Patent Application
20230140346
There is great interest in developing the ability to modify the activity of specific classes of immune cells by targeted expression of exogenous genes introduced into these cells. Different methods are available for introducing DNA encoding desired transgenes into specific cell types, such as CD3+ T-cells, including plasmids and viral vectors, which are often packaged into delivery vehicles such as targeted nanoparticles. However, even if a transgene can be delivered successfully and specifically into the desired cells, there remains a need to present the transgene in a context suitable for sufficient expression to occur in the target cells. To that end, there is a need to develop promoter sequences that can drive required levels of expression of transgenes in specific populations of cells, such as CD3+ cells, so that immunotherapeutic and other treatment paradigms can be carried out successfully.
The present technology provides several promoter sequences suitable to drive expression of a transgene in CD3+ T-cells. The promoter sequences can be used in vectors, such as viral vectors, when placed 5′ to the open reading frame of a transgene intended for expression in CD3+ T-cells. Preferably, the expression supported by the promoters of the present technology is selective for CD3+ T-cells. For example, the promoters preferably support expression of the transgene at a level which is about 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 15-fold, 20-fold, 30-fold, or even 50-fold or 100-fold higher in CD3+ cells, such as CD3+ T-cells than in CD3− cells, such as CD19+, CD3− B-cells.
Promoters of the present technology include nucleic acid sequences, such as DNA or RNA oligonucleotide sequences comprising or consisting of the nucleotide sequence of any of SEQ ID NOS:2-16 or 19-29, or comprising or consisting of a sequence variant thereof having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% identity to any of SEQ ID NOS:2-16 or 19-29.
Other promoters of the present technology can comprise or consist of one or more fragments of any of SEQ ID NOS:2-16 or 19-29, or combinations of such fragments assembled in any order, optionally including linker sequences between the fragments. Such fragments can be any 10 or more, 15 or more, 20 or more, 25 or more, 30 or more, 40 or more, 50 or more, 100 or more, 150 or more, 200 or more, 250 or more, 300 or more, 350 or more, 400 or more, 500 or more, 600 or more, or 700 or more consecutive nucleotides of any of SEQ ID NOS:2-16 or 19-29. Fragments can be taken from the 5′ end or the 3′ end of any of SEQ ID NOS:2-16 or 19-29. Fragments can comprise or consist of the 100, 200, 300, 400, 500, 600, or 700 consecutive nucleotides selected starting at the 3′ end of any of SEQ ID NOS:1-16 and 19-29 and moving towards the 5′ end. Fragments also can comprise or consist of the 500, 1000, or 1500 consecutive nucleotides selected starting at the 3′ end of any of SEQ ID NOS:1-10, 12-16, and 19-29 and moving towards the 5′ end. Fragments also can comprise or consist of any binding site of a transcription factor, such as transcription factors NF-kappaB, AP-1, STAT, GATA-3, and NFAT, as identified in SEQ ID NOS:2-16 and 19-29, which can be combined with or inserted into any of SEQ ID NOS:2-16 or 19-29, or fragments or variants thereof as defined above. Preferably, promoters of the present technology contain at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 18, or 20 transcription factor binding sites selected from binding sites for one or more of NF-kappaB, AP-1, STAT, GATA-3, and NFAT, or variants thereof having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identity to any of the transcription factor binding sites shown in any of SEQ ID NOS:2-16 and 19-29. The transcription factor binding sites can be positioned within the promoter sequence at any desired position in the sequence and in any order. Binding sites for other transcription factors also can be included in promoters of the present technology. Preferred promoter sequences are ICOS (SEQ ID NO:13) and CTLA4 (SEQ ID NO:7). Other preferred promoter sequences are the CD3+ specific promoters LAIR2 (SEQ ID NO:2), TNFS8 (SEQ ID NO:3), TCR (SEQ ID NO:11) and LTK (SEQ ID NO:14); each of these promoters contains fewer than 2 NFκB sites, fewer than 8 NFAT boxes, and fewer than 8 NFκB+AP1 sites.
The technology can be further summarized in the following list of features.
1. A promoter sequence for use in expression of a transgene under control of the promoter sequence in a CD3+ cell, the promoter sequence comprising nucleotides 1501-2000 of any of SEQ ID NOS:2-10 or 12-16, or a variant thereof having at least 90% identity to said sequence.
2. The promoter sequence of feature 1, wherein the promoter sequence comprises nucleotides 1001-2000 of any one of SEQ ID NOS:2-10 or 12-16 or a variant thereof having at least 90% identity to said sequence.
3. The promoter sequence of feature 2, wherein the promoter sequence comprises nucleotides 501-2000 of any one of SEQ ID NOS:2-10 or 12-16 or a variant thereof having at least 90% identity to said sequence.
4. The promoter sequence of feature 3, wherein the promoter sequence comprises the nucleotide sequence of any one of SEQ ID NOS:2-16 or a variant thereof having at least 90% identity to said sequence.
5. The promoter sequence of any of features 1-4, wherein the promoter sequence comprises a binding sequence for one or more transcription factors selected from the group consisting of NF-kappaB, AP-1, STAT, GATA-3, and NFAT.
6. The promoter sequence of any of features 1-5, wherein the promoter is capable of expressing the transgene at a higher level in CD3+ cells compared to CD3− cells.
7. The promoter sequence of feature 6, wherein the ratio of expression in CD3+ cells to CD3-cells is at least 2:1.
8. A promoter sequence for use in expression of a transgene under control of the promoter sequence in a CD3+ cell, the promoter sequence comprising SEQ ID NO: 2, SEQ ID NO:3, SEQ ID NO:7, SEQ ID NO:11, or SEQ ID NO:13.
9. A vector, plasmid, or nucleic acid molecule comprising the promoter sequence of any of features 1-8.
10. The vector of feature 9 which is a viral vector.
11. The viral vector of feature 10 which is a retrovirus, a lentivirus, an adenovirus, an adeno-associated virus, or a herpes simplex virus.
12. The viral vector of any of features 9-11 which is incorporated into a nanoparticle.
13. The viral vector of any of features 9-11 which is not incorporated into a nanoparticle.
14. The viral vector of any of features 9-11 whose envelope lacks a fusion protein.
15. The vector of any of features 9-14, wherein the vector comprises a transgene encoding a product selected from the group consisting of chimeric antigen receptors (CARs), checkpoint inhibitors, cytokines, chemokines, antibodies and antigen binding fragments and variants thereof, enzymes, structural proteins, and reporter genes.
16. The nucleic acid molecule of feature 9 which is an RNA molecule.
17. A cell comprising the vector, plasmid, or nucleic acid molecule of any of features 9-16.
18. The cell of feature 17, wherein the cell comprises a genome-integrated viral vector.
19. The cell of feature 17, wherein the cell comprises an episomal form of the vector.
20. A nanoparticle comprising the vector of any of features 9-15, wherein the nanoparticle is capable of delivery of the vector into a CD3+ cell.
21. The nanoparticle of feature 20, wherein the nanoparticle comprises a targeting moiety that promotes selective entry of the nanoparticle into CD3+ cells.
22. The nanoparticle of feature 20 or 21, wherein the nanoparticle is also capable of delivery of the vector into a CD3− cell.
23. The nanoparticle of any of features 20-22, wherein the nanoparticle comprises a polymer.
24. The nanoparticle of feature 23, wherein the polymer is a poly(beta-amino ester).
25. A method of expressing a transgene in a CD3+ cell, the method comprising the steps of:
(a) providing the vector of any of features 9-15, or the nanoparticle of any of features 20-24, and a CD3+ cell, wherein the vector comprises said transgene;
(b) transducing or transfecting the cell with the vector; and
(c) allowing the transgene to be expressed in the transduced or transfected cell.
26. The method of feature 25, wherein the vector is a lentiviral vector.
27. The method of feature 25, wherein the CD3+ cell is CD4+, CD4−, CD8+, or CD8−.
28. The method of feature 25, wherein step (b) comprises contacting the vector with a mixture of CD3+ and CD3− cells, and wherein the CD3+ cells are selectively transduced.
29. The method of any of features 25-28, wherein step (b) is performed in vitro.
30. The method of any of features 25-28, wherein step (b) is performed in vivo and comprises administration of the vector by intravenous, intratumoral, intramedullary, or intraperitoneal injection.
31. A method of making the vector of any one of features 9-15, the method comprising adding the promoter sequence of any of features 1-8 to a vector for use in transducing a CD3+ cell.
32. The method of feature 31, wherein said promoter sequence does not support expression of the transgene in packaging cells or producer cells used to make the vector.
The present technology provides promoter sequences for use in expressing any desired transgene in CD3+ cells. Each of the promoter sequences can be inserted into a vector for expression of a transgene just upstream of the transgene sequence, in the 5′ untranslated region most proximal to the transgene. The promoters are specific for expression in CD3+ cells, which adds an increased level of safety and specificity when using the transgene for gene transfer or immunotherapy, especially for in vivo therapy in which the vector is introduced into a patient.
One aspect of the present technology is a promoter sequence for use in expression of a transgene in a CD3+ cell. The promoter sequence includes at least nucleotides 1501-2000 of any of SEQ ID NOS:2-10 or 12-16 or a variant thereof. Alternatively, the promoter sequence can include nucleotides 1001-2000 of any one of SEQ ID NOS:2-10 or 12-16, nucleotides 501-2000 of any one of SEQ ID NOS:2-10 or 12-16, or nucleotides 1-2000 of any one of SEQ ID NOS:2-10 or 12-16, or a sequence variant of any of these. Further promoter sequences can be derived from any of SEQ ID NOS:2-16, or a variant thereof, by including one or more blocks of nucleotides starting from the 3′ end of the sequence and extending in a 5′ direction; such blocks of nucleotides can contain 200, 300, 400, 500, 600, 700, or more nucleotides, and extending up to a maximum of the first nucleotide of the sequence at the 5′ end. See, for example, SEQ ID NOS:19-29, described in Example 8. Sequence variants as described above can have at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% identity to the stated sequence or its complement.
Another aspect of a promoter sequence of the present technology is that it can contain a binding sequence for one or more transcription factors selected from the group consisting of NF-kappaB, AP-1, STAT, GATA-3, and NFAT, or another transcription factor. The transcription factor binding sites can occur in any combination, in any position, and in any order within the promoter sequence. An online tool for identifying transcription factor binding sites in promoter sequences or putative promoter sequences is available at http://alggen.lsi.upc.es/cgi-bin/promo_v3/promo/promoinit.cgi?dirDB=TF_8.3.
Yet another aspect of a promoter sequence of the present technology is that it is capable of selectively promoting the in vitro or in vivo expression of a transgene in CD3+ cells compared to CD3− cells. For example, the ratio of expression in CD3+ cells to CD3− cells can be at least 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 15:1, 20:1, or even 50:1 or 100:1, or higher. The promoter sequence can promote the expression of a transgene in CD3+ cells that are either CD4+ or CD4−, in CD3+ cells that are CD8+ or CD8− or in CD3+ cells that are CD4+ CD8+ or CD4− CD8−.
Still another aspect of the technology is a vector containing any of the above-described promoter sequences. The vector can be, for example, a viral vector, such as a lentiviral vector (LV). The vector can also be a “bald” LV, or other viral vector, which lacks a virus fusion protein on the surface of the vector particles, such as described in WO 2019/145796A2, which is incorporated by reference in its entirety herein. Other viral vectors such as retrovirus, adenovirus, adeno-associated virus (AAV), and herpes simplex virus used as gene-delivery vehicles can incorporate the above-described promoter sequences. The vector can be present in a cell, including cells used for immunotherapy or used to produce a recombinant protein. A promoter of the present technology also can be packaged into a plasmid or nucleic acid molecule, such as an RNA molecule, including an mRNA molecule, together with one or more transgenes under its control, for delivery to cells. The vector, plasmid, or nucleic acid molecule can be packaged in a nanoparticle, such as a polymer-containing nanoparticle, including nanoparticles comprising or consisting of polymer-encapsulated vector. Polymers of such nanoparticles can be poly(beta-amino ester)s (PBAEs), including PBAE polymers containing oligopeptide end caps. The vector contains a transgene for expression in a target cell. The transgene can be any gene, including genes intended for immunotherapy involving enhancing the activity of a T-cell or a sub-population of T-cells, including CD4+ cells, CD8+ cells, NK cells, Th cells, or Treg cells.
While the promoters of the present technology can be used to promote the expression of any transgene, the transgene can encode, for example, an anti-checkpoint protein or polypeptide, such as an inhibitor of CTLA-4, PD1, PDL1, LAG-3, TIM 3, B7-H3, ICOS, IDO, 4-1BB, or CD47. The transgene alternatively can encode a chimeric antigen receptor (CAR) having binding specificity for any desired antigen, such as a tumor antigen or an antigen on the surface of a pathogen such as a bacterium, virus, yeast, or parasite. The CAR can be a universal CAR, which binds to an adapter molecule having a domain for CAR binding as well as an antigen binding domain suitable for binding to an antigen such as a tumor antigen or an antigen on the surface of a pathogen such as a bacterium, virus, yeast, or parasite. The transgene can be a protein or a combination of proteins able to elicit an immune response and act as a vaccine. The elicited immune response can be prophylactic or therapeutic, and can stimulate an immune response against bacteria, viruses, other microbial pathogens, or cancer cells, or another undesired cell type found in the body of a subject.
Another aspect of the present technology is a method of expressing a transgene in a CD3+ cell. The method includes the steps of: (a) providing a vector or nanoparticle as described above and a CD3+ cell; (b) transducing the cell, either in vitro or in vivo, with the vector or nanoparticle; and (c) allowing the transgene to be expressed in the transduced cell. The vector or nanoparticles contains the transgene and a promoter as described above in the 5′ untranslated region proximal to the gene.
Even another aspect of the present technology is a method of making the vector described above. The method includes adding any of the above-described promoter sequences to a vector for use in transducing a CD3+ cell.
Different batches of lentiviral vectors (LVs) were prepared and tested in vitro to investigate transgene expression. The LVs were made using the following materials and methods.
Selection of T-Cell Promoters
T lymphocytes represent a diverse population of CD3-positive immune cells, the main types being cytotoxic T-cells (CD8+, Tc cells), helper T-cells (CD4+, Th cells) and regulatory T-cells (Tregs). The hematopoietic lineage expressing the CD3 receptor also includes immature populations at various stages of differentiation (CD4+/CD8−, CD4−/CD8+, CD4+/CD8+) and innate lymphoid cells from which originate natural killer cells (NK cells).
Promoters for specific expression in CD3-positive cells were designed using orthogonal methods. A set of 15 promoters was selected for overexpression in CD3+ cells (SEQ ID NOS:2-16); these promoters are listed in Table 1. Among this group, 3 promoters (SEQ ID NOS:8, 12, and 15) have been described in the literature as partially repressed in Treg and B cells.
Molecular Cloning of T-Cell Promoters
The promoters were ordered as synthetic genes flanked by Mlul and BamHI restriction sites and subcloned into the transfer vector plasmid pARA-CMV-GFP upstream of the open reading frame (ORF) encoding Green Fluorescent Protein (GFP). CMV promoter (SEQ ID NO:1) was chosen as a control as it drives expression of transgenes at a high level in a ubiquitous manner. For SEQ ID NOS:3, 4, and 5, Mlul and BglII sites were chosen as flanking sites due to the presence of BamHI sites within the promoter regions.
The same strategy was followed to subclone the promoters with a T cell specific activity demonstrated in cell assays in a second transfer vector plasmid pARA-hUBC-CAR-CD19 upstream of the ORF encoding a chimeric antigen receptor (CAR) specific for the human CD19 antigen.
Materials
The transfer vector plasmids were pARA-XXX-GFP and pARA-XXX-CAR-CD19. The kanamycin-resistant plasmids coding for the provirus (a non-pathogenic and non-replicative recombinant proviral DNA derived from HIV-1, strain NL4-3), in which expression cassettes encoding GFP or CAR CD19 were cloned. The insert contained the transgene, the promoter for transgene expression and sequences added to increase the transgene expression and to allow the lentiviral vector to transduce all cell types including non-mitotic ones. The promoters were the human T-cell promoters or the CMV promoter devoid of any enhancer sequence. The non-coding sequences and expression signals corresponded to Long Terminal Repeat sequences (LTR) with the whole cis-active elements for the 5′LTR (U3-R-U5) and the deleted one for the 3′LTR, hence lacking the promoter region (ΔU3-R-U5). For the transcription and integration experiments, encapsidation sequences (SD and 5′Gag), the central PolyPurine Tract/Central Termination Site for the nuclear translocation of the vectors, and the BGH polyadenylation site were added.
The packaging plasmid was pARA-Pack. The kanamycin resistant plasmid encoded for the structural lentiviral proteins (GAG, POL, TAT and REV) used in trans for the encapsidation of the lentiviral provirus. The coding sequences corresponded to a polycistronic gene gag-pol-tat-rev, coding for the structural (Matrix MA, Capsid CA and Nucleocapside NC), enzymatic (Protease PR, Integrase IN and Reverse Transcriptase RT) and regulatory (TAT and REV) proteins. The non-coding sequences and expression signals corresponded to a minimal promoter from CMV for transcription initiation, a polyadenylation signal from the insulin gene for transcription termination, and an HIV-1 Rev Responsive Element (RRE) participating for the nuclear export of the packaging RNA.
The envelope plasmid, when used, was pENV1. This kanamycin-resistant plasmid encoded glycoprotein G from the Vesicular Stomatitis Virus (VSV-G) Indiana strain, used for the pseudotyping of some of the lentiviral vectors. The VSV-G genes were codon optimized for expression in human cells, and the gene was cloned into pVAX1 plasmid (Invitrogen). The coding sequences corresponded to codon-optimized VSV-G gene, and the noncoding sequences and expression signals corresponded to a minimal promoter from CMV for transcription initiation, and the BGH polyadenylation site to stabilize the RNA.
Production of VSV-G− (“Bald”) Lentiviral Vector Particles
LV293 cells were seeded at 5×105 cells/mL in 2×3000 mL Erlenmeyer flasks (Corning) in 1000 mL of LV-Max Production Medium (Gibco Invitrogen). The two Erlenmeyers were incubated at 37° C., 65 rpm under humidified 8% CO2. The day after seeding, the transient transfection was performed. PEIPro transfectant reagent (PolyPlus Transfection, Illkirch, France) was mixed with transfer vector plasmids (pARA-CMV-GFP or pARA-XXX-GFP or pARA-XXX-CAR-CD19) and packaging plasmid (pARA-Pack). After incubation at room temperature, the mix PEIPro/Plasmid was added dropwise to the cell line and incubated at 37° C., 65 rpm under humidified 8% CO2. At day 3, the lentivector production was stimulated by sodium butyrate at 5 mM final concentration. The bulk mixture was incubated at 37° C., 65 rpm under humidified 8% CO2 for 24 hours. After clarification by deep filtration at 5 and 0.5 μm (Pall Corporation), the clarified bulk mixture was incubated 1 hour at room temperature for DNase treatment.
Lentivector purification was performed by chromatography on a Q mustang membrane (Pall Corporation) and eluted by NaCl gradient. Tangential flow filtration was performed on a 100 kDa HYDROSORT membrane (Sartorius), which allowed to reduce the volume and to formulate in specific buffer at pH 7, ensuring at least 2 years of stability. After sterile filtration at 0.22 μm (Millipore), the bulk drug product was filled in 2 mL glass vials with aliquots less than 1 ml, then labelled, frozen and stored at <−70° C.
The bald LV number was evaluated by physical titer quantification with two methods: p24 ELISA and qRT-PCR. The p24 ELISA was performed by detection and quantitation of the lentivirus associated HIV-1 p24 core protein only (Cell Biolabs Inc.). A pre-treatment of the samples allows to distinguish the free p24 from destroyed Lentivectors. The qRT-PCR was performed by purification of lentiviral RNA with Nucleospin RNA virus kit (Macherey Nagel) and quantitation with Lenti-X qRT-PCR titration kit (Takara). For each LV batch, physical titer, particle size and size distribution were measured by Nanoparticle Tracking Analyzer and Dynamic Light Scattering (Viewsizer 3000 and NanoPartica SZ-100V2 instruments respectively, Horiba Instruments Inc., USA) Analyses were performed at room temperature after dilution of LV in formulation buffer (10-fold for DLS and 300-fold for NTA) but without filtration not to impact biophysical properties of the samples. The results were determined using the control Horiba softwares of the equipments.
Production of VSV-G+ (“Pseudotyped”) Lentiviral Vector Particles
The same above-described method was used except that PEIPro transfectant reagent (PolyPlus, 115-010) was mixed with transfer vector plasmid (pARA-CMV-GFP or pARA-XXX-GFP or pAra-XXX-CAR-CD19), packaging plasmid (pARA-Pack) and the envelope plasmid (pENV1). Titration for the pseudotyped Lentivectors was performed by quantitative PCR three days post-transduction of HEK293T cells (8×105 cells/well) with clarified bulk obtained during the bioproduction.
As shown in Table 2, production yields were generally as effective as those obtained with the CMV promoter despite the fact that these promoter regions were significantly longer. For all constructs, titers were at least in the 107 TU/mL range and were consistent among different production runs. The lowest titers were obtained with promoters based on SEQ ID 4 and 8. Yields of production are a criteria for the selection of the promoters, as a low yield implies future difficulties for industrialization. In any case, no issue that would impact industrial bioproduction was observed.
In order to investigate the CD3-specific activity of the 15 promoters identified by bioinformatic tools, we used pseudotyped Lentiviral Vectors carrying a green fluorescent protein (GFP) transgene under the control of a given promoter to transduce different human cell types and analyze GFP expression. These studies were performed on CD3-positive Jurkat (Acute T Cell Leukemia Human Cell Line—ATCC TIB-152), CD3-negative Ramos (Burkitt's Lymphoma Human Cell Line—ATCC CRL-1596) and non-lymphocyte HEK293T (Human Embryonic Kidney Cell Line—ATCC CRL-1573).
HEKT293 cells were seeded in 24-well plates at a density of 8×104 cells per well in DMEM medium (Gibco Invitrogen) supplemented with 10% FBS (Gibco Invitrogen), 1 penicillin/streptomycin and incubated for 4 h to adhere. Cells were then transduced by replacing the medium with 300 μL of Lentiviral Vector (at a MOI of 1, 5 or 10) in culture medium or culture medium (NT controls), followed by incubation at 37° C., 5% CO2 for 2 h. After adsorption, 1 mL of complete medium was added to each well. At 72 h post transduction, the cells were trypsinized and resuspended in 200 μL of Cellfix 1×, and the percentage of cells expressing GFP was determined with an Attune N×T flow cytometer (ThermoFisher) using the BL1 channel.
Jurkat and Ramos cells were seeded in 24-well plates at a density of 8×104 cells per well in RPMI-1640 medium (Gibco Invitrogen) supplemented with 10% FBS (Gibco Invitrogen), 1% penicillin/streptomycin. Cells were then transduced by replacing the medium with 300 μL of Lentiviral Vector (at a Multiple of Infection (MOI) of 10, 30 or 50) in culture medium or culture medium alone (NT controls). After 2 h incubation at 37° C., 5% CO2, 500 μL of fresh complete medium was added to each well. The percentage of cells expressing GFP transgene was determined 72 h post-transduction with an Attune N×T flow cytometer using the BL1 channel.
The percentages of viable and GFP-positive cells were determined by gating on debris excluded/viable/single cells. Graphed data represent means of triplicates of a representative experiment.
The results presented in
Promoters TNFS8 (SEQ ID NO: 3), UBASH3 (SEQ ID NO: 4), CTLA4 (SEQ ID NO: 7), ICOS (SEQ ID NO: 13) and LCK (SEQ ID NO: 14) drove the highest GFP expression (above 40% at MOI 10) in CD3-positive Jurkat cells at levels comparable with CMV promoter. However, background GFP expression (5-10% GFP-positive cells) was detected in CD3-negative cells with these promoters. A dose-dependent and strictly restricted to CD3-positive Jurkat cells GFP expression was achieved with promoters LAIR2 (SEQ ID NO: 2), TCR (SEQ ID NO: 11) and ITK (SEQ ID NO: 15). The CD3-specific activity of these last three promoters resulted in weaker GFP expression with maximal values of 45% reached at MOI of 50.
Of note, none of the tested promoters had an impact on viability of transduced cells (data not shown).
Purification of Human PBMCs
Peripheral Blood Mononuclear Cells (PBMCs) were isolated from buffy coats obtained from healthy donors (Etablissement Francais du Sang, Division Rhones-Alpes). After diluting the blood with DPBS, the PBMCs were separated over a FICOLL density gradient (GE Healthcare) and washed twice with DPBS. Then, residual Red Blood Cells were lysed during a 5 min incubation of PBMCs in ACK lysis buffer (Gibco) and an additional DPBS washing. PBMCs were frozen at a density of 20×106 cells/mL in 10% DMSO (Sigma), 90% FBS (Gibco) and stored at −150° C. until use.
Activation and Transduction of PBMCs with VSV-G+ (“Pseudotyped”) Lentiviral Vector
The CD3-specific activity of the six promoters screened in Example 2 was evaluated in human quiescent cells with LV carrying a GFP transgene under the control of a given promoter to transduce previously frozen human PBMCs. Thawed human PBMCs were seeded in 24-well plates at a density of 1×106 cells per well in RPMI medium containing 10% FBS (Gibco) and 1% penicillin/streptomycin (Gibco), activated in presence of CD3-CD28 Dynabeads (Gibco) and incubated for 72 h at 37° C. and 5% CO2. Activated PMBCs were then pooled and transduced with encapsulated pseudotyped LV (at a MOI of 20, 50 or 100) in culture medium or culture medium alone (NT controls) in 24-well plates at a density of 1×105 cells. After 2 h incubation at 37° C., 5% CO2, 500 μL of fresh culture medium (Gibco Invitrogen) was added to each well and incubated for 72h. The percentage of cells expressing GFP was determined 72 h post-transduction with an Attune N×T flow cytometer. The phenotype of transduced cells expressing GFP transgene was determined by flow cytometry staining with antibodies specific for the following cell types following manufacturer's instructions (Biolegend): CD3-AF700, CD14-PE-Cy7, CD16-BV711, CD19-BV605, CD45-BV510, CD56-BV421 and Zombie NIR for live/dead discrimination. After 30 min incubation at 4° C., cells were centrifuged at 500×g for 2 min and fixed with CelIFix solution (BD Biosciences). Fluorescence-positive cells were counted by flow cytometry (AttuneNXT; Invitrogen, Inc.) on BL1 (GFP), RL2 (AF700 dye), RL3 (Zombie NIR), VL1 (BV421 dye), VL2 (BV510 dye), VL3 (BV605 dye), VL4 (BV711 dye) and YL4 (PE-Cy7 dye) channels. Cell phenotypes were defined for CD45+, viable and single cells as follows: T lymphocytes (CD3pos-CD19neg), B lymphocytes (CD3neg-CD19pos), NK cells (CD3neg-CD19neg-CD56pos), monocytes (CD14pos) and granulocytes (SSChigh-CD16pos).
The results presented in
The CD3-specific activity of the promoters screened in Examples 2 and 3 is evaluated in human quiescent cells with PBAE-encapsulated bald LV carrying a GFP transgene under the control of a given promoter to transduce human PBMCs. PBMCs are isolated from buffy coats obtained from healthy donors (Etablissement Francais du Sang, Division Rhones-Alpes) or from blood samples from lymphoma patients as purified and frozen cells available at Lonza and CALYM Network (Centre Hospitalier Lyon-Sud, France) Biobanks.
Purification of Human PBMCs
After diluting the fresh blood with DPBS, the PBMCs are separated over a FICOLL density gradient (GE Healthcare) and washed twice with DPBS. Then, residual red blood cells are lysed during a 5 min incubation of PBMCs in ACK lysis buffer (Gibco) and an additional DPBS washing. PBMCs are frozen at density of 20×106 cells/mL in 10% DMSO (Sigma), 90% FBS (Gibco) and stored at −150° C. until use.
Transduction of PBAE-Encapsulation of VSV-G− (“Bald”) Lentiviral Vector
Because non-dividing cells are generally difficult to transduce with LV (without cytokine and CD3-CD28 activation), oligopeptide-modified poly(beta-amino ester) (OM-PBAE) polymers are used as transfection agents instead. OM-PBAEs have already been described as transfection agents that form polymer-encapsulated vehicles able to deliver genetic material (plasmids or other nucleic acid molecules) to eukaryotic cells (US2016/0145348A1, Mangraviti et al. 2015, Anderson et al. 2004, WO2016/116887). OM-PBAEs have been successfully used to coat transduction-deficient lentiviral vectors and engineer human cells to stably express various transgenes including reporter genes (Green Fluorescent Protein -GFP and mCherry) and CARs (see WO2019/145796). The polymers used in the following encapsulation experiments are poly(beta-amino esters) (PBAEs) conjugated to charged peptides. Polymer PBAE-CR3 refers to PBAE conjugated to the peptide CRRR (SEQ ID NO:17 (same peptide at both ends). PBAE-CH3 polymer refers to PBAE conjugated to the peptide CHHH (SEQ ID NO:18). Mixtures of these OM-PBAEs are tested at a 60/40 molar ratio.
Human PBMCs are seeded in 24-well plates at a density of 1×105 cells per well in RPMI medium containing 10% FBS and 1% penicillin/streptomycin. Cells are then transduced by replacing the medium with 100 to 300 μL of encapsulated pseudotyped LV in culture medium or culture medium alone (NT controls). After 2 h incubation at 37° C., 5% CO2, 600 μL of fresh complete medium are added to each well. The percentage of cells expressing GFP is determined 72 h post-transduction with an Attune N×T flow cytometer using the BL1 channel. The phenotype of transduced cells expressing GFP transgene is determined by flow cytometry staining with antibodies specific for the following cell types following manufacturer's instructions (Biolegend): CD3-AF700, CD14-PE-Cy7, CD16-BV711, CD19-BV605, CD45-BV510, CD56-BV421 and Zombie NIR for live/dead discrimination. After 30 min incubation at 4° C., cells are centrifuged at 500×g for 2 min and fixed with CelIFix solution (BD Biosciences). Fluorescence-positive cells are counted by flow cytometry (AttuneNXT; Invitrogen, Inc.) on BL1 (GFP), RL2 (AF700 dye), RL3 (Zombie NIR), VL1 (BV421 dye), VL2 (BV510 dye), VL3 (BV605 dye), VL4 (BV711 dye) and YL4 (PE-Cy7 dye) channels. Cell phenotypes are defined for CD45+, viable and single cells as follows: T lymphocytes (CD3pos-CD19neg), B lymphocytes (CD3 neg-CD19pos), NK cells (CD3neg-CD19neg-CD56pos), monocytes (CD14pos) and granulocytes (SSChigh-CD16pos).
Finally, this set of experiments is carried out with the promoters that showed the most stringent CD3-specific activity for the expression of intracellular GFP but in the context of transgenes expressed on the surface of lymphocytes, LV without the VSV-G envelope and carrying an anti-CD19 CAR under the control of a given promoter are used to transduce PBMCs from healthy donors and lymphoma patients. The percentage of cells expressing CAR CD19 is determined 72 h post-transduction by flow cytometry with a human CD19 detection reagent (Miltenyi) and an anti-biotin-BB515 antibody (Miltenyi) according to manufacturer instructions using the BL1 channel.
The CD3-specific activity of the 2 best promoters confirmed in Example 4 to trigger the expression of GFP in lymphocytes is evaluated in vivo in immunodeficient NSG mice engrafted with human PBMCs from healthy donors or PBMCs from lymphoma patients. Another mouse model which can be used is NSG mice engrafted with human CD34-positive hematopoeitic stem cells that exhibit multi-lineage engraftment of human immune cell populations. Nanoparticles described in Example 4 consisting in LV carrying a GFP transgene under the control of a given promoter and formulated with and without PBAEs covalently linked with CD3 targeting agents are repeatedly injected intravenously in mice that have previously been injected with PBMCs or CD34-positive hematopoietic stem cells. Control animals are injected with vehicle or transduction-deficient lentiviral vectors lacking the VSV-G envelope and not encapsulated in PBAE polymers.
In vivo biodistribution of expressed GFP transgene is evaluated weekly over 24 to 90 days on whole blood cells by flow cytometry staining with specific antibody panels purchased from Biolegend: general panel (CD3-AF700, CD11b-APC, CD11c-PE, CD14-PE-Cy7, CD16-BV711, CD19-BV605, CD45-BV510, CD56-BV421, CD66b-PerCP-Cy5.5, HLA-DR PE-Dazzle594, and Zombie NIR) and T cell panel (CD3-AF700, CD4-PerCP-Cy5.5, CD8-BV605, CD25-PE, CD45-BV510, CD45RA-BV711, CD69-PE-Dazzle594, CD127-APC, TCRg/d-PE-Cy7, CCR7 (CD197)-BV421 and Zombie NIR).
At sacrifice, the phenotype of GFP-expressing cells is determined on blood cells and cell suspension prepared from collected spleens and bone marrows. Tissue biodistribution of genome-integrated lentiviral vector is analyzed by duplex quantitative PCR on genomic DNA extracted from blood and organs collected at sacrifice. Treatment toxicity is evaluated by determining blood cell counts (flow cytometry as already described in Example 2), ALT/AST hepatic enzymes (enzyme activity kits) and cytokine levels (Th1/Th2 Cytometry Bead Array) in blood samples collected pre-treatment and at weekly post-treatment intervals. Behavior of animals, body weight, water and food consumption are recorded 3 times a week as additional read-outs for treatment safety and tolerance.
Finally, this set of animal experiments is carried out with the promoters selected in Example 4 but in the context of an anti-CD19 CAR transgene expressed on the surface of lymphocytes. The only difference with the above-described animal procedures lies in the evaluation of the phenotype of CD19 CAR-expressing cells that is determined by flow cytometry with the human CD19 detection reagent (Miltenyi) and an anti-biotin-BB515 antibody (Miltenyi) according to manufacturer instructions already described in Example 4.
The CD3-specific activity of the 2 best promoters screened in Example 4 to trigger the expression of CAR CD19 in lymphocytes is evaluated in vivo in immunodeficient NSG mice bearing Ramos cancer cells modified to constitutively express the Luciferase reporter gene. Different NSG mice models are used: NSG mice engrafted with human PBMCs from healthy donors or PBMCs from lymphoma patients and finally NSG mice engrafted with human CD34-positive hematopoeitic stem cells that exhibit multi-lineage engraftment of human immune cell populations.
Nanoparticles described in Example 4 consisting of LV carrying a CAR CD19 transgene under the control of a given promoter and formulated with and without PBAEs covalently linked with CD3 targeting agents are repeatedly injected intravenously in mice that have previously been injected with Ramos-Luc cells. Control animals are injected with vehicle or transduction-deficient LV lacking the VSV-G envelope and not encapsulated in PBAE polymers.
In vivo efficacy is evaluated weekly over 24 to 90 days by whole animal bioluminescence imaging to measure the tumor growth and rate associated with circulating
Ramos-Luc cells and survival in the treated groups versus controls. Treatment toxicity is evaluated by determining blood cell counts (flow cytometry as already described in Example 5), ALT/AST hepatic enzymes (enzyme activity kits) and cytokine levels (Cytometry Bead Array) in blood samples collected pre-treatment and at weekly post-treatment intervals. Behavior of animals, body weight, water and food consumption are recorded 3 times a week as additional read-outs for treatment safety and tolerance.
The promoter sequences described above contain some transcription factor binding sites, including NFκB; AP1, Stats, GATA and NFAT. Table 3 summarizes the presence of those binding sequences inside each promoter sequence. Transcription factor binding sites are depicted in the sequences as well.
EOMES
3
4
13
3
13
BCL11B
3
3
6
2
4
ZAP70
3
5
6
1
7
GIMAP7
2
4
4
5
12
ICR2A
8
1
7
1
5
TIGIT
5
5
6
4
6
TCF7
1
6
6
1
1
To define the significant regions involved in inducible gene expression and increased transgene expression level5,6,7, 5′ deletion constructs were designed by shortening of 2 kb-promoters.
Shortening and Molecular Cloning of Tcell Promoters
Among the set of 15 promoters, CTLA4 (SEQ ID NO: 7) and ICOS (SEQ ID NO: 13) were selected for overexpression in CD3-expressing cell lines and primary cells, and low or no expression in non-CD3-expressing cells. The promoters were shortened from 5′ to 3′ by PCR using the synthetic gene as template and Phusion HF high fidelity DNA polymerase (Thermofisher). Forward primers, containing a Mul restriction site, were specific of 5′ regions of CTLA4 and ICOS and reverse primers, containing a BglII site (for SEQ ID NOS: 24-25) or a BamHI site (for SEQ ID NOS: 19-23, 26-29) were specific to the 3′ end of CTLA4 or ICOS. PCR fragments were then subcloned in the transfer vector plasmid pARA-CMV-GFP upstream of the open reading frame (ORF) encoding GFP and instead of the CMV promoter.
The same strategy was followed to subclone the truncated promoters in a second transfer vector plasmid pARA-hUBC-CAR-CD19 upstream of the ORF encoding a chimeric antigen receptor (CAR) specific for the human CD19 antigen. Sequence identity of truncated promoters and in frame insertion upstream of the transgene were verified by Sanger sequencing. Resulting optimized promoter sequences are described in Table 4.
LV Production and Transduction of Human Cell Lines and Primary Cells
Transfer plasmids encoding GFP and a CD19-targeted CAR were used to produce LV and transduced cell lines and primary cells as described in Examples 3 and 4. GFP or CD19 CAR transgene expression were measured by flow cytometry.
The experiments of Examples 3 and 4 showed that bald LV packaged into nanoparticles, such as by OM-PBAE encapsulation, have the ability to transduce PBMCs, including T lymphocytes, and direct the expression of a transgene. Since the goal of CAR T cell therapy is to introduce a CAR into T cells and express the CAR on the surface of such T cells, the question arises whether the presence of any expressed CAR on the surface of LV intended for use in producing CAR T cells can serve to pseudotype the LV, and possibly direct the LV to transduce cells that were intended for attack by CAR T cells. The experiments described below were designed to address this question.
Production of Lentiviral Vector Particles Coding for CD19 CAR
Production of bald LV particles was performed as described in Example 1. Briefly, LV293 cells were transiently transfected the day after seeding. PEIPro transfectant reagent (PolyPlus Transfection, Illkirch, France) was mixed with the transfer vector plasmid pARA-hUBC-CAR-CD19 and the packaging plasmid pARA-Pack. Bald LV particles encapsulated in OM-PBAEs were prepared as described in Example 3 and used to transduce LV293 cells or human PBMCs.
CD19 CAR Detection
After a DPBS washing step, cells (LV293 transfected and untransfected or LV-transduced PBMCs) were stained with human CD19 detection reagent (Miltenyi) and an anti-biotin-BB515 antibody (Miltenyi) according to manufacturer instructions as already described in Example 4.
The results presented in
In addition, results presented in
Altogether, these results suggest that the use of a ubiquitous promoter to control the expression of CD19 CARs results in the expression of chimeric receptor on the surface of the LV293 cell line that produces LVs (bald or pseudotyped) decorated with membrane proteins. This pseudotyping with CD19 CARs must be sufficient to allow the bald vector to bind to cells and generate an artefactual CD19-CAR signal, because the bald LV are deficient for transduction by nature, even though the CD19-CAR is not an efficient pseudotyping protein, as it does not allow endosomal escape of the LV). This “pseudotyping” may lead to safety issues, as the regular LV (with VSV-G) will directly target CD19+B lymphocytes both in vitro and in vivo. The results obtained here indicate that use of a T-cell specific promoter as described herein will abrogate the expression of CD19 CAR at the surface of LV293, and no pseudotyping of LV will be observed. This will increase the safety margin of LV designed for producing CAR T cells.
Transcription factor binding sites are depicted in each promoter sequence as follows: NFkB (bold), AP-1 (underlined), STATS (italics), GATA-3 (double-underlined) and NFAT 5 (boxed). Of note, some binding sites are overlapping.
CCCAGGTGGGCCGGGCTAGCACTGGGGATGCCCTGGCTCTGTGTCTCGGTTGGGTGGCTGAC
TCCTCCTGGAACGCATCCCTGACATCCTCCAGGCTGGCTTCCCCATACTCTGGGGACACACA
CACCCACCCGAGTATCTGCGGAGATTTGGCCACACCTACTCCTGGGCTGGCAAGTCCAAGTC
CAATTTAGTTCACTCACACAGCACCCCGCCCCCCTTCTCAGGGGGTCCTGCTCCCAGGATGG
TCATACCAGTTTGCTCCTTATGTTTCATTGGCCCTTGCTGCTAAGAGCATCCGCTTGCACCT
GAGCCAAGACTGTGCCATTGTATTCCAGCCTGGGCAACAAGAGAGAAACTCCATCAAATAAA
TGATTATAGGCTTTGAAAAATATAGACCTTATATTTATTATTAGTGGATTTTGCAATATTGA
TATCTAACGCATGTTATGCACAAGCTACCGTGAATTGATAATATCAAAACAAATATCCAGCG
CTCCCCGAAAGCAGTTGTGTTGGCGTGAGTATGAAGTTGGTGTTAGCTCGCTTAGTTTCACT
TACTCAGTTCCAGAGCTAGGCCTCACCTAGGTTGGAAGAAGTCAATTGTTCTCCACTGCCTG
AGTCTGTGTGTGAGTGTGTGGGGGAGTACCTGTGAGGGGTGAGTGTGTGTGTTTATGTGAAA
CACTGCTAAAACAGGCAAATAAACAAAAAAAAAGTTATGGCCAACAGAGTCACTGGAGGGTT
GAGGGGAACAGCGGGGGCTTGATGGTGGACTTCGGGAGCAGAAGCCTCTTTCTCAGCCTCCT
TTATCTAGGTTTGCTGGTAGTGACAGAAACCTCAAAATAACTGAGACTTAGAAAATAGATAT
TAAAAAATGTAATCCAGGGCTGGCATGGAAGATCCATGGTCACCAGGGTCCCAGGCTCTTTC
ATCTGCTTACACTAAAATCTCTTGATTATTAACATAGTAGAGGTAACTGTCACACATTATAC
CCACAAAACGTCAGGACAGAAAGGCAGTCATCTATATGTAGCATTGAGAAATTTCTATGGGC
TAATATCTTTGCTTGCTTTCTAGTATTTAAAAAATTGTGTTTTGCTCTAACTATGCAATGGC
TGACTTCCACAGGCTGAACCACTGGCTTCTGCTCCTCTACATAATACTTCAATTCCAGCATT
TATTACAGGTTCCCCATGAATGTTTCTTTCTTTATTAAAATGTATGAAAACTCTCCAGATTT
ATCATTTGGGTTGGCTTTTCTTTGGACCTTCTTCAACTCTGTTTTGTCTCTGTTGAGTTAAG
GAGAAATAAACTTATTTGTAAAGCTGTCAAGGGACCATTAGAAGGATGGTGCTTCACAGATA
GAATACAGTTTTTATTAATGATGCCTAGACAAATCCTGCCATTAGCCCAAGGGCTCAGAAAG
ATTCCGGGCATATTACAGGTTCCCCATGAATGTTTCTTTCTTTATTAAAATGTATGAAAACT
ATTTGGGTTGGCTTTTCTTTGGACCTTCTTCAACTCTGTTTTGTCTCTGTTGAGTTAAGGCT
AAATAAACTTATTTGTAAAGCTGTCAAGGGACCATTAGAAGGATGGTGCTTCACAGATAGAA
TTGAATCATTTGGGTTGGCTTTTCTTTGGACCTTCTTCAACTCTGTTTTGTCTCTGTTGAGT
TTAGGAGAAATAAACTTATTTGTAAAGCTGTCAAGGGACCATTAGAAGGATGGTGCTTCACA
GATAGAATACAGTTTTTATTAATGATGCCTAGACAAATCCTGCCATTAGCCCAAGGGCTCAG
TCGTAAAACCAAAACAAAAAGGCTTTCTATTCAA
CTTTCCTCATGATGCTACGGGGAGTACAGTGAAAAGGGAGGAGATTGGGGTAGCAAGGTCCC
ATATTATTTCATATAAAACATTTAAGTACATATACATATAATTATCTATGTAATTATTATTG
TCATTTCTCAGATTCCTATGATGCTCTTCTTTCAGATCTTTTCACTTCAATTTCTATAATAA
ATATATTATTTCATATAAAACATTTAAGTACATATACATATAATTATCTATGTAATTATTAT
As used herein, “consisting essentially of” allows the inclusion of materials or steps that do not materially affect the basic and novel characteristics of the claim. Any recitation herein of the term “comprising”, particularly in a description of components of a composition or in a description of elements of a device, can be exchanged with the alternative expressions “consisting essentially of” or “consisting of”.
While the present invention has been described in conjunction with certain preferred embodiments, one of ordinary skill, after reading the foregoing specification, will be able to effect various changes, substitutions of equivalents, and other alterations to the compositions and methods set forth herein.
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/IB2021/000343 | 5/19/2021 | WO |
| Number | Date | Country | |
|---|---|---|---|
| 63026964 | May 2020 | US |
