaryotic plasmids. For example, the expression construct includes a response element and a coding region encoding the therapeutic peptide as described herein, as well as one of more of a promoter sequence, e.g., a promoter sequence that restricts expression to a selected cell type, a conditional promoter, or a strong general promoter; another enhancer sequence; untranslated regulatory sequences, e.g., a 5′ untranslated region (UTR), a 3′UTR; a polyadenylation site; and/or an insulator sequence. Such sequences are known in the art, and the skilled artisan would be able to select suitable sequences. See, e.g., Current Protocols in Molecular Biology, Ausubel, F. M. et al. (eds.) Greene Publishing Associates, (1989), Sections 9.10-9.14; Vancura (ed.), Transcriptional Regulation: Methods and Protocols (Methods in Molecular Biology (Book 809)) Humana Press; 2012 edition (2011) and other standard laboratory manuals.
Expression constructs can be administered in any biologically effective carrier, e.g., any formulation or composition capable of effectively delivering the component gene to cells in vivo. Viral vectors transfect cells directly; plasmid DNA can be delivered with the help of, for example, cationic liposomes (e.g., LIPOFECTIN) or derivatized (e.g. antibody conjugated), polylysine conjugates, gramicidin S, artificial viral envelopes or other such intracellular carriers, as well as direct injection of the gene construct or CaPO4 precipitation. In some embodiments, the nucleic acid is applied “naked” to a cell, i.e., is applied in a simple buffer without the use of any additional agents to enhance uptake. See, e.g., Current Protocols in Molecular Biology, Ausubel, F. M. et al. (eds.) Greene Publishing Associates, (1989), Sections 9.10-9.14 and other standard laboratory manuals.
The dynamic and inducible gene or cell therapeutics described herein have a number of applications. For example, diseases that involve inflammation, such as rheumatoid arthritis, can be treated by injecting the patient with cells or a viral vector, administered either locally (i.e., by injection into a joint) or systemically driving an anti-inflammatory therapeutic peptide from an inflammatory cytokine response element. The drug dosage delivered will depend on the severity of the inflammation, which correlates with the cytokine exposure of the therapeutic. The present therapeutics can also sense healthy physiological cues. For example, a person's body clock strongly regulates metabolic pathways at the transcriptional level, but it is also influenced by eating, travel across time zones, and other behaviors, making it very difficult to synchronize therapies to an individual's clock. The present methods can include delivering cells or nucleic acids engineered to express a response element-driven therapeutic peptide, optionally with a secretion signal as described herein.
Cell Therapy
In some embodiments, the methods include delivering therapeutic cells. Primary and secondary cells to be genetically engineered can be obtained from a variety of tissues and can include cell types that can be maintained and propagated in culture. For example, primary and secondary cells include pancreatic islet β cells, adipose cells, fibroblasts, keratinocytes, epithelial cells (e.g., mammary epithelial cells, intestinal epithelial cells), endothelial cells, glial cells, neural cells, formed elements of the blood (e.g., lymphocytes, bone marrow cells, dendritic cells, natural killer cells (Hölsken et al., Journal der Deutschen Dermatologischen Gesellschaft 2015, 23-28), cytotoxic T lymphocytes (Cooper et al. Cytotherapy 2006, 8(2):105-17), muscle cells (myoblasts) and precursors of these somatic cell types. The generation of adult cells that have been engineered from iPS or embryonic stem cells (e.g., differentiation of embryonic stem cells into mesenchymal stem cells) are also envisioned as a cell source for dynamically drug secreting cells. Primary cells are preferably obtained from the individual to whom the genetically engineered primary or secondary cells will be administered. However, primary cells may be obtained from a donor (i.e., an individual other than the recipient).
The term “primary cell” includes cells present in a suspension of cells isolated from a vertebrate tissue source (prior to their being plated, i.e., attached to a tissue culture substrate such as a dish or flask), cells present in an explant derived from tissue, both of the previous types of cells plated for the first time, and cell suspensions derived from these plated cells. The term “secondary cell” or “cell strain” refers to cells at all subsequent steps in culturing. Secondary cells are cell strains which consist of primary cells which have been passaged one or more times.
Primary or secondary cells of vertebrate, particularly mammalian, origin can be transfected with an exogenous nucleic acid sequence as described herein, and produce the encoded therapeutic peptide product in response to the appropriate physiological signal in vitro and in vivo, over extended periods of time.
The nucleic acid sequence can be introduced into a primary or a secondary cell, e.g., by homologous recombination as described, for example, in U.S. Pat. No. 5,641,670, the contents of which are incorporated herein by reference. In some embodiments, viral vectors, e.g., lentiviral expression vectors, are used. Viral vectors for use in the present methods and compositions include recombinant retroviruses, adenovirus, adeno-associated virus, alphavirus, and lentivirus, e.g., as described herein or known in the art.
The transfected primary or secondary cells can also include DNA encoding a selectable marker, which confers a selectable phenotype upon them, facilitating their identification and isolation.
Vertebrate tissue can be obtained by standard methods such a punch biopsy or other surgical methods of obtaining a tissue source of the primary cell type of interest. For example, a biopsy can be used to obtain bone marrow, as a source of cells, e.g. hematopoietic stem cells. A mixture of primary cells can be obtained from the tissue, using known methods, such as enzymatic digestion or explanting. If enzymatic digestion is used, enzymes such as collagenase, hyaluronidase, dispase, pronase, trypsin, elastase and chymotrypsin can be used.
The resulting primary cell mixture can be transfected directly, or it can be cultured first, removed from the culture plate and resuspended before transfection is carried out. Primary cells or secondary cells are combined with exogenous nucleic acid sequence to, e.g., stably integrate into their genomes, and treated in order to accomplish transfection. As used herein, the term “transfection” includes a variety of techniques for introducing an exogenous nucleic acid into a cell including calcium phosphate or calcium chloride precipitation, microinjection, DEAE-dextrin-mediated transfection, lipofection, electroporation or genome-editing using zinc-finger nucleases, transcription activator-like effector nuclease or the CRIPSR-Cas system, all of which are routine in the art (Kim et al (2010) Anal Bioanal Chem 397(8): 3173-3178; Hockemeyer et al. (2011) Nat. Biotechnol. 29:731-734; Feng, Z et al. (2013) Cell Res 23(10): 1229-1232; Jinek, M. et al. (2013) eLife 2:e00471; Wang et al (2013) Cell. 153(4): 910-918).
Transfected primary or secondary cells can be allowed to undergo sufficient numbers of doubling to produce either a clonal cell strain or a heterogeneous cell strain of sufficient size to provide the therapeutic protein to an individual in effective amounts. The number of required cells in a transfected clonal heterogeneous cell strain is variable and depends on a variety of factors, including but not limited to, the use of the transfected cells, the functional level of RED-peptide expression in the transfected cells, the site of implantation of the transfected cells (for example, the number of cells that can be used is limited by the anatomical site of implantation), and the age, surface area, and clinical condition of the patient.
As an alternative to primary or secondary differentiated cells, the methods can include using adult stem cells or induced pluripotent stem cells.
Adult Stem-Cell Based Therapy
Adult stem cell-based therapeutics offer an alternative strategy to modulating impaired function as described above, and have already been safely and successfully used in the clinic for certain hematopoietic diseases (Gratwohl et al., JAMA 2010, 303 (16): 1617-24; Mahla et al., International Journal of Cell Biology. 2016 (7): 1-24; Maguire et al., ACS Medicinal Chemistry Letters. 7 (5): 441-43). Adult stem cells have the ability to self-renew and to differentiate into specialized cell-types within the lineage of their tissue of origin. Adult stem cells, and the specialized cell-derived from them, are believed to be less likely rejected by the host immune system from which they originated, i.e., autologous stem cells. Stem cells have been identified and isolated from almost all tissues based on their expression of cell-surface proteins and in vitro characterization. Briefly, the tissue of interest can be obtained by standard methods such a punch biopsy or other surgical methods of obtaining a tissue source of the primary cell type of interest. The tissue of interest is then dissociated or homogenized by enzymatic digestion and/or physical dissociation using equipment that is commercially available and is generally known to those skilled in the art. If enzymatic digestion is used, enzymes such as collagenase, hyaluronidase, dispase, pronase, trypsin, elastase and chymotrypsin can be used, along with DNAses and RNAses. Purification of stem cells from the resulting cell mixture is now routinely accomplished by completing several rounds of fluorescent activated cell sorting (FACS) (Bosio et al., Adv. Biochem Engin, 2009, 114:23-72). Prior to being analyzed by flow cytometry, the resulting cell mixture is incubated for a set amount of time in the presence of antibodies conjugated to fluorescent dyes that can bind specific proteins solely expressed on the cell surface of the cell of interest or magnetic beads. For example, mesenchymal stem cells can be isolated from bone marrow, adipose tissue, and umbilical cord, using a combination of these specific cellular markers, e.g. Stro-1, CD146, CD106, CD271, and/or MSCA-1. Other cell types can be used, including T cells, HSCs, fibroblasts, and iPS cells.
The sorting results in a high number of viable adult stem cells that can be passaged in culture, and further enriched by undergoing multiple rounds of FACS. The enriched adult stem cells can be introduced into an individual to whom the product is to be delivered. Various routes of administration and various sites (e.g., renal sub capsular, subcutaneous, central nervous system (including intrathecal), intravascular, intrahepatic, intrasplanchnic, intraperitoneal (including intraomental), intramuscularly implantation) can be used. Once implanted in an individual, the adult stem cells survive, migrate to their appropriate anatomical site, optionally differentiate into a specialized cell-type and express the therapeutic peptide in response to the appropriate physiological stimulus.
Induced Pluripotent Stem (iPs) Cells and Trans-Differentiated Cells for Cell-Based Therapy
Within the field of stem cell biology, embryonic stem cells are considered the golden standard, as embryonic stem cells have the potential to differentiate into cells derived from any of the three germ layers, except for extraembryonic trophoblasts. Embryonic stem cells are therefore considered to be pluripotent. In recent years, it has been reported that induced pluripotent stem (iPS) cells can be established by introducing certain particular nuclear reprogramming substances to adult somatic cells in the form of DNA or protein (Takahashi, K et al., Cell (2007), 131, 131:861-872; Yu et al., Science 2007, 318:1917-1920; Takahashi and Yamanaka, Development 2013 140: 2457-2461; Martin, Front Med (Lausanne). 2017; 4: 229). iPS cells have properties almost equivalent to those of embryonic stem cells, such as pluripotency and growth capacity by self-renewal (Nakagawa, M. et al., Nat Biotech 2008, 26:101-106.
Briefly, adult somatic cells, preferentially keratinocytes, are isolated from the patient by biopsy or plucked hair (Aasen T. et al., Nat Protoc 2010, 5:371-382) and reprogrammed into iPS cells as described above. The cells are engineered by transfection with a construct as described herein. Before or after transfection, the iPS cells can be differentiated in vitro into a specialized cell-type of interest by culturing the cells under very specific conditions that are unique to each specialized cell type and known to those skilled in the art (Meng, G. et al Stem Cells Dev 2012, 21:2036-2048; Nakagawa, M. et al., Sci Rep 2014, 4:3594; Fitzsimmons et al., Stem Cells International, Volume 2018, Article ID 8031718, doi.org/10.1155/2018/8031718). Differentiated iPS cells can be introduced into an individual to whom the product is to be delivered. Various routes of administration and various sites (e.g., renal sub capsular, subcutaneous, central nervous system (including intrathecal), intravascular, intrahepatic, intra-splanchnic, intraperitoneal (including intraomental), intramuscularly implantation) can be used. Once implanted in an individual, the differentiated iPS cells survive, migrate to their appropriate anatomical site, and express cell type-specific proteins corresponding to the specialized cell-type (Hanna, J. et al. Science 2007, 318, 1920-1923; Nelson, T. J. et al., Circulation 2009, 120:408-416; Homma, K. et al., Stem Cells 2013, 1149-1159).
The transfected cells, e.g., cells produced as described herein, can be introduced into an individual to whom the product is to be delivered. Various routes of administration and various sites (e.g., renal sub capsular, subcutaneous, central nervous system (including intrathecal), intravascular, intrahepatic, intrasplanchnic, intraperitoneal (including intraomental), intramuscularly implantation) can be used. Once implanted in an individual, the transfected cells produce the RED-peptide product in response to the appropriate physiological cue.
The choice of cell type and method of delivering response element-driven therapeutic peptide genetic constructs to a patient can be selected depending on the specific clinical application targeted. Adoptive cell transfer strategies, which are already in clinical use, can be used to genetically integrate response element driven therapeutic peptide constructs into long-lived cells such as memory T-cells or hematopoietic stem cells for systemic drug administration. As another example, genetically engineered mesenchymal stem cells can be used for localized secretion into joint interstitial spaces.
For example, an individual who suffers from an inflammatory disorder (e.g., rheumatoid arthritis) is a candidate for implantation of cells producing a compound described herein, e.g., NF-kB inflammatory response driven expression of cytokine inhibitors IL1RA or GP130. The following provides additional examples of uses for the present compositions and methods.
Gene Therapy
The use of viral vectors, e.g., adenoassociated viral (AAV) vectors, is an alternative approach to systemically and dynamically release therapeutic peptides. Viral (e.g., AAV) particles carrying response element therapeutic peptide constructs within their genomic payloads can delivered directly into a patient via intramuscular injection, temporarily inducing dynamic peptide expression and secretion.
The nucleic acids described herein, e.g., nucleic acids encoding a therapeutic protein, a promoter for expression of the therapeutic protein, and a response element that directs expression of the therapeutic protein in response to a physiological stimulus, optionally wherein the therapeutic protein comprises a secretion signal, e.g,. from Guassia princeps or Cypridina noctiluca, can be incorporated into a gene construct to be used as a part of a gene therapy protocol. Expression constructs of such components can be administered in any effective carrier, e.g., any formulation or composition capable of effectively delivering the component gene to cells in vivo. Approaches include insertion of the gene in viral vectors, including recombinant retroviruses, adenovirus, adeno-associated virus, lentivirus, and herpes simplex virus-1, or recombinant bacterial or eukaryotic plasmids. Viral vectors transfect cells directly; plasmid DNA can be delivered naked or with the help of, for example, cationic liposomes (lipofectamine) or derivatized (e.g., antibody conjugated), polylysine conjugates, gramacidin S, artificial viral envelopes or other such intracellular carriers, as well as direct injection of the gene construct or CaPO4 precipitation carried out in vivo.
A preferred approach for in vivo introduction of nucleic acid into a cell is by use of a viral vector containing nucleic acid, e.g., a cDNA. Infection of cells with a viral vector has the advantage that a large proportion of the targeted cells can receive the nucleic acid. Additionally, molecules encoded within the viral vector, e.g., by a cDNA contained in the viral vector, are expressed efficiently in cells that have taken up viral vector nucleic acid.
Retrovirus vectors and adeno-associated virus vectors can be used as a recombinant gene delivery system for the transfer of exogenous genes in vivo, particularly into humans. These vectors provide efficient delivery of genes into cells, and the transferred nucleic acids are stably integrated into the chromosomal DNA of the host. The development of specialized cell lines (termed “packaging cells”) which produce only replication-defective retroviruses has increased the utility of retroviruses for gene therapy, and defective retroviruses are characterized for use in gene transfer for gene therapy purposes (for a review see Miller, Blood 76:271 (1990)). A replication defective retrovirus can be packaged into virions, which can be used to infect a target cell through the use of a helper virus by standard techniques. Protocols for producing recombinant retroviruses and for infecting cells in vitro or in vivo with such viruses can be found in Ausubel, et al., eds., Current Protocols in Molecular Biology, Greene Publishing Associates, (1989), Sections 9.10-9.14, and other standard laboratory manuals. Examples of suitable retroviruses include pLJ, pZIP, pWE and pEM which are known to those skilled in the art. Examples of suitable packaging virus lines for preparing both ecotropic and amphotropic retroviral systems include ΨCrip, ΨCre, Ψ2 and ΨAm. Retroviruses have been used to introduce a variety of genes into many different cell types, including epithelial cells, in vitro and/or in vivo (see for example Eglitis, et al. (1985) Science 230:1395-1398; Danos and Mulligan (1988) Proc. Natl. Acad. Sci. USA 85:6460-6464; Wilson et al. (1988) Proc. Natl. Acad. Sci. USA 85:3014-3018; Armentano et al. (1990) Proc. Natl. Acad. Sci. USA 87:6141-6145; Huber et al. (1991) Proc. Natl. Acad. Sci. USA 88:8039-8043; Ferry et al. (1991) Proc. Natl. Acad. Sci. USA 88:8377-8381; Chowdhury et al. (1991) Science 254:1802-1805; van Beusechem et al. (1992) Proc. Natl. Acad. Sci. USA 89:7640-7644; Kay et al. (1992) Human Gene Therapy 3:641-647; Dai et al. (1992) Proc. Natl. Acad. Sci. USA 89:10892-10895; Hwu et al. (1993) J. Immunol. 150:4104-4115; U.S. Pat. Nos. 4,868,116; 4,980,286; PCT Application WO 89/07136; PCT Application WO 89/02468; PCT Application WO 89/05345; and PCT Application WO 92/07573).
Another viral gene delivery system useful in the present methods utilizes adenovirus-derived vectors. The genome of an adenovirus can be manipulated, such that it encodes and expresses a gene product of interest but is inactivated in terms of its ability to replicate in a normal lytic viral life cycle. See, for example, Berkner et al., BioTechniques 6:616 (1988); Rosenfeld et al., Science 252:431-434 (1991); and Rosenfeld et al., Cell 68:143-155 (1992). Suitable adenoviral vectors derived from the adenovirus strain Ad type 5 d1324 or other strains of adenovirus (e.g., Ad2, Ad3, or Ad7 etc.) are known to those skilled in the art. Recombinant adenoviruses can be advantageous in certain circumstances, in that they are not capable of infecting non-dividing cells and can be used to infect a wide variety of cell types, including epithelial cells (Rosenfeld et al., (1992) supra). Furthermore, the virus particle is relatively stable and amenable to purification and concentration, and as above, can be modified so as to affect the spectrum of infectivity. Additionally, introduced adenoviral DNA (and foreign DNA contained therein) is not integrated into the genome of a host cell but remains episomal, thereby avoiding potential problems that can occur as a result of insertional mutagenesis in situ, where introduced DNA becomes integrated into the host genome (e.g., retroviral DNA). Moreover, the carrying capacity of the adenoviral genome for foreign DNA is large (up to 8 kilobases) relative to other gene delivery vectors (Berkner et al., supra; Haj-Ahmand and Graham, J. Virol. 57:267 (1986).
Yet another viral vector system useful for delivery of nucleic acids is the adeno-associated virus (AAV). Adeno-associated virus is a naturally occurring defective virus that requires another virus, such as an adenovirus or a herpes virus, as a helper virus for efficient replication and a productive life cycle. (For a review see Muzyczka et al., Curr. Topics in Micro. and Immunol. 158:97-129 (1992). It is also one of the few viruses that may integrate its DNA into non-dividing cells, and exhibits a high frequency of stable integration (see for example Flotte et al., Am. J. Respir. Cell. Mol. Biol. 7:349-356 (1992); Samulski et al., J. Virol. 63:3822-3828 (1989); and McLaughlin et al., J. Virol. 62:1963-1973 (1989). Vectors containing as little as 300 base pairs of AAV can be packaged and can integrate. Space for exogenous DNA is limited to about 4.5 kb. An AAV vector such as that described in Tratschin et al., Mol. Cell. Biol. 5:3251-3260 (1985) can be used to introduce DNA into cells. A variety of nucleic acids have been introduced into different cell types using AAV vectors (see for example Hermonat et al., Proc. Natl. Acad. Sci. USA 81:6466-6470 (1984); Tratschin et al., Mol. Cell. Biol. 4:2072-2081 (1985); Wondisford et al., Mol. Endocrinol. 2:32-39 (1988); Tratschin et al., J. Virol. 51:611-619 (1984); and Flotte et al., J. Biol. Chem. 268:3781-3790 (1993).
In addition to viral transfer methods, such as those illustrated above, non-viral methods can also be employed to cause expression of a nucleic acid compound described herein (e.g., a therapeutic protein, a promoter for expression of the therapeutic protein, and a response element that directs expression of the therapeutic protein in response to a physiological stimulus, optionally wherein the therapeutic protein comprises a secretion signal) in the tissue of a subject. Typically non-viral methods of gene transfer rely on the normal mechanisms used by mammalian cells for the uptake and intracellular transport of macromolecules. In some embodiments, non-viral gene delivery systems can rely on endocytic pathways for the uptake of the subject gene by the targeted cell. Exemplary gene delivery systems of this type include liposomal derived systems, poly-lysine conjugates, and artificial viral envelopes. Other embodiments include plasmid injection systems such as are described in Meuli et al., J. Invest. Dermatol. 116(1):131-135 (2001); Cohen et al., Gene Ther. 7(22):1896-905 (2000); or Tam et al., Gene Ther. 7(21):1867-74 (2000).
In some embodiments, a nucleic acid encoding a therapeutic protein, a promoter for expression of the therapeutic protein, and a response element that directs expression of the therapeutic protein in response to a physiological stimulus, optionally wherein the therapeutic protein comprises a secretion signal, is entrapped in liposomes bearing positive charges on their surface (e.g., lipofectins), which can be tagged with antibodies against cell surface antigens of the target tissue (Mizuno et al., No Shinkei Geka 20:547-551 (1992); PCT publication WO91/06309; Japanese patent application 1047381; and European patent publication EP-A-43075).
In clinical settings, the gene delivery systems for the therapeutic gene can be introduced into a subject by any of a number of methods, each of which is familiar in the art. For instance, a pharmaceutical preparation of the gene delivery system can be introduced systemically, e.g., by intravenous injection, and specific transduction of the protein in the target cells will occur predominantly from specificity of transfection, provided by the gene delivery vehicle, cell-type or tissue-type expression due to the transcriptional regulatory sequences controlling expression of the receptor gene, or a combination thereof. In other embodiments, initial delivery of the recombinant gene is more limited, with introduction into the subject being quite localized. For example, the gene delivery vehicle can be introduced by catheter (see U.S. Pat. No. 5,328,470) or by stereotactic injection (e.g., Chen et al., PNAS USA 91: 3054-3057 (1994)).
The pharmaceutical preparation of the gene therapy construct can consist essentially of the gene delivery system in an acceptable diluent, or can comprise a slow release matrix in which the gene delivery vehicle is embedded. Alternatively, where the complete gene delivery system can be produced intact from recombinant cells, e.g., retroviral vectors, the pharmaceutical preparation can comprise one or more cells, which produce the gene delivery system.
Synchronizing GLP1 Delivery with Body Clocks to Improve Glycemic Control and Weight Loss
Circadian clocks are complex molecular architectures that control circadian rhythms of physiology through various molecular processes, but prominently metabolic gene regulation. Clocks have been shown to heavily influence blood glucose regulation and obesity in animal models. Underlying circadian rhythms are oscillations of gene expression occurring in nearly all tissues and cells observed to date, which ultimately give rise to an individual's body clock. An essential component of circadian clocks is the CLOCK-BMAL1 heterodimeric transcription factor, which bind to E-box response elements within the promoter regions of clock regulated genes. Transcriptional reporter assays have shown that these promoter elements are sufficient to recapitulate circadian gene regulation. A patient's body clock can be linked to cell therapeutic drug delivery by engineering constructs that drive therapeutic peptide expression from circadian clock promoter elements.
GLP1 is a circadian appetite suppressing peptide hormone secreted by the gut as a response to eating. It has been shown to be elevated upon gastric bypass and reduce food intake when injected into humans (Hutchinson et al 2017, DaSilva and Bloom 2012). Their clinical use has been hampered by poor stability (GLP1: 30 minute half-life upon injection) and inability to be administered orally. Subcutaneous injection of a long-acting analog of GLP1 (liraglutide/victoza, Novo Nordisk) is currently approved for use in type 2 diabetic patients as an adjunctive therapy to improve glycemic control and weight loss, and as treatment for obesity (saxenda, Novo Nordisk). A cell based therapy approach using GLP1 secreting cells may avoid issues of stability, administration and side effects by providing sustained and controlled secretion of peptide hormones. Using circadian clock promoter elements to drive GLP1 will ensure coordination of appetite suppression and glycemic regulation with an individual's body clock (
Oxygen Sensing Cell Therapeutics to Treat Chronic Kidney Disease Related Anemia with EPO
Hypoxia is defined as a decrease oxygen concentrations detrimental to organismal or cellular health. Molecular pathways that sense and respond to hypoxia via gene expression are well characterized, ubiquitous and highly conserved. Hypoxia inducible factors or HIFs are a family of oxygen sensing transcription factors that bind to hypoxia response elements (HREs) and activate adaptive gene expression. Transcriptional reporter experiments have shown that HREs are sufficient to trigger hypoxia induced gene expression. This invention involves engineering oxygen sensing cell therapeutics by introducing synthetic HREs that drive therapeutic peptide expression (
Erythropoietin (EPO) expression and secretion increases under hypoxic conditions as a result of HIF dependent transcriptional regulation. EPO is a peptide hormone produced largely by the kidneys to increase hematocrit levels, and recombinant EPO is used as an injectable treatment for anemia related to chronic kidney disease (CKD) (e.g., darbapoietin alfa, Amgen). Anemia is a hallmark of advanced CKD, likely due to impaired renal EPO secretion. EPO treatment has been shown to improve morbidity, cognitive function and overall quality of life in CKD patients. Genetic constructs can be used that direct cell therapeutics to secrete EPO under hypoxic conditions by driving EPO expression from synthetic HREs (
Employing the NF-kB Inflammatory Response Pathway to Drive a Cytokine Inhibitors IL1RA or GP130 in the Treatment of Rheumatoid Arthritis or Transplant Rejection
In patients with chronic inflammatory diseases such as rheumatoid arthritis and osteoarthritis, proinflammatory cytokines are a major target for therapeutics (Jones et al, 2011). A number of successful treatments currently target these cytokines to prevent downstream signaling cascades within the cell that activate inflammation. One recent therapy, tocilizumab, works through blocking the IL-6 receptors. IL-6 is a strong candidate for targeting inflammation because it is involved in both acute phase inflammatory responses, as well as homeostatic functions such as regulation of glucose metabolism (Heinrich et al, 2003). During inflammation IL-6 is highly expressed and plasma cytokine levels can reach up to several ug/mL in severe cases (Waage, 1989). IL-6 contains a receptor subunit gp130 or CD130 which important for binding the IL-6 receptors. While it is expressed in all cells, circulating levels of these soluble protein are too low to act on IL-6 receptors to mediate inflammatory. However, it has been shown that delivering a soluble form of the gp130 allows selective inhibition of the IL-6 signaling (Atreya, 2000). In vivo studies show promise for gp130 as a treatment for arthritis, colitis, infection, allergies and cancer (Hurst, 2001). The goal of this therapy is to deliver a gene construct encoding for the gp130 soluble protein, which is capable of binding to IL-6 receptors and blocking inflammatory pathways.
One pathway that is widely explored for its role in inflammation is the nuclear factor NF-κB. It is activated by cytokines such as IL-1 and TNFalpha and microbial products through canonical pathways as well as an alternative pathway through TNF-family cytokines such as lymphotoxin beta, CD40 ligands, and B cell activating factor (Lawrence, 2009). Studies in vitro and in animal models have shown correlation of NF-κB activation in inflammatory disease contexts (Miagkov et al, 1998). This has been linked to not only rheumatoid arthritis, but atherosclerosis, COPD, asthma, multiple sclerosis, IBD and ulcerative colitis as well (Tak et al 2001). Furthermore, its role in expression of anti-inflammatory genes has been established as well through antiapoptotic mechanisms in prolonged inflammation (Greten et al, 2007). Using the response element on NF-κB to drive gp130 secretion, the therapeutic biomolecule is administered in response to inflammatory activation.
Another example is the creation of biosensing cell or gene therapies for reducing transplant rejection. A technology that is sensitive enough to detect signs of graft failure or rejection early, while it is still a local response and before it become a rejection event detectable at systemic levels can be used as a powerful early warning system that indicates impending rejection. Furthermore, it may offer an opportunity to combine therapy with biomarker measurements (known as theranostics), or even trigger the release of an anti-inflammatory through the diagnostic sensor itself, locally at the site of rejection and in a dose sensitive manner. The engineered cells describe herein can be engrafted into an organ prior to transplant to act as an in situ cell-based biosensor for reporting and responding to the state of a graft. These biosensor cells can be genetically engineered with a transcription factor response element, for example NF-kB, as a gene promoter to serve as a theranostic, simultaneously driving the secretion of a blood-based biomarker, for example SEAP, and a therapeutic protein, for example sgp130 or IL-1RA, to attenuate a rejection response.
Heat Triggered Release of IL1RA or GP130 as a Self-Administered Treatment for Rheumatoid Arthritis
Patients with chronic inflammatory conditions have elevated levels of IL-1 receptor antagonist (IL-1RA), a naturally occurring anti-inflammatory protein that binds competitively with IL-1a and IL-1beta to IL-1 receptors (Gabay, 1997). Levels rise dramatically in conditions such as sepsis, rheumatic disease, and noninflammatory tissue injury (al-Janadi, 1993). In these diseases, the main mediators of inflammatory are IL-1beta and TNF-alpha. IL-1RA has been shown in animal models to not only bind IL-1, but to prevent the onset of experimental arthritis and reduce severity in disease models (Arend, 1993). It has been shown specifically to exhibit efficacy when delivered to the site of injury or pathology such as the knee joint (Ghivizzani, 1998). (The IL1RA analog (Kinerete) is an approved second line treatment for a subset of rheumatoid arthritis patients? The side Effects are) This shows that IL-1RA may need to be localized for therapeutic effect and doing so through a gene therapy, such as adenovirus into the paws of mice to express the therapeutic intra-articularly the has shown promise (Whalen, 1999). While systemic levels of the protein were not measurable in vivo, using rabbit models Kim et al showed that treatment of inflammation in joints was mediated with local injection of adenovirus expressing IL-1RA and local levels of IL-1RA were maintained (Kim, 2002). Similarly, this method delivers a gene construct encoding for the IL-1RA gene.
For delivering a local therapeutic, a locally controlled response element, e.g., heat shock transcription factor (HSF), can be used. HSF is an innate response to elevated temperatures which increases the synthesis of heat shock proteins. The regulation of this protein is driven by a highly conserved HSF which can be activated through a number of stress signals (Morimoto, 1993). Heat shock proteins serve to protein cells from lethal exposures of environmental factors such as reactive oxygen specific, chemical toxins, and extreme temperatures (Parsell et al, 1994). There are four different HSFs that provide diversity and specialization in responding to stress signals, and HSF1 activates in responses to a variety of conditions such as heat shock, oxidative stress and foreign amino acids (Morimoto et al, 1998). HSF does not solely detect temperature changes, but in vitro data has shown that reticulocytes can be activated by heat shock and that human HSF1 can acquire DNA binding upon in vitro heat shock (Mosser et al 1990; Zhong et al 1998). Based on this response mechanism, an HSF1 response element can be used to drive IL-1RA or other inflammatory-related therapeutics. It is especially applicable for a therapy in which a local therapeutic is administered because a local activation stimulant can also be administered, such as a heating pad. Using HSF1 to drive IL-1RA could locally activate cells to secrete the therapeutic within the joint where a concentrated response is necessary.
Calcium Responsive Parathyroid Hormone (PTH) Replacement Therapy for Hypoparathyroidism
Hypoparathyroidism as a result of thyroidectomy, congenital defects, or idiopathic causes results in abnormalities in mineral metabolism. In addition, when parathyroid hormone plasma levels are below the average range of 10-60 pg/mL, patients have increased calcium levels and decreased phosphate levels, vitamin D levels and bone mineral density. PTH therapy has also been explored for patients with osteoporosis as it has been shown to increase bone mineralization (Winer et al, 2003). PTH is an 84 amino acid peptide and currently two formulations of the recombinant peptide are available for treatment: the full-length molecule Natpara (1-84) as well as a shortened Teriparatide (1-34) (Marcucci et al, 2012). In both treatment regimens, additional supplementation with vitamin D and calcium is required, which may be due to inability to meet the therapeutic range for extended periods of time. Natpara and Teriparatide are administered through subcutaneous injection at least once daily. The present methods deliver a gene construct encoding for the full-length PTH hormone driven by a dynamic response element.
Endogenously, PTH secretion is driven by a calcium response element, where small decreases in serum calcium stimulate the parathyroid to secrete PTH. Additionally, presence of vitamin D provides negative feedback for PTH secretion. PTH has a short half-life of around 5 minutes in vivo and using an endogenous response element to drive PTH secretion may provide more accurate level restoration. The calcium receptor or CaR is a G-protein couple receptor on which calcium acts to halt PTH secret on parathyroid cells (Silver et al, 2005). The response element has been studied extensively in animal models to show that hypocalcaemia increases transcription of PTH. By using the calcium response element CaSR to drive PTH synthesis, transcription of the PTH gene will take place until calcium levels have been restored.
Synchronizing PTH Delivery with Body Clocks
As noted above, circadian clocks are complex molecular architectures that control circadian rhythms of physiology through various molecular processes. Various bone turnover markers and bone metabolism-regulating hormones such as melatonin and parathyroid hormone (PTH) display diurnal rhythmicity. It has been shown that disruption of the circadian clock due to shift work, sleep restriction, or clock gene knockout is associated with osteoporosis or other abnormal bone metabolism, showing the importance of the circadian clock system for maintaining homeostasis of bone metabolism. Moreover, common causes of osteoporosis, including postmenopausal status and aging, are associated with changes in the circadian clock. Research has shown that agonism of the circadian regulators REV-ERBs inhibits osteoclast differentiation and ameliorates ovariectomy-induced bone loss in mice, suggesting that clock genes may be promising intervention targets for abnormal bone metabolism. Moreover, osteoporosis interventions at different time points can provide varying degrees of bone protection, showing the importance of accounting for circadian rhythms for optimal curative effects in clinical treatment of osteoporosis (see, e.g., Song, C., et al, “Insights into the Role of Circadian Rhythms in Bone Metabolism: A Promising Intervention Target?,” Hindawi, Volume 2018, Article ID 9156478, 11 pages).
PTH exhibits a moderate increase between 16:00 and 19:00 and a broader, longer-lasting increase from late evening to early morning, reaching its peak between 02:00 and 06:00 (J. Redmond, A. J. Fulford, L. Jarjou, B. Zhou, A. Prentice, and I. Schoenmakers, “Diurnal rhythms of bone turnover markers in three ethnic groups,” The Journal of Clinical Endocrinology & Metabolism, vol. 101, no. 8, pp. 3222-3230, 2016; W. D. Fraser, A. M. Ahmad, and J. P. Vora, “The physiology of the circadian rhythm of parathyroid hormone and its potential as a treatment for osteoporosis,” Current Opinion in Nephrology and Hypertension, vol. 13, no. 4, pp. 437-444, 2004). The direct connection between SCN and PTH secretion remains uncharacterized. Constitutively active PTH receptors expressed in osteoblasts promote PER1 expression (R. Hanyu, T. Hayata, M. Nagao et al., “Per-1 is a specific clock gene regulated by parathyroid hormone (PTH) signaling in osteoblasts and is functional for the transcriptional events induced by PTH,” Journal of Cellular Biochemistry, vol. 112, no. 2, pp. 433-438, 2011). In organ-cultured murine femur, Okubo et al. revealed that PTH reset the circadian oscillation of PER2::luciferase activity in a time- and dose-dependent manner (N. Okubo, H. Fujiwara, Y. Minami et al., “Parathyroid hormone resets the cartilage circadian clock of the organ-cultured murine femur,” Acta Orthopaedica, vol. 86, no. 5, pp. 627-631, 2015). Moreover, PTH administration shifts the peak time of PER2::luciferase activity in fracture sites and growth plates (T. Kunimoto, N. Okubo, Y. Minami et al., “A PTH-responsive circadian clock operates in ex vivo mouse femur fracture healing site,” Scientific Reports, vol. 6, 2016). PTH is an approved FDA anabolic drug for osteoporosis. Accordingly, using circadian clock promoter elements to drive PTH is a potential means for preventing bone decay/osteoporosis.
Targeted Cell Type-Specific Expression Through Promoter Elements
An attractive feature being explored for viral vectors that will be directly injected in vivo is the ability to tune expression to only the targeted cell type. For example, viral particles injected intramuscularly can be engineered to contain an additional promoter upstream of the applicable response element that is specific to muscle cells. Myf5, a gene that is only expressed by activated muscle stem cells, is a good target for muscle cell AAV transduction. For this reason, we are exploring the promoter region −1500 bp from the transcriptional start site of Myf5 to be inserted into the vector. This region has been successfully isolated and cloned into a luciferase vector to report out Myf5 expression by Zhang et al.
There are a number of promoter regions that have been identified for different cell types that have been shown to facilitate cell type-specific expression when inserted upstream of a reporter in viral vectors. Depending on the target for viral injection, this could be adapted to minimize off-target effects.
The invention is further described in the following examples, which do not limit the scope of the invention described in the claims.
Circadian clock promoter element driven expression of a secreted luciferase reporter protein (
Circadian clock promoter element driving expression of a secreted luciferase reporter protein in AAV demonstrate oscillation in vitro in murine myoblast cell line, C2C12 (
We have begun to employ genetic constructs which direct cell or gene therapeutics to secrete a luciferase reporter protein when exposed to pro-inflammatory cytokines. (
A rat fibroblast cell line from ATCC (CRL-1764) was engineered with a lentivirus to express a green fluorescent protein (GFP) gene in addition to the gaussia luciferase reporter gene. Rat2 cells were cultured for 24 h in DMEM with increasing concentrations of lentiviral particles per cell (MOI) and protamine sulfate (PS), a cationic vehicle. Conditions with high concentrations of lentiviral particle multiplicity of infection (MOI) and the cationic vehicle protamine sulfate (PS) had the highest transduction efficiency. Transduced GFP-positive cells were sorted using a BD FACS Aria III (BD Biosciences) cell sorter. GFP-positive cells were then cultured, expanded and used for subsequent studies.
Livers were perfused ex vivo for three hours, then replaced with fresh perfusate to test the engraftment of the biosensor cells. Throughout the perfusion, assays were performed to demonstrate the viability of the perfused rat livers in the control and experimental groups. Assays of liver function conclusively showed that the engrafted biosensor cells did not negatively impact liver function and bode well for future transplantation. The perfusate was sampled for gLuc to determine if cells engrafted by indirect means. All the liver perfusions displayed a consistent pattern of gLuc secretion both before and after the perfusate change (
Human MSCs were transduced with lentiviral particles containing an NFκB-Gluc expression constructs. Cells were transduced cells were washed thouroughly with media, then media with or without TNFα, was tested for Gluc activity. Cells were then allowed to incubate for 24 hours before testing media for Gluc activity. Untransduced or native cells were treated identically.
HepG2 hepatocytes were engineered with the NFkB-GLuc construct and stimulated with either inflammatory LPS or IL-1b at two different doses. Media was sampled for GLuc activity after 12 hours. Relative GLuc signal increased dose dependently for LPS stimulation but was not stimulated by IL-1b which acts on a different response element (MAPK) endogenously (
HEK293ts were transfected with various plasmid constructs as indicated on y-axis in
Liver cells were engineered with the EF1α-PTH construct and supernatant was collected. In response to the PTH-containing conditioned media, Saos-2 osteoblasts proliferated in a dose-dependent manner. Both the 1× and 2× dosing group proliferated significantly more than the negative control after 3 days of incubation (
Alternatively, Saos-2 osteosarcoma-derived osteoblasts were transfected with EF1α-PTH construct or a sham transfection (EF1α-GLuc). Despite transfection having a negative impact on cell viability, groups transfected with a PTH construct proliferated significantly more than sham-transfected groups (
AAV vectors administered in vivo result in detectable levels of human PTH in the plasma 3 weeks post injection. AAV2 vectors encoding EF1a-PTH were produced and concentrated in sterile saline at a concentration of 1010 vg/mL. Male C57/B1 mice underwent thyroid/parathyroidectomy surgery and PTH levels were measured in the plasma to ensure levels were below detection limit. Each group consisted of n=2 animals and AAV2 animals received 100 uL of vector solution via intraperitoneal injection. 100 uL of whole blood was sampled via tail vein once per week at the same time of day and plasma was isolated for PTH measurement by ELISA. As shown in
Media from cells engineered with EF1α-sGP130 constructs was sampled, along with cell lysate, showing that measurable protein levels increase over time (
The following serves as Materials and Methods for Examples 12 and 13 below.
Circa promoters are synthetic circadian response elements based on our previous work (Tamayo et al. 2015; Gillessen et al. 2017), upstream of a minimal promoter. Source DNA sequence for minimal promoter was pGL4.24[luc2P/minP] (Promega). Sequences can be found in Table 5. Source DNA sequences for constitutive promoter/enhancers were pENTR-5-EF1ap (Thermo cat #A11145) and pMAXGFP (Lonza) for EF1α and CMV respectively. Source DNA sequences for reporters were pCMV-Gluc2 (NEB cat #8081S) and pCMV-Cluc2 (NEB cat #N0321) for GLUC and CLUC respectively. PCR amplicons or custom synthesized double stranded DNA fragments (IDT) or promoters and reporters were cloned into pENTR TOPO-TA (Thermo cat #EP0402) and pENTR d-TOPO (Thermo cat #K252520) entry vectors respectively. Multisite Gateway cloning into a promoterless lentiviral plasmid pLenti6.4/R4R2/V5-DEST (Thermo cat #A11146) with desired promoter/reporter combination using LR clonase enzyme mix II (Thermo cat #11791100) according to manufacturer's instructions. DNA was isolated using Pureyield (Promega cat #A1222) and Purelink (Thermo cat #K210017). Standard procedures were performed to verify clones, including PCR, restriction enzyme digestion and sequencing. Clones were further selected on their ability to express reporters when transfected using Lipofectamine 3000 (Thermo cat #L3000015) in 293t cells (ATCC cat #CRL-3216).
Jurkat E6-1 cells (ATCC cat #TIB-152) are derived from T lymphocytes originally isolated from a child patient with acute T-cell leukemia (Schneider et al. 1977). Jurkat cells were passaged as indicated by vendor (RPMI). Lentiviral particles were produced using a protocol modified from the manufacturer of Lipofectamine 3000 (thermofisher.com/content/dam/LifeTech/global/life-sciences/CellCultureandTransfection/pdfs/Lipofectamine3000-LentiVirus-AppNote-Global-FHR.pdf). Briefly, 293t cells grown to 85-95% confluency in a 75 cm2 flask (Corning) were transfected with 2 μg pVSVG, 5 μg pPMDL, 2 μg pRSV and 10 μg lentiviral transfer plasmid using Lipofectamine 3000 in OptiMEM (Thermo cat #51985091) containing 5% FBS. Lentiviral particles were harvested 24 to 48 hours post transfection, spun at 5000×g, filtered through a 40 μm basket filter (Millipore), concentrated at 25,000 RPM using a Beckman swing bucket rotor (SW-28) and resuspended in OptiMEM without FBS. Functional titers were determined by transducing 293t cells. Transduced Jurkat cells were selected by blasticidin (Thermo cat #R21001) resistance or by fluorescence activated cell sorting (FACS). For blasticidin selection, cells were incubated in media containing 10 μg/ml blasticidin for 5 days, and media was replaced with fresh blasticidin containing media as needed for 2 weeks. CMV-GLUC; EF1α-CLUC cells were generated by transducing EF1α-CLUC blasticidin resistant cells with Gluc-IRES-eGFP (Partners Research Viral Vector Core, Boston, Mass.) and selecting for GFP positive cells by FACS (sorting was performed by the HSCI-CRM Partners Research Core Facility, Boston, Mass.). Circa1/2-GLUC; EF1α-CLUC cells were generated by electroporating EF1α-CLUC blasticidin resistant cells with Circa1/2-GLUC lentiviral transfer plasmids using an ECM 399 electroporator (BTX). In a 2 mm cuvette (BTX), 3×106 cells resuspended in 200 μl OptiMEM were electroporated with 8 μg lentiviral transfer plasmid DNA at 500V, 700 us, single pulse, then immediately resuspended in standard media. Cells recovered for 24 hours prior to further experiments.
For both GLUC and CLUC assays, up to 20 μl of conditioned media from engineered cells, mouse plasma or purified GLUC (Nanolight cat #321) was loaded onto a 96-well black plate prior to adding working concentration of substrate. A volume of 100 μl of GLUC substrate (coelenterazine) (Nanolight cat #303-500) or CLUC substrate (Cypridina Luciferase Substrate) (Nanolight cat #305-500) at a concentration of 12.5 ng/ml in PBS were added to wells and immediately read with microplate reader (Biotek Synergy 2) with an integration time of 0.1 s. Luminescence was recorded by the device as relative luminescence units (RLU). Continuous monitoring of plasma luciferase from mice is described in a separate section below. To monitor continuous secretion of luciferase from cells in vitro over time, cells were seeded onto a custom-made constant flow cell culture and collection device. For each experiment, 16×106 cells in approximately 2 ml of media were injected into a tube-like bag made from air permeable material (Rogers Corporation HT-6240 Transparent 0.010″) with approximate dimensions of 20 cm in length and 0.6 cm in diameter. We have previously shown that vessels made from this material are optimal for the expansion of human T-cells (Li et al. 2018). Silicone tubing (Platinum LS14 Masterflex cat #96410-14) was used to connect the cell containing vessel to media filled syringes operated by a PHD 2000 syringe pump (Harvard Apparatus) and to a Biologic Biofrac fraction collector (Biorad). Cells were allowed to settle for 3-4 hours prior to flowing media at 3.8 ml/hour. Fractions were collected every hour and 20 μl of every other fraction was assayed for GLUC and/or CLUC using a maximum of 12 fractions per 24-hour period of collection. For circadian experiments, cells were synchronized with 10 μM dexamethasone (Sigma cat #D4902) for 30 minutes, washed 3 times with PBS and seeded onto a continuous flow vessel either immediately or after a 24-hour incubation. For KL001 (Sigma cat #SML1032) experiments, 1×106 cells/ml EF1α-GLUC or Circa2-GLUC stable cells selected by blasticidin resistance were incubated with 20 μM KL001 or DMSO (vehicle) for 24 hours prior to washing, synchronization, and continuous flow monitoring as described above. Underlying RLU data was normalized to 0 by dividing raw data points by the average of the data set, then subtracting quotient by the average of the data set. All line fitting was performed using Prism 8 (Graphpad). Linear detrending and period determination of circadian data was performed using BioDare2 (Zielinski et al. 2014; biodare2.ed.ac.uk).
Jurkat cells were synchronized as described above then seeded in a 24-well plate at 1×106 cells/well, and one well was harvested and washed 30 minutes and then every 2 hours post synchronization for 24 hours. Cells were snap frozen and stored in N2(1) until all cells were collected. Samples for each replicate set were processed simultaneously. RNA was isolated from each sample using the PureLink RNA Mini Kit (Thermo cat #12183025) and A260/280 ratios were determined using a NanoDrop ND-1000 (Thermo). Each sample was used to generate cDNA using the iScript cDNA Synthesis Kit (Biorad cat #170-8891), and the PowerUp SYBR Green Master Mix (Applied Biosystems cat #A25742) was used to perform qPCR according to the manufacturer's instructions using a ViiA 7 Real-Time PCR System (Applied Biosystems). Primer sequences can be found in Table 5. Ct values were automatically generated by the ViiA 7 software. The ΔCt values of each gene at each time point corresponds to the average Ct value subtracted by the average Ct value of GAPDH at the same time point, then transformed by 2{circumflex over ( )}-ΔCt. For heat map representation and statistical analysis, each gene's data set between 2 h and 20 h post-synchronization was normalized to the lowest value of the set. To determine if the lowest and highest values (presumably peaks and troughs) were statistically significant, q-values were calculated using Prism 8 (Graphpad).
In all experiments, female NSG (NOD.Cg-Prkdcscid Il2rgtm1Wjl/SzJ, Jackson Laboratory stock #005557) mice less than 6 months old were used, and they were housed in a 12 hours on/12 hours off facility fed ad libitum. Jurkat cells were washed 4-5 times with PBS and resuspended in 500 μl PBS before their intraperitoneal injection at 5×105 cells per animal. For all experiments, less than 10% of the animal's total blood volume was drawn by tail snip within a 24 hour period around 40 days post injection. Immediately upon drawing blood, heparin sodium (McKesson cat #916396) was added at a final concentration of 0.002 U/ml and spun at 2,000×g for 10 min at 4° C. The plasma supernatant was stored −80° C. Using methods described above, 5 μl of plasma was assayed for GLUC or CLUC activity. Animals were euthanized when they showed clear signs of engraftment related disease as compared to control animals. All animal work was performed in accordance with the ethical standards of the Institutional Animal Care and Use Committee (IACUC).
All line fitting was performed using Prism 8 (Graphpad). Linear detrending and period determination of circadian data was performed using BioDare2 (Zielinski et al. 2014; biodare2.ed.ac.uk). For
Destabilized firefly luciferase, which is largely cytosolic, has traditionally been used to monitor circadian clocks (Vollmers et al. 2008; Zhang et al. 2009). Gaussia princeps and Cypridina noctiluca luciferases, GLUC and CLUC respectively, (Verhaegent and Christopoulos 2002; Nakajima et al. 2004) are naturally secreted forms of luciferase and allow for easy, real-time monitoring in vivo through blood sample collection. GLUC has been used in previous studies to monitor cell expansion of solid tumor xenografts in living animals and has a half-life of ˜20 minutes in mouse plasma, allowing for the monitoring of dynamic secretion (Badr et al. 2009; Chung et al. 2009). In fact, these luciferases have been used to track circadian expression in the plasma of transgenic mice and in fibroblasts in vitro (Yamada et al. 2013; Watanabe et al. 2010). GLUC and CLUC have been shown to catalyze distinct substrates to generate light, which allows for their use as dual luciferase reporters (Wu et al. 2007). We engineered human leukemic T-cells (Jurkat E6-1) to express GLUC and CLUC from constitutive and circadian clock response elements (further discussed below) to first detect secretion rhythms in cell culture before testing them in a xenotransplantation model (
We used EF1α, a strong, constitutive promoter to validate our assays as a reference promoter, and as an indicator of basal transcription and protein synthesis (Wang et al. 2017). Jurkat human leukemic T-cells were transduced and made stable by negative (blasticidin) and/or positive (GFP) selection. Stable cell lines or parental Jurkat cells (untransduced) were then incubated in standard media for 2 hours, at which point media was collected and assayed using either GLUC substrate (coelenterazine) or CLUC substrate (
Luciferase enzymes have long been a staple choice for monitoring gene transcriptional reporters due to their extraordinary sensitivity and dynamic range (Ghim et al. 2010). We characterized the ability of GLUC secretion to correlate with cell number by conditioning media with varying concentrations of stably secreting Jurkat cells (EF1α-GLUC). Remarkably, cell concentrations of less than 1000 cells/ml (
To characterize the dynamic nature of response element secretion over at least 24 hours, we created a system to flow media over sediment suspension cells followed by automated collection of media (
The core circadian clock response element consists of a palindromic 6-base pair sequence known as the E-box (Partch et al. 2016). E-box sequences are high-affinity binding sites of the CLOCK-BMAL1 transcription factor heterodimer within clock regulated gene promoters. Studies have shown that E-box sequences from promoter regions of clock-regulated genes are sufficient to drive rhythmic gene expression (Vollmers et al. 2008; Zhang et al. 2009). Response element (RE) compactness was a factor we considered since large RE-gene cassettes may hinder viral production, and poorly characterized DNA sequences may be a source of noise or toxicity. We based the designs of clock response elements on our previous work showing that three to six much abbreviated portions of the Per1 gene promoter containing E-box sequences (16-21 base pairs) specifically bind CLOCK-BMAL1 and recapitulate circadian promoter binding in vitro (Tamayo et al. 2015; Gillessen et al. 2017). This synthetic clock reporter, we call Circa2, contains six E-box sequences respectively, flanked by 12 base pairs of Per1 promoter sequence and followed by a short 31 base pair minimal promoter (MP) base pairs, with total size of 144 base pairs.
Lentiviral plasmids containing Circa2 driving GLUC expression were electroporated into Jurkat cells constitutively expressing CLUC from the EF1α promoter. Cells were allowed to recover overnight before synchronizing with dexamethasone treatment for 30 minutes (Balsalobre et al. 2000), washing then loading onto the laminar flow system as described above. Fractions were collected every hour and analyzed for GLUC and CLUC activity with a 2-hour resolution and raw data was normalized to the mean of all data points, detrended and set to 0 as before (
To confirm that the oscillatory nature of gene expression was circadian clock related, we next treated cells with a pharmacological agent previously shown to disrupt circadian clocks. KL001 has been shown to stabilize CRY1 protein, a CLOCK-BMAL1 repressor, leading to a dysfunctional transcriptional feedback loop (Hirota et al. 2012). Stable Jurkat cell lines expressing GLUC driven by Circa2 or EF1α as a reference, were treated with a sublethal dose of KL001 (20 μM) or vehicle (DMSO) for 24 hours before dexamethasone synchronization and seeding on the laminar flow system as described above. KL001 treatment had little to no effect on EF1α driven GLUC secretion as shown by raw and normalized data (
To better understand the nature of Jurkat cell endogenous clocks, we measured the expression of core clock controlled genes every 2 hours upon synchronization with dexamethasone in untransduced Jurkat cells. We show by RT-qPCR that Per1, Per2, Bmal1, Clock, Cry1 and Cry2 mRNA transcripts were all detectable, suggesting a rhythmic pattern of expression for Per1, Per2, Bmal1 and Clock (
We next set out to determine if clock driven secretion from human leukemic T-cells would persist in animals upon transplantation. We first used EF1α driven GLUC expression to determine the optimal time post-transplantation for data collection. Stably transduced Jurkat cells were injected into immune-compromised mice (NSG), and plasma GLUC activity was monitored (5 μl plasma assayed) for 42 days post-transplantation. Animals expressed plasma EF1α driven GLUC levels above pre-bleed levels (time 0) between 10 and 30 days with variable kinetic profiles (
The delay in plasma GLUC concentration when driven by Circa2 presented a challenge because mice transplanted with Jurkat cells began showing signs of disease around 43 days post-transplantation, at which point they were euthanized in accordance with the animal protocol. About 30% of animals transplanted with Circa2-GLUC cells were healthy enough to undergo further experiments when plasma GLUC concentrations were detected. Most animals were euthanized by 61 days, with one animal found dead at 43 days (
Mice (NSG) were injected with stably selected Jurkat cells expressing GLUC from the Circa2 synthetic clock response element or from the EF1α promoter as a reference. Plasma GLUC signals were measured every 4 hours for 24 hours. We observed that Circa2 driven GLUC levels in plasma have a dynamic profile consistent with circadian clock dependent transcription, as compared to EF1α driven secretion (
Furthermore, given that our cell culture results indicate that the clocks of Jurkat cells are not strongly coupled, these experiments suggest that Jurkat human leukemic T-cells synchronize to mouse physiological time-setting cues. As shown in
The following serves as Materials and Methods for Examples 15-19 below.
Frozen vials of Rat2 fibroblast cell line were purchased from American Type Culture Collection (Manassas, Va., USA). Cells were thawed and cultured in Dulbecco Modified Eagle Medium (DMEM) composed of 10% fetal bovine serum (FBS) and 2% penicillin and streptomycin. Media was changed every 3-4 days and incubated at 37° C., 5% carbon dioxide. Cells were subcultured when they reached 80-90% confluence.
Rat fibroblasts were harvested at passage 2 for lentiviral infection. A lentivirus vector expressing gLuc (Tannous B A, Kim D E, Fernandez J L, Weissleder R, Breakefield X O. Mol Ther. 2005; 11(3):435-43; Tannous B A. Nat Protoc. 2009; 4(4):582-91. doi: 10.1038/nprot.2009.28) and green fluorescent protein (GFP) under the control of the CMV promoter was obtained from the Massachusetts General Hospital Vector Core (funded by NIH/NINDS P30NS045776). Cells were cultured for 24 h in DMEM with increasing concentrations of lentiviral particles per cell and protamine sulfate, a cationic vehicle (Lin P, Lin Y, Lennon D P, Correa D, Schluchter M, Caplan A I. Efficient lentiviral transduction of human mesenchymal stem cells that preserves proliferation and differentiation capabilities. Stem Cells Transl Med. 2012; 1(12):886-97. Epub 2013/01/04). Transduced GFP-positive cells were sorted using a BD FACS Aria III (BD Biosciences) cell sorter (Harvard Stem Cell Institute Flow Cytometry Core at Massachusetts General Hospital, Boston, Mass., USA). GFP-positive cells were then cultured, expanded and used for subsequent studies. Only passages 3-5 rat fibroblasts were used for experiments.
Male Lewis rats weighing 200 g-250 g were housed in standard conditions (Charles River Laboratories, Boston, Mass., USA). The animals were kept in accordance with the National Research Council guidelines. The experimental protocol was approved by the Institutional Animal Care and Use Committee, Massachusetts General Hospital.
All procurements were performed using the technique of Delriviere et al (Delriviere L, Gibbs P, Kobayashi E, Goto S, Kamada N, Gianello P. Detailed modified technique for safer harvesting and preparation of liver graft in the rat. Microsurgery. 1996; 17(12):690-6. Epub 1996 Jan. 1). Animals were anesthetized using inhalation of 3-5% isoflurane (Forane, Deerfield, Ill., USA) with 1 L/min 95%/5% oxygen-carbon dioxide gas. The animal's abdomen was shaved and a transverse laparotomy was made. Intestines were moved to expose the entirety of the liver, portal vein, common bile duct, and inferior vena cava. The common bile duct was cannulated using a ˜6 cm 28-gauge polyethylene tube (Surflo, Terumo, Somerset, N.J., USA) to collect bile throughout the perfusion. Via the infrahepatic vena cava (IHVC), 300U of heparin was administered and 3 minutes were allowed for circulation. The portal vein was cannulated using a 16-gauge catheter and IHVC was transected for exsanguination. All cannulas were secured with 7-0 silk suture. The liver was immediately flushed in situ via the portal vein cannula with 50 mL of 0.9% NaCl at 4° C. The liver was freed from its ligamentous attachments, weighed, and placed in ice-cold saline prior to being connected to the perfusion circuit.
Perfusate composition consisted of a base of DMEM supplemented with 200 mM L-glutamine (Invitrogen), 10% v/v FBS (Thermo Scientific), 5% with bovine serum albumin (BSA; Sigma-Aldrich), 8 mg/L dexamethasone (Sigma-Aldrich), 2000 U/L heparin (APP Pharmaceuticals), and 2 U/L insulin (Humulin, Eli Lily).
A determined concentration of 5×106 engineered rat fibroblasts was added to 150 mL of perfusate to circulate through the system for the initial three hours. At hour three, the perfusate was switched to media without any rat fibroblasts and perfused for an additional three hours.
Normothermic machine perfusion (NMP) was chosen to maintain the liver at a metabolically active state, similar to in vivo conditions (Tolboom et al. Tissue Eng. 2007; 13(8):2143-51. Epub 2007 Jun. 29; Berendsen et al. Transplant Res. 2012; 1(1):6. Epub 2013 Feb. 2). The NMP circuit used was comprised of an organ reservoir, bubble trap, membrane oxygenator, roller pump, water bath, and series of silicon tubing. Prior to liver procurement, the perfusion system was first flushed with ultrapure water and warmed to 37° C. before perfusate was circulated.
Immediately after procurement, the liver was transferred to the organ reservoir and perfused through the portal vein cannula. The liver was perfused with partial oxygen pressure (pO2) above 400 mmHg. The flow rate of the system was manually altered according to target a portal pressure of 5 mmHg, measured using a water column manometer. Flow rates initiated at 5 mL/min and were increased to maintain an absolute pressure of 5 mmHg inside the liver.
Samples of perfusate were taken at time points 0, 30, 60, 120, 180, 210, 240, 300, and 360 minutes and stored at −80° C. Serum chemistry and blood gas analyses were performed during perfusion using CG4+ and CHEM8+ i-STAT cartridges (Abbott Point of Care Inc., Princeton, N.J., USA). Liver biopsies were taken post-perfusion and either snap-frozen in liquid nitrogen or fixed in 10% formalin. Assays for aspartate aminotransferase (AST; TR70121, Thermo Scientific) were performed following perfusion according to the manufacturer's instructions.
Bioluminescence assays were performed by pipetting 10 μL of sample into a black-walled 96-well plate (Corning) and adding 1000 μL of coelenterazine native substrate (NanoLight Technology) at 100 μmol/L diluted in phosphate buffered saline. Samples were read immediately using a BioTek Synergy 2 Multi-Mode Reader for 10 s at a gain of 100-200 (BioTek).
Prior to perfusion, 5×106Rat2 fibroblasts were labeled with a near infrared fluorescent membrane dye (Qtracker 705 Cell Labeling Kit, Invitrogen). Ex vivo fluorescence imaging with the 665 excitation and 680 emission filter set was performed using the Olympus OV110 (Olympus Corporation) to visualize engraftment in liver. Image visualizations were performed in ImageJ software.
Cell Lysis of gLuc-Secreting Cells in Liver Tissue
Tissue biopsied post perfusion and stored in −80° C. was lysed for Gaussia Luciferase activity using NanoFuel FLASH Assay for Gaussia Luciferase (NanoLight Technology, 319). Approximately 100 mg rat liver tissue was homogenized in 200 uL lysis buffer, the samples were vortexed and kept on ice. After 15 minutes, 200 uL of Gaussia dilution buffer was added to the samples and they were vortexed once more. Gaussia-expressing cells were used as a positive control and were prepared in the same sequence. Tissue perfused with non-transduced cells was used as a negative control. The sample volume for each well was 20 uL with N=4. Finally, 50 uL of Coelenterazine buffer was injected into each well and read for Luminescence with an integration time of 10 seconds.
Once perfusion was completed tissue samples were taken from three different lobe locations. The collected samples were formalin-fixed to be paraffin-embedded. The tissue was cut into 4-micrometer sections, mounted on a glass slide, and stained for hematoxylin-eosin and/or anti-GFP antibody (Abcam ab1218).
We utilized self-inactivating lentiviral vectors as previously described (Wurdinger T et al. Nat Methods. 2008; 5(2):171-3. Epub 2008/01/22) to integrate transgenes into the genome of dividing as well as non-dividing cells and pass them onto daughter cells; hence, cells will be stably expressing all genetic reporters. The lentivirus was engineered to contain a GFP gene for purifying engineered cells by FACS. In addition, a secreted gLuc reporter gene was inserted. gLuc enzyme activity can be specifically and easily quantified in a small aliquot of volume (5 μl) ex vivo by adding its respective substrate and measuring enzymatic conversion. gLuc has been used for high sensitivity detection (Tannous et al. Mol Ther. 2005; 11(3):435-43. Tannous B A. Nat Protoc. 2009; 4(4):582-91) with a half-life of 5-10 minutes in mouse circulation and from as few ˜1000 cells in an entire mouse (Wurdinger et al. Nat Methods. 2008; 5(2):171-3. Epub 2008 Jan. 22; Teng et al. Stem Cells. 2014; 32(8):2021-32. Epub 2014 May 8). Since these probes are secreted, accumulate in the blood, and are specific to their corresponding substrates, the signal intensity is very specific and amplified such that even a few dispersed cells can be detected using a simple bioluminescent blood test. This reporter system could enable the indirect observation, in real-time, of cell fate within an organ transplant in vivo by measuring biomarker levels in circulating fluids.
Conditions with high concentrations of lentiviral particle MOI and the cationic vehicle had the highest transduction efficiency (
A six-hour perfusion was previously established as a benchmark for rat liver normothermic perfusion (NMP) to preserve liver metabolic function before successful transplant into recipient rats (Tolboom et al. Tissue Eng. 2007; 13(8):2143-51. Epub 2007 Jun. 29). Given the eventual aim of these biosensor cells to monitor and regulate transplanted livers, we chose to use the same six-hour perfusion in our experiments. In order to confirm successful engraftment of the biosensor cells into the liver, we infused the cells for the first three hours of the perfusion, then used fresh perfusate to check if the cells washed out. An initial cell mass of 5×106 engineered rat fibroblasts was chosen at a concentration of approximately 30×103 cells/mL to have a dilute cell suspension well below physiological circulating cell numbers.
To confirm the location of the biosensor cells within the liver, they were treated with a near-infrared (NIR) dye prior to perfusion. Cells injected directly through the cannulated liver did not distribute as thoroughly as perfused cells (
NIR tracking of engineered cells helped initially verify cell engraftment, though could not resolve microscopic resolution of cell localization within the tissue. Histological analysis was further performed to assess the presence of the biosensor cells embedded in the tissue by staining GFP+ cells using for anti-GFP antibody 9F9.F9 (
Liver functionality after cell engraftment was further assessed at the organ level by comparing the biochemistries of an experimental group perfused with transduced cells, a group containing un-transduced cells, and a negative control group perfused with no cells. These groups could isolate the effect of cells alone compared to the transgene to identify a root cause of any observed effects.
To assess viability of the perfused grafts, we used the composite viability criterion of Mergental et al which were established to clinically predict primary nonfunction in normothermically perfused human livers (Mergental et al. Liver Transpl. 2018; 24(10):1453-69. Epub 2018 Oct. 26). Briefly, one major and two minor criteria must be met in order to deem the liver clinically viable. As shown in
To further assess if the cell infusion did affect function, we assessed several additional parameters during perfusion: Metabolic activity of the liver was additionally tested using glucose stability (Delriviere et al. Microsurgery. 1996; 17(12):690-6. Epub 1996/01/01) as well as oxygen consumption rate. Hepatocellular damage was further assessed using and aspartate transaminase (AST) release (Imber et al., Transplantation. 2002; 73(5):701-9. Epub 2002/03/22) which we have also shown to be correlated to transplant success in similar normothermic rat liver perfusions systems (Uygun et al., Transplant Proc. 2010; 42(7):2463-7. Epub 2010/09/14). Finally, we measured liver weight before and after perfusion to evaluate if there was any edema. In all three groups lactate (
(S, the solubility constant of water at 37° C.=0.031 μL/mL/mm Hg (Reinders et al. J Stem Cell Res Ther. 2014; 4(2):1000166. Epub 2014 Jun. 6). Oxygen consumption was found to be higher in the control group due to the higher portal flows. AST production, known to correlate with liver damage, followed a similar trend for all three groups throughout perfusion (
Biosensor cells were added to perfusate to circulate and engraft in liver, and fresh perfusate without cells was swapped in after 180 minutes to test for engraftment. gLuc has been used as a highly sensitive reporter for assessment of cells in vivo, so levels in the perfusate allow us to track its activity within the rat livers (Elman et al., PLoS One. 2014; 9(2):e89882. Epub 2014/03/04; Singleton et al., Cytotherapy. 2017; 19(12):1537-45. Epub 2017/09/18; Tannous, Nat Protoc. 2009; 4(4):582-91). There was a consistent pattern of gLuc secretion: an initial buildup in the first three hours, then a drop at the time of switching to fresh perfusate, and resumption of increase during hours 4-6 (
In order to approximate the number of engrafted cells per tissue, we measured intra-tissue gLuc levels from frozen tissue biopsies compared to a known control sample of pure engineered gLuc fibroblasts. Tissue samples were lysed and the transduced cell group, in comparison to the un-transduced cell group (Negative Control), had significantly higher levels of gLuc secretion (
AAGCTCGACTTCCAG
CGTGACCACACGTGGGTCCACGTGCAAGAGGGTATATAATGGA
AGCTCGACTTCCAG
It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.
The present patent application claims the benefit of U.S. Provisional Patent Application No. 62/811,497 filed on Feb. 27, 2019. The entire content of the foregoing are incorporated herein by reference.
This invention was made with Government support under Grant Nos. GM127353, AI34116, and EB012521 awarded by the National Institutes of Health. The Government has certain rights in the invention.
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/US2020/020125 | 2/27/2020 | WO | 00 |
| Number | Date | Country | |
|---|---|---|---|
| 62811497 | Feb 2019 | US |
