Recombinant fowlpox viruses and uses thereof

Within this application several publications are referenced by arabic numerals within parentheses. Full citations for these references may be found at the end of the specification immediately preceding the claims. The disclosures of these publications in their entireties are hereby incorporated by reference into this application in order to more fully describe the state of the art to which this invention pertains.
BACKGROUND OF THE INVENTION
The present invention relates to recombinant fowlpox virus useful in live vaccine to protect fowl against Newcastle disease virus and fowlpox virus.
The ability to isolate DNA and clone this isolated DNA into bacterial plasmids has greatly expanded the approaches available to make viral vaccines. The method used to make the present invention involve modifying cloned DNA sequences by insertions, deletions and single or multiple base changes. The modified DNA is then inserted into a viral genome, and the resulting virus may then be used in a vaccine to elicit an immune response in a host animal and provide protection to the animal against disease.
Fowlpox virus (FPV) is a member of the poxviridiae family of viruses. There are two subfamilies in this classification, and they are differentiated based upon the host range (vertebrate or invertebrate) of the virus. Among the vertebrate poxviruses, there is serological cross reactivity to group specific antigens that has aided in classification of the viruses into six genera, and FPV has been placed in the avipoxvirus genera along with seven additional poxviruses that primarily infect birds. In general, poxviruses are the largest of the animal viruses and can be visualized with the light microscope. Under the electron microscope, the virus takes on a biscuit like or oval shaped appearance. The principal chemical components of the poxviruses are protein (90% by weight), deoxyribonucleic acid (DNA) (3%) and lipid (5%), but in FPV the lipid component is -1/3 of the dry weight. Polyacrylamide gel electrophoresis (PAGE) of solubilized virions indicates that there are >100 different proteins associated with the viruses that include: structural polypeptides, enzymes associated with translation of messenger ribonucleic acid (mRNA), enzymes involved in RNA synthesis, and enzymes associated with DNA replication. The genome of poxviruses consists double-stranded DNA that varies in base composition (32% G+C to 64% G+C) and length (140 kilobasepairs [kb] to 280 kb for FPV) depending upon individual virus. The complete nucleotide sequence of the vaccina virus (VV) genome has recently been determined, and most of the essential genes have been found to lie within the highly conserved middle region of the genome while nonessential functions seem to map nearer to the termini of the DNA. The poxviruses are unique in their propensity to replicate within the cytoplasmic space of the infected cell, and in the case of VV, mature virus particles are moved out of the assembly areas and into the periphery of the cell where additional membrane encapsulation occurs. With FPV, the assembled viral particles become associated with a dense viral-derived protein matrix that occludes the virus in the form of cellular inclusions that may help protect the virion from lytic activities. Depending upon the specific poxvirus and strain (from 1% to 30% of different mature VV strains) varying levels of mature virus can be found extracellularly, but the majority of the virus population remains associated with the cell at the end of the growth cycle.
Fowlpox is unique throughout the world, but because its host-range is limited to birds it is not considered to be a public health hazard. All chickens can be infected by the virus with a resulting decline in the growth rate of the bird and temporary decreases in egg production. Usually, transmission of FPV occurs through physical contact of injured skin, but there are reports that the virus is also transmitted via arthropod vectors. After an incubation period of four to ten days, the disease is typically manifested in the following ways: skin lesions in non-feathered areas, lesions of the nasal passages, and lesions of the mouth. A normal FPV infection usually lasts three to four weeks, and afterward the bird is conferred life-long immunity to the disease.
Currently, conventionally derived FPV vaccines are being used in commercial settings to provide protection to chickens and turkeys. Typically, the vaccine viruses are attenuated by serial passage in cell culture selecting for strains that have altered growth and/or virulence properties. The modified live vaccine is prepared by growth in vitro in chicken embryo fibroblast cells or by growth on the chorioallantoic membrane of the chicken embryo. The vaccine virus is given to birds subcutaneously.
The present invention concerns the use of FPV as a vector for the delivery of specific vaccine antigens to poultry. The idea of using live viruses as delivery systems for antigens (vectoring) has a long history that is associated with introduction of the first live viral vaccines. The antigens that were delivered were not foreign but were naturally expressed by the live virus in the vaccine. The use of viruses to deliver foreign antigens in the modern sense became obvious with the recombinant DNA studies. The vaccinia virus was the vector and various antigens from other disease causing pathogens were the foreign antigens, and the vaccine was created by genetic engineering. While the concept became obvious with these disclosures, what was not obvious were the answers to more practical questions concerning what makes the best candidate viral vector and what constitutes the best foreign gene or gene to deliver. In answering these questions, details of the pathogenicity, site of replication or growth, the kind of elicited immune response, expression levels for the virus and foreign gene of interest (GOI), its suitability for genetic engineering, its probability of being licensed by regulatory agencies, etc. are all factors in the configuration. The prior art does not teach these questions of utility.
The presently preferred method for creating recombinant poxviruses uses a plasmid of bacterial origin that contains at least one cassette consisting of a poxvirus promoter followed by the gene of interest. The cassette(s) is flanked by poxvirus genomic DNA sequences that direct the gene of interest to the corresponding homologous nonessential region of the viral genome by homologous recombination. Cells are initially infected with the wild-type virus, and shortly thereafter the plasmid DNA is introduced into the infected cells. Since poxviruses have their own RNA polymerase and transcriptional apparatus, it is necessary that the gene of interest be regulated by a promoter of poxvirus origin. There are three characteristic poxvirus promoters that are differentiated based upon their temporal regulation of gene expression relative to the infective cycle of the virus: early, intermediate and late expression. Each promoter type can be identified by a typical consensus sequence that is -30 bp in length and specific to each promoter type. In vaccinia virus, some viral genes are regulated by tandem early/late promoters that can be used by the virus to continually express the downstream gene throughout the infective cycle.
It is generally agreed that poxviruses contain non-essential regions of DNA in various parts of the genome, and that modifications of these regions can either attenuate the virus, leading to a non-pathogenic strain from which a vaccine may be derived, or give rise to genomic instabilities that yield mixed populations of virus. The degree of attenuation of the virus is important to the utility of the virus as a vaccine. Insertions or deletions which cause too much attenuation or genetic deletions which cause too much attenuation or genetic instability of the virus will result in a vaccine that fails to elicit an adequate immune response. Although several examples of deletions/insertions are known for poxviruses, the appropriate configuration is not readily apparent.
Thus far, gene expression from foreign genes of interest have been inserted into the genome of poxviruses has been obtained for five different pox viruses: vaccinia, canary pox, pigeon pox, raccoon pox and fowlpox. Vaccinia virus is the classically studied poxvirus, and it has been used extensively to vector foreign genes of interest; it is the subject of U.S. Pat. Nos. 4,603,112 and 4,722,848. Raccoon pox (Esposito, et al., 1988) and Canary pox (Taylor, et al., 1991) have bene used to express antigens from the rabies virus. More recently, FPV has been used to vector a number of different foreign gene of interest, and is the subject of patent applications (EPA 0 284 416, PCT WO 89/03429, PCT WO 89/12684, PCT WO 91/02072, PCT WO 89/03879, PCT etc.). However, these publications do not teach the vectored antigen configuration, the FPV insertion sites, or the promoter sequences and the arrangement of the present invention.
A foreign gene of interest targeted for insertion into the genome of FPV can be obtained from any pathogenic organism of interest. Typically, the gene of interest will be derived from pathogens that cause diseases in poultry that have an economic impact on the poultry industry. The genes can be derived from organisms for which there are existing vaccines, and because of the novel advantages of the vectoring technology the FPV derived vaccines will be superior. Also, the gene of interest may be derived from pathogens for which thee is currently no vaccine but where there is a requirement for control of the disease. Typically, the gene of interest encodes immunogenic polypeptides of the pathogen, and may represent surface proteins, secreted proteins and structural proteins.
One relevant avian pathogen that is a target for FPV vectoring in the present invention is Infectious Laryngotracheitis virus (ILT). ILT is a member of the herpesviridiae family, and this pathogen causes an acute disease of chickens which is characterized by respiratory depression, gasping and expectoration of bloody exudate. Viral replication is limited to cells of the respiratory tract, where in the trachea the infection gives rise to tissue erosion and hemorrhage. In chickens, no drug has been effective in reducing the degree of lesion formation or in decreasing clinical signs. Vaccination of birds with various modified forms of the ILT virus derived by cell passage and/or tedious regimes of administration have conferred acceptable protection in susceptible chickens. Because of the degree of attenuation of current ILT vaccines, care must be taken to assure that the correct level of virus is maintained; enough to provide protection, but not enough to cause disease in the flock.
An additional target for the FPV vectoring approach is Newcastle disease, an infectious, highly contagious and debilitating disease that is caused by the Newcastle disease virus (NDV), a single-stranded RNA virus of the paramyxovirus family. The various pathotypes of NDV (velongic, mesogenic, lentogenic) differ with regard to the severity of the disease, the specificity and symptoms, but most types seem to infect the respiratory system and the nervous system. NDV primarily infects chickens, turkeys and other avian species. Historically, vaccination has been used to prevent disease, but because of maternal antibody interference, life-span of the bird and route of administration, the producer needs to adapt immunization protocols to fit specific needs.
Marek's disease of poultry is a lymphoproliferative tumor producing disease of poultry that primarily affects the peripheral nervous system and other visceral tissues and organs. Marek's disease exists in poultry producing countries throughout the world, and is an additional target described by the present invention for a FPV-based vectored vaccine. The causative agent of Marek's disease is a cell associated gammaherpesvirus that has been designated as Marek's disease virus (MDV). Three classes of viruses have been developed as conventional vaccines for protecting chickens against Marek's disease: attenuated serotype 1 MDV, herpesvirus of turkeys (HVT), and naturally avirulent serotype 2 isolates of MDV. Protection obtained with these vaccines is principally directed toward the tumorigenic aspect of the disease. The occurrence of excessive Marek's disease losses in such conventionally vaccinated flocks has led to the requirement for forming admixtures of the various vaccine types. Such polyvalent vaccines while generally ore effective in disease control, complicate the vaccine regime.
SUMMARY OF THE INVENTION
This invention provides a recombinant fowlpox virus comprising a foreign DNA sequence inserted into the fowlpox virus genomic DNA, wherein the foreign DNA sequence is inserted within a 4.2 kB EcoRI fragment of the fowlpox virus genomic DNA and is capable of being expressed in a fowlpox virus infected host cell.
The invention further provides homology vectors, vaccines and methods of immunization.

BRIEF DESCRIPTION OF THE FIGURES
FIGS. 1A-1C: Detailed description of the SfiI fragment insert in Homology Vector 502-26.22. The diagram shows the orientation of DNA fragments assembled in the cassette. The origin of each fragment is described in the Materials and Methods section. The sequences located at the junctions between each fragment and at the ends of the marker gene are shown, including junction A (SEQ ID NO: 15), junction B (SEQ ID NO: 16), junction C (SEQ ID NO: 17), and junction D (SEQ ID NO: 18). The restriction sites used to generate each fragment are indicated at the appropriate junction. The location of the NDV F and HN genes is shown. Numbers in parenthesis ( ) refer to amino acids, and restriction sites in brackets [ ] indicate the remnants of sites which were destroyed during construction.
FIGS. 2A-2D: Detailed description of fowlpox virus S-FPV-099 and S-FPV-101 and the DNA insertion in Homology Vector 751-07.D1. Diagram showing the orientation of DNA fragments assembled in plasmid 751-07.D1. The origin of each fragment is indicated in the table. The sequences located at each of the junctions between fragments is also shown. FIGS. 2A-2D show the sequences located at Junction A (SEQ ID NO: ), (SEQ ID NO: ), C (SEQ ID NO: ), D (SEQ ID NO: ) and E (SEQ ID NO: ) between fragments and the sequences located at the junctions. The restriction sites used to generate each fragment as well as synthetic linker sequences which are used to join the fragments are described for each junction. The location of several gene coding regions and regulatory elements is also given. The following two conventions are used: numbers in parentheses, ( ), refer to amino acids, and restrictions sites in brackets, [ ], indicate the remnants of sites which are destroyed during construction. The following abbreviations are used: fowlpox virus (FPV), chicken interferon (cIFN), Escherichia coli (E. coli), pox synthetic late promoter 2 early promoter 2 (LP2EP2), pox synthetic late promoter 1 (LP1), base pairs (BP), polymerase chain reaction (PCR).
FIGS. 3A-3D: Detailed description of fowlpox virus S-FPV-100 and the DNA insertion in Homology Vector 751-56.C1. Diagram showing the orientation of DNA fragments assembled in plasmid 751-56.C1. The origin of each fragment is indicated in the table. The sequences located at each of the junctions between fragments is also shown. FIGS. 3A-3D show the sequences located at Junction A (SEQ ID NOS: ), (SEQ ID NO: ), C (SEQ ID NO: ), D (SEQ ID NO: ) and E (SEQ ID NO: ) between fragments and the sequences located at the junctions. The restriction sites used to generate each fragment as well as synthetic linker sequences which are used to join the fragments are described for each junction. The location of several gene coding regions and regulatory elements is also given. The following two conventions are used: numbers in parentheses, ( ), refer to amino acids, and restrictions sites in brackets, [ ], indicate the remnants of sites which are destroyed during construction. The following abbreviations are used: fowlpox virus (FPV), chicken myelomoncytic growth factor (cMGF), Escherichia coli (E. coli), pox synthetic late promoter 2 early promoter 2 (LP2EP2), pox synthetic late promoter 1 (LP1), base pairs (BP), polymerase chain reaction (PCR).

DETAILED DESCRIPTION OF THE INVENTION
This invention provides a recombinant fowlpox virus comprising a foreign DNA sequence inserted into the fowlpox virus genomic DNA, wherein the foreign DNA sequence is inserted within a 2.8 kB EcoRI fragment of the fowlpox virus genomic DNA and is capable of being expressed in a fowlpox virus infected host cell.
In one embodiment the foreign DNA sequence is inserted within a SnaBI restriction endonuclease site within the approximately 2.8 kB EcoRI fragment of the fowlpox virus genomic DNA.
This invention provides a recombinant fowlpox virus comprising a foreign DNA sequence inserted into the fowlpox virus genomic DNA, wherein the foreign DNA sequence is inserted within a 3.5 kB EcoRI fragment of the fowlpox virus genomic DNA and is capable of being expressed in a fowlpox virus infected host cell.
In one embodiment the recombinant fowlpox virus the foreign DNA sequence is inserted within a HpaI restriction endonuclease site within the approximately 3.5 kB EcoRI fragment of the fowlpox virus genomic DNA.
The present invention provides a recombinant fowlpox virus comprising a foreign DNA sequence inserted into the fowlpox virus genomic DNA, wherein the foreign DNA sequence is inserted within a 4.2 kB EcoRI fragment of the fowlpox virus genomic DNA and is capable of being expressed in a fowlpox virus infected host cell.
In one embodiment of the recombinant fowlpox virus foreign DNA sequence is inserted within a MluI restriction endonuclease site within the approximately 4.2 kB EcoRI fragment of the fowlpox virus genomic DNA. The invention provides a recombinant fowlpox virus comprising a foreign DNA sequence inserted into the fowlpox virus genomic DNA, wherein the foreign DNA sequence is inserted within a non-essential region of the fowlpox virus genomic DNA and is capable of being expressed in a fowlpox virus infected host cell.
In one embodiment this invention provides a recombinant fowlpox virus wherein the foreign DNA sequence is inserted into an open reading frame within the non-essential region the fowlpox virus genomic DNA.
For purposes of this invention, "a recombinant fowlpox virus capable of replication" is a live fowlpox virus which has been generated by the recombinant methods well known to those of skill in the art, e.g., the methods set forth in HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT FPV in Materials and Methods and has not had genetic material essential for the replication of the recombinant fowlpox virus deleted.
The invention further provides a foreign DNA sequence or foreign RNA which encodes a polypeptide. Preferably, the polypeptide is antigenic in the animal. Preferably, this antigenic polypeptide is a linear polymer of more than 10 amino acids linked by peptide bonds which stimulates the animal to produce antibodies.
The invention further provides a recombinant fowlpox virus capable of replication which contains a foreign DNA encoding a polypeptide which is a detectable marker. Preferably the detectable marker is the polypeptide E. coli .beta.-galactosidase or E. coli beta-glucuronidase.
In one embodiment of the recombinant fowlpox virus the foreign DNA sequence encodes a cytokine. In another embodiment the cytokine is chicken myelomonocytic growth factor (cMGF) or chicken interferon (cIFN). Cytokines include, but are not limited to: transforming growth factor beta, epidermal growth factor family, fibroblast growth factors, hepatocyte growth factor, insulin-like growth factor, vascular endothelial growth factor, interleukin 1, IL-1 receptor antagonist, interleukin-2, interleukin-3, interleukin-4, interleukin-5, interleukin-6, IL-6 soluble receptor, interleukin-7, interleukin-8, interleukin-9, interleukin-10, interleukin-11, interleukin-12, interleukin-13, angiogenin, chemokines, colony stimulating factors, granulocyte-macrophage colony stimulating factors, erythropoietin, interferon, interferon gamma, c-kit ligand, leukemia inhibitory factor, oncostatin M, pleiotrophin, secretory leukocyte protease inhibitor, stem cell factor, tumor necrosis factors, and soluble TNF receptors. These cytokines are from humans, bovine, equine, feline, canine, porcine or avian.
This invention provides a recombinant fowlpox virus further comprising a newcastle disease virus hemagglutinin (NDV HN), or a newcastle disease virus fusion (NDV F).
Antigenic polypeptide of a human pathogen which are derived from human herpesvirus include, but are not limited to: hepatitis B virus and hepatitis C virus hepatitis B virus surface and core antigens, hepatitis C virus, human immunodeficiency virus, herpes simplex virus-1, herpes simplex virus-2, human cytomegalovirus, Epstein-Barr virus, Varicella-Zoster virus, human herpesvirus-6, human herpesvirus-7, human influenza, measles virus, hantaan virus, pneumonia virus, rhinovirus, poliovirus, human respiratory syncytial virus, retrovirus, human T-cell leukemia virus, rabies virus, mumps virus, malaria (Plasmodium falciparum), Bordetella pertussis, Diptheria, Rickettsia prowazekii, Borrelia berfdorferi, Tetanus toxoid, malignant tumor antigens.
The antigenic polypeptide of an equine pathogen can derived from equine influenza virus, or equine herpesvirus. In one embodiment the antigenic polypeptide is equine influenza neuraminidase or hemagglutinin. Examples of such antigenic polypeptide are equine influenza virus type A/Alaska 91 neuraminidase, equine influenza virus type A/Prague 56 neuraminidase, equine influenza virus type A/Miami 63 neuraminidase, equine influenza virus type A/Kentucky 81 neuraminidase, equine influenza virus type A/Kentucky 92 neuraminidase equine herpesvirus type 1 glycoprotein B, equine herpesvirus type 1 glycoprotein D, Streptococcus equi, equine infectious anemia virus, equine encephalitis virus, equine rhinovirus and equine rotavirus.
The present invention further provides an antigenic polypeptide which includes, but is not limited to: hog cholera virus gE1, hog cholera virus gE2, swine influenza virus hemagglutinin, neuromanidase, matrix and nucleoprotein, pseudorabies virus gB, gC and gD, and PRRS virus ORF7.
For example, the antigenic polypeptide of derived from infectious bovine rhinotracheitis virus gE, bovine respiratory syncytial virus equine pathogen can derived from equine influenza virus is bovine respiratory syncytial virus attachment protein (BRSV G), bovine respiratory syncytial virus fusion protein (BRSV F), bovine respiratory syncytial virus nucleocapsid protein (BRSV N), bovine parainfluenza virus type 3 fusion protein, and the bovine parainfluenza virus type 3 hemagglutinin neuraminidase.
The present invention provides a recombinant fowlpox virus wherein the foreign DNA sequence encodes an antigenic polypeptide which is derived or derivable from a group consisting of: feline immunodeficiency virus gag, feline immunodeficiency virus env, infectious laryngotracheitis virus glycoprotein B, infectious laryngotracheitis virus gI, infectious laryngotracheitis virus gD, infectious bovine rhinotracheitis virus glycoprotein G, infectious bovine rhinotracheitis virus glycoprotein E, pseudorabies virus glycoprotein 50, pseudorabies virus II glycoprotein B, pseudorabies virus III glycoprotein C, pseudorabies virus glycoprotein E, pseudorabies virus glycoprotein H, marek's disease virus glycoprotein A, marek's disease virus glycoprotein B, marek's disease virus glycoprotein D, newcastle disease virus hemagglutinin or neuraminadase, newcastle disease virus fusion, infectious bursal disease virus VP2, infectious bursal disease virus VP3, infectious bursal disease virus VP4, infectious bursal disease virus polyprotein, infectious bronchitis virus spike, infectious bronchitis virus matrix, and chick anemia virus.
The present invention provides a recombinant fowlpox virus wherein the foreign DNA sequence is under control of a promoter. In one embodiment the foreign DNA sequence is under control of an endogenous upstream poxvirus promoter. In another embodiment the foreign DNA sequence is under control of a heterologous upstream promoter. In another embodiment the promoter is selected from a group consisting of: synthetic pox viral promoter, pox synthetic late promoter 1, pox synthetic late promoter 2 early promoter 2, pox O1L promoter, pox I4L promoter, pox I3L promoter, pox I2L promoter, pox I1L promoter, pox E10R promoter, HCMV immediate early, BHV-1.1 VP8, marek's disease virus glycoprotein A, marek's disease virus glycoprotein B, marek's disease virus glycoprotein D, laryngotracheitis virus glycoprotein I, infectious laryngotracheitis virus glycoprotein B, and infectious laryngotracheitis virus gD.
The present invention also provides a recombinant fowlpox virus designated S-FPV-097. The S-FPV-097 has been deposited on Feb. 25, 1994 pursuant to the Budapest Treaty on the International Deposit of Microorganisms for the Purposes of Patent Procedure with the Patent Culture Depository of the American Type Culture Collection, 12301 Parklawn Drive, Rockville, Md. 20852 U.S.A. under ATCC Accession No. VR 2446.
The present invention also provides a vaccine which comprises an effective immunizing amount of the recombinant virus designated S-FPV-097 and a suitable carrier. The vaccine may contain either inactivated or live fowlpox virus S-FPV-097, although live virus is presently preferred. The present invention also provides a method of immunizing an animal, particularly poultry, against disease caused by fowlpox virus, Newcastle disease virus and infectious laryngotracheitis virus. This method comprises administering to the animal an effective immunizing dose of the vaccine of the present invention. The vaccine may be administered by any of the methods well known to those skilled in the art, for example, by intramuscular, intraperitoneal, intravenous or intradermal injection. Alternatively, the vaccine may be administered intranasally, orally, or ocularly.
The present invention also provides a recombinant fowlpox virus designated S-FPV-095. The present invention also provides a vaccine which comprises an effective immunizing amount of the recombinant virus designated S-FPV-095 and a suitable carrier. The vaccine may contain either inactivated or live fowlpox virus S-FPV-095, although live virus is presently preferred. The present invention also provides a method of immunizing an animal, particularly poultry, against disease caused by fowlpox virus, Newcastle disease virus and infectious laryngotracheitis virus. This method comprises administering to the animal an effective immunizing dose of the vaccine of the present invention. The vaccine may be administered by any of the methods well known to those skilled in the art, for example, by intramuscular, intraperitoneal, intravenous or intradermal injection. Alternatively, the vaccine may be administered intranasally, orally, or ocularly.
The present invention also provides a recombinant fowlpox virus designated S-FPV-074. The present invention also provides a vaccine which comprises an effective immunizing amount of the recombinant virus designated S-FPV-074 and a suitable carrier. The vaccine may contain either inactivated or live fowlpox virus S-FPV-074, although live virus is presently preferred. The present invention also provides a method of immunizing an animal, particularly poultry, against disease caused by fowlpox virus and Newcastle disease virus. This method comprises administering to the animal an effective immunizing dose of the vaccine of the present invention. The vaccine may be administered by any of the methods well known to those skilled in the art, for example, by intramuscular, intraperitoneal, intravenous or intradermal injection. Alternatively, the vaccine may be administered intranasally, orally, or ocularly.
The present invention also provides a recombinant fowlpox virus designated S-FPV-081. The present invention also provides a vaccine which comprises an effective immunizing amount of the recombinant virus designated S-FPV-081 and a suitable carrier. The vaccine may contain either inactivated or live fowlpox virus S-FPV-081, although live virus is presently preferred. The present invention also provides a method of immunizing an animal, particularly poultry, against disease caused by fowlpox virus and Marek's disease virus. This method comprises administering to the animal an effective immunizing dose of the vaccine of the present invention. The vaccine may be administered by any of the methods well known to those skilled in the art, for example, by intramuscular, intraperitoneal, intravenous or intradermal injection. Alternatively, the vaccine may be administered intranasally, orally, or ocularly.
The present invention also provides a recombinant fowlpox virus designated S-FPV-085. The present invention also provides a vaccine which comprises an effective immunizing amount of the recombinant virus designated S-FPV-085 and a suitable carrier. The vaccine may contain either inactivated or live fowlpox virus S-FPV-085, although live virus is presently preferred. The present invention also provides a method of immunizing an animal, particularly poultry, against disease caused by fowlpox virus, Newcastle disease virus, infectious laryngotracheitis virus and Marek's disease virus. This method comprises administering to the animal an effective immunizing dose of the vaccine of the present invention. The vaccine may be administered by any of the methods well known to those skilled in the art, for example, by intramuscular, intraperitoneal, intravenous or intradermal injection. Alternatively, the vaccine may be administered intranasally, orally, or ocularly.
The present invention also provides a recombinant fowlpox virus designated S-FPV-082, S-FPV-083, S-FPV-099, S-FPV-100, and S-FPV-101.
Suitable carriers for use with the recombinant fowlpox virus vaccines of the present invention are those well known in the art and include proteins, sugars, etc. One example of such a suitable carrier is a physiologically balanced culture medium containing one or more stabilizing agents such as stabilized, hydrolyzed proteins, lactose, etc.
An "effective immunizing amount" of the recombinant viruses of the present invention is an amount within the range of 10.sup.2 -10.sup.9 PFU/dose. Preferably, the effective immunizing amount is from about 10.sup.3 -10.sup.5 PFU/dose for the live virus vaccine. Preferable, the live vaccine is created by taking tissue culture fluids and adding stabilizing agents such as stabilized, hydrolyzed proteins.
MATERIAL AND METHODS
PREPARATION OF FOWLPOX VIRUS STOCK SAMPLES
Fowlpox virus samples were prepared by infecting chicken embryo fibroblast (CEF) cells at a multiplicity of infection of 0.01 PFU/cell in a 1:1 mixture of HAM's F10 medium and Medium 199 (F10/199) containing 2 mM glutamine and antibiotics (referred to as CEF negative medium). Prior to infection, the cell monolayers were washed once with CEF negative medium to remove fetal bovine serum. The FPV contained in the initial inoculum (0.5 ml for 10 cm plate; 10 ml for T175 cm flask) was allowed to absorb onto the cell monolayer for two hours, being redistributed every half hour. After this period, the original inoculum was brought up to an appropriate final volume by the addition of complete CEF medium (CEF negative medium plus 2% fetal bovine serum). The plates were incubated at 37.degree. C. in 5% CO.sub.2 until cytopathic effect was complete. The medium and cells were harvested, frozen at -70.degree. C., thawed and dispensed into 1.0 ml vials and refrozen at -70.degree. C. Virus titers typically range between 10.sup.8 and 10.sup.7 PFU/ml.
PREPARATION OF FPV DNA
For fowlpox virus DNA isolation, a confluent monolayer of CEF cells in a T175 cm.sup.2 flask was infected at a multiplicity of 0.1 and incubated 4-6 days until the cells were showing 100% cytopathic effect. The infected cells were harvested by scraping into the medium and centrifuging at 3000 rpm for 5 minutes in a clinical centrifuge. The medium was decanted, and the cell pellet was gently resuspended in 1.0 ml PBS (per T175) and subjected to two successive freeze-thaws (-70.degree. C. to 37.degree. C.). After the last thaw, the cells (on ice) were sonicated two times for 30 seconds each with 45 seconds cooling time in between. Cellular debris was removed by centrifuging (Sorvall RC-5B Superspeed Centrifuge) at 3000 rpm for 5 minutes in an HB4 rotor at 4.degree. C. FPV virions, present in the supernatant, were pelleted by centrifugation at 15,000 rpm for 20 minutes at 4.degree. C. in a SS34 rotor (Sorvall) and resuspended in 10 mM Tris (pH 7.5). This fraction was then layered onto a 36% sucrose gradient (w/v in 10 mM Tris pH 7.5) and centrifuged (Beckman L8-70M Ultracentrifuge) at 18,000 rpm for 60 minutes in a SW41 rotor at 4.degree. C. The virion pellet was resuspended in 1.0 ml of 10 mM Tris pH 7.5 and sonicated on ice for 30 seconds. This fraction was layered onto a 20% to 50% continuous sucrose gradient and centrifuged at 16,000 rpm for 60 minutes in a SW41 rotor at 4.degree. C. The FPV virion band located about three quarters down the gradient was harvested, diluted with 20% sucrose and pelleted by centrifugation at 18,000 rpm for 60 minutes in a SW41 rotor at 4.degree. C. The resultant pellet was then washed once with 10 mM Tris pH 7.5 to remove traces of sucrose and finally resuspended in 10 mM Tris pH 7.5. FPV DNA was then extracted from the purified virions by lysis (four hours at 60.degree. C.) following the addition of EDTA, SDS, and proteinase K to final concentrations of 20 mM, 0.5% and 0.5 mf/ml, respectively. After digestion, three phenol-chloroform (1:1) extractions were conducted and the sample precipitated by the addition of two volumes of absolute ethanol and incubated at -20.degree. C. for 30 minutes. The sample was then centrifuged in an Eppendorf minifuge for five minutes at full speed. The supernatant was decanted, and the pellet air dried and rehydrated in 0.01 M Tris pH 7.5, 1 mM EDTA at 4.degree. C.
MOLECULAR BIOLOGICAL TECHNIQUES
Techniques for the manipulation of bacteria and DNA, including such procedures as digestion with restriction endonucleases, gel electrophoresis, extraction of DNA from gels, ligation, phosphorylation with kinase, treatment with phosphatase, growth of bacterial cultures, transformation of bacteria with DNA, and other molecular biological methods are described by Maniatis et al (1982) and Sambrook et al (1989). Except as noted, these were used with minor variation.
DNA SEQUENCING
Sequencing was performed using the BRL Sequenase Kit and .sup.35 S-dATP (NEN). Reactions using both the dGTP mixes and the dITP mixes were performed to clarify areas of compression. Alternatively, compressed areas were resolved on formamide gels. Templates were double-stranded plasmid subclones or single stranded M13 subclones, and primers were either made to the vector just outside the insert to be sequenced, or to previously obtained sequence. Sequence obtained was assembled and compared using Dnastar software. Manipulation and comparison of sequences obtained was performed with Superclone and Supersee programs from Coral Software.
STRATEGY FOR THE CONSTRUCTION OF SYNTHETIC POX VIRAL PROMOTERS
For recombinant fowlpox vectors synthetic pox promoters offer several advantages including the ability to control the strength and timing of foreign gene expression. We chose to design four promoter cassettes EP1 (SEQ ID NO:8, LP1 (SEQ ID NO:9), EP2 (SEQ ID NO:10), and LP2 (SEQ ID NO:11) based on promoters that have been defined in the vaccinia virus (Bertholet et al. 1986, Davidson and Moss, 1989a, and Davidson and Moss, 1989b). Each cassette was designed to contain the DNA sequences defined in vaccina flanked by restriction sites which could be used to combine the cassettes in any order or combination. Initiator methionines were also designed into each cassette such that inframe fusions could be made at either EcoRI or BamHi sites. A set of translational stop codons in all three reading frames and an early transcriptional termination signal (Earl, et al., 1990) was also engineered downstream of the inframe fusion site. DNA encoding each cassette was synthesized according to standard techniques and cloned into the appropriate homology vectors.
cDNA CODING PROCEDURE
cDNA cloning refers to the methods used to convert RNA molecules into DNA molecules following state of the art procedures. Applicants' methods are described in (Gubler and Hoffman, 1983). Bethesda Research Laboratories (Gaithersburg, Md.) have designed a cDNA Cloning Kit that is very similar to the procedures used by applicants, and contains a set of reagents and protocols that may be used to duplicate our results.
For cloning virus mRNA species, a host cell line sensitive to infection by the virus was infected at 5-10 plaque forming units per cell. When cytopathic effect was evident, but before total destruction, the medium was removed and the cells were lysed in 10 mls lysis buffer (4 M guanidine thiocyanate, 0.1% antifoam A, 25 mM sodium citrate pH 7.0, 0.5% N-lauroyl sarcosine, 0.1 M beta-mercaptoethanol). The cell lysate was poured into a sterilized Dounce homogenizer and homogenized on ice 8-10 times until the solution was homogenous. For RNA purification, 8 mls of cell lysate were gently layered over 3.5 mls of CsCl solution (5.7 M CsCl, 25 mM sodium citrate pH 7.0) in a Beckman SW41 centrifuge tube. The samples were centrifuged for 18 hrs at 20.degree. C. at 36000 rpm in a Beckman SW41 rotor. The tubes were put on ice and the supernatants from the tubes were carefully removed by aspiration to leave the RNA pellet undisturbed. The pellet was resuspended in 400 .mu.l glass distilled water, and 2.6 mls of guanidine solution (7.5 M guanidine-HCl, 25 mM sodium citrate pH 7.0, 5 mM dithiothreitol) were added. Then 0.37 volumes of 1 M acetic acid were added, followed by 0.75 volumes of cold ethanol and the sample was put at -20.degree. C. for 18 hrs to precipitate RNA. The precipitate was collected by centrifugation in a Sorvall centrifuge for 10 min at 4.degree. C. at 10000 rpm in an SS34 rotor. The pellet was dissolved in 1.0 ml distilled water, recentrifuged at 13000 rpm, and the supernatant saved. RNA was re-extracted from the pellet 2 more times as above with 0.5 ml distilled water, and the supernatants were pooled. A 0.1 volume of 2 M potassium acetate solution was added to the sample followed by 2 volumes of cold ethanol and the sample was put at -20.degree. C. for 18 hrs. The precipitated RNA was collected by centrifugation in the SS34 rotor at 4.degree. C. for 10 min at 10000 rpm. The pellet was dissolved in 1 ml distilled water and the concentration taken by adsorption at A260/280. The RNA was stored at -70.degree. C.
mRNA containing polyadenylate tails (poly-A) was selected using oligo-dT cellulose (Pharmacia #27 5543-0). Three mg of total RNA was boiled and chilled and applied to a 100 mg oligo-dT cellulose column in binding buffer (0.1 M Tris pH 7.5, 0.5 M LiCl, 5 mM EDTA pH 8.0, 0.1% lithium dodecyl sulfate). The retained poly-A+RNA was eluted from the column with elution buffer (5 mM Tris pH 7.5, 1 mM EDTA pH 8.0, 0.1% sodium dodecyl sulfate). This mRNA was reapplied to an oligo-dT column in binding buffer and eluted again in elution buffer. The sample was precipitated with 200 mM sodium acetate and 2 volumes cold ethanol at -20.degree. C. for 18 hrs. The RNA was resuspended in 50 .mu.l distilled water.
Ten .mu.g poly-A+ RNA was denatured in 20 mM methyl mercury hydroxide for 6 min at 22.degree. C. .beta.-mercaptoethanol was added to 75 mM and the sample was incubated for 5 min at 22.degree. C. The reaction mixture for first strand cDNA synthesis in 0.25 ml contained 1 .mu.g oligo-dT primer (P-L Bio-chemicals) or 1 .mu.g synthetic primer, 28 units placental ribonuclease inhibitor (Bethesda Research Labs #5518SA), 100 mM Tris pH 8.3, 140 mM KCl, 10 mM MgCl2, 0.8 mM dATP, dCTP, dGTP, and dTTP (Pharmacia), 100 microcuries 32P-labeled dCTP (New England Nuclear #NEG-013H), and 180 units AMV reverse transcriptase (Molecular Genetics Resources #MG 101). The reaction was incubated at 42.degree. C. for 90 min, and then was terminated with 20 mM EDTA pH 8.0. The sample was extracted with an equal volume of phenol/chloroform (1:1) and precipitated with 2 M ammonium acetate and 2 volumes of cold ethanol -20.degree. C. for 3 hrs. After precipitation and centrifugation, the pellet was dissolved in 100 .mu.l distilled water. The sample was loaded onto a 15 ml G-100 Sephadex column (Pharmacia) in buffer (100 mM Tris pH 7.5, 1 mM EDTA pH 8.0, 100 mM NaCl). The leading edge of the eluted DNA fractions were pooled, and DNA was concentrated by lyophilization until the volume was about 100 .mu.l, then the DNA was precipitated with ammonium acetate plus ethanol as above.
The entire first strand sample was used for second strand reaction which followed the Gubler and Hoffman (1983) method except that 50 .mu.g/ml dNTP's, 5.4 units DNA polymerase I (Boerhinger Mannheim #642-711), and 100 units/ml E. coli DNA ligase (New England Biolabs #205) in a total volume of 50 microliters were used. After second strand synthesis, the cDNA was phenol/chloroform extracted and precipitated. The DNA was resuspended in 10 .mu.l distilled water, treated with 1 .mu.g RNase A for 10 min at 22.degree. C., and electrophoresed through a 1% agarose gel (Sigma Type II agarose) in 40 mM Tris-acetate buffer pH 6.85. The gel was strained with ethidium bromide, and DNA in the expected size range was excised from the gel and electroeluted in 8 mM Tris-acetate pH 6.85. Electroeluted DNA was lyophilized to about 100 microliters, and precipitated with ammonium acetate and ethanol as above. The DNA was resuspended in 20 .mu.l water.
Oligo-dC tails were added to the DNA to facilitate cloning. The reaction contained the DNA, 100 mM potassium cacodylate pH 7.2, 0.2 mM dithiothreitol, 2 mM CaCl.sub.2, 80 .mu.moles dCTP, and 25 units terminal deoxynucleotidyl transferase (Molecular Genetic Resources #S1001) in 50 .mu.l. After 30 min at 37.degree. C., the reaction was terminated with 10 mM EDTA, and the sample was phenol/chloroform extracted and precipitated as above.
The dC-tailed DNA sample was annealed to 200 ng plasmid vector pBR322 that contained oligo-dG tails (Bethesda Research Labs #5355 SA/SB) in 200 .mu.l of 0.01 M Tris pH 7.5, 0.1 M NaCl, 1 mM EDTA pH 8.0 at 65.degree. C. for 2 min and then 57.degree. C. for 2 hrs. Fresh competent E. coli DH-1 cells were prepared and transformed as described by Hanahan (1983) using half the annealed cDNA sample in twenty 200 .mu.l aliquots of cells. Transformed cells were plated on L-broth agar plates plus 10 .mu.g/ml tetracycline. Colonies were screened for the presence of inserts into the ampicillin gene using Ampscreen.backslash.(Bethesda Research Labs #5537 UA), and the positive colonies were picked for analysis.
HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT FPV
This method relies upon the homologous recombination between FPV DNA and the plasmid homology vector DNA which occurs in the tissue culture cells containing both FPV DNA and transfected plasmid homology vector. For homologous recombination to occur, monolayers of CEF cells are infected with S-FPV-001 (A mild fowlpox vaccine strain available as Bio-Pox.TM. from Agri-Bio Corporation, Gainsville, Ga.) at a multiplicity of infection of 0.01 PFU/cell to introduce replicating FPV (i.e. DNA synthesis) into the cells. The plasmid homology vector DNA is then transfected into these cells according to the "Infection-Transfection Procedure".
INFECTION-TRANSFECTION PROCEDURE
CEF cells in 6 cm plates (about 80% confluent) were infected with S-FPV-001 at a multiplicity of infection of 0.01 PFU/cell in CEF negative medium and incubated at 37.degree. C. in a humidified 5% CO.sub.2 incubator for five hours. The transfection procedure used is essentially that recommended for Lipofectin.TM. Reagent (BRL). Briefly, for each 6 cm plate, 15 micrograms of plasmid DNA were diluted up to 100 microliters with H.sub.2 O. Separately, 50 micrograms of Lipofectin.TM. Reagent were diluted to 100 microliters with H.sub.2 O. The 100 microliters of diluted Lipofectin.TM. Reagent were added dropwise to the diluted plasmid DNA contained in a polystyrene, 5 ml, snap cap tube and mixed gently. The mixture was then incubated for 15-20 minutes at room temperature. During this time, the virus inoculum was removed from the 6 cm plates and the cell monolayers washed once with CEF negative medium. Three mls of CEF negative medium were added to the plasmid DNA/lipofectin mixture and the contents pipetted onto the cell monolayer. Following overnight (about 16 hours) incubation at 37.degree. C. in a humidified 5% CO.sub.2 incubator, the medium was removed and replaced with 5 ml CEF complete medium. The cells were incubated at 37.degree. C. in 5% CO.sub.2 for 3-7 days until cytopathic effect from the virus was 80-100%. Virus was harvested as described above for the preparation of virus stocks. This stock was referred to as a transfection stock and was subsequently screened for recombinant virus by the "Plaque Hybridization Procedure For Purifying Recombinant FPV".
PLAQUE HYBRIDIZATION PROCEDURE FOR PURIFYING RECOMBINANT FPV
CEF cell monolayers were infected with various dilutions of the infection/transfection viral stocks, overlaid with nutrient agarose media (equal volumes of 1.2%-1.4% agarose and 2X M199) and incubated 6-7 days for plaque development to occur. The agarose overlay and plate were marked with the same three asymmetrical dots (India ink) to aid in positioning the Nitrocellulose (NC) membrane (cell monolayer) and agarose overlay. The agarose overlay was transferred to the lid of the 10 cm dish and stored at 4.degree. C. The CEF monolayer was overlaid with a pre-wetted (PBS) NC membrane and pressure applied to transfer the monolayer to the NC membrane. Cells contained on the NC membrane were then lysed by placing the membranes in 1.5 ml of 1.5 M NaCl and 0.5 M NaOH for five minutes. The membranes were placed in 1.5 ml of 3 M sodium acetate (pH 5.2) for five minutes. DNA from the lysed cells was bound to the NC membrane by baking at 80.degree. C. for one hour. After this period the membranes were prehybridized with a solution containing 6X SSC, 3% skim milk, 0.5% SDS, salmon sperm DNA (50 .mu.g/ml) and incubated at 65.degree. C. for one hour. Radio-labeled probe DNA (alpha.sup.32 P-dCTP) was added and incubated at 65.degree. C. overnight (12 hours). After hybridization the NC membranes were washed two times (30 minutes each) with 2X SSC at 65.degree. C., followed by two additional washes at 65.degree. C. with 0.5X SSC. The NC membranes were dried and exposed to X-ray film (Kodak X-OMAT, AR) at -70.degree. C. for 12 hours. Plaques corresponding to positive signals seen on the autoradiogram were picked from the agarose overlay, using a pasteur pipette, and were resuspended into 1 ml of CEF media and stored at -70.degree. C. Typically, 5-6 rounds of plaque purification were required to ensure purity of the recombinant virus.
SCREEN FOR FOREIGN GENE EXPRESSION IN RECOMBINANT FPV USING BLACK PLAQUE ASSAYS
To analyze expression of foreign antigens expressed by recombinant fowlpox viruses, monolayers of CEF cells were infected with recombinant FPV, overlaid with nutrient agarose media and incubated for 6-7 days at 37.degree. C. for plaque development to occur. The agarose overlay was removed from the dish, the cells fixed with 100% methanol for 10 minutes at room temperature and air dried. The primary antibody was diluted to an appropriate concentration with PBS and incubated on the cell monolayer for two hours at room temperature. Unbound antibody was removed from the cells by washing three times with PBS at room temperature. A horseradish peroxidase conjugated secondary antibody was diluted with PBS and incubated on the cell monolayer for two hours at room temperature. Unbound secondary antibody was then removed by washing the cells three times with PBS at room temperature. The cells were incubated 15-30 minutes at room temperature with freshly prepared substrate solution (100 .mu.g/ml 4-chloro-1-naphthol, 0.003% H.sub.2 O.sub.2 in PBS). Plaques expressing the correct antigen stain black.
SCREEN FOR RECOMBINANT FPV EXPRESSING ENZYMATIC MARKER GENES
When the E. coli .beta.-galactosidase (lacZ) or .beta.-glucuronidase (uidA) marker gene was incorporated into a recombinant virus the plaques containing recombinants were visualized by a simple assay. The enzymatic substrate was incorporated (300 .mu.g/ml) into the agarose overlay during the plaque assay. For the lacZ marker gene the substrates Bluogal.TM. (halogenated indolyl-.beta.-D-galactosidase, Bethesda Research Labs) for blue plaques or CPRG (chlorophenol Red Galactopyranoside, Boehringer mannheim) for red plaques were used. For the uidA marker gene the substrate X-Glucuro Chx (5-bromo-4-chloro-3-indolyl-.beta.-D-glucuronic acid Cyclohexylammonium salt, Biosynth AG) was used. Plaques that expressed active marker enzyme turned either red or blue. The plaques were then picked onto fresh cells and purified by further plaque isolation.
RNA ISOLATED FROM CONCANAVALIN A STIMULATED CHICKEN SPLEEN CELLS
Chicken spleens were dissected from 3 week old SPAFAS hatched chicks, washed, and disrupted through a syringe/needle to release cells. After allowing stroma and debri to settle out, the cells were pelleted and washed twice with PBS. The cell pellet was treated with a hypotonic lysis buffer to lyse red blood cells, and splenocytes were recovered and washed twice with PBS. Splenocytes were resuspended at 5.times.106 cells/ml in RPMI containing 5% FBS and 5 .mu.g/ml Concanavalin A and incubated at 39.degree. for 48 hours. Total RNA was isolated from the cells using guanidine isothionate lysis reagents and protocols from the Promega RNA isolation kit (Promega Corporation, Madison Wis.). 4 .mu.g of total RNA was used in each 1st strand reaction containing the appropriate antisense primers and AMV reverse transcriptase (Promega Corporation, Madison Wis.). cDNA synthesis was performed in the same tube following the reverse transcriptase reaction, using the appropriate sense primers and Vent.RTM. DNA polymerase (Life Technologies, Inc. Bethesda, Md.).
HOMOLOGY VECTOR 451-79.95
The plasmid 451-79.95 was constructed for the purpose of inserting the NDV HN gene into FPV. A lacZ marker gene followed by the NDV HN gene was inserted as a cassette into the homology vector 443-88.14 at the unique SfiI site. The cassette may be constructed utilizing standard recombinant DNA techniques (Maniatis et al., 1982 and Sambrook et al., 1989), by joining restriction fragments from the following sources with the synthetic DNA sequences indicated. The first fragment is the synthetic late promoter LP1 (SEQ ID NO:9). The second fragment contains the coding region of E. coli lacZ and is derived from plasmid pJF751 (Ferrari et al., 1985). Note that the promoter and lacZ gene are fused so as to express a hybrid protein consisting of 4 amino acids derived from the synthetic promoter followed by amino acids 10 to 1024 of the lacZ gene. The third fragment is another copy of the synthetic late promoter LP1. the fourth fragment contains the coding region of the NDV HN gene and was derived from the full length HN cDNA clone. Note that the promoter and HN gene are fused so as to express a hybrid protein consisting of 4 amino acids derived from the synthetic promoter followed by amino acids 2 to 577 of the HN gene. Both genes are in the opposite transcriptional orientation relative to the ORF1 gene in the parental homology vector.
HOMOLOGY VECTOR 489-21.1
The plasmid 489-21.1 was constructed for the purpose of inserting the NDV HN gene into FPV. The NDV HN gene was inserted as a cassette into the homology vector 443-88.8 at the unique SfiI site. The cassette may be constructed utilizing standard recombinant DNA techniques (Maniatis et al., 1982 and Sambrook et al., 1989), by joining restriction fragments from the following sources with the synthetic DNA sequences indicated. The first fragment is the synthetic early/late promoter EP1LP2 (SEQ ID NO:8/SEQ ID NO:11) . The second fragment contains the coding region of the NDV HN gene and was derived from the full length HN cDNA clone. Note that the promoter and HN gene are fused so as to express a hybrid protein consisting of 4 amino acids derived from the synthetic promoter followed by amino acids 2 to 577 of the HN gene. The HN gene is in the opposite transcriptional orientation relative to the ORF in the parental homology vector.
HOMOLOGY VECTORS 502-26.22
The plasmid 502-26.22 was constructed for the purpose of inserting the NDV HN and F genes into FPV. The NDV HN and F genes were inserted as a SfiI fragment (SEQ ID NO:12) into the homology vector 443-88.8 at the unique SfiI site. The NDV HN and F genes were inserted in the same transcriptional orientation as the ORF in the parental homology vector. A detailed description of the SfiI is shown in FIGS. 1A-1C. The inserted SfiI fragment may be constructed utilizing standard recombinant DNA techniques (Maniatis et al. and Sambrook et al., 1989), by joining restriction fragments from the following sources with the synthetic DNA sequences indicated in FIGS. 1A-1C. Fragment 1 is approximately 1811 base pair AvaII to NaeI restriction fragment of the full length NDV HN cDNA clone (B1 strain). Fragment 2 is an approximately 1812 base pair BamHI to PstI restriction fragment of the full length NDV F cDNA (B1 strain). Fragment 3 is an approximately 235 base pair PstI and ScaI restriction fragment of the plasmid pBR322.
HOMOLOGY VECTOR 502-27.5
The plasmid 502-27.5 was constructed for the purpose of inserting the NDV F gene into FPV. A LacZ marker gene followed by the NDV F gene was inserted as a cassette into the homology vector 443-88.14 at the unique SfiI site. The cassette may be constructed utilizing standard recombinant DNA techniques (Maniatis et al., 1982 and Sambrook et al., 1989), joining restriction fragments from the following sources with the synthetic DNA sequences indicated. The first fragment is the synthetic late promoter LP1 (SEQ ID NO:9). The second fragment contains the coding region of E. coli LacZ and is derived from plasmid pJF751 (Ferrari et al., 1985). Note that the promoter and LacZ gene are fused so as to express a hybrid protein consisting of 4 amino acids derived from the synthetic promoter followed by amino acids 10 to 1024 of the LacZ gene. The third fragment is the synthetic early/late promoter EP1LP2 (SEQ ID NO:8/SEQ ID NO:11). The fourth fragment contains the coding region of the NDV F gene and was derived from the full length F cDNA clone. Note that the promoter and F gene are fused so as to express a hybrid protein consisting of 4 amino acids dervied from the synthetic promoter followed by 10 amino acids derivied from the F gene 5' untranslated region followed by amino acid 1 to 544 of the F gene. Both genes are in the opposite transcriptional orientation relative to the ORF in the parental homology vector.
HOMOLOGY VECTOR 586-36.6
The plasmid 586-36.6 was constructed for the purpose of inserting the infectious laryngotracheitis virus (ILT) gB and gD genes into the FPV. An E. coli .beta.-glucuronidase uidA marker gene preceeded by the ILT gB and gD genes was inserted as a cassette into the homology vector 451-08.22 at the unique SfiI site. The cassette may be constructed utilizing standard recombinant DNA techniques (Maniatis et al., 1982 and Sambrook et al., 1989), by joining restriction fragments from the following sources with the synthetic DNA sequences indicated. The first fragment is the synthetic early/late promoter EP1LP2 (SEQ ID NO:8/SEQ ID NO:11). The second fragment contains the coding region of ILT gB and is dervied from an approximately 3000 base pair ILT virus genomic EcoRI fragment. Note that the promoter and gB gene are fused so as to express the complete coding region of the gB gene (amino acids 1-883). The third fragment is the synthetic early/late promoter EP1LP2 (SEQ ID NO:8/SEQ ID NO:11). The fourth fragment contains the coding region of the ILT gD gene (SEQ ID NO:19) and was derived from an approximately 2060 base pair EcoRI to BclI restriction sub-fragment of the ILT KpnI genomic restriction fragment #8 (10.6 KB). Note that the promoter and gD gene are fused so as to express a hybrid protein consisting of 3 amino acids dervied from the synthetic promoter followed by amino acids 3 to 434 of the gD gene. The fifth fragment is the synthetic late promoter LP1 (SEQ ID NO:9). The last fragment contains the coding region of E. coli uidA and is derived from plasmid pRAJ260 (Clonetech). Note that the promoter and uidA gene are fused so as to express a hybrid protein consisting of 3 amino acids derived from the synthetic promoter followed by amino acids 1 to 602 of the uidA gene. All three genes are in the opposite transcriptional orientation relative to ORF1 in the parental homology vector.
HOMOLOGY VECTOR 608-10.3
The plasmid 608-10.3 was constructed for the purpose of inserting the Marek's Disease virus (MDV) gD and gB genes into FPV. A LacZ marker gene preceeded by the MDV gD and gB genes was inserted as a cassette into the homology vector 443-88.14 at the unique SfiI site. The cassette may be constructed utilizing standard recombinant DNA techniques (Maniatis et al., 1982 and Sambrook et al., 1989), by joining restriction fragments from the following sources with the synthetic DNA sequences indicated. The first fragment is the synthetic late/early promoter LP2EP2 (SEQ ID NO:11/SEQ ID NO:10). The second fragment contains the coding region of MDV gD and is derived from an approximately 2177 base pair NcoI to SalI sub-fragment of the MDV BglII 4.2 KB genomic restriction fragment (Ross, et al., 1991). Note that the promoter and gD are fused so as to express a hybrid protein consisting of 3 amino acids derived from the synthetic promoter followed by amino acids 3 to 403 of the gD gene. The third fragment is the synthetic early/late promoter EP1LP2 (SEQ ID NO:8/SEQ ID NO:11). The fourth fragment contains the coding region of the MDV gB gene and was derived from an approximately 3898 base pair SalI to EcoRI genomic MDV fragment (Ross, et al., 1989). Note that the promoter and gB gene are fused so as to express a hybrid protein consisting of 3 amino acids derived from the synthetic promoter followed by amino acids 3 to 865 of the gB gene. The fifth fragment is the synthetic late promoter LP1 (SEQ ID NO:9). The sixth fragment contains the coding region of E. coli LacZ and is derived from plasmid pJF751 (Ferrari, et al., 1985). Note that the promoter and LacZ gene are fused so as to express a hybrid protein consisting of 4 amino acids derived from the synthetic promoter followed by amino acids 10 to 1024 of the LacZ gene. All three genes are in the opposite transcriptional orientation relative to ORF1 in the parental homology vector.
HOMOLOGY VECTOR 538-51.27
The plasmid 538-51.27 was constructed for the purpose of inserting the genes for Infectious Bronchitis virus (IBV) Massachusetts Spike protein (Mass Spike) and Massachusetts Matrix protein (Mass Matrix) into FPV. A lacZ marker gene and the genes for IBV Mass Spike and Mass Matrix were inserted as a cassette into the homology vector 443-88.14 at the unique SfiI site. The inserted SfiI fragment is constructed utilizing standard recombinant DNA techniques (Maniatis et al., 1982 and Sambrook et al., 1989), by joining restriction fragments from the following sources. The first fragment is the synthetic early/late promoter EP1LP2 (SEQ ID NO: 8/SEQ ID NO: 11). The second fragment contains the coding region for the IBV Mass Spike gene and (amino acids 3-1162) is derived from an approximately 3500 base pair BsmI to PvuI IBV cDNA fragment. The third fragment is the synthetic early/late promoter EP1LP2 (SEQ ID NO: 8/SEQ ID NO: 11). The fourth fragment contains the coding region for the IBV Mass Matrix gene (amino acids 1-232) and is derived from an approximately 1500 base pair XbaI to SpeI IBV cDNA fragment. The fifth fragment is the synthetic late promoter LP1 (SEQ ID NO: 9). The sixth fragment contains the coding region of E. coli lacZ and is derived from plasmid pJF751 (Ferrari, et al. 1985).
HOMOLOGY VECTOR 622-49.1
The plasmid 622-49.1 was constructed for the purpose of inserting the IBV Massachusetts (Mass) Nucleocapsid gene into FPV. A uidA marker gene and the IBV Mass Nucleocapsid gene was inserted as a cassette into the homology vector 451-08.22 at the unique SfiI site. The inserted SfiI fragment was constructed utilizing standard recombinant DNA techniques (Maniatis et al., 1982 and Sambrook et al., 1989), by joining restriction fragments from the following sources. The first fragment is the synthetic early/late promoter EP1LP2 (SEQ ID NO: 8/SEQ ID NO: 11). The second fragment contains the coding region for the IBV Mass Nucleocapsid gene and is derived from an approximately 3800 base pair PstI to IBV cDNA fragment. The third fragment is the synthetic late promoter LP1 (SEQ ID NO: 9). The fourth fragment contains the coding region of E. coli uidA and is derived from plasmid pRAJ260 (Clonetech).
HOMOLOGY VIRUS 584-36.12
The plasmid 584-36.12 was constructed for the purpose of inserting the NDV HN and F genes into FPV. The NDV HN and F genes were inserted as a SfiI fragment into the homology vector 443-88.14 (see example 1B) at the unique SfiI site. The NDV HN and F genes were inserted in the same transcriptional orientation as the ORF in the parental homology vector. A detailed description of the SfiI fragment is shown in FIGS. 1A-1C. The inserted SfiI fragment was constructed utilizing standard recombinant DNA techniques (Maniatis et al, 1982 and Sambrook et al, 1989), by joining restriction fragments from the following sources with the synthetic DNA sequences indicated in FIGS. 1A-1C. Fragment 1 is an approximately 1811 base pair AvaII to NaeI restriction fragment of the full length NDV HN cDNA clone (B1 strain). Fragment 2 is an approximately 1812 base pair BamHI to PstI restriction fragment of the full length NDV F cDNA (B1 strain). Fragment 3 is an approximately 235 base pair PstI to ScaI restriction fragment of the plasmid pBR322.
HOMOLOGY VECTOR 694-10.4.
The plasmid 694-10.4 was constructed for the purpose of inserting the infectious laryngotracheitis virus (ILTV) gB and gD genes into FPV. An E.coli .beta.-glucuronidase uidA marker gene preceded by the ILTV gB and gD genes was inserted as a cassette into the homology vector 451-08.22 at the unique SfiI site. The cassette was constructed utilizing standard recombinant DNA techniques (Maniatis et al, 1982 and Sambrook et al, 1989), by joining restriction fragments from the following sources with the synthetic DNA sequences indicated. The first fragment is the synthetic early/late promoter EP1LP2 (SEQ ID NO:8/SEQ ID NO:11). The second fragment contains the coding region of ILTV gB and is derived from an approximately 3000 base pair ILT virus genomic EcoRI fragment. Note that the promoter and gB gene are fused so as to express the complete coding region of the gB gene (animo acids 1-883). The third fragment is the synthetic early/late promoter EP1LP2 (SEQ ID NO:8/SEQ ID NO:11). The fourth fragment contains the coding region of the ILTV gD gene and was derived from an approximately 2060 base pair EcoRI to BclI restriction sub-fragment of the ILTV KpnI genomic restriction fragment #8 (10.6 KB). Note that the promoter and gD gene are fused so as to express a hybrid protein consisting of 3 amino acids derived from the synthetic promoter followed by amino acids 3 to 434 of the gD gene. The fifth fragment is the synthetic late promoter LP1 (SEQ ID NO:9). The last fragment contains the coding region of E.coli uidA and is derived from plasmid pRAJ260 (Clonetech). Note that the promoter and uidA gene are fused so as to express a hybrid protein consisting of 3 amino acids derived from the synthetic promoter followed by amino acids 1 to 602 of the uidA gene.
HOMOLOGY VECTOR 749-75.82
The plasmid 749-75.82 was used to insert foreign DNA into FPV. It incorporates an E. coli .beta.-galactosidase (lacZ) marker gene and the infectious bursal disease virus (IBDV) polymerase gene flanked by FPV DNA. When this plasmid was used according to the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT FPV a virus containing DNA coding for the foreign genes results. Note that the .beta.-galactosidase (lacZ) marker gene is under the control of a synthetic late pox promoter (LP1) and the IBDV polymerase gene is under the control of a synthetic late/early pox promoter (LP2EP2). The homology vector was constructed utilizing standard recombinant DNA techniques (11 and 14), by joining restriction fragments from the following sources with the appropriate synthetic DNA sequences. The plasmid vector was derived from an approximately 2999 base pair EcoRI restriction fragment of pSP64 (Promega). Fragment 1 is an approximately 1184 base pair EcoRI to SnaBI restriction sub-fragment of the 2.8 kb EcoRI FPV genomic fragment (SEQ ID NO. 5). Fragment 2 is an approximately 2700 EcoRI to AscI restriction fragment synthesized by cDNA cloning and polymerase chain reaction (PCR) from an IBDV RNA template. cDNA and PCR primers (5'-CACGAATTCTGACATTTTCAACAGTCCACAGGCGC-3'; 12/93.4) (SEQ ID NO: ) and 5'-GCTGTTGGACATCACGGGCCAGG-3'; 9/93.28) (SEQ ID NO: ) were used to synthesize an approximately 1100 base pair EcoRI to BclI fragment at the 5' end of the IBDV polymerase gene. cDNA and PCR primers (5'-ACCCGGAACATATGGTCAGCTCCAT-3'; 12/93.2) (SEQ ID NO: ) and 5'-GGCGCGCCAGGCGAAGGCCGGGGATACGG-3'; 12/93.3) (SEQ ID NO: ) were used to synthesize an approximately 1700 base pair BclI to AscI fragment at the 3' end of the IBDV polymerase gene. The two fragments were ligated at the BclI site to form the approximately 2800 base pair EcoRI to BclI fragment. Fragment 3 is an approximately 3002 base pair BamHI to PvuII restriction fragment of plasmid pJF751 (7). Fragment 4 is an approximately 1626 base pair SnaBI to EcoRI restriction sub-fragment of the 2.8 kb EcoRI FPV genomic fragment (SEQ ID NO. 5).
HOMOLOGY VECTOR 751-07.D1
The plasmid 751-07.D1 was used to insert foreign DNA into FPV. It incorporates an E. coli .beta.-galactosidase (lacZ) marker gene and the chicken interferon (cIFN) gene flanked by FPV DNA. When this plasmid was used according to the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT FPV a virus containing DNA coding for the foreign genes results. Note that the .beta.-galactosidase (lacZ) marker gene is under the control of a synthetic late pox promoter (LP1) and the cIFN gene is under the control of a synthetic late/early pox promoter (LP2EP2). The homology vector was constructed utilizing standard recombinant DNA techniques (17), by joining restriction fragments from the following sources with the appropriate synthetic DNA sequences. The plasmid vector was derived from an approximately 2999 base pair EcoRI restriction fragment of pSP64 (Promega). Fragment 1 is an approximately 1626 base pair EcoRI to SnaBI restriction sub-fragment of the 2.8 kb EcoRI FPV genomic fragment (SEQ ID NO. 5). Fragment 2 is an approximately 577 base pair EcoRI to BglII fragment coding for the cIFN gene (17) derived by reverse transcription and polymerase chain reaction (PCR) (Sambrook, et al., 1989) of RNA ISOLATED FROM CONCANAVALIN A STIMULATED CHICKEN SPLEEN CELLS. The antisense primer (6/94.13) used for reverse transcription and PCR was 5' CGACGGATCCGAGGTGCGTTTGGGGCTAAGTGC-3' (SEQ ID NO: ). The sense primer (6/94.12) used for PCR was 5' CCACGGATCCAGCACAACGCGAGTCCCACCATGGCT-3' (SEQ ID NO: ). The BamHI fragment resulting from reverse transcription and PCR was gel purified and used as a template for a second PCR reaction to introduce a unique EcoRI site at the 5' end and a unique BglII site at the 3' end. The second PCR reaction used primer 6/94.22 (5' CCACGAATTCGATGGCTGTGCCTGCAAGCCCACAG-3'; SEQ ID NO: ) at the 5' end and primer 6/94.34 (5'-CGAAGATCTGAGGTGCGTTTGGGGCTAAGTGC-3'; SEQ ID NO: ) at the 3' end to yield an approximately 577 base pair fragment. The DNA fragment contains the coding sequence from amino acid 1 to amino acid 193 of the chicken interferon protein (17) which includes a 31 amino acid signal sequence at the amino terminus and 162 amino acids of the mature protein encoding chicken interferon. Fragment 3 is an approximately 3002 base pair BamHI to PvuII restriction fragment of plasmid pJF751 (7). Fragment 4 is an approximately 1184 base pair SnaBI to EcoRI restriction sub-fragment of the 2.8 kb EcoRI FPV genomic fragment (SEQ ID NO. 5).
HOMOLOGY VECTOR 751-56.C1.
The plasmid 751-56.C1 was used to insert foreign DNA into FPV. It incorporates an E. coli .beta.-galactosidase (lacZ) marker gene and the chicken myelomonocytic growth factor (cMGF) gene flanked by FPV DNA. When this plasmid was used according to the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT FPV a virus containing DNA coding for the foreign genes results. Note that the .beta.-galactosidase (lacZ) marker gene is under the control of a synthetic late pox promoter (LP1) and the cMGF gene is under the control of a synthetic late/early pox promoter (LP2EP2). The homology vector was constructed utilizing standard recombinant DNA techniques (11 and 14), by joining restriction fragments from the following sources with the appropriate synthetic DNA sequences. The plasmid vector was derived from an approximately 2999 base pair EcoRI restriction fragment of pSP64 (Promega). Fragment 1 is an approximately 1184 base pair EcoRI to SnaBI restriction sub-fragment of the 2.8 kb EcoRI FPV genomic fragment (SEQ ID NO. 5). Fragment 2 is an approximately 640 base pair EcoRI to BamHI fragment coding for the cMGF gene (16) derived by reverse transcription and polymerase chain reaction (PCR) (Sambrook, et al., 1989) of RNA ISOLATED FROM CONCANAVALIN A STIMULATED CHICKEN SPLEEN CELLS. The antisense primer (6/94.20) used for reverse transcription and PCR was 5' CGCAGGATCCGGGGCGTCAGAGGCGGGCGAGGTG-3' (SEQ ID NO: ). The sense primer (5/94.5) used for PCR was 5' GAGCGGATCCTGCAGGAGGAGACACAGAGCTG-3' (SEQ ID NO: ). The BamHI fragment derived from PCR was subcloned into a plasmid and used as a template for a second PCR reaction using primer 6/94.16 (5'-GCGCGAATTCCATGTGCTGCCTCACCCCTGTG 3'; SEQ ID NO: ) at the 5' end and primer 6/94.20 (5' CGCAGGATCCGGGGCGTCAGAGGCGGGCGAGGTG-3'; SEQ ID NO: ) at the 3' end to yield an approximately 640 base pair fragment. The DNA fragment contains the coding sequence from amino acid 1 to amino acid 201 of the cMGF protein (16) which includes a 23 amino acid signal sequence at the amino terminus and 178 amino acids of the mature protein encoding cMGF. Fragment 3 is an approximately 3002 base pair BamHI to PvuII restriction fragment of plasmid pJF751 (7). Fragment 4 is an approximately 1626 base pair SnaBI to EcoRI restriction sub-fragment of the 2.8 kb EcoRI FPV genomic fragment (SEQ ID NO. 5).
EXAMPLE 1
Sites for Insertion of Foreign DNA into FPV
In order to define appropriate insertion sites, a library of FPV EcoRI restriction fragments was generated in the plasmid vector pSP64 (Promega). Several of these restriction fragments were subjected to restriction mapping analysis. Unique blunt cutting restriction endonuclease sites were identified and mapped within the cloned FPV DNA regions. The blunt restriction sites were converted to Not I and Sfi I sites through the use of synthetic DNA linkers (oligo 66.04; 5'-GGCGGCCGCGGCCCTCGAGGCCA-3' SEQ ID NO: 1 and oligo 66.05; 5' TGGCCTCGAGGGCCGCGGCCGCC 3' SEQ ID NO: 2). A .beta.-galactosidase (lacZ) marker gene was inserted in each of the potential sites. A plasmid containing such a foreign DNA insert may be used according to the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT FPV to construct a FPV containing the foreign DNA. For this procedure to be successful it is important that the insertion site be in a region non-essential to the replication of the FPV and that the site be flanked with FPV DNA appropriate for mediating homologous recombination between virus and plasmid DNAs. The plasmids containing the lacZ marker gene were utilized in the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT FPV. The generation of recombinant virus was determined by the SCREEN FOR RECOMBINANT FPV EXPRESSING ENZYMATIC MARKER GENES. Three sites were successfully used to generate a recombinant viruses. In each case the resulting virus was easily purified to 100%, clearly defining an appropriate site for the insertion of foreign DNA. The three homology vectors used to define these sites are described below.
EXAMPLE 1A
Homology Vector 443-88.8
The homology vector 443-88.8 contains a 3.5 KB FPV genomic EcoRI fragment and is useful for the insertion of foreign DNA into FPV. This EcoRI fragment maps to the approximately 5.5 KB overlap of FPV genomic fragments SalI C and PstI F (Coupar et al., 1990). The NotI/SfiI linker described above was inserted into a unique HpaI site in this fragment. This site is designated the 680 insertion site.
The homology vector 443-88.8 was characterized by DNA sequence analysis. Approximately 1495 base pairs of DNA sequence flanking the HpaI site was determined (SEQ ID NO: 3). This sequence indicates that the open reading frame of 383 amino acids spans the HpaI insertion site. The HpaI site interrupts this ORF at amino acid 226. This ORF shows no amino acid sequence homology to any known pox virus genes.
EXAMPLE 1B
Homology Vector 443-88.14
The homology vector 443-88.14 contains a 2.8 KB FPV genomic EcoRI fragment and is useful for the insertion of foreign DNA into FPV. The NotI/SfiI linker described above was inserted into a unique SnaBI site in this fragment. This site is designated the 681 insertion site.
The homology vector 443-88.14 was characterized by DNA sequence analysis. The entire sequence of the 2.8 KB fragment was determined (SEQ ID NO: 5). This sequence indicates that the SnaBI site is flanked on one side by a complete ORF of 422 amino acids (ORF1) reading toward the restriction site and on the other side by an incomplete ORF of 387 amino acids (ORF2) also reading toward the restriction site. Both ORF1 and ORF2 share homology with the vaccinia virus M1L gene (ref). The M1L gene shares homology with the vaccinia virus K1L gene which has been shown to be involved in viral host-range functions.
EXAMPLE 1C
Homology Vector 451-08.22
The homology vector 451-08.22 contains a 4.2 KB FPV genomic EcoRI fragment and is useful for the insertion of foreign DNA into FPV. The NotI/SfiI linker described above was inserted into a unique StuI site in this fragment. A unique MluI site is located approximately 500 base pairs away from the StuI insertion site. This site is designated the 540 insertion site.
EXAMPLE 2
Bivalent Vaccines Against Newcastle Disease and Fowlpox
Recombinant FPV expressing proteins from NDV make bivalent vaccines protecting against both Marek's Disease and Newcastle disease. We have constructed several recombinant FPV expressing NDV proteins: S-FPV-013 (example 2A), S-FPV-035 (example 2B), S-FPV-041 (example 2C), S-FPV-042 (example 2D), and S-FPV-043 (example 2E).
EXAMPLE 2A
S-FPV-013
S-FPV-013 is a recombinant fowlpox virus that expresses two foreign genes. The gene for E. coli .beta.-galactosidase (lacZ gene) and the gene for Newcastle Disease virus hemagglutinin-neuraminidase (HN) protein were inserted into the 681 insertion site. The lacZ gene is under the control of a synthetic late promoter LP1 and the HN gene is under the control of the synthetic late promoter LP2.
S-FPV-013 was derived from S-FPV-001. This was accomplished utilizing the homology vector 451-79.95 (see Materials and Methods) and virus S-FPV-001 in the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT FPV. The transfection stock was screened by the SCREEN FOR RECOMBINANT FPV EXPRESSING ENZYMATIC MARKER GENES. The final result of red plaque purification was the recombinant virus designated S-FPV-013. This virus was assayed for .beta.-galactosidase expression, purity, and insert stability by multiple passages monitored by the blue plaque assay as described in the materials and methods. After the initial three rounds of purification all plaques observed were blue indicating that the virus was pure, stable and expressing the marker gene.
S-FPV-013 was assayed for expression of NDV specific antigens using the BLACK PLAQUE SCREEN FOR FOREIGN GENE EXPRESSION IN RECOMBINANT FPV. An NDV HN specific monoclonal antibody (3-1G-5) was shown to react specifically with S-FPV-013 plaques and not with S-FPV-001 negative control plaques. All S-FPV-013 observed plaques reacted with the monoclonal antibody antiserum indicating that the virus was stably expressing the NDV foreign gene.
EXAMPLE 2B
S-FPV-035
S-FPV-035 is a recombinant fowlpox virus that express a foreign gene. The Newcastle Disease virus HN gene was inserted at the 680 insertion site (see example 1A) . The HN gene is under the control of the synthetic early/late promoter EP1LP2.
S-FPV-035 was derived from S-FPV-001. This was accomplished utilizing the homology vector 489-21.1 (see Materials and Methods) and virus S-FPV-001 in the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT FPV. The transfection stock was screened by the PLAQUE HYBRIDIZATION PROCEDURE FOR PURIFYING RECOMBINANT FPV. The final result of plaque hybridization purification was the recombinant virus designated S-FPV-035.
S-FPV-035 was assayed for expression of NDV specific antigens using the BLACK PLAQUE SCREEN FOR FOREIGN GENE EXPRESSION IN RECOMBINANT FPV. An NDV HN specific monoclonal antibody (3-1G-5) was shown to react specifically with S-FPV-035 plaques and not with S-FPV-001 negative control plaques. All S-FPV-035 observed plaques reacted with the monoclonal antibody indicating that the virus was stably expressing the NDV foreign gene.
EXAMPLE 2C
S-FPV-041
S-FPV-041 is a recombinant fowlpox virus that expresses two foreign genes. The gene for E. coli .beta.-galactosidase (lacZ gene) and the gene for Newcastle Disease virus fusion (F) protein were inserted into the 681 insertion site. The lacZ gene is under the control of a synthetic late promoter LP1 and the F gene is under the control of the synthetic early/late promoter EP1LP2.
S-FPV-041 was derived from S-FPV-001. This was accomplished utilizing the homology vector 502-27.5 (see Materials and Methods) and virus S-FPV-001 in the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT FPV. The transfection stock was screened by the SCREEN FOR RECOMBINANT FPV EXPRESSING ENZYMATIC MARKER GENES. The final result of red plaque purification was the recombinant virus designated S-FPV-041. This virus was assayed for .beta.-galactosidase expression, purity, and insert stability by multiple passages monitored by the blue plaque assay as described in the materials and methods. After the initial three rounds of purification all plaques observed were blue indicating that the virus was pure, stable and expressing the marker gene.
S-FPV-041 was assayed for expression of NDV specific antigens using the BLACK PLAQUE SCREEN FOR FOREIGN GENE EXPRESSION IN RECOMBINANT FPV. An NDV F specific monoclonal antibody (5-3F-2) was shown to react specifically with S-FPV-041 plaques and not with S-FPV-001 negative control plaques. All S-FPV-041 observed plaques reacted with the monoclonal antibody indicating that the virus was stably expressing the NDV foreign gene.
EXAMPLE 2D
S-FPV-042
S-FPV-042 is a recombinant fowlpox virus that expresses three foreign genes. The gene for E. coli .beta.-galactosidase (lacZ gene) and the gene for Newcastle Disease virus fusion (F) protein was inserted into the 681 insertion site. The lacZ gene is under the control of a synthetic late promoter LP1 and the F gene is under the control of the synthetic early/late promoter EP1LP2. The Newcastle Disease virus hemagglutinin (HN) gene were inserted at the 680 insertion site. The HN gene is under the control of the synthetic early/late promoter EP1LP2. S-FPV-042 was derived from S-FPV-035. This was accomplished utilizing the homology vector 502-27.5 (see Materials and Methods) and virus S-FPV-035 in the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT FPV. The transfection stock was screened by the SCREEN FOR RECOMBINANT FPV EXPRESSING ENZYMATIC MARKER GENES. The final result of red plaque purification was the recombinant virus designated S-FPV-042. This virus was assayed for .beta.-galactosidase expression, purity, and insert stability by multiple passages monitored by the blue plaque assay as described in the materials and methods. After the initial three rounds of purification all plaques observed were blue indicating that the virus was pure, stable and expressing the marker gene.
S-FPV-042 was assayed for expression of NDV specific antigens using the BLACK PLAQUE SCREEN FOR FOREIGN GENE EXPRESSION IN RECOMBINANT FPV. Monoclonal antibodies specific for both HN (3-1G-5) and F (5-3F-2) were shown to react specifically with S-FPV-042 plaques and not with S-FPV-001 negative control plaques. All S-FPV-042 observed plaques reacted with the monoclonal antibodies indicating that the virus was stably expressing the NDV foreign genes.
EXAMPLE 2E
S-FPV-043
S-FPV-043 is a recombinant fowlpox virus that expresses two foreign genes. The genes for Newcastle Disease virus F protein and HN protein were inserted at the 680 insertion site. The F and HN genes are each under the control of a synthetic early/late promoter EP1LP2.
S-FPV-043 was derived from S-FPV-001. This was accomplished utilizing the homology vector 502-26.22 (see Materials and Methods) and virus S-FPV-001 in the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT FPV. The transfection stock was screened by the PLAQUE HYBRIDIZATION PROCEDURE FOR PURIFYING RECOMBINANT FPV. The final result of plaque hybridization purification was the recombinant virus designated S-FPV-043. The S-FPV-043 has been deposited pursuant to the Budapest Treaty on the International Deposit of Microorganisms for the Purposes of Patent Procedure with the Patent Culture Depository of the American Type Culture Collection, 12301 Parklawn Drive, Rockville, Md. 20852 U.S.A. under ATCC Accession No. VR 2395.
S-FPV-043 was assayed for expression of NDV specific antigens using the BLACK PLAQUE SCREEN FOR FOREIGN GENE EXPRESSION IN RECOMBINANT FPV. Monoclonal antibodies specific for both HN (3-1G-5) and F (5-3F-2) were shown to react specifically with S-FPV-043 plaques and not with S-FPV-001 negative control plaques. All S-FPV-043 observed plaques reacted with the monoclonal antibodies antiserum indicating that the virus was stably expressing the NDV foreign genes.
TESTING OF RECOMBINANT FPV EXPRESSING NDV ANTIGENS
Groups of one day old SPF chicks (HyVac Inc.) were immunized with recombinant fowlpox viruses S-FPV-035, S-FPV-041, or S-FPV-043. Non vaccinated controls were also included. Three weeks post-vaccination, the birds were challenged intramuscularly with either virulent NDV or virulent FPV (Table 1). The challenged chicks were observed daily for 14 days for clinical signs and death due to NDV. Non vaccinated control birds showed 100% mortality. S-FPV-043 vaccinated birds showed 100% protection against FPV challenge. Birds vaccinated with S-FPV-035 showed 95% protection compared with 85% seen with birds immunized with S-FPV-041. These results suggest that recombinants expressing HN or F alone provide only partial protection. When both NDV proteins are combined into the same virus S-FPV-043, an enhancement of protection against lethal NDV challenge is obtained, resulting in a lower protective dose. The chicks that were challenged with FPV were scored for pox lesions. Non vaccinated control birds showed no protection against FPV lesions. Birds vaccinated with S-FPV-043 were completely protected from FPV lesions.
The duration of immunity conferred by vaccination with S-FPV-043 was examined. A group of SPF chicks was immunized with S-FPV-043 at one day of age and then challenged six weeks post-vaccination with either NDV or FPV. Complete protection was observed against both NDV and FPV challenge in S-FPV-043 vaccinated birds, whereas non vaccinated controls were totally susceptible to both challenge viruses. These results suggest that the duration of immunity afforded by vaccination with S-FPV-043 would span the life of a broiler bird (.about.6 weeks).
The effect of vaccinating hens in lay with the recombinant S-FPV-043 was evaluated by assessing egg production post-vaccination. One group of 50 hens was vaccinated and a second group of 50 hens, housed under conditions identical to the vaccinated group, served as non vaccinated controls. Daily egg production was monitored for four weeks post-vaccination. No differences were observed in egg production between the two groups of hens, indicating this vaccine will not adversely affect egg production in laying hens.
A study was conducted to determine whether S-FPV-043 could actively immunize chicks in the presence of maternal antibodies to both NDV and FPV. Chicks obtained from NDV and FPV immunized flocks were vaccinated with S-FPV-043 and three weeks after vaccination, they were challenged with either virulent NDV or virulent FPV. Clinical responses were compared with non vaccinated chicks from the same flock and with non-vaccinated chicks from an antibody negative flock (Table 2). Chicks derived from antibody negative flocks showed 100% mortality after NDV challenge. Protection against NDV challenge, in non-vaccinated chicks known to have maternally derived antibody against NDV, ranged from 30 to 60%. Protection levels increased, to a range of 75 to 85%, when the maternal antibody positive chicks were vaccinated with S-FPV-043 suggesting an active immunization. The increase in NDV protection from 30% to 75% (flock 1) and 55% to 85% (flock 2) clearly demonstrate the ability of S-FPV-043 to partially overcome maternal antibody to both NDV and FPV. A decrease in FPV protection (90%) was observed in flock 1, suggesting some inhibition of FPV replication.
TABLE 1______________________________________Immunity conferred by Fowlpox recombinant vaccines vectoring different genes from Newcastle disease virus. Challenge.sup.aVIRUS DOSE.sup.b NDV FPV______________________________________FPV/NDV-HN 8 .times. 10.sup.5 95 .sup. NT.sup.c FPV/NDV-F 2 .times. 10.sup.4 85 NT FPV/NDV-HN + F 2 .times. 10.sup.3 100 100 Controls none 0 0______________________________________ .sup.a Percent protection following challenge 3 weeks postvaccination .sup.b PFU/0.1 ml dose .sup.c Not tested
TABLE 2__________________________________________________________________________Ability of recombinant vaccine FPV/NDV-HN + F (S- FPV-043) to vaccinate chicks with maternal antibody.History Challenge.sup.aFlock Hen Antibody.sup.b NDV FPVVaccination NDV-HI.sup.c NDV ELISA FPV-AGP.sup.d Vacc. Con. Vacc. Con.__________________________________________________________________________1 NDV + FPV 1:36 1:1738 Neg 75 30 90 0 2 NDV + FPV 1:64 1:2852 Neg 85 55 100 0 3 NDV only 1:92 1:4324 Neg 80 60 95 0 4 None Neg Neg Neg -- 0 -- 0__________________________________________________________________________ .sup.a Percent protection following challenge 3 weeks postvaccination. .sup.b Every flock antibody. .sup.c HI -- Hemagglutination Inhibition Assay .sup.d AGP -- Agar Gel Precipitation Assay
EXAMPLE 2F
S-FPV-074
S-FPV-074 is a recombinant fowlpox virus that expresses two foreign genes. The genes for Newcastle Disease virus F protein and HN protein were inserted at the 681 insertion site. The F and HN genes are each under the control of a synthetic late/early promoter LP2EP2.
S-FPV-074 was derived from S-FPV-001. This was accomplished utilizing the homology vector 584-36.12 (see Materials and Methods) and virus S-FPV-001 in the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT FPV. The transfection stock was screened by the PLAQUE HYBRIDIZATION PROCEDURE FOR PURIFYING RECOMBINANT FPV. The final result of plaque hybridization purification was the recombinant virus designated S-FPV-074.
S-FPV-074 was assayed for expression of NDV specific antigens using the BLACK PLAQUE SCREEN FOR FOREIGN GENE EXPRESSION IN RECOMBINANT FPV. Monoclonal antibodies specific for NDV HN (3-1G-5) and F (5-3F-2) were shown to react specifically with S-FPV-074 plaques and not with S-FPV-001 negative control plaques. All S-FPV-074 observed plaques reacted with the monoclonal antibodies indicating that the virus was stably expressing the NDV foreign genes.
S-FPV-074 expresses foreign antigens from NDV. This virus is useful as a multi-valent vaccine against Newcastle Diseases and Fowlpox.
EXAMPLE 3
Recombinant fowlpox viruses expressing proteins from Marek's disease virus (MDV) make vaccines protecting against both fowlpox virus and Marek's disease virus. We have constructed several recombinant FPV expressing MDV proteins: S-FPV-081, S-FPV-082 and S-FPV-085. Of these S-FPV-082 and S-FPV-085 also express proteins from Newcastle disease virus. These viruses are useful for vaccinating against fowlpox virus, Marek's disease virus, and Newcastle disease virus.
S-FPV-085 further expresses proteins from infectious laryngotracheitis virus (ILTV), making them useful as vaccines against ILTV.
EXAMPLE 3A
S-FPV-081
S-FPV-081 is a recombinant fowlpox virus that expresses three foreign genes. The gene for E.coli .beta.-galactosidase (lacZ gene) and the genes for Marek's Disease virus (MDV) glycoprotein D (gD) and glycoprotein B (gB) were inserted into the 681 insertion site. The lac Z gene is under the control of a synthetic late promoter LP1 and the MDV gD and gB genes are under the control of the synthetic early/late promoters LP2EP2 and EP1LP2 respectively.
S-FPV-081 was derived from S-FPV-001. This was accomplished utilizing the homology vector 608-10.3 (see Materials and Methods) and virus S-FPV-001 in the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT FPV. The transfection stock was screened by the SCREEN FOR RECOMBINANT FPV EXPRESSING ENZYMATIC MARKER GENES. The final result of red plaque purification was the recombinant virus designated S-FPV-081. This virus was assayed for .beta.-galactosidase expression, purity, and insert stability by multiple passages monitored by the blue plaque assay as described in the materials and methods. After the initial three rounds of purification all plaques observed were blue indicating that the virus was pure, stable and expressing the marker gene.
S-FPV-081 was assayed for expression of MDV specific antigens using the BLACK PLAQUE SCREEN FOR FOREIGN GENE EXPRESSION IN RECOMBINANT FPV. Convalescent sera from MDV infected chickens was shown to react specifically with S-FPV-081 plaques and not with S-FPV-001 negative control plaques. All S-FPV-081 observed plaques reacted with the chicken antiserum indicating that the virus was stably expressing the MDV foreign genes. Western blot assays of infected cell lysates using convalescent sera from MDV-infected chickens indicated that S-FPV-081 was expressing a MDV glycoprotein B and MDV glycoprotein D.
S-FPV-081 expresses foreign antigens from MDV. This virus is useful as a multi-valent vaccine against Marek's Disease and Fowlpox.
EXAMPLE 3B
S-FPV-082
S-FPV-082 is a recombinant fowlpox virus that expresses five foreign genes. The genes for Newcastle Disease virus F protein and HN protein were inserted at the 680 insertion site. The F and HN genes are each under the control of a synthetic early/late promoter EP1LP2. The gene for E. coli .beta.-galactosidase (lacZ gene) and the genes for Marek's Disease virus (MDV) gD and gB were inserted into the 681 insertion site. The lacZ gene is under the control of a synthetic late promoter LP1 and the MDV gD and gB genes are under the control of the synthetic early/late promoters LP2EP2 and EP1LP2 respectively.
S-FPV-082 was derived from S-FPV-043. This was accomplished utilizing the homology vector 608-10.3 (see Materials and Methods) and virus S-FPV-043 in the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT FPV. The transfection stock was screened by the SCREEN FOR RECOMBINANT FPV EXPRESSING ENZYMATIC MARKER GENES. The final result of red plaque purification was the recombinant virus designated S-FPV-082. This virus was assayed for .beta.-galactosidase expression, purity, and insert stability by multiple passages monitored by the blue plaque assay as described in the materials and methods. After the initial three rounds of purification all plaques observed were blue indicating that the virus was pure, stable and expressing the marker gene.
S-FPV-082 was assayed for expression of MDV specific antigens using the BLACK PLAQUE SCREEN FOR FOREIGN GENE EXPRESSION IN RECOMBINANT FPV. Convalescent sera from MDV infected chickens was shown to react specifically with S-FPV-082 plaques and not with S-FPV-001 negative control plaques. All S-FPV-082 observed plaques reacted with the chicken antiserum indicating that the virus was stably expressing the MDV foreign genes.
S-FPV-082 expresses foreign antigens from NDV and MDV. This virus will be valuable as a multi-valent vaccine against Newcastle Disease, Marek's Disease and Fowlpox.
EXAMPLE 3C
S-FPV-085
S-FPV-085 is a recombinant fowlpox virus that expresses eight foreign genes. The genes for Newcastle Disease virus F protein and HN protein are inserted at the 680 insertion site. The F and HN genes are each under the control of a synthetic early/late promoter EP1LP2. The gene for E.coli .beta.-galactosidase (lacZ gene) and the genes for Marek's Disease virus (MDV) gD and gB are inserted into the 681 insertion site. The lac Z gene is under the control of a synthetic late promoter LP1 and the MDV gD and gB genes are under the control of the synthetic early/late promoters LP2EP2 and EP1LP2 respectively. The gene for E.coli .beta.-glucuronidase (uidA gene) and the genes for Infectious Laryngotracheitis virus (ILTV) gD and gB are inserted into the 540 insertion site. The uidA gene is under the control of a synthetic late promoter LP1 and the ILTV gD and gB genes are each under the control of a synthetic early/late promoter EP1LP2.
S-FPV-085 is derived from S-FPV-082. This is accomplished utilizing the homology vector 586-36.6 (see Materials and Methods) and virus S-FPV-082 in the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT FPV. The transfection stock is screened by the SCREEN FOR RECOMBINANT FPV EXPRESSING ENZYMATIC MARKER GENES. The final result of blue plaque (.beta.-glucuronidase) purification is the recombinant virus designated S-FPV-085. This virus is assayed for .beta.-glucuronidase expression, purity, and insert stability by multiple passages monitored by the blue plaque assay as described in the materials and methods. After the initial three rounds of purification all plaques observed are blue indicating that the virus is pure, stable and expressing the marker gene.
S-FPV-085 is assayed for expression of MDV specific antigens using the BLACK PLAQUE SCREEN FOR FOREIGN GENE EXPRESSION IN RECOMBINANT FPV. S-FPV-085 expresses foreign antigens from NDV, MDV and ILTV. This virus is useful as a multi-valent vaccine against Newcastle Disease, Marek's Disease, Infectious Laryngotracheitis and Fowlpox.
EXAMPLE 4
Recombinant fowlpox virus (FPV) expressing proteins from infectious laryngotracheitis virus (ILTV) make vaccines protecting against both FPV and ILTV. We have constructed several recombinant FPV expressing ILTV proteins: S-FPV-095, S-FPV-083, and S-FPV-097. Of these, S-FPV-083 and S-FPV-097 also express proteins from Newcastle disease virus (NDV), making them useful as vaccines against NDV as well.
EXAMPLE 4A
S-FPV-095
S-FPV-095 is a recombinant fowlpox virus that expresses three foreign genes. The gene for E.coli .beta.-glucuronidase (uidA gene) and the genes for Infectious Laryngotracheitis virus (ILTV) glycoprotein D (gD) and glycoprotein B (gB) were inserted into the 540 insertion site. The uidA gene is under the control of a synthetic late promoter LP1 and the ILTV gD and gB genes are each under the control of a synthetic early/late promoter EP1LP2.
S-FPV-095 was derived from S-FPV-001. This was accomplished utilizing the homology vector 694-10.4 (see Materials and Methods) and virus S-FPV-001 in the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT FPV. The transfection stock was screened by the SCREEN FOR RECOMBINANT FPV EXPRESSING ENZYMATIC MARKER GENES. The final result of blue plaque purification (.beta.-glucuronidase) was the recombinant virus designated S-FPV-095. This virus was assayed for .beta.-glucuronidase expression, purity, and insert stability by multiple passages monitored by the blue plaque assay as described in the materials and methods. After the initial three rounds of purification all plaques observed were blue indicating that the virus was pure, stable and expressing the marker gene.
S-FPV-095 was assayed for expression of ILTV specific antigens using the BLACK PLAQUE SCREEN FOR FOREIGN GENE EXPRESSION IN RECOMBINANT FPV. Antibodies to ILTV gB and gD was shown to react specifically with S-FPV-095 plaques and not with S-FPV-001 negative control plaques. All S-FPV-095 observed plaques reacted with the antiserum indicating that the virus was stably expressing the ILTV foreign genes.
S-FPV-095 expresses foreign antigens from ILTV. This virus is useful as a multi-valent vaccine against Infectious Laryngotracheitis and Fowlpox.
EXAMPLE 4B
S-FPV-083
S-FPV-083 is a recombinant fowlpox virus that expresses five foreign genes. The genes for Newcastle Disease virus F protein and HN protein were inserted at the 680 insertion site. The F and HN genes are each under the control of a synthetic early/late promoter EP1LP2. The gene for E. coli .beta.-glucuronidase (uidA gene) and the genes for Infectious Laryngotracheitis virus (ILT) gD and gB were inserted into the 540 insertion site. The uidA gene is under the control of a synthetic late promoter LP1 and the ILT gD and gB genes are each under the control of a synthetic early/late promoter (EP1LP2).
S-FPV-083 was derived from S-FPV-043. This was accomplished utilizing the homology vector 586-36.6 (see Materials and Methods) and virus S-FPV-043 in the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT FPV. The transfection stock was screened by the SCREEN FOR RECOMBINANT FPV EXPRESSING ENZYMATIC MARKER GENES. The final result of blue plaque purification was the recombinant virus designated S-FPV-083. This virus was assayed for .beta.-glucuronidase expression, purity, and insert stability by multiple passages monitored by the blue plaque assay as described in the materials and methods. After the initial three rounds of purification all plaques observed were blue indicating that the virus was pure, stable and expressing the marker gene.
S-FPV-083 was assayed for expression of ILTV specific antigens using the BLACK PLAQUE SCREEN FOR FOREIGN GENE EXPRESSION IN RECOMBINANT FPV. Convalescent sera from ILTV infected chickens was shown to react specifically with S-FPV-083 plaques and not with S-FPV-001 negative control plaques. All S-FPV-083 observed plaques reacted with the chicken antiserum indicating that the virus was stably expressing the ILTV foreign genes.
S-FPV-083 expresses foreign antigens from NDV and ILTV. This virus will be valuable as a multi-valent vaccine against Newcastle Disease, Infectious Laryngotracheitis and Fowlpox.
EXAMPLE 4C
S-FPV-097
S-FPV-097 is a recombinant fowlpox virus that expresses five foreign genes. The genes for Newcastle Disease virus F protein and HN protein were inserted at the 680 insertion site. The F and HN genes are each under the control of a synthetic early/late promoter EP1LP2. The gene for E.coli .beta.-glucuronidase (uidA gene) and the genes for Infectious Laryngotracheitis virus (ILTV) glycoprotein D (gD) and glycoprotein B (gB) were inserted into the 540 insertion site. The uidA gene is under the control of a synthetic late promoter LP1 and the ILTV gD and gB genes are each under the control of a synthetic early/late promoter EP1LP2.
S-FPV-097 was derived from S-FPV-043. This was accomplished utilizing the homology vector 694-10.4 (see Materials and Methods) and virus S-FPV-043 in the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT FPV. The transfection stock was screened by the SCREEN FOR RECOMBINANT FPV EXPRESSING ENZYMATIC MARKER GENES. The final result of blue plaque purification was the recombinant virus designated S-FPV-097. This virus was assayed for .beta.-glucuronidase expression, purity, and insert stability by multiple passages monitored by the blue plaque assay as described in the materials and methods. After the initial three rounds of purification all plaques observed were blue indicating that the virus was pure, stable and expressing the marker gene.
S-FPV-097 was assayed for expression of ILTV specific antigens using the BLACK PLAQUE SCREEN FOR FOREIGN GENE EXPRESSION IN RECOMBINANT FPV. Antibodies to ILTV gB and gD was shown to react specifically with S-FPV-097 plaques and not with S-FPV-001 negative control plaques. All S-FPV-097 observed plaques reacted with the antiserum indicating that the virus was stably expressing the ILTV foreign genes. All S-FPV-097 observed plaques reacted with the chicken antiserum to ILTV indicating that the virus was stably expressing the ILTV foreign genes. Monoclonal antibodies specific for NDV HN (3-1G-5) and F (5-3F-2) were shown to react specifically with S-FPV-097 plaques and not with S-FPV-001 negative control plaques. All S-FPV-097 observed plaques reacted with the monoclonal antibodies indicating that the virus was stably expressing the NDV foreign genes.
S-FPV-097 expresses foreign antigens from NDV and ILTV. This virus is useful as a multi-valent vaccine against Newcastle Disease, Infectious Laryngotracheitis and Fowlpox.
EXAMPLE 5
Recombinant fowlpox virus (FPV) expressing proteins from infectious bronchitis virus (IBV) make vaccines protecting against both FPV and IBV. We have constructed two recombinant FPV expressing IBV proteins: S-FPV-072 and S-FPV-079. Both of these viruses also express proteins from Newcastle disease virus (NDV), making them useful as vaccines against NDV.
EXAMPLE 5A
S-FPV-072
S-FPV-072 is a recombinant fowlpox virus that expresses five foreign genes. The genes for Newcastle Disease virus F protein and HN protein were inserted at the 680 insertion site. The F and HN genes are each under the control of a synthetic early/late promoter EP1LP2. The gene for E.coli .beta.-galactosidase (lacZ gene) and the genes for Infectious Bronchitis virus (IBV) Massachusetts Spike protein (Mass Spike) and Massachusetts Matrix protein (Mass Matrix) were inserted into the 681 insertion site. The lac Z gene is under the control of a synthetic late promoter LP1 and the IBV Mass Spike and Mass Matrix genes are each under the control of the synthetic early/late promoter EP1LP2.
S-FPV-072 was derived from S-FPV-043. This was accomplished utilizing the homology vector 538-51.27 (see Materials and Methods) and virus S-FPV-043 in the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT FPV. The transfection stock was screened by the SCREEN FOR RECOMBINANT FPV EXPRESSING ENZYMATIC MARKER GENES. The final result of red plaque purification was the recombinant virus designated S-FPV-072. This virus was assayed for .beta.-galactosidase expression, purity, and insert stability by multiple passages monitored by the blue plaque assay as described in the materials and methods. After the initial three rounds of purification, all plaques observed were blue indicating that the virus was pure, stable and expressing the marker gene.
S-FPV-072 was assayed for expression of NDV and IBV specific antigens using the BLACK PLAQUE SCREEN FOR FOREIGN GENE EXPRESSION IN RECOMBINANT FPV. Monoclonal antibody 15-88 to the IBV Mass Spike protein was shown to react specifically with S-FPV-072 plaques and not with S-FPV-001 negative control plaques. All S-FPV-072 observed plaques reacted with the monoclonal antibodies indicating that the virus was stably expressing the IBV foreign gene. Western blot assays of infected cell lysates using monoclonal antibody 15-88 to the IBV Mass Spike protein indicated that S-FPV-072 was expressing a 90 kD IBV Mass Spike protein. Monoclonal antibodies specific for both HN (3-1G-5) and F (5-3F-2) were shown to react specifically with S-FPV-072 plaques and not with S-FPV-001 negative control plaques. All S-FPV-072 observed plaques reacted with the monoclonal antibodies indicating that the virus was stably expressing the NDV foreign genes.
S-FPV-072 expresses foreign antigens from NDV and IBV. This virus is useful as a multi-valent vaccine against Newcastle Diseases, Infectious Bronchitis, and Fowlpox.
EXAMPLE 5B
S-FPV-079 is a recombinant fowlpox virus that expresses seven foreign genes. The genes for Newcastle Disease virus F protein and HN protein were inserted at the 680 insertion site. The F and HN genes are each under the control of a synthetic early/late promoter EP1LP2. The gene for E.coli .beta.-galactosidase (lacZ gene) and the genes for Infectious Bronchitis virus (IBV) Massachusetts Spike protein (Mass Spike) and Massachusetts Matrix protein (Mass Matrix) were inserted into the 681 insertion site. The lac Z gene is under the control of a synthetic late promoter LP1 and the IBV Mass Spike and Mass Matrix genes are each under the control of the synthetic early/late promoter EP1LP2. The gene for the E. coli .beta.-glucuronidase (uidA) gene and the gene for the IBV Mass Nucleocapsid protein were inserted into the 540 insertion site. The uidA gene is under the control of the synthetic late/early promoter LP2EP2 and the IBV Mass Nucleocapsid gene is under the control of the synthetic early/late promoter EP1LP2.
S-FPV-079 was derived from S-FPV-072. This was accomplished utilizing the Homology Vector 611-49.1 (see Materials and Methods) and virus S-FPV-072 in the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT FPV. The transfection stock was screened by the SCREEN FOR RECOMBINANT FPV EXPRESSING ENZYMATIC MARKER GENES. The final result of red plaque purification was the recombinant virus designated S-FPV-079. This virus was assayed for B-galactosidase expression, purity, and insert stability by multiple passages monitored by the blue plaque assay as described in the materials and methods. After the initial three rounds of purification, all plaques observed were blue indicating that the virus was pure, stable and expressing the marker gene.
S-FPV-079 was assayed for expression of NDV and IBV specific antigens using the BLACK PLAQUE SCREEN FOR FOREIGN GENE EXPRESSION IN RECOMBINANT FPV. Monoclonal antibody 15-88 to the IBV Mass Spike protein was shown to react specifically with S-FPV-072 plaques and not with S-FPV-001 negative control plaques. All S-FPV-079 observed plaques reacted with the monoclonal antibody antiserum to IBV indicating that the virus was stably expressing the IBV foreign gene. Western blot assays of infected cell lysates using monoclonal antibody 15-88 to the IBV Mass Spike protein indicated that S-FPV-079 was expressing a 90 kD IBV Mass Spike protein. Monoclonal antibodies specific for both HN (3-1G-5) and F (5-3F-2) were shown to react specifically with S-FPV-079 plaques and not with S-FPV-001 negative control plaques. All S-FPV-079 observed plaques reacted with the monoclonal antibodies indicating that the virus was stably expressing the NDV foreign genes.
S-FPV-079 expresses foreign antigens from NDV and IBV. This virus is useful as a multi-valent vaccine against Newcastle Diseases, Infectious Bronchitis, and Fowlpox.
EXAMPLE 6
Recombinant fowlpox virus, S-FPV-099 or S-FPV-101, expressing chicken interferon (cIFN) or S-FPV-100, expressing chicken myelomonocytic growth factor (cMGF), are useful to enhance the immune response when added to vaccines against diseases of poultry. Chicken myelomonocytic growth factor (cMGF) is homologous to mammalian interleukin-6 protein, and chicken interferon (cIFN) is homologous to mammalian interferon Type I. When used alone or in combination with vaccines against specific avian diseases, S-FPV-099, S-FPV-100 and S-FPV-101 provide enhanced mucosal, humoral, or cell mediated immunity against avian disease-causing viruses including, but not limited to, Marek's disease virus, Newcastle disease virus, infectious laryngotracheitis virus, infectious bronchitis virus, infectious bursal disease virus.
S-FPV-099
S-FPV-099 is a recombinant fowlpox virus that expresses two foreign genes. The genes for chicken interferon (cIFN) and E. coli lacZ were inserted at the uniqe SnaBI restriction endonuclease site in the 2.8 kB EcoRI FPV genomic fragment (681 insertion site). The cIFN gene is under the control of a synthetic late/early promoter LP2EP2, and the E. coli lacZ gene is under the control of a synthetic late promoter LP1.
S-FPV-099 was derived from S-FPV-001. This was accomplished utilizing the homology vector 751-07.D1 (see Materials and Methods) and virus S-FPV-001 in the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT FPV. The transfection stock was screened by the SCREEN FOR RECOMBINANT FPV EXPRESSING ENZYMATIC MARKER GENES. The final result of red plaque purification was the recombinant virus designated S-FPV-099. This virus was assayed for .beta.-galactosidase expression, purity, and insert stability by multiple passages monitored by the blue plaque assay as described in Materials and Methods. After the initial three rounds of purification, all plaques observed were blue indicating that the virus S-FPV-099 was pure, stable, and expressing the foreign gene.
Supernatants from S-FPV-099 have interferon activity in cell culture. Addition of S-FPV-099 conditioned media to chicken embryo fibroblast (CEF) cell culture inhibits infection of the CEF cells by vesicular stomatitis virus or by herpesvirus of turkeys. S-FPV-099 is useful to enhance the immune response alone or when added to vaccines against diseases of poultry.
S-FPV-100
S-FPV-100 is a recombinant fowlpox virus that expresses two foreign genes. The genes for chicken myelomonocytic growth factor (cMGF) and E. coli lacZ were inserted at the uniqe SnaBI restriction endonuclease site in the 2.8 kB EcoRI FPV genomic fragment (681 insertion site). The cMGF gene is under the control of a synthetic late/early promoter LP2EP2, and the E. coli lacZ gene is under the control of a synthetic late promoter LP1.
S-FPV-100 was derived from S-FPV-001. This was accomplished utilizing the homology vector 751-56.C1 (see Materials and Methods) and virus S-FPV-001 in the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT FPV. The transfection stock was screened by the SCREEN FOR RECOMBINANT FPV EXPRESSING ENZYMATIC MARKER GENES. The final result of red plaque purification was the recombinant virus designated S-FPV-100. This virus was assayed for .beta.-galactosidase expression, purity, and insert stability by multiple passages monitored by the blue plaque assay as described in Materials and Methods. After the initial three rounds of purification, all plaques observed were blue indicating that the virus S-FPV-100 was pure, stable, and expressing the foreign gene.
S-FPV-100 is useful to enhance the immune response alone or when added to vaccines against diseases of poultry.
S-FPV-101
S-FPV-101 is a recombinant fowlpox virus that expresses four foreign genes. The genes for chicken interferon (cIFN) and E. coli lacZ were inserted at the uniqe SnaBI restriction endonuclease site in the 2.8 kB EcoRI FPV genomic fragment (681 insertion site). The cIFN gene is under the control of a synthetic late/early promoter LP2EP2, and the E. coli lacZ gene is under the control of a synthetic late promoter LP1. The genes for Newcastle Disease virus F protein and HN protein were inserted at the 680 insertion site. The F and HN genes are each under the control of a synthetic early/late promoter EP1LP2.
S-FPV-101 was derived from S-FPV-043. This was accomplished utilizing the homology vector 751-07.D1 (see Materials and Methods) and virus S-FPV-043 in the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT FPV. The transfection stock was screened by the SCREEN FOR RECOMBINANT FPV EXPRESSING ENZYMATIC MARKER GENES. The final result of red plaque purification was the recombinant virus designated S-FPV-101. This virus was assayed for .beta.-galactosidase expression, purity, and insert stability by multiple passages monitored by the blue plaque assay as described in Materials and Methods. After the initial three rounds of purification, all plaques observed were blue indicating that the virus S-FPV-101 was pure, stable, and expressing the foreign gene.
Supernatants from S-FPV-101 have interferon activity in cell culture. Addition of S-FPV-101 conditioned media to chicken embryo fibroblast (CEF) cell culture inhibits infection of the CEF cells by vesicular stomatitis virus or by herpesvirus of turkeys. S-FPV-101 is useful to enhance the immune response alone or when added to vaccines against diseases of poultry. S-FPV-101 is useful as a multi-valent vaccine against Newcastle Diseases and Fowlpox.
EXAMPLE 7
Recombinant fowlpox virus expressing Newcastle's disease virus HN and F proteins lacking the membrane anchor sequences is a superior vaccine against fowlpox and Newcastle's disease.
Day old chicks from hens which have been exposed to or vaccinated against Newcastle's disease virus carry antibodies to NDV which may neutralize a vaccine containing a recombinant fowlpox virus expressing the NDV HN and F proteins. In vitro virus neutralization (VN) assays using VN monoclonal antibodies specific for either NDV HN or F proteins have been shown to neutralize recombinant fowlpox virus expressing the NDV HN and F proteins. These results suggest that the NDV HN and F glycoproteins are incorporated into the fowlpox virus virion. To increase the efficacy of a vaccine in the presence on maternal antibodies against Newcastle's disease virus, a recombinant fowlpox virus is constructed which expresses the NDV HN and F proteins lacking the membrane anchor domains of each protein. The resulting recombinant virus produces NDV HN and F proteins secreted into the serum of the vaccinated animal producing a strong humoral and cell mediated immune response to the Newcastle's disease virus. The NDV HN and F proteins are not presented on the surface of the FPV particle and thus evade neutralization by maternal antibodies present in the vaccinated day old chicks.
The hemagglutinin-Neuraminidase (HN) and Fusion (F) genes from the B1 strain of Newcastle Disease Virus (ATCC VR-108) were isolated as cDNA clones, using oligo dT primed poly A selected mRNA.
The fusion (F) protein mediates penetration of NDV into host cells by fusion of the viral envelope with the host cell plasma membrane. A posttranslational cleavage of inactive precursors F.sub.0 into two disulfide-bonded polypeptides, F1 and F2, is necessary to produce fusion active F protein and thereby yield infectious virions. The new hydrophobic N-terminus of F1 generated after cleavage of F.sub.0 is responsible for the fusion characteristic of paramyxoviruses and thus determines virulence. The required proteolytic cleavage signal (paired basic residues) in the NDV B1 strain is altered, thereby preventing cleavage of F.sub.0 into F1 and F2, resulting in an attenuated NDV strain. The addition of the NDV F signal sequence (aa1-25) to VP2 (vFP147), resulted in the secretion of VP2 in the TC fluid, but abolished its protective response (Paoletti, et. al WO 93/03145). Three hydrophobic domains exist within the F glycoprotein which interact with the lipid bilayer:1). The signal sequence at the N-terminus of the primary translation product F.sub.0 ; 2). the N-terminus of F1; and 3). the transmembrane anchor domain near the C-terminus of F1. The F glycoprotein of the B1 strain of NDV is 544 amino acids in length with the transmembrane anchor domain spanning 27 amino acids from position 500 to 526 (LITYIVLTIISLVFGILSLILACYLMY). Amino acids 1-499 of the NDV F protein are expressed under the control of a synthetic promoter element which functions as both an early and late promoter, such as EP1LP2 or LP2EP2, directing expression throughout the reproduction cycle. This results in the deletion of amino acids 527-544, the cytoplasmic tail, thought to interact with the inner membrane protein (M) before or during virus assembly. A recombinant fowlpox virus is constructed which expresses the NDV F protein lacking the C-terminal membrane anchor domain from a synthetic early/late promoter.
The hemagglutinin-neuraminidase (HN) glycoprotein provides NDV with the ability to agglutinate and elute erythrocytes. The process consists of two stages: attachment of the virus to the receptor on the red blood cell surface (agglutination) and destruction of the receptor by the neuraminidase enzyme activity (elution). The major hydrophobic anchor domain is present near the N-terminus of HN, supporting the view that the N-terminus is anchored to the lipid bilayer. The HN glycoprotein of the B1 strain of NDV is 577 amino acids in length with the transmembrane anchor domain spanning 28 amino acids from position 27 to 54 (IAILFLTVVTLAISVASLLYSMGASTPS). The extreme N-terminal amino acids (1 to 26) are relatively hydrophilic. Amino acids 55 to 577 of the HN protein are expressed under the control of a synthetic promoter element which functions as both an early and late promoter, such as EP1LP2 or LP2EP2, directing expression throughout the reproduction cycle. THE NDV HN polypeptide has a membrane transport signal sequence, such as the PRV gX signal sequence, at its amino terminus to direct the protein to be secreted into the serum of a vaccinated animal. A recombinant fowlpox virus is constructed which expresses the NDV HN protein lacking the N-terminal membrane anchor domain and containing an N-terminal PRV gX signal sequence from a synthetic early/late promoter. Alternatively the NDV HN polypeptide contains a deletion of the transmembrane anchor domain spanning 28 amino acids from position 27 to 54 and retains amino acids 1 to 26 and 55 to 577. A recombinant fowlpox virus is constructed which expresses the NDV HN protein lacking the membrane anchor domain (amino acids 27 to 54) from a synthetic early/late promoter.
A recombinant fowlpox virus is constructed which expresses both the NDV HN and F proteins lacking the membrane anchor domains of each protein from a synthetic early/late promoter. The resulting recombinant virus produces NDV HN and F proteins secreted into the serum of the vaccinated animal producing a strong humoral and cell mediated immune response to the Newcastle's disease virus. The NDV HN and F proteins are not presented on the surface of the FPV particle and thus evade neutralization by maternal antibodies present in the vaccinated day old chicks.
EXAMPLE 8
Recombinant fowlpox virus expressing cell surface receptors on the surface of the FPV viral particle useful for targeting gene products to specific tissues or organs.
Serum from chickens carrying maternal antibodies to Newcastle's disease virus inhibits productive infection and plaque formation by S-FPV-043 on chicken embryo fibroblasts in cell culture. One explanation for this result is that the antigenic epitopes of the NDV HN and F proteins expressed in S-FPV-043 are displayed on the surface of the fowlpox viral particle. Display of proteins on the surface of the FPV particle is useful to target specific gene products to specific normal cell types or tumor cell types. Proteins which are displayed on the surface of the FPV particle include but are not limited to integrins which would target the virus to integrin receptors on the cell surface; erythropoetin which would target the virus to erythropoetin receptors on the surface of red blood cells; antibodies or other proteins which would target to specific proteins or receptors on the surface of normal or tumor cells. The fowlpox virus also delivers cytokines, interleukins, interferons, or colony stimulating factors which stimulate a strong humoral or cell mediated immune response against a tumor or disease causing organism. The proteins displayed on the surface of the fowlpox virus are expressed from the fowlpox genome as fusion proteins to the membrane anchor domains of the NDV HN or F proteins, or to other proteins containing membrane anchor domains. The cytokines, interleukins, interferons, or colony stimulating factors are expressed as fusion proteins to PRV gX, E. coli .beta.-galactosidase or another protein in a soluble, not membrane bound, form. The fusion protein stabilizes the cytokine protein and allows it to diffuse in the serum of the animal to reach its cellular target.
EXAMPLE 9
S-FPV-098
S-FPV-098 is a recombinant fowlpox virus that expresses two foreign genes. The genes for infectious bursal disease virus (IBDV) polymerase gene and E. coli lacZ were inserted at the 681 insertion site. The IBDV polymerase gene is under the control of a synthetic late/early promoter LP2EP2, and the E. coli lacZ gene is under the control of a synthetic late promoter LP1. S-FPV-098 was derived from S-FPV-001. This was accomplished utilizing the homology vector 749-75.82 (see Materials and Methods) and virus S-FPV-001 in the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT FPV. The transfection stock was screened by the SCREEN FOR RECOMBINANT FPV EXPRESSING ENZYMATIC MARKER GENES. The final result of red plaque purification was the recombinant virus designated S-FPV-098. This virus was assayed for .beta.-galactosidase expression, purity, and insert stability by multiple passages monitored by the blue plaque assay as described in Materials and Methods. After the initial three rounds of purification, all plaques observed were blue indicating that the virus S-FPV-098 was pure, stable, and expressing the foreign gene.
S-FPV-098 is useful for expression of IBDV polymerase protein. S-FPV-098 is useful in an in vitro approach to a recombinant IBDV attenuated vaccine. RNA strands from the attenuated IBDV strain are synthesized in a bacterial expression system using T3 or T7 promoters (pBlueScript plasmid; Stratagene, Inc.) to synthesize double stranded short and long segments of the IBDV genome. The IBDV double stranded RNA segments and S-FPV-098 are transfected into Vero cells. The fowlpox virus expresses the IBDV polymerase but does not replicate in Vero cells. The IBDV polymerase produced from S-FPV-098 synthesizes infectious attenuated IBDV virus from the double stranded RNA genomic templates. The resulting attenuated IBDV virus is useful as a vaccine against infectious bursal disease in chickens.
As an alternative to the construction of a IBD vaccine using a viral vectored delivery system and/or subunit approaches, IBD virus RNA is directly manipulated reconstructing the virus using full length RNA derived from cDNA clones representing both the large (segment A) and small (segment B) double-stranded RNA subunits. Generation of IBD virus is this manner offers several advantages over the first two approaches. First, if IBD virus is re-generated using RNA templates, one is able to manipulate the cloned cDNA copies of the viral genome prior to transcription (generation of RNA). Using this approach, it is possible to either attenuate a virulent IBD strain or replace the VP2 variable region of the attenuated vaccine backbone with that of virulent strains. In doing so, the present invention provides protection against the virulent IBDV strain while providing the safety and efficacy of the vaccine strain. Furthermore, using this approach, the present invention constructs and tests temperature sensitive IBD viruses generated using the RNA polymerase derived from the related birnavirus infectious pancreatic necrosis virus (IPNV) and the polyprotein derived from IBDV. The IPNV polymerase has optimum activity at a temperature lower than that of IBDV. If the IPNV polymerase recognizes the regulatory signals present on IBDV, the hybrid virus is expected to be attenuated at the elevated temperature present in chickens. Alternatively, it is possible to construct and test IBD viruses generated using the RNA polymerase derived from IBDV serotype 2 viruse and the polyprotein derived from IBDVserotype 1 virus.
cDNA clones representing the complete genome of IBDV (double stranded RNA segments A and B) is constructed, initially using the BursaVac vaccine strain (Sterwin Labs). Once cDNA clones representing full length copies of segment A and B are constructed, template RNA is prepared. Since IBDV exists as a bisegmented double-stranded RNA virus, both the sense and anti-sense RNA strands of each segment are produced using the pBlueScript plasmid; Stratagene, Inc.). These vectors utilize the highly specific phage promoters SP6 or T7 to produce substrate amounts of RNA in vitro. A unique restriction endonuclease site is engineered into the 3' PCR primer to linearize the DNA for the generation of run-off transcripts during transcription.
The purified RNA transcripts (4 strands) are transfected into Vero cells to determine whether the RNA is infectious. If IBD virus is generated, as determined by black plaque assays using IBDV specific Mabs, no further manipulations are required and engineering of the vaccine strain can commence. The advantage of this method is that engineered IBD viruses generated in this manner will be pure and require little/no purification, greatly decreasing the time required to generate new vaccines. If negative results are obtained using the purified RNA's, functional viral RNA polymerase is required by use of a helper virus. Birnaviruses replicate their nucleic acid by a strand displacement (semi-conservative) mechanism, with the RNA polymerase binding to the ends of the double-stranded RNA molecules forming circularized ring structures (Muller & Nitschke, Virology 159, 174-177, 1987). RNA polymerase open reading frame of about 878 amino acids in fowlpox virus is expressed and this recombinant virus (S-FPV-098) is used to provide functional IBDV RNA polymerase in trans. Fowlpox virus expressed immunologically recognizable foreign antigens in non-avian cells (Vero cells), where there are no signs of productive replication of the viral vector (Paoletti et al., Technological Advances in Vaccine Development, 321-334, 1988, Alan R. Liss, Inc.). In the present invention the IBDV polymerase protein is expressed in the same cells as the transfected RNA using the fowlpox virus vector without contaminating the cells with FPV replication.
With the demonstration that IBD virus is generated in vitro using genomic RNA, an improved live attenuated virus vaccines against infectious bursal disease is developed. Using recombinant DNA technology along with the newly defined system of generating IBD virus, specific deletions within the viral genome, facilitating the construction of attenuated viruses are made. Using this technology, the region of IBDV responsible for virulence and generate attenuated, immunogenic IBDV vaccines are identified. The present invention provides a virulent IBD strain or replacement of the VP2 variable region of the attenuated vaccine backbone with that of a virulent strain, thus protecting against the virulent strain while providing the safety and efficacy of the vaccine strain.
EXAMPLE 10
The chicken interferon (cIFN) gene was cloned into wild type (FPV) viruses by homologous recombinant techniques. Briefly, the entire coding region of cIFN was isolated from activated chicken spleen cell RNA by RT/PCR using primer sequences from the recently published cIFN sequence (Sekellick, M., et al., 1994). Recombinant FPV viruses containing cIFN, and FPV/cIFN (S-FPV-099), were engineered to contain the entire cIFN ORF under the control of a synthetic pox virus promoter (LP2EP2), which functions as both an early and late promoter, directing expression throughout the entire viral replication cycle.
A third recombinant virus, FPV/cIFN+NDV, (S-FPV-101) was made in a similar manner, except that a FPV virus previously engineered to contain the Newcastle Disease (NDV) antigens HN and F was used as the parent virus during homologous recombination, thus yielding a recombinant fowlpox virus co-expressing the cIFN and NDV genes. All recombinant viruses contain the lac Z gene engineered in tandem with cIFN under the control of a synthetic late (LP1) pox promoter. All promoter/gene constructs were sequenced at the promoter/cIFN junction to confirm the integrity of the proper DNA coding frame. Co-expression of .beta.-galactosidase facilitated the isolation and plaque purification of the recombinant viruses. Independent viral insertion sites were used for insertion of the cIFN gene and the NDV genes in the fowlpox virus. The insertion sites were found to interrupt nonessential virus genes in both SPV and FPV.
To confirm the presence of the cIFN gene, recombinant viral DNAs were analyzed by PCR, using cIFN specific primers flanking the coding region. All viral DNA's yielded the expected 600 bp amplified cIFN DNA product. In addition, southern blot analysis on the viral DNA was performed using a non-radioactive labeled cIFN cDNA probe. Plasmid constructs containing the cIFN gene cassettes were sequenced across the transcriptional and translational initiation/termination signals, to confirm the integrity of the ORF.
Growth Properties of Recombinant Viruses in Cell Culture
Recombinant FPV/cIFN and FPV/cIFN+NDV were found to be attenuated with respect to their growth in chicken embryo fibroblast (CEF) cells. Plaque size was decreased significantly and viral titers were 0.9-1.4 logs less when compared to wild type FPV. We suggest that fowlpox virus has anti-IFN mechanisms, similar to anti-IFN mechanisms reported for other pox viruses, e.g. vaccinia, cowpox. And that these mechanisms help the virus to overcome the inhibitory effects of exogenously expressed cIFN. Therefore, fowlpox virus is able to infect, replicate and retain a productive infectious state.
In Vivo Properties of Recombinant FPV/cIFN Virus in Chicks
10-day old chicks were inoculated, subcutaneously, with recombinant FPV/cIFN (S-FPV-099) virus at increasing dosages. At 10 days post inoculation, all chicks were inoculated with a mixture of sheep red blood cells (SRBC) and Brucella abortus (BA). At 15 days post FPV/cIFN virus inoculation, sera was collected, total body weights and antibody responses to SRBC's and BA were measured, and chicks were sacrificed for necropsy analysis. These data show that there were no significant differences in chick body weight, SRBC and BA antibody responses or gross pathology.sup.c associated with inoculation of recombinant FPV/cIFN virus, as compared to chicks inoculated with PBS alone. Therefore, this virus appears to be safe in 10-day old chicks.
TABLE 3______________________________________Determination of safety of recombinant FPV/cIFN virus in 10-day old chicks. Total body FPV/cIFN weight Antibody titers.sup.a,d(pfu/chick) (grams).sup.a,b BA SRBC______________________________________0 (PBS) 438 4.66 2.16 600 460 4.00 2.00 6,000 461 4.25 2.00 60,000 460 4.62 2.00______________________________________ .sup.a Measured 15 days post FPV/cIFN virus inoculation .sup.b Mean body weight (n = 8). .sup.c There were no detectable gross pathological changes in any of the groups. .sup.d Mean antibody titers were determined by agglutination assay and expressed as log.sub.2 (n = 8).
One-day old chicks were inoculated intranasally/intraocularly with NDV B1 (10.sup.6 ELD.sub.50 /chick) alone or in addition to subcutaneous inoculation with FPV/cIFN (10.sup.3 pfu/chick). Chick mortality was recorded 2 weeks post vaccination. Chicks vaccinated with NDV B1 alone or with NDV B1 plus FPV wild-type virus showed 20-30% mortality compared to chickens co-vaccinated with NDV-B1 and FPV/cIFN, in which group, all chicks remained alive. Subsequently, all chicks were challenged at 4 weeks post vaccination with a pathogenic strain of NDV (GB-TX). All chicks were protected, except for those in the "no treatment" control group. These data show that NDV B1 vaccine induced mortality was reduced without affecting the vaccine's protective ability.
TABLE 4______________________________________Effect of recombinant FPV/cIFN virus on NVD B1 vaccine induced chick mortality and NDV B1 induced protection from NDV challenge. Challenge Post vaccination Vaccine induced induced anti-NDV antibody mortality..sup.a mortality..sup.b,c responses.Treatment Dead/Total Dead/Total 2 weeks.sup.d 4 weeks______________________________________No 0/25 15/15 <1 <1 treatment NDVB1 alone 7/30 0/12 1.87 2.15 (0.31) (0.32) NDVB1 + FPV 9/30 0/10 1.96 1.99 (0.54) (0.35) NDVB1 + 0/30 0/19 2.00 2.15 FPV/cIFN (0.42) (0.37)______________________________________ .sup.a Mortality was measured 2 weeks post vaccination. .sup.b Chicks were challenged 4 weeks post vaccinatian, intramuscularly, with 10,000 ELD.sub.50 NDV GBTX. .sup.c Mortality was measured 2 weeks post challenge .sup.d Antibody titers were determined by NDV virus neutralization and expressed as group mean (log.sub.10).
17-day-old chicken embryos were inoculated with 500 pfu/embryo with FPV/cIFN/NDV virus, FPV wild-type virus or PBS diluent (0.2 ml). Chicks were allowed to hatch and then placed in an isolation unit and observed for mortality for one week. These data show that inoculation of chicken embryos with FPV/cIFN+NDV or FPV wild-type does not interfere with normal hatching.
TABLE 5______________________________________Effect of FPV/cIFN/NDV virus in ovo. Number of Eggs Mortality Treatment Hatched/Total (Dead/Total).sup.a______________________________________Diluent (PBS) 15/17 1/15 FPV (wild-type) 15/17 3/15 FPV/cIFN/NDV 14/18 0/14______________________________________ .sup.a 1 week post hatch
Three week old SPF chicks were vaccinated, subcutaneously, with 500 pfu/chick of FPV/cIFN/NDV recombinant virus. Sera were collected 9 days and 28 days post vaccination to measure neutralizing antibody responses raised against NDV. All chickens were challenged 28 days post vaccination with a pathogenic strain of NDV and observed for NDV induced mortality for 15 days. These data show that vaccinated chicks developed detectable anti-NDV antibody responses as little as 9 days post vaccination with FPV/NDV/cIFN recombinant virus. These antibody levels were maintained for at least 28 days. In addition, chickens vaccinated with FPV/cIFN/NDV recombinant virus were all protected against challenge with a virulent strain of NDV.
TABLE 6______________________________________Protective efficacy of FPV/cIFN/NDV vaccine in 3-week-old-chickens. Post Challenge Post Vaccination Antibody Mortality.sup.a ResponsesVaccine Dead/Total 9 days 28 days______________________________________None 19/19 <1.sup.b <1.sup.c FPV-IFN-NDV 0/20 1.36 (0.12) 1.33 (0.31)______________________________________ .sup.a Chicks were challenged intramuscularly, 28 days post vaccination, with 10,000 ELD.sub.50 NDV GBTX. .sup.b Antibody responses were determined by VN test and expressed as geometric mean titer (log10) of 5 chickens .sup.c Antibody responses were determined by VN test and expressed as geometric mean titer (log10) of 10 chickens
One day old SPF chicks were vaccinated, subcutaneously, with 500 pfu/chick of FPV/cIFN/NDV recombinant virus. Chicks were challenged intranasally/intraocularly at 4 , 7 and 15 days post vaccination with virulent NDV (GB-TX), and observed for NDV induced mortality for 15 days in each case. These data show that vaccinated chicks are resistant to virulent NDV when challenged at 7 days post vaccination, but not as early as 4 days post vaccination. Thus, onset of immunity to NDV following vaccination with FPV/cIFN/NDV recombinant virus occurs between 4 and 7 days post vaccination.
TABLE 7______________________________________Protective efficacy of FPV/cIFN/NDV vaccine in one day old chicks. Mortality following challenge at 4, 7, and 15 days post vaccination.Experiment 4-days 7-days 15-days No. Vaccine Dead/Total Dead/Total Dead/Total______________________________________1 None ND.sup.a 10/10 10/10 FPV-IFN-NDV ND 0/10 0/10 2 None 10/10 10/10 10/10 FPV-IFN-NDV 10/10 1/10 0/10 NDV-B1 4/10 0/10 0/10______________________________________ .sup.a Not Done
Conclusions
1. Recombinant fowlpox viruses express biologically active chicken interferon into the supernatants of infected cells, as measured by protection of CEF cells from VSV infection.
2. Chicken interferon expressed in supernatants from recombinant SPV/cIFN infected cells has been shown to protect CEF cells against infection with HVT in a dose dependent manner.
3. Chicken interferon expressed from SPV/cIFN acted synergistically with LPS to activate chicken macrophages as detected by nitric oxide induction.
4. Recombinant FPV/cIFN virus was found to be safe in 10 day old chicks at a dosage of 6.times.10.sup.4 pfu/chick.
5. Recombinant FPV/cIFN virus was shown to reduce NDV B1 vaccine induced mortality without affecting the vaccine's ability to protect chicks against NDV infection.
6. Inoculation of recombinant FPV/cIFN/NDV virus in ovo does not appear to interfere with normal hatching.
7. Recombinant FPV/cIFN/NDV virus was shown to induce anti-NDV neutralizing antibody in 3-week-old chicks as early as 9 days post vaccination with sustained immunity thru 28 days post vaccination. Furthermore, three-week-old chicks were fully protected against virulent NDV challenge at 28 days post vaccination.
8. Recombinant FPV/cIFN/NDV virus was shown to protect one-day-old chicks from virulent NDV challenge as early as 7 days post vaccination.
9. The foregoing data indicate that recombinant fowlpox viruses expressing chicken IFN may have beneficial applications as immune modulating agents in vitro, in vivo and in ovo.
References
1. C. Bertholet, et al., EMBO Journal 5, 1951-1957, 1986.
2. B. H. Coupar, et al., Virology 179, 159-167, 1990.
3. A. J. Davidson and B. Moss, J. Mol. Biol. 210, 749-769.
4. A. J. Davidson and B. Moss, J. Mol. Biol., 210, 771-784.
5. P. L. Earl, et al., Journal of Virology 64, 2448-2451, 1990.
6. J. Esposito, et al., Virology 165, 313.
7. F. A. Ferrari, et al., Journal of Bacteriology 161, 556-562, 1985.
8. U. Gubler and B. J. Hoffman, Gene 25, 263-269.
9. D. Hanahan, Molecular Biology 166, 557-580, 1983.
10. M. A. Innis, et al., PCR Protocols A Guide to Methods and Applications, 84-91, Academic Press, Inc., San Diego 1990.
11. Maniatis, et al., Molecular Cloning, Cold Spring Harbor Laboratory, New York 1982.
12. L. J. N. Ross, et al., Journal of General Virology, 70, 1789-1804 (1989).
13. L. J. N. Ross, et al., Journal of General Virology, 72, 949-954 (1991).
14. J. Sambrook, et al., Molecular Cloning A Laboratory Manual Second Edition, Cold Spring Harbor Press, 1989.
15. J. Taylor, et al., Vaccine 9, 190-193, 1991.
16. A. Leutz, et al., EMBO Journal 8: 175-182 (1989).
17. M. J. Sekellick, et al., Journal of Interferon Reserch 14: 71-79 (1994).
__________________________________________________________________________# SEQUENCE LISTING - - - - (1) GENERAL INFORMATION: - - (iii) NUMBER OF SEQUENCES: 20 - - - - (2) INFORMATION FOR SEQ ID NO:1: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 28 base - #pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: DNA (genomic) - - (iii) HYPOTHETICAL: NO - - (iv) ANTI-SENSE: NO - - (xi) SEQUENCE DESCRIPTION: SEQ - #ID NO:1: - - CATAAGGCGG CCGCGGCCCT CGAGGCCA - # - # 28 - - - - (2) INFORMATION FOR SEQ ID NO:2: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 28 base - #pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: DNA (genomic) - - (iii) HYPOTHETICAL: NO - - (iv) ANTI-SENSE: NO - - (xi) SEQUENCE DESCRIPTION: SEQ - #ID NO:2: - - CATAATGGCC TCGAGGGCCG CGGCCGCC - # - # 28 - - - - (2) INFORMATION FOR SEQ ID NO:3: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 1507 base - #pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: DNA (genomic) - - (iii) HYPOTHETICAL: NO - - (iv) ANTI-SENSE: NO - - (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 260..1411 - - (xi) SEQUENCE DESCRIPTION: SEQ - #ID NO:3: - - CTACTTCATA AAAAGTTTAA ACCTTCCGAA AGATTTTTGG ATAAAAGTAG AG -#AACTCGCA 60 - - TTGCGATTAT GCTCTAGGAC AATCCTGTAA AGTGTCTCGA TCTTAGCATA TA -#GATAAATG 120 - - TTTGAACTAA TATCCTAAAG CCTGTATGTA ACAGTTGGTG CCTATTGAAA GA -#TACTGATT 180 - - ATCAAGGAGA AGAATAATAT AAATCGTAAA AATAATACTT ATTATATAAT AT -#AATGTATA 240 - - ATAATATACA AAAACAGCC ATG ATA CGT ATT ATA ATA TTA - # TCG TTA TTATTT 292 - # Met Ile Arg Ile Ile Ile Leu Ser Leu - # Leu Phe - # 1 - # 5 - # 10 - - ATT AAC GTA ACA ACA GAT AGT CAA GAA TCT TC - #A AAA AAT ATA CAA AAT 340 Ile Asn Val Thr Thr Asp Ser Gln Glu Ser Se - #r Lys Asn Ile Gln Asn 15 - # 20 - # 25 - - GTA TTG CAC GTT ACA GAA TAT AGT AGA ACT GG - #T GTA ACA GCT TGC TCG 388 Val Leu His Val Thr Glu Tyr Ser Arg Thr Gl - #y Val Thr Ala Cys Ser 30 - # 35 - # 40 - - TTA CAT TGT TTT GAT CGT TCC AAA GGT TTA GA - #T CAA CCA AAA ACA TTT 436 Leu His Cys Phe Asp Arg Ser Lys Gly Leu As - #p Gln Pro Lys Thr Phe 45 - # 50 - # 55 - - ATC CTG CCT GGT AAA TAT AGC AAT AAC AGT AT - #A AAA CTA GAA GTA GCT 484 Ile Leu Pro Gly Lys Tyr Ser Asn Asn Ser Il - #e Lys Leu Glu Val Ala 60 - # 65 - # 70 - # 75 - - ATT GAT ACA TAT AAA AAA GAT AGC GAC TTC AG - #T TAT TCT CAC CCA TGT 532 Ile Asp Thr Tyr Lys Lys Asp Ser Asp Phe Se - #r Tyr Ser His Pro Cys 80 - # 85 - # 90 - - CAA ATA TTC CAG TTC TGT GTG TCT GGT AAT TT - #T AGT GGT AAA CGG TTC 580 Gln Ile Phe Gln Phe Cys Val Ser Gly Asn Ph - #e Ser Gly Lys Arg Phe 95 - # 100 - # 105 - - GAT CAT TAT CTA TAT GGG TAT ACA ATT TCC GG - #A TTT ATA GAT ATT GCT 628 Asp His Tyr Leu Tyr Gly Tyr Thr Ile Ser Gl - #y Phe Ile Asp Ile Ala 110 - # 115 - # 120 - - CCA AAA TAT TAT AGC GGT ATG TCT ATA AGT AC - #T ATT ACT GTT ATG CCA 676 Pro Lys Tyr Tyr Ser Gly Met Ser Ile Ser Th - #r Ile Thr Val Met Pro 125 - # 130 - # 135 - - TTA CAA GAA GGA TCA TTA AAG CAT GAT GAT GC - #C GAT GAC TAT GAC TAC 724 Leu Gln Glu Gly Ser Leu Lys His Asp Asp Al - #a Asp Asp Tyr Asp Tyr 140 1 - #45 1 - #50 1 -#55 - - GAT GAT GAT TGT GTT CCT TAT AAA GAA ACC CA - #G CCT CGA CAT ATGCCA 772 Asp Asp Asp Cys Val Pro Tyr Lys Glu Thr Gl - #n Pro Arg His Met Pro 160 - # 165 - # 170 - - GAA TCG GTA ATA AAA GAA GGA TGT AAA CCC AT - #T CCA CTA CCA AGG TAT 820 Glu Ser Val Ile Lys Glu Gly Cys Lys Pro Il - #e Pro Leu Pro Arg Tyr 175 - # 180 - # 185 - - GAT GAA AAT GAC GAT CCT ACT TGT ATT ATG TA - #T TGG GAT CAC TCG TGG 868 Asp Glu Asn Asp Asp Pro Thr Cys Ile Met Ty - #r Trp Asp His Ser Trp 190 - # 195 - # 200 - - GAT AAT TAC TGT AAT GTT GGA TTT TTT AAT TC - #T CTA CAG AGT GAT CAC 916 Asp Asn Tyr Cys Asn Val Gly Phe Phe Asn Se - #r Leu Gln Ser Asp His 205 - # 210 - # 215 - - AAT CCT CTG GTT TTT CCG TTA ACA AGT TAT TC - #T GAT ATA AAC AAT GCA 964 Asn Pro Leu Val Phe Pro Leu Thr Ser Tyr Se - #r Asp Ile Asn Asn Ala 220 2 - #25 2 - #30 2 -#35 - - TTT CAT GCT TTT CAA TCA TCT TAT TGT AGA TC - #A CTA GGC TTT AACCAA 1012 Phe His Ala Phe Gln Ser Ser Tyr Cys Arg Se - #r Leu Gly Phe Asn Gln 240 - # 245 - # 250 - - TCA TAC AGT GTA TGC GTA TCT ATA GGT GAT AC - #A CCA TTT GAG GTT ACG 1060 Ser Tyr Ser Val Cys Val Ser Ile Gly Asp Th - #r Pro Phe Glu Val Thr 255 - # 260 - # 265 - - TAT CAT AGT TAT GAA AGT GTT ACT GTT GAT CA - #G TTA TTA CAA GAA ATT 1108 Tyr His Ser Tyr Glu Ser Val Thr Val Asp Gl - #n Leu Leu Gln Glu Ile 270 - # 275 - # 280 - - AAA ACA CTA TAT GGA GAA GAT GCT GTA TAT GG - #A TTA CCG TTT AGA AAT 1156 Lys Thr Leu Tyr Gly Glu Asp Ala Val Tyr Gl - #y Leu Pro Phe Arg Asn 285 - # 290 - # 295 - - ATA ACT ATA AGG GCG CGT ACA CGG ATT CAA AG - #T TTA CCT CTT ACT AAC 1204 Ile Thr Ile Arg Ala Arg Thr Arg Ile Gln Se - #r Leu Pro Leu Thr Asn 300 3 - #05 3 - #10 3 -#15 - - AAT ACC TGT ATC CCT AAA CAA GAC GAT GCT GA - #T GAT GTT GAC GATGCT 1252 Asn Thr Cys Ile Pro Lys Gln Asp Asp Ala As - #p Asp Val Asp Asp Ala 320 - # 325 - # 330 - - GAT GAT GTT GAC GAT GCT GAT GAT GCT GAC GA - #T GAT GAT GAT TAC GAG 1300 Asp Asp Val Asp Asp Ala Asp Asp Ala Asp As - #p Asp Asp Asp Tyr Glu 335 - # 340 - # 345 - - TTA TAT GTA GAA ACT ACA CCA AGA GTG CCA AC - #A GCG AGA AAA AAA CCC 1348 Leu Tyr Val Glu Thr Thr Pro Arg Val Pro Th - #r Ala Arg Lys Lys Pro 350 - # 355 - # 360 - - GTT ACA GAA GAA TAT AAT GAT ATA TTT AGT AG - #T TTT GAT AAT TTT GAC 1396 Val Thr Glu Glu Tyr Asn Asp Ile Phe Ser Se - #r Phe Asp Asn Phe Asp 365 - # 370 - # 375 - - ATG AAA AAG AAA TAAGACATAT TTTATTAAAT CAAAAAGTCT GT - #CGAACTTT 1448 Met Lys Lys Lys 380 - - TAGTGTTTAA CCTATATCGA TTTATGATTT TTCCATGATG ATCCAGGCTA TG -#ACTGACT 1507 - - - - (2) INFORMATION FOR SEQ ID NO:4: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 383 amino - #acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein - - (xi) SEQUENCE DESCRIPTION: - # SEQ ID NO:4: - - Ile Arg Ile Ile Ile Leu Ser Leu Leu Phe Il - #e Asn Val Thr Thr 1 5 - # 10 - # 15 - - Asp Ser Gln Glu Ser Ser Lys Asn Ile Gln As - #n Val Leu His Val Thr 20 - # 25 - # 30 - - Glu Tyr Ser Arg Thr Gly Val Thr Ala Cys Se - #r Leu His Cys Phe Asp 35 - # 40 - # 45 - - Arg Ser Lys Gly Leu Asp Gln Pro Lys Thr Ph - #e Ile Leu Pro Gly Lys 50 - # 55 - # 60 - - Tyr Ser Asn Asn Ser Ile Lys Leu Glu Val Al - #a Ile Asp Thr Tyr Lys 65 - # 70 - # 75 - # 80 - - Lys Asp Ser Asp Phe Ser Tyr Ser His Pro Cy - #s Gln Ile Phe Gln Phe 85 - # 90 - # 95 - - Cys Val Ser Gly Asn Phe Ser Gly Lys Arg Ph - #e Asp His Tyr Leu Tyr 100 - # 105 - # 110 - - Gly Tyr Thr Ile Ser Gly Phe Ile Asp Ile Al - #a Pro Lys Tyr Tyr Ser 115 - # 120 - # 125 - - Gly Met Ser Ile Ser Thr Ile Thr Val Met Pr - #o Leu Gln Glu Gly Ser 130 - # 135 - # 140 - - Leu Lys His Asp Asp Ala Asp Asp Tyr Asp Ty - #r Asp Asp Asp Cys Val 145 1 - #50 1 - #55 1 -#60 - - Pro Tyr Lys Glu Thr Gln Pro Arg His Met Pr - #o Glu Ser Val IleLys 165 - # 170 - # 175 - - Glu Gly Cys Lys Pro Ile Pro Leu Pro Arg Ty - #r Asp Glu Asn Asp Asp 180 - # 185 - # 190 - - Pro Thr Cys Ile Met Tyr Trp Asp His Ser Tr - #p Asp Asn Tyr Cys Asn 195 - # 200 - # 205 - - Val Gly Phe Phe Asn Ser Leu Gln Ser Asp Hi - #s Asn Pro Leu Val Phe 210 - # 215 - # 220 - - Pro Leu Thr Ser Tyr Ser Asp Ile Asn Asn Al - #a Phe His Ala Phe Gln 225 2 - #30 2 - #35 2 -#40 - - Ser Ser Tyr Cys Arg Ser Leu Gly Phe Asn Gl - #n Ser Tyr Ser ValCys 245 - # 250 - # 255 - - Val Ser Ile Gly Asp Thr Pro Phe Glu Val Th - #r Tyr His Ser Tyr Glu 260 - # 265 - # 270 - - Ser Val Thr Val Asp Gln Leu Leu Gln Glu Il - #e Lys Thr Leu Tyr Gly 275 - # 280 - # 285 - - Glu Asp Ala Val Tyr Gly Leu Pro Phe Arg As - #n Ile Thr Ile Arg Ala 290 - # 295 - # 300 - - Arg Thr Arg Ile Gln Ser Leu Pro Leu Thr As - #n Asn Thr Cys Ile Pro 305 3 - #10 3 - #15 3 -#20 - - Lys Gln Asp Asp Ala Asp Asp Val Asp Asp Al - #a Asp Asp Val AspAsp 325 - # 330 - # 335 - - Ala Asp Asp Ala Asp Asp Asp Asp Asp Tyr Gl - #u Leu Tyr Val Glu Thr 340 - # 345 - # 350 - - Thr Pro Arg Val Pro Thr Ala Arg Lys Lys Pr - #o Val Thr Glu Glu Tyr 355 - # 360 - # 365 - - Asn Asp Ile Phe Ser Ser Phe Asp Asn Phe As - #p Met Lys Lys Lys 370 - # 375 - # 380 - - - - (2) INFORMATION FOR SEQ ID NO:5: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 2849 base - #pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: DNA (genomic) - - (iii) HYPOTHETICAL: NO - - (iv) ANTI-SENSE: NO - - (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 300..1568 - - (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: complement - #(1685..2848) - - (xi) SEQUENCE DESCRIPTION: SEQ - #ID NO:5: - - AAGCCAGTTT GAATTCAATA TTCATCGCCG ATAGTTGGTA GAAATACTAT TC -#ATGAAATT 60 - - TACCTTCTTC CGTGGCTTAA AAACTTATTG TATGTACCAT TCATTATAAG AT -#CTGATACT 120 - - ATCGGCATCT TCTATTTTCC GAGTTTTTTA CATCTGGTTA CTAGTATCCA TG -#TTCGTCTA 180 - - ATAAGAGGGA AGGAATATAT CTATCTACAT AAACATCATA AGGTTCTTTG AT -#AGATTTAT 240 - - ATCGCTAATA AAATATAAAT AATAATTAAA GATTTTATGA TATATCGAGC TT -#TGCAAAA 299 - - ATG TCT GTT GAT TGG CGT ACA GAA ATC TAT TC - #G GGT GAT ATA TCCCTA 347 Met Ser Val Asp Trp Arg Thr Glu Ile Tyr Se - #r Gly Asp Ile Ser Leu 1 5 - # 10 - # 15 - - GTA GAA AAA CTT ATA AAG AAT AAA GGT AAT TG - #C ATC AAT ATA TCT GTA 395 Val Glu Lys Leu Ile Lys Asn Lys Gly Asn Cy - #s Ile Asn Ile Ser Val 20 - # 25 - # 30 - - GAG GAA ACA ACA ACT CCG TTA ATA GAC GCT AT - #A AGA ACC GGA AAT GCC 443 Glu Glu Thr Thr Thr Pro Leu Ile Asp Ala Il - #e Arg Thr Gly Asn Ala 35 - # 40 - # 45 - - AAA ATA GTA GAA CTA TTT ATC AAG CAC GGA GC - #G CAA GTT AAT CAT GTA 491 Lys Ile Val Glu Leu Phe Ile Lys His Gly Al - #a Gln Val Asn His Val 50 - # 55 - # 60 - - AAT ACT AAA ATT CCT AAT CCC TTG TTA ACA GC - #T ATC AAA ATA GGA TCA 539 Asn Thr Lys Ile Pro Asn Pro Leu Leu Thr Al - #a Ile Lys Ile Gly Ser 65 - # 70 - # 75 - # 80 - - CAC GAT ATA GTA AAA CTG CTG TTG ATT AAC GG - #A GTT GAT ACT TCT ATT 587 His Asp Ile Val Lys Leu Leu Leu Ile Asn Gl - #y Val Asp Thr Ser Ile 85 - # 90 - # 95 - - TTG CCA GTC CCC TGC ATA AAT AAA GAA ATG AT - #A AAA ACT ATA TTA GAT 635 Leu Pro Val Pro Cys Ile Asn Lys Glu Met Il - #e Lys Thr Ile Leu Asp 100 - # 105 - # 110 - - AGT GGT GTG AAA GTA AAC ACA AAA AAT GCT AA - #A TCT AAA ACT TTC TTG 683 Ser Gly Val Lys Val Asn Thr Lys Asn Ala Ly - #s Ser Lys Thr Phe Leu 115 - # 120 - # 125 - - CAT TAC GCG ATT AAG AAT AAT GAC TTA GAG GT - #T ATC AAA ATG CTT TTT 731 His Tyr Ala Ile Lys Asn Asn Asp Leu Glu Va - #l Ile Lys Met Leu Phe 130 - # 135 - # 140 - - GAG TAT GGA GCT GAT GTT AAT ATA AAA GAT GA - #T AAC ATA TGT TAT TCT 779 Glu Tyr Gly Ala Asp Val Asn Ile Lys Asp As - #p Asn Ile Cys Tyr Ser 145 1 - #50 1 - #55 1 -#60 - - ATA CAC ATA GCT ACT AGG AGT AAT TCA TAT GA - #A ATC ATA AAA TTACTA 827 Ile His Ile Ala Thr Arg Ser Asn Ser Tyr Gl - #u Ile Ile Lys Leu Leu 165 - # 170 - # 175 - - TTA GAA AAA GGT GCT TAT GCA AAC GTA AAA GA - #C AAT TAT GGT AAT TCT 875 Leu Glu Lys Gly Ala Tyr Ala Asn Val Lys As - #p Asn Tyr Gly Asn Ser 180 - # 185 - # 190 - - CCG TTA CAT AAC GCG GCT AAA TAT GGC GAT TA - #T GCT TGT ATT AAA TTA 923 Pro Leu His Asn Ala Ala Lys Tyr Gly Asp Ty - #r Ala Cys Ile Lys Leu 195 - # 200 - # 205 - - GTT TTA GAC CAT ACT AAT AAC ATA AGC AAT AA - #G TGC AAC AAC GGT GTT 971 Val Leu Asp His Thr Asn Asn Ile Ser Asn Ly - #s Cys Asn Asn Gly Val 210 - # 215 - # 220 - - ACA CCG TTA CAT AAC GCT ATA CTA TAT AAT AG - #A TCT GCC GTA GAA TTA 1019 Thr Pro Leu His Asn Ala Ile Leu Tyr Asn Ar - #g Ser Ala Val Glu Leu 225 2 - #30 2 - #35 2 -#40 - - CTG ATT AAC AAT CGA TCT ATT AAT GAT ACG GA - #T GTA GAC GGA TATACT 1067 Leu Ile Asn Asn Arg Ser Ile Asn Asp Thr As - #p Val Asp Gly Tyr Thr 245 - # 250 - # 255 - - CCA CTA CAT TAT GCT TTG CAA CCT CCG TGT AG - #T ATA GAT ATT ATA GAT 1115 Pro Leu His Tyr Ala Leu Gln Pro Pro Cys Se - #r Ile Asp Ile Ile Asp 260 - # 265 - # 270 - - ATA CTA CTA TAT AAC AAC GCC GAT ATA TCT AT - #A AAA GAT AAT AAC GGA 1163 Ile Leu Leu Tyr Asn Asn Ala Asp Ile Ser Il - #e Lys Asp Asn Asn Gly 275 - # 280 - # 285 - - CGC AAT CCT ATC GAT ACG GCG TTT AAG TAT AT - #T AAC AGA GAT AGC GTT 1211 Arg Asn Pro Ile Asp Thr Ala Phe Lys Tyr Il - #e Asn Arg Asp Ser Val 290 - # 295 - # 300 - - ATA AAA GAA CTT CTC CGA AAC GCC GTG TTA AT - #T AAC GAG GTC GGT AAA 1259 Ile Lys Glu Leu Leu Arg Asn Ala Val Leu Il - #e Asn Glu Val Gly Lys 305 3 - #10 3 - #15 3 -#20 - - TTA AAA GAT ACT ACT ATC TTA GAA CAC AAA GA - #A ATA AAA GAC AATACC 1307 Leu Lys Asp Thr Thr Ile Leu Glu His Lys Gl - #u Ile Lys Asp Asn Thr 325 - # 330 - # 335 - - GTG TTT TCA AAC TTT GTG TAC GAA TGT AAT GA - #A GAA ATT AAA AAA ATG 1355 Val Phe Ser Asn Phe Val Tyr Glu Cys Asn Gl - #u Glu Ile Lys Lys Met 340 - # 345 - # 350 - - AAG AAA ACT AAA TGT GTC GGT GAC TAT AGT AT - #G TTT GAC GTA TAC ATG 1403 Lys Lys Thr Lys Cys Val Gly Asp Tyr Ser Me - #t Phe Asp Val Tyr Met 355 - # 360 - # 365 - - ATA AGG TAT AAA CAC AAA TAT GAC GGT AAT AA - #G GAT AGT ATT AAA GAC 1451 Ile Arg Tyr Lys His Lys Tyr Asp Gly Asn Ly - #s Asp Ser Ile Lys Asp 370 - # 375 - # 380 - - TAT TTG CGT TGT CTT GAT GAT AAT AGT ACT CG - #T ATG TTA AAA ACT ATA 1499 Tyr Leu Arg Cys Leu Asp Asp Asn Ser Thr Ar - #g Met Leu Lys Thr Ile 385 3 - #90 3 - #95 4 -#00 - - GAT ATT AAT GAA TTT CCT ATA TAT TCT ATG TA - #T CTC GTA AGA TGCCTA 1547 Asp Ile Asn Glu Phe Pro Ile Tyr Ser Met Ty - #r Leu Val Arg Cys Leu 405 - # 410 - # 415 - - TAT GAT ATG GTA ATA TAT TAAAAGAAAT GGGCTCTTGC AT - #ACATAATC 1595 Tyr Asp Met Val Ile Tyr 420 - - GGTATAAAAA ATAACGAAAT TATTAGCGGT TACATATCTT ACGGCGGCCG CG -#GCCCTCGA 1655 - - GGCCAGTAGC TCAGTATTTC CTATAAACTC TAATATTGAG AGTTTGATAT CC -#GGAGAAGT 1715 - - TTAGACCAAC CGCTAGAATC TAATATTTCA TCTAATTTTG ATCTACTTTT TT -#CTAATATT 1775 - - TTATGTCTAT TACTGGCTAA GGATATGGAA GTTTTAAGAC GATCTCCGTA AT -#TATAGAAA 1835 - - TAGTAAGTAT TAATTTCCTT TATTATAGGA TTATTTACTA AGTGATGTAA CA -#GGTTCATG 1895 - - TTTTTACTAA TAACGAATAT ATCTAAAGAG TAAAACATAT TAATACGAAT TT -#TAGATATA 1955 - - TCTTTTAGTT CTTCCTTACA ACTCAACCAA ATACTTTTAA ACGTATCATC GC -#TTTGAATA 2015 - - ATTTCTCTCA AGGGGTTTAC TTCACTTCTG ATATCGTGAC GTATAAAATC TT -#GTATACAT 2075 - - ATATGTGCTA TGATATATCT AAAAGAAAAC ATATTACTGT TAAGGCTCTT AT -#CGATGACC 2135 - - CTACTATCTC TAAGTTCAGC ACCATAATGT AATAATATAT TTACTATACC AT -#GATATTCT 2195 - - AATGCTATTA ATAAAGGATA TTGATTCCTT ATGTTAATAG CATTTACATC CG -#CTCCGTTA 2255 - - TCTAATAACA TTTTTATAAC TTCTGGTTTA CAATTCTTTT TACACGCATA AT -#GCAACGGA 2315 - - GTAGATAAGT ATTTGTTTTT AGAATTAACA TTAGCTCCTC TATCTATGAG CG -#TTTTTACA 2375 - - CTCATATACG GATTTGTTCC ATATAAGGCA AAATGTAAAA CCGTTCCTAT CT -#TCTGCGAT 2435 - - AACGCTTCTA TATCGGCCCC GTAATCTAAA AGAGTGTTTA TGATAACTAC AT -#TGTTTCTT 2495 - - ACAGCGGCAT AATGAATAGG CGTCTTGTCA CAATAATCTC TAGCATTTAC GT -#TCGCTCCC 2555 - - AATTCTAACA ACGTTATAAC TGTATCTTTA TATCTATCTA GAGTAGAGGC TT -#GATGTAAT 2615 - - GGAGTGATAT ACAGACTATC AGCGGCGTTA ACATCTGCAC CCCGCATTAT TA -#AAGTTCTA 2675 - - ATGTTTTCTG TATCGTATCC ATTCTTAGCC ATGAGATACA GAGGAGTTTC TC -#CTTTAATG 2735 - - TTTTTAGCGT TAACATCTAT TCCTCTTTCC AATAACTTGG GTACTAGTCT AC -#TTAACGAA 2795 - - GGTGCTTGTA CCGTGTAATG CAAAGGAGTA TTCTTATAAA CATCTATAGA AT - #TC 2849 - - - - - - (2) INFORMATION FOR SEQ ID NO:6: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 422 amino - #acids (B) TYPE: amino acid (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: protein - - (xi) SEQUENCE DESCRIPTION: SEQ - #ID NO:6: - - Met Ser Val Asp Trp Arg Thr Glu Ile Tyr Se - #r Gly Asp Ile Ser Leu 1 - # 5 - # 10 - # 15 - - Val Glu Lys Leu Ile Lys Asn Lys Gly Asn Cy - #s Ile Asn Ile Ser Val 20 - # 25 - # 30 - - Glu Glu Thr Thr Thr Pro Leu Ile Asp Ala Il - #e Arg Thr Gly Asn Ala 35 - # 40 - # 45 - - Lys Ile Val Glu Leu Phe Ile Lys His Gly Al - #a Gln Val Asn His Val 50 - # 55 - # 60 - - Asn Thr Lys Ile Pro Asn Pro Leu Leu Thr Al - #a Ile Lys Ile Gly Ser 65 - # 70 - # 75 - # 80 - - His Asp Ile Val Lys Leu Leu Leu Ile Asn Gl - #y Val Asp Thr Ser Ile 85 - # 90 - # 95 - - Leu Pro Val Pro Cys Ile Asn Lys Glu Met Il - #e Lys Thr Ile Leu Asp 100 - # 105 - # 110 - - Ser Gly Val Lys Val Asn Thr Lys Asn Ala Ly - #s Ser Lys Thr Phe Leu 115 - # 120 - # 125 - - His Tyr Ala Ile Lys Asn Asn Asp Leu Glu Va - #l Ile Lys Met Leu Phe 130 - # 135 - # 140 - - Glu Tyr Gly Ala Asp Val Asn Ile Lys Asp As - #p Asn Ile Cys Tyr Ser 145 1 - #50 1 - #55 1 -#60 - - Ile His Ile Ala Thr Arg Ser Asn Ser Tyr Gl - #u Ile Ile Lys LeuLeu 165 - # 170 - # 175 - - Leu Glu Lys Gly Ala Tyr Ala Asn Val Lys As - #p Asn Tyr Gly Asn Ser 180 - # 185 - # 190 - - Pro Leu His Asn Ala Ala Lys Tyr Gly Asp Ty - #r Ala Cys Ile Lys Leu 195 - # 200 - # 205 - - Val Leu Asp His Thr Asn Asn Ile Ser Asn Ly - #s Cys Asn Asn Gly Val 210 - # 215 - # 220 - - Thr Pro Leu His Asn Ala Ile Leu Tyr Asn Ar - #g Ser Ala Val Glu Leu 225 2 - #30 2 - #35 2 -#40 - - Leu Ile Asn Asn Arg Ser Ile Asn Asp Thr As - #p Val Asp Gly TyrThr 245 - # 250 - # 255 - - Pro Leu His Tyr Ala Leu Gln Pro Pro Cys Se - #r Ile Asp Ile Ile Asp 260 - # 265 - # 270 - - Ile Leu Leu Tyr Asn Asn Ala Asp Ile Ser Il - #e Lys Asp Asn Asn Gly 275 - # 280 - # 285 - - Arg Asn Pro Ile Asp Thr Ala Phe Lys Tyr Il - #e Asn Arg Asp Ser Val 290 - # 295 - # 300 - - Ile Lys Glu Leu Leu Arg Asn Ala Val Leu Il - #e Asn Glu Val Gly Lys 305 3 - #10 3 - #15 3 -#20 - - Leu Lys Asp Thr Thr Ile Leu Glu His Lys Gl - #u Ile Lys Asp AsnThr 325 - # 330 - # 335 - - Val Phe Ser Asn Phe Val Tyr Glu Cys Asn Gl - #u Glu Ile Lys Lys Met 340 - # 345 - # 350 - - Lys Lys Thr Lys Cys Val Gly Asp Tyr Ser Me - #t Phe Asp Val Tyr Met 355 - # 360 - # 365 - - Ile Arg Tyr Lys His Lys Tyr Asp Gly Asn Ly - #s Asp Ser Ile Lys Asp 370 - # 375 - # 380 - - Tyr Leu Arg Cys Leu Asp Asp Asn Ser Thr Ar - #g Met Leu Lys Thr Ile 385 3 - #90 3 - #95 4 -#00 - - Asp Ile Asn Glu Phe Pro Ile Tyr Ser Met Ty - #r Leu Val Arg CysLeu 405 - # 410 - # 415 - - Tyr Asp Met Val Ile Tyr 420 - - - - (2) INFORMATION FOR SEQ ID NO:7: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 387 amino - #acids (B) TYPE: amino acid (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: protein - - (xi) SEQUENCE DESCRIPTION: - # SEQ ID NO:7: - - Asn Ser Ile Asp Val Tyr Lys Asn Thr Pro Le - #u His Tyr Thr Val Gln 1 5 - # 10 - # 15 - - Ala Pro Ser Leu Ser Arg Leu Val Pro Lys Le - #u Leu Glu Arg Gly Ile 20 - # 25 - # 30 - - Asp Val Asn Ala Lys Asn Ile Lys Gly Glu Th - #r Pro Leu Tyr Leu Met 35 - # 40 - # 45 - - Ala Lys Asn Gly Tyr Asp Thr Glu Asn Ile Ar - #g Thr Leu Ile Met Arg 50 - # 55 - # 60 - - Gly Ala Asp Val Asn Ala Ala Asp Ser Leu Ty - #r Ile Thr Pro Leu His 65 - # 70 - # 75 - # 80 - - Gln Ala Ser Thr Leu Asp Arg Tyr Lys Asp Th - #r Val Ile Thr Leu Leu 85 - # 90 - # 95 - - Glu Leu Gly Ala Asn Val Asn Ala Arg Asp Ty - #r Cys Asp Lys Thr Pro 100 - # 105 - # 110 - - Ile His Tyr Ala Ala Val Arg Asn Asn Val Va - #l Ile Ile Asn Thr Leu 115 - # 120 - # 125 - - Leu Asp Tyr Gly Ala Asp Ile Glu Ala Leu Se - #r Gln Lys Ile Gly Thr 130 - # 135 - # 140 - - Val Leu His Phe Ala Leu Tyr Gly Thr Asn Pr - #o Tyr Met Ser Val Lys 145 1 - #50 1 - #55 1 -#60 - - Thr Leu Ile Asp Arg Gly Ala Asn Val Asn Se - #r Lys Asn Lys TyrLeu 165 - # 170 - # 175 - - Ser Thr Pro Leu His Tyr Ala Cys Lys Lys As - #n Cys Lys Pro Glu Val 180 - # 185 - # 190 - - Ile Lys Met Leu Leu Asp Asn Gly Ala Asp Va - #l Asn Ala Ile Asn Ile 195 - # 200 - # 205 - - Arg Asn Gln Tyr Pro Leu Leu Ile Ala Leu Gl - #u Tyr His Gly Ile Val 210 - # 215 - # 220 - - Asn Ile Leu Leu His Tyr Gly Ala Glu Leu Ar - #g Asp Ser Arg Val Ile 225 2 - #30 2 - #35 2 -#40 - - Asp Lys Ser Leu Asn Ser Asn Met Phe Ser Ph - #e Arg Tyr Ile IleAla 245 - # 250 - # 255 - - His Ile Cys Ile Gln Asp Phe Ile Arg His As - #p Ile Arg Ser Glu Val 260 - # 265 - # 270 - - Asn Pro Leu Arg Glu Ile Ile Gln Ser Asp As - #p Thr Phe Lys Ser Ile 275 - # 280 - # 285 - - Trp Leu Ser Cys Lys Glu Glu Leu Lys Asp Il - #e Ser Lys Ile Arg Ile 290 - # 295 - # 300 - - Asn Met Phe Tyr Ser Leu Asp Ile Phe Val Il - #e Ser Lys Asn Met Asn 305 3 - #10 3 - #15 3 -#20 - - Leu Leu His His Leu Val Asn Asn Pro Ile Il - #e Lys Glu Ile AsnThr 325 - # 330 - # 335 - - Tyr Tyr Phe Tyr Asn Tyr Gly Asp Arg Leu Ly - #s Thr Ser Ile Ser Leu 340 - # 345 - # 350 - - Ala Ser Asn Arg His Lys Ile Leu Glu Lys Se - #r Arg Ser Lys Leu Asp 355 - # 360 - # 365 - - Glu Ile Leu Asp Ser Ser Gly Trp Ser Lys Le - #u Leu Arg Ile Ser Asn 370 - # 375 - # 380 - - Ser Gln Tyr 385 - - - - (2) INFORMATION FOR SEQ ID NO:8: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 40 base - #pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: DNA (genomic) - - (iii) HYPOTHETICAL: NO - - (iv) ANTI-SENSE: NO - - (xi) SEQUENCE DESCRIPTION: SEQ - #ID NO:8: - - AAAAATTGAA AAACTATTCT AATTTATTGC ACGGAGATCT - # - # 40 - - - - (2) INFORMATION FOR SEQ ID NO:9: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 32 base - #pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: DNA (genomic) - - (iii) HYPOTHETICAL: NO - - (iv) ANTI-SENSE: NO - - (xi) SEQUENCE DESCRIPTION: SEQ - #ID NO:9: - - AATTTCATTT TGTTTTTTTC TATGCTATAA AT - # - # 32 - - - - (2) INFORMATION FOR SEQ ID NO:10: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 37 base - #pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: DNA (genomic) - - (iii) HYPOTHETICAL: NO - - (iv) ANTI-SENSE: NO - - (xi) SEQUENCE DESCRIPTION: SEQ - #ID NO:10: - - GTATCCTAAA ATTGAATTGT AATTATCGAT AATAAAT - #- # 37 - - - - (2) INFORMATION FOR SEQ ID NO:11: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 42 base - #pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: DNA (genomic) - - (iii) HYPOTHETICAL: NO - - (iv) ANTI-SENSE: NO - - (xi) SEQUENCE DESCRIPTION: SEQ - #ID NO:11: - - TTTTTTTTTT TTTTTTTTTT GGCATATAAA TGAATTCGGA TC - # - # 42 - - - - (2) INFORMATION FOR SEQ ID NO:12: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 4177 base - #pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: DNA (genomic) - - (iii) HYPOTHETICAL: NO - - (iv) ANTI-SENSE: NO - - (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 115..1860 - - (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 2095..3756 - - (xi) SEQUENCE DESCRIPTION: SEQ - #ID NO:12: - - CATACTGGCC TCGAGGGCCG CGGCCGCCTG CAGGTCGACT CTAGAAAAAA TT -#GAAAAACT 60 - - ATTCTAATTT ATTGCACGGA GATCTTTTTT TTTTTTTTTT TTTTTGGCAT AT - #AAATG 117 - # - # - #Met - # - # - # - - AAT TCG GAT CCG GAC CGC GCC GTT AGC CAA GT - #T GCG TTA GAG AATGAT 165 Asn Ser Asp Pro Asp Arg Ala Val Ser Gln Va - #l Ala Leu Glu Asn Asp 5 - # 10 - # 15 - - GAA AGA GAG GCA AAA AAT ACA TGG CGC TTG AT - #A TTC CGG ATT GCA ATC 213 Glu Arg Glu Ala Lys Asn Thr Trp Arg Leu Il - #e Phe Arg Ile Ala Ile 20 - # 25 - # 30 - - TTA TTC TTA ACA GTA GTG ACC TTG GCT ATA TC - #T GTA GCC TCC CTT TTA 261 Leu Phe Leu Thr Val Val Thr Leu Ala Ile Se - #r Val Ala Ser Leu Leu 35 - # 40 - # 45 - - TAT AGC ATG GGG GCT AGC ACA CCT AGC GAT CT - #T GTA GGC ATA CCG ACT 309 Tyr Ser Met Gly Ala Ser Thr Pro Ser Asp Le - #u Val Gly Ile Pro Thr 50 - # 55 - # 60 - # 65 - - AGG ATT TCC AGG GCA GAA GAA AAG ATT ACA TC - #T ACA CTT GGT TCC AAT 357 Arg Ile Ser Arg Ala Glu Glu Lys Ile Thr Se - #r Thr Leu Gly Ser Asn 70 - # 75 - # 80 - - CAA GAT GTA GTA GAT AGG ATA TAT AAG CAA GT - #G GCC CTT GAG TCT CCA 405 Gln Asp Val Val Asp Arg Ile Tyr Lys Gln Va - #l Ala Leu Glu Ser Pro 85 - # 90 - # 95 - - TTG GCA TTG TTA AAT ACT GAG ACC ACA ATT AT - #G AAC GCA ATA ACA TCT 453 Leu Ala Leu Leu Asn Thr Glu Thr Thr Ile Me - #t Asn Ala Ile Thr Ser 100 - # 105 - # 110 - - CTC TCT TAT CAG ATT AAT GGA GCT GCA AAC AA - #C AGC GGG TGG GGG GCA 501 Leu Ser Tyr Gln Ile Asn Gly Ala Ala Asn As - #n Ser Gly Trp Gly Ala 115 - # 120 - # 125 - - CCT ATT CAT GAC CCA GAT TAT ATA GGG GGG AT - #A GGC AAA GAA CTC ATT 549 Pro Ile His Asp Pro Asp Tyr Ile Gly Gly Il - #e Gly Lys Glu Leu Ile 130 1 - #35 1 - #40 1 -#45 - - GTA GAT GAT GCT AGT GAT GTC ACA TCA TTC TA - #T CCC TCT GCA TTTCAA 597 Val Asp Asp Ala Ser Asp Val Thr Ser Phe Ty - #r Pro Ser Ala Phe Gln 150 - # 155 - # 160 - - GAA CAT CTG AAT TTT ATC CCG GCG CCT ACT AC - #A GGA TCA GGT TGC ACT 645 Glu His Leu Asn Phe Ile Pro Ala Pro Thr Th - #r Gly Ser Gly Cys Thr 165 - # 170 - # 175 - - CGA ATA CCC TCA TTT GAC ATG AGT GCT ACC CA - #T TAC TGC TAC ACC CAT 693 Arg Ile Pro Ser Phe Asp Met Ser Ala Thr Hi - #s Tyr Cys Tyr Thr His 180 - # 185 - # 190 - - AAT GTA ATA TTG TCT GGA TGC AGA GAT CAC TC - #A CAC TCA CAT CAG TAT 741 Asn Val Ile Leu Ser Gly Cys Arg Asp His Se - #r His Ser His Gln Tyr 195 - # 200 - # 205 - - TTA GCA CTT GGT GTG CTC CGG ACA TCT GCA AC - #A GGG AGG GTA TTC TTT 789 Leu Ala Leu Gly Val Leu Arg Thr Ser Ala Th - #r Gly Arg Val Phe Phe 210 2 - #15 2 - #20 2 -#25 - - TCT ACT CTG CGT TCC ATC AAC CTG GAC GAC AC - #C CAA AAT CGG AAGTCT 837 Ser Thr Leu Arg Ser Ile Asn Leu Asp Asp Th - #r Gln Asn Arg Lys Ser 230 - # 235 - # 240 - - TGC AGT GTG AGT GCA ACT CCC CTG GGT TGT GA - #T ATG CTG TGC TCG AAA 885 Cys Ser Val Ser Ala Thr Pro Leu Gly Cys As - #p Met Leu Cys Ser Lys 245 - # 250 - # 255 - - GCC ACG GAG ACA GAG GAA GAA GAT TAT AAC TC - #A GCT GTC CCT ACG CGG 933 Ala Thr Glu Thr Glu Glu Glu Asp Tyr Asn Se - #r Ala Val Pro Thr Arg 260 - # 265 - # 270 - - ATG GTA CAT GGG AGG TTA GGG TTC GAC GGC CA - #A TAT CAC GAA AAG GAC 981 Met Val His Gly Arg Leu Gly Phe Asp Gly Gl - #n Tyr His Glu Lys Asp 275 - # 280 - # 285 - - CTA GAT GTC ACA ACA TTA TTC GGG GAC TGG GT - #G GCC AAC TAC CCA GGA 1029 Leu Asp Val Thr Thr Leu Phe Gly Asp Trp Va - #l Ala Asn Tyr Pro Gly 290 2 - #95 3 - #00 3 -#05 - - GTA GGG GGT GGA TCT TTT ATT GAC AGC CGC GT - #G TGG TTC TCA GTCTAC 1077 Val Gly Gly Gly Ser Phe Ile Asp Ser Arg Va - #l Trp Phe Ser Val Tyr 310 - # 315 - # 320 - - GGA GGG TTA AAA CCC AAT ACA CCC AGT GAC AC - #T GTA CAG GAA GGG AAA 1125 Gly Gly Leu Lys Pro Asn Thr Pro Ser Asp Th - #r Val Gln Glu Gly Lys 325 - # 330 - # 335 - - TAT GTG ATA TAC AAG CGA TAC AAT GAC ACA TG - #C CCA GAT GAG CAA GAC 1173 Tyr Val Ile Tyr Lys Arg Tyr Asn Asp Thr Cy - #s Pro Asp Glu Gln Asp 340 - # 345 - # 350 - - TAC CAG ATT CGA ATG GCC AAG TCT TCG TAT AA - #G CCT GGA CGG TTT GGT 1221 Tyr Gln Ile Arg Met Ala Lys Ser Ser Tyr Ly - #s Pro Gly Arg Phe Gly 355 - # 360 - # 365 - - GGG AAA CGC ATA CAG CAG GCT ATC TTA TCT AT - #C AAA GTG TCA ACA TCC 1269 Gly Lys Arg Ile Gln Gln Ala Ile Leu Ser Il - #e Lys Val Ser Thr Ser 370 3 - #75 3 - #80 3 -#85 - - TTA GGC GAA GAC CCG GTA CTG ACT GTA CCG CC - #C AAC ACA GTC ACACTC 1317 Leu Gly Glu Asp Pro Val Leu Thr Val Pro Pr - #o Asn Thr Val Thr Leu 390 - # 395 - # 400 - - ATG GGG GCC GAA GGC AGA ATT CTC ACA GTA GG - #G ACA TCC CAT TTC TTG 1365 Met Gly Ala Glu Gly Arg Ile Leu Thr Val Gl - #y Thr Ser His Phe Leu 405 - # 410 - # 415 - - TAT CAG CGA GGG TCA TCA TAC TTC TCT CCC GC - #G TTA TTA TAT CCT ATG 1413 Tyr Gln Arg Gly Ser Ser Tyr Phe Ser Pro Al - #a Leu Leu Tyr Pro Met 420 - # 425 - # 430 - - ACA GTC AGC AAC AAA ACA GCC ACT CTT CAT AG - #T CCT TAT ACA TTC AAT 1461 Thr Val Ser Asn Lys Thr Ala Thr Leu His Se - #r Pro Tyr Thr Phe Asn 435 - # 440 - # 445 - - GCC TTC ACT CGG CCA GGT AGT ATC CCT TGC CA - #G GCT TCA GCA AGA TGC 1509 Ala Phe Thr Arg Pro Gly Ser Ile Pro Cys Gl - #n Ala Ser Ala Arg Cys 450 4 - #55 4 - #60 4 -#65 - - CCC AAC TCA TGT GTT ACT GGA GTC TAT ACA GA - #T CCA TAT CCC CTAATC 1557 Pro Asn Ser Cys Val Thr Gly Val Tyr Thr As - #p Pro Tyr Pro Leu Ile 470 - # 475 - # 480 - - TTC TAT AGA AAC CAC ACC TTG CGA GGG GTA TT - #C GGG ACA ATG CTT GAT 1605 Phe Tyr Arg Asn His Thr Leu Arg Gly Val Ph - #e Gly Thr Met Leu Asp 485 - # 490 - # 495 - - GGT GAA CAA GCA AGA CTT AAC CCT GCG TCT GC - #A GTA TTC GAT AGC ACA 1653 Gly Glu Gln Ala Arg Leu Asn Pro Ala Ser Al - #a Val Phe Asp Ser Thr 500 - # 505 - # 510 - - TCC CGC AGT CGC ATA ACT CGA GTG AGT TCA AG - #C AGC ATC AAA GCA GCA 1701 Ser Arg Ser Arg Ile Thr Arg Val Ser Ser Se - #r Ser Ile Lys Ala Ala 515 - # 520 - # 525 - - TAC ACA ACA TCA ACT TGT TTT AAA GTG GTC AA - #G ACC AAT AAG ACC TAT 1749 Tyr Thr Thr Ser Thr Cys Phe Lys Val Val Ly - #s Thr Asn Lys Thr Tyr 530 5 - #35 5 - #40 5 -#45 - - TGT CTC AGC ATT GCT GAA ATA TCT AAT ACT CT - #C TTC GGA GAA TTCAGA 1797 Cys Leu Ser Ile Ala Glu Ile Ser Asn Thr Le - #u Phe Gly Glu Phe Arg 550 - # 555 - # 560 - - ATC GTC CCG TTA CTA GTT GAG ATC CTC AAA GA - #T GAC GGG GTT AGA GAA 1845 Ile Val Pro Leu Leu Val Glu Ile Leu Lys As - #p Asp Gly Val Arg Glu 565 - # 570 - # 575 - - GCC AGG TCT GGC TAGTTGAGTC AACTATGAAA GAGTTGGAAA GA - #TGGCATTG 1897 Ala Arg Ser Gly 580 - - TATCACCTAT CTTCTGCGAC ATCAAGAATC AAACCGAATG CCCGGATCCA TA -#ATTAATTA 1957 - - ATTAATTTTT ATCCCTCGAC TCTAGAAAAA ATTGAAAAAC TATTCTAATT TA -#TTGCACGG 2017 - - AGATCTTTTT TTTTTTTTTT TTTTTTGGCA TATAAATGAA TTCGGATCGA TC -#CCGGTTGG 2077 - - CGCCCTCCAG GTGCAGG ATG GGC TCC AGA CCT TCT ACC - #AAG AAC CCA GCA 2127 - - - # Met Gly Ser Arg Pro Ser Thr Lys Asn Pro -#Ala - # 1 - #5 - #10 - - CCT ATG ATG CTG ACT ATC CGG GTC GCG CTG GT - #A CTG AGT TGC ATC TGT 2175 Pro Met Met Leu Thr Ile Arg Val Ala Leu Va - #l Leu Ser Cys Ile Cys 15 - # 20 - # 25 - - CCG GCA AAC TCC ATT GAT GGC AGG CCT CTT GC - #A GCT GCA GGA ATT GTG 2223 Pro Ala Asn Ser Ile Asp Gly Arg Pro Leu Al - #a Ala Ala Gly Ile Val 30 - # 35 - # 40 - - GTT ACA GGA GAC AAA GCA GTC AAC ATA TAC AC - #C TCA TCC CAG ACA GGA 2271 Val Thr Gly Asp Lys Ala Val Asn Ile Tyr Th - #r Ser Ser Gln Thr Gly 45 - # 50 - # 55 - - TCA ATC ATA GTT AAG CTC CTC CCG AAT CTG CC - #A AAG GAT AAG GAG GCA 2319 Ser Ile Ile Val Lys Leu Leu Pro Asn Leu Pr - #o Lys Asp Lys Glu Ala 60 - # 65 - # 70 - # 75 - - TGT GCG AAA GCC CCC TTG GAT GCA TAC AAC AG - #G ACA TTG ACC ACT TTG 2367 Cys Ala Lys Ala Pro Leu Asp Ala Tyr Asn Ar - #g Thr Leu Thr Thr Leu 80 - # 85 - # 90 - - CTC ACC CCC CTT GGT GAC TCT ATC CGT AGG AT - #A CAA GAG TCT GTG ACT 2415 Leu Thr Pro Leu Gly Asp Ser Ile Arg Arg Il - #e Gln Glu Ser Val Thr 95 - # 100 - # 105 - - ACA TCT GGA GGG GGG AGA CAG GGG CGC CTT AT - #A GGC GCC ATT ATT GGC 2463 Thr Ser Gly Gly Gly Arg Gln Gly Arg Leu Il - #e Gly Ala Ile Ile Gly 110 - # 115 - # 120 - - GGT GTG GCT CTT GGG GTT GCA ACT GCC GCA CA - #A ATA ACA GCG GCC GCA 2511 Gly Val Ala Leu Gly Val Ala Thr Ala Ala Gl - #n Ile Thr Ala Ala Ala 125 - # 130 - # 135 - - GCT CTG ATA CAA GCC AAA CAA AAT GCT GCC AA - #C ATC CTC CGA CTT AAA 2559 Ala Leu Ile Gln Ala Lys Gln Asn Ala Ala As - #n Ile Leu Arg Leu Lys 140 1 - #45 1 - #50 1 -#55 - - GAG AGC ATT GCC GCA ACC AAT GAG GCT GTG CA - #T GAG GTC ACT GACGGA 2607 Glu Ser Ile Ala Ala Thr Asn Glu Ala Val Hi - #s Glu Val Thr Asp Gly 160 - # 165 - # 170 - - TTA TCG CAA CTA GCA GTG GCA GTT GGG AAG AT - #G CAG CAG TTC GTT AAT 2655 Leu Ser Gln Leu Ala Val Ala Val Gly Lys Me - #t Gln Gln Phe Val Asn 175 - # 180 - # 185 - - GAC CAA TTT AAT AAA ACA GCT CAG GAA TTA GA - #C TGC ATC AAA ATT GCA 2703 Asp Gln Phe Asn Lys Thr Ala Gln Glu Leu As - #p Cys Ile Lys Ile Ala 190 - # 195 - # 200 - - CAG CAA GTT GGT GTA GAG CTC AAC CTG TAC CT - #A ACC GAA TCG ACT ACA 2751 Gln Gln Val Gly Val Glu Leu Asn Leu Tyr Le - #u Thr Glu Ser Thr Thr 205 - # 210 - # 215 - - GTA TTC GGA CCA CAA ATC ACT TCA CCT GCC TT - #A AAC AAG CTG ACT ATT 2799 Val Phe Gly Pro Gln Ile Thr Ser Pro Ala Le - #u Asn Lys Leu Thr Ile 220 2 - #25 2 - #30 2 -#35 - - CAG GCA CTT TAC AAT CTA GCT GGT GGG AAT AT - #G GAT TAC TTA TTGACT 2847 Gln Ala Leu Tyr Asn Leu Ala Gly Gly Asn Me - #t Asp Tyr Leu Leu Thr 240 - # 245 - # 250 - - AAG TTA GGT ATA GGG AAC AAT CAA CTC AGC TC - #A TTA ATC GGT AGC GGC 2895 Lys Leu Gly Ile Gly Asn Asn Gln Leu Ser Se - #r Leu Ile Gly Ser Gly 255 - # 260 - # 265 - - TTA ATC ACC GGT AAC CCT ATT CTA TAC GAC TC - #A CAG ACT CAA CTC TTG 2943 Leu Ile Thr Gly Asn Pro Ile Leu Tyr Asp Se - #r Gln Thr Gln Leu Leu 270 - # 275 - # 280 - - GGT ATA CAG GTA ACT CTA CCT TCA GTC GGG AA - #C CTA AAT AAT ATG CGT 2991 Gly Ile Gln Val Thr Leu Pro Ser Val Gly As - #n Leu Asn Asn Met Arg 285 - # 290 - # 295 - - GCC ACC TAC TTG GAA ACC TTA TCC GTA AGC AC - #A ACC AGG GGA TTT GCC 3039 Ala Thr Tyr Leu Glu Thr Leu Ser Val Ser Th - #r Thr Arg Gly Phe Ala 300 3 - #05 3 - #10 3 -#15 - - TCG GCA CTT GTC CCA AAA GTG GTG ACA CGG GT - #C GGT TCT GTG ATAGAA 3087 Ser Ala Leu Val Pro Lys Val Val Thr Arg Va - #l Gly Ser Val Ile Glu 320 - # 325 - # 330 - - GAA CTT GAC ACC TCA TAC TGT ATA GAA ACT GA - #C TTA GAT TTA TAT TGT 3135 Glu Leu Asp Thr Ser Tyr Cys Ile Glu Thr As - #p Leu Asp Leu Tyr Cys 335 - # 340 - # 345 - - ACA AGA ATA GTA ACG TTC CCT ATG TCC CCT GG - #T ATT TAC TCC TGC TTG 3183 Thr Arg Ile Val Thr Phe Pro Met Ser Pro Gl - #y Ile Tyr Ser Cys Leu 350 - # 355 - # 360 - - AGC GGC AAT ACA TCG GCC TGT ATG TAC TCA AA - #G ACC GAA GGC GCA CTT 3231 Ser Gly Asn Thr Ser Ala Cys Met Tyr Ser Ly - #s Thr Glu Gly Ala Leu 365 - # 370 - # 375 - - ACT ACA CCA TAT ATG ACT ATC AAA GGC TCA GT - #C ATC GCT AAC TGC AAG 3279 Thr Thr Pro Tyr Met Thr Ile Lys Gly Ser Va - #l Ile Ala Asn Cys Lys 380 3 - #85 3 - #90 3 -#95 - - ATG ACA ACA TGT AGA TGT GTA AAC CCC CCG GG - #T ATC ATA TCG CAAAAC 3327 Met Thr Thr Cys Arg Cys Val Asn Pro Pro Gl - #y Ile Ile Ser Gln Asn 400 - # 405 - # 410 - - TAT GGA GAA GCC GTG TCT CTA ATA GAT AAA CA - #A TCA TGC AAT GTT TTA 3375 Tyr Gly Glu Ala Val Ser Leu Ile Asp Lys Gl - #n Ser Cys Asn Val Leu 415 - # 420 - # 425 - - TCC TTA GGC GGG ATA ACT TTA AGG CTC AGT GG - #G GAA TTC GAT GTA ACT 3423 Ser Leu Gly Gly Ile Thr Leu Arg Leu Ser Gl - #y Glu Phe Asp Val Thr 430 - # 435 - # 440 - - TAT CAG AAG AAT ATC TCA ATA CAA GAT TCT CA - #A GTA ATA ATA ACA GGC 3471 Tyr Gln Lys Asn Ile Ser Ile Gln Asp Ser Gl - #n Val Ile Ile Thr Gly 445 - # 450 - # 455 - - AAT CTT GAT ATC TCA ACT GAG CTT GGG AAT GT - #C AAC AAC TCG ATC AGT 3519 Asn Leu Asp Ile Ser Thr Glu Leu Gly Asn Va - #l Asn Asn Ser Ile Ser 460 4 - #65 4 - #70 4 -#75 - - AAT GCC TTG AAT AAG TTA GAG GAA AGC AAC AG - #A AAA CTA GAC AAAGTC 3567 Asn Ala Leu Asn Lys Leu Glu Glu Ser Asn Ar - #g Lys Leu Asp Lys Val 480 - # 485 - # 490 - - AAT GTC AAA CTG ACC AGC ACA TCT GCT CTC AT - #T ACC TAT ATC GTT TTG 3615 Asn Val Lys Leu Thr Ser Thr Ser Ala Leu Il - #e Thr Tyr Ile Val Leu 495 - # 500 - # 505 - - ACT ATC ATA TCT CTT GTT TTT GGT ATA CTT AG - #C CTG ATT CTA GCA TGC 3663 Thr Ile Ile Ser Leu Val Phe Gly Ile Leu Se - #r Leu Ile Leu Ala Cys 510 - # 515 - # 520 - - TAC CTA ATG TAC AAG CAA AAG GCG CAA CAA AA - #G ACC TTA TTA TGG CTT 3711 Tyr Leu Met Tyr Lys Gln Lys Ala Gln Gln Ly - #s Thr Leu Leu Trp Leu 525 - # 530 - # 535 - - GGG AAT AAT ACC CTA GAT CAG ATG AGA GCC AC - #T ACA AAA ATGTGAACACAGA 3763 Gly Asn Asn Thr Leu Asp Gln Met Arg Ala Th - #r Thr Lys Met 540 5 - #45 5 - #50 - - TGAGGAACGA AGGTTTCCCT AATAGTAATT TGTGTGAAAG TTCTGGTAGT CT -#GTCAGTTC 3823 - - GGAGAGTTAA GAAAAAAAAA AAACCCCCCC CCCCCCCCCC CCCCCCCCCT GC -#AGGCATCG 3883 - - TGGTGTCACG CTCGTCGTTT GGTATGGCTT CATTCAGCTC CGGTTCCCAA CG -#ATCAAGGC 3943 - - GAGTTACATG ATCCCCCATG TTGTGCAAAA AAGCGGTTAG CTCCTTCGGT CC -#TCCGATCG 4003 - - TTGTCAGAAG TAAGTTGGCC GCAGTGTTAT CACTCATGGT TATGGCAGCA CT -#GCATAATT 4063 - - CTCTTACTGT CATGCCATCC GTAAGATGCT TTTCTGTGAC TGGTGAGTGA TC -#CATAATTA 4123 - - ATTAATTAAT TTTTATCCCG GGTCGACCTG CAGGCGGCCG CGGCCCTCGA GG - #CC 4177 - - - - (2) INFORMATION FOR SEQ ID NO:13: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 581 amino - #acids (B) TYPE: amino acid (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: protein - - (xi) SEQUENCE DESCRIPTION: - # SEQ ID NO:13: - - Met Asn Ser Asp Pro Asp Arg Ala Val Ser Gl - #n Val Ala Leu Glu Asn 1 5 - # 10 - # 15 - - Asp Glu Arg Glu Ala Lys Asn Thr Trp Arg Le - #u Ile Phe Arg Ile Ala 20 - # 25 - # 30 - - Ile Leu Phe Leu Thr Val Val Thr Leu Ala Il - #e Ser Val Ala Ser Leu 35 - # 40 - # 45 - - Leu Tyr Ser Met Gly Ala Ser Thr Pro Ser As - #p Leu Val Gly Ile Pro 50 - # 55 - # 60 - - Thr Arg Ile Ser Arg Ala Glu Glu Lys Ile Th - #r Ser Thr Leu Gly Ser 65 - # 70 - # 75 - # 80 - - Asn Gln Asp Val Val Asp Arg Ile Tyr Lys Gl - #n Val Ala Leu Glu Ser 85 - # 90 - # 95 - - Pro Leu Ala Leu Leu Asn Thr Glu Thr Thr Il - #e Met Asn Ala Ile Thr 100 - # 105 - # 110 - - Ser Leu Ser Tyr Gln Ile Asn Gly Ala Ala As - #n Asn Ser Gly Trp Gly 115 - # 120 - # 125 - - Ala Pro Ile His Asp Pro Asp Tyr Ile Gly Gl - #y Ile Gly Lys Glu Leu 130 - # 135 - # 140 - - Ile Val Asp Asp Ala Ser Asp Val Thr Ser Ph - #e Tyr Pro Ser Ala Phe 145 1 - #50 1 - #55 1 -#60 - - Gln Glu His Leu Asn Phe Ile Pro Ala Pro Th - #r Thr Gly Ser GlyCys 165 - # 170 - # 175 - - Thr Arg Ile Pro Ser Phe Asp Met Ser Ala Th - #r His Tyr Cys Tyr Thr 180 - # 185 - # 190 - - His Asn Val Ile Leu Ser Gly Cys Arg Asp Hi - #s Ser His Ser His Gln 195 - # 200 - # 205 - - Tyr Leu Ala Leu Gly Val Leu Arg Thr Ser Al - #a Thr Gly Arg Val Phe 210 - # 215 - # 220 - - Phe Ser Thr Leu Arg Ser Ile Asn Leu Asp As - #p Thr Gln Asn Arg Lys 225 2 - #30 2 - #35 2 -#40 - - Ser Cys Ser Val Ser Ala Thr Pro Leu Gly Cy - #s Asp Met Leu CysSer 245 - # 250 - # 255 - - Lys Ala Thr Glu Thr Glu Glu Glu Asp Tyr As - #n Ser Ala Val Pro Thr 260 - # 265 - # 270 - - Arg Met Val His Gly Arg Leu Gly Phe Asp Gl - #y Gln Tyr His Glu Lys 275 - # 280 - # 285 - - Asp Leu Asp Val Thr Thr Leu Phe Gly Asp Tr - #p Val Ala Asn Tyr Pro 290 - # 295 - # 300 - - Gly Val Gly Gly Gly Ser Phe Ile Asp Ser Ar - #g Val Trp Phe Ser Val 305 3 - #10 3 - #15 3 -#20 - - Tyr Gly Gly Leu Lys Pro Asn Thr Pro Ser As - #p Thr Val Gln GluGly 325 - # 330 - # 335 - - Lys Tyr Val Ile Tyr Lys Arg Tyr Asn Asp Th - #r Cys Pro Asp Glu Gln 340 - # 345 - # 350 - - Asp Tyr Gln Ile Arg Met Ala Lys Ser Ser Ty - #r Lys Pro Gly Arg Phe 355 - # 360 - # 365 - - Gly Gly Lys Arg Ile Gln Gln Ala Ile Leu Se - #r Ile Lys Val Ser Thr 370 - # 375 - # 380 - - Ser Leu Gly Glu Asp Pro Val Leu Thr Val Pr - #o Pro Asn Thr Val Thr 385 3 - #90 3 - #95 4 -#00 - - Leu Met Gly Ala Glu Gly Arg Ile Leu Thr Va - #l Gly Thr Ser HisPhe 405 - # 410 - # 415 - - Leu Tyr Gln Arg Gly Ser Ser Tyr Phe Ser Pr - #o Ala Leu Leu Tyr Pro 420 - # 425 - # 430 - - Met Thr Val Ser Asn Lys Thr Ala Thr Leu Hi - #s Ser Pro Tyr Thr Phe 435 - # 440 - # 445 - - Asn Ala Phe Thr Arg Pro Gly Ser Ile Pro Cy - #s Gln Ala Ser Ala Arg 450 - # 455 - # 460 - - Cys Pro Asn Ser Cys Val Thr Gly Val Tyr Th - #r Asp Pro Tyr Pro Leu 465 4 - #70 4 - #75 4 -#80 - - Ile Phe Tyr Arg Asn His Thr Leu Arg Gly Va - #l Phe Gly Thr MetLeu 485 - # 490 - # 495 - - Asp Gly Glu Gln Ala Arg Leu Asn Pro Ala Se - #r Ala Val Phe Asp Ser 500 - # 505 - # 510 - - Thr Ser Arg Ser Arg Ile Thr Arg Val Ser Se - #r Ser Ser Ile Lys Ala 515 - # 520 - # 525 - - Ala Tyr Thr Thr Ser Thr Cys Phe Lys Val Va - #l Lys Thr Asn Lys Thr 530 - # 535 - # 540 - - Tyr Cys Leu Ser Ile Ala Glu Ile Ser Asn Th - #r Leu Phe Gly Glu Phe 545 5 - #50 5 - #55 5 -#60 - - Arg Ile Val Pro Leu Leu Val Glu Ile Leu Ly - #s Asp Asp Gly ValArg 565 - # 570 - # 575 - - Glu Ala Arg Ser Gly 580 - - - - (2) INFORMATION FOR SEQ ID NO:14: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 553 amino - #acids (B) TYPE: amino acid (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: protein - - (xi) SEQUENCE DESCRIPTION: - # SEQ ID NO:14: - - Met Gly Ser Arg Pro Ser Thr Lys Asn Pro Al - #a Pro Met Met Leu Thr 1 5 - # 10 - # 15 - - Ile Arg Val Ala Leu Val Leu Ser Cys Ile Cy - #s Pro Ala Asn Ser Ile 20 - # 25 - # 30 - - Asp Gly Arg Pro Leu Ala Ala Ala Gly Ile Va - #l Val Thr Gly Asp Lys 35 - # 40 - # 45 - - Ala Val Asn Ile Tyr Thr Ser Ser Gln Thr Gl - #y Ser Ile Ile Val Lys 50 - # 55 - # 60 - - Leu Leu Pro Asn Leu Pro Lys Asp Lys Glu Al - #a Cys Ala Lys Ala Pro 65 - # 70 - # 75 - # 80 - - Leu Asp Ala Tyr Asn Arg Thr Leu Thr Thr Le - #u Leu Thr Pro Leu Gly 85 - # 90 - # 95 - - Asp Ser Ile Arg Arg Ile Gln Glu Ser Val Th - #r Thr Ser Gly Gly Gly 100 - # 105 - # 110 - - Arg Gln Gly Arg Leu Ile Gly Ala Ile Ile Gl - #y Gly Val Ala Leu Gly 115 - # 120 - # 125 - - Val Ala Thr Ala Ala Gln Ile Thr Ala Ala Al - #a Ala Leu Ile Gln Ala 130 - # 135 - # 140 - - Lys Gln Asn Ala Ala Asn Ile Leu Arg Leu Ly - #s Glu Ser Ile Ala Ala 145 1 - #50 1 - #55 1 -#60 - - Thr Asn Glu Ala Val His Glu Val Thr Asp Gl - #y Leu Ser Gln LeuAla 165 - # 170 - # 175 - - Val Ala Val Gly Lys Met Gln Gln Phe Val As - #n Asp Gln Phe Asn Lys 180 - # 185 - # 190 - - Thr Ala Gln Glu Leu Asp Cys Ile Lys Ile Al - #a Gln Gln Val Gly Val 195 - # 200 - # 205 - - Glu Leu Asn Leu Tyr Leu Thr Glu Ser Thr Th - #r Val Phe Gly Pro Gln 210 - # 215 - # 220 - - Ile Thr Ser Pro Ala Leu Asn Lys Leu Thr Il - #e Gln Ala Leu Tyr Asn 225 2 - #30 2 - #35 2 -#40 - - Leu Ala Gly Gly Asn Met Asp Tyr Leu Leu Th - #r Lys Leu Gly IleGly 245 - # 250 - # 255 - - Asn Asn Gln Leu Ser Ser Leu Ile Gly Ser Gl - #y Leu Ile Thr Gly Asn 260 - # 265 - # 270 - - Pro Ile Leu Tyr Asp Ser Gln Thr Gln Leu Le - #u Gly Ile Gln Val Thr 275 - # 280 - # 285 - - Leu Pro Ser Val Gly Asn Leu Asn Asn Met Ar - #g Ala Thr Tyr Leu Glu 290 - # 295 - # 300 - - Thr Leu Ser Val Ser Thr Thr Arg Gly Phe Al - #a Ser Ala Leu Val Pro 305 3 - #10 3 - #15 3 -#20 - - Lys Val Val Thr Arg Val Gly Ser Val Ile Gl - #u Glu Leu Asp ThrSer 325 - # 330 - # 335 - - Tyr Cys Ile Glu Thr Asp Leu Asp Leu Tyr Cy - #s Thr Arg Ile Val Thr 340 - # 345 - # 350 - - Phe Pro Met Ser Pro Gly Ile Tyr Ser Cys Le - #u Ser Gly Asn Thr Ser 355 - # 360 - # 365 - - Ala Cys Met Tyr Ser Lys Thr Glu Gly Ala Le - #u Thr Thr Pro Tyr Met 370 - # 375 - # 380 - - Thr Ile Lys Gly Ser Val Ile Ala Asn Cys Ly - #s Met Thr Thr Cys Arg 385 3 - #90 3 - #95 4 -#00 - - Cys Val Asn Pro Pro Gly Ile Ile Ser Gln As - #n Tyr Gly Glu AlaVal 405 - # 410 - # 415 - - Ser Leu Ile Asp Lys Gln Ser Cys Asn Val Le - #u Ser Leu Gly Gly Ile 420 - # 425 - # 430 - - Thr Leu Arg Leu Ser Gly Glu Phe Asp Val Th - #r Tyr Gln Lys Asn Ile 435 - # 440 - # 445 - - Ser Ile Gln Asp Ser Gln Val Ile Ile Thr Gl - #y Asn Leu Asp Ile Ser 450 - # 455 - # 460 - - Thr Glu Leu Gly Asn Val Asn Asn Ser Ile Se - #r Asn Ala Leu Asn Lys 465 4 - #70 4 - #75 4 -#80 - - Leu Glu Glu Ser Asn Arg Lys Leu Asp Lys Va - #l Asn Val Lys LeuThr 485 - # 490 - # 495 - - Ser Thr Ser Ala Leu Ile Thr Tyr Ile Val Le - #u Thr Ile Ile Ser Leu 500 - # 505 - # 510 - - Val Phe Gly Ile Leu Ser Leu Ile Leu Ala Cy - #s Tyr Leu Met Tyr Lys 515 - # 520 - # 525 - - Gln Lys Ala Gln Gln Lys Thr Leu Leu Trp Le - #u Gly Asn Asn Thr Leu 530 - # 535 - # 540 - - Asp Gln Met Arg Ala Thr Thr Lys Met 545 5 - #50 - - - - (2) INFORMATION FOR SEQ ID NO:15: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 182 base - #pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: DNA (genomic) - - (iii) HYPOTHETICAL: NO - - (iv) ANTI-SENSE: NO - - (xi) SEQUENCE DESCRIPTION: SEQ - #ID NO:15: - - GGCCTCGAGG GCCGCGGCCG CCTGCAGGTC GACTCTAGAA AAAATTGAAA AA -#CTATTCTA 60 - - ATTTATTGCA CGGAGATCTT TTTTTTTTTT TTTTTTTTTG GCATATAAAT GA -#ATTCGGAT 120 - - CCGGACCGCG CCGTTAGCCA AGTTGCGTTA GAGAATGATG AAAGAGAGGC AA -#AAAATACA 180 - - TG - # - # - # 182 - - - - (2) INFORMATION FOR SEQ ID NO:16: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 178 base - #pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: DNA (genomic) - - (iii) HYPOTHETICAL: NO - - (iv) ANTI-SENSE: NO - - (xi) SEQUENCE DESCRIPTION: SEQ - #ID NO:16: - - ATCTTCTGCG ACATCAAGAA TCAAACCGAA TGCCCGGATC CATAATTAAT TA -#ATTAATTT 60 - - TTATCCCTCG ACTCTAGAAA AAATTGAAAA ACTATTCTAA TTTATTGCAC GG -#AGATCTTT 120 - - TTTTTTTTTT TTTTTTTTGG CATATAAATG AATTCGGATC GATCCCGGTT GG -#CGCCCT 178 - - - - (2) INFORMATION FOR SEQ ID NO:17: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 60 base - #pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: DNA (genomic) - - (iii) HYPOTHETICAL: NO - - (iv) ANTI-SENSE: NO - - (xi) SEQUENCE DESCRIPTION: SEQ - #ID NO:17: - - AAAAACCCCC CCCCCCCCCC CCCCCCCCCC CTGCAGGCAT CGTGGTGTCA CG -#CTCGTCGT 60 - - - - (2) INFORMATION FOR SEQ ID NO:18: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 120 base - #pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: DNA (genomic) - - (iii) HYPOTHETICAL: NO - - (iv) ANTI-SENSE: NO - - (xi) SEQUENCE DESCRIPTION: SEQ - #ID NO:18: - - ATAATTCTCT TACTGTCATG CCATCCGTAA GATGCTTTTC TGTGACTGGT GA -#GTGATCCA 60 - - TAATTAATTA ATTAATTTTT ATCCCGGGTC GACCTGCAGG CGGCCGCGGC CC -#TCGAGGCC 120 - - - - (2) INFORMATION FOR SEQ ID NO:19: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 1305 base - #pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: DNA (genomic) - - (iii) HYPOTHETICAL: NO - - (iv) ANTI-SENSE: NO - - (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 1..1305 - - (xi) SEQUENCE DESCRIPTION: SEQ - #ID NO:19: - - ATG CAC CGT CCT CAT CTC AGA CGG CAC TCG CG - #T TAC TAC GCG AAAGGA 48 Met His Arg Pro His Leu Arg Arg His Ser Ar - #g Tyr Tyr Ala Lys Gly 1 5 - # 10 - # 15 - - GAG GTG CTT AAC AAA CAC ATG GAT TGC GGT GG - #A AAA CGG TGC TGC TCA 96 Glu Val Leu Asn Lys His Met Asp Cys Gly Gl - #y Lys Arg Cys Cys Ser 20 - # 25 - # 30 - - GGC GCA GCT GTA TTC ACT CTT TTC TGG ACT TG - #T GTC AGG ATT ATG CGG 144 Gly Ala Ala Val Phe Thr Leu Phe Trp Thr Cy - #s Val Arg Ile Met Arg 35 - # 40 - # 45 - - GAG CAT ATC TGC TTT GTA CGC AAC GCT ATG GA - #C CGC CAT TTA TTT TTG 192 Glu His Ile Cys Phe Val Arg Asn Ala Met As - #p Arg His Leu Phe Leu 50 - # 55 - # 60 - - AGG AAT GCT TTT TGG ACT ATC GTA CTG CTT TC - #T TCC TTC GCT AGC CAG 240 Arg Asn Ala Phe Trp Thr Ile Val Leu Leu Se - #r Ser Phe Ala Ser Gln 65 - # 70 - # 75 - # 80 - - AGC ACC GCC GCC GTC ACG TAC GAC TAC ATT TT - #A GGC CGT CGC GCG CTC 288 Ser Thr Ala Ala Val Thr Tyr Asp Tyr Ile Le - #u Gly Arg Arg Ala Leu 85 - # 90 - # 95 - - GAC GCG CTA ACC ATA CCG GCG GTT GGC CCG TA - #T AAC AGA TAC CTC ACT 336 Asp Ala Leu Thr Ile Pro Ala Val Gly Pro Ty - #r Asn Arg Tyr Leu Thr 100 - # 105 - # 110 - - AGG GTA TCA AGA GGC TGC GAC GTT GTC GAG CT - #C AAC CCG ATT TCT AAC 384 Arg Val Ser Arg Gly Cys Asp Val Val Glu Le - #u Asn Pro Ile Ser Asn 115 - # 120 - # 125 - - GTG GAC GAC ATG ATA TCG GCG GCC AAA GAA AA - #A GAG AAG GGG GGC CCT 432 Val Asp Asp Met Ile Ser Ala Ala Lys Glu Ly - #s Glu Lys Gly Gly Pro 130 - # 135 - # 140 - - TTC GAG GCC TCC GTC GTC TGG TTC TAC GTG AT - #T AAG GGC GAC GAC GGC 480 Phe Glu Ala Ser Val Val Trp Phe Tyr Val Il - #e Lys Gly Asp Asp Gly 145 1 - #50 1 - #55 1 -#60 - - GAG GAC AAG TAC TGT CCA ATC TAT AGA AAA GA - #G TAC AGG GAA TGTGGC 528 Glu Asp Lys Tyr Cys Pro Ile Tyr Arg Lys Gl - #u Tyr Arg Glu Cys Gly 165 - # 170 - # 175 - - GAC GTA CAA CTG CTA TCT GAA TGC GCC GTT CA - #A TCT GCA CAG ATG TGG 576 Asp Val Gln Leu Leu Ser Glu Cys Ala Val Gl - #n Ser Ala Gln Met Trp 180 - # 185 - # 190 - - GCA GTG GAC TAT GTT CCT AGC ACC CTT GTA TC - #G CGA AAT GGC GCG GGA 624 Ala Val Asp Tyr Val Pro Ser Thr Leu Val Se - #r Arg Asn Gly Ala Gly 195 - # 200 - # 205 - - CTG ACT ATA TTC TCC CCC ACT GCT GCG CTC TC - #T GGC CAA TAC TTG CTG 672 Leu Thr Ile Phe Ser Pro Thr Ala Ala Leu Se - #r Gly Gln Tyr Leu Leu 210 - # 215 - # 220 - - ACC CTG AAA ATC GGG AGA TTT GCG CAA ACA GC - #T CTC GTA ACT CTA GAA 720 Thr Leu Lys Ile Gly Arg Phe Ala Gln Thr Al - #a Leu Val Thr Leu Glu 225 2 - #30 2 - #35 2 -#40 - - GTT AAC GAT CGC TGT TTA AAG ATC GGG TCG CA - #G CTT AAC TTT TTACCG 768 Val Asn Asp Arg Cys Leu Lys Ile Gly Ser Gl - #n Leu Asn Phe Leu Pro 245 - # 250 - # 255 - - TCG AAA TGC TGG ACA ACA GAA CAG TAT CAG AC - #T GGA TTT CAA GGC GAA 816 Ser Lys Cys Trp Thr Thr Glu Gln Tyr Gln Th - #r Gly Phe Gln Gly Glu 260 - # 265 - # 270 - - CAC CTT TAT CCG ATC GCA GAC ACC AAT ACA CG - #A CAC GCG GAC GAC GTA 864 His Leu Tyr Pro Ile Ala Asp Thr Asn Thr Ar - #g His Ala Asp Asp Val 275 - # 280 - # 285 - - TAT CGG GGA TAC GAA GAT ATT CTG CAG CGC TG - #G AAT AAT TTG CTG AGG 912 Tyr Arg Gly Tyr Glu Asp Ile Leu Gln Arg Tr - #p Asn Asn Leu Leu Arg 290 - # 295 - # 300 - - AAA AAG AAT CCT AGC GCG CCA GAC CCT CGT CC - #A GAT AGC GTC CCG CAA 960 Lys Lys Asn Pro Ser Ala Pro Asp Pro Arg Pr - #o Asp Ser Val Pro Gln 305 3 - #10 3 - #15 3 -#20 - - GAA ATT CCC GCT GTA ACC AAG AAA GCG GAA GG - #G CGC ACC CCG GACGCA 1008 Glu Ile Pro Ala Val Thr Lys Lys Ala Glu Gl - #y Arg Thr Pro Asp Ala 325 - # 330 - # 335 - - GAA AGC AGC GAA AAG AAG GCC CCT CCA GAA GA - #C TCG GAG GAC GAC ATG 1056 Glu Ser Ser Glu Lys Lys Ala Pro Pro Glu As - #p Ser Glu Asp Asp Met 340 - # 345 - # 350 - - CAG GCA GAG GCT TCT GGA GAA AAT CCT GCC GC - #C CTC CCC GAA GAC GAC 1104 Gln Ala Glu Ala Ser Gly Glu Asn Pro Ala Al - #a Leu Pro Glu Asp Asp 355 - # 360 - # 365 - - GAA GTC CCC GAG GAC ACC GAG CAC GAT GAT CC - #A AAC TCG GAT CCT GAC 1152 Glu Val Pro Glu Asp Thr Glu His Asp Asp Pr - #o Asn Ser Asp Pro Asp 370 - # 375 - # 380 - - TAT TAC AAT GAC ATG CCC GCC GTG ATC CCG GT - #G GAG GAG ACT ACT AAA 1200 Tyr Tyr Asn Asp Met Pro Ala Val Ile Pro Va - #l Glu Glu Thr Thr Lys 385 3 - #90 3 - #95 4 -#00 - - AGT TCT AAT GCC GTC TCC ATG CCC ATA TTC GC - #G GCG TTC GTA GCCTGC 1248 Ser Ser Asn Ala Val Ser Met Pro Ile Phe Al - #a Ala Phe Val Ala Cys 405 - # 410 - # 415 - - GCG GTC GCG CTC GTG GGG CTA CTG GTT TGG AG - #C ATC GTA AAA TGC GCG 1296 Ala Val Ala Leu Val Gly Leu Leu Val Trp Se - #r Ile Val Lys Cys Ala 420 - # 425 - # 430 - - CGT AGC TAA - # - #- # 1305 Arg Ser 435 - - - - (2) INFORMATION FOR SEQ ID NO:20: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 434 amino - #acids (B) TYPE: amino acid (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: protein - - (xi) SEQUENCE DESCRIPTION: SEQ - #ID NO:20: - - Met His Arg Pro His Leu Arg Arg His Ser Ar - #g Tyr Tyr Ala LysGly 1 5 - # 10 - # 15 - - Glu Val Leu Asn Lys His Met Asp Cys Gly Gl - #y Lys Arg Cys Cys Ser 20 - # 25 - # 30 - - Gly Ala Ala Val Phe Thr Leu Phe Trp Thr Cy - #s Val Arg Ile Met Arg 35 - # 40 - # 45 - - - - Glu His Ile Cys Phe Val Arg Asn Ala Met As - #p Arg His LeuPhe Leu 50 - # 55 - # 60 - - Arg Asn Ala Phe Trp Thr Ile Val Leu Leu Se - #r Ser Phe Ala SerGln - - 65 - # 70 - # 75- # 80 - - Ser Thr Ala Ala Val Thr Tyr Asp Tyr Ile Le - #u Gly Arg Arg AlaLeu 85 - # 90 - # 95 - - Asp Ala Leu Thr Ile Pro Ala Val Gly Pro Ty - #r Asn Arg Tyr Leu Thr 100 - # 105 - # 110 - - Arg Val Ser Arg Gly Cys Asp Val Val Glu Le - #u Asn Pro Ile Ser Asn 115 - # 120 - # 125 - - Val Asp Asp Met Ile Ser Ala Ala Lys Glu Ly - #s Glu Lys Gly Gly Pro 130 - # 135 - # 140 - - Phe Glu Ala Ser Val Val Trp Phe Tyr Val Il - #e Lys Gly Asp Asp Gly 145 1 - #50 1 - #55 1 -#60 - - Glu Asp Lys Tyr Cys Pro Ile Tyr Arg Lys Gl - #u Tyr Arg Glu CysGly 165 - # 170 - # 175 - - Asp Val Gln Leu Leu Ser Glu Cys Ala Val Gl - #n Ser Ala Gln Met Trp 180 - # 185 - # 190 - - Ala Val Asp Tyr Val Pro Ser Thr Leu Val Se - #r Arg Asn Gly Ala Gly 195 - # 200 - # 205 - - Leu Thr Ile Phe Ser Pro Thr Ala Ala Leu Se - #r Gly Gln Tyr Leu Leu 210 - # 215 - # 220 - - Thr Leu Lys Ile Gly Arg Phe Ala Gln Thr Al - #a Leu Val Thr Leu Glu 225 2 - #30 2 - #35 2 -#40 - - Val Asn Asp Arg Cys Leu Lys Ile Gly Ser Gl - #n Leu Asn Phe LeuPro 245 - # 250 - # 255 - - Ser Lys Cys Trp Thr Thr Glu Gln Tyr Gln Th - #r Gly Phe Gln Gly Glu 260 - # 265 - # 270 - - His Leu Tyr Pro Ile Ala Asp Thr Asn Thr Ar - #g His Ala Asp Asp Val 275 - # 280 - # 285 - - Tyr Arg Gly Tyr Glu Asp Ile Leu Gln Arg Tr - #p Asn Asn Leu Leu Arg 290 - # 295 - # 300 - - Lys Lys Asn Pro Ser Ala Pro Asp Pro Arg Pr - #o Asp Ser Val Pro Gln 305 3 - #10 3 - #15 3 -#20 - - Glu Ile Pro Ala Val Thr Lys Lys Ala Glu Gl - #y Arg Thr Pro AspAla 325 - # 330 - # 335 - - Glu Ser Ser Glu Lys Lys Ala Pro Pro Glu As - #p Ser Glu Asp Asp Met 340 - # 345 - # 350 - - Gln Ala Glu Ala Ser Gly Glu Asn Pro Ala Al - #a Leu Pro Glu Asp Asp 355 - # 360 - # 365 - - Glu Val Pro Glu Asp Thr Glu His Asp Asp Pr - #o Asn Ser Asp Pro Asp 370 - # 375 - # 380 - - Tyr Tyr Asn Asp Met Pro Ala Val Ile Pro Va - #l Glu Glu Thr Thr Lys 385 3 - #90 3 - #95 4 -#00 - - Ser Ser Asn Ala Val Ser Met Pro Ile Phe Al - #a Ala Phe Val AlaCys 405 - # 410 - # 415 - - Ala Val Ala Leu Val Gly Leu Leu Val Trp Se - #r Ile Val Lys Cys Ala 420 - # 425 - # 430 - - Arg Ser__________________________________________________________________________

Number	Name	Date
5093258	Cohen et al.	Mar 1992
5174993	Paoletti	Dec 1992
5180675	Drillien et al.	Jan 1993
5182210	Binns et al.	Jan 1993
5204243	Paoletti	Apr 1993
5258294	Boyle et al.	Nov 1993
5286639	Yanagida et al.	Feb 1994
5310671	Binns et al.	May 1994
5332676	Binns et al.	Jul 1994
5338683	Paoletti	Aug 1994
5368855	Boyle et al.	Nov 1994
5369025	Nazerian et al.	Nov 1994
5374558	Binns et al.	Dec 1994
5387519	Yanagida et al.	Feb 1995
5403582	Nazerian et al.	Apr 1995
5443831	Keeler et al.	Aug 1995
5505941	Paoletti	Apr 1996
5514375	Paoletti et al.	May 1996
5529780	Paoletti et al.	Jun 1996

Number	Date	Country
404576A3	Dec 1990	EPX
520753A1	Dec 1992	EPX
517292A1	Dec 1992	EPX
538496A1	Apr 1993	EPX
314569B1	Mar 1994	EPX
308220B1	Jun 1994	EPX
284416B1	Feb 1995	EPX
338807B1	Nov 1995	EPX
WO8802022	Mar 1988	WOX
WO8903429	Apr 1989	WOX
WO8903879	May 1989	WOX
WO8907644	Aug 1989	WOX
WO8912684	Dec 1989	WOX
WO9004638	May 1990	WOX
WO9012882	Nov 1990	WOX
WO9112318	Aug 1991	WOX
WO9102072	Mar 1992	WOX
WO9203545	Mar 1992	WOX
WO9222641	Dec 1992	WOX
WO9303145	Feb 1993	WOX
WO9314219	Jul 1993	WOX

Recombinant fowlpox viruses and uses thereof

Information

Patent Number

Date Filed

Date Issued

Inventors

Original Assignees

Examiners

Agents

CPC

US Classifications

Field of Search

US

International Classifications

Abstract

Description

Claims

Parent Case Info

US Referenced Citations (19)

Foreign Referenced Citations (21)

Non-Patent Literature Citations (59)

Continuations (1)

Continuation in Parts (1)

Entry
Perkus, M.E. et al. Science, vol. 229, p. 981-984, 1985.
Klasing, K.C. Poultry Science, vol. 73, no. 7, p. 1035-1043, 1994
Ramshaw, I. A. et al. TIBTECH, vol. 10, p. 424-426, 1992.
Yamano, Y. Japanese Poultry Science, vol. 13, No. 1, p. 26-29 (abstract only cited), 1976.
Yanagida, N. et al. Journal of VIrology, vol. 33, p. 1402-1408, Mar. 1992.
Mueller, H.K. et al. (1977) "Comparison of 5 Poxvirus Genomes By Analysis With Restriction Endonucleases Hin-D-III Bam-I and Eco-R-I", Virology 38:135-148.
Boyle, D.B. and Coupar B.E.H. (1986) "Identification and Cloning of the Fowlpox Virus Thymidine Kinase Gene Using Vaccinia Virus", Virology 67:1591-1600.
Boyle, D.B. et al. (1987) "Fowlpox Virus Thymidine Kinase Nucleotide Sequence and Relationships to Other Thymidine Kinases", Virology 156:355-365.
Binns, M.M. et al. (1988) "Comparison of A Conserved Region In Fowlpox Virus And Vaccinia Virus Genomes and the Translocation of the Fowlpox Virus Thymidine Kinase Gene", Journal of General Virology 69:1275-1284.
Taylor, J. And Paoletti, E. (1988) "Fowlpox Virus as a Vector in Non-Avian Species", Vaccine 6:466-468.
Schnitzlein, W.M. et al. (1988) "Genomic and Antigenic Characterization of Avipoxviruses", Virus Research 10:65-76.
Boyle, D.B. and Coupar, B.E.H. (1988) "Construction of Recombinant Fowlpox Viruses as Vectors For Poultry Vaccines", Virus Research 10:343-356.
Tomley, F. et al. (1988) "Sequence Analysis of an 11.2 Kilobase Near-Terminal Bam-H-I Fragment of Fowlpox Virus", Journal of General Virology 69:1025-1040.
Campbell, J.I.A. et al. (1989) "Tandem Repeated Sequences With The Terminal Region of the Fowlpox Virus Genome", Journal of General Virology 70:145-154.
Taylor, J. et al. (1988) "Recombinant Fowlpox Virus Inducing Protective Immunity In Non-Avian Species", Vaccine 6:497-503.
Taylor, J. et al. (1988) "Protective Immunity Against Avian Influenza Induced By A Fowlpox Virus Recombinant", Vaccine 6:504-508.
Yanagida, N. et al. (Xxxx) "Protective Immunity Against Newcastle Disease Virus Induced By Fowlpox Virus Recombinants", Vaccines 90, Cold Spring Harbor Laboratory Press 85-89.
Spehner, D. et al. (1990) "Construction of Fowlpox Virus Vectors With Intergenic Insertions Expression of the Beta Galactosidase Gene and the Measles Virus Fusion Gene", Journal of Virology 64:1441-1450.
Kumar S. and Boyle, D.B. (1990) "Mapping of a Major Early-Late Gene of Fowlpox Virus", Virus Research 15:175-186.
Taylor, J. et al. (1990) "Newcastle Disease Virus Fusion Protein Expressed in a Fowlpox Virus Recombinant Confers Protection in Chickens", Journal of Virology 64:1441-1450.
Boursnell, M.E.G. et al. (1990) "Insertion of the Fusion Gene from Newcastle Disease Virus Into A Non-Essential Region In The Terminal Repeats of Fowlpox Virus and Demonstration of Protective Immunity Induced by the Recombinant", Virology 71:621-628.
Dhawale, S.S. and Nazerian K. (1990) "Construction of Recombinant Fowlpox Virus Expressing Bacterial Betagalactosidase in Chick Embryo Fibroblasts", Abstr Annu Meet Am Soc Microbiol 90:333.
Tripathy, D.N. and Wittek, R. (1990) "Regulation of Foreign Gene in Fowlpox Virus By a Vaccinia Virus Promoter", Avain Diseases 34:218-220.
Prideaux, C.T. et al. (1990) "Comparative Analysis of Vaccinia Virus Promoter Activity in Fowlpox and Vaccinia Virus Recombinants", Virus Res 16:43-58.
Tartaglia, J. et al. (1990) "Nucleotide Sequence Analysis of a 10.5 Kbp Hin-D-III Fragment of Fowlpox Virus Relatedness to the Central Portion of the Vaccinia Virus Hin-D-III D Region", J. Gen. Virology 71:1517-1524.
Kumar, S. and Boyle D.B. (1990) "Activity of a Fowlpox Virus Late Gene Promoter in Vaccinia and Fowlpox Virus Recombinants", Archives of Virology 112:139-148.
Boursnell, M.E.G. et al. (1990) "A Recombinant Fowlpox Virus Expressing the Hemagglutinin-Neuraminidase Gene To Newcastle Disease Virus NDV Protects Chickens Against Challenge By NDV", Virology 178:297-300.
Kumar, S. and Boyle D.B. (1990) "A Poxvirus Bidirectional Promoter Element with Early-Late and Late Functions", Virology 179:151-158.
Coupar, B.E.H. et al. (1990) "Restriction Endonuclease Mapping of the Fowlpox Virus Genome", Virology 179:159-167.
Wild, F. et al. (1990) "Fowlpox Virus Recombinant Encoding the Measles Virus Fusion Protein Protection of Mice Against Fatal Measles Encephalitis", Vaccine 8:441-442.
Ogawa, R. et al. (1990) "Recombinant Fowlpox Viruses Inducing Protective Immunity Against Newcastle Disease and Fowlpox Virus", Vaccine 8:486-490.
Edbauer, C. et al. (1990) "Protection of Chickens With a Recombinant Fowlpox Virus Expressing the Newcastle Disease Virus Hemagglutinin-Neuraminidase Gene", Virology 179:901-904.
Binns, M.M. et al. (1990) "Analysis of the Fowlpox Virus Genome Region Correspinding to the Vaccinia Virus D6 to A1 Region Location of and Variation in Non-Essential Genes in Poxviruses", Journal of General Virology 71:2873-2882.
Nazerian, K. And Dhawale, S. (1991) "Structural Analysis of Unstable Intermediate and Stable Forms of Recombinant Fowlpox Virus", Virology 72:2792-2795.
Tripathy, D.N. and Schnitzlein, W.M. (1991) "Expression of Avian Influenza Virus Hemagglutinin By Recombinant Fowlpox Virus", Avain Diseases 35:186-191.
Taylor, J. et al. (1991) "Efficacy Studies on a Canarypox-Rabies Recombinant Virus", Vaccine 9:190-193.
Webster, R.G. et al. (1991) "Efficacy of Nucleoprotein and Hemagglutinin Antigens Expressed In Fowlpox Virus as Vaccine For Influenza in Chickens", Vaccine 9:303-308.
Beard, C.W. et al. (1991) "Protection of Chickens Against Highly Pathogenic Avian Influenza Virus H5N2 By Recombinant Fowlpox Viruses", Avian Disease 35:356-359.
Iritani, Y. et al. (1991) "Antibody Response To Newcastle Disease Virus NDV of Recombinant Fowlpox Virus Fpv Expressing a Hemagglutinin-Neuraminidase of Ndv into Chickens in the Presence of Antibody to NDV or FPV", Avain Diseases 35:659-661.
Bayliss, C.D. et al. (1991) "A Recombinant Fowlpox Virus That Expresses the Vp2 Antigen of Infectious Bursal Disease Virus Induces Protection Against Mortality Caused By the Virus", Archives of Virology 120:193-205.