Patent Application
20120288498
In accordance with 37 C.F.R. §1.52(e)(5), a Sequence Listing in the form of a text file (entitled “Sequence Listing”, created on May 30, 2012 and of 279 kilobytes) is incorporated herein by reference in its entirety.
The present invention relates to polynucleotide and polypeptide sequences which are differentially expressed in cancer compared to normal cells. The present invention more particularly relates to the use of these sequences in the diagnosis, prognosis or treatment of cancer and in the detection of cancer cells.
Among gynecologic malignancies, ovarian cancer accounts for the highest tumor-related mortality in women in the United States (Jemal et al., 2005). It is the fourth leading cause of cancer-related death in women in the U.S (Menon et al., 2005). The American Cancer Society estimated a total of 22,220 new cases in 2005 and attributed 16,210 deaths to the disease (Bonome et al., 2005). For the past 30 years, the statistics have remained largely the same—the majority of women who develop ovarian cancer will die of this disease (Chambers and Vanderhyden, 2006). The disease carries a 1:70 lifetime risk and a mortality rate of >60% (Chambers and Vanderhyden, 2006). The high mortality rate is due to the difficulties with the early detection of ovarian cancer when the malignancy has already spread beyond the ovary. Indeed, >80% of patients are diagnosed with advanced staged disease (stage III or IV) (Bonome et al., 2005). These patients have a poor prognosis that is reflected in <45% 5-year survival rate, although 80% to 90% will initially respond to chemotherapy (Berek et al., 2000). This increased success compared to 20% 5-year survival rate years earlier is, at least in part, due to the ability to optimally debulk tumor tissue when it is confined to the ovaries, which is a significant prognostic factor for ovarian cancer (Bristow R. E., 2000 and Brown et al., 2004). In patients who are diagnosed with early disease (stage I), the 5-yr survival ranges from >90 (Chambers and Vanderhyden, 2006).
Ovarian cancer comprises a heterogeneous group of tumors that are derived from the surface epithelium of the ovary or from surface inclusions. They are classified into serous, mucinous, endometrioid, clear cell, and Brenner (transitional) types corresponding to the different types of epithelia in the organs of the female reproductive tract (Shih and Kurman, 2005). Of these, serous tumors account for ˜60% of the ovarian cancer cases diagnosed. Each histologic subcategory is further divided into three groups: benign, intermediate (borderline tumor or low malignancy potential (LMP)), and malignant, reflecting their clinical behavior (Seidman et al., 2002). LMP represents 10% to 15% of tumors diagnosed as serous and is a conundrum as they display atypical nuclear structure and metastatic behavior, yet they are considerably less aggressive than high-grade serous tumors. The 5-year survival for patients with LMP tumors is 95% in contrast to a <45% survival for advanced high-grade disease over the same period (Berek et al., 2000).
Despite improved knowledge of the etiology of the disease, aggressive cytoreductive surgery, and modern combination chemotherapy, there has been only little change in mortality. Poor outcomes have been attributed to (1) lack of adequate screening tests for early disease detection, in combination with only subtle presentation of symptoms at this stage—diagnosis is frequently being made only after progression to later stages, at which point the peritoneal dissemination of the cancer limits effective treatment and (2) the frequent development of resistance to standard chemotherapeutic strategies limiting improvement in the 5-year survival rate of patients. The initial chemotherapy regimen for ovarian cancer includes the combination of carboplatin (Paraplatin) and paclitaxel (taxol). Years of clinical trials have proved this combination to be most effective after effective surgery—reduces tumor volume in about 80% of the women with newly diagnosed ovarian cancer and 40% to 50% will have complete regression—but studies continue to look for ways to improve it. Recent abdominal infusion of chemotherapeutics to target hard-to-reach cells in combination with intravenous delivery has increased the effectiveness. However, severe side effects often lead to an incomplete course of treatment. Some other chemotherapeutic agents include doxorubicin, cisplatin, cyclophosphamide, bleomycin, etoposide, vinblastine, topotecan hydrochloride, ifosfamide, 5-fluorouracil and melphalan. The excellent survival rates for women with early stage disease receiving chemotherapy provide a strong rationale for research efforts to develop strategies to improve the detection of ovarian cancer. Furthermore, the discovery of new ovarian cancer-related biomarkers will lead to the development of more effective therapeutic strategies with minimal side effects for the future treatment of ovarian cancer.
Presently, the diagnosis of ovarian cancer is accomplished, in part, through routine analysis of the medical history of patients and by performing physical, ultrasound and x-ray examinations, and hematological screening. Two alternative strategies have been reported for early hematological detection of serum biomarkers. One approach is the analysis of serum samples by mass spectrometry to find proteins or protein fragments of unknown identity that detect the presence or absence of cancer (Mor et al., 2005 and Kozak et al., 2003). However, this strategy is expensive and not broadly available. Alternatively, the presence or absence of known proteins/peptides in the serum is being detected using antibody microarrays, ELISA, or other similar approaches. Serum testing for a protein biomarker called CA-125 (cancer antigen-125) has long been widely performed as a marker for ovarian cancer. However, although ovarian cancer cells may produce an excess of these protein molecules, there are some other cancers, including cancer of the fallopian tube or endometrial cancer (cancer of the lining of the uterus), 60% of people with pancreatic cancer, and 20%-25% of people with other malignancies with elevated levels of CA-125. The CA-125 test only returns a true positive result for about 50% of Stage I ovarian cancer patients and has a 80% chance of returning true positive results from stage II, III, and IV ovarian cancer patients. The other 20% of ovarian cancer patients do not show any increase in CA-125 concentrations. In addition, an elevated CA-125 test may indicate other benign activity not associated with cancer, such as menstruation, pregnancy, or endometriosis. Consequently, this test has very limited clinical application for the detection of early stage disease when it is still treatable, exhibiting a positive predictive value (PPV) of <10%. And, even with the addition of ultrasound screening to CA-125, the PPV only improves to around 20% (Kozak et al., 2003). Thus, this test is not an effective screening test.
Other studies have yielded a number of biomarker combinations with increased specificity and sensitivity for ovarian cancer relative to CA-125 alone (McIntosh et al., 2004, Woolas et al., 1993, Schorge et., 2004). Serum biomarkers that are often elevated in women with epithelial ovarian cancer, but not exclusively, include carcinoembryonic antigen, ovarian cystadenocarcinoma antigen, lipidassociated sialic acid, NB/70, TAG72.3, CA-15.3, and CA-125. Unfortunately, although this approach has increased the sensitivity and specificity of early detection, published biomarker combinations still fail to detect a significant percentage of stage I/II epithelial ovarian cancer. Another study (Elieser et al., 2005) measured serum concentrations of 46 biomarkers including CA-125 and amongst these, 20 proteins in combination correctly recognized more than 98% of serum samples of women with ovarian cancer compared to other benign pelvic disease. Although other malignancies were not included in this study, this multimarker panel assay provided the highest diagnostic power for early detection of ovarian cancer thus far.
Additionally, with the advent of differential gene expression analysis technologies, for example DNA microarrays and subtraction methods, many groups have now reported large collections of genes that are upregulated in epithelial ovarian cancer (United States Patent Application published under numbers; 20030124579, 20030087250, 20060014686, 20060078941, 20050095592, 20050214831, 20030219760, 20060078941, 20050214826). However, the clinical utilities with respect to ovarian cancer of one or combinations of these genes are not as yet fully determined.
There is a need for new tumor biomarkers for improving diagnosis and/or prognosis of cancer. In addition, due to the genetic diversity of tumors, and the development of chemoresistance by many patients, there exists further need for better and more universal therapeutic approaches for the treatment of cancer. Molecular targets for the development of such therapeutics may preferably show a high degree of specificity for the tumor tissues compared to other somatic tissues, which will serve to minimize or eliminate undesired side effects, and increase the efficacy of the therapeutic candidates.
This present invention tries to address these needs and other needs.
In accordance with the present invention, there is provided new polynucleotide sequences and new polypeptide sequences as well as compositions, antibodies specific for these sequences, vectors and cells comprising a recombinant form of these new sequences.
The present invention also provides methods of detecting cancer cells using single or multiple polynucleotides and/or polypeptide sequences which are specific to these tumor cells. Some of the polynucleotides and/or polypeptides sequences provided herein are differentially expressed in ovarian cancer compared to normal cells and may also be used to distinguish between malignant ovarian cancer and an ovarian cancer of a low malignancy potential and/or a normal state (individual free of ovarian cancer).
Also encompassed by the present invention are diagnostic methods, prognostic methods, methods of detection, kits, arrays, librairies and assays which comprises one or more polypeptide and/or polynucleotide sequences or antibodies described herein as well as new therapeutic avenues for cancer treatment.
The Applicant has come to the surprising discovery that polynucleotide and/or polypeptide sequences described herein are preferentially upregulated in malignant ovarian cancer compared to low malignancy potential ovarian cancer and/or compared to normal cells. More interestingly, some of these sequences appear to be overexpressed in late stage ovarian cancer.
The Applicant has also come to the surprising discovery that some of the sequences described herein are not only expressed in ovarian cancer cells but in other cancer cells such as cells from breast cancer, prostate cancer, renal cancer, colon cancer, lung cancer, melanoma, leukemia and from cancer of the central nervous system. As such, several of these sequences, either alone or in combination may represent universal tumor markers. Therefore, some NSEQs and PSEQs described herein not only find utility in the field of ovarian cancer detection and treatment but also in the detection and treatment of other types of tumors
Therefore, using NSEQs or PSEQs of the present invention, one may readily identify a cell as being cancerous. As such NSEQs or PSEQs may be used to identify a cell as being a ovarian cancer cell, a prostate cancer cell, a breast cancer cell, a lung cancer cell, a colon cancer cell, a renal cancer cell, a cell from a melanoma, a leukemia cell or a cell from a cancer of the central nervous system.
Even more particularly, NSEQs or PSEQs described herein may be used to identify a cell as being a malignant ovarian cancer or a low malignant potential ovarian cancer.
The presence of some NSEQs or PSEQs in ovarian cancer cell may preferentially be indicative that the ovarian cancer is of the malignant type. Some NSEQs or PSEQs of the present invention may also more particularly indicate that the cancer is a late-stage malignant ovarian cancer.
The NSEQs or PSEQs may further be used to treat cancer or to identify compounds useful in the treatment of cancer including, ovarian cancer (i.e, LMP and/or malignant ovarian cancer), prostate cancer, breast cancer, lung cancer, colon cancer, renal cancer, melanoma, leukemia or cancer of the central nervous system.
As used herein and in some embodiments of the invention, the term “NSEQ” refers generally to polynucleotides sequences comprising or consisting of any one of SEQ. ID. NOs:1 to 49, and 169 (e.g., an isolated form) or comprising or consisting of a fragment of any one of SEQ. ID. NOs: 1 to 49 and 169. The term “NSEQ” more particularly refers to a polynucleotide sequence comprising or consisting of a transcribed portion of any one of SEQ. ID. NOs:1 to 49 and 169, which may be, for example, free of untranslated or untranslatable portion(s) (i.e., a coding portion of any one of SEQ ID Nos.: 1-49 and 169). The term “NSEQ” additionally refers to a sequence substantially identical to any one of the above and more particularly substantially identical to polynucleotide sequence comprising or consisting of a transcribed portion of any one of SEQ. ID. NOs:1 to 49 and 169, which may be, for example, free of untranslated or untranslatable portion(s). The term “NSEQ” additionally refers to a nucleic acid sequence region of any one of SEQ. ID. NOs:1 to 49 and 169 which encodes or is able to encode a polypeptide. The term “NSEQ” also refers to a polynucleotide sequence able to encode any one of the polypeptides described herein or a polypeptide fragment of any one of the above. Finally, the term “NSEQ” refers to a sequence substantially complementary to any one of the above.
In other embodiments of the invention such as those which relate to detection and/or treatment of cancers other than ovarian cancer, NSEQ may also relates to SEQ ID NO.:50 including any polynucleotide comprising or consisting of SEQ. ID. NO:50 (e.g., an isolated form) or comprising or consisting of a fragment of any one of SEQ. ID. NO:50, such as a polynucleotide sequence comprising or consisting of a transcribed portion of any one of SEQ. ID. NO:50, which may be, for example, free of untranslated or untranslatable portion(s) (i.e., a coding portion of SEQ. ID. NO:50). The term “NSEQ” additionally refers to a sequence substantially identical to any one of the above and more particularly substantially identical to polynucleotide sequence comprising or consisting of a transcribed portion of SEQ. ID. NO:50, which may be, for example, free of untranslated or untranslatable portion(s). The term “NSEQ” additionally refers to a nucleic acid sequence region of SEQ. ID. NO:50 which encodes or is able to encode a polypeptide. Finally, the term “NSEQ” refers to a sequence substantially complementary to any one of the above.
As such, in embodiments of the invention NSEQ encompasses, for example, SEQ. ID. NOs:1 to 49, 50 and 169 and also encompasses polynucleotide sequences which comprises, are designed or derived from SEQ. ID. NOs:1 to 49, 50 or 169. Non-limiting examples of such sequences includes, for example, SEQ ID NOs.: 103-150 or 151-152.
The term “inhibitory NSEQ” generally refers to a sequence substantially complementary to any one of SEQ. ID. NOs:1 to 49, 50 or 169, substantially complementary to a fragment of any one of SEQ. ID. Nos: 1 to 49, 50 or 169, substantially complementary to a sequence substantially identical to SEQ. ID. NOs:1 to 49, 50 or 169 and more particularly, substantially complementary to a transcribed portion of any one of SEQ. ID. NOs:1 to 49, 50 or 169 (e.g., which may be free of untranslated or untranslatable portion) and which may have attenuating or even inhibitory action against the transcription of a mRNA or against expression of a polypeptide encoded by a corresponding SEQ ID NOs.:1 to 49, 50 or 169. Suitable “inhibitory NSEQ” may have for example and without limitation from about 10 to about 30 nucleotides, from about 10 to about 25 nucleotides or from about 15 to about 20 nucleotides.
As used herein the term “PSEQ” refers generally to each and every polypeptide sequences mentioned herein such as, for example, any polypeptide sequences encoded (putatively encoded) by any one of NSEQ described herein (e.g., any one of SEQ. ID. NOs:1 to 49 or 169) including their isolated or substantially purified form. Therefore, in embodiments of the invention, a polypeptide comprising or consisting of any one of SEQ. ID. NOs:51 to 88 or 170 including variants (e.g., an isolated natural protein variant), analogs, derivatives and fragments thereof are collectively referred to herein as “PSEQ”. In other embodiments of the invention, such as those related to detection and/or treatment of cancers other than ovarian cancer, PSEQ also refers to polypeptide comprising or consisting of SEQ ID NO.:89 including variants (e.g., an isolated natural protein variant), analogs, derivatives and fragments.
Some of the NSEQs or PSEQs described herein have been previously characterized for purposes other than those described herein. As such diagnostics and therapeutics which are known to target those NSEQs or PSEQs (e.g., antibodies and/or inhibitors) may thus now be applied for inhibition of these NSEQ or PSEQ in the context of treatment of ovarian cancer, prostate cancer, renal cancer, colon cancer, lung cancer, melanoma, leukemia or cancer of the central nervous system. The use of these known therapeutics and diagnostics for previously undisclosed utility such as those described herein is encompassed by the present invention.
For example, antibodies capable of binding to folate receptor-1 may thus be used for specific binding of tumor cells other than ovarian cancer cells, such as breast cancer, prostate cancer, renal cancer, colon cancer, lung cancer, melanoma, leukemia and from cancer of the central nervous system. As such the use of antibodies and/or inhibitors of folate receptor-1 (e.g., CB300638, CB300945 which are Cyclopenta[g]quinazoline-based Thymidylate Synthase Inhibitor, those described in US20040242606, US20050009851, etc.) in the use of treatment of prostate cancer, renal cancer, colon cancer, lung cancer, melanoma, leukemia and cancer of the central nervous system is encompassed by the present invention.
The NSEQ described herein may be used either directly or in the development of tools for the detection and isolation of expression products (mRNA, mRNA precursor, hnRNA, etc.), of genomic DNA or of synthetic products (cDNA, PCR fragments, vectors comprising NSEQ etc.). NSEQs may also be used to prepare suitable tools for detecting an encoded polypeptide or protein. NSEQ may thus be used to provide an encoded polypeptide and to generate an antibody specific for the polypeptide.
Those skilled in the art will also recognize that short oligonucleotides sequences may be prepared based on the polynucleotide sequences described herein. For example, oligonucleotides having 10 to 20 nucleotides or more may be prepared for specifically hybridizing to a NSEQ having a substantially complementary sequence and to allow detection, identification and isolation of nucleic sequences by hybridization. Probe sequences of for example, at least 10-20 nucleotides may be prepared based on a sequence found in any one of SEQ ID NO.:1 to 49, 50 or 169 and more particularly selected from regions that lack homology to undesirable sequences. Probe sequences of 20 or more nucleotides that lack such homology may show an increased specificity toward the target sequence. Useful hybridization conditions for probes and primers are readily determinable by those of skill in the art. Stringent hybridization conditions encompassed herewith are those that may allow hybridization of nucleic acids that are greater than 90% homologous but which may prevent hybridization of nucleic acids that are less than 70% homologous. The specificity of a probe may be determined by whether it is made from a unique region, a regulatory region, or from a conserved motif. Both probe specificity and the stringency of diagnostic hybridization or amplification (maximal, high, intermediate, or low) reactions depend on whether or not the probe identifies exactly complementary sequences, allelic variants, or related sequences. Probes designed to detect related sequences may have, for example, at least 50% sequence identity to any of the selected polynucleotides.
Furthermore, a probe may be labelled by any procedure known in the art, for example by incorporation of nucleotides linked to a “reporter molecule”. A “reporter molecule”, as used herein, may be a molecule that provides an analytically identifiable signal allowing detection of a hybridized probe. Detection may be either qualitative or quantitative. Commonly used reporter molecules include fluorophores, enzymes, biotin, chemiluminescent molecules, bioluminescent molecules, digoxigenin, avidin, streptavidin or radioisotopes. Commonly used enzymes include horseradish peroxidase, alkaline phosphatase, glucose oxidase and 3-galactosidase, among others. Enzymes may be conjugated to avidin or streptavidin for use with a biotinylated probe. Similarly, probes may be conjugated to avidin or streptavidin for use with a biotinylated enzyme. Incorporation of a reporter molecule into a DNA probe may be effected by any method known to the skilled artisan, for example by nick translation, primer extension, random oligo priming, by 3′ or 5′ end labeling or by other means. In addition, hybridization probes include the cloning of nucleic acid sequences into vectors for the production of mRNA probes. Such vectors are known in the art, are commercially available, and may be used to synthesize RNA probes in vitro. The labelled polynucleotide sequences may be used in Southern or northern analysis, dot blot, or other membrane-based technologies; in PCR technologies; and in micro arrays utilizing samples from subjects to detect altered expression. Oligonucleotides useful as probes for screening of samples by hybridization assays or as primers for amplification may be packaged into kits. Such kits may contain the probes or primers in a pre-measured or predetermined amount, as well as other suitably packaged reagents and materials needed for the particular hybridization or amplification protocol.
The expression of mRNAs identical or substantially identical to the NSEQs of the present invention may thus be detected and/or isolated using methods which are known in the art. Exemplary embodiment of such methods includes, for example and without limitation, hybridization analysis using oligonucleotide probes, reverse transcription and in vitro nucleic acid amplification methods.
Such procedures may therefore, permit detection of mRNAs in ovarian cells (e.g., ovarian cancer cells) or in any other cells expressing such mRNAs. Expression of mRNA in a tissue-specific or a disease-specific manner may be useful for defining the tissues and/or particular disease state. One of skill in the art may readily adapt the NSEQs for these purposes.
It is to be understood herein that the NSEQs may hybridize to a substantially complementary sequence found in a test sample (e.g., cell, tissue, etc.). Additionally, a sequence substantially complementary to NSEQ (including fragments) may bind a NSEQ and substantially identical sequences found in a test sample (e.g., cell, tissue, etc.).
Polypeptide encoded by an isolated NSEQ, polypeptide variants, polypeptide analogs or polypeptide fragments thereof are also encompassed herewith. The polypeptides whether in a premature, mature or fused form, may be isolated from lysed cells, or from the culture medium, and purified to the extent needed for the intended use. One of skill in the art may readily purify these proteins, polypeptides and peptides by any available procedure. For example, purification may be accomplished by salt fractionation, size exclusion chromatography, ion exchange chromatography, reverse phase chromatography, affinity chromatography and the like. Alternatively, PSEQ may be made by chemical synthesis.
Natural variants may be identified through hybridization screening of a nucleic acid library or polypeptide library from different tissue, cell type, population, species, etc using the NSEQ and derived tools.
In order to express a polypeptide, a NSEQ able to encode any one of a PSEQ described herein may be inserted into an expression vector, i.e., a vector that contains the elements for transcriptional and translational control of the inserted coding sequence in a particular host. These elements may include regulatory sequences, such as enhancers, constitutive and inducible promoters, and 5′ and 3′ un-translated regions. Methods that are well known to those skilled in the art may be used to construct such expression vectors. These methods include in vitro recombinant DNA techniques, synthetic techniques, and in vivo genetic recombination.
A variety of expression vector/host cell systems known to those of skill in the art may be utilized to express a polypeptide or RNA from NSEQ. These include, but are not limited to, microorganisms such as bacteria transformed with recombinant bacteriophage, plasmid, or cosmid DNA expression vectors; yeast transformed with yeast expression vectors; insect cell systems infected with baculovirus vectors; plant cell systems transformed with viral or bacterial expression vectors; or animal cell systems. For long-term production of recombinant proteins in mammalian systems, stable expression in cell lines may be effected. For example, NSEQ may be transformed into cell lines using expression vectors that may contain viral origins of replication and/or endogenous expression elements and a selectable or visible marker gene on the same or on a separate vector. The invention is not to be limited by the vector or host cell employed.
Alternatively, RNA and/or polypeptide may be expressed from a vector comprising NSEQ using an in vitro transcription system or a coupled in vitro transcription/translation system respectively.
In general, host cells that contain NSEQ and/or that express a polypeptide encoded by the NSEQ, or a portion thereof, may be identified by a variety of procedures known to those of skill in the art. These procedures include, but are not limited to, DNA/DNA or DNA/RNA hybridizations, PCR amplification, and protein bioassay or immunoassay techniques that include membrane, solution, or chip based technologies for the detection and/or quantification of nucleic acid or amino acid sequences. Immunological methods for detecting and measuring the expression of polypeptides using either specific polyclonal or monoclonal antibodies are known in the art. Examples of such techniques include enzyme-linked immunosorbent assays (ELISAs), radioimmunoassays (RIAs), and fluorescence activated cell sorting (FACS). Those of skill in the art may readily adapt these methodologies to the present invention.
Host cells comprising NSEQ may thus be cultured under conditions for the transcription of the corresponding RNA (mRNA, siRNA, shRNA etc.) and/or the expression of the polypeptide from cell culture. The polypeptide produced by a cell may be secreted or may be retained intracellularly depending on the sequence and/or the vector used. As will be understood by those of skill in the art, expression vectors containing NSEQ may be designed to contain signal sequences that direct secretion of the polypeptide through a prokaryotic or eukaryotic cell membrane. Due to the inherent degeneracy of the genetic code, other DNA sequences that encode the same, substantially the same or a functionally equivalent amino acid sequence may be produced and used, for example, to express a polypeptide encoded by NSEQ. The nucleotide sequences of the present invention may be engineered using methods generally known in the art in order to alter the nucleotide sequences for a variety of purposes including, but not limited to, modification of the cloning, processing, and/or expression of the gene product. DNA shuffling by random fragmentation and PCR reassembly of gene fragments and synthetic oligonucleotides may be used to engineer the nucleotide sequences. For example, oligonucleotide-mediated site-directed mutagenesis may be used to introduce mutations that create new restriction sites, alter glycosylation patterns, change codon preference, produce splice variants, and so forth. In addition, a host cell strain may be chosen for its ability to modulate expression of the inserted sequences or to process the expressed polypeptide in the desired fashion. Such modifications of the polypeptide include, but are not limited to, acetylation, carboxylation, glycosylation, phosphorylation, lipidation, and acylation. Post-translational processing, which cleaves a “prepro” form of the polypeptide, may also be used to specify protein targeting, folding, and/or activity. Different host cells that have specific cellular machinery and characteristic mechanisms for post-translational activities (e.g., CHO, HeLa, MDCK, HEK293, and W138) are available commercially and from the American Type Culture Collection (ATCC) and may be chosen to ensure the correct modification and processing of the expressed polypeptide.
Those of skill in the art will readily appreciate that natural, modified, or recombinant nucleic acid sequences may be ligated to a heterologous sequence resulting in translation of a fusion polypeptide containing heterologous polypeptide moieties in any of the aforementioned host systems. Such heterologous polypeptide moieties may facilitate purification of fusion polypeptides using commercially available affinity matrices. Such moieties include, but are not limited to, glutathione S-transferase (GST), maltose binding protein, thioredoxin, calmodulin binding peptide, 6-His (His), FLAG, c-myc, hemaglutinin (HA), and antibody epitopes such as monoclonal antibody epitopes.
In yet a further aspect, the present invention relates to a polynucleotide which may comprise a nucleotide sequence encoding a fusion protein, the fusion protein may comprise a fusion partner fused to a peptide fragment of a protein encoded by, or a naturally occurring allelic variant polypeptide encoded by, the polynucleotide sequence described herein.
Those of skill in the art will also readily recognize that the nucleic acid and polypeptide sequences may be synthesized, in whole or in part, using chemical or enzymatic methods well known in the art. For example, peptide synthesis may be performed using various solid-phase techniques and machines such as the ABI 431A Peptide synthesizer (PE Biosystems) may be used to automate synthesis. If desired, the amino acid sequence may be altered during synthesis and/or combined with sequences from other proteins to produce a variant protein.
The present invention additionally relates to a bioassay for evaluating compounds as potential antagonists of the polypeptide described herein, the bioassay may comprise:
The present invention further relates to a bioassay for evaluating compounds as potential agonists for a polypeptide encoded by the polynucleotide sequence described herein, the bioassay may comprise:
The skilled artisan will readily recognize that NSEQ may be used to identify a particular cell, cell type, tissue, disease and thus may be used for diagnostic purposes to determine the absence, presence, or altered expression (i.e. increased or decreased compared to normal) of the expression product of a gene. Suitable NSEQ may be for example, between 10 and 20 or longer, i.e., at least 10 nucleotides long or at least 12 nucleotides long, or at least 15 nucleotides long up to any desired length and may comprise, for example, RNA, DNA, branched nucleic acids, and/or peptide nucleic acids (PNAs). In one alternative, the polynucleotides may be used to detect and quantify gene expression in samples in which expression of NSEQ is correlated with disease. In another alternative, NSEQ may be used to detect genetic polymorphisms associated with a disease. These polymorphisms may be detected, for example, in the transcript, cDNA or genomic DNA.
The invention provides for the use of at least one of the NSEQ described herein on an array and for the use of that array in a method of detection of a particular cell, cell type, tissue, disease for the prognosis or diagnosis of cancer. The method may comprise hybridizing the array with a patient sample (putatively comprising or comprising a target polynucleotide sequence substantially complementary to a NSEQ) under conditions to allow complex formation (between NSEQ and target polynucleotide), detecting complex formation, wherein the complex formation is indicative of the presence of the polynucleotide and wherein the absence of complex formation is indicative of the absence of the polynucleotide in the patient sample. The presence or absence of the polynucleotide may be indicative of cancer such as, for example, ovarian cancer or other cancer as indicated herein.
The method may also comprise the step of quantitatively or qualitatively comparing (e.g., with a computer system, apparatus) the level of complex formation in the patient sample to that of standards for normal cells or individual or other type, origin or grade of cancer.
The present invention provides one or more compartmentalized kits for detection of a polynucleotide and/or polypeptide for the diagnosis or prognosis of ovarian cancer. A first kit may have a receptacle containing at least one isolated NSEQ or probe comprising NSEQ. Such a probe may bind to a nucleic acid fragment which is present/absent in normal cells but which is absent/present in affected or diseased cells. Such a probe may be specific for a nucleic acid site that is normally active/inactive but which may be inactive/active in certain cell types. Similarly, such a probe may be specific for a nucleic acid site that may be abnormally expressed in certain cell types. Finally, such a probe may identify a specific mutation. The probe may be capable of hybridizing to the nucleic acid sequence which is mutated (not identical to the normal nucleic acid sequence), or may be capable of hybridizing to nucleic acid sequences adjacent to the mutated nucleic acid sequences. The probes provided in the present kits may have a covalently attached reporter molecule. Probes and reporter molecules may be readily prepared as described above by those of skill in the art.
Antibodies (e.g., isolated antibody) that may specifically bind to a protein or polypeptide described herein (a PSEQ) as well as nucleic acids encoding such antibodies are also encompassed by the present invention.
As used herein the term “antibody” means a monoclonal antibody, a polyclonal antibody, a single chain antibody, a chimeric antibody, a humanized antibody, a deimmunized antibody, an antigen-binding fragment, an Fab fragment; an F(ab′)2 fragment, and Fv fragment; CDRs, or a single-chain antibody comprising an antigen-binding fragment (e.g., a single chain Fv).
The antibody may originate for example, from a mouse, rat or any other mammal or from other sources such as through recombinant DNA technologies.
The antibody may also be a human antibody which may be obtained, for example, from a transgenic non-human mammal capable of expressing human Ig genes. The antibody may also be a humanised antibody which may comprise, for example, one or more complementarity determining regions of non-human origin. It may also comprise a surface residue of a human antibody and/or framework regions of a human antibody. The antibody may also be a chimeric antibody which may comprise, for example, variable domains of a non-human antibody and constant domains of a human antibody.
The antibody of the present invention may be mutated and selected based on an increased affinity, solubility, stability, specificity and/or for one of a polypeptide described herein and/or based on a reduced immunogenicity in a desired host or for other desirable characteristics.
Suitable antibodies may bind to unique antigenic regions or epitopes in the polypeptides, or a portion thereof. Epitopes and antigenic regions useful for generating antibodies may be found within the proteins, polypeptides or peptides by procedures available to one of skill in the art. For example, short, unique peptide sequences may be identified in the proteins and polypeptides that have little or no homology to known amino acid sequences. Preferably the region of a protein selected to act as a peptide epitope or antigen is not entirely hydrophobic; hydrophilic regions are preferred because those regions likely constitute surface epitopes rather than internal regions of the proteins and polypeptides. These surface epitopes are more readily detected in samples tested for the presence of the proteins and polypeptides. Such antibodies may include, but are not limited to, polyclonal, monoclonal, chimeric, and single chain antibodies, Fab fragments, and fragments produced by a Fab expression library. The production of antibodies is well known to one of skill in the art and is not intended to be limited herein.
Peptides may be made by any procedure known to one of skill in the art, for example, by using in vitro translation or chemical synthesis procedures or by introducing a suitable expression vector into cells. Short peptides which provide an antigenic epitope but which by themselves are too small to induce an immune response may be conjugated to a suitable carrier. Suitable carriers and methods of linkage are well known in the art. Suitable carriers are typically large macromolecules such as proteins, polysaccharides and polymeric amino acids. Examples include serum albumins, keyhole limpet hemocyanin, ovalbumin, polylysine and the like. One of skill in the art may use available procedures and coupling reagents to link the desired peptide epitope to such a carrier. For example, coupling reagents may be used to form disulfide linkages or thioether linkages from the carrier to the peptide of interest. If the peptide lacks a disulfide group, one may be provided by the addition of a cysteine residue. Alternatively, coupling may be accomplished by activation of carboxyl groups.
The minimum size of peptides useful for obtaining antigen specific antibodies may vary widely. The minimum size must be sufficient to provide an antigenic epitope that is specific to the protein or polypeptide. The maximum size is not critical unless it is desired to obtain antibodies to one particular epitope. For example, a large polypeptide may comprise multiple epitopes, one epitope being particularly useful and a second epitope being immunodominant, etc. Typically, antigenic peptides selected from the present proteins and polypeptides will range without limitation, from 5 to about 100 amino acids in length. More typically, however, such an antigenic peptide will be a maximum of about 50 amino acids in length, and preferably a maximum of about 30 amino acids. It is usually desirable to select a sequence of about 6, 8, 10, 12 or 15 amino acids, up to about 20 or 25 amino acids (and any number therebetween).
Amino acid sequences comprising useful epitopes may be identified in a number of ways. For example, preparing a series of short peptides that taken together span the entire protein sequence may be used to screen the entire protein sequence. One of skill in the art may routinely test a few large polypeptides for the presence of an epitope showing a desired reactivity and also test progressively smaller and overlapping fragments to identify a preferred epitope with the desired specificity and reactivity.
As mentioned herein, antigenic polypeptides and peptides are useful for the production of monoclonal and polyclonal antibodies. Antibodies to a polypeptide encoded by the polynucleotides of NSEQ, polypeptide analogs or portions thereof, may be generated using methods that are well known in the art. For example, monoclonal antibodies may be prepared using any technique that provides for the production of antibody molecules by continuous cell lines in culture. These include, but are not limited to, the hybridoma, the human B-cell hybridoma, and the EBV-hybridoma techniques. In addition, techniques developed for the production of chimeric antibodies may be used. Alternatively, techniques described for the production of single chain antibodies may be employed. Fabs that may contain specific binding sites for a polypeptide encoded by the polynucleotides of NSEQ, or a portion thereof, may also be generated. Various immunoassays may be used to identify antibodies having the desired specificity. Numerous protocols for competitive binding or immunoradiometric assays using either polyclonal or monoclonal antibodies with established specificities are well known in the art.
To obtain polyclonal antibodies, a selected animal may be immunized with a protein or polypeptide. Serum from the animal may be collected and treated according to known procedures. Polyclonal antibodies to the protein or polypeptide of interest may then be purified by affinity chromatography. Techniques for producing polyclonal antisera are well known in the art.
Monoclonal antibodies (MAbs) may be made by one of several procedures available to one of skill in the art, for example, by fusing antibody producing cells with immortalized cells and thereby making a hybridoma. The general methodology for fusion of antibody producing B cells to an immortal cell line is well within the province of one skilled in the art. Another example is the generation of MAbs from mRNA extracted from bone marrow and spleen cells of immunized animals using combinatorial antibody library technology.
One drawback of MAbs derived from animals or from derived cell lines is that although they may be administered to a patient for diagnostic or therapeutic purposes, they are often recognized as foreign antigens by the immune system and are unsuitable for continued use. Antibodies that are not recognized as foreign antigens by the human immune system have greater potential for both diagnosis and treatment. Methods for generating human and humanized antibodies are now well known in the art.
Chimeric antibodies may be constructed in which regions of a non-human MAb are replaced by their human counterparts. A preferred chimeric antibody is one that has amino acid sequences that comprise one or more complementarity determining regions (CDRs) of a non-human Mab that binds to a polypeptide encoded by the polynucleotides of NSEQ, or a portion thereof, grafted to human framework (FW) regions. Methods for producing such antibodies are well known in the art. Amino acid residues corresponding to CDRs and FWs are known to one of average skill in the art.
A variety of methods have been developed to preserve or to enhance affinity for antigen of antibodies comprising grafted CDRs. One way is to include in the chimeric antibody the foreign framework residues that influence the conformation of the CDR regions. A second way is to graft the foreign CDRs onto human variable domains with the closest homology to the foreign variable region. Thus, grafting of one or more non-human CDRs onto a human antibody may also involve the substitution of amino acid residues which are adjacent to a particular CDR sequence or which are not contiguous with the CDR sequence but which are packed against the CDR in the overall antibody variable domain structure and which affect the conformation of the CDR. Humanized antibodies of the invention therefore include human antibodies which comprise one or more non-human CDRs as well as such antibodies in which additional substitutions or replacements have been made to preserve or enhance binding characteristics.
Chimeric antibodies of the invention also include antibodies that have been humanized by replacing surface-exposed residues to make the MAb appear human. Because the internal packing of amino acid residues in the vicinity of the antigen-binding site remains unchanged, affinity is preserved. Substitution of surface-exposed residues of a polypeptide encoded by the polynucleotides of NSEQ (or a portion thereof)-antibody according to the invention for the purpose of humanization does not mean substitution of CDR residues or adjacent residues that influence affinity for a polypeptide encoded by the polynucleotides of NSEQ, or a portion thereof.
Chimeric antibodies may also include antibodies where some or all non-human constant domains have been replaced with human counterparts. This approach has the advantage that the antigen-binding site remains unaffected. However, significant amounts of non-human sequences may be present where variable domains are derived entirely from non-human antibodies.
Antibodies of the invention include human antibodies that are antibodies consisting essentially of human sequences. Human antibodies may be obtained from phage display libraries wherein combinations of human heavy and light chain variable domains are displayed on the surface of filamentous phage. Combinations of variable domains are typically displayed on filamentous phage in the form of Fab′ s or scFvs. The library may be screened for phage bearing combinations of variable domains having desired antigen-binding characteristics. Preferred variable domain combinations are characterized by high affinity for a polypeptide encoded by the polynucleotides of NSEQ, or a portion thereof. Preferred variable domain combinations may also be characterized by high specificity for a polypeptide encoded by the polynucleotides of NSEQ, or a portion thereof, and little cross-reactivity to other related antigens. By screening from very large repertoires of antibody fragments, (2−10×1010) a good diversity of high affinity Mabs may be isolated, with many expected to have sub-nanomolar affinities for a polypeptide encoded by the polynucleotides of NSEQ, or a portion thereof.
Alternatively, human antibodies may be obtained from transgenic animals into which un-rearranged human Ig gene segments have been introduced and in which the endogenous mouse Ig genes have been inactivated. Preferred transgenic animals contain very large contiguous Ig gene fragments that are over 1 Mb in size but human polypeptide-specific Mabs of moderate affinity may be raised from transgenic animals containing smaller gene loci. Transgenic animals capable of expressing only human Ig genes may also be used to raise polyclonal antiserum comprising antibodies solely of human origin.
Antibodies of the invention may include those for which binding characteristics have been improved by direct mutation or by methods of affinity maturation. Affinity and specificity may be modified or improved by mutating CDRs and screening for antigen binding sites having the desired characteristics. CDRs may be mutated in a variety of ways. One way is to randomize individual residues or combinations of residues so that in a population of otherwise identical antigen binding sites, all twenty amino acids may be found at particular positions. Alternatively, mutations may be induced over a range of CDR residues by error prone PCR methods. Phage display vectors containing heavy and light chain variable region gene may be propagated in mutator strains of E. coli. These methods of mutagenesis are illustrative of the many methods known to one of skill in the art.
The antibody may further comprise a detectable label (reporter molecule) attached thereto.
There is provided also methods of producing antibodies able to specifically bind to one of a polypeptide, polypeptide fragments, or polypeptide analogs described herein, the method may comprise:
The method may further comprise the step of administering a second dose to the mammal (e.g., animal).
Methods of producing a hybridoma which secretes an antibody that specifically binds to a polypeptide are also encompassed herewith and are known in the art.
The method may comprise:
Also encompassed by the present invention is a method of producing an antibody that specifically binds to one of the polypeptide described herein, the method may comprise:
The antibody of the present invention may thus be obtained, for example, from a library (e.g., bacteriophage library) which may be prepared, for example, by
In order to generate antibodies, the host animal may be immunized with polypeptide and/or a polypeptide fragment and/or analog described herein to induce an immune response prior to extracting the cells which are responsible for production of antibodies.
The antibodies obtained by the means described herein may be useful for detecting proteins, variant and derivative polypeptides in specific tissues or in body fluids. Moreover, detection of aberrantly expressed proteins or protein fragments is probative of a disease state. For example, expression of the present polypeptides encoded by the polynucleotides of NSEQ, or a portion thereof, may indicate that the protein is being expressed at an inappropriate rate or at an inappropriate developmental stage. Hence, the present antibodies may be useful for detecting diseases associated with protein expression from NSEQs disclosed herein.
For in vivo detection purposes, antibodies may be those which preferably recognize an epitope present at the surface of a tumor cell.
A variety of protocols for measuring polypeptides, including ELISAs, RIAs, and FACS, are well known in the art and provide a basis for diagnosing altered or abnormal levels of expression. Standard values for polypeptide expression are established by combining samples taken from healthy subjects, preferably human, with antibody to the polypeptide under conditions for complex formation. The amount of complex formation may be quantified by various methods, such as photometric means. Quantities of polypeptide expressed in disease samples may be compared with standard values. Deviation between standard and subject values may establish the parameters for diagnosing or monitoring disease.
Design of immunoassays is subject to a great deal of variation and a variety of these are known in the art. Immunoassays may use a monoclonal or polyclonal antibody reagent that is directed against one epitope of the antigen being assayed. Alternatively, a combination of monoclonal or polyclonal antibodies may be used which are directed against more than one epitope. Protocols may be based, for example, upon competition where one may use competitive drug screening assays in which neutralizing antibodies capable of binding a polypeptide encoded by the polynucleotides of NSEQ, or a portion thereof, specifically compete with a test compound for binding the polypeptide. Alternatively one may use, direct antigen-antibody reactions or sandwich type assays and protocols may, for example, make use of solid supports or immunoprecipitation. Furthermore, antibodies may be labelled with a reporter molecule for easy detection. Assays that amplify the signal from a bound reagent are also known. Examples include immunoassays that utilize avidin and biotin, or which utilize enzyme-labelled antibody or antigen conjugates, such as ELISA assays.
Kits suitable for immunodiagnosis and containing the appropriate labelled reagents include antibodies directed against the polypeptide protein epitopes or antigenic regions, packaged appropriately with the remaining reagents and materials required for the conduct of the assay, as well as a suitable set of assay instructions.
The present invention therefore provides a kit for specifically detecting a polypeptide described herein, the kit may comprise, for example, an antibody or antibody fragment capable of binding specifically to the polypeptide described herein.
In accordance with the present invention, the kit may be a diagnostic kit, which may comprise:
In accordance with the present invention, the antibodies may be immobilized on a solid support. The detection reagent may comprise, for example, an anti-immunoglobulin, protein G, protein A or lectin etc. The reporter group may be selected, without limitation, from the group consisting of radioisotopes, fluorescent groups, luminescent groups, enzymes, biotin and dye particles
One of skill in the art will readily appreciate that the NSEQ, PSEQ, expression systems, assays, kits and array discussed above may also be used to evaluate the efficacy of a particular therapeutic treatment regimen, in animal studies, in clinical trials, or to monitor the treatment of an individual subject. Once the presence of disease is established and a treatment protocol is initiated, hybridization or amplification assays may be repeated on a regular basis to determine if the level of mRNA or protein in the patient (patient's blood, tissue, cell etc.) begins to approximate the level observed in a healthy subject. The results obtained from successive assays may be used to show the efficacy of treatment over a period ranging from several days to many years.
In yet another aspect of the invention, NSEQ may be used therapeutically for the purpose of expressing mRNA and polypeptide, or conversely to block transcription and/or translation of the mRNA. Expression vectors may be constructed using elements from retroviruses, adenoviruses, herpes or vaccinia viruses, or bacterial plasmids, and the like. These vectors may be used for delivery of nucleotide sequences to a particular target organ, tissue, or cell population. Methods well known to those skilled in the art may be used to construct vectors to express nucleic acid sequences or their complements.
Alternatively, NSEQ may be used for somatic cell or stem cell gene therapy. Vectors may be introduced in vivo, in vitro, and ex vivo. For ex vivo therapy, vectors are introduced into stem cells taken from the subject, and the resulting transgenic cells are clonally propagated for autologous transplant back into that same subject. Delivery of NSEQ by transfection, liposome injections, or polycationic amino polymers may be achieved using methods that are well known in the art. Additionally, endogenous NSEQ expression may be inactivated using homologous recombination methods that insert an inactive gene sequence into the coding region or other targeted region of NSEQ.
Depending on the specific goal to be achieved, vectors containing NSEQ may be introduced into a cell or tissue to express a missing polypeptide or to replace a non-functional polypeptide. Of course, when one wishes to express PSEQ in a cell or tissue, one may use a NSEQ able to encode such PSEQ for that purpose or may directly administer PSEQ to that cell or tissue.
On the other hand, when one wishes to attenuate or inhibit the expression of PSEQ, one may use a NSEQ (e.g., an inhibitory NSEQ) which is substantially complementary to at least a portion of a NSEQ able to encode such PSEQ.
The expression of an inhibitory NSEQ may be done by cloning the inhibitory NSEQ into a vector and introducing the vector into a cell to down-regulate the expression of a polypeptide encoded by the target NSEQ. Complementary or anti-sense sequences may also comprise an oligonucleotide derived from the transcription initiation site; nucleotides between about positions −10 and +10 from the ATG may be used. Therefore, inhibitory NSEQ may encompass a portion which is substantially complementary to a desired nucleic acid molecule to be inhibited and a portion (sequence) which binds to an untranslated portion of the nucleic acid.
Similarly, inhibition may be achieved using triple helix base-pairing methodology. Triple helix pairing is useful because it causes inhibition of the ability of the double helix to open sufficiently for the binding of polymerases, transcription factors, or regulatory molecules. Recent therapeutic advances using triplex DNA have been described in the literature. (See, e.g., Gee et al. 1994)
Ribozymes, enzymatic RNA molecules, may also be used to catalyze the cleavage of mRNA and decrease the levels of particular mRNAs, such as those comprising the polynucleotide sequences of the invention. Ribozymes may cleave mRNA at specific cleavage sites. Alternatively, ribozymes may cleave mRNAs at locations dictated by flanking regions that form complementary base pairs with the target mRNA. The construction and production of ribozymes is well known in the art.
RNA molecules may be modified to increase intracellular stability and half-life. Possible modifications include, but are not limited to, the addition of flanking sequences at the 5′ and/or 3′ ends of the molecule, or the use of phosphorothioate or 2′ O-methyl rather than phosphodiester linkages within the backbone of the molecule. Alternatively, nontraditional bases such as inosine, queosine, and wybutosine, as well as acetyl-, methyl-, thio-, and similarly modified forms of adenine, cytidine, guanine, thymine, and uridine which are not as easily recognized by endogenous endonucleases, may be included.
Pharmaceutical compositions are also encompassed by the present invention. The pharmaceutical composition may comprise at least one NSEQ or PSEQ and a pharmaceutically acceptable carrier.
As it will be appreciated form those of skill in the art, the specificity of expression NSEQ and/or PSEQ in tumor cells may advantageously be used for inducing an immune response (through their administration) in an individual having, or suspected of having a tumor expressing such sequence. Administration of NSEQ and/or PSEQ in individuals at risk of developing a tumor expressing such sequence is also encompassed herewith.
In addition to the active ingredients, a pharmaceutical composition may contain pharmaceutically acceptable carriers comprising excipients and auxiliaries that facilitate processing of the active compounds into preparations that may be used pharmaceutically.
For any compound, the therapeutically effective dose may be estimated initially either in cell culture assays or in animal models such as mice, rats, rabbits, dogs, or pigs. An animal model may also be used to determine the concentration range and route of administration. Such information may then be used to determine useful doses and routes for administration in humans. These techniques are well known to one skilled in the art and a therapeutically effective dose refers to that amount of active ingredient that ameliorates the symptoms or condition. Therapeutic efficacy and toxicity may be determined by standard pharmaceutical procedures in cell cultures or with experimental animals, such as by calculating and contrasting the ED50 (the dose therapeutically effective in 50% of the population) and LD50 (the dose lethal to 50% of the population) statistics. Any of the therapeutic compositions described above may be applied to any subject in need of such therapy, including, but not limited to, mammals such as dogs, cats, cows, horses, rabbits, monkeys, and most preferably, humans.
The pharmaceutical compositions utilized in this invention may be administered by any number of routes including, but not limited to, oral, intravenous, intramuscular, intra-arterial, intramedullary, intrathecal, intraventricular, transdermal, subcutaneous, intraperitoneal, intranasal, enteral, topical, sublingual, or rectal means.
The term “treatment” for purposes of this disclosure refers to both therapeutic treatment and prophylactic or preventative measures, wherein the object is to prevent or slow down (lessen) the targeted pathologic condition or disorder. Those in need of treatment include those already with the disorder as well as those prone to have the disorder or those in whom the disorder is to be prevented.
The invention also provides products, compositions, processes and methods that utilize a NSEQ described herein, a polypeptide encoded by a NSEQ described herein, a PSEQ described herein for research, biological, clinical and therapeutic purposes. For example, to identify splice variants, mutations, and polymorphisms and to generate diagnostic and prognostic tools.
NSEQ may be extended utilizing a partial nucleotide sequence and employing various PCR-based methods known in the art to detect upstream sequences such as promoters and other regulatory elements. Additionally, one may use an XL-PCR kit (PE Biosystems, Foster City Calif.), nested primers, and commercially available cDNA libraries (Life Technologies, Rockville Md.) or genomic libraries (Clontech, Palo Alto Calif.) to extend the sequence.
The polynucleotides (NSEQ) may also be used as targets in a microarray. The microarray may be used to monitor the expression patterns of large numbers of genes simultaneously and to identify splice variants, mutations, and polymorphisms. Information derived from analyses of the expression patterns may be used to determine gene function, to identify a particular cell, cell type or tissue, to understand the genetic basis of a disease, to diagnose a disease, and to develop and monitor the activities of therapeutic agents used to treat a disease. Microarrays may also be used to detect genetic diversity, single nucleotide polymorphisms which may characterize a particular population, at the genomic level.
The polynucleotides (NSEQ) may also be used to generate hybridization probes useful in mapping the naturally occurring genomic sequence. Fluorescent in situ hybridization (FISH) may be correlated with other physical chromosome mapping techniques and genetic map data.
It is to be understood herein that a sequence which is upregulated in an ovarian cancer cell (e.g., malignant ovarian cancer cell) may represent a sequence which is involved in or responsible for the growth, development, maligancy and so on, of the cancer cell (referred herein as a positive regulator of ovarian cancer). It is also to be understood that a sequence which is downregulated (unexpressed or expressed at low levels) in a malignant ovarian cancer cell may represent a sequence which is responsible for the maintenance of the normal status (untransformed) of an ovarian cell (referred herein as a negative regulator of ovarian cancer). Therefore, both the presence or absence of some sequences may be indicative of the disease or may be indicative of the disease, probability of having a disease, degree of severity of the disease (staging).
Therefore, the present invention relates in an aspect thereof to an isolated polynucleotide (e.g., exogenous form of) which may comprise a member selected from the group consisting of;
More specifically, the present invention relates to expressed polynucleotides which are selected from the group consisting of;
Vectors (e.g., a viral vector, a mammalian vector, a plasmid, a cosmid, etc.) which may comprise the polynucleotides described herein are also encompassed by the present invention. The vector may be, for example, an expression vector.
The present invention also provides a library of polynucleotide comprising at least one polynucleotide (e.g., at least two, etc.) described herein (may include SEQ ID NO.:50). The library may be, for example, an expression library. Some or all of the polynucleotides described herein may be contained within an expression vector. The present invention also relates to a polypeptide library which may comprise at least one (e.g., at least two, etc.) polypeptide as described herein.
In another aspect, the present invention provides arrays which may comprise at least one polynucleotide (e.g., at least two, etc.) described herein.
The present invention also provides an isolated cell (e.g., an isolated live cell such as an isolated mammalian cell, a bacterial cell, a yeast cell, an insect cell, etc.) which may comprise the polynucleotide, the vector or the polypeptide described herein.
In yet a further aspect the present invention relates to a composition comprising the polynucleotide and/or polypeptide described herein.
In accordance with the present invention, the composition may be, for example, a pharmaceutical composition which may comprise a polynucleotide and/or a polypeptide described herein and a pharmaceutically acceptable carrier. More specifically, the pharmaceutical composition may be used for the treatment of ovarian cancer and/or for inhibiting the growth of an ovarian cancer cell.
Polynucleotides fragments of those listed above includes polynucleotides comprising at least 10 nucleic acids which may be identical to a corresponding portion of any one of a) to e) and more particularly a coding portion of any one of SEQ ID NO.:1 to 49, 50 or 169.
Another exemplary embodiment of polynucleotide fragments encompassed by the present invention includes polynucleotides comprising at least 10 nucleic acids which may be substantially complementary to a corresponding portion of a coding portion of any one of SEQ ID NO.:1 to 49, 50 or 169 and encompasses, for example, fragments selected from the group consisting of any one of SEQ ID NO.: 103 to 150.
These above sequences may represent powerful markers of cancer and more particularly of, ovarian cancer, breast cancer, prostate cancer, leukemia, melanoma, renal cancer, colon cancer, lung cancer, cancer of the central nervous system and any combination thereof.
Based on the results presented herein and upon reading the present description, a person skilled in the art will understand that the appearance of a positive signal upon testing (hybridization, PCR amplification etc.) for the presence of a given sequence amongst those expressed in a cancer cell, indicates that such sequence is specifically expressed in that type of cancer cell. A person skilled in the art will also understand that, sequences which are specifically expressed in a certain types of cancer cell may be used for developing tools for the detection of this specific type of cancer cell and may also be used as targets in the development of anticancer drugs.
A positive signal may be in the form of a band in a gel following electrophoresis, Northern blot or Western blot, a PCR fragment detected by emission of fluorescence, etc.
As it will be understood, sequences which are particularly useful for the development of tools for the detection of cancer cell may preferably be expressed at lower levels in at least some normal cells (non-cancerous cells).
For example, in
NSEQs chosen among those which are substantially complementary to those listed in Table 2, or to fragments of those of Table 2, may be used for the treatment of cancer.
The present invention therefore relates to a method for identifying a cancer cell. The method may comprise contacting a cell, a cell sample (cell lysate), a body fluid (blood, urine, plasma, saliva etc.) or a tissue with a reagent which may be, for example, capable of specifically binding at least one NSEQ or PSEQ described herein. The method may more particularly comprise contacting a sequence isolated or derived such cell, sample, fluid or tissue. The complex formed may be detected using methods known in the art.
In accordance with the present invention, the presence of the above mentioned complex may be indicative (a positive indication of the presence) of the presence of a cancer cell.
The present invention also relates in an additional aspect thereof to a method for the diagnosis or prognosis of cancer. The method may comprise, for example, detecting, in a cell, tissue, sample, body fluid, etc., at least one NSEQ or PSEQ described herein.
The cell, cell sample, body fluid or tissue may originate, for example, from an individual which has or is suspected of having a cancer and more particularly ovarian cancer, breast cancer, prostate cancer, leukemia, melanoma, renal cancer, colon cancer, lung cancer and/or cancer of the central nervous system
Any of the above mentioned methods may further comprise comparing the level obtained with at least one reference level or value.
Detection of NSEQ may require an amplification (e.g., PCR) step in order to have sufficient material for detection purposes.
In accordance with the present invention, the polynucleotide described herein may comprise, for example, a RNA molecule, a DNA molecule, including those which are partial or complete, single-stranded or double-stranded, hybrids, modified by a group etc.
Other aspects of the present invention which are encompassed herewith comprises the use of at least one NSEQ or PSEQ described herein and derived antibodies in the manufacture of a composition for identification or detection of a cancer cell (e.g., a tumor cell) or for inhibiting or lowering the growth of cancer cell (e.g., for treatment of ovarian cancer or other cancer).
As some NSEQ and PSEQ are expressed at higher levels in malignant ovarian cancer than in LMP detection of such NSEQ or PSEQ in a sample from an individual (or in vivo) one may rule-out a low malignant potential ovarian cancer and may therefore conclude in a diagnostic of a malignant ovarian cancer. Furthermore, detection of the NSEQ or PSEQ in a cell, tissue, sample or body fluid from an individual may also be indicative of a late-stage malignant ovarian cancer. As such, therapies adapted for the treatment of a malignant ovarian cancer or a late-stage malignant ovarian cancer may be commenced.
In accordance with an embodiment of the present invention, the method may also comprise a step of qualitatively or quantitatively comparing the level (amount, presence) of at least one complex present in the test cell, test sample, test fluid or test tissue with the level of complex in a normal cell, a normal cell sample, a normal body fluid, a normal tissue or a reference value (e.g., for a non-cancerous condition).
The normal cell may be any cell which does not substantially express the desired sequence to be detected. Examples of such normal cells are included for example, in the description of the drawings section. A normal cell sample or tissue thus include, for example, a normal (non-cancerous) ovarian cell, a normal breast cell, a normal prostate cell, a normal lymphocyte, a normal skin cell, a normal renal cell, a normal colon cell, a normal lung cell and/or a normal cell of the central nervous system. For comparison purposes, a normal cell may be chosen from those of identical or similar cell type.
Of course, the presence of more than one complex may be performed in order to increase the precision of the diagnostic method. As such, at least two complexes (e.g., formed by a first reagent and a first polynucleotide and a second reagent or a second polynucleotide) or multiple complexes may be detected.
An exemplary embodiment of a reagent which may be used for detecting a NSEQ described herein is a polynucleotide which may comprise a sequence substantially complementary to the NSEQ.
A suitable reference level or value may be, for example, derived from the level of expression of a specified sequence in a low malignant potential ovarian cancer and/or from a normal cell.
It will be understood herein that a higher level of expression measured in a cancer cell, tissue or sample in comparison with a reference value or sample is a indicative of the presence of cancer in the tested individual.
For example, the higher level measured in an ovarian cell, ovarian tissue or a sample of ovarian origin compared to a reference level or value for a normal cell (normal ovarian cell or normal non-ovarian cell) may be indicative of an ovarian cancer. For comparison purpose, the presence or level of expression of a desired NSEQ or PSEQ to be detected or identified may be compared with the presence, level of expression, found in a normal cell which has been shown herein not to express the desired sequence.
Therapeutic uses and methods are also encompassed herewith.
The invention therefore provides polynucleotides which may be able to lower or inhibit the growth of an ovarian cancer cell (e.g., in a mammal or mammalian cell thereof).
The present invention therefore relates in a further aspect to the use of a polynucleotide sequence which may be selected from the group consisting of
The polynucleotide may be selected, for example, from the group consisting of polynucleotides which may comprise a sequence of at least 10 nucleotides which is complementary to the nucleic acid sequence of any one of SEQ ID NO.: 1 to 49, 50 and 169 (to a translated portion which may be free, for example, of untranslated portions).
Of course, the present invention encompasses immunizing an individual by administering a NSEQ (e.g., in an expression vector) or a PSEQ.
The present invention also relates to a method of reducing or slowing the growth of an ovarian cancer cell in an individual in need thereof. The method may comprise administering to the individual a polynucleotide sequence which may be selected from the group consisting of
The present invention therefore provides in yet another aspect thereof, a siRNA or shRNA molecule that is able to lower the expression of a nucleic acid selected from the group consisting of
Exemplary embodiment of polynucleotides are those which, for example, may be able to inhibit the growth of an ovarian cancer cell, such as, for example, a polynucleotide having or comprising a sequence selected from the group consisting of any one of SEQ ID NO. 103 to 150. These specific sequences are provided as guidance only and are not intended to limit the scope of the invention.
The present invention also provides a kit for the diagnosis of cancer. The kit may comprise at least one polynucleotide as described herein and/or a reagent capable of specifically binding at least one polynucleotide described herein.
In a further aspect, the present invention relates to an isolated polypeptide encoded by the polynucleotide described herein.
The present invention more particularly provides an isolated polypeptide which may be selected from the group consisting of
In accordance with the present invention, the analog may comprise, for example, at least one amino acid substitution, deletion or insertion in its amino acid sequence.
The substitution may be conservative or non-conservative. The polypeptide analog may be a biologically active analog or an immunogenic analog which may comprise, for example, at least one amino acid substitution (conservative or non conservative), for example, 1 to 5, 1 to 10, 1 to 15, 1 to 20, 1 to 50 etc. (including any number there between) compared to the original sequence. An immunogenic analog may comprise, for example, at least one amino acid substitution compared to the original sequence and may still be bound by an antibody specific for the original sequence.
In accordance with the present invention, a polypeptide fragment may comprise, for example, at least 6 consecutive amino acids, at least 8 consecutive amino acids or more of an amino acid sequence selected from the group consisting of polypeptides encoded by a polynucleotide selected from the group consisting of SEQ ID NO.: 1 to 49 and 169 or any one of SEQ. ID. NOs:51 to 88 and 170, including variants and analogs thereof. The fragment may be immunogenic and may be used for the purpose, for example, of generating antibodies.
Exemplary embodiments of polypeptide encompassed by the present invention are those which may be encoded by any one of SEQ ID NO.:1-49 and 169, more particularly those encoded by any one of SEQ ID NO.:1, 14, 16, 19, 20, 22, 28, 37, 41, 45, 46, 47 or 49 and even more particularly those encoded by any one of SEQ ID NO.: 14, 19, 22, 37, 41, 45, 46 or 49.
In a further aspect the present invention relates to a polypeptide which may be encoded by the isolated differentially expressed sequence of the present invention. The present invention as well relates to the polypeptide encoded by the non-human ortholog polynucleotide, analogs, derivatives and fragments thereof.
A person skilled in the art may easily determine the possible peptide sequence encoded by a particular nucleic acid sequence as generally, a maximum of 6 possible open-reading frames exist in a particular coding sequence. The first possible open-reading frame may start at the first nucleotide (5′-3′) of the sequence, therefore using in a 5′ to 3′ direction nucleotides No. 1 to 3 as the first codon, using nucleotides 4 to 6 as the second codon, etc. The second possible open-reading frame may start at the second nucleotide (5′-3′) of the sequence, therefore using in a 5′ to 3′ direction nucleotides No. 2 to 4 as the first codon, using nucleotides 5 to 7 as the second codon, etc. Finally, the third possible open-reading frame may start at the third nucleotide (5′-3′) of the sequence, therefore using in a 5′ to 3′ direction nucleotides No. 3 to 5 as the first codon, using nucleotides 6 to 8 as the second codon, etc. The fourth possible open-reading frame may start at the first nucleotide of the sequence in a 3′ to 5′ direction, therefore using in 3′ to 5′ direction, nucleotides No. 1 to 3 as the first codon, using nucleotides 4 to 6 as the second codon, etc. The fifth possible open-reading frame may start at the second nucleotide of the sequence in a 3′ to 5′ direction, therefore using in a 3′ to 5′ direction, nucleotides No. 2 to 4 as the first codon, using nucleotides 5 to 7 as the second codon, etc. Finally, the sixth possible open-reading frame may start at the third nucleotide of the sequence in a 3′ to 5′ direction, therefore using in a 3′ to 5′ direction nucleotides No. 3 to 5 as the first codon, using nucleotides 6 to 8 as the second codon, etc.
In an additional aspect, the present invention relates to the use of at least one polypeptide in the manufacture of a composition for the identification or detection of a cancer cell (tumor cell). The polypeptide may be used, for example, as a standard in an assay and/or for detecting antibodies specific for the particular polypeptide, etc. In yet an additional aspect, the present invention relates to the use of at least one polypeptide described herein in the identification or detection of a cancer cell, such as for example, an ovarian cancer cell or any other cancer cell as described herein.
The present invention therefore relates in a further aspect, to the use of at least one polypeptide described herein in the prognosis or diagnosis of cancer, such as, for example, a malignant ovarian cancer or a low malignant potential ovarian cancer.
As such and in accordance with the present invention, detection of the polypeptide in a cell (e.g., ovarian cell), tissue (e.g., ovarian tissue), sample or body fluid from an individual may preferentially be indicative of a malignant ovarian cancer diagnosis over a low malignant potential ovarian cancer diagnosis and therefore may preferentially be indicative of a malignant ovarian cancer rather than a low malignant potential ovarian cancer.
Further in accordance with the present invention, the presence of the polypeptide in a cell, tissue, sample or body fluid from an individual may preferentially be indicative of a late-stage malignant ovarian cancer.
There is also provided by the present invention, methods for identifying a cancer cell, which may comprise, for example, contacting a test cell, a test cell sample (cell lysate), a test body fluid (blood, urine, plasma, saliva etc.) or a test tissue with a reagent which may be capable of specifically binding the polypeptide described herein, and detecting the complex formed by the polypeptide and reagent. The presence of a complex may be indicative (a positive indication of the presence) of a cancer cell such as for example, an ovarian cancer cell, a breast cancer cell, a prostate cancer cell, leukemia, melanoma, a renal cancer cell, a colon cancer cell, a lung cancer cell, a cancer cell of the central nervous system and any combination thereof.
The presence of a complex formed by the polypeptide and the specific reagent may be indicative, for example, of ovarian cancer including, for example, a low malignant potential ovarian cancer or a malignant ovarian cancer.
However, the method is more particularly powerful for the detection of ovarian cancer of the malignant type. Therefore, the presence of a complex may preferentially be indicative of a malignant ovarian cancer relative (rather than) to a low malignant potential ovarian cancer.
Detection of the complex may also be indicative of a late stage malignant ovarian cancer.
In accordance with the present invention, the method may also comprise a step of qualitatively or quantitatively comparing the level (amount, presence) of at least one complex present in a test cell, a test sample, a test fluid or a test tissue with the level of complex in a normal cell, a normal cell sample, a normal body fluid, a normal tissue or a reference value (e.g., for a non-cancerous condition).
Of course, the presence of more than one polypeptide or complex (two complexes or more (multiple complexes)) may be determined, e.g., one formed by a first specific reagent and a first polypeptide and another formed by a second specific reagent and a second polypeptide may be detected. Detection of more than one polypeptide or complex may help in the determination of the tumorigenicity of the cell.
An exemplary embodiment of a reagent, which may be used for the detection of the polypeptide described herein, is an antibody and antibody fragment thereof.
The present invention also relates to a kit which may comprise at least one of the polypeptide described herein and/or a reagent capable of specifically binding to at least one of the polypeptide described herein.
As one skill in the art will understand, compositions which comprises a polypeptide may be used, for example, for generating antibodies against the particular polypeptide, may be used as a reference for assays and kits, etc.
Additional aspects of the invention relates to isolated or purified antibodies (including an antigen-binding fragment thereof) which may be capable of specifically binding to a polypeptide selected from the group consisting of;
More particularly, exemplary embodiments of the present invention relates to antibodies which may be capable of specifically binding a polypeptide comprising a polypeptide sequence encoded by any one of SEQ ID NO.: 1, 14, 16, 19, 20, 22, 28, 37, 41, 45, 46, 47 or 49, or a fragment of at least 6 amino acids of the polypeptide.
Even more particular exemplary embodiments of the present invention relates to antibodies which may be capable of specifically binding a polypeptide comprising a polypeptide sequence encoded by any one of SEQ ID NO.: 14, 19, 22, 37, 41, 45, 46 or 49, or a fragment of at least 6 amino acids of the polypeptide.
In yet an additional aspect, the present invention relates to a hybridoma cell which is capable of producing an antibody which may specifically bind to a polypeptide selected from the group consisting of;
Exemplary hybridoma which are more particularly encompassed by the present invention are those which may produce an antibody which may be capable of specifically binding a polypeptide comprising a polypeptide sequence encoded by any one of SEQ ID NO.: 1, 14, 16, 19, 20, 22, 28, 37, 41, 45, 46, 47 or 49 or a fragment of at least 6 amino acids of the polypeptide.
Exemplary embodiments of hybridoma which are even more particularly encompassed by the present invention are those which may produce an antibody which is capable of specifically binding a polypeptide comprising a polypeptide sequence encoded by any one of SEQ ID NO.: 14, 19, 22, 37, 41, 45, 46 or 49 or a fragment of at least 6 amino acids of the polypeptide.
The present invention also relates to a composition which may comprise an antibody described herein.
In a further aspect the present invention provides a method of making an antibody which may comprise immunizing a non-human animal with an immunogenic fragment (at least 6 amino acids, at least 8 amino acids, etc.) of a polypeptide which may be selected, for example, from the group consisting of;
Exemplary polypeptides which may, more particularly, be used for generating antibodies are those which are encoded by any one of SEQ ID NO.: 1, 14, 16, 19, 20, 22, 28, 37, 41, 45, 46, 47 or 49 (and polypeptide comprising a polypeptide fragment of these particular PSEQ). Even more particular polypeptides encompassed by the present invention are those which are encoded by any one of SEQ ID NO.: 14, 19, 22, 37, 41, 45, 46 or 49.
In a further aspect, the present invention relates to a method of identifying a compound which is capable of inhibiting the activity or function of a polypeptide which may be selected, for example from the group consisting of any one of SEQ ID NO.:51 to 88 and 170 or a polypeptide comprising a polypeptide sequence encoded by any one of SEQ ID NO.:1 to 49 and 169 (e.g., a transcribed portion, a translated portion, a fragment, substantially identical and even substantially complementary sequences). The method may comprise contacting the polypeptide with a putative compound an isolating or identifying a compound which is capable of specifically binding any one of the above mentioned polypeptide. The compound may originate from a combinatorial library.
The method may also further comprise determining whether the activity or function of the polypeptide (e.g., such as a function indicated at Table 2) is affected by the binding of the compound. Those compounds which capable of binding to the polypeptide and which and/or which are capable of altering the function or activity of the polypeptide represents a desirable compound to be used in cancer therapy.
The method may also further comprise a step of determining the effect of the putative compound on the growth of a cancer cell such as an ovarian cancer cell.
The present invention also relates to an assay and method for identifying a nucleic acid sequence and/or protein involved in the growth or development of ovarian cancer. The assay and method may comprise silencing an endogenous gene of a cancer cell such as an ovarian cancer cell and providing the cell with a candidate nucleic acid (or protein). A candidate gene (or protein) positively involved in inducing cancer cell death (e.g., apoptosis) (e.g., ovarian cancer cell) may be identified by its ability to complement the silenced endogenous gene. For example, a candidate nucleic acid involved in ovarian cancer provided to a cell for which an endogenous gene has been silenced, may enable the cell to undergo apoptosis more so in the presence of an inducer of apoptosis.
Alternatively, an assay or method may comprise silencing an endogenous gene (gene expression) corresponding to the candidate nucleic acid or protein sequence to be evaluated and determining the effect of the candidate nucleic acid or protein on cancer growth (e.g., ovarian cancer cell growth). A sequence involved in the promotion or inhibition of cancer growth, development or malignancy may change the viability of the cell, may change the ability of the cell to grow or to form colonies, etc. The activity of a polypeptide may be impaired by targeting such polypeptide with an antibody molecule or any other type of compound. Again, such compound may be identified by screening combinatorial libraries, phage libraries, etc.
The present invention also provides a method for identifying an inhibitory compound (inhibitor, antagonist) able to impair the function (activity) or expression of a polypeptide described herein. The method may comprise, for example, contacting the (substantially purified or isolated) polypeptide or a cell expressing the polypeptide with a candidate compound and measuring the function (activity) or expression of the polypeptide. A reduction in the function or activity of the polypeptide (compared to the absence of the candidate compound) may thus positively identify a suitable inhibitory compound.
In accordance with the present invention, the impaired function or activity may be associated, for example, with a reduced ability of the polypeptide to reduce growth of an ovarian cancer cell or a reduced enzymatic activity or function identified for example in Table 2.
The cell used to carry the screening test may not naturally (endogenously) express the polypeptide or analogs, or alternatively the expression of a naturally expressed polypeptide analog may be repressed.
As used herein the term “sequence identity” relates to (consecutive) nucleotides of a nucleotide sequence with reference to an original nucleotide sequence which when compared are the same or have a specified percentage of nucleotides which are the same.
The identity may be compared over a region or over the total sequence of a nucleic acid sequence. Thus, “identity” may be compared, for example, over a region of 10, 19, 20 nucleotides or more (and any number therebetween) and more preferably over a longer region or over the entire region of a polynucleotide sequence described at Table 4 (e.g., any one of SEQ ID NO.:1 to 49 and 169). It is to be understood herein that gaps of non-identical nucleotides may be found between identical nucleic acids regions (identical nucleotides). For example, a polynucleotide may have 100% identity with another polynucleotide over a portion thereof. However, when the entire sequence of both polynucleotides is compared, the two polynucleotides may have 50% of their overall (total) sequence identity to one another.
Percent identity may be determined, for example, with n algorithm GAP, BESTFIT, or FASTA in the Wisconsin Genetics Software Package Release 7.0, using default gap weights.
Polynucleotides of the present invention or portion thereof having from about 50 to about 100% and any range therebetween, or about 60 to about 100% or about 70 to about 100% or about 80 to about 100% or about 85% to about 100%, about 90% to about 100%, about 95% to about 100% sequence identity with an original polynucleotide are encompassed herewith. It is known by those of skill in the art, that a polynucleotide having from about 50% to 100% identity may function (e.g., anneal to a substantially complementary sequence) in a manner similar to an original polynucleotide and therefore may be used in replacement of an original polynucleotide. For example a polynucleotide (a nucleic acid sequence) may comprise or have from about 50% to about 100% identity with an original polynucleotide over a defined region and may still work as efficiently or sufficiently to achieve the present invention.
The term “substantially identical” used to define the polynucleotides of the present invention refers to polynucleotides which have, for example, from 50% to 100% sequence identity and any range therebetween but preferably at least 80%, at least 85%, at least 90%, at least 95% sequence identity and also include 100% identity with that of an original sequence (including sequences 100% identical over the entire length of the polynucleotide sequence).
“Substantially identical” polynucleotide sequences may be identified by providing a probe of about 10 to about 25, or more or about 10 to about 20 nucleotides long (or longer) based on the sequence of any one of SEQ ID NOs.:1 to 49 and 169 (more particularly, a transcribed and/or translated portion of any one of SEQ ID NOs.: 1 to 49 and 169) and complementary sequence thereof and hybridizing a library of polynucleotide (e.g., cDNA or else) originating from another species, tissue, cell, individual etc. A polynucleotide which hybridizes under highly stringent conditions (e.g., 6×SCC, 65° C.) to the probe may be isolated and identified using methods known in the art. A sequence “substantially identical” includes for example, an isolated allelic variant, an isolated splice variant, an isolated non-human ortholog, a modified NSEQ etc.
As used herein the terms “sequence complementarity” refers to (consecutive) nucleotides of a nucleotide sequence which are complementary to a reference (original) nucleotide sequence. The complementarity may be compared over a region or over the total sequence of a nucleic acid sequence.
Polynucleotides of the present invention or portion thereof having from about 50 to about 100%, or about 60 to about 100% or about 70 to about 100% or about 80 to about 100% or about 85%, about 90%, about 95% to about 100% sequence complementarity with an original polynucleotide are thus encompassed herewith. It is known by those of skill in the art, that a polynucleotide having from about 50% to 100% complementarity with an original sequence may anneal to that sequence in a manner sufficient to carry out the present invention (e.g., inhibit expression of the original polynucleotide).
The term “substantially complementary” used to define the polynucleotides of the present invention refers to polynucleotides which have, for example, from 50% to 100% sequence complementarity and any range therebetween but preferably at least 80%, at least 85%, at least 90%, at least 95% sequence complementarity and also include 100% complementarity with that of an original sequence (including sequences 100% complementarity over the entire length of the polynucleotide sequence).
As used herein the term “polynucleotide” generally refers to any polyribonucleotide or polydeoxyribo-nucleotide, which may be unmodified RNA or DNA, or modified RNA or DNA. “Polynucleotides” include, without limitation single- and double-stranded DNA, DNA that is a mixture of single- and double-stranded regions, single- and double-stranded RNA, and RNA that is a mixture of single- and double-stranded regions, hybrid molecules comprising DNA and RNA that may be single-stranded or, more typically, double-stranded or a mixture of single- and double-stranded regions. In addition, “polynucleotide” refers to triple-stranded regions comprising RNA or DNA or both RNA and DNA. The term polynucleotide also includes DNAs or RNAs containing one or more modified bases and DNAs or RNAs with backbones modified for stability or for other reasons. “Modified” bases include, for example, tritylated bases and unusual bases such as inosine. A variety of modifications may be made to DNA and RNA; thus “polynucleotide” embraces chemically, enzymatically or metabolically modified forms of polynucleotides as typically found or not in nature, as well as the chemical forms of DNA and RNA characteristic of viruses and cells. “Polynucleotide” includes but is not limited to linear and end-closed molecules. “Polynucleotide” also embraces relatively short polynucleotides, often referred to as oligonucleotides.
“Polypeptides” refers to any peptide or protein comprising two or more amino acids joined to each other by peptide bonds or modified peptide bonds (i.e., peptide isosteres). “Polypeptide” refers to both short chains, commonly referred as peptides, oligopeptides or oligomers, and to longer chains generally referred to as proteins. As described above, polypeptides may contain amino acids other than the 20 gene-encoded amino acids.
As used herein the term “polypeptide analog” or “analog” relates to mutants, chimeras, fusions, a polypeptide comprising at least one amino acid deletion, a polypeptide comprising at least one amino acid insertion or addition, a polypeptide comprising at least one amino acid substitutions, and any other type of modifications made relative to a given polypeptide.
An “analog” is thus to be understood herein as a molecule having a biological activity and/or chemical structure similar to that of a polypeptide described herein. An “analog” may have sequence similarity with that of an original sequence or a portion of an original sequence and may also have a modification of its structure as discussed herein. For example, an “analog” may have at least 80% or 85% or 90% sequence similarity with an original sequence or a portion of an original sequence. An “analog” may also have, for example; at least 70% or even 50% sequence similarity with an original sequence or a portion of an original sequence and may function in a suitable manner.
A “derivative” is to be understood herein as a polypeptide originating from an original sequence or from a portion of an original sequence and which may comprise one or more modification; for example, one or more modification in the amino acid sequence (e.g., an amino acid addition, deletion, insertion, substitution etc.), one or more modification in the backbone or side-chain of one or more amino acid, or an addition of a group or another molecule to one or more amino acids (side-chains or backbone). Biologically active derivatives of the carrier described herein are encompassed by the present invention. Also, an “derivative” may have, for example, at least 50%, 70%, 80%, 90% sequence similarity to an original sequence with a combination of one or more modification in a backbone or side-chain of an amino acid, or an addition of a group or another molecule, etc.
As used herein the term “biologically active” refers to an analog which retains some or all of the biological activity of the original polypeptide, i.e., to have some of the activity or function associated with the polypeptide described at Table 2, or to be able to promote or inhibit the growth ovarian cancer.
Therefore, any polypeptide having a modification compared to an original polypeptide which does not destroy significantly a desired activity, function or immunogenicity is encompassed herein. It is well known in the art, that a number of modifications may be made to the polypeptides of the present invention without deleteriously affecting their biological activity. These modifications may, on the other hand, keep or increase the biological activity of the original polypeptide or may optimize one or more of the particularity (e.g. stability, bioavailability, etc.) of the polypeptides of the present invention which, in some instance might be desirable. Polypeptides of the present invention may comprise for example, those containing amino acid sequences modified either by natural processes, such as posttranslational processing, or by chemical modification techniques which are known in the art. Modifications may occur anywhere in a polypeptide including the polypeptide backbone, the amino acid side-chains and the amino- or carboxy-terminus. It will be appreciated that the same type of modification may be present in the same or varying degrees at several sites in a given polypeptide. Also, a given polypeptide may contain many types of modifications. It is to be understood herein that more than one modification to the polypeptides described herein are encompassed by the present invention to the extent that the biological activity is similar to the original (parent) polypeptide.
As discussed above, polypeptide modification may comprise, for example, amino acid insertion, deletion and substitution (i.e., replacement), either conservative or non-conservative (e.g., D-amino acids, desamino acids) in the polypeptide sequence where such changes do not substantially alter the overall biological activity of the polypeptide.
Example of substitutions may be those, which are conservative (i.e., wherein a residue is replaced by another of the same general type or group) or when wanted, non-conservative (i.e., wherein a residue is replaced by an amino acid of another type). In addition, a non-naturally occurring amino acid may substitute for a naturally occurring amino acid (i.e., non-naturally occurring conservative amino acid substitution or a non-naturally occurring non-conservative amino acid substitution).
As is understood, naturally occurring amino acids may be sub-classified as acidic, basic, neutral and polar, or neutral and non-polar. Furthermore, three of the encoded amino acids are aromatic. It may be of use that encoded polypeptides differing from the determined polypeptide of the present invention contain substituted codons for amino acids, which are from the same type or group as that of the amino acid to be replaced. Thus, in some cases, the basic amino acids Lys, Arg and His may be interchangeable; the acidic amino acids Asp and Glu may be interchangeable; the neutral polar amino acids Ser, Thr, Cys, Gln, and Asn may be interchangeable; the non-polar aliphatic amino acids Gly, Ala, Val, Ile, and Leu are interchangeable but because of size Gly and Ala are more closely related and Val, Ile and Leu are more closely related to each other, and the aromatic amino acids Phe, Trp and Tyr may be interchangeable.
It should be further noted that if the polypeptides are made synthetically, substitutions by amino acids, which are not naturally encoded by DNA (non-naturally occurring or unnatural amino acid) may also be made.
A non-naturally occurring amino acid is to be understood herein as an amino acid which is not naturally produced or found in a mammal. A non-naturally occurring amino acid comprises a D-amino acid, an amino acid having an acetylaminomethyl group attached to a sulfur atom of a cysteine, a pegylated amino acid, etc. The inclusion of a non-naturally occurring amino acid in a defined polypeptide sequence will therefore generate a derivative of the original polypeptide. Non-naturally occurring amino acids (residues) include also the omega amino acids of the formula NH2(CH2)nCOOH wherein n is 2-6, neutral nonpolar amino acids, such as sarcosine, t-butyl alanine, t-butyl glycine, N-methyl isoleucine, norleucine, etc. Phenylglycine may substitute for Trp, Tyr or Phe; citrulline and methionine sulfoxide are neutral nonpolar, cysteic acid is acidic, and ornithine is basic. Proline may be substituted with hydroxyproline and retain the conformation conferring properties.
It is known in the art that analogs may be generated by substitutional mutagenesis and retain the biological activity of the polypeptides of the present invention. These analogs have at least one amino acid residue in the protein molecule removed and a different residue inserted in its place. For example, one site of interest for substitutional mutagenesis may include but are not restricted to sites identified as the active site(s), or immunological site(s). Other sites of interest may be those, for example, in which particular residues obtained from various species are identical. These positions may be important for biological activity. Examples of substitutions identified as “conservative substitutions” are shown in Table A. If such substitutions result in a change not desired, then other type of substitutions, denominated “exemplary substitutions” in Table A, or as further described herein in reference to amino acid classes, are introduced and the products screened.
In some cases it may be of interest to modify the biological activity of a polypeptide by amino acid substitution, insertion, or deletion. For example, modification of a polypeptide may result in an increase in the polypeptide's biological activity, may modulate its toxicity, may result in changes in bioavailability or in stability, or may modulate its immunological activity or immunological identity. Substantial modifications in function or immunological identity are accomplished by selecting substitutions that differ significantly in their effect on maintaining (a) the structure of the polypeptide backbone in the area of the substitution, for example, as a sheet or helical conformation. (b) the charge or hydrophobicity of the molecule at the target site, or (c) the bulk of the side chain. Naturally occurring residues are divided into groups based on common side chain properties:
(1) hydrophobic: norleucine, methionine (Met), Alanine (Ala), Valine (Val), Leucine (Leu), Isoleucine (Ile)
(2) neutral hydrophilic: Cysteine (Cys), Serine (Ser), Threonine (Thr)
(3) acidic: Aspartic acid (Asp), Glutamic acid (Glu)
(4) basic: Asparagine (Asn), Glutamine (Gln), Histidine (His), Lysine (Lys), Arginine (Arg)
(5) residues that influence chain orientation: Glycine (Gly), Proline (Pro); and aromatic: Tryptophan (Trp), Tyrosine (Tyr), Phenylalanine (Phe)
Non-conservative substitutions will entail exchanging a member of one of these classes for another.
It is to be understood herein, that if a “range” or “group” of substances (e.g. amino acids), substituents” or the like is mentioned or if other types of a particular characteristic (e.g. temperature, pressure, chemical structure, time, etc.) is mentioned, the present invention relates to and explicitly incorporates herein each and every specific member and combination of sub-ranges or sub-groups therein whatsoever. Thus, any specified range or group is to be understood as a shorthand way of referring to each and every member of a range or group individually as well as each and every possible sub-ranges or sub-groups encompassed therein; and similarly with respect to any sub-ranges or sub-groups therein. Thus, for example, with respect to a percentage (%) of identity of from about 80 to 100%, it is to be understood as specifically incorporating herein each and every individual %, as well as sub-range, such as for example 80%, 81%, 84.78%, 93%, 99% etc. with respect to a length of “about 10 to about 25” it is to be understood as specifically incorporating each and every individual number such as for example 10, 11, 12, 13, 14, 15 up to and including 25; and similarly with respect to other parameters such as, concentrations, elements, etc. . . .
Other objects, features, advantages, and aspects of the present invention will become apparent to those skilled in the art from the following description. It should be understood, however, that the following description and the specific examples, while indicating preferred embodiments of the invention, are given by way of illustration only. Various changes and modifications within the spirit and scope of the disclosed invention will become readily apparent to those skilled in the art from reading the following description and from reading the other parts of the present disclosure.
In the appended drawings:
More particularly,
The applicant employed a carefully planned strategy to identify and isolate genetic sequences involved in ovarian cancer. The process involved the following steps: 1) preparation of highly representative cDNA libraries using mRNA isolated from LMPs and malignant ovarian cancer samples of human origin; 2) isolation of sequences upregulated in the malignant ovarian cancer samples; 3) identification and characterization of upregulated sequences; 4) selection of upregulated sequences for tissue specificity; 5) determination of knock-down effects on ovarian cancer cell line proliferation and migration; and 6) determination of the expression pattern of each upregulated sequence in samples derived from nine different cancer types. The results discussed in this disclosure demonstrate the advantage of targeting ovarian cancer-related genes that are highly specific to this differentiated cell type compared to normal tissues and provide a more efficient screening method when studying the genetic basis of diseases and disorders. Polynucleotide and/or polypeptide sequences that are known but have not had a role assigned to them until the present disclosure have also been isolated and shown to have a critical role in ovarian cancer cell line proliferation and migration. Finally, novel polynucleotide and/or polypeptide sequences have been identified that play a role as well.
The present invention is illustrated in further details below in a non-limiting fashion.
Commercially available reagents referred to in the present disclosure were used according to supplier's instructions unless otherwise indicated. Throughout the present disclosure certain starting materials were prepared as follows:
LMP and malignant ovarian tumor samples were selected based on histopathology to identify the respective stage and grade (Table B). LMP was choosen instead of normal ovarian tissue to avoid genes that associated with proliferation due to ovulation. Also very few cells would have been recovered and stromal cells would have been a major contaminant. LMP and serous (most common) ovarian tumors represent the extremes of tumorigenicity, differentiation and invasion. Once the sample were selected, total RNA was extracted with Trizol™ (InVitrogen, Grand Island, N.Y.) after the tissues were homogenized. The quality of the RNA was assessed using a 2100 Bioanalyzer (Agilent Technologies, Palo Alto, Calif.)
C—Method of Isolating Differentially Expressed mRNA
Key to the discovery of differentially expressed sequences unique to malignant ovarian cancer is the use of the applicant's patented STAR technology (Subtractive Transcription-based Amplification of mRNA; U.S. Pat. No. 5,712,127 Malek et al., 1998). Based on this procedure, mRNA isolated from malignant ovarian tumor sample is used to prepare “tester RNA”, which is hybridized to complementary single-stranded “driver DNA” prepared from mRNA from LMP sample and only the un-hybridized “tester RNA” is recovered, and used to create cloned cDNA libraries, termed “subtracted libraries”. Thus, the “subtracted libraries” are enriched for differentially expressed sequences inclusive of rare and novel mRNAs often missed by micro-array hybridization analysis. These rare and novel mRNA are thought to be representative of important gene targets for the development of better diagnostic and therapeutic strategies.
The clones contained in the enriched “subtracted libraries” are identified by DNA sequence analysis and their potential function assessed by acquiring information available in public databases (NCBI and GeneCard). The non-redundant clones are then used to prepare DNA micro-arrays, which are used to quantify their relative differential expression patterns by hybridization to fluorescent cDNA probes. Two classes of cDNA probes may be used, those which are generated from either RNA transcripts prepared from the same subtracted libraries (subtracted probes) or from mRNA isolated from different ovarian LMP and malignant samples (standard probes). The use of subtracted probes provides increased sensitivity for detecting the low abundance mRNA sequences that are preserved and enriched by STAR. Furthermore, the specificity of the differentially expressed sequences to malignant ovarian cancer is measured by hybridizing radio-labeled probes prepared from each selected sequence to macroarrays containing RNA from different LMP and malignant ovarian cancer samples and different normal human tissues.
A major challenge in gene expression profiling is the limited quantities of RNA available for molecular analysis. The amount of RNA isolated from many human specimens (needle aspiration, laser capture micro-dissection (LCM) samples and transfected cultured cells) is often insufficient for preparing: 1) conventional tester and driver materials for STAR; 2) standard cDNA probes for DNA micro-array analysis; 3) RNA macroarrays for testing the specificity of expression; 4) Northern blots and; 5) full-length cDNA clones for further biological validation and characterization etc. Thus, the applicant has developed a proprietary technology called RAMP (RNA Amplification Procedure) (U.S. patent application Ser. No. 11/000,958 published under No. US 2005/0153333A1 on Jul. 14, 2005 and entitled “Selective Terminal Tagging of Nucleic Acids”), which linearly amplifies the mRNA contained in total RNA samples yielding microgram quantities of amplified RNA sufficient for the various analytical applications. The RAMP RNA produced is largely full-length mRNA-like sequences as a result of the proprietary method for adding a terminal sequence tag to the 3′-ends of single-stranded cDNA molecules, for use in linear transcription amplification. Greater than 99.5% of the sequences amplified in RAMP reactions show <2-fold variability and thus, RAMP provides unbiased RNA samples in quantities sufficient to enable the discovery of the unique mRNA sequences involved in ovarian cancer.
Total RNA from five human ovarian LMP samples (MF-15, -16, -18, -19 and -20) (Table B) and five malignant ovarian cancer samples (MF-22, -25, -27, -28 and -30) (Table B) (CHUM, Montreal, QC) were prepared as described above. Following a slight modification of the teachings of Malek et al., 1998 (U.S. Pat. No. 5,712,127) i.e., preparation of the cDNA libraries on the paramagnetic beads as described below), 1 μg of total RNA from each sample were used to prepare highly representative cDNA libraries on streptavidin-coated paramagnetic beads (InVitrogen, Grand Island, N.Y.) for preparing tester and driver materials. In each case, first-strand cDNA was synthesized using an oligo dT11 primer with 3′ locking nucleotides (e.g., A, G or C), a 5′-biotin moiety and containing a Not I recognition site (OGS 364: SEQ. ID. NO. 90) Next, second-strand cDNA synthesis was performed according to the manufacturer's procedure for double-stranded cDNA synthesis (Invitrogen, Burlington, ON) and the resulting double-stranded cDNA ligated to linkers containing an Asc I recognition site (New England Biolabs, Pickering, ON). The double-stranded cDNAs were then digested with Asc I and Not I restriction enzymes (New England Biolabs, Pickering, ON), purified from the excess linkers using the cDNA fractionation column from Invitrogen (Burlington, ON) as specified by the manufacturer. Each sample was equally divided and ligated separately to specialized oligonucleotide promoter tags, TAG1 (OGS 594 and 595: SEQ. ID. NO: 91 and SEQ. ID. NO:92) and TAG2 (OGS 458 and 459: SEQ. ID. NO:93 and SEQ. ID. NO:94) used for preparing tester and driver materials, respectively. Thereafter, each ligated cDNA was purified by capturing on the streptavidin beads as described by the supplier (InVitrogen, Grand Island, N.Y.), and transcribed in vitro with T7 RNA polymerase (Ambion, Austin, Tex.).
Next, in order to prepare 3′-represented tester and driver libraries, a 10-μg aliquot of each of the in vitro synthesized RNA was converted to double-stranded cDNA by performing first-strand cDNA synthesis as described above followed by primer-directed (primer OGS 494 (SEQ. ID. NO:95) for TAG1 and primer OGS 302 (SEQ. ID. NO:96) for TAG2) second-strand DNA synthesis using Advantage-2 Taq polymerase (BD Biosciences Clontech, Mississauga, ON). The double-stranded cDNA was purified using Qiaquick columns and quantified at A260nm. Thereafter, 6×1-μg aliquots of each double-stranded cDNA was digested individually with one of the following 4-base recognition restriction enzymes Rsa I, Sau3A1, Mse I, Msp I, HinPl I and Bsh 1236I (MBI Fermentas, Burlington, ON), yielding up to six possible 3′-fragments for each RNA species contained in the cDNA library. Following digestion, the restriction enzymes were inactivated with phenol and the set of six reactions pooled. The restriction enzymes sites were then blunted with T4 DNA polymerase and ligated to linkers containing an Asc I recognition site. Each linker-adapted pooled DNA sample was digested with Asc I and Not I restriction enzymes, desalted and ligated to specialized oligonucleotide promoter tags, TAG1 (OGS 594 and 595) for the original TAG1-derived materials to generate tester RNA and TAG2-related OGS 621 and 622 (SEQ. ID. NO:97 and SEQ. ID. NO:98) with only the promoter sequence for the original TAG2-derived materials for generating driver DNA. The promoter-ligated materials were purified using the streptavidin beads, which were then transcribed in vitro with either T7 RNA polymerase (Ambion, Austin, Tex.), purified and quantified at A260nm. The resulting TAG1 3′-represented RNA was used directly as “tester RNA” whereas, the TAG2 3′-represented RNA was used to synthesize first-strand cDNA, which then served as single-stranded “driver DNA”. Each “driver DNA” reaction was treated with RNase A and RNase H to remove the RNA, phenol extracted and purified before use. An equivalent amount of each driver RNA for the five LMP samples were pooled before synthesis of the single-stranded driver DNA.
The following 3′-represented libraries were prepared:
Tester 1 (MF-22)—human malignant ovarian cancer donor 1
Tester 2 (MF-25)—human malignant ovarian cancer donor 2
Tester 3 (MF-27)—human malignant ovarian cancer donor 3
Tester 4 (MF-28)—human malignant ovarian cancer donor 4
Tester 5 (MF-30)—human malignant ovarian cancer donor 5
Driver 1 (MF-15)—human ovarian LMP donor 1
Driver 2 (MF-16)—human ovarian LMP donor 2
Driver 3 (MF-18)—human ovarian LMP donor 3
Driver 4 (MF-19)—human ovarian LMP donor 4
Driver 5 (MF-20)—human ovarian LMP donor 5
Each tester RNA sample was subtracted following the teachings of U.S. Pat. No. 5,712,127 with the pooled driver DNA (MF-15, -16, -18, -19 and -20) in a ratio of 1:100 for 2-rounds following the teachings of Malek et al., 1998 (U.S. Pat. No. 5,712,127). Additionally, control reactions containing tester RNA and no driver DNA, and tester RNA plus driver DNA but no RNase H were prepared. The tester RNA remaining in each reaction after subtraction was converted to double-stranded DNA, and a volume of 5% removed and amplified in a standard PCR reaction for 30-cycles for analytical purposes. The remaining 95% of only the tester-driver plus RNase H subtracted samples after 2-rounds were amplified for 4-cycles in PCR, digested with Asc I and Not I restriction enzymes, and one half ligated into the pCATRMAN (SEQ. ID. NO:99) plasmid vector and the other half, into the p20 (SEQ. ID. NO:100) plasmid vector. The ligated materials were transformed into E. coli DH10B and individual clones contained in the pCATRMAN libraries were picked for further analysis (DNA sequencing and hybridization) whereas, clones contained in each p20 library were pooled for use as subtracted probes. Each 4-cycles amplified cloned subtracted library contained between 15,000 and 25,000 colonies. Additionally, in order to prepare subtracted cDNA probes, reciprocal subtraction for 2-rounds was performed using instead, the pooled driver RNA as “tester” and each of the malignant tester RNA as “driver”. The materials remaining after subtraction for each were similarly amplified for 4-cycles in PCR, digested with Asc I and Not I restriction enzymes, and one half ligated into the p20 plasmid vector.
The following cloned subtracted libraries were prepared:
SL123—Tester 1 (MF-22) minus Pooled Driver (MF-15, -16, -18, -19 and -20)
SL124—Tester 2 (MF-25) minus Pooled Driver (MF-15, -16, -18, -19 and -20)
SL125—Tester 3 (MF-27) minus Pooled Driver (MF-15, -16, -18, -19 and -20)
SL126—Tester 4 (MF-28) minus Pooled Driver (MF-15, -16, -18, -19 and -20)
SL127—Tester 5 (MF-30) minus Pooled Driver (MF-15, -16, -18, -19 and -20)
SL133—Pooled Driver (MF-15, -16, -18, -19 and -20) minus Tester 1 (MF-22)
SL134—Pooled Driver (MF-15, -16, -18, -19 and -20) minus Tester 2 (MF-25)
SL135—Pooled Driver (MF-15, -16, -18, -19 and -20) minus Tester 3 (MF-27)
SL136—Pooled Driver (MF-15, -16, -18, -19 and -20) minus Tester 4 (MF-28)
SL137—Pooled Driver (MF-15, -16, -18, -19 and -20) minus Tester 5 (MF-30)
A 5-μL aliquot of the 30-cycles PCR amplified subtracted and non-subtracted materials were visualized on a 1.5% agarose gel containing ethidium bromide and then transferred to Hybond N+ (Amersham Biosciences, Piscataway, N.J.) nylon membrane for Southern blot analysis. Using radiolabeled probes specific for GAPDH (glyceraldehyde-3-phosphate dehydrogenase; Accession #M32599.1) and β-actin (Accession #X00351), which are typically non-differentially expressed house-keeping genes, it was evident that there was subtraction of both GAPDH and β-actin (
Approximately ˜5300 individual colonies contained in the pCATRMAN subtracted libraries (SL123 to SL127) described above were randomly picked using a Qbot (Genetix Inc., Boston, Mass.) into 60 μL of autoclaved water. Then, 42 μL of each was used in a 100-μL standard PCR reaction containing oligonucleotide primers, OGS 1 and OGS 142 and amplified for 40-cycles (94° C. for 10 minutes, 40× (94° C. for 40 seconds, 55° C. for 30 seconds and 72° C. for 2 minutes) followed by 72° C. for 7 minutes) in 96-wells microtitre plates using HotStart™ Taq polymerase (Qiagen, Mississauga, ON). The completed PCR reactions were desalted using the 96-well filter plates (Corning) and the amplicons recovered in 100 μL 10 mM Tris (pH 8.0). A 5-μL aliquot of each PCR reaction was visualized on a 1.5% agarose gel containing ethidium bromide and only those reactions containing a single amplified product were selected for DNA sequence analysis using standard DNA sequencing performed on an ABI 3100 instrument (Applied Biosystems, Foster City, Calif.). Each DNA sequence obtained was given a Sequence Identification Number and entered into a database for subsequent tracking and annotation.
Each sequence was selected for BLAST analysis of public databases (e.g. NCBI). Absent from these sequences were the standard housekeeping genes (GAPDH, actin, most ribosomal proteins etc.), which was a good indication that the subtracted library was depleted of at least the relatively abundant non-differentially expressed sequences.
Once sequencing and annotation of the selected clones were completed, the next step involved identifying those sequences that were actually upregulated in the malignant ovarian cancer samples compared to the LMP samples.
The PCR amplicons representing the annotated sequences from the pCATRMAN libraries described above were used to prepare DNA microarrays. The purified PCR amplicons contained in 70 μL of the PCR reactions prepared in the previous section was lyophilized and each reconstituted in 20 μL of spotting solution comprising 3×SSC and 0.1% sarkosyl. DNA micro-arrays of each amplicon in triplicate were then prepared using CMT-GAP2 slides (Corning, Corning, N.Y.) and the GMS 417 spotter (Affymetrix, Santa Clara, Calif.).
The DNA micro-arrays were then hybridized with either standard or subtracted cy3 and cy5 labelled cDNA probes as recommended by the supplier (Amersham Biosciences, Piscataway, N.J.). The standard cDNA probes were synthesized using RAMP amplified RNA prepared from the different human ovarian LMP and malignant samples. It is well known to the skilled artisan that standard cDNA probes only provide limited sensitivity of detection and consequently, low abundance sequences contained in the cDNA probes are usually missed. Thus, the hybridization analysis was also performed using cy3 and cy5 labelled subtracted cDNA probes prepared from in vitro transcribed RNA generated from subtracted libraries (SLP123 to SLP127 and SLP133 to SLP137) cloned into the p20 plasmid vector and represent the different tester and driver materials. These subtracted libraries may be enriched for low abundance sequences as a result of following the teachings of Malek et al., 1998 (U.S. Pat. No. 5,712,127), and therefore, may provide increased detection sensitivity.
All hybridization reactions were performed using the dye-swap procedure as recommended by the supplier (Amersham Biosciences, Piscataway, N.J.) and approximately 750 putatively differentially expressed upregulated (>2-fold) sequences were selected for further analysis.
The differentially expressed sequences identified in Section F for the different human malignant ovarian cancer subtracted libraries (SL123 to SL127) were tested for specificity by hybridization to nylon membrane-based macroarrays. The macroarrays were prepared using RAMP amplified RNA from 6 LMP and 20 malignant human ovarian samples, and 30 normal human tissues (adrenal, liver, lung, ovary, skeletal muscle, heart, cervix, thyroid, breast, placenta, adrenal cortex, kidney, vena cava, fallopian tube, pancreas, testicle, jejunum, aorta, esophagus, prostate, stomach, spleen, ileum, trachea, brain, colon, thymus, small intestine, bladder and duodenum) purchased commercially (Ambion, Austin, Tex.). In addition, RAMP RNA prepared from breast cancer cell lines, MDA and MCF7, prostate cancer cell line, LNCap, and a normal and prostate cancer LCM microdissected sample. Because of the limited quantities of mRNA available for many of these samples, it was necessary to first amplify the mRNA using the RAMP methodology. Each amplified RNA sample was reconstituted to a final concentration of 250 ng/μL in 3×SSC and 0.1% sarkosyl in a 96-well microtitre plate and 1 μL spotted onto Hybond N+ nylon membranes using the specialized MULTI-PRINT™ apparatus (VP Scientific, San Diego, Calif.), air dried and UV-cross linked. Of the ˜750 different sequences selected from SL123 to SL127 for macroarray analysis, only 250 sequences were individually radiolabeled with α-32P-dCTP using the random priming procedure recommended by the supplier (Amersham, Piscataway, N.J.) and used as probes on the macroarrays thus far. Hybridization and washing steps were performed following standard procedures well known to those skilled in the art.
Occasionally, the results obtained from the macroarray methodology were inconclusive. For example, probing the membranes with certain STAR clones resulted in patterns where all the RNA samples appeared to express equal levels of the message or in patterns where there was no signal. This suggested that not all STAR clones were useful tools to verify the expression of their respective genes. To circumvent this problem, RT-PCR was used to determine the specificity of expression. Using the same RAMP RNA samples that were spotted on the macroarrays, 500 μg of RNA was converted to single-stranded cDNA with Thermoscript RT (Invitrogen, Burlington, ON) as described by the manufacturer. The cDNA reaction was diluted so that 1/200 of the reaction was used for each PCR experiment. After trial PCR reactions with gene-specific primers designed against each SEQ. ID NOs. to be tested, the linear range of the reaction was determined and applied to all samples, PCR was conducted in 96-well plates using Hot-Start Taq Polymerase from Qiagen (Mississauga, ON) in a DNA Engine Tetrad from MJ Research. Half of the reaction mixture was loaded on a 1.2% agarose/ethidium bromide gel and the amplicons visualized with UV light.
Of the 250 sequences tested, approximately 55% were found to be upregulated in many of the malignant samples compared to the LMPs. However, many of these sequences were also readily detected in a majority of the different normal human tissues. Based on these results, those sequences that were detected in many of the other human tissues at significantly elevated levels were eliminated. Consequently, only 49 sequences, which appeared to be upregulated and highly malignant ovarian cancer-specific, were selected for biological validation studies. This subset of 49 sequences include some genes previously reported in the literature to be upregulated in ovarian cancer but without demonstration of their relative expression in normal tissues. The macroarray data for FOLR1 (SEQ. ID. NO.50) is included to exemplify the hybridization pattern and specificity of a gene that is already known to be involved in the development of ovarian cancer.
The present invention thus relates in one aspect thereof to a method of representatively identifying a differentially expressed sequence involved in ovarian cancer. The sequence may be, for example, differentially expressed in a malignant ovarian cancer cell compared to a LMP ovarian cancer cell or normal ovarian cells. The sequence may be, for example, differentially expressed in a malignant ovarian cancer cell and a LMP ovarian cancer cell compared to a normal ovarian cell.
The method of the present invention may comprise the following steps or some of the following steps;
The method may further comprise the step of comparatively determining the presence of the identified differentially expressed sequence in a cancer cell relative to a normal cell (e.g., a normal ovarian cell, a normal prostate cell, a normal breast cell etc.) or relative to a standard value.
The method may be used to preferentially identify a sequence which is upregulated in malignant ovarian cancer cell compared to a cell from a low malignancy potential ovarian cancer and/or compared to a normal cell.
In accordance with the present invention, a sequence may be further selected based on a reduced, lowered or substantially absent expression in a subset of other normal cell (e.g., a normal ovarian cell) or tissue, therefore representing a candidate sequence specifically involved in ovarian cancer.
The method may also further comprise a step of determining the complete sequence of the nucleotide sequence and may also comprise determining the coding sequence of the nucleotide sequence.
A sequence may also be selected for its specificity to other types of tumor cells, thus identifying a sequence having a more generalized involvement in the development of cancer. These types of sequence may therefore represent desirable candidates having a more universal utility in the treatment and/or detection of cancer.
The present invention also relates in a further aspect, to the isolated differentially expressed sequence (polynucleotide and polypeptide) identified by the method of the present invention.
The candidate STAR sequence for SEQ. ID. NO:1 maps to a genomic hit and est hits according to NCBI's nr and est databases (see Table 2). Although, the matching ests are clustered into a new Unigene identifier number, Hs.555871, the STAR sequence does not map to any of the known mRNA sequences listed in this cluster, which codes for guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 1 (GNGT1). We have demonstrated that this STAR clone sequence is markedly upregulated in malignant ovarian cancer samples compared to ovarian LMP samples and a majority of normal human tissues (
The candidate protein encoded by the isolated SEQ. ID. NO:2 is associated with a previously identified gene that encodes a predicted polypeptide, interferon-induced protein 44-like (IFI44L) with an unknown function (see Table 2). We have demonstrated that expression of this gene is markedly upregulated in malignant ovarian cancer samples compared to ovarian LMP samples and a majority of normal human tissues (
The candidate protein encoded by the isolated SEQ. ID. NO:3 is associated with a previously identified gene that encodes a known polypeptide, HOX D1, which contains a homeobox DNA-binding domain. This gene is a member of the Antp homeobox family and is nuclear sequence-specific transcription factor that is previously known to be involved in differentiation and limb development (see Table 2). We have demonstrated that expression of this gene is markedly upregulated in malignant ovarian cancer samples compared to ovarian LMP samples and the normal human tissues (
The candidate protein encoded by the isolated SEQ. ID. NO:4 is associated with a previously identified gene that encodes a hypothetical polypeptide, LOC92196, similar to death-associated protein with an unknown function (see Table 2). We have demonstrated that expression of this gene is markedly upregulated in malignant ovarian cancer samples compared to ovarian LMP samples and a majority of normal human tissues (
The candidate protein encoded by the isolated SEQ. ID. NO:5 is associated with a previously identified gene that encodes a predicted polypeptide, interferon-induced protein with tetratricopeptide repeats 1 (IFIT1), with unknown function (see Table 2). We have demonstrated that expression of this gene is markedly upregulated in malignant ovarian cancer samples compared to ovarian LMP samples and a majority of normal human tissues (
The candidate protein encoded by the isolated SEQ. ID. NO:6 is associated with a previously identified gene that encodes a known protein, glycine dehydrogenase (GLDC) (decarboxylating; glycine decarboxylase, glycine cleavage system protein P), which is a mitochondrial enzyme that catalyzes the degradation of glycine (see Table 2). We have demonstrated that expression of this gene is markedly upregulated in malignant ovarian cancer samples compared to ovarian LMP samples and a majority of normal human tissues (
The candidate protein encoded by the isolated SEQ. ID. NO:7 is associated with a previously identified gene that encodes a protein, dipeptidase 3 (DPEP3), which has membrane dipeptidase (proteolysis and peptidolysis) activity (see Table 2). We have demonstrated that expression of this gene is markedly upregulated in malignant ovarian cancer samples compared to ovarian LMP samples and a majority of normal human tissues (
The candidate protein encoded by the isolated SEQ. ID. NO:8 is associated with a previously identified gene that encodes a protein, neuromedin U (NMU), which is a neuropeptide with potent activity on smooth muscle (see Table 2). We have demonstrated that expression of this gene is markedly upregulated in malignant ovarian cancer samples compared to ovarian LMP samples and a majority of normal human tissues (
The candidate protein encoded by the isolated SEQ. ID. NO:9 is associated with a previously identified gene that encodes a protein, bone morphogenetic protein 7 (BMP7), which plays a role in calcium regulation and bone homeostasis (see Table 2). We have demonstrated that expression of this gene is markedly upregulated in malignant ovarian cancer samples compared to ovarian LMP samples and a majority of normal human tissues (
The candidate protein encoded by the isolated SEQ. ID. NO:10 is associated with a previously identified gene that encodes a protein, cyclin-dependent kinase inhibitor 3 (CDKN3) (CDK2-associated dual specificity phosphatase), which is expressed at the G1 to S transition of the cell cycle (see Table 2). We have demonstrated that expression of this gene is markedly upregulated in malignant ovarian cancer samples compared to ovarian LMP samples and a majority of normal human tissues (
The candidate protein encoded by the isolated SEQ. ID. NO:11 is associated with a previously identified gene that encodes a protein, CDC28 protein kinase regulatory subunit 1B (CKS1B), which has cyclin-dependent protein kinase activity in cell cycle regulation (see Table 2). We have demonstrated that expression of this gene is markedly upregulated in malignant ovarian cancer samples compared to ovarian LMP samples and a majority of normal human tissues (
The candidate protein encoded by the isolated SEQ. ID. NO:12 is associated with a previously identified gene that encodes a protein, preferentially expressed antigen in melanoma (PRAME), which has no known function (see Table 2). We have demonstrated that expression of this gene is markedly upregulated in malignant ovarian cancer samples compared to ovarian LMP samples and a majority of normal human tissues (
The candidate protein encoded by the isolated SEQ. ID. NO:13 is associated with a previously identified gene that encodes a protein, ISG15 ubiquitin-like modifier (ISG15), which is associated with ubiquitin-dependent protein catabolism (see Table 2). We have demonstrated that expression of this gene is markedly upregulated in malignant ovarian cancer samples compared to ovarian LMP samples and a majority of normal human tissues (
The candidate STAR sequence represented by the isolated SEQ. ID. NO:14 is associated with a previously identified partial gene sequence related to Accession #AI922121.1 (see Table 2), which codes for a yet unknown protein. We have demonstrated that this STAR clone sequence is markedly upregulated in malignant ovarian cancer samples compared to ovarian LMP samples and a majority of normal human tissues (
The candidate protein encoded by the isolated SEQ. ID. NO:15 is associated with a previously identified gene that encodes a hypothetical protein, FLJ33790, which has no known function (see Table 2). We have demonstrated that expression of this gene is markedly upregulated in malignant ovarian cancer samples compared to ovarian LMP samples and a majority of normal human tissues (
The STAR sequence represented by the isolated SEQ. ID. NO:16 maps to a previously identified est, BG213598 that is from a transcribed genomic locus contained in the Unigene cluster, Hs.334302, which encodes a yet unknown protein (see Table 2). We have demonstrated that this STAR clone sequence is markedly upregulated in malignant ovarian cancer samples compared to ovarian LMP samples and a majority of normal human tissues (
The candidate protein encoded by the isoalted SEQ. ID. NO:17 is associated with a previously identified gene that encodes a protein, V-set domain containing T cell activation inhibitor 1 (VTCN1), which has no known function (see Table 2). We have demonstrated that expression of this gene is markedly upregulated in malignant ovarian cancer samples compared to ovarian LMP samples and a majority of normal human tissues (
The candidate protein encoded by the isolated SEQ. ID. NO:18 is associated with a previously identified gene that encodes a protein, kinesin family member 20A (KIF20A), which is involved in cell division in and membrane traffic within the Golgi apparatus (see Table 2). We have demonstrated that expression of this gene is markedly upregulated in malignant ovarian cancer samples compared to ovarian LMP samples and a majority of normal human tissues (
The STAR sequence represented by the isolated SEQ. ID. NO:19 maps to a genomic hit, Accession #AY769439 and to a group of ests represented by Accession #AA744939. The ests are clustered into Unigene identifier, Hs.478368 representing the protein, potassium large conductance calcium-activated channel, subfamily M, beta member 2 (KCNMB2). However, the STAR sequence does not overlap with any of the mRNA sequences listed thus far in the Hs.478368 Unigene cluster (see Table 2). We have demonstrated that this STAR clone sequence is markedly upregulated in malignant ovarian cancer samples compared to ovarian LMP samples and a majority of normal human tissues (
The STAR sequence represented by the isolated SEQ. ID. NO:20 maps to a previously identified est, BU595315 belonging to a group of ests that is from a transcribed genomic locus contained in the Unigene cluster, Hs.603908, which encodes a yet unknown protein (see Table 2). We have demonstrated that this STAR clone sequence is markedly upregulated in malignant ovarian cancer samples compared to ovarian LMP samples and a majority of normal human tissues (
The candidate protein encoded by the isolated SEQ. ID. NO:21 is a previously identified gene that encodes a protein, chemokine (C-X-C motif) ligand 10 (CXCL10), which has chemokine activity (see Table 2). We have demonstrated that expression of this gene is markedly upregulated in malignant ovarian cancer samples compared to ovarian LMP samples and a majority of normal human tissues (
The STAR sequence represented by the isolated SEQ. ID. NO:22 maps to chromosome 14, and may represent a portion of an unknown gene sequence (see Table 2). We have demonstrated that this STAR clone sequence is markedly upregulated in malignant ovarian cancer samples compared to ovarian LMP samples and a majority of normal human tissues (
The candidate protein encoded by the isolated SEQ. ID. NO:23 is a previously identified gene that encodes a protein, asparagine-linked glycosylation 8 homolog (yeast, alpha-1,3-glucosyltransferase) (ALG8), which catalyzes the addition of the second glucose residue to the lipid-linked oligosaccharide precursor for N-linked glycosylation of proteins (see Table 2). We have demonstrated that expression of this gene is markedly upregulated in malignant ovarian cancer samples compared to ovarian LMP samples and a majority of normal human tissues (
The candidate protein encoded by the isolated SEQ. ID. NO:24 is a previously identified gene that encodes a protein, kidney associated antigen 1 (KAAG1), which has no known function (see Table 2). We have demonstrated that expression of this gene is markedly upregulated in malignant ovarian cancer samples compared to ovarian LMP samples and a majority of normal human tissues (
The candidate protein encoded by the isolated SEQ. ID. NO:25 is a previously identified gene that encodes a protein, cyclin-dependent kinase inhibitor 2A (CDKN2A), which is involved in cell cycle control, G1/S Checkpoint (see Table 2). We have demonstrated that expression of this gene is markedly upregulated in malignant ovarian cancer samples compared to ovarian LMP samples and a majority of normal human tissues (
The candidate protein encoded by the isolated SEQ. ID. NO:26 is a previously identified gene that encodes a protein, microtubule-associated protein homolog (Xenopus laevis) (TPX2), which is involved in cell proliferation from the transition G1/S until the end of cytokinesis (see Table 2). We have demonstrated that expression of this gene is markedly upregulated in malignant ovarian cancer samples compared to ovarian LMP samples and a majority of normal human tissues (
The candidate protein encoded by the isolated SEQ. ID. NO:27 is a previously identified gene that encodes a protein, ubiquitin-conjugating enzyme E2C (UBE2C), which is required for the destruction of mitotic cyclins and for cell cycle progression (see Table 2). We have demonstrated that expression of this gene is markedly upregulated in malignant ovarian cancer samples compared to ovarian LMP samples and a majority of normal human tissues (
The STAR sequence represented by the isolated SEQ. ID. NO:28 maps to cDNA FLJ35538 fis, clone SPLEN2002463 of Unigene cluster, Hs.590469 and may represent a portion of an unknown gene sequence (see Table 2). We have demonstrated that this STAR clone sequence is markedly upregulated in malignant ovarian cancer samples compared to ovarian LMP samples and a majority of normal human tissues (
The candidate protein encoded by the isolated SEQ. ID. NO:29 is a previously identified gene that encodes a protein, cellular retinoic acid binding protein 2 (CRABP2), whose function has not been precisely determined but this isoform is important in retinoic acid-mediated regulation of human skin growth and differentiation (see Table 2). We have demonstrated that expression of this gene is markedly upregulated in malignant ovarian cancer samples compared to ovarian LMP samples and a majority of normal human tissues (
The candidate protein encoded by the isolated SEQ. ID. NO:30 is a previously identified gene that encodes a protein, Histone 3, H2a (HIST3H2A), which is involved in nucleosome formation (see Table 2). We have demonstrated that expression of this gene is markedly upregulated in malignant ovarian cancer samples compared to ovarian LMP samples and a majority of normal human tissues (
The candidate protein encoded by the isolated SEQ. ID. NO:31 is a previously identified gene that encodes a protein, Histone 1, H4h (HIST1H4H), which is involved in nucleosome formation (see Table 2). We have demonstrated that expression of this gene is markedly upregulated in malignant ovarian cancer samples compared to ovarian LMP samples and a majority of normal human tissues (
The candidate protein encoded by the isolated SEQ. ID. NO:32 is a previously identified gene that encodes a hypothetical protein, Homeo box D3 (HOXD3), which is a nuclear transcription factor involved in development and differentiation (see Table 2). We have demonstrated that expression of this gene is markedly upregulated in malignant ovarian cancer samples compared to ovarian LMP samples and a majority of normal human tissues (
The candidate protein encoded by the isolated SEQ. ID. NO:33 is a previously identified gene that encodes a member of the immunoglobulin gene family, immunoglobulin constant gamma 1 (IGHG1), which probably plays a role in immune response and antigen binding (see Table 2). We have demonstrated that expression of this gene is markedly upregulated in malignant ovarian cancer samples compared to ovarian LMP samples and a majority of normal human tissues (
The candidate protein encoded by the isolated SEQ. ID. NO:34 is a previously identified gene that encodes a member of the immunoglobulin gene family, immunoglobulin kappa constant (IGKC), which probably plays a role in immune response and antigen biinding (see Table 2). We have demonstrated that expression of this gene is markedly upregulated in malignant ovarian cancer samples compared to ovarian LMP samples and a majority of normal human tissues (
The candidate protein encoded by the isolated SEQ. ID. NO:35 is a gene located on chromosome 10 that encodes an open reading frame of unknown function. (see Table 2). The gene may encode a protein termed astroprincin that was found to be expressed in a critical region in DiGeorge syndrome. We have demonstrated that expression of this gene is markedly upregulated in malignant ovarian cancer samples compared to ovarian LMP samples and a majority of normal human tissues (
The candidate protein encoded by the isolated SEQ. ID. NO:36 is a previously identified gene that encodes a protein, histocompatibility (minor) 13 (HM13), which has no known function (see Table 2). We have demonstrated that expression of this gene is markedly upregulated in malignant ovarian cancer samples compared to ovarian LMP samples and a majority of normal human tissues (
The STAR sequence represented by the isolated SEQ. ID. NO:37 maps to chromosome 13, and may represent a portion of an unknown gene sequence (see Table 2). We have demonstrated that this STAR clone sequence is markedly upregulated in malignant ovarian cancer samples compared to ovarian LMP samples and a majority of normal human tissues (
The candidate protein encoded by the isolated SEQ. ID. NO:38 is a previously identified gene that encodes a protein, frizzled-related protein (FRZB), which is associated with symptomatic osteoarthritis and may play a role in skeletal morphogenesis (see Table 2). We have demonstrated that expression of this gene is markedly upregulated in malignant ovarian cancer samples compared to ovarian LMP samples and a majority of normal human tissues (
The candidate protein encoded by the isolated SEQ. ID. NO:39 is a previously identified gene that encodes a protein, forkhead box M1 (FOXM1), which is a transcription factor that regulates genes involved in cell proliferation (see Table 2). We have demonstrated that expression of this gene is markedly upregulated in malignant ovarian cancer samples compared to ovarian LMP samples and a majority of normal human tissues (
The candidate protein encoded by the isolated SEQ. ID. NO:40 is a gene located on chromosome 20 that encodes an open reading frame of unknown function. (see Table 2). The gene is predicted to encode a membrane protein. We have demonstrated that expression of this gene is markedly upregulated in malignant ovarian cancer samples compared to ovarian LMP samples and a majority of normal human tissues (
The STAR sequence represented by the isolated SEQ. ID. NO:41 maps to chromosome 1, and may represent a portion of an unknown gene sequence (see Table 2). Weak homology has been found between SEQ. ID. NO. 41 and the envelop proteins present at the surface of human endogenous retroviruses. We have demonstrated that this STAR clone sequence is markedly upregulated in malignant ovarian cancer samples compared to ovarian LMP samples and a majority of normal human tissues (
The candidate protein encoded by the isolated SEQ. ID. NO:42 is a gene located on chromosome 16 that encodes an open reading frame of unknown function. (see Table 2). The gene is predicted to encode a membrane protein. We have demonstrated that expression of this gene is markedly upregulated in malignant ovarian cancer samples compared to ovarian LMP samples and a majority of normal human tissues (
The candidate protein encoded by the isolated SEQ. ID. NO:43 is a previously identified gene that encodes a protein, Rac GTPase activating protein 1 (RACGAP1), which is a GTPase that interacts with Rho GTPases to control many cellular processes (see Table 2). These types of proteins are important effector molecules for the downstream signaling of Rho GTPases. We have demonstrated that expression of this gene is markedly upregulated in malignant ovarian cancer samples compared to ovarian LMP samples and a majority of normal human tissues (
The candidate protein encoded by the isolated SEQ. ID. NO:44 is a gene that encodes transmembrane protein 19 (TMEM19) that has no known function. (see Table 2). The gene is predicted to encode a membrane protein. We have demonstrated that expression of this gene is markedly upregulated in malignant ovarian cancer samples compared to ovarian LMP samples and a majority of normal human tissues (
The STAR sequence represented by the isolated SEQ. ID. NO:45 maps to chromosome 4, and may represent a portion of an unknown gene sequence (see Table 2). We have demonstrated that this STAR clone sequence is markedly upregulated in malignant ovarian cancer samples compared to ovarian LMP samples and a majority of normal human tissues (
The STAR sequence represented by the isolated SEQ. ID. NO:46 maps to chromosome 1, and may represent a portion of an unknown gene sequence (see Table 2). We have demonstrated that this STAR clone sequence is markedly upregulated in malignant ovarian cancer samples compared to ovarian LMP samples and a majority of normal human tissues (
The candidate protein encoded by the isolated SEQ. ID. NO:47 is a previously identified gene with the Unigene cluster, Hs.449585, and may represent a portion immunoglobulin lambda locus (IGLV@), which probably plays a role in immune response and antigen biinding (see Table 2). We have demonstrated that expression of this gene is markedly upregulated in malignant ovarian cancer samples compared to ovarian LMP samples and a majority of normal human tissues (
The candidate protein encoded by the isolated SEQ. ID. NO:48 is a previously identified gene that encodes a protein, secretory carrier membrane protein 3 (SCAMP3), which functions as a cell surface carrier protein during vesicular transport (see Table 2). We have demonstrated that expression of this gene is markedly upregulated in malignant ovarian cancer samples compared to ovarian LMP samples but it is also expressed in a majority of normal human tissues (
The STAR sequence represented by the isolated SEQ. ID. NO:49 maps to chromosome 2, and may represent a portion of an unknown gene sequence (see Table 2). We have demonstrated that this STAR clone sequence is markedly upregulated in malignant ovarian cancer samples compared to ovarian LMP samples and a majority of normal human tissues (
The candidate protein encoded by the isolated SEQ. ID. NO:50 is a previously identified gene that encodes a protein, Folate receptor 1 (adult) (FOLR1), with members of this gene family having a high affinity for folic acid and for several reduced folic acid derivatives, and mediate delivery of 5-methyltetrahydrofolate to the interior of cells (see Table 2). We have demonstrated that this gene is markedly upregulated in malignant ovarian cancer samples compared to ovarian LMP samples and a majority of normal human tissues (
The candidate protein encoded by the isolated SEQ. ID. NO:169 is a previously identified gene that encodes a protein, ceruloplasmin (CP), that binds most of the copper in plasma and is involved in the peroxidation of Fe(II)transferrin. The deficiency of this metalloprotein, termed aceruloplasminemia, leads to iron accumulation and tissue damage, and is associated diabetes and neurologic diseases (see Table 2). We have demonstrated that this gene is markedly upregulated in malignant ovarian cancer samples compared to ovarian LMP samples and a majority of normal human tissues (
RNA interference is a recently discovered gene regulation mechanism that involves the sequence-specific decrease in a gene's expression by targeting the mRNA for degradation and although originally described in plants, it has been discovered across many animal kingdoms from protozoans and invertebrates to higher eukaryotes (reviewed in Agrawal et al., 2003). In physiological settings, the mechanism of RNA interference is triggered by the presence of double-stranded RNA molecules that are cleaved by an RNAse III-like protein active in cells, called Dicer, which releases the 21-23 bp siRNAs. The siRNA, in a homology-driven manner, complexes into a RNA-protein amalgamation termed RISC(RNA-induced silencing complex) in the presence of mRNA to cause degradation resulting in attenuation of that mRNA's expression (Agrawal et al., 2003).
Current approaches to studying the function of genes, such as gene knockout mice and dominant negatives, are often inefficient, and generally expensive, and time-consuming. RNA interference is proving to be a method of choice for the analysis of a large number of genes in a quick and relatively inexpensive manner. Although transfection of synthetic siRNAs is an efficient method, the effects are often transient at best (Hannon G. J., 2002). Delivery of plasmids expressing short hairpin RNAs by stable transfection has been successful in allowing for the analysis of RNA interference in longer-term studies (Brummelkamp et al., 2002; Elbashir et al., 2001).
In order to determine which ovarian cancer-specific genes participate in the proliferation of ovarian cancer cells, an assay was developed using stably transfected cell lines that contain attenuated (i.e., knocked down) levels of the specific gene being investigated. Two human ovarian cancer cell lines derived from chemotherapy-naïve patients were utilized that have been previously characterized in terms of their morphology, tumorigenicity, and global expression profiles. In addition, these analyses revealed that these cell lines were excellent models for in vivo behavior of ovarian tumors in humans (Provencher et al., 2000 and Samouelian et al., 2004). These cell lines are designated TOV-21G and TOV-112D.
The design and subcloning of individual shRNA expression cassettes and the procedure utilized for the characterisation of each nucleotide sequence is described below. Selection of polynucleotides were chosen based on their upregulation in ovarian tumors and the selective nature of their expression in these tumors compared to other tissues as described above. The design of shRNA sequences was performed using web-based software that is freely available to those skilled in the art (Qiagen for example). These chosen sequences, usually 19-mers, were included in two complementary oligonucleotides that form the template for the shRNAs, i.e. the 19-nt sense sequence, a 9-nt linker region (loop), the 19-nt antisense sequence followed by a 5-6 poly-T tract for termination of the RNA polymerase III. Appropriate restriction sites were inserted at the ends of these oligonucleotides to facilitate proper positioning of the inserts so that the transcriptional start point is at a precise location downstream of the hU6 promoter. The plasmid utilized in all RNA interference studies, pSilencer 2.0 (SEQ. ID. NO. 101), was purchase from a commercial supplier (Ambion, Austin, Tex.). For each sequence selected, at least two different shRNA expression vectors were constructed to increase the chance of observing RNA interference.
TOV-21G or TOV-112D cells were seeded in 6-well plates in OSE (Samouelian et al., 2004) containing 10% fetal bovine serum at a density of 600 000 cells/well, allowed to plate overnight and transfected with 1 μg of pSil-shRNA plasmid (
The proliferative ability of each shRNA-expressing cell line was determined and compared to cells expressing the scrambled shRNA (control). Cell number was determined spectrophotometrically by MTT assay at 570 nm (Mosmann, 1983). After selection of stably shRNA expressing pools and expansion of the lines, 5 000 cells/well of each cell lines was plated in 48-well plates in triplicate and incubated for 4 days under standard growth conditions. Representative data from 2 experiments ±SEM is displayed and experiments were typically repeated at least three times to confirm the results observed.
The gene encoding the folate receptor 1, SEQ. ID. NO. 50 (0967A) (
Table 1 below lists all of the genes tested and the average growth inhibition (n=3-4) that was observed in TOV-21G cells. Differences of less than 20% (see Table 1, <20) compared to the control cell lines represent cells where statistically significant reduction in proliferation was measured within a range of 5-20%.
As a means of complementing the growth inhibition data that was generated with the stable TOV-21G cell lines, a colony survival assay was used to determine the requirement of the selected genes in the survival of the cancer cells. The ‘colony formation assay’ or ‘clonogenic assay’ is a classical test to evaluate cell growth after treatment. The assay is widespread in oncological research areas where it is used to test the proliferating power of cancer cell lines after radiation and/or treatment with anticancer agents. It was expected that the results obtained when analyzing the genes that were functionally important in ovarian cancer would correlate between the growth inhibition study and the colony survival assay.
TOV-21G cells were seeded in 12-well plates at a density of 50 000 cells/well and transfected 24 h later with 1 μg of pSil-shRNA vector, the same plasmids used in the previous assay. The next day, fresh medium was applied containing 2 μg/ml puromycin and the selection of the cells was carried out for 3 days. The cells were washed and fresh medium without puromycin was added and growth continued for another 5 days. To visualize the remaining colonies, the cells were washed in PBS and fixed and stained simultaneously in 1% crystal violet/10% ethanol in PBS for 15 minutes at room temperature. Following extensive washing in PBS, the dried plates were scanned for photographic analysis.
As shown in
One skilled in the art will recognize that the sequences described in this invention have utilities in not only ovarian cancer, but these applications can also be expanded to other oncology indications where the genes are expressed. To address this, a PCR-based method was adapted to determine the expression pattern of all sequences described above in cancer cell lines isolated from nine types of cancer. The cancer types represented by the cell lines are leukemia, central nervous sytem, breast, colon, lung, melanoma, ovarian, prostate, and renal cancer (see Table C). These RNA samples were obtained from the Developmental Therapeutics Program at the NCl/NIH. Using the same RAMP RNA samples that amplified from the total RNA samples obtained from the NCl, 500 μg of RNA was converted to single-stranded cDNA with Thermoscript RT (Invitrogen, Burlington, ON) as described by the manufacturer. The cDNA reaction was diluted so that 1/200 of the reaction was used for each PCR experiment. After trial PCR reactions with gene-specific primers designed against each SEQ. ID NOs. to be tested, the linear range of the reaction was determined and applied to all samples, PCR was conducted in 96-well plates using Hot-Start Taq Polymerase from Qiagen (Mississauga, ON) in a DNA Engine Tetrad from MJ Research. Half of the reaction mixture was loaded on a 1.2% agarose/ethidium bromide gel and the amplicons visualized with UV light. To verify that equal quantities of RNA was used in each reaction, the level of RNA was monitored with GAPDH expression.
One of skill in the art will readily recognize that orthologues for all mammals may be identified and verified using well-established techniques in the art, and that this disclosure is in no way limited to one mammal. The term “mammal(s)” for purposes of this disclosure refers to any animal classified as a mammal, including humans, domestic and farm animals, and zoo, sports, or pet animals, such as dogs, cats, cattle, horses, sheep, pigs, goats, rabbits, etc. Preferably, the mammal is human.
The sequences in the experiments discussed above are representative of the NSEQ being claimed and in no way limit the scope of the invention. The disclosure of the roles of the NSEQs in proliferation of ovarian cancer cells satisfies a need in the art to better understand ovarian cancer disease, providing new compositions that are useful for the diagnosis, prognosis, treatment, prevention and evaluation of therapies for ovarian cancer and other cancers where said genes are expressed as well.
The art of genetic manipulation, molecular biology and pharmaceutical target development have advanced considerably in the last two decades. It will be readily apparent to those skilled in the art that newly identified functions for genetic sequences and corresponding protein sequences allows those sequences, variants and derivatives to be used directly or indirectly in real world applications for the development of research tools, diagnostic tools, therapies and treatments for disorders or disease states in which the genetic sequences have been implicated.
Although the present invention has been described herein above by way of preferred embodiments thereof, it may be modified, without departing from the spirit and nature of the subject invention as defined in the appended claims.
GTCAAGAAACCACACTTTA
GTGACATGGAACCCAGCGA
ACCGTGGCTGCTCGATAAA
GCCAGAGAGCACAGAAATA
GAGGAATGCCTCTAAGAAA
GGGAACGAGAAGGGCTTCT
AGCTGGAGGAATGAGAATT
AGGGCCAAAGCTTTCCATA
GGCAGGCTGTCCGCTTAAA
GGTCCTTAGGCACCCAGAT
GCGGAGCCCAGGGAGAATA
GCCCGGATTGATGACATAT
GTGGAGGCTGAGTTTCCAT
GGATGTTAACCTGCGAAAT
GGTCAGCAGGGTTCATTTA
GCCTCAGGAACAAGATGAA
GCGCGAGATCCTCTCCATT
GCGCCAGAGGAGCGGGAAG
GCCGCCCAGTTCAATACAA
GAGCTTACAACCTGCCTTA
GGCGCCCACTACCCAAGAA
GAGTCAGGGATGGGTCCAT
GGGCCAGTCTGTACTCATT
GGGAATTCCATCTCCATAT
GGCGCAGATCACCCAGAAG
GAGCATCCTGGTGAGGAAT
GGTGCCACATGACTAGGAT
GCTGCAGACGTGTATGCAT
GCGGAGGCACTGGGCTTAT
GCCCGCTTACTTCCTGGAG
GCTCTGCTCAAGTTGGATA
GCTGCTGCCTTGCAGTTTG
GCCCTTACCTGATGCTAAA
GGCACCTACAAATGTTATA
GAGGCCTGGAAGCTCCTAA
GCAGCTTCAGGAGGTTAAA
GCCGGACCTCTTCATCTTA
GCGTCCATCACGGAAACAT
GTCATCAGGACGTCCATTA
GACACGATCTACCCTCAAA
GGGCCATAGGGAAGCTTGA
GCCCACGTGTTGAGATCAA
GCTCCCACTGATTCCACAT
GCCAGAGAGTAAAAGGGAT
GGCATATGGAAGGAGCATT
GTGGTTTGGTTCAGCAGTT
GGCCTCCAGCCACGTAATT
GGCGCTGCTGCCGCTCATC
GGGCTGGAACTGGACTTCA
GCCCATAAGGATGTTTCCT
GCGTCCGGGCCTGTCTTCAACCT
GCCCCACCCTCTACCCCACCACTA
This patent application is a divisional of U.S. Ser. No. 12/305,648 filed on Jun. 22, 2007, now U.S. Pat. No. 8,216,582 which is a national stage filing under 35 U.S.C. §371 of international application No. PCT/CA2007/001134 filed on Jun. 22, 2007 which claimed priority to U.S. provisional application No. 60/815,829 filed on Jun. 23, 2006 and U.S. provisional application No. 60/874,471 filed Dec. 13, 2006. The entire contents of each of these priority applications are incorporated herein by reference.
| Number | Date | Country | |
|---|---|---|---|
| 60815829 | Jun 2006 | US | |
| 60874471 | Dec 2006 | US |
| Number | Date | Country | |
|---|---|---|---|
| Parent | 12305648 | Nov 2009 | US |
| Child | 13490857 | US |
