The ASCII file, entitled 60245SequenceListing.txt, created on Aug. 13, 2014, comprising 50,913.275 bytes, submitted concurrently with the filing of this application is incorporated herein by reference.
The invention relates to compositions and methods for reducing susceptibility to Nosema spp infection in bees and more particularly, to the use of composition for reduction of Nosema mitosomial gene expression for prevention and treatment of Nosema spp in honeybees.
The importance of honeybees and other pollinating insects to the global world economy far surpasses their contribution in terms of honey production. The United States Department of Agriculture (USDA) estimates that every third bite we consume in our diet is dependent on a honeybee to pollinate that food. The total contribution of pollination in terms of added value to fruit crops exceeds $15 billion per annum, with indirect potential consequence of $75 billion dollars.
Microsporidia are basal fungi and obligate intracellular parasites of other eukaryotes characterized by extreme genomic and cellular reduction. Two described species of microsporidia, Nosema apis and Nosema ceranae, cause a widespread and destructive disease in adult honey bee. Nosema disease is widespread across the world, and it has been observed that nosema pathogenesis, together with increased viral load, are the best predictors of weak and collapsing colonies. In Europe, disappearing colony syndrome has been directly attributed to Nosema ceranae, and the risk of colony depopulation is six times higher in colonies infected with N. ceranae than in uninfected ones. Recently, it was shown that natural Nosema ceranae infection can cause the sudden collapse of bee colonies.
Transmission of Nosema in honey bee colonies is mainly via the fecal-oral route in which pathogens are spread from diseased hosts to uninfected hosts via ingestion of nucleated Nosema spores from fecal material from infected bees. The spores geminate within the midgut and release polar tubes that transfer their sporoplasm into midgut epithelial cells. Inside the cell, the sporoplasm grows to form a multinuclear plasmodium, or “meront”, replicating to generate more spores, usually numbering in the millions per infected bee.
Current Anti-Nosema Protocol: Fumagillin
Fumagillin is an antibiotic derived from the fungus Aspergillus fumigates. It is an anti-angiogenic agent that covalently and selectively binds and inhibits the methionine aminopeptidase, MetAP-2 and has been used for many years to treat microsporidiosis caused by Nosema in honeybees. It is used extensively in the United States where beekeepers drench their hives in sucrose solution containing Fumagillin. However, Fumagillin does not kill Nosema spores, and has rapidly deteriorating potency after application, resulting in only partial and temporary anti-Nosema effect, since new bees emerge constantly in a colony, and re-application is required several times a year. Indeed, differences between treated and untreated colonies disappear several months after treatment, with several different etiologies.
In humans, Fumagillin was used more than 40 years ago for the treatment of intestinal amebiasis, and it is effective when used topically. However, a recent study showed that Fumigillin caused serious toxic side effects (neutropenia and thrombocytopenia) in patients that were treated for microsporidiosis due to Enterocytozoon bieneusi.
Of further concern is the possibility that Nosema, multiplying in the millions in each bee gut, will eventually develop resistance to Fumagillin, as has been the experience with other antibiotics that are copiously applied. Thus, possible resistance of Nosema to Fumagillin makes many beekeepers around the world understandably concerned about it's widespread use for prevention of Nosema infection. Due to these and other concerns, Fumagillin's use for treating Nosema in honeybees has already been prohibited in Europe.
Nosema and Microsporidian Genetics
Several Microsporidian genomes, including the human Encephalitozoon cuniculi (E. cunuculi), have been published to date. The sequence analysis of E. cuniculi revealed a very small and compacted genome of 2.9-megabase, comprising of nearly 2000 genes. Due to its extreme reduction, E. cuniculi genome lacks most of the introns and intergenic spacers usually found in eukaryotic genomes. The majority of the genes are also shorter than their corresponding homologues. In addition, in-depth analysis of the predicted genes showed absence of genes of some biosynthetic and metabolic pathways, while other such pathways included a relatively limited number of genes. Recent studies using the sequencing information have revealed some details of microsporidian evolution and metabolism such as homologues of bacterial ADP/ATP transporter suspected important in E. cunuculi energy metabolism.
Being an obligate parasite, E. cuniculi, and microsporidia in general, relies on its host to provide it with the energetic and metabolic needs. The compensation pathways, and their function, are poorly understood.
For many years, microsporidia were thought be lacking the mitochondria, and accordingly proposed to have evolved before the appearance of the eukaryotic mitochondria. Nosema lack electron transport chain and Kreb's cycle, however, recently a highly reduced organelle, extremely reduced both in size and biochemical complexity, called the mitosome was identified, a probable relic from a primitive mitochondrion. To date, only 20 mitosomal proteins were identified, in contrast to the yeast mitochondrion, which contains about 1000 proteins.
Recently, a draft sequence of the Nosema ceranae genome was published, enabling further analysis of protein homologies and revealing a significant homology to, while distinct diversity from the E. cunuculi genome, and only few genes orthologous with that of S. cerevisae.
Intracellular symbiotic organisms use mitochondrial carrier family proteins (MCF) in order to acquire various substrates, including ATP, from the host cell, in order to provide the energy for the protein transport and other necessary mitosomal activities. However, as the microsporidian genomes have apparently lost all of the genes for the MCF proteins, it is not known how the parasite's mitosome acquires the necessary ATP for its function. Several bacterial intracellular parasites, such as Rickettsia, possess a nucleotide transporter which is used for ATP import from their eukaryotic host cell. Homologues of these genes were identified in the E. cuniculi genome, however, the use of such bacterial-like nucleotide transporters to acquire ATP from a eukaryotic cell is unknown in a eukaryotic parasite. There are no homologues of these proteins in either vertebrate or invertebrate species sequenced to date.
Gene Silencing in Invertebrates
The process of post-transcriptional gene silencing is most likely a cellular defense mechanism used to prevent the expression of foreign genes, thought to be shared across kingdoms. The presence of long dsRNAs in cells stimulates the activity of a ribonuclease III enzyme referred to as Dicer, which is involved in the processing of the dsRNA into short pieces known as short interfering RNAs (siRNAs). These are typically about 21 to about 23 nucleotides in length and comprise about 19 base pair duplexes. The RNAi response also features an endonuclease complex, commonly referred to as an RNA-induced silencing complex (RISC), which mediates cleavage of single-stranded RNA having sequence complementarity to the antisense strand of the siRNA duplex. In some organisms, an amplification stage may follow the initiation stage of gene silencing, involving an RNA dependent RNA Polymerase (RdRP), which may subsequently lead to degradation of RNAs outside the initial dsRNA region of homology. It has been shown in some species that RNAi mediated interference spreads from the initial site of dsRNA delivery, producing interference phenotypes throughout the injected animal. In some invertebrates, including honeybees, a systemic interference defective (SID) gene encoding a transmembrane protein important to the systemic RNAi pathway has been identified. Apparently, these SID1-like proteins channel dsRNAs between cells, enabling a mechanism of systemic spread of the silencing signal. However, an invertebrate RdRP homologue has not yet been described. Recently, gene silencing by feeding viral dsRNA has been demonstrated effective in combating IAPV infection in honeybees (PCT IL2008/001440).
Microsporidia have been classified as Fungi, which have shown an evolutionarily diverse repertoire of silencing proteins. Some of these are distinct from vertebrate silencing homologues. In Trypanosoma brucei a DICER-like homologue was identified. RISC homologues have also been described, and RNAi-related transcripts have been identified in simple, parasitic eukaryotes such as Giardia and Trichomonas. However, the function of such enzymes and their products is unclear. Further, although DICER and RISC enzymes have been detected in some species of Trypanosomes, other Trypanosomes have been identified as RNAi-negative, consistent with the observation that many eukaryotic parasites are genetically heterogeneous where RNAi pathways are concerned (Ullu et al, 2004).
RNAi gene silencing in intracellular eukaryotic parasites has been demonstrated either for host proteins suspected of critical roles in the parasites life cycle (as in T. cruzi), or in free-living forms, such as the extra-cellular forms of Plasmodium and T. brucei that can be cultured in-vitro. As opposed to the numerous studies with viral parasites, to date, no endogenous gene silencing in intracellular forms of eukaryotic parasites has been demonstrated. In addition to the requirement of traversing at least one parasite membrane of undefined permeability and composition, additional obstacles to effective RNAi methodology for intracellular forms of eukaryotic parasites include the heterogeneity of RNAi pathways in lower, parasitic eukaryotes, poor understanding of the function of such pathways, and the limited knowledge of parasite metabolism, and therefore difficulty in selecting effective targets for silencing the parasite genes.
There is thus a need and it would be highly desirable to have methods for effective, gene silencing in Nosema, in order to prevent and treat Nosema infection in honeybees.
According to an aspect of some embodiments of the present invention there is provided an isolated nucleic acid agent comprising a nucleic acid sequence downregulating expression of a gene product of a Nosema parasite.
According to another aspect of some embodiments of the present invention there is provided a nucleic acid construct comprising an isolated nucleic acid agent comprising a nucleic acid sequence downregulating expression of a gene product of a Nosema parasite.
According to yet another aspect of some embodiments of the present invention there is provided a bee-ingestible composition comprising an isolated nucleic acid agent comprising a nucleic acid sequence downregulating expression of a gene product of a Nosema parasite.
According to some embodiments of the invention the bee-ingestible composition is in solid form.
According to some embodiments of the invention the bee-ingestible composition is in liquid form.
According to some embodiments of the invention the bee-ingestible composition comprises protein.
According to some embodiments of the invention the protein is in the form of pollen and/or soy patties.
According to some embodiments of the invention the liquid is a sucrose solution or a corn syrup solution.
According to some embodiments of the invention the liquid further comprises a carbohydrate or sugar supplement.
According to still another aspect of some embodiments of the present invention there is provided a method for reducing the susceptibility of a bee to a Nosema infection comprising feeding the bee an effective amount of an isolated nucleic acid agent comprising a nucleic acid sequence downregulating expression of a gene product of a Nosema parasite, thereby reducing the susceptibility of the bee to the Nosema infection.
According to an aspect of some embodiments of the present invention there is provided a method for reducing the susceptibility of a bee to a Nosema infection comprising feeding the bee an effective amount of the nucleic acid agent comprising nucleic acid sequences downregulating the expression of at least one Nosema ATP/ADP transporter protein or homologue thereof and least one Nosema mitosomal protein, thereby reducing the susceptibility of said bee to the Nosema infection.
According to another aspect of some embodiments of the present invention there is provided a method of reducing the susceptibility of honeybees to Nosema infection, the method comprising feeding to the honeybee hive an effective amount of double stranded ribonucleic nucleic acid (dsRNA), said double stranded RNA comprising at least one sequence complementary to at least 21 nucleotides of a Nosema-specific mRNA and capable of inducing degradation of the Nosema-specific mRNA.
According to some embodiments of the invention the gene product is an mRNA encoding a Nosema polypeptide.
According to some embodiments of the invention the agent is selected from the group consisting of a dsRNA, an antisense RNA and a ribozyme.
According to some embodiments of the invention the dsRNA is selected from the group consisting of siRNA, shRNA and miRNA.
According to some embodiments of the invention the nucleic acid sequence is greater than 15 base pairs in length.
According to some embodiments of the invention the nucleic acid sequence is 19 to 25 base pairs in length.
According to some embodiments of the invention the nucleic acid sequence is greater than 30 base pairs in length.
According to some embodiments of the invention the Nosema parasite is N. ceranae or N. apis.
According to some embodiments of the invention the Nosema parasite is N. ceranae and the gene product is an mRNA encoding a Nosema mitosomal protein.
According to some embodiments of the invention the Nosema mitosomal protein is selected from the group consisting of TOM70, T1M22, TOM40, Imp2, mitochondrial Hsp70, ATM1-ABC transporter proteins, Frataxin, Ferredoxin, ERV1, ferredoxin, NADPH oxido-reductase [FNR], pyruvate dehydrogenase α subunit, pyruvate dehydrogenase β subunit, mitochondrial glycerol-3-phosphate dehydrogenase (mtG3PDH), manganese-containing superoxide dismutase (MnSOD), DNAJ (Hsp70 interacting), Iron Sulfur cluster ISU1, Cystein desulfurase Nsf1, NAR1 and RLI1.
According to some embodiments of the invention the nucleic acid sequence is complementary to a sequence as set forth in any of SEQ ID NOs: 55-252698.
According to some embodiments of the invention the Nosema parasite is N. ceranae and the gene product is an mRNA encoding a Nosema ATP/ADP transporter protein or homologue thereof.
According to some embodiments of the invention the ATP/ADP transporter protein or homologue thereof is selected from the group consisting of proteins encoded by SEQ ID NOs: 44, 45, 46 and 47.
According to some embodiments of the invention the isolated nucleic acid agent comprises at least two nucleic acid sequences downregulating expression of a gene product of a Nosema parasite. The at least two nucleic acid sequences can be contiguous or non-contiguous with respect to one another.
According to some embodiments of the invention nucleic acid sequences downregulate the expression of at least two Nosema mitosomal proteins. According to some embodiments of the invention the nucleic acid sequences downregulate the expression of at least one Nosema ATP/ADP transporter protein or homologue thereof and least one Nosema mitosomal protein.
According to some embodiments of the invention the nucleic acid sequences comprise at least one nucleic acid sequence complementary to the sequence as set forth in SEQ ID NO: 59 and at least one nucleic acid sequence complementary to a sequence as set forth in SEQ ID NOs: 57 and 58.
According to some embodiments of the invention the nucleic acid sequences comprise a plurality of sequences having at least one nucleic acid sequence complementary to a sequence as set forth in each of SEQ ID NO: 59, 55, 56, 57 and 58.
According to some embodiments of the invention the bee is a honeybee, a forager, or a hive bee.
According to some embodiments of the invention the Nosema infection is a Nosema ceranae or a Nosema apis infection.
According to some embodiments of the invention the infection is a Nosema ceranae infection and feeding the effective amount of the nucleic acid agent reduces mortality from the infection.
According to some embodiments of the invention the nucleic acid agent comprises a nucleic acid sequence selected complementary to any of the sequences as set forth in the group consisting of SEQ ID NOs: 55-252698.
According to some embodiments of the invention the nucleic acid agent comprises a plurality of nucleic acid sequences complementary to any of the sequences as set forth in each of the group consisting of SEQ ID NOs: 57, 58 and 59.
According to some embodiments of the invention the feeding comprises providing a liquid bee-ingestible composition.
According to some embodiments of the invention the feeding comprises providing a solid bee-ingestible composition.
Unless otherwise defined, all technical and/or scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention pertains. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of embodiments of the invention, exemplary methods and/or materials are described below. In case of conflict, the patent specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and are not intended to be necessarily limiting.
The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
Some embodiments of the invention are herein described, by way of example only, with reference to the accompanying drawings and images. With specific reference now to the drawings and images in detail, it is stressed that the particulars shown are by way of example and for purposes of illustrative discussion of embodiments of the invention. In this regard, the description taken with the drawings and images makes apparent to those skilled in the art how embodiments of the invention may be practiced.
In the drawings:
The present invention, in some embodiments thereof, relates to methods and compositions for reducing the susceptibility of bees to Nosema infection and/or reducing the severity of Nosema infections by feeding Nosema-specific dsRNA.
Before explaining at least one embodiment of the invention in detail, it is to be understood that the invention is not necessarily limited in its application to the details set forth in the following description or exemplified by the Examples. The invention is capable of other embodiments or of being practiced or carried out in various ways.
While reducing the present invention to practice, the inventors have shown that ingestion by a bee of compositions containing one or more dsRNA molecules, wherein at least one segment of the dsRNA molecule corresponds to a substantially identical segment of Nosema mitosomal protein RNA and/or one or more non-mitosomal ATP/ADP transporter homologues, will result in reduced incidence and severity of a Nosema infection, and greatly enhanced survival of the bees and the colony overall. These results indicate that a polynucleotide molecule, either DNA or RNA, derived from a Nosema mitosomal protein and/or at least one additional non-mitosomal ATP/ADP transporter protein homologue sequence can be used to design a nucleic acid agent or nucleic acid construct according to the methods of the present invention to produce one or more RNA sequences that can form into a dsRNA molecule available for ingestion by bees when provided by feeding. While reducing to practice, it was shown that bee colonies exposed to Nosema mitosomal protein-specific dsRNA in their feed endured Nosema infection with greater survival (see
Thus, according to one embodiment of the present invention there is provided a method for reducing the susceptibility of a bee to a Nosema infection comprising feeding the bee an effective amount of an isolated nucleic acid agent comprising a nucleic acid sequence downregulating expression of a Nosema gene product, or a nucleic acid construct comprising the nucleic acid sequence, thereby reducing the susceptibility of the bee to the Nosema infection.
As used herein, the term “bee” is defined as any of several winged, hairy-bodied, usually stinging insects of the superfamily Apoidea in the order Hymenoptera, including both solitary and social species and characterized by sucking and chewing mouthparts for gathering nectar and pollen. Exemplary bee species include, but are not limited to Apis, Bombus, Trigona, Osmia and the like. In one embodiment, bees include, but are not limited to bumblebees (Bombus terrestris) and honeybees (Apis mellifera). U.S. Pat. No. As used herein, the term “colony” is defined as a population of dozens to typically several tens of thousand honeybees that cooperate in nest building, food collection, and brood rearing. A colony normally has a single queen, the remainder of the bees being either “workers” (females) or “drones” (males). The social structure of the colony is maintained by the queen and workers and depends on an effective system of communication. Division of labor within the worker caste primarily depends on the age of the bee but varies with the needs of the colony. Reproduction and colony strength depend on the queen, the quantity of food stores, and the size of the worker force. Honeybees can also be subdivided into the categories of “hive bees”, usually for the first part of a workers lifetime, during which the “hive bee” performs tasks within the hive, and “forager bee”, during the latter part of the bee's lifetime, during which the “forager” locates and collects pollen and nectar from outside the hive, and brings the nectar or pollen into the hive for consumption and storage.
As used herein, the term “tolerance” is defined as the ability of a bee or bee colony to resist and/or endure infestation by and/or proliferation of a Nosema pathogen, including, but not limited to, degree of infection, severity of symptoms, infectivity to other individuals (contagion), and the like. Tolerance can be assessed, for example, by monitoring bee longetivity/life-span, infectivity, presence of symptoms, such as, but not limited to, hunger, vitality, flight range, etc, presence of pathogenic organisms, or time course of a disease in a population following a challenge with the Nosema pathogen.
As used herein, the term “susceptibility” is defined as the ability of a bee or bee colony to become infested or infected by and/or support proliferation of a Nosema pathogen, including, but not limited to, degree of infection, severity of symptoms, infectivity to other individuals (contagion), and the like. Susceptibility can be assessed, for example, by monitoring infectivity, presence of symptoms, such as, but not limited to, hunger, vitality, flight range, etc, presence of pathogenic organisms, mortality or time course of a disease in an individual bee or bee population following a challenge with the Nosema pathogen.
As used herein, the term “Nosema” is defined as any organism of a genus (the type of the family Nosematidae) of microsporidian protozoans that includes various parasites, particularly those causing disease in bees or bee colonies. Nosema infecting bee include but are not limited to N. ceranae and N. apis. Infection of bees or bee colonies with a Nosema parasite is commonly known as Nosemosis. It will be appreciated that the gene silencing mechanisms described herein can be effective for combating microsporidean species infecting hosts other than bees, with examples including but not limited to, the silk moth, and humans. However, due to the heterogeneity of RNAi and metabolic pathways in microsporidia, and in view of the critical role of the individual parasite's endogenous RNAi pathways for effective gene silencing, identification of effective candidate target genes may be required in each case.
As used herein, the term “mitosome” is defined as a double membrane-bound mitochondria-like organelle of Microsporidia highly reduced from the perspective of both physical size and biochemical complexity. Mitosomal proteins include, but are not limited to protein and metabolite import proteins (TOM70, T1M22, TOM40, Imp2, mitochondrial Hsp70, and ATM1-ABC transporter proteins), proteins involved in ISC assembly and export (frataxin, ferredoxin, ISCU, ISCS, ERV1, and ferredoxin NADPH oxido-reductase [FNR]), pyruvate dehydrogenase subunits, PDHa and −β, mitochondrial glycerol-3-phosphate dehydrogenase (mtG3PDH) and manganese-containing superoxide dismutase (MnSOD).
As used herein, the term “ATP/ADP transporter protein” refers to a protein which function is transfer of ATP and/or ADP through membranes. Microsporidian ATP/ADP transporter proteins homologous to ATP/ADP transporter proteins from other species have been identified in E. cuniculi and N. ceranae(see above, and
As used herein, the terms “bee disease” or “bee colony disease” are defined as undesirable changes in the behavior, physiology, morphology, reproductive fitness, economic value, viability, honey production, pollination capability, resistance to infection and/or infestation of a bee, a population of bees and/or a bee colony, directly or indirectly resulting from contact with a Nosema parasite or a Nosema-infected bee or other organism.
A draft of the genome of N. ceranae has been provided in Cornman et al. 2009 Plos Pathogen.
While reducing the present invention to practice, the inventors have shown that providing Nosema mitosomal-specific dsRNA, alone or in combination with dsRNA specific to additional non-mitosomal Nosema ATP/ADP transporter protein homologues in the feed of bees exposed to Nosema dramatically reduced the incidence and levels of Nosema sequences detected in the bees (see
As used herein, the term “downregulating expression” is defined as causing, directly or indirectly, reduction in the transcription of a desired gene, reduction in the amount, stability or translatability of transcription products (e.g. RNA) of said gene, reduction in translation of the polypeptide(s) encoded by the desired gene and/or reduction in the amount, stability, or alteration of biochemical function of the polypeptides encoded by the desired gene, so as to reduce the amount or function of the gene products. As used herein, “downregulating expression” also relates to reduction in amount, stability or translatability of Nosema mitosomal or non-mitosomal RNA molecules in cells of a bee. Downregulating expression of a Nosema gene RNA can be monitored, for example, by direct detection of gene transcripts (for example, by PCR), by detection of polypeptide(s) encoded by the gene or bee Nosema RNA (for example, by Western blot or immunoprecipitation), by detection of biological activity of polypeptides encode by the gene (for example, catalytic activity, ligand binding, and the like), or by monitoring changes in a cell or organism resulting from reduction in expression of a desired Nosema gene or Nosema RNA (for example, reduced proliferation of a Nosema parasite, reduced virulence of a Nosema parasite, etc). It will be appreciated that changes in the course, severity, duration, etc. of a Nosema infection can be monitored in some instances via observation of the host, and/or host colony as well as direct observation of the parasite. This direct observation can be useful in instances where nosema virulence in relation to honeybee genotype is high. As used herein, the downregulation can be transient, for example, for the duration of the presence of a downregulating agent, or permanent, resulting in reduction of Nosema gene expression or RNA for the lifetime of the organism and/or its future generations.
Downregulation of Nosema mitosomal or non-mitosomal polypetides can be effected on the genomic and/or the transcript level using a variety of molecules which interfere with transcription and/or translation (e.g., RNA silencing agents, Ribozyme, DNAzyme and antisense). Treatment and prevention of viral infections with dsRNA has been disclosed by WO/2003/004649 to Tenllado et al and PCT patent application IL2008/001440 to Paldi et al. Use of dsRNA in insects is disclosed in US Patent Application 2007 0250947, US Patent Application 2006 0272049, PCT Applications WO 2007/080127 and WO 2007/080126, US patent application 20030150017, PCT patent application WO 02/14472, US Patent Application 20030154508, PCT patent application WO 2004/005485, PCT application WO 99/32619 and U.S. Pat. No. 6,326,193.
Following is a list of agents capable of downregulating expression level and/or activity of Nosema mitosomal polypeptides.
Downregulation of Nosema mitosomal and non-mitosomal polypeptides can be achieved by RNA silencing. As used herein, the phrase “RNA silencing” refers to a group of regulatory mechanisms [e.g. RNA interference (RNAi), transcriptional gene silencing (TGS), post-transcriptional gene silencing (PTGS), quelling, co-suppression, and translational repression] mediated by RNA molecules which result in the inhibition or “silencing” of the expression of a corresponding protein-coding gene or Nosema mitosomal RNA sequence. RNA silencing has been observed in many types of organisms, including plants, animals, and fungi.
As used herein, the term “RNA silencing agent” refers to an RNA which is capable of inhibiting or “silencing” the expression of a target gene. In certain embodiments, the RNA silencing agent is capable of preventing complete processing (e.g, the full translation and/or expression) of an mRNA molecule through a post-transcriptional silencing mechanism. RNA silencing agents include noncoding RNA molecules, for example RNA duplexes comprising paired strands, as well as precursor RNAs from which such small non-coding RNAs can be generated. Exemplary RNA silencing agents include dsRNAs such as siRNAs, miRNAs and shRNAs. In one embodiment, the RNA silencing agent is capable of inducing RNA interference. In another embodiment, the RNA silencing agent is capable of mediating translational repression.
RNA interference commonly refers to the process of sequence-specific post-transcriptional gene silencing in animals mediated by short interfering RNAs (siRNAs). The corresponding process in plants is commonly referred to as post-transcriptional gene silencing or RNA silencing and is also referred to as quelling in fungi. The process of post-transcriptional gene silencing is thought to be an evolutionarily-conserved cellular defense mechanism used to prevent the expression of foreign genes and is commonly shared by diverse flora and phyla. Such protection from foreign gene expression may have evolved in response to the production of double-stranded RNAs (dsRNAs) derived from viral infection or from the random integration of transposon elements into a host genome via a cellular response that specifically destroys homologous single-stranded RNA or viral genomic RNA.
The presence of long dsRNAs in cells stimulates the activity of a ribonuclease III enzyme referred to as dicer. Dicer is involved in the processing of the dsRNA into short pieces of dsRNA known as short interfering RNAs (siRNAs). Short interfering RNAs derived from dicer activity are typically about 21 to about 23 nucleotides in length and comprise about 19 base pair duplexes. The RNAi response also features an endonuclease complex, commonly referred to as an RNA-induced silencing complex (RISC), which mediates cleavage of single-stranded RNA having sequence complementary to the antisense strand of the siRNA duplex. Cleavage of the target RNA takes place in the middle of the region complementary to the antisense strand of the siRNA duplex.
Accordingly, the present invention contemplates use of dsRNA to downregulate protein expression from mRNA.
According to one embodiment, the dsRNA is greater than 30 bp. The use of long dsRNAs can provide numerous advantages in that the cell can select the optimal silencing sequence alleviating the need to test numerous siRNAs; long dsRNAs will allow for silencing libraries to have less complexity than would be necessary for siRNAs.
In one embodiment of the present invention, the dsRNA is greater than 30 base-pairs, and is selected from the group complementary to a sequence as set forth in SEQ ID NOs: 55-59. In another embodiment of the present invention, the dsRNA is greater than 30 base pairs and comprises at least two sequences complementary to a sequence selected from group as set forth in SEQ ID NOs: 55-59. In yet another embodiment, the dsRNA comprises the sequence complementary to the sequence as set forth in SEQ ID NO: 59 and to a sequence as set forth in at least one of SEQ ID NOs: 57 and 58. In one embodiment of the present invention, the dsRNA comprises at least two sequences downregulating expression of a target Nosema gene, wherein the at least two sequences can be contiguous, or non-contiguous with respect to one another.
Another method of downregulating Nosema mitosomal and/or non-mitosomal proteins is by introduction of small inhibitory RNAs (siRNAs).
The term “siRNA” refers to small inhibitory RNA duplexes (generally between 18-30 basepairs, between 19 and 25 basepairs) that induce the RNA interference (RNAi) pathway. Typically, siRNAs are chemically synthesized as 21mers with a central 19 bp duplex region and symmetric 2-base 3′-overhangs on the termini, although it has been recently described that chemically synthesized RNA duplexes of 25-30 base length can have as much as a 100-fold increase in potency compared with 21mers at the same location. The observed increased potency obtained using longer RNAs in triggering RNAi is theorized to result from providing Dicer with a substrate (27mer) instead of a product (21mer) and that this improves the rate or efficiency of entry of the siRNA duplex into RISC.
It has been found that position of the 3′-overhang influences potency of an siRNA and asymmetric duplexes having a 3′-overhang on the antisense strand are generally more potent than those with the 3′-overhang on the sense strand (Rose et al., 2005). This can be attributed to asymmetrical strand loading into RISC, as the opposite efficacy patterns are observed when targeting the antisense transcript.
The strands of a double-stranded interfering RNA (e.g., an siRNA) may be connected to form a hairpin or stem-loop structure (e.g., an shRNA). Thus, as mentioned the RNA silencing agent of the present invention may also be a short hairpin RNA (shRNA).
The term “shRNA”, as used herein, refers to an RNA agent having a stem-loop structure, comprising a first and second region of complementary sequence, the degree of complementarity and orientation of the regions being sufficient such that base pairing occurs between the regions, the first and second regions being joined by a loop region, the loop resulting from a lack of base pairing between nucleotides (or nucleotide analogs) within the loop region. The number of nucleotides in the loop is a number between and including 3 to 23, or 5 to 15, or 7 to 13, or 4 to 9, or 9 to 11. Some of the nucleotides in the loop can be involved in base-pair interactions with other nucleotides in the loop. Examples of oligonucleotide sequences that can be used to form the loop include 5′-UUCAAGAGA-3′ (Brummelkamp, T. R. et al. (2002) Science 296: 550) and 5′-UUUGUGUAG-3′ (Castanotto, D. et al. (2002) RNA 8:1454). It will be recognized by one of skill in the art that the resulting single chain oligonucleotide forms a stem-loop or hairpin structure comprising a double-stranded region capable of interacting with the RNAi machinery.
According to another embodiment the RNA silencing agent may be a miRNA. miRNAs are small RNAs made from genes encoding primary transcripts of various sizes. They have been identified in both animals and plants. The primary transcript (termed the “pri-miRNA”) is processed through various nucleolytic steps to a shorter precursor miRNA, or “pre-miRNA.” The pre-miRNA is present in a folded form so that the final (mature) miRNA is present in a duplex, the two strands being referred to as the miRNA (the strand that will eventually basepair with the target) The pre-miRNA is a substrate for a form of dicer that removes the miRNA duplex from the precursor, after which, similarly to siRNAs, the duplex can be taken into the RISC complex. It has been demonstrated that miRNAs can be transgenically expressed and be effective through expression of a precursor form, rather than the entire primary form (Parizotto et al. (2004) Genes & Development 18:2237-2242 and Guo et al. (2005) Plant Cell 17:1376-1386).
Unlike, siRNAs, miRNAs bind to transcript sequences with only partial complementarity (Zeng et al., 2002, Molec. Cell 9:1327-1333) and repress translation without affecting steady-state RNA levels (Lee et al., 1993, Cell 75:843-854; Wightman et al., 1993, Cell 75:855-862). Both miRNAs and siRNAs are processed by Dicer and associate with components of the RNA-induced silencing complex (Hutvagner et al., 2001, Science 293:834-838; Grishok et al., 2001, Cell 106: 23-34; Ketting et al., 2001, Genes Dev. 15:2654-2659; Williams et al., 2002, Proc. Natl. Acad. Sci. USA 99:6889-6894; Hammond et al., 2001, Science 293:1146-1150; Mourlatos et al., 2002, Genes Dev. 16:720-728). A report (Hutvagner et al., 2002, Sciencexpress 297:2056-2060) hypothesizes that gene regulation through the miRNA pathway versus the siRNA pathway is determined solely by the degree of complementarity to the target transcript. It is speculated that siRNAs with only partial identity to the mRNA target will function in translational repression, similar to an miRNA, rather than triggering RNA degradation.
According to one embodiment of the present invention, the nucleic acid agent is capable of causing cleavage and/or degradation of a Nosema mitosomal and/or non-mitosomal target polynucleotide sequence. As used herein, the phrases “target” or “target polynucleotide sequence” refer to any sequence present in a Nosema cell, whether naturally occurring sequence or a heterologous sequence present due to an intracellular or extracellular pathogenic infection or a disease (e.g. Nosemosis), which Nosema mitosomal or non-mitosomal polynucleotide sequence has a function that is desired to be reduced or inhibited. The Nosema target sequence may be a coding sequence, that is, it is translated to express a protein or a functional fragment thereof. Alternatively, the target sequence may be non-coding, but may have a regulatory function, or it may be without any known function. As described herein, one target polynucleotide sequence is a Nosema mitosomal polynucleotide sequence necessary for proteins involved in energy transfer, such as that of Nosema mitosomal ATP transporter homologues or metabolite import proteins, combinations of the same, alone or in combination with polynucleotide sequences targeting Nosema non-mitosomal proteins such as non-mitosomal ATP/ADP transporter homologues. The term “gene” is intended to include any target sequence intended to be “silenced”, whether or not transcribed and/or translated, including regulatory sequences, such as promoters, enhancers and other non-coding sequences.
In one embodiment of the present invention, synthesis of RNA silencing agents suitable for use with the present invention can be effected as follows. First, the Nosema polypeptide mRNA or other target sequence is scanned downstream of the AUG start codon for AA dinucleotide sequences. Occurrence of each AA and the 3′ adjacent 19 nucleotides is recorded as potential siRNA target sites. Preferably, siRNA target sites are selected from the open reading frame, as untranslated regions (UTRs) are richer in regulatory protein binding sites. UTR-binding proteins and/or translation initiation complexes may interfere with binding of the siRNA endonuclease complex [Tuschl ChemBiochem. 2:239-245]. It will be appreciated though, that siRNAs directed at untranslated regions may also be effective, as demonstrated for GAPDH wherein siRNA directed at the 5′ UTR mediated about 90% decrease in cellular GAPDH mRNA and completely abolished protein level (see Ambion technical library 91/912 at the Ambion website).
Second, potential target sites are compared to an appropriate genomic database (e.g., human, mouse, rat, insect, etc.) using any sequence alignment software, such as the BLAST software available from the NCBI server of the NIH. Putative target sites which exhibit significant homology to other coding sequences are filtered out. For example, host (e.g. bee) target sites can be filtered out in this manner.
Qualifying target sequences are selected as template for siRNA synthesis. Preferred sequences are those including low G/C content as these have proven to be more effective in mediating gene silencing as compared to those with G/C content higher than 55%. Several target sites are preferably selected along the length of the target gene or sequence for evaluation. For better evaluation of the selected siRNAs, a negative control is preferably used in conjunction. Negative control siRNA preferably include the same nucleotide composition as the siRNAs but lack significant homology to the genome. Thus, a scrambled nucleotide sequence of the siRNA is preferably used, provided it does not display any significant homology to host gene sequences, or non-relevant Nosema target sequences.
For example, a suitable Nosema siRNA can be an Nosema specific siRNA corresponding to Nosema ceranae sequences SEQ ID NOs: 27, 47 and 46. Additional suitable Nosema siRNAs can be designed according to sequences from any Nosema, for example, including, but not limited to Nosema apis, Nosema bombi, Nosema bombycis, Nosema antheraeae, E. cuniculi and the like. According to one specific embodiment, the Nosema mitosomal target sequences are ADP/ATP transporter homologue 123 and/or the mitosomal metabolite transport protein TOM 70, and any or all of the non-mitosomal ADP/ATP transporter homologues, Nc 006, Nc 014 and Nc 017. Primer sequences for producing nucleic acid agents for silencing these genes are detailed in Table 1.
Nosema-specific dsRNA sequences for silencing
CTAATACGACTCACTATAGGGAGA
CTAATACGACTCACTATAGGGAGAC
CTAATACGACTCACTATAGGGAGA
CTAATACGACTCACTATAGGGAGA
CTAATACGACTCACTATAGGGAGA
CTAATACGACTCACTATAGGGAGA
CTAATACGACTCACTATAGGGAGA
CTAATACGACTCACTATAGGGAGA
CTAATACGACTCACTATAGGGAGACT
CTAATACGACTCACTATAGGGAGAACC
Additional suitable Nosema siRNAs can be designed according to sequences from any Nosema sequence, for example, the sequences detailed herein, including, but not limited to TOM70(for example, SEQ ID NOs:60-11687), TIM22, TOM40(for example, SEQ ID NOs: 11688-19103), Imp2, mitochondrial Hsp70(for example, SEQ ID NOs: 19104-34511), ATM1-ABC transporter proteins (for example, SEQ ID NOs: 34512-80411), Frataxin, Ferredoxin, ERV1(for example, SEQ ID NOs: 80412-84803), ferredoxin, NADPH oxido-reductase [FNR] (for example, SEQ ID NOs:84804-94911, 94912-108140), pyruvate dehydrogenase α subunit (for example, SEQ ID NOs: 108141-116852), pyruvate dehydrogenase 0 subunit (for example, SEQ ID NOs: 116853-125294), mitochondrial glycerol-3-phosphate dehydrogenase (mtG3PDH) (for example, SEQ ID NOs: 125295-140999), manganese-containing superoxide dismutase (MnSOD) (for example, SEQ ID NOs: 141000-146687), DNAJ (Hsp70 interacting) (for example, SEQ ID NOs: 146688-157505), Iron Sulfur cluster ISU1, Cystein desulfurase Nsf1 (for example, SEQ ID NOs: 157506-169079), NAR1 (for example, SEQ ID NOs:169080-178790), RLI1 (for example, SEQ ID NOs:178791-195062), NC006 (for example, SEQ ID NOs: 195063-209633, NC123 (for example, SEQ ID NOs: 209634-224609), NC014 (for example, SEQ ID NOs: 224610-239747) and NC017 (for example, SEQ ID NOs:239748-252698) (see Table 2, below).
Nosema Proteins suitable for targeting with dsRNA
Nosema
Nosema GenBank (DNA)/
It will be appreciated that the dsRNA sequences target RNA transcripts complementary to DNA sequences of the targeted gene which are expressed in the parasite (transcribed into RNA), and that the actual complementation taking place in the RNAi pathways occurs following reduction of the dsRNA to smaller fragments by the RNAi enzymes.
Multiple Nosema sequences can be designed to include sequences suitable for producing siRNAs effective against more than one Nosema species. Such multiple Nosema dsRNA can be of the long or short variety, and may also be combined with sequences corresponding to diverse classes of pathogens (e.g. viral and/or bacterial and/or fungal sequences, etc). Further, multiple sequences can be designed to include two or more dsRNA sequences of the same Nosema parasite.
It will be appreciated that the RNA silencing agent of the present invention need not be limited to those molecules containing only RNA, but further encompasses chemically-modified nucleotides and non-nucleotides.
In some embodiments, the RNA silencing agent provided herein can be functionally associated with a cell-penetrating peptide. As used herein, a “cell-penetrating peptide” is a peptide that comprises a short (about 12-30 residues) amino acid sequence or functional motif that confers the energy-independent (i.e., non-endocytotic) translocation properties associated with transport of the membrane-permeable complex across the plasma and/or nuclear membranes of a cell. The cell-penetrating peptide used in the membrane-permeable complex of the present invention preferably comprises at least one non-functional cysteine residue, which is either free or derivatized to form a disulfide link with a double-stranded ribonucleic acid that has been modified for such linkage. Representative amino acid motifs conferring such properties are listed in U.S. Pat. No. 6,348,185, the contents of which are expressly incorporated herein by reference. The cell-penetrating peptides of the present invention preferably include, but are not limited to, penetratin, transportan, pIs1, TAT (48-60), pVEC, MTS, and MAP.
Another agent capable of downregulating a Nosema polypeptide is a DNAzyme molecule capable of specifically cleaving an mRNA transcript or DNA sequence of the Nosema polypeptide. DNAzymes are single-stranded polynucleotides which are capable of cleaving both single and double stranded target sequences (Breaker, R. R. and Joyce, G. Chemistry and Biology 1995; 2:655; Santoro, S. W. & Joyce, G. F. Proc. Natl, Acad. Sci. USA 1997; 943:4262) A general model (the “10-23” model) for the DNAzyme has been proposed. “10-23” DNAzymes have a catalytic domain of 15 deoxyribonucleotides, flanked by two substrate-recognition domains of seven to nine deoxyribonucleotides each. This type of DNAzyme can effectively cleave its substrate RNA at purine:pyrimidine junctions (Santoro, S. W. & Joyce, G. F. Proc. Natl, Acad. Sci. USA 199; for rev of DNAzymes see Khachigian, L M [Curr Opin Mol Ther 4:119-21 (2002)].
Examples of construction and amplification of synthetic, engineered DNAzymes recognizing single and double-stranded target cleavage sites have been disclosed in U.S. Pat. No. 6,326,174 to Joyce et al.
Downregulation of Nosema polypeptides or cleavage of Nosema RNA can also be effected by using an antisense polynucleotide capable of specifically hybridizing with an mRNA transcript encoding the Nosema polypeptide or a Nosema RNA target sequence.
Design of antisense molecules which can be used to efficiently downregulate a Nosema polypeptide must be effected while considering two aspects important to the antisense approach. The first aspect is delivery of the oligonucleotide into the cytoplasm of the appropriate cells, while the second aspect is design of an oligonucleotide which specifically binds the designated mRNA or RNA target sequence within cells in a way which inhibits translation thereof.
A number of delivery strategies which can be used to efficiently deliver oligonucleotides into a wide variety of cell types have been disclosed [see, for example, Luft J Mol Med 76: 75-6 (1998); Kronenwett et al. Blood 91: 852-62 (1998); Rajur et al. Bioconjug Chem 8: 935-40 (1997); Lavigne et al. Biochem Biophys Res Commun 237: 566-71 (1997) and Aoki et al. (1997) Biochem Biophys Res Commun 231: 540-5 (1997)]. Several approaches for designing and predicting efficiency of specific oligonucleotides using an in vitro system were also published (Matveeva et al., Nature Biotechnology 16: 1374-1375 (1998)].
For example, a suitable antisense oligonucleotide targeted against the Nosema mRNA would be of the sequences complementary to sequences as set forth in SEQ ID NOs: 27, 46 and 47.
Thus, the current consensus is that recent developments in the field of antisense technology which, as described above, have led to the generation of highly accurate antisense design algorithms and a wide variety of oligonucleotide delivery systems, enable an ordinarily skilled artisan to design and implement antisense approaches suitable for downregulating expression of known sequences without having to resort to undue trial and error experimentation.
Another agent capable of downregulating a Nosema polypeptide is a ribozyme molecule capable of specifically cleaving an mRNA transcript encoding a Nosema polypeptide. Ribozymes are being increasingly used for the sequence-specific inhibition of gene expression by the cleavage of mRNAs encoding proteins of interest [Welch et al., Curr Opin Biotechnol. 9:486-96 (1998)]. Ribozymes have been identified in insects (Webb et al, Science 2009; 326:953), and used effectively for gene silencing in insects (Lee et al, FASEB J 2001; 15:2390-400).
An additional method of regulating the expression of a Nosema polypeptide gene in cells is via triplex forming oligonucleotides (TFOs). Recent studies have shown that TFOs can be designed which can recognize and bind to polypurine/polypirimidine regions in double-stranded helical DNA in a sequence-specific manner. These recognition rules are outlined by Maher III, L. J., et al., Science, 1989; 245:725-730; Moser, H. E., et al., Science, 1987; 238:645-630; Beal, P. A., et al, Science, 1992; 251:1360-1363; Cooney, M., et al., Science, 1988; 241:456-459; and Hogan, M. E., et al., EP Publication 375408. Detailed description of the design, synthesis and administration of effective TFOs can be found in U.S. Patent Application Nos. 2003 017068 and 2003 0096980 to Froehler et al, and 2002 0128218 and 2002 0123476 to Emanuele et al, and U.S. Pat. No. 5,721,138 to Lawn.
The RNA, dsRNA, siRNA, or miRNA of the present invention may be produced chemically or enzymatically through manual or automated reactions or in vivo in an organism. RNA may also be produced by partial or total organic synthesis. Any modified ribonucleotide can be introduced by in vitro enzymatic or organic synthesis. The RNA may be synthesized by a cellular RNA polymerase or a bacteriophage RNA polymerase (e.g., T3, T7, SP6). If synthesized chemically or by in vitro enzymatic synthesis, the RNA may be purified prior to feeding or formulated in an acceptable carrier and provided as a liquid, solid or semi-solid to the bees. For example, RNA can be purified from a mixture by extraction with a solvent or resin, precipitation, electrophoresis, chromatography, or a combination thereof. Alternatively, the RNA may be used with no, or a minimum of, purification to avoid losses due to sample processing. The RNA may be dried for storage or dissolved in an aqueous solution. The solution may contain buffers or salts to promote annealing, and/or stabilization of the duplex strands.
It will be appreciated that mechanisms other than dsRNA for targeting the Nosema ATP/ADP transporter homologues, or other mitosomal and non-mitosomal proteins can effectively block gene expression in the parasite, and therefore potentially reduce Nosema levels, severity of symptoms and contagiousness in the host bees. Any molecules capable of traversing the membrane of bee mucosal epithelial cells and able to disrupt Nosema mitosomal (such as a mitosomal ATP/ADP homologue or TOM) or non-mitosomal (such as a non-mitosomal ATP/ADP homologue) expression or activity, could potentially enter the Nosema parasite in the intracellular stage, and reduce infection levels and severity of symptoms in infected host bees. Examples of such drugs are small molecules, peptides, enzymes that interact with the ATP-ADP transporters such as kinase or phosphatase enzymes.
For transcription from a transgene in vivo or from an expression cassette, a regulatory region (e.g., promoter, enhancer, silencer, leader, intron and polyadenylation) may be used to modulate the transcription of the RNA strand (or strands). Therefore, in one embodiment, there is provided a nucleic acid construct comprising the nucleic acid agent. The nucleic acid construct can have polynucleotide sequences constructed to facilitate transcription of the RNA molecules of the present invention are operably linked to one or more promoter sequences functional in a host cell. The polynucleotide sequences may be placed under the control of an endogenous promoter normally present in the host genome. The polynucleotide sequences of the present invention, under the control of an operably linked promoter sequence, may further be flanked by additional sequences that advantageously affect its transcription and/or the stability of a resulting transcript. Such sequences are generally located upstream of the promoter and/or downstream of the 3′ end of the expression construct. The term “operably linked”, as used in reference to a regulatory sequence and a structural nucleotide sequence, means that the regulatory sequence causes regulated expression of the linked structural nucleotide sequence. “Regulatory sequences” or “control elements” refer to nucleotide sequences located upstream, within, or downstream of a structural nucleotide sequence, and which influence the timing and level or amount of transcription, RNA processing or stability, or translation of the associated structural nucleotide sequence. Regulatory sequences may include promoters, translation leader sequences, introns, enhancers, stem-loop structures, repressor binding sequences, termination sequences, pausing sequences, polyadenylation recognition sequences, and the like.
The nucleic acid agent can be delivered to the bees in a great variety of ways. As detailed herein, bee feeding is common practice amongst bee-keepers, for providing both nutritional and other, for example, supplemental needs. Bees typically feed on honey and pollen, but have been known to ingest non-natural feeds as well. Bees can be fed various foodstuffs including, but not limited to Wheast (a dairy yeast grown on cottage cheese), soybean flour, yeast (e.g. brewer's yeast, torula yeast) and yeast products products-fed singly or in combination and soybean flour fed as a dry mix or moist cake inside the hive or as a dry mix in open feeders outside the hive. Also useful is sugar, or a sugar syrup. The addition of 10 to 12 percent pollen to a supplement fed to bees improves palatability. The addition of 25 to 30 percent pollen improves the quality and quantity of essential nutrients that are required by bees for vital activity.
Cane or beet sugar, isomerized corn syrup, and type-50 sugar syrup are satisfactory substitutes for honey in the natural diet of honey bees. The last two can be supplied only as a liquid to bees.
Liquid feed can be supplied to bees inside the hive by, for example, any of the following methods: friction-top pail, combs within the brood chamber, division board feeder, boardman feeder, etc. Dry sugar may be fed by placing a pound or two on the inverted inner cover. A supply of water must be available to bees at all times. In one embodiment, pan or trays in which floating supports-such as wood chips, cork, or plastic sponge—are present are envisaged. Detailed descriptions of supplemental feeds for bees can be found in, for example, USDA publication by Standifer, et al 1977, entitled “Supplemental Feeding of Honey Bee Colonies” (USDA, Agriculture Information Bulletin No. 413).
It will be appreciated that the dosing and treatment regimen of Nosema-specific nucleic acid agent can be optimized by the individual user according to host sub-species, weather conditions, stage in the life cycle of the host and/or parasite, host environmental conditions, etc. For example, the nucleic acid agent can be provided to the bees constantly, throughout the hives' lifetime, or according to a predetermined schedule of feeding.
All the bees in a hive are potentially susceptible to the Nosema infections detailed herein. Thus, according to some embodiments, the bees can be forager bees, hive bees and the like.
Also provided is a method for reducing the susceptibility of a bee to a disease caused by Nosema, the method effected by feeding the bee on an effective amount of a nucleic acid or nucleic acid construct comprising a nucleic acid agent downregulating expression of a Nosema mitosomal and/or non-mitosomal polypeptide and/or causing cleavage and/or degradation of a Nosema mitosomal or non-mitosomal RNA. Methods for reducing the susceptibility of a bee colony or bee-hive to Nosema infection or epidemic by feeding oligonucleotides and/or polynucleotides are envisaged. Thus, in some embodiments, the present invention can be used to benefit any numbers of bees, from a few in the hive, to the entire bee population within a hive and its surrounding area. It will be appreciated, that in addition to feeding of oligonucleotides and/or polynucleotides for reduction of the Nosema infection and infestation, enforcement of proper sanitation (for example, refraining from reuse of infested hives) can augment the effectiveness of treatment and prevention of infections.
It is expected that during the life of a patent maturing from this application many relevant methods for downregulating Nosema proteins will be developed and the scope of the term “downregulating Nosema protein” or “downregulating Nosema polypeptide” is intended to include all such new technologies a priori.
As used herein the term “about” refers to ±10%.
The terms “comprises”, “comprising”, “includes”, “including”, “having” and their conjugates mean “including but not limited to”. This term encompasses the terms “consisting of” and “consisting essentially of”.
The phrase “consisting essentially of” means that the composition or method may include additional ingredients and/or steps, but only if the additional ingredients and/or steps do not materially alter the basic and novel characteristics of the claimed composition or method.
As used herein, the singular form “a”, “an” and “the” include plural references unless the context clearly dictates otherwise. For example, the term “a compound” or “at least one compound” may include a plurality of compounds, including mixtures thereof.
Throughout this application, various embodiments of this invention may be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 3, 4, 5, and 6. This applies regardless of the breadth of the range.
Whenever a numerical range is indicated herein, it is meant to include any cited numeral (fractional or integral) within the indicated range. The phrases “ranging/ranges between” a first indicate number and a second indicate number and “ranging/ranges from” a first indicate number “to” a second indicate number are used herein interchangeably and are meant to include the first and second indicated numbers and all the fractional and integral numerals therebetween.
As used herein the term “method” refers to manners, means, techniques and procedures for accomplishing a given task including, but not limited to, those manners, means, techniques and procedures either known to, or readily developed from known manners, means, techniques and procedures by practitioners of the chemical, pharmacological, biological, biochemical and medical arts.
As used herein, the term “treating” includes abrogating, substantially inhibiting, slowing or reversing the progression of a condition, substantially ameliorating clinical or aesthetical symptoms of a condition or substantially preventing the appearance of clinical or aesthetical symptoms of a condition.
It is appreciated that certain features of the invention, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable subcombination or as suitable in any other described embodiment of the invention. Certain features described in the context of various embodiments are not to be considered essential features of those embodiments, unless the embodiment is inoperative without those elements.
Various embodiments and aspects of the present invention as delineated hereinabove and as claimed in the claims section below find experimental support in the following examples.
Reference is now made to the following examples, which together with the above descriptions illustrate some embodiments of the invention in a non limiting fashion.
Bees were introduced into boxes (30-35 bees to each box) at study day 0, and placed in a room kept at a constant temperature of 25° C., 70% relative humidity and 12 hour light/dark cycle.
Nurse bees were collected from the entrance of a honeybee colony that was previously checked and no N. ceranae detected in the older forager bees. The bees were placed for several minutes in the cold to reduce activity. Subsequently, 30-35 bees were transferred into each box. The bees were observed during the first 2 days to determine stability in the boxes (i.e. no visible changes in the population). At study day 3 daily feeding of the treatment groups was initiated. The indicated amounts of all treatment components were added to the 66% sugar solution. All boxes were then monitored for bees' survival for up to an additional 21 days.
The boxes were then allocated randomly and equally to each treatment group.
Bees in the boxes were fed a sucrose syrup via a capillary tube sealed at its top end, thus avoiding drippage and enabling supply of feed upon demand. One feeding capillary tube was placed in each box.
The feeding capillaries were filled with 1.5 milliliters of 66% sucrose solution (w/v) and placed into the boxes (one in each box). The bees were then left for a 2 day acclimation period. During the acclimation period—any dead bees from the initial collection process were replaced with newly captured bees. At the end of the 2 days, only boxes in which the honeybees consumed the sucrose solution were included in the trial.
Untreated Infected (Control):
Fed 66% w/v sucrose solution then infected with U.S. Nosema Ceranae (>100,000 per bee), on study day 5. The bees were subsequently fed 50 microliter per bee 66% sucrose solution for another 12-14 days.
Treatment Group
(all four ATP/ADP transporter dsRNA sequences): Fed regular 66% w/v sucrose solution then infected with U.S. Nosema Ceranae (>100,000 per bee), either 10 days or 3 days after acclimation. The bees were subsequently fed 50 microliter per bee 66% sucrose solution for another 12-14 days, containing 20 ug/ml of each of 4 Nosema ATP/ADP transporter sequence dsRNA (complementary to sequences as set forth in SEQ ID NOs. 55-58).
Following administration of treatment solutions to bees' boxes at study day 3, each day the bees in each box are visually inspected and the number of dead bees counted in each box.
Bees infected with Nosema show increased hunger level that is typified by increased responsiveness to sugar. Specifically, bees infected with Nosema show a lower threshold level of responsiveness to sugar in a Proboscis Extension Reflex assay.
At the end of the feeding regimen in the boxes or mini-hives, bees were placed for 5 minutes in a freezer, captured individually and individually placed in a glass vial and chilled on ice until immobile. Then they were strapped within a 4.5 cm long plastic drinking straw with a small strip of tape on the thorax. Testing begins 45 minutes after the last bee is strapped to allow the bees to get acclimated and 24 bees are tested at a time. The antennae of a strapped bee was touched with a droplet of sucrose and proboscis extension response [response is full extension of the proboscis—a Proboscis Extension Response (PER)]—is recorded. Each bee is assayed for PER with a concentration series of 0.1%, 0.3%, 1%, 3%, 10%, and 30% sucrose solution by weight. In between every two successive concentrations, the antennae are touched with water to control for possible sensitization from repeated stimulation.
Each day, all the dead bees were removed from each box, pooled according to treatment and total nosema spore counts were performed with 100 microliter water per crushed bee. Nosema counts were performed essentially as described previously by Cantwell et al: Briefly, bee abdomens were ground with a glass pestle, vigorously mixed with 1.5-2.0 ml water, and sampled (10 μl) into a hemacytometer for counting. Total number of Nosema under the microscope were counted for 16 small squares (or one large square). The average Nosema spore count per bee was calculated as follows:
(total number of spores counted)(4,000,000)/number of squares counted=number of spores per bee.
dsRNA Preparation:
Nosema sequences corresponding to mitosomal and non-mitosomal proteins associated with energy metabolism and ATP/ADP transport (SEQ ID NOs: 27, 44, 45, 46 and 47) were cloned into a plasmid between two opposing T7 promoters. Following propagation of plasmid DNA, the viral fragments, including the T7 promoters, were excised, gel-purified, and served as templates for T7-directed in-vitro transcription.
Only live bees were collected, to a 15 ml collection tube. The tubes were frozen immediately in liquid nitrogen and transferred to −70c. Standard curves were generated for each reaction, specific curves for each gene. The standard curves were based on known concentration of plasmids suspensions, cloned with the fragments amplified by each tested gene specific primers. The standard curves allow the calculation of the relative arbitrary number of mRNA copies from each tested gene.
The relative expression levels for each gene were calculated as the number of arbitrary copies of the tested gene in each sample divided by the arbitrary mRNA arbitrary copy number of a Nosema ceranae housekeeping gene (e.g. tubulin or actin). Mean and standard error values were calculated for each sample and sets of repeats, according to the experimental design.
Values of each treatment were featured as the relative expression from the control treatment at study day 0, and are given the 100% expression level. Mean and standard error values were calculated for each sample and sets of repeats, according to the experiment design, and standard statistics analysis. The desired fragments were reverse transcribed and amplified from RNA isolates of Nosema-infected bees. The pLUG plasmids were generated using the pLUG(R)-Multi TA cloning vector kit from iNTRON Biotechnology (Gyeonggi-do, Korea), according to the manufacturer's protocol. The RT amplified fragments were ligated into the plasmids and the ligated plasmids transformed into Top10 E. coli competent cells, using heat shock transformation. The Top10 competent cells were incubated on LB agar plates containing 200 ug/ml Ampicillin and blue/white selection reagent. Colonies that grew and were positive were tested for presence of the insert using PCR amplification with the forward primer from the desired insert and the reverse primer from the pLUG plasmid. Positive colonies were grown in LB medium supplemented with 200 ug\ml ampicillin. The pLUG plasmids were purified from the top10 E. Coli cells, using the IBI High speed plasmid mini kit (IBI Scientific, IOWA, USA), according to the manufacturer's protocol.
Primers
All reactions were carried out according to a thermal protocol consisting of 5 min at 95° C., then 40 cycles of the four-step protocol consisting of 94° C. 20 seconds, 60° C. 30 seconds, 72° C. 1 minute and 78° C. 20 seconds. Fluorescence was monitored repeatedly during the 78° C. step, in order to reduce fluorescence from primer artifacts.
Bees were introduced into minihives (˜300 bees to each hive) at study day 0. Nurse bees were collected from within a honeybee colony that was previously checked and found to have no N. ceranae. The bees were transferred into every mini-hive containing a queen in a cage, approximately 300 bees in each mini-hive, 5 grams protein patty, and 5 grams candy.
The bees were observed during the first 2 days to determine stability in the minihives (i.e. no drastic changes in the population). At study day 3 daily feeding of sucrose syrup were initiated according to the treatment groups.
All mini-hives were monitored until egg laying by the queen is initiated. Only hives that accepted the new queen, take in the syrup treatments and have the queen initiate egg laying are included in the trial.
The mini-hive boxes are placed in a room kept at a constant temperature of 30° C., and in constant darkeness. The sucrose syrup with or without treatment is fed via a petri dish placed at the bottom of the mini-hive.
Following administration of treatment solutions to bees minihives at study day 3, each day the bees in each box were visually inspected to ensure the stability of the system. In all mini-hives, the queens layed eggs as required for inclusion criteria. At day 10, when the bees were infected with Nosema ceranae (approximately 100,000 spores per bee), once daily photographs were taken to record bee survival on both sides of each comb. The number of bees in each mini-hive was calculated by counting the bees on the screen from both sides of the single comb in the mini-hive.
Differential Effect of ATP/ADP Transporter dsRNA Sequences on Gene Real-Time PCR Transcript Levels
Nurse bees were collected from a hive found to be without N. ceranae. Set up as described above.
Five treatment groups were defined, three hives of 30 bees per group-total 90 bees per group. Total of 15 minihives were included. Allocation to treatment groups was assigned arbitrarily on day 0. Daily feeding of 50 micoliters per bee 66% w/v sucrose solution with 1 microgram per bee each dsRNA of ATP/ADP transporters. Infection with Nosema was initiated on day 3. The five treatment groups were:
The plastic boxes were placed in a room kept at a constant temperature of 25° C., 70% RH and 12 hour light/dark cycle. Feeding was as described for the Bee Box protocol above.
Live bees were collected at day 0 and at day 13 after infection. From each box, bees were pooled into groups of 3 bees (3×3 pools per hive, total 9 samples from each treatment), and RNA was extracted separately for each group, as described above.
The N. ceranae genome has been published.
Since Nosema rarely reduces nurse bee lifespan in box experiments due to the feeding of the bees ad-libitum (not shown), indicators for reduced lifespan are best achieved in a hive setting. In our box experiments, no difference was observed in forager lifespan within the time span of the experiment. When bee lifespan was evaluated in the more natural mini-hive setting (
In order to determine the effectiveness of feeding dsRNA in prevention of Nosema, parasite levels in dead bees from Nosema infected samples were determined. In all box and mini-hive experiments from 7 days post infection to 15 days post infection (bees in which no parasites were detected under the microscope were excluded), counting parasite levels clearly showed that the bees fed with dsRNA from the 4 Nosema ceranae ATP/ADP transporter homologues have an over three-fold lower count compared with untreated controls (
In order to determine whether feeding N. ceranae mitosomal and non-mitosomal ATP/ADP-specific dsRNA reduces energetic stress in bees following N. ceranae infection, Proboscis Extension Reflex (PER), an indicator of hunger, was tested in treated and control bees.
Metabolic stress following N. ceranae infection in bees manifests in increased responsiveness to very low concentrations of sucrose, with the PER at low (<1%) sucrose being measurably increased in the infected bees.
Further, when Nosema counts were performed on the treated and control bees participating in the bioassay (PER), no significant difference in the levels of parasite infestation in bees from the different groups was discernible (results not shown). While not wishing to be limited to a single hypothesis, one explanation of this would be that treatment of the bees with the Nosema-specific dsRNA not only acts to eliminate the parasite infestation, but weakens the virulence and/or metabolic load of the parasite infection, enhancing survival among even infected bees. This is further borne out by the observation that in the minihive experiments, untreated controls the bee population was found to decline by more than a third following infection with Nosema, and none of the live bees had apparent Nosema. Without being limited to one explanation, this could be due to a more rapid mortality of infected bees.
In order to determine whether feeding bees dsRNA of Nosema mitosomal and non-mitosomal ATP/ADP transporter homologues results in a specific effect on expression of the targeted genes, and not in a generalized alteration of Nosema metabolism and/or gene expression, transcript levels of specific targeted genes in infected bees were evaluated by Real-Time PCR, and standardized against housekeeping gene expression (Nosema tubulin).
In order to determine the effect of silencing individual Nosema mitosomal and non-mitosomal energy-related homologues with dsRNA on bee resistance to Nosema infection, survival of bees in minihives following feeding with a variety of dsRNAs of Nosema mitosomal and non-mitosomal energy-related homologues was monitored.
Feeding bees a combination of dsRNA of Nosema non-mitosomal ATP/ADP transporter homologues nc014 and nc017, and the mitosomal TOM-70 orthologue was effective in enhancing survival in minihive experiments (
Spore counts from live bees treated with combined dsRNA for Nosema ATP/ADP transporter homologues nc014 and nc017 with dsRNA for Nosema TOM-70 (“TOM 70+NC14+NC17”) (
Resistance of the bees to Nosema infection was also tested by feeding dsRNAs of Nosema mitosomal and non-mitosomal energy-related homologues prior to infection with the parasite, and monitoring survival of the bees in box protocol (continuous feeding) following infection.
Thus, the results brought herein clearly indicate that gene silencing by feeding bees dsRNA of some, but not all Nosema mitosomal and non-mitosomal proteins associated with energy metabolism such as ATP/ADP transporter and TOM-70 homologues, can effectively reduce Nosema infection and virulence, enhancing overall survival, and specifically enhancing survival of Nosema-infected bees.
Although the invention has been described in conjunction with specific embodiments thereof, it is evident that many alternatives, modifications and variations will be apparent to those skilled in the art. Accordingly, it is intended to embrace all such alternatives, modifications and variations that fall within the spirit and broad scope of the appended claims.
All publications, patents and patent applications mentioned in this specification are herein incorporated in their entirety by reference into the specification, to the same extent as if each individual publication, patent or patent application was specifically and individually indicated to be incorporated herein by reference. In addition, citation or identification of any reference in this application shall not be construed as an admission that such reference is available as prior art to the present invention. To the extent that section headings are used, they should not be construed as necessarily limiting.
This application is a continuation of U.S. patent application Ser. No. 13/318,636 filed on Nov. 3, 2011, which is a National Phase of PCT Patent Application No. PCT/IB2010/051980 having International filing date of May 5, 2010, which claims the benefit of priority of U.S. Provisional Patent Application No. 61/213,086 filed on May 5, 2009. The contents of the above applications are all incorporated by reference as if fully set forth herein in their entirety.
Number | Date | Country | |
---|---|---|---|
61213086 | May 2009 | US |
Number | Date | Country | |
---|---|---|---|
Parent | 13318636 | Nov 2011 | US |
Child | 14474205 | US |