Recombinant fowlpox virus S-FPV-043 and uses thereof

Abstract

The present invention provides a recombinant fowlpox virus designated S-FPV-043 (ATCC Accession No. VR 2395). A vaccine useful for immunizing an animal against fowlpox virus and Newcastle disease virus is provided which comprises an effective immunizing amount of S-FPV-043 and a suitable carrier. A method of immunizing an animal against fowlpox virus and Newcastle disease virus is also provided which comprises administering to the animal an effective immunizing dose of the vaccine.

Description

FIELD OF THE INVENTION

The present invention relates to a recombinant fowlpox virus useful in a live vaccine to protect fowl against Newcastle disease virus and fowlpox virus.

BACKGROUND OF THE INVENTION

The ability to isolate DNA and clone this isolated DNA into bacterial plasmids has greatly expanded the approaches available to make viral vaccines. The method used to make the present invention involve modifying cloned DNA sequences by insertions, deletions and/or single or multiple base changes. The modified DNA is then inserted into a viral genome, and the resulting virus may then be used in a vaccine to elicit an immune response in a host animal and provide protection to the animal against disease.

Fowlpox virus (FPV) is a member of the poxviridiae family of viruses. There are two subfamilies in this classification, and they are differentiated based upon the host range (vertebrate or invertebrate) of the virus. Among the vertebrate poxviruses, there is serological cross reactivity to group specific antigens that has aided in classification of the viruses into six genera, and FPV has been placed in the avipoxvirus genera along with seven additional poxviruses that primarily infect birds. In general, poxviruses are the largest of the animal viruses and can be visualized with the light microscope. Under the electron microscope, the virus takes on a biscuit like or oval shaped appearance. The principal chemical components of the poxviruses are protein (90% by weight), deoxyribonucleic acid (DNA) (3%) and lipid (5%), but in FPV the lipid component is approximately 1/3 of the dry weight. Polyacrylamide gel electrophoresis (PAGE) of solubilized virions indicates that there are >100 different proteins associated with the viruses that include: structural polypeptides, enzymes associated with translation of messenger ribonucleic acid (mRNA), enzymes involved in RNA synthesis, and enzymes associated with DNA replication. The genome of poxviruses consists of double-stranded DNA that varies in base composition (32% G+C to 64% G+C) and length (140 kilobasepairs [kb] to 280 kb for FPV) depending upon the individual virus. The complete nucleotide sequence of the vaccina virus genome has recently been determined, and most of the essential genes have been found to lie within the highly conserved middle region of the genome while nonessential functions seem to map nearer to the termini of the DNA. The poxviruses are unique in their propensity to replicate within the cytoplasmic space of the infected cell, and in the case of VV, mature virus particles are moved out of the assembly areas and into the periphery of the cell where additional membrane encapsulation occurs. With FPV, the assembled viral particles become associated with a dense viral-derived protein matrix that occludes the virus in the form of cellular inclusions that may help protect the virion from lytic activities. Depending upon the specific poxvirus and strain (from 1% to 30% of different mature VV strains) varying levels of mature virus can be found extracellularly, but the majority of the virus population remains associated with the cell at the end of the growth cycle.

Fowlpox is unique throughout the world, but because its host-range is limited to birds it is not considered to be a public health hazard. All chickens can be infected by the virus with a resulting decline in the growth rate of the bird and temporary decreases in egg production. Usually, transmission of FPV occurs through physical contact of injured skin, but there are reports that the virus is also transmitted via arthropod vectors. After an incubation period of four to ten days, the disease is typically manifested in the following ways: skin lesions in non-feathered areas, lesions of the nasal passages, and lesions of the mouth. A normal FPV infection usually lasts three to four weeks, and afterward the bird is conferred life-long immunity to the disease.

Currently, conventionally derived FPV vaccines are being used in commercial settings to provide protection to chickens and turkeys. Typically, the vaccine viruses are attenuated by serial passage in cell culture selecting for strains that have altered growth and/or virulence properties. The modified live vaccine is prepared by growth in vitro in chicken embryo fibroblast cells or by growth on the chorioallantoic membrane of the chicken embryo. The vaccine virus is typically given to birds subcutaneously.

The present invention concerns the use of FPV as a vector for the delivery of specific vaccine antigens to poultry. The idea of using live viruses as delivery systems for antigens (vectoring) has a long history that is associated with introduction of the first live viral vaccines. The antigens that were delivered were not foreign but were naturally expressed by the live virus in the vaccine. The use of viruses to deliver foreign antigens in the modern sense became possible with the advent of recombinant DNA methods. The vaccinia virus was the first such vector and various antigens from other disease-causing pathogens were used as the foreign antigens in a vaccine was created by genetic engineering. While the concept begins with these disclosures, the answers to more practical questions concerning what makes the best candidate viral vector and what constitutes the best foreign gene or gene to be delivered were not obvious. In answering these questions, details of the pathogenicity, site of replication or growth, the kind of elicited immune response, expression levels for the virus and foreign gene of interest, its suitability for genetic engineering, its probability of being licensed by regulatory agencies, etc. needed to be addressed.

The presently preferred method for creating a recombinant poxvirus uses a plasmid of bacterial origin that contains at least one cassette consisting of a poxvirus promoter followed by the gene of interest. The cassette(s) is flanked by poxvirus genomic DNA sequences that direct insertion of the gene of interest into the corresponding homologous nonessential region of the viral genome by homologous recombination. Cells are initially infected with the wild-type virus, and shortly thereafter the plasmid DNA is introduced into the infected cells. Since poxviruses have their own RNA polymerase and transcriptional apparatus, it is necessary that the gene of interest be regulated by a promoter of poxvirus origin. There are three characteristic poxvirus promoters that are differentiated based upon their temporal regulation of gene expression relative to the infective cycle of the virus: early, intermediate and late expression. Each promoter type can be identified by a typical consensus sequence that is approximately 30 bp in length and specific to each promoter type. In vaccinia virus, some viral genes are regulated by tandem early/late promoters that can be used by the virus to continually express the downstream gene throughout the infective cycle.

It is generally agreed that poxviruses contain non-essential regions of DNA in various parts of the genome, and that modifications of these regions can either attenuate the virus, leading to a non-pathogenic strain from which a vaccine may be derived, or give rise to genomic instabilities that yield mixed populations of virus. The degree of attenuation of the virus is important to the utility of the virus as a vaccine. Insertions or deletions which cause too much attenuation or genetic deletions which cause too much attenuation or genetic instability of the virus will result in a vaccine that fails to elicit an adequate immune response. Although several examples of deletions/insertions are known for poxviruses, the appropriate configuration is not readily apparent.

Thus far, gene expression from foreign genes of interest inserted into the genome of poxviruses has been obtained for five different pox viruses: vaccinia, canary pox, pigeon pox, raccoon pox and fowlpox. Vaccinia virus is the classically studied poxvirus, and it has been used extensively to vector foreign genes of interest (see U.S. Pat. Nos. 4,603,112 (1986) and 4,722,848 (1988). Raccoon pox (Esposito, et al., 1988) and Canary pox (Taylor, et al., 1991) have bene used to express antigens from the rabies virus. More recently, FPV has been used to vector a number of different foreign genes of interest, and is the subject of several published patent applications (EPA 0 284 416 (1988), PCT WO 89/03429 (1989), PCT WO 89/12684 (1989), PCT WO 91/02072 (1991), PCT WO 89/03879 (1989)). However, these publications do not teach the vectored antigen configuration, the FPV insertion sites, or the promoter sequences and arrangement of the present invention.

A foreign gene of interest targeted for insertion into the genome of FPV may be obtained from any pathogenic organism of interest. Typically, the gene of interest will be derived from pathogens that cause diseases in poultry that have an economic impact on the poultry industry. The genes may be derived from organisms for which there are existing vaccines, and because of the novel advantages of the vectoring technology the resulting FPV-derived vaccines will be superior. Also, the genes of interest may be derived from pathogens for which there are currently no vaccines but where there is a requirement for control of a disease. Typically, the gene of interest encodes an immunogenic polypeptide of the pathogen, and may represent surface protein, secreted protein or structural protein.

One relevant avian pathogen that is a target for FPV vectoring in the present invention is Infectious Laryngotracheitis virus (ILT). ILT is a member of the herpesviridiae family, and this pathogen causes an acute disease of chickens which is characterized by respiratory depression, gasping and expectoration of bloody exudate. Viral replication is limited to cells of the respiratory tract, where in the trachea the infection gives rise to tissue erosion and hemorrhage. In chickens, no drug has been effective in reducing the degree of lesion formation or in decreasing clinical signs. Vaccination of birds with various modified forms of the ILT virus derived by cell passage and/or tedious regimes of administration have conferred acceptable protection in susceptible chickens. However because of the degree of attenuation of current ILT vaccines, care must be taken to assure that the correct level of virus is maintained; enough to provide protection, but not enough to cause disease in the flock.

An additional target for the FPV vectoring approach is Newcastle disease, an infectious, highly contagious and debilitating disease that is caused by the Newcastle disease virus (NDV), a single-stranded RNA virus of the paramyxovirus family. The various pathotypes of NDV (velongic, mesogenic, lentogenic) differ with regard to the severity of the disease, as well as the specificity and symptoms, but most types seem to infect the respiratory system and the nervous system. NDV primarily infects chickens, turkeys and other avian species. Historically, vaccination has been used to prevent disease, but because of maternal antibody interference, life-span of the bird and route of administration, the producer needs to adapt immunization protocols to fit specific needs.

Marek's disease of poultry is a lymphoproliferative tumor producing disease of poultry that primarily affects the peripheral nervous system and other visceral tissues and organs. Marek's disease exists in poultry producing countries throughout the world, and is an additional target described by the present invention for a FPV-based vectored vaccine. The causative agent of Marek's disease is a cell associated gammaherpesvirus that has been designated as Marek's disease virus (MDV). Three classes of viruses have been developed as conventional vaccines for protecting chickens against Marek's disease: attenuated serotype 1 MDV, herpesvirus of turkeys (HVT), and naturally avirulent serotype 2 isolates of MDV. Protection obtained with these vaccines is principally directed toward the tumorigenic aspect of the disease. The occurrence of excessive Marek's disease losses in such conventionally vaccinated flocks has led to the requirement for forming admixtures of the various vaccine types. Such polyvalent vaccines while generally ore effective in disease control, complicate the vaccine regime.

SUMMARY OF THE INVENTION

Specifically, the present invention provides a genetically-engineered fowlpox virus designated S-FPV-043 (ATCC Accession No. VR 2395). The present invention also provides a vaccine which comprises an effective immunizing amount of the genetically engineered fowlpox virus designated S-FPV-043 and a suitable carrier. The invention further provides a method of immunizing the animal against disease caused by fowlpox virus and Newcastle disease virus which comprises administering to an animal an effective immunizing dose of the vaccine of the present invention.

BRIEF DESCRIPTION OF THE FIGURES

FIG. 1A, FIG. 1B and FIG. 1C

Detailed description of the SfiI fragment insert in Homology Vector 502-26.22. The diagram shows the orientation of DNA fragments assembled in the cassette. The origin of each fragment is described in the Materials and Methods section. The sequences located at the junctions between each fragment and at the ends of the marker gene are shown, including junction A (SEQ ID NO: 15), junction B (SEQ ID NO: 16), junction C (SEQ ID NO: 17), and junction D (SEQ ID NO: 18). The restriction sites used to generate each fragment are indicated at the appropriate junction. The location of the NDV F and HN genes is shown. Numbers in parenthesis ( ) refer to amino acids, and restriction sites in brackets [ ] indicate the remnants of sites which were destroyed during construction.

DETAILED DESCRIPTION OF THE INVENTION

The present invention provides a genetically-engineered fowlpox virus designated S-FPV-043 (ATCC Accession No. VR 2395). The S-FPV-043 has been deposited pursuant to the Budapest Treaty on the International Deposit of Microorganisms for the Purposes of Patent Procedure with the Patent Culture Depository of the American Type Culture Collection, 12301 Parklawn Drive, Rockville, Md. 20852 U.S.A. under ATCC Accession No. VR 2395. The present invention also provides a vaccine which comprises an effective immunizing amount of the attenuated, genetically-engineered fowlpox virus designate S-FPV-043 and a suitable carrier. The vaccine may contain either inactivated or live fowlpox virus S-FPV-043 although live virus is presently preferred.

Suitable carriers for use with the fowlpox virus are well known in the art and include proteins, sugars, etc. One example of such a suitable carrier is a physiologically balanced culture medium containing one or more stabilizing agents such as stabilized, hydrolyzed proteins, lactose, etc.

For purposes of this invention, an "effective immunizing amount" of the S-FPV-043 virus is an amount within the range of 10.sup.2 -10.sup.9 PFU/dose. Preferably, the effective immunizing amount is from about 10.sup.3 -10.sup.5 PFU/dose for the live virus vaccine. Preferably, the live vaccine is created by taking tissue culture fluids and adding stabilizing agents such as stabilized, hydrolyzed proteins.

The present invention also provides a method of immunizing an animal, particularly a poultry such as a chicken or turkey against disease caused by fowlpox virus and Newcastle disease virus. This method comprises administering to the animal or bird an effective immunizing dose of the vaccine of the present invention. The vaccine may be administered by any of the methods well known to those skilled in the art, for example, by intramuscular, subcutaneous, intraperitoneal, intravenous or intradermal injection. Alternatively, the vaccine may be administered intranasally, orally, or ocularly.

Experimental Details

Methods for constructing, selecting and purifying genetically-engineered fowlpox virus S-FPV-043 are detailed in the Materials and Methods section which follows.

One advantage of recombinant FPV as live vaccines is that they may be engineered to express only a limited number of antigens that are needed to confer protective immunity to the corresponding pathogens. Consequently, host animals vaccinated with the recombinant FPV can be distinguished from those which have been infected with the wild type virus by the absence of antigens that are normally present in the wild type virus.

Materials and Methods

PREPARATION OF FOWLPOX VIRUS STOCK SAMPLES. Fowlpox virus samples were prepared by infecting chicken embryo fibroblast (CEF) cells at a multiplicity of infection of 0.01 PFU/cell in a 1:1 mixture of HAM's F10 medium and Medium 199 (F10/199) containing 2 mM glutamine and antibiotics (referred to as CEF negative medium). Prior to infection, the cell monolayers were washed once with CEF negative medium to remove fetal bovine serum. The FPV contained in the initial inoculum (0.5 ml for 10 cm plate; 10 ml for T175 cm flask) was allowed to absorb onto the cell monolayer for two hours, being redistributed every half hour. After this period, the original inoculum was brought up to an appropriate final volume by the addition of complete CEF medium (CEF negative medium plus 2% fetal bovine serum). The plates were incubated at 37.degree. C. in 5% CO.sub.2 until cytopathic effect was complete. The medium and cells were harvested, frozen at -70.degree. C., thawed and dispensed into 1.0 ml vials and refrozen at -70.degree. C. Virus titers typically range between 10.sup.8 and 10.sup.7 PFU/ml.

PREPARATION OF FPV DNA. For fowlpox virus DNA isolation, a confluent monolayer of CEF cells in a T175 cm.sup.2 flask was infected at a multiplicity of 0.1 and incubated 4-6 days until the cells were showing 100% cytopathic effect. The infected cells were harvested by scraping into the medium and centrifuging at 3000 rpm for 5 minutes in a clinical centrifuge. The medium was decanted, and the cell pellet was gently resuspended in 1.0 ml PBS (per T175) and subjected to two successive freeze-thaws (-70.degree. C. to 37.degree. C.). After the last thaw, the cells (on ice) were sonicated two times for 30 seconds each with 45 seconds cooling time in between. Cellular debris was removed by centrifuging (Sorvall RC-5B Superspeed Centrifuge) at 3000 rpm for 5 minutes in an HB4 rotor at 4.degree. C. FPV virions, present in the supernatant, were pelleted by centrifugation at 15,000 rpm for 20 minutes at 4.degree. C. in a SS34 rotor (Sorvall) and resuspended in 10 mM Tris (pH 7.5). This fraction was then layered onto a 36% sucrose gradient (w/v in 10 mM Tris pH 7.5) and centrifuged (Beckman L8-70M Ultracentrifuge) at 18,000 rpm for 60 minutes in a SW41 rotor at 4.degree. C. The virion pellet was resuspended in 1.0 ml of 10 mM Tris pH 7.5 and sonicated on ice for 30 seconds. This fraction was layered onto a 20% to 50% continuous sucrose gradient and centrifuged at 16,000 rpm for 60 minutes in a SW41 rotor at 4.degree. C. The FPV virion band located about three quarters down the gradient was harvested, diluted with 20% sucrose and pelleted by centrifugation at 18,000 rpm for 60 minutes in a SW41 rotor at 4.degree. C. The resultant pellet was then washed once with 10 mM Tris pH 7.5 to remove traces of sucrose and finally resuspended in 10 mM Tris pH 7.5. FPV DNA was then extracted from the purified virions by lysis (four hours at 60.degree. C.) following the addition of EDTA, SDS, and proteinase K to final concentrations of 20 mM, 0.5% and 0.5 mf/ml, respectively. After digestion, three phenol-chloroform (1:1) extractions were conducted and the sample precipitated by the addition of two volumes of absolute ethanol and incubated at -20.degree. C. for 30 minutes. The sample was then centrifuged in an Eppendorf minifuge for five minutes at full speed. The supernatant was decanted, and the pellet air dried and rehydrated in 0.01 M Tris pH 7.5, 1 mM EDTA at 4.degree. C.

MOLECULAR BIOLOGICAL TECHNIQUES. Techniques for the manipulation of bacteria and DNA, including such procedures as digestion with restriction endonucleases, gel electrophoresis, extraction of DNA from gels, ligation, phosphorylation with kinase, treatment with phosphatase, growth of bacterial cultures, transformation of bacteria with DNA, and other molecular biological methods are described by Maniatis et al (1982) and Sambrook et al (1989). Except as noted, these were used with minor variation.

DNA SEQUENCING. Sequencing was performed using the BRL SEQUENASE.RTM. KIT (genetically engineered form of T7 DNA polymerase with no 3' to 5' exonuclease activity as compared to native T7 DNA polymerase) and .sup.35 S-dATP (NEN). Reactions using both the dGTP mixes and the dITP mixes were performed to clarify areas of compression. Alternatively, compressed areas were resolved on formamide gels. Templates were double-stranded plasmid subclones or single stranded M13 subclones, and primers were either made to the vector just outside the insert to be sequenced, or to previously obtained sequence. Sequence obtained was assembled and compared using Dnastar software. Manipulation and comparison of sequences obtained was performed with Superclone and Supersee programs from Coral Software.

STRATEGY FOR THE CONSTRUCTION OF SYNTHETIC POX VIRAL PROMOTERS. For recombinant fowlpox vectors synthetic pox promoters offer several advantages including the ability to control the strength and timing of foreign gene expression. We chose to design four promoter cassettes EP1 (SEQ ID NO:8, LP1 (SEQ ID NO:9), EP2 (SEQ ID NO:10), and LP2 (SEQ ID NO:11) based on promoters that have been defined in the vaccinia virus (Bertholet et al. 1986, Davidson and Moss, 1989a, and Davidson and Moss, 1989b). Each cassette was designed to contain the DNA sequences defined in vaccina flanked by restriction sites which could be used to combine the cassettes in any order or combination. Initiator methionines were also designed into each cassette such that inframe fusions could be made at either EcoRI or BamHi sites. A set of translational stop codons in all three reading frames and an early transcriptional termination signal (Earl, et al., 1990) was also engineered downstream of the inframe fusion site. DNA encoding each cassette was synthesized according to standard techniques and cloned into the appropriate homology vectors.

cDNA CLONING PROCEDURE. cDNA cloning refers to the methods used to convert RNA molecules into DNA molecules following state of the art procedures. Applicants' methods are described in (Gubler and Hoffman, 1983). Bethesda Research Laboratories (Gaithersburg, Md.) have designed a cDNA Cloning Kit that is very similar to the procedures used by applicants, and contains a set of reagents and protocols that may be used to duplicate our results.

For cloning virus mRNA species, a host cell line sensitive to infection by the virus was infected at 5-10 plaque forming units per cell. When cytopathic effect was evident, but before total destruction, the medium was removed and the cells were lysed in 10 mls lysis buffer (4 M guanidine thiocyanate, 0.1% antifoam A, 25 mM sodium citrate pH 7.0, 0.5% N-lauroyl sarcosine, 0.1 M beta-mercaptoethanol). The cell lysate was poured into a sterilized Dounce homogenizer and homogenized on ice 8-10 times until the solution was homogenous. For RNA purification, 8 mls of cell lysate were gently layered over 3.5 mls of CsCl solution (5.7 M CsCl, 25 mM sodium citrate pH 7.0) in a Beckman SW41 centrifuge tube. The samples were centrifuged for 18 hrs at 20.degree. C. at 36000 rpm in a Beckman SW41 rotor. The tubes were put on ice and the supernatants from the tubes were carefully removed by aspiration to leave the RNA pellet undisturbed. The pellet was resuspended in 400 .mu.l glass distilled water, and 2.6 mls of guanidine solution (7.5 M guanidine-HCl, 25 mM sodium citrate pH 7.0, 5 mM dithiothreitol) were added. Then 0.37 volumes of 1 M acetic acid were added, followed by 0.75 volumes of cold ethanol and the sample was put at -20.degree. C. for 18 hrs to precipitate RNA. The precipitate was collected by centrifugation in a Sorvall centrifuge for 10 min at 4.degree. C. at 10000 rpm in an SS34 rotor. The pellet was dissolved in 1.0 ml distilled water, recentrifuged at 13000 rpm, and the supernatant saved. RNA was re-extracted from the pellet 2 more times as above with 0.5 ml distilled water, and the supernatants were pooled. A 0.1 volume of 2 M potassium acetate solution was added to the sample followed by 2 volumes of cold ethanol and the sample was put at -20.degree. C. for 18 hrs. The precipitated RNA was collected by centrifugation in the SS34 rotor at 4.degree. C. for 10 min at 10000 rpm. The pellet was dissolved in 1 ml distilled water and the concentration taken by adsorption at A260/280. The RNA was stored at -70.degree. C.

mRNA containing polyadenylate tails (poly-A) was selected using oligo-dT cellulose (Pharmacia #27 5543-0). Three mg of total RNA was boiled and chilled and applied to a 100 mg oligo-dT cellulose column in binding buffer (0.1 M Tris pH 7.5, 0.5 M LiCl, 5 mM EDTA pH 8.0, 0.1% lithium dodecyl sulfate). The retained poly-A+ RNA was eluted from the column with elution buffer (5 mM Tris pH 7.5, 1 mM EDTA pH 8.0, 0.1% sodium dodecyl sulfate). This mRNA was reapplied to an oligo-dT column in binding buffer and eluted again in elution buffer. The sample was precipitated with 200 mM sodium acetate and 2 volumes cold ethanol at -20.degree. C. for 18 hrs. The RNA was resuspended in 50 .mu.l distilled water.

Ten .mu.g poly-A+ RNA was denatured in 20 mM methyl mercury hydroxide for 6 min at 22.degree. C. .beta.-mercaptoethanol was added to 75 mM and the sample was incubated for 5 min at 22.degree. C. The reaction mixture for first strand CDNA synthesis in 0.25 ml contained 1 .mu.g oligo-dT primer (P-L Bio-chemicals) or 1 .mu.g synthetic primer, 28 units placental ribonuclease inhibitor (Bethesda Research Labs #5518SA), 100 mM Tris pH 8.3, 140 mM KCl, 10 mM MgCl2, 0.8 mM dATP, dCTP, dGTP, and dTTP (Pharmacia), 100 microcuries 32P-labeled dCTP (New England Nuclear #NEG-013H), and 180 units AMV reverse transcriptase (Molecular Genetics Resources #MG 101). The reaction was incubated at 42.degree. C. for 90 min, and then was terminated with 20 mM EDTA pH 8.0. The sample was extracted with an equal volume of phenol/chloroform (1:1) and precipitated with 2 M ammonium acetate and 2 volumes of cold ethanol -20.degree. C. for 3 hrs. After precipitation and centrifugation, the pellet was dissolved in 100 .mu.l distilled water. The sample was loaded onto a 15 ml G-100 SEPHADEX.RTM. column, (Pharmacia), gel filtration media; fractionation range for globular proteins: 4,000 to 100,000 daltons, (Pharmacia) in buffer (100 mM Tris pH 7.5, 1 mM EDTA pH 8.0, 100 mM NaCl). The leading edge of the eluted DNA fractions were pooled, and DNA was concentrated by lyophilization until the volume was about 100 .mu.l, then the DNA was precipitated with ammonium acetate plus ethanol as above.

The entire first strand sample was used for second strand reaction which followed the Gubler and Hoffman (1983) method except that 50 .mu.g/ml dNTP's, 5.4 units DNA polymerase I (Boerhinger Mannheim #642-711), and 100 units/ml E. coli DNA ligase (New England Biolabs #205) in a total volume of 50 microliters were used. After second strand synthesis, the cDNA was phenol/chloroform extracted and precipitated. The DNA was resuspended in 10 .mu.l distilled water, treated with 1 .mu.g RNase A for 10 min at 22.degree. C., and electrophoresed through a 1% agarose gel (Sigma Type II agarose) in 40 mM Tris-acetate buffer pH 6.85. The gel was strained with ethidium bromide, and DNA in the expected size range was excised from the gel and electroeluted in 8 mM Tris-acetate pH 6.85. Electroeluted DNA was lyophilized to about 100 microliters, and precipitated with ammonium acetate and ethanol as above. The DNA was resuspended in 20 .mu.l water.

Oligo-dC tails were added to the DNA to facilitate cloning. The reaction contained the DNA, 100 mM potassium cacodylate pH 7.2, 0.2 mM dithiothreitol, 2 mM CaCl.sub.2, 80 .mu.moles dCTP, and 25 units terminal deoxynucleotidyl transferase (Molecular Genetic Resources #S1001) in 50 .mu.l. After 30 min at 37.degree. C., the reaction was terminated with 10 mM EDTA, and the sample was phenol/chloroform extracted and precipitated as above.

The dC-tailed DNA sample was annealed to 200 ng plasmid vector pBR322 that contained oligo-dG tails (Bethesda Research Labs #5355 SA/SB) in 200 .mu.l of 0.01 M Tris pH 7.5, 0.1 M NaCl, 1 mM EDTA pH 8.0 at 65.degree. C. for 2 min and then 57.degree. C. for 2 hrs. Fresh competent E. coli DH-1 cells were prepared and transformed as described by Hanahan (1983) using half the annealed cDNA sample in twenty 200 .mu.l aliquots of cells. Transformed cells were plated on L-broth agar plates plus 10 .mu.g/ml tetracycline. Colonies were screened for the presence of inserts into the ampicillin gene using AMPSCREEN.RTM., ampicillin-resistance screening disks suitable for screening inactivation of the .beta.-lactamase gene responible for ampicillin resistance in E. coli. Ampscreen disks are 85 mm filter paper circles impregnated with benzylpenicillin and bromocresol purple. 600 mg of unbuffered benzylpenicillin is dissolved in 4 ml of 0.1% aqueous solution of bromocresol purple, 0.05 ml 0.1 mol/l sodium hydroxide is added. (Bethesda Research Labs #5537 UA), and the positive colonies were picked for analysis.

HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT FPV. This method relies upon the homologous recombination between FPV DNA and the plasmid homology vector DNA which occurs in the tissue culture cells containing both FPV DNA and transfected plasmid homology vector. For homologous recombination to occur, monolayers of CEF cells are infected with S-FPV-001 (A mild fowlpox vaccine strain available as BIO-POX.TM. from Agri-Bio Corporation, Gainsville, Ga.) at a multiplicity of infection of 0.01 PFU/cell to introduce replicating FPV (i.e. DNA synthesis) into the cells. The plasmid homology vector DNA is then transfected into these cells according to the "Infection-Transfection Procedure".

INFECTION-TRANSFECTION PROCEDURE. CEF cells in 6 cm plates (about 80% confluent) were infected with S-FPV-001 at a multiplicity of infection of 0.01 PFU/cell in CEF negative medium and incubated at 37.degree. C. in a humidified 5% CO.sub.2 incubator for five hours. The transfection procedure used is essentially that recommended for LIPOFECTIN.RTM. Reagent (BRL), 1:1 (w/w) liposome formulation of cationic lipid N-[1-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTMA) and dioleoyl phosphatidyl ethanolamine (DOPE). Briefly, for each 6 cm plate, 15 micrograms of plasmid DNA were diluted up to 100 microliters with H.sub.2 O. Separately, 50 micrograms of LIPOFECTIN.TM. Reagent were diluted to 100 microliters with H.sub.2 O. The 100 microliters of diluted LIPOFECTIN .TM. Reagent were added dropwise to the diluted plasmid DNA contained in a polystyrene, 5 ml, snap cap tube and mixed gently. The mixture was then incubated for 15-20 minutes at room temperature. During this time, the virus inoculum was removed from the 6 cm plates and the cell monolayers washed once with CEF negative medium. Three mls of CEF negative medium were added to the plasmid DNA/lipofectin mixture and the contents pipetted onto the cell monolayer. Following overnight (about 16 hours) incubation at 37.degree. C. in a humidified 5% CO.sub.2 incubator, the medium was removed and replaced with 5 ml CEF complete medium. The cells were incubated at 37.degree. C. in 5% CO.sub.2 for 3-7 days until cytopathic effect from the virus was 80-100%. Virus was harvested as described above for the preparation of virus stocks. This stock was referred to as a transfection stock and was subsequently screened for recombinant virus by the "Plaque Hybridization Procedure For Purifying Recombinant FPV".

PLAQUE HYBRIDIZATION PROCEDURE FOR PURIFYING RECOMBINANT FPV. CEF cell monolayers were infected with various dilutions of the infection/transfection viral stocks, overlaid with nutrient agarose media (equal volumes of 1.2%-1.4% agarose and 2.times. M199) and incubated 6-7 days for plaque development to occur. The agarose overlay and plate were marked with the same three asymmetrical dots (India ink) to aid in positioning the Nitrocellulose (NC) membrane (cell monolayer) and agarose overlay. The agarose overlay was transferred to the lid of the 10 cm dish and stored at 4.degree. C. The CEF monolayer was overlaid with a pre-wetted (PBS) NC membrane and pressure applied to transfer the monolayer to the NC membrane. Cells contained on the NC membrane were then lysed by placing the membranes in 1.5 ml of 1.5 M NaCl and 0.5 M NaOH for five minutes. The membranes were placed in 1.5 ml of 3 M sodium acetate (pH 5.2) for five minutes. DNA from the lysed cells was bound to the NC membrane by baking at 80.degree. C. for one hour. After this period the membranes were prehybridized with a solution containing 6.times.SSC, 3% skim milk, 0.5% SDS, salmon sperm DNA (50 .mu.g/ml) and incubated at 65.degree. C. for one hour. Radio-labeled probe DNA (alpha.sup.32 P-dCTP) was added and incubated at 65.degree. C. overnight (12 hours). After hybridization the NC membranes were washed two times (30 minutes each) with 2.times.SSC at 65.degree. C., followed by two additional washes at 65.degree. C. with 0.5.times.SSC. The NC membranes were dried and exposed to X-ray film (Kodak X-OMAT, AR) at -70.degree. C. for 12 hours. Plaques corresponding to positive signals seen on the autoradiogram were picked from the agarose overlay, using a pasteur pipette, and were resuspended into 1 ml of CEF media and stored at -70.degree. C. Typically, 5-6 rounds of plaque purification were required to ensure purity of the recombinant virus.

SCREEN FOR FOREIGN GENE EXPRESSION IN RECOMBINANT FPV USING BLACK PLAQUE ASSAYS. To analyze expression of foreign antigens expressed by recombinant fowlpox viruses, monolayers of CEF cells were infected with recombinant FPV, overlaid with nutrient agarose media and incubated for 6-7 days at 37.degree. C. for plaque development to occur. The agarose overlay was removed from the dish, the cells fixed with 100% methanol for 10 minutes at room temperature and air dried. The primary antibody was diluted to an appropriate concentration with PBS and incubated on the cell monolayer for two hours at room temperature. Unbound antibody was removed from the cells by washing three times with PBS at room temperature. A horseradish peroxidase conjugated secondary antibody was diluted with PBS and incubated on the cell monolayer for two hours at room temperature. Unbound secondary antibody was then removed by washing the cells three times with PBS at room temperature. The cells were incubated 15-30 minutes at room temperature with freshly prepared substrate solution (100 .mu.g/ml 4-chloro-1-naphthol, 0.003% H.sub.2 O.sub.2 in PBS). Plaques expressing the correct antigen stain black.

SCREEN FOR RECOMBINANT FPV EXPRESSING ENZYMATIC MARKER GENES. When the E. coli .beta.-galactosidase (lacZ) or .beta.-glucuronidase (uidA) marker gene was incorporated into a recombinant virus the plaques containing recombinants were visualized by a simple assay. The enzymatic substrate was incorporated (300 .mu.g/ml) into the agarose overlay during the plaque assay. For the lacZ marker gene the substrates BLUOGAL .TM. (halogenated indolyl-.beta.-D-galactosidase, Bethesda Research Labs) for blue plaques or CPRG (chlorophenol Red Galactopyranoside, Boehringer mannheim) for red plaques were used. For the uidA marker gene the substrate X-Glucuro Chx (5-bromo-4-chloro-3-indolyl-.beta.-D-glucuronic acid Cyclohexylammonium salt, Biosynth AG) was used. Plaques that expressed active marker enzyme turned either red or blue. The plaques were then picked onto fresh cells and purified by further plaque isolation.

HOMOLOGY VECTOR 451-79.95. The plasmid 451-79.95 was constructed for the purpose of inserting the NDV HN gene into FPV. A lacZ marker gene followed by the NDV HN gene was inserted as a cassette into the homology vector 443-88.14 at the unique SfiI site. The cassette may be constructed utilizing standard recombinant DNA techniques (Maniatis et al., 1982 and Sambrook et al., 1989), by joining restriction fragments from the following sources with the synthetic DNA sequences indicated. The first fragment is the synthetic late promoter LP1 (SEQ ID NO:9). The second fragment contains the coding region of E. coli lacZ and is derived from plasmid pJF751 (Ferrari et al., 1985). Note that the promoter and lacZ gene are fused so as to express a hybrid protein consisting of 4 amino acids derived from the synthetic promoter followed by amino acids 10 to 1024 of the lacZ gene. The third fragment is another copy of the synthetic late promoter LP1. the fourth fragment contains the coding region of the NDV HN gene and was derived from the full length HN cDNA clone. Note that the promoter and HN gene are fused so as to express a hybrid protein consisting of 4 amino acids derived from the synthetic promoter followed by amino acids 2 to 577 of the HN gene. Both genes are in the opposite transcriptional orientation relative to the ORF1 gene in the parental homology vector.

HOMOLOGY VECTOR 489-21.1. The plasmid 489-21.1 was constructed for the purpose of inserting the NDV HN gene into FPV. The NDV HN gene was inserted as a cassette into the homology vector 443-88.8 at the unique SfiI site. The cassette may be constructed utilizing standard recombinant DNA techniques (Maniatis et al., 1982 and Sambrook et al., 1989), by joining restriction fragments from the following sources with the synthetic DNA sequences indicated. The first fragment is the synthetic early/late promoter EP1LP2 (SEQ ID NO:8/SEQ ID NO:11). The second fragment contains the coding region of the NDV HN gene and was derived from the full length HN cDNA clone. Note that the promoter and HN gene are fused so as to express a hybrid protein consisting of 4 amino acids derived from the synthetic promoter followed by amino acids 2 to 577 of the HN gene. The HN gene is in the opposite transcriptional orientation relative to the ORF in the parental homology vector.

HOMOLOGY VECTORS 502-26.22. The plasmid 502-26.22 was constructed for the purpose of inserting the NDV HN and F genes into FPV. The NDV HN and F genes were inserted as a SfiI fragment (SEQ ID NO:12,13,14) into the homology vector 443-88.8 at the unique SfiI site. The NDV HN and F genes were inserted in the same transcriptional orientation as the ORF in the parental homology vector. A detailed description of the SfiI is shown in FIG. 1. The inserted SfiI fragment may be constructed utilizing standard recombinant DNA techniques (Maniatis et al. and Sambrook et al., 1989), by joining restriction fragments from the following sources with the synthetic DNA sequences indicated in FIG. 1. Fragment 1 is approximately 1811 base pair AvaII to NaeI restriction fragment of the full length NDV HN cDNA clone (B1 strain). Fragment 2 is an approximately 1812 base pair BamHI to PstI restriction fragment of the full length NDV F cDNA (B1 strain). Fragment 3 is an approximately 235 base pair PstI and ScaI restriction fragment of the plasmid pBR322.

HOMOLOGY VECTOR 502-27.5. The plasmid 502-27.5 was constructed for the purpose of inserting the NDV F gene into FPV. A LacZ marker gene followed by the NDV F gene was inserted as a cassette into the homology vector 443-88.14 at the unique SfiI site. The cassette may be constructed utilizing standard recombinant DNA techniques (Maniatis et al., 1982 and Sambrook et al., 1989), joining restriction fragments from the following sources with the synthetic DNA sequences indicated. The first fragment is the synthetic late promoter LP1 (SEQ ID NO:9). The second fragment contains the coding region of E. coli LacZ and is derived from plasmid pJF751 (Ferrari et al., 1985). Note that the promoter and LacZ gene are fused so as to express a hybrid protein consisting of 4 amino acids derived from the synthetic promoter followed by amino acids 10 to 1024 of the LacZ gene. The third fragment is the synthetic early/late promoter EP1LP2 (SEQ ID NO:8/SEQ ID NO:11). The fourth fragment contains the coding region of the NDV F gene and was derived from the full length F cDNA clone. Note that the promoter and F gene are fused so as to express a hybrid protein consisting of 4 amino acids dervied from the synthetic promoter followed by 10 amino acids derivied from the F gene 5' untranslated region followed by amino acid 1 to 544 of the F gene. Both genes are in the opposite transcriptional orientation relative to the ORF in the parental homology vector.

HOMOLOGY VECTOR 586-36.6. The plasmid 586-36.6 was constructed for the purpose of inserting the infectious laryngotracheitis virus (ILT) gB and gD genes into the FPV. An E. coli .beta.-glucuronidase uidA marker gene preceeded by the ILT gB and gD genes was inserted as a cassette into the homology vector 451-08.22 at the unique SfiI site. The cassette may be constructed utilizing standard recombinant DNA techniques (Maniatis et al., 1982 and Sambrook et al., 1989), by joining restriction fragments from the following sources with the synthetic DNA sequences indicated. The first fragment is the synthetic early/late promoter EP1LP2 (SEQ ID NO:8/SEQ ID NO:11). The second fragment contains the coding region of ILT gB and is dervied from an approximately 3000 base pair ILT virus genomic EcoRI fragment. Note that the promoter and gB gene are fused so as to express the complete coding region of the gB gene (amino acids 1-883). The third fragment is the synthetic early/late promoter EP1LP2 (SEQ ID NO:8/SEQ ID NO:11). The fourth fragment contains the coding region of the ILT gD gene (SEQ ID NO:19,20) and was derived from an approximately 2060 base pair EcoRI to BclI restriction sub-fragment of the ILT KpnI genomic restriction fragment #8 (10.6 KB). Note that the promoter and gD gene are fused so as to express a hybrid protein consisting of 3 amino acids dervied from the synthetic promoter followed by amino acids 3 to 434 of the gD gene. The fifth fragment is the synthetic late promoter LP1 (SEQ ID NO:9). The last fragment contains the coding region of E. coli uidA and is derived from plasmid pRAJ260 (Clonetech). Note that the promoter and uidA gene are fused so as to express a hybrid protein consisting of 3 amino acids derived from the synthetic promoter followed by amino acids 1 to 602 of the uidA gene. All three genes are in the opposite transcriptional orientation relative to ORF1 in the parental homology vector.

HOMOLOGY VECTOR 608-10.3. The plasmid 608-10.3 was constructed for the purpose of inserting the Marek's Disease virus (MDV) gD and gB genes into FPV. A LacZ marker gene preceeded by the MDV gD and gB genes was inserted as a cassette into the homology vector 443-88.14 at the unique SfiI site. The cassette may be constructed utilizing standard recombinant DNA techniques (Maniatis et al., 1982 and Sambrook et al., 1989), by joining restriction fragments from the following sources with the synthetic DNA sequences indicated. The first fragment is the synthetic late/early promoter LP2EP2 (SEQ ID NO:11/SEQ ID NO:10). The second fragment contains the coding region of MDV gD and is derived from an approximately 2177 base pair NcoI to SalI sub-fragment of the MDV BglII 4.2 KB genomic restriction fragment (Ross, et al., 1991). Note that the promoter and gD are fused so as to express a hybrid protein consisting of 3 amino acids derived from the synthetic promoter followed by amino acids 3 to 403 of the gD gene. The third fragment is the synthetic early/late promoter EP1LP2 (SEQ ID NO:8/SEQ ID NO:11). The fourth fragment contains the coding region of the MDV gB gene and was derived from an approximately 3898 base pair SalI to EcoRI genomic MDV fragment (Ross, et al., 1989). Note that the promoter and gB gene are fused so as to express a hybrid protein consisting of 3 amino acids derived from the synthetic promoter followed by amino acids 3 to 865 of the gB gene. The fifth fragment is the synthetic late promoter LP1 (SEQ ID NO:9). The sixth fragment contains the coding region of E. coli LacZ and is derived from plasmid pJF751 (Ferrari, et al., 1985). Note that the promoter and LacZ gene are fused so as to express a hybrid protein consisting of 4 amino acids dervied from the synthetic promoter followed by amino acids 10 to 1024 of the LacZ gene. All three genes are in the opposite transcriptional orientation relative to ORF1 in te parental homology vector.

EXAMPLES

Example 1

Sites for Insertion of Foreign DNA into FPV

In order to define appropriate insertion sites, a library of FPV EcoRI restriction fragments was generated in the plasmid vector pSP64 (Promega). Several of these restriction fragments were subjected to restriction mapping analysis. Unique blunt cutting restriction endonuclease sites were identified and mapped within the cloned FPV DNA regions. The blunt restriction sites were converted to Not I and Sfi I sites through the use of synthetic DNA linkers (oligo 66.04; 5'-GGCGGCCGCGGCCCTCGAGGCCA-3' SEQ ID NO: 1 and oligo 66.05; 5' TGGCCTCGAGGGCCGCGGCCGCC 3' SEQ ID NO: 2). A .beta.-galactosidase (lacZ) marker gene was inserted in each of the potential sites. A plasmid containing such a foreign DNA insert may be used according to the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT FPV to construct a FPV containing the foreign DNA. For this procedure to be successful it is important that the insertion site be in a region non-essential to the replication of the FPV and that the site be flanked with FPV DNA appropriate for mediating homologous recombination between virus and plasmid DNAs. The plasmids containing the lacZ marker gene were utilized in the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT FPV. The generation of recombinant virus was determined by the SCREEN FOR RECOMBINANT FPV EXPRESSING ENZYMATIC MARKER GENES. Three sites were successfully used to generate a recombinant viruses. In each case the resulting virus was easily purified to 100%, clearly defining an appropriate site for the insertion of foreign DNA. The three homology vectors used to define these sites are described below.

Example 1A

Homolocy Vector 443-88.8

The homology vector 443-88.8 contains a 3.5 KB FPV genomic EcoRI fragment and is useful for the insertion of foreign DNA into FPV. This EcoRI fragment maps to the approximately 5.5 KB overlap of FPV genomic fragments SalI C and PstI F (Coupar et al., 1990). The NotI/SfiI linker described above was inserted into a unique HpaI site in this fragment. This site is designated the 680 insertion site.

The homology vector 443-88.8 was characterized by DNA sequence analysis. Approximately 1495 base pairs of DNA sequence flanking the HpaI site was determined (SEQ ID NO: 3,4). This sequence indicates that the open reading frame of 383 amino acids spans the HpaI insertion site. The HpaI site interrupts this ORF at amino acid 226. This ORF shows no amino acid sequence homology to any known pox virus genes. Example 1B

Homology Vector 443-88.14

The homology vector 443-88.14 contains a 2.8 KB FPV genomic EcoRI fragment and is useful for the insertion of foreign DNA into FPV. The NotI/SfiI linker described above was inserted into a unique SnaBI site in this fragment. This site is designated the 681 insertion site.

The homology vector 443-88.14 was characterized by DNA sequence analysis. The entire sequence of the 2.8 KB fragment was determined (SEQ ID NO: 5,6,7). This sequence indicates that the SnaBI site is flanked on one side by a complete ORF of 422 amino acids (ORF1) reading toward the restriction site and on the other side by an incomplete ORF of 387 amino acids (ORF2) also reading toward the restriction site. Both ORF1 and ORF2 share homology with the vaccinia virus M1L gene (ref). The M1L gene shares homology with the vaccinia virus K1L gene which has been shown to be involved in viral host-range functions.

Example 1C

Homology Vector 451-08.22

The homology vector 451-08.22 contains a 4.2 KB FPV genomic EcoRI fragment and is useful for the insertion of foreign DNA into FPV. The NotI/SfiI linker described above was inserted into a unique StuI site in this fragment. A unique MluI site is located approximately 500 base pairs away from the StuI insertion site. This site is designated the 540 insertion site.

Example 2

Bivalent Vaccines Against Newcastle Disease and Fowlpox

Recombinant FPV expressing proteins from NDV make bivalent vaccines protecting against both Marek's Disease and Newcastle disease. We have constructed several recombinant FPV expressing NDV proteins: S-FPV-013 (example 2A), S-FPV-035 (example 2B), S-FPV-041 (example 2C), S-FPV-042 (example 2D), and S-FPV-043 (example 2E).

Example 2A

S-FPV-013

S-FPV-013 is a recombinant fowlpox virus that expresses at least two foreign genes. The gene for E. coli .beta.-galactosidase (lacZ gene) and the gene for Newcastle Disease virus hemagglutinin-neuraminidase (HN) protein were inserted into the 681 insertion site. The lacZ gene is under the control of a synthetic late promoter LP1 and the HN gene is under the control of the synthetic late promoter LP2.

S-FPV-013 was derived from S-FPV-001. This was accomplished utilizing the homology vector 451-79.95 (see Materials and Methods) and virus S-FPV-001 in the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT SPV. The transfection stock was screened by the SCREEN FOR RECOMBINANT FPV EXPRESSING ENZYMATIC MARKER GENES. The final result of red plaque purification was the recombinant virus designated S-FPV-013. This virus was assayed for .beta.-galactosidase expression, purity, and insert stability by multiple passages monitored by the blue plaque assay as described in the materials and methods. After the initial three rounds of purification all plaques observed were blue indicating that the virus was pure, stable and expressing the marker gene.

S-FPV-013 was assayed for expression of NDV specific antigens using the BLACK PLAQUE SCREEN FOR FOREIGN GENE EXPRESSION IN RECOMBINANT FPV. An NDV HN specific monoclonal antibody (3-1G-5) was shown to react specifically with S-FPV-013 plaques and not with S-FPV-001 negative control plaques. All S-FPV-013 observed plaques reacted with the monoclonal antibody antiserum indicating that the virus was stably expressing the NDV foreign gene.

Example 2B

S-FPV-035

S-FPV-035 is a recombinant fowlpox virus that express a foreign gene. The Newcastle Disease virus HN gene was inserted at the 680 insertion site (see example 1A). The HN gene is under the control of the synthetic early/late promoter EP1LP2.

S-FPV-035 was derived from S-FPV-001. This was accomplished utilizing the homology vector 489-21.1 (see Materials and Methods) and virus S-FPV-001 in the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT SPV. The transfection stock was screened by the PLAQUE HYBRIDIZATION PROCEDURE FOR PURIFYING RECOMBINANT FPV. The final result of plaque hybridization purification was the recombinant virus designated S-SPV-035.

S-FPV-035 was assayed for expression of NDV specific antigens using the BLACK PLAQUE SCREEN FOR FOREIGN GENE EXPRESSION IN RECOMBINANT FPV. An NDV HN specific monoclonal antibody (3-1G-5) was shown to react specifically with S-FPV-035 plaques and not with S-FPV-001 negative control plaques. All S-FPV-035 observed plaques reacted with the monoclonal antibody indicating that the virus was stably expressing the NDV foreign gene.

Example 2C

S-FPV-041

S-FPV-041 is a recombinant fowlpox virus that expresses at least two foreign genes. The gene for E. coli .beta.-galactosidase (lacZ gene) and the gene for Newcastle Disease virus fusion (F) protein were inserted into the 681 insertion site. The lacZ gene is under the control of a synthetic late promoter LP1 and the F gene is under the control of the synthetic early/late promoter EP1LP2.

S-FPV-041 was derived from S-FPV-001. This was accomplished utilizing the homology vector 502-27.5 (see Materials and Methods) and virus S-FPV-001 in the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT SPV. The transfection stock was screened by the SCREEN FOR RECOMBINANT FPV EXPRESSING ENZYMATIC MARKER GENES. The final result of red plaque purification was the recombinant virus designated S-FPV-041. This virus was assayed for .beta.-galactosidase expression, purity, and insert stability by multiple passages monitored by the blue plaque assay as described in the materials and methods. After the initial three rounds of purification all plaques observed were blue indicating that the virus was pure, stable and expressing the marker gene.

S-FPV-041 was assayed for expression of NDV specific antigens using the BLACK PLAQUE SCREEN FOR FOREIGN GENE EXPRESSION IN RECOMBINANT FPV. An NDV F specific monoclonal antibody (5-3F-2) was shown to react specifically with S-FPV-041 plaques and not with S-FPV-001 negative control plaques. All S-FPV-041 observed plaques reacted with the monoclonal antibody indicating that the virus was stably expressing the NDV foreign gene.

Example 2D

S-FPV-042

S-FPV-042 is a recombinant fowlpox virus that expresses at least three foreign genes. The gene for E.coli .beta.-galactosidase (lacZ gene) and the gene for Newcastle Disease virus fusion (F) protein was inserted into the 681 insertion site. The lacZ gene is under the control of a synthetic late promoter LP1 and the F gene is under the control of the synthetic early/late promoter EP1LP2. The Newcastle Disease virus hemagglutinin (HN) gene were inserted at the 680 insertion site. The HN gene is under the control of the synthetic early/late promoter EP1LP2.

S-FPV-042 was derived from S-FPV-035. This was accomplished utilizing the homology vector 502-27.5 (see Materials and Methods) and virus S-FPV-035 in the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT SPV. The transfection stock was screened by the SCREEN FOR RECOMBINANT FPV EXPRESSING ENZYMATIC MARKER GENES. The final result of red plaque purification was the recombinant virus designated S-FPV-042. This virus was assayed for .beta.-galactosidase expression, purity, and insert stability by multiple passages monitored by the blue plaque assay as described in the materials and methods. After the initial three rounds of purification all plaques observed were blue indicating that the virus was pure, stable and expressing the marker gene.

S-FPV-042 was assayed for expression of NDV specific antigens using the BLACK PLAQUE SCREEN FOR FOREIGN GENE EXPRESSION IN RECOMBINANT FPV. Monoclonal antibodies specific for both HN (3-1G-5) and F (5-3F-2) were shown to react specifically with S-FPV-042 plaques and not with S-FPV-001 negative control plaques. All S-FPV-042 observed plaques reacted with the monoclonal antibodies indicating that the virus was stably expressing the NDV foreign genes.

Example 2E

S-FPV-043

S-FPV-043 is a recombinant fowlpox virus that expresses at least two foreign genes. The genes for Newcastle Disease virus F protein and HN protein were inserted at the 680 insertion site. The F and HN genes are each under the control of a synthetic early/late promoter EP1LP2.

S-FPV-043 was derived from S-FPV-001. This was accomplished utilizing the homology vector 502-26.22 (see Materials and Methods) and virus S-FPV-001 in the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT SPV. The transfection stock was screened by the PLAQUE HYBRIDIZATION PROCEDURE FOR PURIFYING RECOMBINANT FPV. The final result of plaque hybridization purification was the recombinant virus designated S-SPV-043. The S-FPV-043 has been deposited pursuant to the Budapest Treaty on the International Deposit of Microorganisms for the Purposes of Patent Procedure with the Patent Culture Depository of the American Type Culture Collection, 12301 Parklawn Drive, Rockville, Md. 20852 U.S.A. under ATCC Accession No. VR .sub.------.

S-FPV-043 was assayed for expression of NDV specific antigens using the BLACK PLAQUE SCREEN FOR FOREIGN GENE EXPRESSION IN RECOMBINANT FPV. Monoclonal antibodies specific for both HN (3-1G-5) and F (5-3F-2) were shown to react specifically with S-FPV-043 plaques and not with S-FPV-001 negative control plaques. All S-FPV-043 observed plaques reacted with the monoclonal antibodies antiserum indicating that the virus was stably expressing the NDV foreign genes.

TESTING OF RECOMBINANT FPV EXPRESSING NDV ANTIGENS

Groups of one day old SPF chicks (HyVac Inc.) were immunized with recombinant fowlpox viruses S-FPV-035, S-FPV-041, or S-FPV-043. Non vaccinated controls were also included. Three weeks post-vaccination, the birds were challenged intramuscularly with either virulent NDV or virulent FPV (Table 1). The challenged chicks were observed daily for 14 days for clinical signs and death due to NDV. Non vaccinated control birds showed 100% mortality. S-FPV-043 vaccinated birds showed 100% protection against FPV challenge. Birds vaccinated with S-FPV-035 showed 95% protection compared with 85% seen with birds immunized with S-FPV-041. These results suggest that recombinants expressing HN or F alone provide only partial protection. When both NDV proteins are combined into the same virus S-FPV-043, an enhancement of protection against lethal NDV challenge is obtained, resulting in a lower protective dose. The chicks that were challenged with FPV were scored for pox lesions. Non vaccinated control birds showed no protection against FPV lesions. Birds vaccinated with S-FPV-043 were completely protected from FPV lesions.

The duration of immunity conferred by vaccination with S-FPV-043 was examined. A group of SPF chicks was immunized with S-FPV-043 at one day of age and then challenged six weeks post-vaccination with either NDV or FPV. Complete protection was observed against both NDV and FPV challenge in S-FPV-043 vaccinated birds, whereas non vaccinated controls were totally susceptible to both challenge viruses. These results suggest that the duration of immunity afforded by vaccination with S-FPV-043 would span the life of a broiler bird (.about.6 weeks).

The effect of vaccinating hens in lay with the recombinant S-FPV-043 was evaluated by assessing egg production post-vaccination. One group of 50 hens was vaccinated and a second group of 50 hens, housed under conditions identical to the vaccinated group, served as non vaccinated controls. Daily egg production was monitored for four weeks post-vaccination. No differences were observed in egg production between the two groups of hens, indicating this vaccine will not adversely affect egg production in laying hens.

A study was conducted to determine whether S-FPV-043 could actively immunize chicks in the presence of maternal antibodies to both NDV and FPV. Chicks obtained from NDV and FPV immunized flocks were vaccinated with S-FPV-043 and three weeks after vaccination, they were challenged with either virulent NDV or virulent FPV. Clinical responses were compared with non vaccinated chicks from the same flock and with non-vaccinated chicks from an antibody negative flock (Table 2). Chicks derived from antibody negative flocks showed 100% mortality after NDV challenge. Protection against NDV challenge, in non-vaccinated chicks known to have maternally derived antibody against NDV, ranged from 30 to 60%. Protection levels increased, to a range of 75 to 85%, when the maternal antibody positive chicks were vaccinated with S-FPV-043 suggesting an active immunization. The increase in NDV protection from 30% to 75% (flock 1) and 55% to 85% (flock 2) clearly demonstrate the ability of S-FPV-043 to partially overcome maternal antibody to both NDV and FPV. A decrease in FPV protection (90%) was observed in flock 1, suggesting some inhibition of FPV replication.

Table 1. Immunity conferred by Fowlpox recombinant vaccines vectoring different genes from Newcastle disease virus.

TABLE 1______________________________________Immunity conferred by Fowlpox recombinant vaccinesvectoring different genes from Newcastle disease virus. Challenge.sup.aVIRUS DOSE.sup.b NDV FPV______________________________________FPV/NDV-HN 8 .times. 10.sup.5 95 NT.sup.c(S-FPV-035)FPV/NDV-F 2 .times. 10.sup.4 85 NT.sup.(S-FPV-041)FPV/NDV-HN+F 2 .times. 10.sup.3 100 100(S-FPV-043)Controls none 0 0______________________________________ .sup.a Percent protection following challenge 3 weeks postvaccination .sup.b PFU/0.1 ml dose .sup.c Not tested TABLE 2__________________________________________________________________________Ability of recombinant vaccine FPV/NDV-HN+F (S-FPV-043) to vaccinate chicks with maternal antibody.History Challenge.sup.aFlock Hen Antibody.sup.b NDV FPVVaccination NDV-HI.sup.c NDV ELISA FPV-AGP.sup.d Vacc. Con. Vacc. Con.__________________________________________________________________________1 NDV + FPV 1:36 1:1738 Neg 75 30 90 02 NDV + FPV 1:64 1:2852 Neg 85 55 100 03 NDV only 1:92 1:4324 Neg 80 60 95 04 None Neg Neg Neg -- 0 -- 0__________________________________________________________________________ .sup.a Percent protection following challenge 3 weeks postvaccination. .sup.b Every flock antibody. .sup.c HIHemagglutination Inhibition Assay .sup.d AGPAgar Gel Precipitation Assay

Example 3

S-FPV-082

S-FPV-082 is a recombinant fowlpox virus that expresses at least five foreign genes. The genes for Newcastle Disease virus F protein and HN protein were inserted at the 680 insertion site. The F and HN genes are each under the control of a synthetic early/late promoter EP1LP2. The gene for E.coli .beta.-galactosidase (lacZ gene) and the genes for Marek's Disease virus (MDV) gD and gB were inserted into the 681 insertion site. The lacZ gene is under the control of a synthetic late promoter LP1 and the MDV gD and gB genes are under the control of the synthetic early/late promoters LP2EP2 and EP1LP2 respectively.

S-FPV-082 was derived from S-FPV-043. This was accomplished utilizing the homology vector 608-10.3 (see Materials and Methods) and virus S-FPV-043 in the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT SPV. The transfection stock was screened by the SCREEN FOR RECOMBINANT FPV EXPRESSING ENZYMATIC MARKER GENES. The final result of red plaque purification was the recombinant virus designated S-FPV-082. This virus was assayed for .beta.-galactosidase expression, purity, and insert stability by multiple passages monitored by the blue plaque assay as described in the materials and methods. After the initial three rounds of purification all plaques observed were blue indicating that the virus was pure, stable and expressing the marker gene.

S-FPV-082 was assayed for expression of MDV specific antigens using the BLACK PLAQUE SCREEN FOR FOREIGN GENE EXPRESSION IN RECOMBINANT FPV. Convalescent sera from MDV infected chickens was shown to react specifically with S-FPV-082 plaques and not with S-FPV-001 negative control plaques. All S-FPV-082 observed plaques reacted with the chicken antiserum indicating that the virus was stably expressing the MDV foreign genes.

S-FPV-082 expresses foreign antigens from NDV and MDV. This virus will be valuable as a multi-valent vaccine against Newcastle Disease, Marek's Disease and Fowlpox.

Example 4

S-FPV-083

S-FPV-083 is a recombinant fowlpox virus that expresses at least five foreign genes. The genes for Newcastle Disease virus F protein and HN protein were inserted at the 680 insertion site. The F and HN genes are each under the control of a synthetic early/late promoter EP1LP2. The gene for E. coli .beta.-glucuronidase (uidA gene) and the genes for Infectious Laryngotracheitis virus (ILT) gD and gB were inserted into the 540 insertion site. The uidA gene is under the control of a synthetic late promoter LP1 and the ILT gD and gB genes are each under the control of a synthetic early/late promoter (EP1LP2).

S-FPV-083 was derived from S-FPV-043. This was accomplished utilizing the homology vector 586-36.6 (see Materials and Methods) and virus S-FPV-043 in the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT SPV. The transfection stock was screened by the SCREEN FOR RECOMBINANT FPV EXPRESSING ENZYMATIC MARKER GENES. The final result of blue plaque purification was the recombinant virus designated S-FPV-083. This virus was assayed for .beta.-glucuronidase expression, purity, and insert stability by multiple passages monitored by the blue plaque assay as described in the materials and methods. After the initial three rounds of purification all plaques observed were blue indicating that the virus was pure, stable and expressing the marker gene.

S-FPV-083 was assayed for expression of ILT specific antigens using the BLACK PLAQUE SCREEN FOR FOREIGN GENE EXPRESSION IN RECOMBINANT FPV. Convalescent sera from ILT infected chickens was shown to react specifically with S-FPV-083 plaques and not with S-FPV-001 negative control plaques. All S-FPV-083 observed plaques reacted with the chicken antiserum indicating that the virus was stably expressing the ILT foreign genes.

S-FPV-083 expresses foreign antigens from NDV and ILT. This virus will be valuable as a multi-valent vaccine against Newcastle Disease, Infectious Laryngotracheitis and Fowlpox.

References

1. C. Bertholet, et al., EMBO Journal 5, 1951-1957, 1986. 2. B. H. Coupar, et al., Virology 179, 159-167, 1990. 3. A. J. Davidson and B. Moss, J. Mol. Biol. 210, 749-769. 4. A. J. Davidson and B. Moss, J. Mol. Biol., 210, 771-784. 5. P. L. Earl, et al., Journal of Virology 64, 2448-2451, 1990. 6. J. Esposito, et al., Virology 165, 313. 7. F. A. Ferrari, et al., Journal of Bacteriology 161, 556-562, 1985. 8. U. Gubler and B. J. Hoffman, Gene 25, 263-269. 9. D. Hanahan, Molecular Biology 166, 557-580, 1983. 10. M. A. Innis, et al., PCR Protocols A Guide to Methods and Applications, 84-91, Academic Press, Inc., San Diego 1990. 11. Maniatis, et al., Molecular Cloning, Cold Spring Harbor Laboratory, New York 1982. 12. L. J. N. Ross, et al., Journal of General Virology, 70, 1789-1804 (1989). 13. L. J. N. Ross, et al., Journal of General Virology, 72, 949-954 (1991). 14. J. Sambrook, et al., Molecular Cloning A Laboratory Manual Second Edition, Cold Spring Harbor Press, 1989. 15. J. Taylor, et al., Vaccine 9, 190-193, 1991. __________________________________________________________________________# SEQUENCE LISTING- (1) GENERAL INFORMATION:- (iii) NUMBER OF SEQUENCES: 20- (2) INFORMATION FOR SEQ ID NO:1:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 28 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (iii) HYPOTHETICAL: NO- (iv) ANTI-SENSE: NO- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:# 28 CCCT CGAGGCCA- (2) INFORMATION FOR SEQ ID NO:2:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 28 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (iii) HYPOTHETICAL: NO- (iv) ANTI-SENSE: NO- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:# 28 GCCG CGGCCGCC- (2) INFORMATION FOR SEQ ID NO:3:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 1507 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (iii) HYPOTHETICAL: NO- (iv) ANTI-SENSE: NO- (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 260..1411- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:- CTACTTCATA AAAAGTTTAA ACCTTCCGAA AGATTTTTGG ATAAAAGTAG AG - #AACTCGCA 60- TTGCGATTAT GCTCTAGGAC AATCCTGTAA AGTGTCTCGA TCTTAGCATA TA - #GATAAATG 120- TTTGAACTAA TATCCTAAAG CCTGTATGTA ACAGTTGGTG CCTATTGAAA GA - #TACTGATT 180- ATCAAGGAGA AGAATAATAT AAATCGTAAA AATAATACTT ATTATATAAT AT - #AATGTATA 240- ATAATATACA AAAACAGCC ATG ATA CGT ATT ATA ATA TTA - # TCG TTA TTA TTT 292# Met Ile Arg Ile Ile Ile Leu Ser Leu - # Leu Phe# 10- ATT AAC GTA ACA ACA GAT AGT CAA GAA TCT TC - #A AAA AAT ATA CAA AAT340Ile Asn Val Thr Thr Asp Ser Gln Glu Ser Se - #r Lys Asn Ile Gln Asn# 25- GTA TTG CAC GTT ACA GAA TAT AGT AGA ACT GG - #T GTA ACA GCT TGC TCG388Val Leu His Val Thr Glu Tyr Ser Arg Thr Gl - #y Val Thr Ala Cys Ser# 40- TTA CAT TGT TTT GAT CGT TCC AAA GGT TTA GA - #T CAA CCA AAA ACA TTT436Leu His Cys Phe Asp Arg Ser Lys Gly Leu As - #p Gln Pro Lys Thr Phe# 55- ATC CTG CCT GGT AAA TAT AGC AAT AAC AGT AT - #A AAA CTA GAA GTA GCT484Ile Leu Pro Gly Lys Tyr Ser Asn Asn Ser Il - #e Lys Leu Glu Val Ala# 75- ATT GAT ACA TAT AAA AAA GAT AGC GAC TTC AG - #T TAT TCT CAC CCA TGT532Ile Asp Thr Tyr Lys Lys Asp Ser Asp Phe Se - #r Tyr Ser His Pro Cys# 90- CAA ATA TTC CAG TTC TGT GTG TCT GGT AAT TT - #T AGT GGT AAA CGG TTC580Gln Ile Phe Gln Phe Cys Val Ser Gly Asn Ph - #e Ser Gly Lys Arg Phe# 105- GAT CAT TAT CTA TAT GGG TAT ACA ATT TCC GG - #A TTT ATA GAT ATT GCT628Asp His Tyr Leu Tyr Gly Tyr Thr Ile Ser Gl - #y Phe Ile Asp Ile Ala# 120- CCA AAA TAT TAT AGC GGT ATG TCT ATA AGT AC - #T ATT ACT GTT ATG CCA676Pro Lys Tyr Tyr Ser Gly Met Ser Ile Ser Th - #r Ile Thr Val Met Pro# 135- TTA CAA GAA GGA TCA TTA AAG CAT GAT GAT GC - #C GAT GAC TAT GAC TAC724Leu Gln Glu Gly Ser Leu Lys His Asp Asp Al - #a Asp Asp Tyr Asp Tyr140 1 - #45 1 - #50 1 -#55- GAT GAT GAT TGT GTT CCT TAT AAA GAA ACC CA - #G CCT CGA CAT ATG CCA772Asp Asp Asp Cys Val Pro Tyr Lys Glu Thr Gl - #n Pro Arg His Met Pro# 170- GAA TCG GTA ATA AAA GAA GGA TGT AAA CCC AT - #T CCA CTA CCA AGG TAT820Glu Ser Val Ile Lys Glu Gly Cys Lys Pro Il - #e Pro Leu Pro Arg Tyr# 185- GAT GAA AAT GAC GAT CCT ACT TGT ATT ATG TA - #T TGG GAT CAC TCG TGG 868Asp Glu Asn Asp Asp Pro Thr Cys Ile Met Ty - #r Trp Asp His Ser Trp# 200- GAT AAT TAC TGT AAT GTT GGA TTT TTT AAT TC - #T CTA CAG AGT GAT CAC 916Asp Asn Tyr Cys Asn Val Gly Phe Phe Asn Se - #r Leu Gln Ser Asp His# 215- AAT CCT CTG GTT TTT CCG TTA ACA AGT TAT TC - #T GAT ATA AAC AAT GCA 964Asn Pro Leu Val Phe Pro Leu Thr Ser Tyr Se - #r Asp Ile Asn Asn Ala220 2 - #25 2 - #30 2 -#35- TTT CAT GCT TTT CAA TCA TCT TAT TGT AGA TC - #A CTA GGC TTT AAC CAA1012Phe His Ala Phe Gln Ser Ser Tyr Cys Arg Se - #r Leu Gly Phe Asn Gln# 250- TCA TAC AGT GTA TGC GTA TCT ATA GGT GAT AC - #A CCA TTT GAG GTT ACG1060Ser Tyr Ser Val Cys Val Ser Ile Gly Asp Th - #r Pro Phe Glu Val Thr# 265- TAT CAT AGT TAT GAA AGT GTT ACT GTT GAT CA - #G TTA TTA CAA GAA ATT1108Tyr His Ser Tyr Glu Ser Val Thr Val Asp Gl - #n Leu Leu Gln Glu Ile# 280- AAA ACA CTA TAT GGA GAA GAT GCT GTA TAT GG - #A TTA CCG TTT AGA AAT1156Lys Thr Leu Tyr Gly Glu Asp Ala Val Tyr Gl - #y Leu Pro Phe Arg Asn# 295- ATA ACT ATA AGG GCG CGT ACA CGG ATT CAA AG - #T TTA CCT CTT ACT AAC1204Ile Thr Ile Arg Ala Arg Thr Arg Ile Gln Se - #r Leu Pro Leu Thr Asn300 3 - #05 3 - #10 3 -#15- AAT ACC TGT ATC CCT AAA CAA GAC GAT GCT GA - #T GAT GTT GAC GAT GCT1252Asn Thr Cys Ile Pro Lys Gln Asp Asp Ala As - #p Asp Val Asp Asp Ala# 330- GAT GAT GTT GAC GAT GCT GAT GAT GCT GAC GA - #T GAT GAT GAT TAC GAG1300Asp Asp Val Asp Asp Ala Asp Asp Ala Asp As - #p Asp Asp Asp Tyr Glu# 345- TTA TAT GTA GAA ACT ACA CCA AGA GTG CCA AC - #A GCG AGA AAA AAA CCC1348Leu Tyr Val Glu Thr Thr Pro Arg Val Pro Th - #r Ala Arg Lys Lys Pro# 360- GTT ACA GAA GAA TAT AAT GAT ATA TTT AGT AG - #T TTT GAT AAT TTT GAC1396Val Thr Glu Glu Tyr Asn Asp Ile Phe Ser Se - #r Phe Asp Asn Phe Asp# 375- ATG AAA AAG AAA TAAGACATAT TTTATTAAAT CAAAAAGTCT GT - #CGAACTTT1448Met Lys Lys Lys380- TAGTGTTTAA CCTATATCGA TTTATGATTT TTCCATGATG ATCCAGGCTA TG - #ACTGACT1507- (2) INFORMATION FOR SEQ ID NO:4:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 383 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:- Met Ile Arg Ile Ile Ile Leu Ser Leu Leu Ph - #e Ile Asn Val Thr Thr# 15- Asp Ser Gln Glu Ser Ser Lys Asn Ile Gln As - #n Val Leu His Val Thr# 30- Glu Tyr Ser Arg Thr Gly Val Thr Ala Cys Se - #r Leu His Cys Phe Asp# 45- Arg Ser Lys Gly Leu Asp Gln Pro Lys Thr Ph - #e Ile Leu Pro Gly Lys# 60- Tyr Ser Asn Asn Ser Ile Lys Leu Glu Val Al - #a Ile Asp Thr Tyr Lys# 80- Lys Asp Ser Asp Phe Ser Tyr Ser His Pro Cy - #s Gln Ile Phe Gln Phe# 95- Cys Val Ser Gly Asn Phe Ser Gly Lys Arg Ph - #e Asp His Tyr Leu Tyr# 110- Gly Tyr Thr Ile Ser Gly Phe Ile Asp Ile Al - #a Pro Lys Tyr Tyr Ser# 125- Gly Met Ser Ile Ser Thr Ile Thr Val Met Pr - #o Leu Gln Glu Gly Ser# 140- Leu Lys His Asp Asp Ala Asp Asp Tyr Asp Ty - #r Asp Asp Asp Cys Val145 1 - #50 1 - #55 1 -#60- Pro Tyr Lys Glu Thr Gln Pro Arg His Met Pr - #o Glu Ser Val Ile Lys# 175- Glu Gly Cys Lys Pro Ile Pro Leu Pro Arg Ty - #r Asp Glu Asn Asp Asp# 190- Pro Thr Cys Ile Met Tyr Trp Asp His Ser Tr - #p Asp Asn Tyr Cys Asn# 205- Val Gly Phe Phe Asn Ser Leu Gln Ser Asp Hi - #s Asn Pro Leu Val Phe# 220- Pro Leu Thr Ser Tyr Ser Asp Ile Asn Asn Al - #a Phe His Ala Phe Gln225 2 - #30 2 - #35 2 -#40- Ser Ser Tyr Cys Arg Ser Leu Gly Phe Asn Gl - #n Ser Tyr Ser Val Cys# 255- Val Ser Ile Gly Asp Thr Pro Phe Glu Val Th - #r Tyr His Ser Tyr Glu# 270- Ser Val Thr Val Asp Gln Leu Leu Gln Glu Il - #e Lys Thr Leu Tyr Gly# 285- Glu Asp Ala Val Tyr Gly Leu Pro Phe Arg As - #n Ile Thr Ile Arg Ala# 300- Arg Thr Arg Ile Gln Ser Leu Pro Leu Thr As - #n Asn Thr Cys Ile Pro305 3 - #10 3 - #15 3 -#20- Lys Gln Asp Asp Ala Asp Asp Val Asp Asp Al - #a Asp Asp Val Asp Asp# 335- Ala Asp Asp Ala Asp Asp Asp Asp Asp Tyr Gl - #u Leu Tyr Val Glu Thr# 350- Thr Pro Arg Val Pro Thr Ala Arg Lys Lys Pr - #o Val Thr Glu Glu Tyr# 365- Asn Asp Ile Phe Ser Ser Phe Asp Asn Phe As - #p Met Lys Lys Lys# 380- (2) INFORMATION FOR SEQ ID NO:5:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 2849 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (iii) HYPOTHETICAL: NO- (iv) ANTI-SENSE: NO- (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 300..1568- (ix) FEATURE: (A) NAME/KEY: CDS#(1685..2848) LOCATION: complement- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:- AAGCCAGTTT GAATTCAATA TTCATCGCCG ATAGTTGGTA GAAATACTAT TC - #ATGAAATT 60- TACCTTCTTC CGTGGCTTAA AAACTTATTG TATGTACCAT TCATTATAAG AT - #CTGATACT 120- ATCGGCATCT TCTATTTTCC GAGTTTTTTA CATCTGGTTA CTAGTATCCA TG - #TTCGTCTA 180- ATAAGAGGGA AGGAATATAT CTATCTACAT AAACATCATA AGGTTCTTTG AT - #AGATTTAT 240- ATCGCTAATA AAATATAAAT AATAATTAAA GATTTTATGA TATATCGAGC TT - #TGCAAAA 299- ATG TCT GTT GAT TGG CGT ACA GAA ATC TAT TC - #G GGT GAT ATA TCC CTA 347Met Ser Val Asp Trp Arg Thr Glu Ile Tyr Se - #r Gly Asp Ile Ser Leu# 15- GTA GAA AAA CTT ATA AAG AAT AAA GGT AAT TG - #C ATC AAT ATA TCT GTA 395Val Glu Lys Leu Ile Lys Asn Lys Gly Asn Cy - #s Ile Asn Ile Ser Val# 30- GAG GAA ACA ACA ACT CCG TTA ATA GAC GCT AT - #A AGA ACC GGA AAT GCC 443Glu Glu Thr Thr Thr Pro Leu Ile Asp Ala Il - #e Arg Thr Gly Asn Ala# 45- AAA ATA GTA GAA CTA TTT ATC AAG CAC GGA GC - #G CAA GTT AAT CAT GTA 491Lys Ile Val Glu Leu Phe Ile Lys His Gly Al - #a Gln Val Asn His Val# 60- AAT ACT AAA ATT CCT AAT CCC TTG TTA ACA GC - #T ATC AAA ATA GGA TCA 539Asn Thr Lys Ile Pro Asn Pro Leu Leu Thr Al - #a Ile Lys Ile Gly Ser# 80- CAC GAT ATA GTA AAA CTG CTG TTG ATT AAC GG - #A GTT GAT ACT TCT ATT 587His Asp Ile Val Lys Leu Leu Leu Ile Asn Gl - #y Val Asp Thr Ser Ile# 95- TTG CCA GTC CCC TGC ATA AAT AAA GAA ATG AT - #A AAA ACT ATA TTA GAT 635Leu Pro Val Pro Cys Ile Asn Lys Glu Met Il - #e Lys Thr Ile Leu Asp# 110- AGT GGT GTG AAA GTA AAC ACA AAA AAT GCT AA - #A TCT AAA ACT TTC TTG 683Ser Gly Val Lys Val Asn Thr Lys Asn Ala Ly - #s Ser Lys Thr Phe Leu# 125- CAT TAC GCG ATT AAG AAT AAT GAC TTA GAG GT - #T ATC AAA ATG CTT TTT 731His Tyr Ala Ile Lys Asn Asn Asp Leu Glu Va - #l Ile Lys Met Leu Phe# 140- GAG TAT GGA GCT GAT GTT AAT ATA AAA GAT GA - #T AAC ATA TGT TAT TCT 779Glu Tyr Gly Ala Asp Val Asn Ile Lys Asp As - #p Asn Ile Cys Tyr Ser145 1 - #50 1 - #55 1 -#60- ATA CAC ATA GCT ACT AGG AGT AAT TCA TAT GA - #A ATC ATA AAA TTA CTA 827Ile His Ile Ala Thr Arg Ser Asn Ser Tyr Gl - #u Ile Ile Lys Leu Leu# 175- TTA GAA AAA GGT GCT TAT GCA AAC GTA AAA GA - #C AAT TAT GGT AAT TCT 875Leu Glu Lys Gly Ala Tyr Ala Asn Val Lys As - #p Asn Tyr Gly Asn Ser# 190- CCG TTA CAT AAC GCG GCT AAA TAT GGC GAT TA - #T GCT TGT ATT AAA TTA 923Pro Leu His Asn Ala Ala Lys Tyr Gly Asp Ty - #r Ala Cys Ile Lys Leu# 205- GTT TTA GAC CAT ACT AAT AAC ATA AGC AAT AA - #G TGC AAC AAC GGT GTT 971Val Leu Asp His Thr Asn Asn Ile Ser Asn Ly - #s Cys Asn Asn Gly Val# 220- ACA CCG TTA CAT AAC GCT ATA CTA TAT AAT AG - #A TCT GCC GTA GAA TTA1019Thr Pro Leu His Asn Ala Ile Leu Tyr Asn Ar - #g Ser Ala Val Glu Leu225 2 - #30 2 - #35 2 -#40- CTG ATT AAC AAT CGA TCT ATT AAT GAT ACG GA - #T GTA GAC GGA TAT ACT1067Leu Ile Asn Asn Arg Ser Ile Asn Asp Thr As - #p Val Asp Gly Tyr Thr# 255- CCA CTA CAT TAT GCT TTG CAA CCT CCG TGT AG - #T ATA GAT ATT ATA GAT1115Pro Leu His Tyr Ala Leu Gln Pro Pro Cys Se - #r Ile Asp Ile Ile Asp# 270- ATA CTA CTA TAT AAC AAC GCC GAT ATA TCT AT - #A AAA GAT AAT AAC GGA1163Ile Leu Leu Tyr Asn Asn Ala Asp Ile Ser Il - #e Lys Asp Asn Asn Gly# 285- CGC AAT CCT ATC GAT ACG GCG TTT AAG TAT AT - #T AAC AGA GAT AGC GTT1211Arg Asn Pro Ile Asp Thr Ala Phe Lys Tyr Il - #e Asn Arg Asp Ser Val# 300- ATA AAA GAA CTT CTC CGA AAC GCC GTG TTA AT - #T AAC GAG GTC GGT AAA1259Ile Lys Glu Leu Leu Arg Asn Ala Val Leu Il - #e Asn Glu Val Gly Lys305 3 - #10 3 - #15 3 -#20- TTA AAA GAT ACT ACT ATC TTA GAA CAC AAA GA - #A ATA AAA GAC AAT ACC1307Leu Lys Asp Thr Thr Ile Leu Glu His Lys Gl - #u Ile Lys Asp Asn Thr# 335- GTG TTT TCA AAC TTT GTG TAC GAA TGT AAT GA - #A GAA ATT AAA AAA ATG1355Val Phe Ser Asn Phe Val Tyr Glu Cys Asn Gl - #u Glu Ile Lys Lys Met# 350- AAG AAA ACT AAA TGT GTC GGT GAC TAT AGT AT - #G TTT GAC GTA TAC ATG1403Lys Lys Thr Lys Cys Val Gly Asp Tyr Ser Me - #t Phe Asp Val Tyr Met# 365- ATA AGG TAT AAA CAC AAA TAT GAC GGT AAT AA - #G GAT AGT ATT AAA GAC1451Ile Arg Tyr Lys His Lys Tyr Asp Gly Asn Ly - #s Asp Ser Ile Lys Asp# 380- TAT TTG CGT TGT CTT GAT GAT AAT AGT ACT CG - #T ATG TTA AAA ACT ATA1499Tyr Leu Arg Cys Leu Asp Asp Asn Ser Thr Ar - #g Met Leu Lys Thr Ile385 3 - #90 3 - #95 4 -#00- GAT ATT AAT GAA TTT CCT ATA TAT TCT ATG TA - #T CTC GTA AGA TGC CTA1547Asp Ile Asn Glu Phe Pro Ile Tyr Ser Met Ty - #r Leu Val Arg Cys Leu# 415- TAT GAT ATG GTA ATA TAT TAAAAGAAAT GGGCTCTTGC AT - #ACATAATC1595Tyr Asp Met Val Ile Tyr 420- GGTATAAAAA ATAACGAAAT TATTAGCGGT TACATATCTT ACGGCGGCCG CG - #GCCCTCGA1655- GGCCAGTAGC TCAGTATTTC CTATAAACTC TAATATTGAG AGTTTGATAT CC - #GGAGAAGT1715- TTAGACCAAC CGCTAGAATC TAATATTTCA TCTAATTTTG ATCTACTTTT TT - #CTAATATT1775- TTATGTCTAT TACTGGCTAA GGATATGGAA GTTTTAAGAC GATCTCCGTA AT - #TATAGAAA1835- TAGTAAGTAT TAATTTCCTT TATTATAGGA TTATTTACTA AGTGATGTAA CA - #GGTTCATG1895- TTTTTACTAA TAACGAATAT ATCTAAAGAG TAAAACATAT TAATACGAAT TT - #TAGATATA1955- TCTTTTAGTT CTTCCTTACA ACTCAACCAA ATACTTTTAA ACGTATCATC GC - #TTTGAATA2015- ATTTCTCTCA AGGGGTTTAC TTCACTTCTG ATATCGTGAC GTATAAAATC TT - #GTATACAT2075- ATATGTGCTA TGATATATCT AAAAGAAAAC ATATTACTGT TAAGGCTCTT AT - #CGATGACC2135- CTACTATCTC TAAGTTCAGC ACCATAATGT AATAATATAT TTACTATACC AT - #GATATTCT2195- AATGCTATTA ATAAAGGATA TTGATTCCTT ATGTTAATAG CATTTACATC CG - #CTCCGTTA2255- TCTAATAACA TTTTTATAAC TTCTGGTTTA CAATTCTTTT TACACGCATA AT - #GCAACGGA2315- GTAGATAAGT ATTTGTTTTT AGAATTAACA TTAGCTCCTC TATCTATGAG CG - #TTTTTACA2375- CTCATATACG GATTTGTTCC ATATAAGGCA AAATGTAAAA CCGTTCCTAT CT - #TCTGCGAT2435- AACGCTTCTA TATCGGCCCC GTAATCTAAA AGAGTGTTTA TGATAACTAC AT - #TGTTTCTT2495- ACAGCGGCAT AATGAATAGG CGTCTTGTCA CAATAATCTC TAGCATTTAC GT - #TCGCTCCC2555- AATTCTAACA ACGTTATAAC TGTATCTTTA TATCTATCTA GAGTAGAGGC TT - #GATGTAAT2615- GGAGTGATAT ACAGACTATC AGCGGCGTTA ACATCTGCAC CCCGCATTAT TA - #AAGTTCTA2675- ATGTTTTCTG TATCGTATCC ATTCTTAGCC ATGAGATACA GAGGAGTTTC TC - #CTTTAATG2735- TTTTTAGCGT TAACATCTAT TCCTCTTTCC AATAACTTGG GTACTAGTCT AC - #TTAACGAA2795- GGTGCTTGTA CCGTGTAATG CAAAGGAGTA TTCTTATAAA CATCTATAGA AT - #TC2849- (2) INFORMATION FOR SEQ ID NO:6:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 422 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:- Met Ser Val Asp Trp Arg Thr Glu Ile Tyr Se - #r Gly Asp Ile Ser Leu# 15- Val Glu Lys Leu Ile Lys Asn Lys Gly Asn Cy - #s Ile Asn Ile Ser Val# 30- Glu Glu Thr Thr Thr Pro Leu Ile Asp Ala Il - #e Arg Thr Gly Asn Ala# 45- Lys Ile Val Glu Leu Phe Ile Lys His Gly Al - #a Gln Val Asn His Val# 60- Asn Thr Lys Ile Pro Asn Pro Leu Leu Thr Al - #a Ile Lys Ile Gly Ser# 80- His Asp Ile Val Lys Leu Leu Leu Ile Asn Gl - #y Val Asp Thr Ser Ile# 95- Leu Pro Val Pro Cys Ile Asn Lys Glu Met Il - #e Lys Thr Ile Leu Asp# 110- Ser Gly Val Lys Val Asn Thr Lys Asn Ala Ly - #s Ser Lys Thr Phe Leu# 125- His Tyr Ala Ile Lys Asn Asn Asp Leu Glu Va - #l Ile Lys Met Leu Phe# 140- Glu Tyr Gly Ala Asp Val Asn Ile Lys Asp As - #p Asn Ile Cys Tyr Ser145 1 - #50 1 - #55 1 -#60- Ile His Ile Ala Thr Arg Ser Asn Ser Tyr Gl - #u Ile Ile Lys Leu Leu# 175- Leu Glu Lys Gly Ala Tyr Ala Asn Val Lys As - #p Asn Tyr Gly Asn Ser# 190- Pro Leu His Asn Ala Ala Lys Tyr Gly Asp Ty - #r Ala Cys Ile Lys Leu# 205- Val Leu Asp His Thr Asn Asn Ile Ser Asn Ly - #s Cys Asn Asn Gly Val# 220- Thr Pro Leu His Asn Ala Ile Leu Tyr Asn Ar - #g Ser Ala Val Glu Leu225 2 - #30 2 - #35 2 -#40- Leu Ile Asn Asn Arg Ser Ile Asn Asp Thr As - #p Val Asp Gly Tyr Thr# 255- Pro Leu His Tyr Ala Leu Gln Pro Pro Cys Se - #r Ile Asp Ile Ile Asp# 270- Ile Leu Leu Tyr Asn Asn Ala Asp Ile Ser Il - #e Lys Asp Asn Asn Gly# 285- Arg Asn Pro Ile Asp Thr Ala Phe Lys Tyr Il - #e Asn Arg Asp Ser Val# 300- Ile Lys Glu Leu Leu Arg Asn Ala Val Leu Il - #e Asn Glu Val Gly Lys305 3 - #10 3 - #15 3 -#20- Leu Lys Asp Thr Thr Ile Leu Glu His Lys Gl - #u Ile Lys Asp Asn Thr# 335- Val Phe Ser Asn Phe Val Tyr Glu Cys Asn Gl - #u Glu Ile Lys Lys Met# 350- Lys Lys Thr Lys Cys Val Gly Asp Tyr Ser Me - #t Phe Asp Val Tyr Met# 365- Ile Arg Tyr Lys His Lys Tyr Asp Gly Asn Ly - #s Asp Ser Ile Lys Asp# 380- Tyr Leu Arg Cys Leu Asp Asp Asn Ser Thr Ar - #g Met Leu Lys Thr Ile385 3 - #90 3 - #95 4 -#00- Asp Ile Asn Glu Phe Pro Ile Tyr Ser Met Ty - #r Leu Val Arg Cys Leu# 415- Tyr Asp Met Val Ile Tyr 420- (2) INFORMATION FOR SEQ ID NO:7:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 387 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:- Asn Ser Ile Asp Val Tyr Lys Asn Thr Pro Le - #u His Tyr Thr Val Gln# 15- Ala Pro Ser Leu Ser Arg Leu Val Pro Lys Le - #u Leu Glu Arg Gly Ile# 30- Asp Val Asn Ala Lys Asn Ile Lys Gly Glu Th - #r Pro Leu Tyr Leu Met# 45- Ala Lys Asn Gly Tyr Asp Thr Glu Asn Ile Ar - #g Thr Leu Ile Met Arg# 60- Gly Ala Asp Val Asn Ala Ala Asp Ser Leu Ty - #r Ile Thr Pro Leu His# 80- Gln Ala Ser Thr Leu Asp Arg Tyr Lys Asp Th - #r Val Ile Thr Leu Leu# 95- Glu Leu Gly Ala Asn Val Asn Ala Arg Asp Ty - #r Cys Asp Lys Thr Pro# 110- Ile His Tyr Ala Ala Val Arg Asn Asn Val Va - #l Ile Ile Asn Thr Leu# 125- Leu Asp Tyr Gly Ala Asp Ile Glu Ala Leu Se - #r Gln Lys Ile Gly Thr# 140- Val Leu His Phe Ala Leu Tyr Gly Thr Asn Pr - #o Tyr Met Ser Val Lys145 1 - #50 1 - #55 1 -#60- Thr Leu Ile Asp Arg Gly Ala Asn Val Asn Se - #r Lys Asn Lys Tyr Leu# 175- Ser Thr Pro Leu His Tyr Ala Cys Lys Lys As - #n Cys Lys Pro Glu Val# 190- Ile Lys Met Leu Leu Asp Asn Gly Ala Asp Va - #l Asn Ala Ile Asn Ile# 205- Arg Asn Gln Tyr Pro Leu Leu Ile Ala Leu Gl - #u Tyr His Gly Ile Val# 220- Asn Ile Leu Leu His Tyr Gly Ala Glu Leu Ar - #g Asp Ser Arg Val Ile225 2 - #30 2 - #35 2 -#40- Asp Lys Ser Leu Asn Ser Asn Met Phe Ser Ph - #e Arg Tyr Ile Ile Ala# 255- His Ile Cys Ile Gln Asp Phe Ile Arg His As - #p Ile Arg Ser Glu Val# 270- Asn Pro Leu Arg Glu Ile Ile Gln Ser Asp As - #p Thr Phe Lys Ser Ile# 285- Trp Leu Ser Cys Lys Glu Glu Leu Lys Asp Il - #e Ser Lys Ile Arg Ile# 300- Asn Met Phe Tyr Ser Leu Asp Ile Phe Val Il - #e Ser Lys Asn Met Asn305 3 - #10 3 - #15 3 -#20- Leu Leu His His Leu Val Asn Asn Pro Ile Il - #e Lys Glu Ile Asn Thr# 335- Tyr Tyr Phe Tyr Asn Tyr Gly Asp Arg Leu Ly - #s Thr Ser Ile Ser Leu# 350- Ala Ser Asn Arg His Lys Ile Leu Glu Lys Se - #r Arg Ser Lys Leu Asp# 365- Glu Ile Leu Asp Ser Ser Gly Trp Ser Lys Le - #u Leu Arg Ile Ser Asn# 380- Ser Gln Tyr385- (2) INFORMATION FOR SEQ ID NO:8:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 40 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (iii) HYPOTHETICAL: NO- (iv) ANTI-SENSE: NO- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:# 40 TTCT AATTTATTGC ACGGAGATCT- (2) INFORMATION FOR SEQ ID NO:9:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 32 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (iii) HYPOTHETICAL: NO- (iv) ANTI-SENSE: NO- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:# 32 TTTC TATGCTATAA AT- (2) INFORMATION FOR SEQ ID NO:10:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 37 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (iii) HYPOTHETICAL: NO- (iv) ANTI-SENSE: NO- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:# 37 TTGT AATTATCGAT AATAAAT- (2) INFORMATION FOR SEQ ID NO:11:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 42 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (iii) HYPOTHETICAL: NO- (iv) ANTI-SENSE: NO- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:11:# 42 TTTT GGCATATAAA TGAATTCGGA TC- (2) INFORMATION FOR SEQ ID NO:12:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 4177 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (iii) HYPOTHETICAL: NO- (iv) ANTI-SENSE: NO- (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 115..1860- (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 2095..3756- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:12:- CATACTGGCC TCGAGGGCCG CGGCCGCCTG CAGGTCGACT CTAGAAAAAA TT - #GAAAAACT 60- ATTCTAATTT ATTGCACGGA GATCTTTTTT TTTTTTTTTT TTTTTGGCAT AT - #AA ATG 117# Met# 1- AAT TCG GAT CCG GAC CGC GCC GTT AGC CAA GT - #T GCG TTA GAG AAT GAT 165Asn Ser Asp Pro Asp Arg Ala Val Ser Gln Va - #l Ala Leu Glu Asn Asp# 15- GAA AGA GAG GCA AAA AAT ACA TGG CGC TTG AT - #A TTC CGG ATT GCA ATC 213Glu Arg Glu Ala Lys Asn Thr Trp Arg Leu Il - #e Phe Arg Ile Ala Ile# 30- TTA TTC TTA ACA GTA GTG ACC TTG GCT ATA TC - #T GTA GCC TCC CTT TTA 261Leu Phe Leu Thr Val Val Thr Leu Ala Ile Se - #r Val Ala Ser Leu Leu# 45- TAT AGC ATG GGG GCT AGC ACA CCT AGC GAT CT - #T GTA GGC ATA CCG ACT 309Tyr Ser Met Gly Ala Ser Thr Pro Ser Asp Le - #u Val Gly Ile Pro Thr# 65- AGG ATT TCC AGG GCA GAA GAA AAG ATT ACA TC - #T ACA CTT GGT TCC AAT 357Arg Ile Ser Arg Ala Glu Glu Lys Ile Thr Se - #r Thr Leu Gly Ser Asn# 80- CAA GAT GTA GTA GAT AGG ATA TAT AAG CAA GT - #G GCC CTT GAG TCT CCA 405Gln Asp Val Val Asp Arg Ile Tyr Lys Gln Va - #l Ala Leu Glu Ser Pro# 95- TTG GCA TTG TTA AAT ACT GAG ACC ACA ATT AT - #G AAC GCA ATA ACA TCT 453Leu Ala Leu Leu Asn Thr Glu Thr Thr Ile Me - #t Asn Ala Ile Thr Ser# 110- CTC TCT TAT CAG ATT AAT GGA GCT GCA AAC AA - #C AGC GGG TGG GGG GCA 501Leu Ser Tyr Gln Ile Asn Gly Ala Ala Asn As - #n Ser Gly Trp Gly Ala# 125- CCT ATT CAT GAC CCA GAT TAT ATA GGG GGG AT - #A GGC AAA GAA CTC ATT 549Pro Ile His Asp Pro Asp Tyr Ile Gly Gly Il - #e Gly Lys Glu Leu Ile130 1 - #35 1 - #40 1 -#45- GTA GAT GAT GCT AGT GAT GTC ACA TCA TTC TA - #T CCC TCT GCA TTT CAA 597Val Asp Asp Ala Ser Asp Val Thr Ser Phe Ty - #r Pro Ser Ala Phe Gln# 160- GAA CAT CTG AAT TTT ATC CCG GCG CCT ACT AC - #A GGA TCA GGT TGC ACT 645Glu His Leu Asn Phe Ile Pro Ala Pro Thr Th - #r Gly Ser Gly Cys Thr# 175- CGA ATA CCC TCA TTT GAC ATG AGT GCT ACC CA - #T TAC TGC TAC ACC CAT 693Arg Ile Pro Ser Phe Asp Met Ser Ala Thr Hi - #s Tyr Cys Tyr Thr His# 190- AAT GTA ATA TTG TCT GGA TGC AGA GAT CAC TC - #A CAC TCA CAT CAG TAT 741Asn Val Ile Leu Ser Gly Cys Arg Asp His Se - #r His Ser His Gln Tyr# 205- TTA GCA CTT GGT GTG CTC CGG ACA TCT GCA AC - #A GGG AGG GTA TTC TTT 789Leu Ala Leu Gly Val Leu Arg Thr Ser Ala Th - #r Gly Arg Val Phe Phe210 2 - #15 2 - #20 2 -#25- TCT ACT CTG CGT TCC ATC AAC CTG GAC GAC AC - #C CAA AAT CGG AAG TCT 837Ser Thr Leu Arg Ser Ile Asn Leu Asp Asp Th - #r Gln Asn Arg Lys Ser# 240- TGC AGT GTG AGT GCA ACT CCC CTG GGT TGT GA - #T ATG CTG TGC TCG AAA 885Cys Ser Val Ser Ala Thr Pro Leu Gly Cys As - #p Met Leu Cys Ser Lys# 255- GCC ACG GAG ACA GAG GAA GAA GAT TAT AAC TC - #A GCT GTC CCT ACG CGG 933Ala Thr Glu Thr Glu Glu Glu Asp Tyr Asn Se - #r Ala Val Pro Thr Arg# 270- ATG GTA CAT GGG AGG TTA GGG TTC GAC GGC CA - #A TAT CAC GAA AAG GAC 981Met Val His Gly Arg Leu Gly Phe Asp Gly Gl - #n Tyr His Glu Lys Asp# 285- CTA GAT GTC ACA ACA TTA TTC GGG GAC TGG GT - #G GCC AAC TAC CCA GGA1029Leu Asp Val Thr Thr Leu Phe Gly Asp Trp Va - #l Ala Asn Tyr Pro Gly290 2 - #95 3 - #00 3 -#05- GTA GGG GGT GGA TCT TTT ATT GAC AGC CGC GT - #G TGG TTC TCA GTC TAC1077Val Gly Gly Gly Ser Phe Ile Asp Ser Arg Va - #l Trp Phe Ser Val Tyr# 320- GGA GGG TTA AAA CCC AAT ACA CCC AGT GAC AC - #T GTA CAG GAA GGG AAA1125Gly Gly Leu Lys Pro Asn Thr Pro Ser Asp Th - #r Val Gln Glu Gly Lys# 335- TAT GTG ATA TAC AAG CGA TAC AAT GAC ACA TG - #C CCA GAT GAG CAA GAC1173Tyr Val Ile Tyr Lys Arg Tyr Asn Asp Thr Cy - #s Pro Asp Glu Gln Asp# 350- TAC CAG ATT CGA ATG GCC AAG TCT TCG TAT AA - #G CCT GGA CGG TTT GGT1221Tyr Gln Ile Arg Met Ala Lys Ser Ser Tyr Ly - #s Pro Gly Arg Phe Gly# 365- GGG AAA CGC ATA CAG CAG GCT ATC TTA TCT AT - #C AAA GTG TCA ACA TCC1269Gly Lys Arg Ile Gln Gln Ala Ile Leu Ser Il - #e Lys Val Ser Thr Ser370 3 - #75 3 - #80 3 -#85- TTA GGC GAA GAC CCG GTA CTG ACT GTA CCG CC - #C AAC ACA GTC ACA CTC1317Leu Gly Glu Asp Pro Val Leu Thr Val Pro Pr - #o Asn Thr Val Thr Leu# 400- ATG GGG GCC GAA GGC AGA ATT CTC ACA GTA GG - #G ACA TCC CAT TTC TTG1365Met Gly Ala Glu Gly Arg Ile Leu Thr Val Gl - #y Thr Ser His Phe Leu# 415- TAT CAG CGA GGG TCA TCA TAC TTC TCT CCC GC - #G TTA TTA TAT CCT ATG1413Tyr Gln Arg Gly Ser Ser Tyr Phe Ser Pro Al - #a Leu Leu Tyr Pro Met# 430- ACA GTC AGC AAC AAA ACA GCC ACT CTT CAT AG - #T CCT TAT ACA TTC AAT1461Thr Val Ser Asn Lys Thr Ala Thr Leu His Se - #r Pro Tyr Thr Phe Asn# 445- GCC TTC ACT CGG CCA GGT AGT ATC CCT TGC CA - #G GCT TCA GCA AGA TGC1509Ala Phe Thr Arg Pro Gly Ser Ile Pro Cys Gl - #n Ala Ser Ala Arg Cys450 4 - #55 4 - #60 4 -#65- CCC AAC TCA TGT GTT ACT GGA GTC TAT ACA GA - #T CCA TAT CCC CTA ATC1557Pro Asn Ser Cys Val Thr Gly Val Tyr Thr As - #p Pro Tyr Pro Leu Ile# 480- TTC TAT AGA AAC CAC ACC TTG CGA GGG GTA TT - #C GGG ACA ATG CTT GAT1605Phe Tyr Arg Asn His Thr Leu Arg Gly Val Ph - #e Gly Thr Met Leu Asp# 495- GGT GAA CAA GCA AGA CTT AAC CCT GCG TCT GC - #A GTA TTC GAT AGC ACA1653Gly Glu Gln Ala Arg Leu Asn Pro Ala Ser Al - #a Val Phe Asp Ser Thr# 510- TCC CGC AGT CGC ATA ACT CGA GTG AGT TCA AG - #C AGC ATC AAA GCA GCA1701Ser Arg Ser Arg Ile Thr Arg Val Ser Ser Se - #r Ser Ile Lys Ala Ala# 525- TAC ACA ACA TCA ACT TGT TTT AAA GTG GTC AA - #G ACC AAT AAG ACC TAT1749Tyr Thr Thr Ser Thr Cys Phe Lys Val Val Ly - #s Thr Asn Lys Thr Tyr530 5 - #35 5 - #40 5 -#45- TGT CTC AGC ATT GCT GAA ATA TCT AAT ACT CT - #C TTC GGA GAA TTC AGA1797Cys Leu Ser Ile Ala Glu Ile Ser Asn Thr Le - #u Phe Gly Glu Phe Arg# 560- ATC GTC CCG TTA CTA GTT GAG ATC CTC AAA GA - #T GAC GGG GTT AGA GAA1845Ile Val Pro Leu Leu Val Glu Ile Leu Lys As - #p Asp Gly Val Arg Glu# 575- GCC AGG TCT GGC TAGTTGAGTC AACTATGAAA GAGTTGGAAA GA - #TGGCATTG1897Ala Arg Ser Gly 580- TATCACCTAT CTTCTGCGAC ATCAAGAATC AAACCGAATG CCCGGATCCA TA - #ATTAATTA1957- ATTAATTTTT ATCCCTCGAC TCTAGAAAAA ATTGAAAAAC TATTCTAATT TA - #TTGCACGG2017- AGATCTTTTT TTTTTTTTTT TTTTTTGGCA TATAAATGAA TTCGGATCGA TC - #CCGGTTGG2077#AAG AAC CCA GCA 2127GC TCC AGA CCT TCT ACC#Alat Gly Ser Arg Pro Ser Thr Lys Asn Pro#10- CCT ATG ATG CTG ACT ATC CGG GTC GCG CTG GT - #A CTG AGT TGC ATC TGT2175Pro Met Met Leu Thr Ile Arg Val Ala Leu Va - #l Leu Ser Cys Ile Cys# 25- CCG GCA AAC TCC ATT GAT GGC AGG CCT CTT GC - #A GCT GCA GGA ATT GTG2223Pro Ala Asn Ser Ile Asp Gly Arg Pro Leu Al - #a Ala Ala Gly Ile Val# 40- GTT ACA GGA GAC AAA GCA GTC AAC ATA TAC AC - #C TCA TCC CAG ACA GGA2271Val Thr Gly Asp Lys Ala Val Asn Ile Tyr Th - #r Ser Ser Gln Thr Gly# 55- TCA ATC ATA GTT AAG CTC CTC CCG AAT CTG CC - #A AAG GAT AAG GAG GCA2319Ser Ile Ile Val Lys Leu Leu Pro Asn Leu Pr - #o Lys Asp Lys Glu Ala# 75- TGT GCG AAA GCC CCC TTG GAT GCA TAC AAC AG - #G ACA TTG ACC ACT TTG2367Cys Ala Lys Ala Pro Leu Asp Ala Tyr Asn Ar - #g Thr Leu Thr Thr Leu# 90- CTC ACC CCC CTT GGT GAC TCT ATC CGT AGG AT - #A CAA GAG TCT GTG ACT2415Leu Thr Pro Leu Gly Asp Ser Ile Arg Arg Il - #e Gln Glu Ser Val Thr# 105- ACA TCT GGA GGG GGG AGA CAG GGG CGC CTT AT - #A GGC GCC ATT ATT GGC2463Thr Ser Gly Gly Gly Arg Gln Gly Arg Leu Il - #e Gly Ala Ile Ile Gly# 120- GGT GTG GCT CTT GGG GTT GCA ACT GCC GCA CA - #A ATA ACA GCG GCC GCA2511Gly Val Ala Leu Gly Val Ala Thr Ala Ala Gl - #n Ile Thr Ala Ala Ala# 135- GCT CTG ATA CAA GCC AAA CAA AAT GCT GCC AA - #C ATC CTC CGA CTT AAA2559Ala Leu Ile Gln Ala Lys Gln Asn Ala Ala As - #n Ile Leu Arg Leu Lys140 1 - #45 1 - #50 1 -#55- GAG AGC ATT GCC GCA ACC AAT GAG GCT GTG CA - #T GAG GTC ACT GAC GGA2607Glu Ser Ile Ala Ala Thr Asn Glu Ala Val Hi - #s Glu Val Thr Asp Gly# 170- TTA TCG CAA CTA GCA GTG GCA GTT GGG AAG AT - #G CAG CAG TTC GTT AAT2655Leu Ser Gln Leu Ala Val Ala Val Gly Lys Me - #t Gln Gln Phe Val Asn# 185- GAC CAA TTT AAT AAA ACA GCT CAG GAA TTA GA - #C TGC ATC AAA ATT GCA2703Asp Gln Phe Asn Lys Thr Ala Gln Glu Leu As - #p Cys Ile Lys Ile Ala# 200- CAG CAA GTT GGT GTA GAG CTC AAC CTG TAC CT - #A ACC GAA TCG ACT ACA2751Gln Gln Val Gly Val Glu Leu Asn Leu Tyr Le - #u Thr Glu Ser Thr Thr# 215- GTA TTC GGA CCA CAA ATC ACT TCA CCT GCC TT - #A AAC AAG CTG ACT ATT2799Val Phe Gly Pro Gln Ile Thr Ser Pro Ala Le - #u Asn Lys Leu Thr Ile220 2 - #25 2 - #30 2 -#35- CAG GCA CTT TAC AAT CTA GCT GGT GGG AAT AT - #G GAT TAC TTA TTG ACT2847Gln Ala Leu Tyr Asn Leu Ala Gly Gly Asn Me - #t Asp Tyr Leu Leu Thr# 250- AAG TTA GGT ATA GGG AAC AAT CAA CTC AGC TC - #A TTA ATC GGT AGC GGC2895Lys Leu Gly Ile Gly Asn Asn Gln Leu Ser Se - #r Leu Ile Gly Ser Gly# 265- TTA ATC ACC GGT AAC CCT ATT CTA TAC GAC TC - #A CAG ACT CAA CTC TTG2943Leu Ile Thr Gly Asn Pro Ile Leu Tyr Asp Se - #r Gln Thr Gln Leu Leu# 280- GGT ATA CAG GTA ACT CTA CCT TCA GTC GGG AA - #C CTA AAT AAT ATG CGT2991Gly Ile Gln Val Thr Leu Pro Ser Val Gly As - #n Leu Asn Asn Met Arg# 295- GCC ACC TAC TTG GAA ACC TTA TCC GTA AGC AC - #A ACC AGG GGA TTT GCC3039Ala Thr Tyr Leu Glu Thr Leu Ser Val Ser Th - #r Thr Arg Gly Phe Ala300 3 - #05 3 - #10 3 -#15- TCG GCA CTT GTC CCA AAA GTG GTG ACA CGG GT - #C GGT TCT GTG ATA GAA3087Ser Ala Leu Val Pro Lys Val Val Thr Arg Va - #l Gly Ser Val Ile Glu# 330- GAA CTT GAC ACC TCA TAC TGT ATA GAA ACT GA - #C TTA GAT TTA TAT TGT3135Glu Leu Asp Thr Ser Tyr Cys Ile Glu Thr As - #p Leu Asp Leu Tyr Cys# 345- ACA AGA ATA GTA ACG TTC CCT ATG TCC CCT GG - #T ATT TAC TCC TGC TTG3183Thr Arg Ile Val Thr Phe Pro Met Ser Pro Gl - #y Ile Tyr Ser Cys Leu# 360- AGC GGC AAT ACA TCG GCC TGT ATG TAC TCA AA - #G ACC GAA GGC GCA CTT3231Ser Gly Asn Thr Ser Ala Cys Met Tyr Ser Ly - #s Thr Glu Gly Ala Leu# 375- ACT ACA CCA TAT ATG ACT ATC AAA GGC TCA GT - #C ATC GCT AAC TGC AAG3279Thr Thr Pro Tyr Met Thr Ile Lys Gly Ser Va - #l Ile Ala Asn Cys Lys380 3 - #85 3 - #90 3 -#95- ATG ACA ACA TGT AGA TGT GTA AAC CCC CCG GG - #T ATC ATA TCG CAA AAC3327Met Thr Thr Cys Arg Cys Val Asn Pro Pro Gl - #y Ile Ile Ser Gln Asn# 410- TAT GGA GAA GCC GTG TCT CTA ATA GAT AAA CA - #A TCA TGC AAT GTT TTA3375Tyr Gly Glu Ala Val Ser Leu Ile Asp Lys Gl - #n Ser Cys Asn Val Leu# 425- TCC TTA GGC GGG ATA ACT TTA AGG CTC AGT GG - #G GAA TTC GAT GTA ACT3423Ser Leu Gly Gly Ile Thr Leu Arg Leu Ser Gl - #y Glu Phe Asp Val Thr# 440- TAT CAG AAG AAT ATC TCA ATA CAA GAT TCT CA - #A GTA ATA ATA ACA GGC3471Tyr Gln Lys Asn Ile Ser Ile Gln Asp Ser Gl - #n Val Ile Ile Thr Gly# 455- AAT CTT GAT ATC TCA ACT GAG CTT GGG AAT GT - #C AAC AAC TCG ATC AGT3519Asn Leu Asp Ile Ser Thr Glu Leu Gly Asn Va - #l Asn Asn Ser Ile Ser460 4 - #65 4 - #70 4 -#75- AAT GCC TTG AAT AAG TTA GAG GAA AGC AAC AG - #A AAA CTA GAC AAA GTC3567Asn Ala Leu Asn Lys Leu Glu Glu Ser Asn Ar - #g Lys Leu Asp Lys Val# 490- AAT GTC AAA CTG ACC AGC ACA TCT GCT CTC AT - #T ACC TAT ATC GTT TTG3615Asn Val Lys Leu Thr Ser Thr Ser Ala Leu Il - #e Thr Tyr Ile Val Leu# 505- ACT ATC ATA TCT CTT GTT TTT GGT ATA CTT AG - #C CTG ATT CTA GCA TGC3663Thr Ile Ile Ser Leu Val Phe Gly Ile Leu Se - #r Leu Ile Leu Ala Cys# 520- TAC CTA ATG TAC AAG CAA AAG GCG CAA CAA AA - #G ACC TTA TTA TGG CTT3711Tyr Leu Met Tyr Lys Gln Lys Ala Gln Gln Ly - #s Thr Leu Leu Trp Leu# 535- GGG AAT AAT ACC CTA GAT CAG ATG AGA GCC AC - #T ACA AAA ATG TGAACACAGA3763Gly Asn Asn Thr Leu Asp Gln Met Arg Ala Th - #r Thr Lys Met540 5 - #45 5 - #50- TGAGGAACGA AGGTTTCCCT AATAGTAATT TGTGTGAAAG TTCTGGTAGT CT - #GTCAGTTC3823- GGAGAGTTAA GAAAAAAAAA AAACCCCCCC CCCCCCCCCC CCCCCCCCCT GC - #AGGCATCG3883- TGGTGTCACG CTCGTCGTTT GGTATGGCTT CATTCAGCTC CGGTTCCCAA CG - #ATCAAGGC3943- GAGTTACATG ATCCCCCATG TTGTGCAAAA AAGCGGTTAG CTCCTTCGGT CC - #TCCGATCG4003- TTGTCAGAAG TAAGTTGGCC GCAGTGTTAT CACTCATGGT TATGGCAGCA CT - #GCATAATT4063- CTCTTACTGT CATGCCATCC GTAAGATGCT TTTCTGTGAC TGGTGAGTGA TC - #CATAATTA4123- ATTAATTAAT TTTTATCCCG GGTCGACCTG CAGGCGGCCG CGGCCCTCGA GG - #CC4177- (2) INFORMATION FOR SEQ ID NO:13:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 581 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:13:- Met Asn Ser Asp Pro Asp Arg Ala Val Ser Gl - #n Val Ala Leu Glu Asn# 15- Asp Glu Arg Glu Ala Lys Asn Thr Trp Arg Le - #u Ile Phe Arg Ile Ala# 30- Ile Leu Phe Leu Thr Val Val Thr Leu Ala Il - #e Ser Val Ala Ser Leu# 45- Leu Tyr Ser Met Gly Ala Ser Thr Pro Ser As - #p Leu Val Gly Ile Pro# 60- Thr Arg Ile Ser Arg Ala Glu Glu Lys Ile Th - #r Ser Thr Leu Gly Ser# 80- Asn Gln Asp Val Val Asp Arg Ile Tyr Lys Gl - #n Val Ala Leu Glu Ser# 95- Pro Leu Ala Leu Leu Asn Thr Glu Thr Thr Il - #e Met Asn Ala Ile Thr# 110- Ser Leu Ser Tyr Gln Ile Asn Gly Ala Ala As - #n Asn Ser Gly Trp Gly# 125- Ala Pro Ile His Asp Pro Asp Tyr Ile Gly Gl - #y Ile Gly Lys Glu Leu# 140- Ile Val Asp Asp Ala Ser Asp Val Thr Ser Ph - #e Tyr Pro Ser Ala Phe145 1 - #50 1 - #55 1 -#60- Gln Glu His Leu Asn Phe Ile Pro Ala Pro Th - #r Thr Gly Ser Gly Cys# 175- Thr Arg Ile Pro Ser Phe Asp Met Ser Ala Th - #r His Tyr Cys Tyr Thr# 190- His Asn Val Ile Leu Ser Gly Cys Arg Asp Hi - #s Ser His Ser His Gln# 205- Tyr Leu Ala Leu Gly Val Leu Arg Thr Ser Al - #a Thr Gly Arg Val Phe# 220- Phe Ser Thr Leu Arg Ser Ile Asn Leu Asp As - #p Thr Gln Asn Arg Lys225 2 - #30 2 - #35 2 -#40- Ser Cys Ser Val Ser Ala Thr Pro Leu Gly Cy - #s Asp Met Leu Cys Ser# 255- Lys Ala Thr Glu Thr Glu Glu Glu Asp Tyr As - #n Ser Ala Val Pro Thr# 270- Arg Met Val His Gly Arg Leu Gly Phe Asp Gl - #y Gln Tyr His Glu Lys# 285- Asp Leu Asp Val Thr Thr Leu Phe Gly Asp Tr - #p Val Ala Asn Tyr Pro# 300- Gly Val Gly Gly Gly Ser Phe Ile Asp Ser Ar - #g Val Trp Phe Ser Val305 3 - #10 3 - #15 3 -#20- Tyr Gly Gly Leu Lys Pro Asn Thr Pro Ser As - #p Thr Val Gln Glu Gly# 335- Lys Tyr Val Ile Tyr Lys Arg Tyr Asn Asp Th - #r Cys Pro Asp Glu Gln# 350- Asp Tyr Gln Ile Arg Met Ala Lys Ser Ser Ty - #r Lys Pro Gly Arg Phe# 365- Gly Gly Lys Arg Ile Gln Gln Ala Ile Leu Se - #r Ile Lys Val Ser Thr# 380- Ser Leu Gly Glu Asp Pro Val Leu Thr Val Pr - #o Pro Asn Thr Val Thr385 3 - #90 3 - #95 4 -#00- Leu Met Gly Ala Glu Gly Arg Ile Leu Thr Va - #l Gly Thr Ser His Phe# 415- Leu Tyr Gln Arg Gly Ser Ser Tyr Phe Ser Pr - #o Ala Leu Leu Tyr Pro# 430- Met Thr Val Ser Asn Lys Thr Ala Thr Leu Hi - #s Ser Pro Tyr Thr Phe# 445- Asn Ala Phe Thr Arg Pro Gly Ser Ile Pro Cy - #s Gln Ala Ser Ala Arg# 460- Cys Pro Asn Ser Cys Val Thr Gly Val Tyr Th - #r Asp Pro Tyr Pro Leu465 4 - #70 4 - #75 4 -#80- Ile Phe Tyr Arg Asn His Thr Leu Arg Gly Va - #l Phe Gly Thr Met Leu# 495- Asp Gly Glu Gln Ala Arg Leu Asn Pro Ala Se - #r Ala Val Phe Asp Ser# 510- Thr Ser Arg Ser Arg Ile Thr Arg Val Ser Se - #r Ser Ser Ile Lys Ala# 525- Ala Tyr Thr Thr Ser Thr Cys Phe Lys Val Va - #l Lys Thr Asn Lys Thr# 540- Tyr Cys Leu Ser Ile Ala Glu Ile Ser Asn Th - #r Leu Phe Gly Glu Phe545 5 - #50 5 - #55 5 -#60- Arg Ile Val Pro Leu Leu Val Glu Ile Leu Ly - #s Asp Asp Gly Val Arg# 575- Glu Ala Arg Ser Gly 580- (2) INFORMATION FOR SEQ ID NO:14:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 553 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:14:- Met Gly Ser Arg Pro Ser Thr Lys Asn Pro Al - #a Pro Met Met Leu Thr# 15- Ile Arg Val Ala Leu Val Leu Ser Cys Ile Cy - #s Pro Ala Asn Ser Ile# 30- Asp Gly Arg Pro Leu Ala Ala Ala Gly Ile Va - #l Val Thr Gly Asp Lys# 45- Ala Val Asn Ile Tyr Thr Ser Ser Gln Thr Gl - #y Ser Ile Ile Val Lys# 60- Leu Leu Pro Asn Leu Pro Lys Asp Lys Glu Al - #a Cys Ala Lys Ala Pro# 80- Leu Asp Ala Tyr Asn Arg Thr Leu Thr Thr Le - #u Leu Thr Pro Leu Gly# 95- Asp Ser Ile Arg Arg Ile Gln Glu Ser Val Th - #r Thr Ser Gly Gly Gly# 110- Arg Gln Gly Arg Leu Ile Gly Ala Ile Ile Gl - #y Gly Val Ala Leu Gly# 125- Val Ala Thr Ala Ala Gln Ile Thr Ala Ala Al - #a Ala Leu Ile Gln Ala# 140- Lys Gln Asn Ala Ala Asn Ile Leu Arg Leu Ly - #s Glu Ser Ile Ala Ala145 1 - #50 1 - #55 1 -#60- Thr Asn Glu Ala Val His Glu Val Thr Asp Gl - #y Leu Ser Gln Leu Ala# 175- Val Ala Val Gly Lys Met Gln Gln Phe Val As - #n Asp Gln Phe Asn Lys# 190- Thr Ala Gln Glu Leu Asp Cys Ile Lys Ile Al - #a Gln Gln Val Gly Val# 205- Glu Leu Asn Leu Tyr Leu Thr Glu Ser Thr Th - #r Val Phe Gly Pro Gln# 220- Ile Thr Ser Pro Ala Leu Asn Lys Leu Thr Il - #e Gln Ala Leu Tyr Asn225 2 - #30 2 - #35 2 -#40- Leu Ala Gly Gly Asn Met Asp Tyr Leu Leu Th - #r Lys Leu Gly Ile Gly# 255- Asn Asn Gln Leu Ser Ser Leu Ile Gly Ser Gl - #y Leu Ile Thr Gly Asn# 270- Pro Ile Leu Tyr Asp Ser Gln Thr Gln Leu Le - #u Gly Ile Gln Val Thr# 285- Leu Pro Ser Val Gly Asn Leu Asn Asn Met Ar - #g Ala Thr Tyr Leu Glu# 300- Thr Leu Ser Val Ser Thr Thr Arg Gly Phe Al - #a Ser Ala Leu Val Pro305 3 - #10 3 - #15 3 -#20- Lys Val Val Thr Arg Val Gly Ser Val Ile Gl - #u Glu Leu Asp Thr Ser# 335- Tyr Cys Ile Glu Thr Asp Leu Asp Leu Tyr Cy - #s Thr Arg Ile Val Thr# 350- Phe Pro Met Ser Pro Gly Ile Tyr Ser Cys Le - #u Ser Gly Asn Thr Ser# 365- Ala Cys Met Tyr Ser Lys Thr Glu Gly Ala Le - #u Thr Thr Pro Tyr Met# 380- Thr Ile Lys Gly Ser Val Ile Ala Asn Cys Ly - #s Met Thr Thr Cys Arg385 3 - #90 3 - #95 4 -#00- Cys Val Asn Pro Pro Gly Ile Ile Ser Gln As - #n Tyr Gly Glu Ala Val# 415- Ser Leu Ile Asp Lys Gln Ser Cys Asn Val Le - #u Ser Leu Gly Gly Ile# 430- Thr Leu Arg Leu Ser Gly Glu Phe Asp Val Th - #r Tyr Gln Lys Asn Ile# 445- Ser Ile Gln Asp Ser Gln Val Ile Ile Thr Gl - #y Asn Leu Asp Ile Ser# 460- Thr Glu Leu Gly Asn Val Asn Asn Ser Ile Se - #r Asn Ala Leu Asn Lys465 4 - #70 4 - #75 4 -#80- Leu Glu Glu Ser Asn Arg Lys Leu Asp Lys Va - #l Asn Val Lys Leu Thr# 495- Ser Thr Ser Ala Leu Ile Thr Tyr Ile Val Le - #u Thr Ile Ile Ser Leu# 510- Val Phe Gly Ile Leu Ser Leu Ile Leu Ala Cy - #s Tyr Leu Met Tyr Lys# 525- Gln Lys Ala Gln Gln Lys Thr Leu Leu Trp Le - #u Gly Asn Asn Thr Leu# 540- Asp Gln Met Arg Ala Thr Thr Lys Met545 5 - #50- (2) INFORMATION FOR SEQ ID NO:15:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 182 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (iii) HYPOTHETICAL: NO- (iv) ANTI-SENSE: NO- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:15:- GGCCTCGAGG GCCGCGGCCG CCTGCAGGTC GACTCTAGAA AAAATTGAAA AA - #CTATTCTA 60- ATTTATTGCA CGGAGATCTT TTTTTTTTTT TTTTTTTTTG GCATATAAAT GA - #ATTCGGAT 120- CCGGACCGCG CCGTTAGCCA AGTTGCGTTA GAGAATGATG AAAGAGAGGC AA - #AAAATACA 180# 182- (2) INFORMATION FOR SEQ ID NO:16:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 178 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (iii) HYPOTHETICAL: NO- (iv) ANTI-SENSE: NO- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:16:- ATCTTCTGCG ACATCAAGAA TCAAACCGAA TGCCCGGATC CATAATTAAT TA - #ATTAATTT 60- TTATCCCTCG ACTCTAGAAA AAATTGAAAA ACTATTCTAA TTTATTGCAC GG - #AGATCTTT 120- TTTTTTTTTT TTTTTTTTGG CATATAAATG AATTCGGATC GATCCCGGTT GG - #CGCCCT 178- (2) INFORMATION FOR SEQ ID NO:17:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 60 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (iii) HYPOTHETICAL: NO- (iv) ANTI-SENSE: NO- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:17:- AAAAACCCCC CCCCCCCCCC CCCCCCCCCC CTGCAGGCAT CGTGGTGTCA CG - #CTCGTCGT 60- (2) INFORMATION FOR SEQ ID NO:18:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 120 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (iii) HYPOTHETICAL: NO- (iv) ANTI-SENSE: NO- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:18:- ATAATTCTCT TACTGTCATG CCATCCGTAA GATGCTTTTC TGTGACTGGT GA - #GTGATCCA 60- TAATTAATTA ATTAATTTTT ATCCCGGGTC GACCTGCAGG CGGCCGCGGC CC - #TCGAGGCC 120- (2) INFORMATION FOR SEQ ID NO:19:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 1305 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (iii) HYPOTHETICAL: NO- (iv) ANTI-SENSE: NO- (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 1..1305- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:19:- ATG CAC CGT CCT CAT CTC AGA CGG CAC TCG CG - #T TAC TAC GCG AAA GGA 48Met His Arg Pro His Leu Arg Arg His Ser Ar - #g Tyr Tyr Ala Lys Gly# 15- GAG GTG CTT AAC AAA CAC ATG GAT TGC GGT GG - #A AAA CGG TGC TGC TCA 96Glu Val Leu Asn Lys His Met Asp Cys Gly Gl - #y Lys Arg Cys Cys Ser# 30- GGC GCA GCT GTA TTC ACT CTT TTC TGG ACT TG - #T GTC AGG ATT ATG CGG 144Gly Ala Ala Val Phe Thr Leu Phe Trp Thr Cy - #s Val Arg Ile Met Arg# 45- GAG CAT ATC TGC TTT GTA CGC AAC GCT ATG GA - #C CGC CAT TTA TTT TTG 192Glu His Ile Cys Phe Val Arg Asn Ala Met As - #p Arg His Leu Phe Leu# 60- AGG AAT GCT TTT TGG ACT ATC GTA CTG CTT TC - #T TCC TTC GCT AGC CAG 240Arg Asn Ala Phe Trp Thr Ile Val Leu Leu Se - #r Ser Phe Ala Ser Gln# 80- AGC ACC GCC GCC GTC ACG TAC GAC TAC ATT TT - #A GGC CGT CGC GCG CTC 288Ser Thr Ala Ala Val Thr Tyr Asp Tyr Ile Le - #u Gly Arg Arg Ala Leu# 95- GAC GCG CTA ACC ATA CCG GCG GTT GGC CCG TA - #T AAC AGA TAC CTC ACT 336Asp Ala Leu Thr Ile Pro Ala Val Gly Pro Ty - #r Asn Arg Tyr Leu Thr# 110- AGG GTA TCA AGA GGC TGC GAC GTT GTC GAG CT - #C AAC CCG ATT TCT AAC 384Arg Val Ser Arg Gly Cys Asp Val Val Glu Le - #u Asn Pro Ile Ser Asn# 125- GTG GAC GAC ATG ATA TCG GCG GCC AAA GAA AA - #A GAG AAG GGG GGC CCT 432Val Asp Asp Met Ile Ser Ala Ala Lys Glu Ly - #s Glu Lys Gly Gly Pro# 140- TTC GAG GCC TCC GTC GTC TGG TTC TAC GTG AT - #T AAG GGC GAC GAC GGC 480Phe Glu Ala Ser Val Val Trp Phe Tyr Val Il - #e Lys Gly Asp Asp Gly145 1 - #50 1 - #55 1 -#60- GAG GAC AAG TAC TGT CCA ATC TAT AGA AAA GA - #G TAC AGG GAA TGT GGC 528Glu Asp Lys Tyr Cys Pro Ile Tyr Arg Lys Gl - #u Tyr Arg Glu Cys Gly# 175- GAC GTA CAA CTG CTA TCT GAA TGC GCC GTT CA - #A TCT GCA CAG ATG TGG 576Asp Val Gln Leu Leu Ser Glu Cys Ala Val Gl - #n Ser Ala Gln Met Trp# 190- GCA GTG GAC TAT GTT CCT AGC ACC CTT GTA TC - #G CGA AAT GGC GCG GGA 624Ala Val Asp Tyr Val Pro Ser Thr Leu Val Se - #r Arg Asn Gly Ala Gly# 205- CTG ACT ATA TTC TCC CCC ACT GCT GCG CTC TC - #T GGC CAA TAC TTG CTG 672Leu Thr Ile Phe Ser Pro Thr Ala Ala Leu Se - #r Gly Gln Tyr Leu Leu# 220- ACC CTG AAA ATC GGG AGA TTT GCG CAA ACA GC - #T CTC GTA ACT CTA GAA 720Thr Leu Lys Ile Gly Arg Phe Ala Gln Thr Al - #a Leu Val Thr Leu Glu225 2 - #30 2 - #35 2 -#40- GTT AAC GAT CGC TGT TTA AAG ATC GGG TCG CA - #G CTT AAC TTT TTA CCG 768Val Asn Asp Arg Cys Leu Lys Ile Gly Ser Gl - #n Leu Asn Phe Leu Pro# 255- TCG AAA TGC TGG ACA ACA GAA CAG TAT CAG AC - #T GGA TTT CAA GGC GAA 816Ser Lys Cys Trp Thr Thr Glu Gln Tyr Gln Th - #r Gly Phe Gln Gly Glu# 270- CAC CTT TAT CCG ATC GCA GAC ACC AAT ACA CG - #A CAC GCG GAC GAC GTA 864His Leu Tyr Pro Ile Ala Asp Thr Asn Thr Ar - #g His Ala Asp Asp Val# 285- TAT CGG GGA TAC GAA GAT ATT CTG CAG CGC TG - #G AAT AAT TTG CTG AGG 912Tyr Arg Gly Tyr Glu Asp Ile Leu Gln Arg Tr - #p Asn Asn Leu Leu Arg# 300- AAA AAG AAT CCT AGC GCG CCA GAC CCT CGT CC - #A GAT AGC GTC CCG CAA 960Lys Lys Asn Pro Ser Ala Pro Asp Pro Arg Pr - #o Asp Ser Val Pro Gln305 3 - #10 3 - #15 3 -#20- GAA ATT CCC GCT GTA ACC AAG AAA GCG GAA GG - #G CGC ACC CCG GAC GCA1008Glu Ile Pro Ala Val Thr Lys Lys Ala Glu Gl - #y Arg Thr Pro Asp Ala# 335- GAA AGC AGC GAA AAG AAG GCC CCT CCA GAA GA - #C TCG GAG GAC GAC ATG1056Glu Ser Ser Glu Lys Lys Ala Pro Pro Glu As - #p Ser Glu Asp Asp Met# 350- CAG GCA GAG GCT TCT GGA GAA AAT CCT GCC GC - #C CTC CCC GAA GAC GAC1104Gln Ala Glu Ala Ser Gly Glu Asn Pro Ala Al - #a Leu Pro Glu Asp Asp# 365- GAA GTC CCC GAG GAC ACC GAG CAC GAT GAT CC - #A AAC TCG GAT CCT GAC1152Glu Val Pro Glu Asp Thr Glu His Asp Asp Pr - #o Asn Ser Asp Pro Asp# 380- TAT TAC AAT GAC ATG CCC GCC GTG ATC CCG GT - #G GAG GAG ACT ACT AAA1200Tyr Tyr Asn Asp Met Pro Ala Val Ile Pro Va - #l Glu Glu Thr Thr Lys385 3 - #90 3 - #95 4 -#00- AGT TCT AAT GCC GTC TCC ATG CCC ATA TTC GC - #G GCG TTC GTA GCC TGC1248Ser Ser Asn Ala Val Ser Met Pro Ile Phe Al - #a Ala Phe Val Ala Cys# 415- GCG GTC GCG CTC GTG GGG CTA CTG GTT TGG AG - #C ATC GTA AAA TGC GCG1296Ala Val Ala Leu Val Gly Leu Leu Val Trp Se - #r Ile Val Lys Cys Ala# 430# 1305Arg Ser 435- (2) INFORMATION FOR SEQ ID NO:20:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 434 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:20:- Met His Arg Pro His Leu Arg Arg His Ser Ar - #g Tyr Tyr Ala Lys Gly# 15- Glu Val Leu Asn Lys His Met Asp Cys Gly Gl - #y Lys Arg Cys Cys Ser# 30- Gly Ala Ala Val Phe Thr Leu Phe Trp Thr Cy - #s Val Arg Ile Met Arg# 45- Glu His Ile Cys Phe Val Arg Asn Ala Met As - #p Arg His Leu Phe Leu# 60- Arg Asn Ala Phe Trp Thr Ile Val Leu Leu Se - #r Ser Phe Ala Ser Gln# 80- Ser Thr Ala Ala Val Thr Tyr Asp Tyr Ile Le - #u Gly Arg Arg Ala Leu# 95- Asp Ala Leu Thr Ile Pro Ala Val Gly Pro Ty - #r Asn Arg Tyr Leu Thr# 110- Arg Val Ser Arg Gly Cys Asp Val Val Glu Le - #u Asn Pro Ile Ser Asn# 125- Val Asp Asp Met Ile Ser Ala Ala Lys Glu Ly - #s Glu Lys Gly Gly Pro# 140- Phe Glu Ala Ser Val Val Trp Phe Tyr Val Il - #e Lys Gly Asp Asp Gly145 1 - #50 1 - #55 1 -#60- Glu Asp Lys Tyr Cys Pro Ile Tyr Arg Lys Gl - #u Tyr Arg Glu Cys Gly# 175- Asp Val Gln Leu Leu Ser Glu Cys Ala Val Gl - #n Ser Ala Gln Met Trp# 190- Ala Val Asp Tyr Val Pro Ser Thr Leu Val Se - #r Arg Asn Gly Ala Gly# 205- Leu Thr Ile Phe Ser Pro Thr Ala Ala Leu Se - #r Gly Gln Tyr Leu Leu# 220- Thr Leu Lys Ile Gly Arg Phe Ala Gln Thr Al - #a Leu Val Thr Leu Glu225 2 - #30 2 - #35 2 -#40- Val Asn Asp Arg Cys Leu Lys Ile Gly Ser Gl - #n Leu Asn Phe Leu Pro# 255- Ser Lys Cys Trp Thr Thr Glu Gln Tyr Gln Th - #r Gly Phe Gln Gly Glu# 270- His Leu Tyr Pro Ile Ala Asp Thr Asn Thr Ar - #g His Ala Asp Asp Val# 285- Tyr Arg Gly Tyr Glu Asp Ile Leu Gln Arg Tr - #p Asn Asn Leu Leu Arg# 300- Lys Lys Asn Pro Ser Ala Pro Asp Pro Arg Pr - #o Asp Ser Val Pro Gln305 3 - #10 3 - #15 3 -#20- Glu Ile Pro Ala Val Thr Lys Lys Ala Glu Gl - #y Arg Thr Pro Asp Ala# 335- Glu Ser Ser Glu Lys Lys Ala Pro Pro Glu As - #p Ser Glu Asp Asp Met# 350- Gln Ala Glu Ala Ser Gly Glu Asn Pro Ala Al - #a Leu Pro Glu Asp Asp# 365- Glu Val Pro Glu Asp Thr Glu His Asp Asp Pr - #o Asn Ser Asp Pro Asp# 380- Tyr Tyr Asn Asp Met Pro Ala Val Ile Pro Va - #l Glu Glu Thr Thr Lys385 3 - #90 3 - #95 4 -#00- Ser Ser Asn Ala Val Ser Met Pro Ile Phe Al - #a Ala Phe Val Ala Cys# 415- Ala Val Ala Leu Val Gly Leu Leu Val Trp Se - #r Ile Val Lys Cys Ala# 430- Arg Ser__________________________________________________________________________

Claims

1. A recombinant fowlpox virus designated S-FPV-043, ATCC Accession No. VR 2395.

2. A vaccine which comprises an effective immunizing amount of the virus of claim 1 and a suitable carrier.

3. The vaccine of claim 2, wherein in the carrier is a physiologically balanced culture medium containing stabilizing agents.

4. The vaccine of claim 2, wherein the effective immunizing amount is 10.sup.3 to about 10.sup.9 PFU/dose.

5. The vaccine of claim 2, wherein the effective immunizing amount is about 10.sup.3 to about 10.sup.5 PFU/dose.

6. A method of immunizing an animal against fowlpox virus and Newcastle disease virus which comprises administering to the animal an effective immunizing dose of vaccine of claim 2.

7. The method of claim 6, wherein the animal is poultry.

8. The method of claim 6, wherein the animal is a chicken.

9. The method of claim 6, wherein the vaccine is administered by intramuscular, subcutaneous, intraperitoneal, intravenous or intradermal injection.

10. The method of claim 6, wherein the vaccine is administered intranasaly.

11. The method of claim 6, wherein the vaccine is administered orally.

12. The method of claim 6, wherein the vaccine is administered ocularly.