Recombinant papilloma virus L1

Abstract

This invention relates to a recombinant papilloma virus L1 protein which can elicit an immune response which recognises papilloma virus VLP including L1 protein and can form extracellularly a multimeric structure or VLP wherein the multimeric structure comprises a plurality of recombinant papilloma virus L1 proteins. This invention also includes the use of the recombinant papilloma virus L1 protein to detect the presence of papilloma virus and can form the basis of a vaccine for prophylactic and therapeutic use.

Description

FIELD OF THE INVENTION

THIS INVENTION relates to the L1 protein papilloma viruses. In particular, the invention relates to recombinant papilloma virus L1 protein and its use for detecting and treating papilloma virus infections.

BACKGROUND OF THE INVENTION

Papilloma viruses infect a range of hosts including man, cattle, sheep, dogs and cats. For a more complete listing, see "Papilloma Virus Infections in Animals" by J. P. Sundberg which is described in Papilloma Viruses and Human Diseases, edited by K. Syrjanen, L. Gissman and L. G. Koss, Springer Verlag, 1987.

Human papilloma viruses induce benign hyperproliferative lesions of the cutaneous and mucosal epithelia. Of the 70 different virus types which infect humans, more than 20 are associated with anogenital lesions (de Villiers, 1989, J. Virol. 63 4898-4903). Papilloma viruses have also been associated with various forms of cancers. Human papilloma virus types 16 and 18 have been associated with a number of cervical intra-epithelial neoplasias and carcinomas of the cervix (Lancaster et al., 1987, Cancer Metast. Rev. 6 6653-6664 and Pfister, 1987, Adv. Cancer Res. 48 113-147).

Papilloma viruses are small DNA viruses encoding up to eight early and two late genes. The late genes L1 and L2 code for structural proteins which assemble into a capsid within the cell (Galloway et al., 1989, Adv. Virus Res. 37 125-171). A single virus capsid is a T=7d icosahedron composed of 360 pentameric capsomers, each of which contains five molecules of the major capsid protein L1 (Baker et al., 1991, Biophys. J. 60 1445-1456 and Finch et al., 1965, J. Mol. Bio. 13 1-12). The minor capsid protein L2 is present at approximately one-tenth the abundance of L1 (Doorbar et al., 1987, J. Virol. 61 2793-2799).

Propagation of human papilloma viruses in vitro has not been achieved (Taichman et al., 1984, J. Invest. Dermatol. 83 25) and only small amounts of HPV proteins have been isolated from infected tissues (Androphy etal., 1987, Embo J. 6 1989; Banks et al., 1987, J. Gen. Virol. 68 1351; Firzlaff et al., 1988, Virology 164 467; Oltersdorf et al., 1987, J. Gen. Virol. 68 2933; Schneider-Gadicke et al., 1988, Cancer Res. 48 2969; Seedorf et al., Embo J. 6 139 and Smotkin et al., 1986, PNAS 83 4680). However, the gene coding for L1 protein has been cloned and expressed in a eukaryotic expression system using recombinant vaccinia virus (Browne etal., 1988, J. Gen. Virol. 69 1263-1273; Zhou et al., 1990, J. Gen. Virol. 71 2185-2190 and Zhou et al., 1991, Virology 185 251-257), in a baculovirus expression system (Park et al., 1993, J. Virol. Meth. 45 303-318) and in a bacterial expression system (Strike et al., 1989, J. Gen. Virol. 70 543-555).

As L1 protein is the major capsid protein, it has been used as the basis for the development of vaccines for protection against papilloma virus infection. Zhou et al. immunized mice with synthetic HPV16 virus-like particles (VLPs) using a vaccinia virus doubly recombinant for the L1 and L2 proteins of HPV16. The murine anti-VLP anti-sera recognised HPV16 capsids by ELISA and baculovirus recombinant HPV16L1 and L2 protein on immunoblot. The murine anti-VLP anti-sera, however, failed to recognise two peptides that were recognised by anti-HPV16L1 monoclonal antibodies raised against a recombinant L1 fusion protein (Zhou et al., 1992, Virology 189 592-599). These researchers concluded that the immunoreactive epitopes of HPV16 defined using virus-like particles differ significantly from those defined using recombinant HPV16L1 fusion proteins.

To overcome problems of presentation, vaccines were developed using virus-like particles. VLPs were formed intracellularly from recombinant L1 or L1 and L2 proteins encoded by recombinant vaccinia virus (Zhou et al., 1991, Virology 185 251-257; Zhou et al., 1991, Virology 181 203-210 and International Patent Specification WO93/02184). These vaccines using synthetic virus-like particles have a number of disadvantages. Firstly, the recombinant L1 or L1 and L2 genes are expressed from a vaccinia virus vector which may not be suitable for the production of a vaccine. Secondly, the virus-like particles are produced intracellularly which is a rate limiting step. Thirdly, the virus-like particles may incorporate cellular DNA because they are produced intracellularly and virus-like particles incorporating DNA are not suitable for use in vaccines. Fourthly, virus-like particles may only be partially purified because of the need to retain their integrity and hence correct epitope presentation. Consequently, other proteins or matter associated with the virus-like particles may contaminate a vaccine preparation. Fifthly, the process of producing a vaccine in commercial amounts with virus-like particles from recombinant vaccinia viruses is comparatively expensive.

Similar disadvantages apply to the use of the virus-line particles produced from recombinant vaccinia viruses for the detection of antibodies in the sera of patients.

SUMMARY OF THE INVENTION

The present invention results from the surprising discovery that a recombinant papilloma virus L1 protein can form multimeric structures extracellularly and elicit an immune response that recognises native papilloma virus capsids.

Thus it is an object of the present invention to provide a recombinant papilloma virus L1 protein that can form an immunogenic multimeric structure.

In one aspect, the invention is a recombinant papilloma virus L1 protein which has an N terminal amino acid sequence including (His).sub.6. (His).sub.6 represents six linked histidine residues.

The recombinant papilloma virus L1 protein may have an N terminal amino acid sequence which includes:

MetArgGlySerHisHisHisHisHisHisGlyMetAlaSerMetThrGlyGlyGlnGlnMetGlyArgAspLeuTyrAspAspAspAspLysAsp (SEQ ID NO:1).

The recombinant papilloma virus L1 protein may be derived from any papilloma virus type. The recombinant papilloma virus L1 protein may be an entire or partial amino acid sequence of a papilloma virus L1 protein. The recombinant papilloma virus L1 protein may be an amino acid sequence coding for one or more epitopes that elicit an immune response which recognises papilloma virus VLP. By way of example, the recombinant papilloma virus L1 protein is derived from HPV 6b and the recombinant papilloma virus L1 protein is shown in FIGS. 1(a)-1(c).

The immune response elicited by the recombinant papilloma virus L1 protein may be an antibody response, or an antibody response together with a cell mediated response. The elicited response may recognise recombinant and/or native papilloma virus VLP L1 protein. The antibody response is where antibodies are raised against the recombinant papilloma virus L1 protein and these antibodies recognise papilloma virus VLP L1 protein. The cell mediated and humoral response may include T cells, large granular lymphocytes, mononuclear phagocytes, neutrophils, eosinophils, basophils, mast cells, various tissue cells, platelets, complement, inflammatory mediators and cytokines including interferons, interleukins, colony stimulating factor, tumor necrosis factor and transforming growth factor B. The cell mediated and humoral response may result from being primed and challenged with recombinant papilloma virus L1 protein. An example of a cell mediated and humoral response is delayed type hypersensitivity.

In a second aspect, the invention is a multimeric structure comprising a plurality of recombinant papilloma virus L1 proteins; each of said recombinant papilloma virus L1 proteins having an N terminal amino acid sequence including (His).sub.6 One or more of the recombinant papilloma virus L1 proteins may have an N terminal amino acid sequence as described above.

The multimeric structure may be any size but preferably it is a pentameric structure. A multimeric structure may be a VLP. The term VLP includes papilloma virus virions and recombinant VLP. The multimeric structures are preferably formed after the recombinant papilloma virus L1 protein has been substantially purified. The multimeric structures may self-assemble extracellularly in suitable buffers. Further, the multimeric structure is able to induce an immune response that recognises papilloma virus VLP.

A third aspect of the invention is a recombinant DNA molecule which encodes a recombinant papilloma virus L1 protein according to the first aspect of the invention. The recombinant DNA molecule may encode a part of said recombinant papilloma virus L1 protein that includes epitopes that elicit an immune response which recognises papilloma virus VLP. Alternatively, the recombinant DNA molecule may be a synonymous DNA sequence that codes for said recombinant papilloma virus L1 protein or said part of said recombinant papilloma virus L1 protein. The recombinant DNA molecule may encode a sequence that can hybridise under standard conditions to a sequence encoding said recombinant papilloma virus L1 protein or said part of said recombinant papilloma virus L1 protein. The recombinant DNA molecule which encodes the recombinant papilloma virus L1 protein may have a 5' nucleotide sequence which includes six repeats of the trinucleotide sequence CAT. The recombinant DNA molecule which encodes the recombinant papilloma virus L1 protein may preferably have a 5' nucleotide sequence which includes:

ATGCGGGGTTCTCATCATCATCATCATCATGGTATGGCTAGCATGACTGGTGGACAGCAAATGGGTCGGGATCTGTACGACGATGACGATAAGGAT (SEQ ID NO:2).

A suitable recombinant DNA molecule is shown in FIGS. 1(a)-1(c).

A fourth aspect of the invention is a method for preparation of a multimeric structure comprising a plurality of recombinant papilloma virus L1 protein, said multimeric structure is able to induce an immune response that recognises papilloma virus VLP including the steps of:

(I) expressing a recombinant DNA molecule which encodes a recombinant papilloma virus L1 protein from a bacterium; (II) substantially purifying the recombinant papilloma virus L1 protein; and (III) forming said multimeric structure extracellularly.

The method may use multimeric structures comprising recombinant papilloma virus L1 proteins which has an N terminal amino acid sequence that includes (His).sub.6. The N terminal amino acid sequence may include:

MetArgGlySerHisHisHisHisHisHisGlyMetAlaSerMetThrGlyGlyGlnGlnMetGlyArgAspLeuTyrAspAspAspAspLysAsp (SEQ ID NO:1).

The recombinant DNA molecule may be constructed from a suitable source of papilloma virus DNA such as a human papilloma virus or a bovine papilloma virus using standard cloning and/or PCR techniques. The recombinant DNA molecule may also include an expression vector. The expression vector may be a plasmid, cosmid, phagemid or a virus. A suitable expression vector encodes (in the following order) an ATG site, (His).sub.6 peptide, and then a cloning site wherein papilloma virus L1 protein DNA sequence may be inserted in the correct reading frame so that a fusion protein of (His).sub.6 -L1 protein results from translation. A preferable expression vector is any one of plasmids pTrcHisA, pTrcHisB and pTrcHisC. A suitable host is a E. coli strain.

The preferred expression system is a bacterial expression system with E coli and plasmid pTrcHisB. Introduction of the recombinant DNA molecule into a suitable host may be achieved by any suitable method including transfection and transformation. A preferable recombinant DNA molecule is the complete DNA sequence of HPV6b L1 protein inserted into pTrcHisB in a correct reading frame orientation to form pTrc6bL1. The recombinant DNA molecule pTrc6bL1 is preferably transformed into E. coli strain DH5.

Following expression, the expression system may be disrupted. Where the expression system is a cell system, the cell may be lysed with suitable techniques and agents such as sonication in a buffer containing guanidinium hydrochloride. The recombinant papilloma virus L1 protein may be partially or completely purified. Purification may be achieved by using any one or more suitable chromatographic procedures. The recombinant papilloma virus L1 protein may be purified using a step of affinity chromatography with a nickel column. Additional purification steps may include preparative gel electrophoresis.

In a fifth aspect, the invention provides a method for detecting the presence of papilloma virus.

The method may detect the presence of papilloma virus L1 protein in a sample using antibody raised against said papilloma virus L1 protein. The method may employ ELISA, RIA or other immunoassay techniques. The method may include the steps of:

(1) coating the wells of a microtitre plate with a sample which putatively contains papilloma virus L1 protein; (2) adding antisera raised against the recombinant papilloma virus L1 protein to form a papilloma virus L1 protein-antibody complex; and (3) detecting the presence of the papilloma virus L1 protein-antibody complex with a detection agent.

With respect to step (1), the wells of the microtitre plate may be initially coated with antisera raised against the recombinant papilloma virus L1 protein prior to the addition of the sample. The detection agent may be an antibody or other suitable ligand conjugated with a suitable label. A suitable label may include any suitable enzyme label such as horseradish peroxidase, a radioactive isotope or a fluorometric molecule.

In a sixth aspect, the invention provides a method for detecting the presence of antibodies specific for papilloma virus L1 proteins in a sample using said recombinant papilloma virus L1 protein.

The method may employ ELISA, RIA or other immunoassay techniques. The method may include the steps of:

(i) coating the wells of a microtitre plate with the recombinant papilloma virus L1 protein; (ii) adding the sample which putatively contains antibody specific for papilloma virus L1 protein to form a recombinant papilloma virus L1 protein-antibody complex; and (iii) detecting the presence of recombinant papilloma virus L1-antibody complex with a detection agent.

In a seventh aspect, the invention provides a kit for detecting the presence of papilloma virus L1 protein in a sample and includes antibody raised against said recombinant papilloma virus L1 protein.

In an eighth aspect, the invention provides for a kit for detecting the presence of antibody specific for papilloma virus L1 protein in a sample and includes said recombinant papilloma virus L1 protein.

In a ninth aspect, the invention provides for a prophylactic or therapeutic vaccine including said recombinant papilloma virus L1 protein. The vaccine may include a suitable adjuvant such as ISCOMS, alum, Freunds Incomplete adjuvant, Freunds Complete adjuvant, Quil A, other saponins, Aluminium hydroxide algammulin, and pertussigen. Alternatively, the vaccine may not include adjuvant where the recombinant papilloma virus L1 protein is immunogenic without adjuvant.

BRIEF DESCRIPTION OF THE DRAWINGS

FIGS. 1(a)-1(c) illustrate the DNA nucleotide sequence and amino acid sequence of HPV6bL1HEXAHIS protein (SEQ ID NOS:5 and 6); and

FIG. 2 is an electron micrograph of pentameric structures of HPV6bL1 HEXAHIS protein aggregates.

Reference may now be made to various preferred embodiments of the invention. In these preferred embodiments, it should be noted that the references to specific papilloma viruses, vaccines and constructs of recombinant DNA molecules are given by way of example only.

EXPERIMENTAL

EXAMPLE 1

Production of HPV6b L1 HEXAHIS protein

Construction of pTRC6bL1 The L1 open reading frame of HPV6b was cloned from a clinical isolate by polymerase chain reaction using as primers: GCGGATCCAGATGTGGCGGCCTAGCGACAGCACAGTATATG and CGCCCGGGTTACCTTTTAGTTTTGGCCTCGCTTACGTTITAGG (SEQ ID NOS:3 and 4).

The resulting 1.5 kb PCR product was cleaved with BamH1 and Sma1 and cloned into a BamH1/klenow blunted Eco R1 site created within the plasmid pTRCHIS B (Invitrogen). The resultant L1 recombinant plasmid was pTRC6bL1 and encodes a protein sequence:

Met.Arg.Gly.Ser.His.His.His.His.His.His.Gly.Met.Ala.Ser.Met.Thr.Gly.Gly. Gln.Gln.Met.Gly.Arg.Asp.Leu.Tyr.Asp.Asp.Asp.Lys.Asp. (HPV6b L1 aas1-520) (SEQ ID NO:1). Growth of Bacteria encoding the HPV6b L1 HEXAHIS Protein

10 mls of 2YT broth (16 mg tyrptone, 10 mg yeast. 5 mg NaC1) containing Ampicillin (final concentration 100 .mu.g/ml) was inoculated with 10 .mu.l of one loopful of bacteria (E. coli DH5) from glycerol stock. The culture was incubated at 37.degree. C. with aeration at 120 rpm for six hours.

200 mls of 2YT broth containing Ampicillin (final concentration 100 .mu.g/ml) was inoculated with the six hour-10 ml culture. The culture was incubated at 37.degree. C. with aeration at 120 rpm overnight.

800 mls of 2YT broth containing Ampicillin (final concentration 100 .mu.g/ml) was inoculated with the 200 ml-overnight culture. The culture was incubated at 37.degree. C. with aeration at 120 rpm until the absorbance reached between 0.6-0.8 O.D. units at 600 nm (usually 2-3 hours). The HPV6b L1 HEXAHIS protein was induced by addition of 0.5 mM IPTG for 4-6 hours.

The bacteria were pelleted by centrifugation (Beckman JA14 rotor centrifuged at 5000 rpm for 10 minutes at 20.degree. C.). The pellet was washed in 50 ml of phosphate buffered saline by resuspending the bacterial pellet in a 50 ml centrifuged tube. The washed bacteria were repelleted by centrifugation (Beckman TJ-6 at 3000 rpm for 10 minutes at 20.degree. C.). The supernatant was discarded. The pellet was stored at -20.degree. C. or -70.degree. C. until needed.

Purification of HPV6b L1 HEXAHIS Protein

The bacteria were resuspended and lysed in 50 ml of Guanidinium lysis buffer (6M Guanidinium hydrochloride and 5.8 ml/liter of solution A [177 mM NaH.sub.2 PO.sub.4 and 5M NaCl] pH 7.8 using HCl). The suspension was sonicated at 30% output for two minutes. The cell debris was peileted by centrifugation (Beckman JA21 rotor at 10000 rpm for 30 minutes at 4.degree. C.). The supernatant which contains the HPV6b L1 HEXAHIS protein was retained.

The HPV6b L1 HEXAHIS protein was substantially purified by essentially a two step purification procedure.

The supernatant containing the HPV6b L1 HEXAHIS protein was loaded onto a nickel column (2.6 cm.times.6 cm) using a BIORAD ECONO system at 4.degree. C. Before loading the supernatant, the column was washed thoroughly with NA buffer at 1 ml/minute. NA buffer comprises 6M urea, 5.8 mls/liter solution A [177 mM NaH.sub.2 PO.sub.4 and 5M NaCl], 94 mls/liter solution B [200 mM Na.sub.2 HPO.sub.4 and 5M NaCl] at pH 7.8 using HCl before urea was added. The supernatant was loaded onto the Nickel column at one mi/minute. 10 ml fractions were collected in case the column was overloaded and any unbound protein was washed through the column. After the supernatant was loaded, the column was washed with NB buffer at a flow rate of one ml/minute. NB buffer comprises 6M urea and 100 mls/liter of solution A [177M NaH.sub.2 PO.sub.4 and 5M NaCl] at pH 4.0 using HCl before urea is added. The column was washed with NB buffer according to the procedure in Table 1 where lowering of the pH gradient removed contaminating proteins. 10 ml fractions of the eluent were collected.

The fractions containing HPV6b L1 HEXAHIS protein were determined by either dot blot, direct ELISA or SDS PAGE. After the fractions were identified, the washing of the column continued with 100% NB buffer until the pH levelled off. The column was then washed with NA buffer. (The column was stored in 20% ethanol.)

The fractions containing HPV6b L1 HEXAHIS protein were pooled and dialysed against five liters of dH.sub.2 O or 10 mM Tris HCl pH 7.5 for overnight at 4.degree. C. (or two hours at room temperature). The protein was then precipitated with acetone in a 8:2 acetone to sample ratio, for two hours at -70.degree. C. or overnight at -20.degree. C. The protein-acetone solution was centrifuged (Beckman TJ-6 at 3000 rpm and at 4.degree. C. for 20 minutes). The supernatant was discarded. The pellet was dried under a flow of nitrogen gas for five minutes to remove any remaining acetone.

The pellet was resuspended in 1 ml of ddH.sub.2 O and 4-5 mls of 4.times. loading buffer [1.0 ml of 0.5M Tris pH 6.8, 0.8 ml of glycerol, 1.6 ml of 10% SDS w/v, 0.1 g of DTT 1% w/v, 0.2 ml of 0.1% w/v bromphenol blue and 4.4 ml of dH.sub.2 O]. The resuspended pellet was heated at 65-70.degree. C. for 15 minutes to ensure all the protein was dissolved.

The resuspension was loaded onto a BIORAD Prep Cell comprising a 10% separating gel (4.5 cm high by 4 cm diameter) with a 4% stacking gel (4 cm high by 4 cm diameter). The Prep Cell was ran at 12 W constant power.

When the dye front of the gel reached 2 cm from the bottom, 10 ml fractions at a 1 ml/minute elution rate were collected. Fractions were tested for HPV6b L1 HEXAHIS protein by either dot blot, direct ELISA or SDS PAGE (with the Phast system). Positive fractions were tested on SDS PAGE and those found to have a single HPV 6bL1HEXAHIS protein band were pooled. The pooled fractions were dialysed against 5 liters of ddH.sub.2 O to remove glycine. Dialysis occurred overnight at a temperature of 4.degree. C. and using two changes of ddH.sub.2 O.

The dialysed HPV6b L1 HEXAHIS protein was precipitated with acetone to remove SDS. A 8:2 acetone to sample ratio was used either for two hours at -70.degree. C. or overnight at -20.degree. C. The protein-acetone solution was centrifuged (Beckman TJ-6 at 3000 rpm and at 4.degree. C. for 20 minutes). The supernatant was discarded and the pellet was dried under a flow of nitrogen gas for five minutes to remove any remaining acetone.

The protein was then able to be resuspended in a buffer of choice and its concentration determined. This protein was subsequently demonstrated to form capsomers by purifying the HPV6b L1 HEXAHIS protein as described , gradual removal of urea by dialysis against 10 mM Tris HCl pH 7.5, and examination of the resultant immunoprecipitate by scanning electron microscopy. FIG. 2 shows the typical pentameric structures of HPV6b L1 HEXAHIS protein aggregates.

EXAMPLE 2

Demonstration of antibody production against HPV6b L1 HEXAHIS protein

To produce antibody against HPV6b L1 HEXAHIS protein, mice (strain C57BI/6) were injected subcutaneously twice at a four week interval with 50 .mu.g protein/mouse following the experimental protocol in Table 2. Two weeks after the second injection the mice were bled. Serum was obtained from the extracted blood using standard procedures.

The serum was tested for the production of antibodies to HPV6b L1 HEXAHIS protein using three different antigens.

The serum was tested against a human papilloma virus HPV6B capsid preparation. The serum was diluted at 1 in 200 and tested against a HPV6B capsid preparation in RIPA buffer (20 mM Tris-HCl pH 7.6; 2 mM EDTA; 50 mM NaCl; 1% deoxycholate; 1% Triton X-100; 0.25% SDS; 1% aproptinin, and 1 mM PMSF). The antibody-antigen precipitates were run on 10% SDS PAGE separating the individual components of the immune complex. The presence of HPV6b L1 protein was detected with rabbit anti-HPV6b L1 antibody. The presence of HPV6b L1 protein indicates anti-HPV6b L1 antibody was produced in the mouse against 6bL1HEXAHIS protein. Groups A, B, C, D,E and F gave positive results.

Serum was also tested by western blot analysis with HPV6b L1 produced from baculovirus. A positive result indicates anti-HPV6b L1 antibody was produced in the mouse against HPV6b L1 HEXAHIS protein. Groups A, B, C, D, E and F gave positive results with the best result demonstrated when aluminium hydroxide was used as adjuvant. The control groups A, B, C, D and E gave negative results.

The serum was tested by dot blot and ELISA using standard techniques against bovine papilloma virus L1 protein. The best result was achieved with serum from group D mice (i.e. when aluminium was used as an adjuvant) with a OD reading of 0.96. This was followed by serum from group C (i.e. with Freund's complete adjuvant) with OD reading of 0.70, serum from group E (ie. with algammulin) with OD reading 0.34, then serum from group B (i.e. boiled in 1% SDS and cooled) with OD reading 0.24 and serum from group A (no adjuvant) with OD reading 0.34. All control groups had an OD reading of 0.05.

The testing of the serum against three different antigens showed that the HPV6b L1 HEXAHIS protein was immunogenic and produced anti-HPV6b L1 antibodies when used as an antigen with or without adjuvant.

EXAMPLE 3

Demonstration of delayed type hypersensitivity (and confirm antibody production) in mice by HPV6b L1 HEXAHIS protein

Delayed type hypersensitivity involves cell mediated immune reactions as well as some humoral immune reactions. Mice (strain BALB/c) were treated (intraperitoneal injection) with HPV6b L1 HEXAHIS protein under a variety of conditions outlined in Table 3. On day 11 the ear was challenged by intradermal injection) with HPV6b L1 HEXAHIS protein or another HEXAHIS protein. The thickness of the ear was measured on day 13 and day 14. Mice that gave a positive response on day 14 were killed and the histology of the ear was examined.

It was demonstrated in this example that HPV6b L1 HEXAHIS protein without adjuvant induced good delayed type hypersensitivity with initial doses of 50 .mu.g/mouse but not at 5 .mu.g/mouse. However, mice needed to be pertussigen treated to induce a delayed type hypersensitivity response.

With respect to the three examples, it has been shown that HPV6b L1 protein expressed and isolated in the method of Example 1 formed capsomeric aggregates, and the HPV6b L1 protein capsomeric aggregates without further adjuvant were immunogenic producing an antibody response and a cell mediated response. Therefore, HPV6b L1 HEXAHIS protein would serve as a suitable basis for a vaccine designed to prevent human papilloma virus infection by induction of neutralising antibodies or to treat existing lesions through the induction of L1 protein specific cell mediated immunity. Examples 1 to 3 have used HPV6b L1 protein as an example to demonstrate the immunogenicity of the preparation and, as an example, the invention is not restricted to this example and any papilloma virus L1 protein can be used.

EXAMPLE 4

Demonstration that antibodies raised to HPV6b L1 HEXAHIS protein recognise HPV6b L1 virus-like particles (VLPS)

Wells of plates were coated at 0.2 .mu.g protein/well with either HPV6b L1 HEXAHIS produced from E. coli, HPV6 VLP-L1 produced from baculovirus, and baculovirus and E. coli preparations (cell fermentation supernatants) as controls, in PBS at pH 7.2 and left to incubate overnight at room temperature. One wash was conducted with PBS at pH 7.2. Non-specific binding was blocked by incubating the plates with 1% (w/v) casein for 1 hour at room temperature.

Rabbit HPV6b L1 HEXAHIS antisera was added to each of the wells coated with HPV6b L1 HEXAHIS, HPV VLP-1, baculovirus prepared controls or E. coli prepared controls (prepared in duplicate), and was serially diluted 1/2 down the plates. Sera raised against influenza virus A/PR-8 was used as a negative control. Sera raised against HPV VLP-L1 was used as positive control on HPV VLP-L1 plates. Plates were incubated for 1 hour, at room temperature, and were then washed three times with PBS containing 0.05% (v/v) Tween 20 at pH 7.2. Goat-rabbit IgG-HRP conjugate was added to each well and plates were incubated and washed as before. Specific binding of antisera to antigen was detected using TMB. The reaction was stopped after 5 minutes using 0.5M HCl.

Results

The results of the experiment are shown in Table 4. Both HPV6b L1 HEXAHIS protein and HPV6 VLP-L1 complexed with antibody raised against HPV6b L1 HEXAHIS protein indicating that HPV6b HEXAHIS L1 correctly presents in vivo one or more epitopes presented by HPV VLP-L1. The sera raised against HPV6 L1 protein was also negative in the baculovirus or E. coli wells demonstrating the specificity of the reaction. This provides support for the use of HPVL1 HEXAHIS as a vaccine immunogen suitable for inducing antibody which can interact with and potentially neutralise virus. Further, this example provides support for an immunoassay for the detection of papilloma virus L1 protein demonstrated by the coating of various proteins in wells and the use of antibody raised against recombinant HPV6 L1 HEXAHIS protein. Wells containing either HPV6b derived antigen gave a positive result. This example also provides support for an immunoassay for the detection of antibody specific for papilloma virus L1 protein demonstrated by the coating of the wells with recombinant HPV6b L1 HEXAHIS protein and the use of sera raised against influenza virus A/PR-8 and sera raised against HPV6 L1 HEXAHIS protein. In this case, wells containing sera raised against HPV6 L1 HEXAHIS protein gave a positive result whilst that raised againt influenza virus was negative.

EXAMPLE 5

ELISA capture assay demonstrating the formation of multimeric structure-antibody complex

Western blot and ELISA experiments were conducted as previously described or following standard procedures. An ELISA capture assay was conducted by the following method:

(1) a monoclonal antibody (moAb 8) specific for VLPs was used to coat the wells of a microtitre plate; (2) HPV VLP L1 protein was added and incubated under suitable conditions and washed with PBS containing 0.1% Tween 20 at pH 7.4; (3) antibodies raised against various immunogens (shown in column 2 of Table 5) in various animals (shown in column 1 of Table 5) was added; and (4) suitable detection agents (in the case of rabbit antisera, goat-anti-rabbit peroxidase conjugate was used) were added to detect multimeric structure/VLP-antibody complex. Results

The amount of captured recombinant papilloma virus HEXAHIS per well is given in Table 5. These experiments demonstrate that the antisera raised against recombinant papilloma virus L1 HEXAHIS proteins elicit an immune response which recognises papilloma virus VLP including L1 protein.

The ability of a papilloma virus L1 protein to elicit an immune response which recognises papilloma virus VLP including L1 protein requires correct presentation of appropriate epitopes. Recombinant papilloma virus L1 proteins that do not form VLP do not induce an immune response which recognises papilloma virus VLPs including L1 protein. Recombinant GST papilloma virus L1 protein, recombinant MS2 papilloma virus L1 protein and denatured papilloma virus L1 protein do not elicit an immune response which recognises papilloma virus VLP including L1 protein. All VLPs to date have been produced intracellularly with the expression of papilloma virus L1 or L1 and L2 genes. The recombinant papilloma virus L1 protein of the present invention correctly presents one or more epitopes to elicit an immune response which recognises papilloma virus VLP including L1 protein. The recombinant papilloma virus L1 protein of the present invention can form the multimeric structures or VLPs extracellularly. It is believed that the multimeric structures of VLPs formed from the recombinant papilloma virus L1 protein correctly presents one or more epitopes to elicit an immune response which recognises papilloma virus VLPs including L1 protein. Therefore, the invention provides a recombinant papilloma virus L1 protein which can form extracellularly a multimeric structure or VLP which can elicit an immune response which recognises papilloma virus VLP including L1 protein wherein said multimeric structure comprises a plurality of recombinant papilloma virus L1 proteins.

The fact that the multimeric structures or VLPs can be formed extracellularly overcomes a number of problems associated with intracellular VLP formation. These problems include low VLP levels, the possibility of incorporating DNA in the VLP and the possible loss of integrity of the VLP with purification.

TABLE 1______________________________________Procedure for washing the Nickel column with NB bufferTime (Minutes) % NB Buffer______________________________________0 030 0300 100310 100320 100330 100______________________________________ TABLE 2______________________________________Experimental protocol for injecting mice with 6b L1 HEXAHISprotein to produce antibodies Addition ofMice 6b L1 HEXAHISGroup.sup.a protein.sup.b Other conditions______________________________________A + No adjuvant.sub. A.sub.1 - No adjuvantB + boiled in 1% SDS and cooled.sub. B.sub.1 - boiled in 1% SDS and cooledC + with Freund's complete adjuvant.sub. C.sub.1 - with Freund's complete adjuvantD + absorbed to Aluminium hydroxide.sub. D.sub.1 - absorbed to Aluminium hydroxideE + with Algammulin.sub. E.sub.1 - with AlgammulinF + with L2 (50 .mu.g) and no adjuvant______________________________________ TABLE 3__________________________________________________________________________Experimental protocol for producing delayed type hypersensitivity to 6bL1 HEXAHIS protein in miceMice Antigen Antigen Mean EarGroup.sup.a Antigen.sup.a Adjuvant.sup.c dose Challenge.sup.b,d Pertussigen dose *Swelling Day 14.sup.f__________________________________________________________________________1 L1 PBS 50 .mu.g L1 + 4 4.52 L1 PBS 50 .mu.g L1 + 13.8 83 L1 PBS 50 .mu.g L1 - 3.8 1.54 L1 PBS 50 .mu.g L1 - 2.4 3.85 L1 PBS 50 .mu.g IRR +6 Saline PBS L1 + 4.7 1.37 Saline PBS L1 - 2.3 18 L1 CFA (0.1 ml) 50 .mu.g L1 + 19.3 16.89 Saline CFA (0.1 ml) L1 + 4.8 210 L1 Quil A (pg) 50 .mu.g L1 + 15.7 8.711 L1 Quil A (pg) 50 .mu.g L1 - 7.2 0.212 L1 Quil A (pg) 50 .mu.g IRR +13 Saline Quil A (pg) 50 .mu.g L1 +__________________________________________________________________________ TABLE 4______________________________________Results of ELISA using rabbit HPV6b L1 HEXAHIS antisera ELISA USING RABBIT HPV6b L1ANTIGEN HEXAHIS ANTISERA______________________________________HPV6 VLP-L1 >4.0 exceeds limits @ 1:4000HPV6b L1 HEXAHIS 2.12 .+-. 0.1 @ 1:4000baculovirus control preparation 0.63 .+-. 0.01 @ 1:4000E. coli control preparation 0.12 .+-. 0.00 @ 1:4000______________________________________ TABLE 5__________________________________________________________________________Results of experiments conducted in Example 5 IMMUNOREACTIVITY IMMUNOREACTIVITY WITH L1 PROTEIN WITH L1 ON CELLSANIMAL Western ELISA Capture L1 as L1 asNO. IMMUNOGEN ADJUVANT Blot (VLPs) ELISA VLP HEXAHIS__________________________________________________________________________Rabbit HEXAHIS L1 CFA +++ 1.712 0.538 +++ +++31 @ @ 1:100 1:100Rabbit HEXAHIS L1 Nil ++ 0.095 0.050 +++ ?39 @ @ 1:100 1:100Rabbit VLPs Nil +++ 0.972 0.487 ? ?10 (baculovirus @ @ derived) 1:100 1:100Mouse HEXAHIS L1 Nil ++ ? ND ? ?Mouse HEXAHIS L1 CFA ++++ 0.400 ND ? ? @ 1:100MoAb 8 GST L1 fusion CFA/IFA ++++ ++++ ND +++ ? protein__________________________________________________________________________

LEGENDS

TABLE 2 .sup.a each group of mice contains four mice .sup.b 6b L1 HEXAHIS protein was administered at 50 .mu.g protein per mouse TABLE 3 .sup.a Groups consist of 4 to 6 Balb/C mice (68-102) .sup.b L1 denotes 6b L1 HEXAHIS protein and IRR denotes irrelevant HEXAHIS protein .sup.c PBS is phosphate buffered saline and CFA is complete Freund's adjuvant .sup.d 6b L1 HEXAHIS protein was administered at 10 .mu.g in a maximum volume of 2 .mu.l .sup.e 30 .mu.g of pertussigen was added .sup.f Ear measurements (.mu.m.times.10) TABLE 5 ND: technically cannot be determined FIGS. 1(a)-1(c) DNA nucleotide sequence and amino acid sequence of HPV6b L1 HEXAHIS protein (SEQ ID NO:5 and 6) FIG. 2 Electron macrograph of pentameric structures of HPV6b L1 HEXAHIS protein aggregates __________________________________________________________________________# SEQUENCE LISTING- (1) GENERAL INFORMATION:- (iii) NUMBER OF SEQUENCES: 6- (2) INFORMATION FOR SEQ ID NO:1:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 32 amino (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:- Met Arg Gly Ser His His His His His His Gl - #y Met Ala Ser Met Thr# 15- Gly Gly Gln Gln Met Gly Arg Asp Leu Tyr As - #p Asp Asp Asp Lys Asp# 30- (2) INFORMATION FOR SEQ ID NO:2:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 96 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:- ATGCGGGGTT CTCATCATCA TCATCATCAT GGTATGGCTA GCATGACTGG TG - #GACAGCAA 60# 96 ACGA CGATGACGAT AAGGAT- (2) INFORMATION FOR SEQ ID NO:3:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 41 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:# 41 CGGC CTAGCGACAG CACAGTATAT G- (2) INFORMATION FOR SEQ ID NO:4:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 43 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:# 43 TAGT TTTGGCCTCG CTTACGTTTT AGG- (2) INFORMATION FOR SEQ ID NO:5:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 1599 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 1..1596- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:- ATG CGG GGT TCT CAT CAT CAT CAT CAT CAT GG - #T ATG GCT AGC ATG ACT 48Met Arg Gly Ser His His His His His His Gl - #y Met Ala Ser Met Thr# 15- GGT GGA CAG CAA ATG GGT CGG GAT CTG TAC GA - #C GAT GAC GAT AAG GAT 96Gly Gly Gln Gln Met Gly Arg Asp Leu Tyr As - #p Asp Asp Asp Lys Asp# 30- ATG TGG CGG CCT AGC GAC AGC ACA GTA TAT GT - #G CCT CCT CCT AAC CCT 144Met Trp Arg Pro Ser Asp Ser Thr Val Tyr Va - #l Pro Pro Pro Asn Pro# 45- GTA TCC AAA GTT GTT GCC ACG GAT GCT TAT GT - #T ACT CGC ACC AAC ATA 192Val Ser Lys Val Val Ala Thr Asp Ala Tyr Va - #l Thr Arg Thr Asn Ile# 60- TTT TAT CAT GCC AGC AGT TCT AGA CTT CTT GC - #A GTG GGA CAT CCT TAT 240Phe Tyr His Ala Ser Ser Ser Arg Leu Leu Al - #a Val Gly His Pro Tyr# 80- TTT TCC ATA AAA CGG GCT AAC AAA ACT GTT GT - #G CCA AAG GTG TCA GGA 288Phe Ser Ile Lys Arg Ala Asn Lys Thr Val Va - #l Pro Lys Val Ser Gly# 95- TAT CAA TAC AGG GTA TTT AAG GTG GTG TTA CC - #A GAT CCT AAC AAA TTT 336Tyr Gln Tyr Arg Val Phe Lys Val Val Leu Pr - #o Asp Pro Asn Lys Phe# 110- GCA TTG CCT GAC TCG TCT CTT TTC GAT CCC AC - #A ACA CAA CGT TTA GTA 384Ala Leu Pro Asp Ser Ser Leu Phe Asp Pro Th - #r Thr Gln Arg Leu Val# 125- TGG GCA TGC ACA GGC CTA GAG GTG GGC AGG GG - #A CAG CCA TTA GGT GTG 432Trp Ala Cys Thr Gly Leu Glu Val Gly Arg Gl - #y Gln Pro Leu Gly Val# 140- GGT GTA AGT GGA CAT CCT TTC CTA AAT AAA TA - #T GAT GAT GTT GAA AAT 480Gly Val Ser Gly His Pro Phe Leu Asn Lys Ty - #r Asp Asp Val Glu Asn145 1 - #50 1 - #55 1 -#60- TCA GGG AGT GGT GGT AAC CCT GGA CAG GAT AA - #C AGG GTT AAT GTA GGT 528Ser Gly Ser Gly Gly Asn Pro Gly Gln Asp As - #n Arg Val Asn Val Gly# 175- ATG GAT TAT AAA CAA ACA CAA TTA TGC ATG GT - #T GGA TGT GCC CCC CCT 576Met Asp Tyr Lys Gln Thr Gln Leu Cys Met Va - #l Gly Cys Ala Pro Pro# 190- TTG GGC GAG CAT TGG GGT AAA GGT AAA CAG TG - #T ACT AAT ACA CCT GTA 624Leu Gly Glu His Trp Gly Lys Gly Lys Gln Cy - #s Thr Asn Thr Pro Val# 205- CAG GCT GGT GAC TGC CCG CCC TTA GAA CTT AT - #T ACC AGT GTT ATA CAG 672Gln Ala Gly Asp Cys Pro Pro Leu Glu Leu Il - #e Thr Ser Val Ile Gln# 220- GAT GGC GAT ATG GTT GAC ACA GGC TTT GGT GC - #T ATG AAT TTT GCT GAT 720Asp Gly Asp Met Val Asp Thr Gly Phe Gly Al - #a Met Asn Phe Ala Asp225 2 - #30 2 - #35 2 -#40- TTG CAG ACC AAT AAA TCA GAT GTT CCT ATT GA - #C ATA TGT GGC ACT ACA 768Leu Gln Thr Asn Lys Ser Asp Val Pro Ile As - #p Ile Cys Gly Thr Thr# 255- TGT AAA TAT CCA GAT TAT TTA CAA ATG GCT GC - #A GAC CCA TAT GGT GAT 816Cys Lys Tyr Pro Asp Tyr Leu Gln Met Ala Al - #a Asp Pro Tyr Gly Asp# 270- AGA TTA TTT TTT TTT CTA CGG AAG GAA CAA AT - #G TTT GCC AGA CAT TTT 864Arg Leu Phe Phe Phe Leu Arg Lys Glu Gln Me - #t Phe Ala Arg His Phe# 285- TTT AAC AGG GCT GGC GAG GTG GGG GAA CCT GT - #G CCT GAT ACA CTT ATA 912Phe Asn Arg Ala Gly Glu Val Gly Glu Pro Va - #l Pro Asp Thr Leu Ile# 300- ATT AAG GGT AGT GGA AAT CGC ACG TCT GTA GG - #G AGT AGT ATA TAT GTT 960Ile Lys Gly Ser Gly Asn Arg Thr Ser Val Gl - #y Ser Ser Ile Tyr Val305 3 - #10 3 - #15 3 -#20- AAC ACC CCG AGC GGC TCT TTG GTG TCC TCT GA - #G GCA CAA TTG TTT AAT1008Asn Thr Pro Ser Gly Ser Leu Val Ser Ser Gl - #u Ala Gln Leu Phe Asn# 335- AAG CCA TAT TGG CTA CAA AAA GCC CAG GGA CA - #T AAC AAT GGT ATT TGT1056Lys Pro Tyr Trp Leu Gln Lys Ala Gln Gly Hi - #s Asn Asn Gly Ile Cys# 350- TGG GGT AAT CAA CTG TTT GTT ACT GTG GTA GA - #T ACC ACA CGC AGT ACC1104Trp Gly Asn Gln Leu Phe Val Thr Val Val As - #p Thr Thr Arg Ser Thr# 365- AAC ATG ACA TTA TGT GCA TCC GTA ACT ACA TC - #T TCC ACA TAC ACC AAT1152Asn Met Thr Leu Cys Ala Ser Val Thr Thr Se - #r Ser Thr Tyr Thr Asn# 380- TCT GAT TAT AAA GAG TAC ATG CGT CAT GTG GA - #A GAG TAT GAT TTA CAA1200Ser Asp Tyr Lys Glu Tyr Met Arg His Val Gl - #u Glu Tyr Asp Leu Gln385 3 - #90 3 - #95 4 -#00- TTT ATT TTT CAA TTA TGT AGC ATT ACA TTG TC - #T GCT GAA GTA ATG GCC1248Phe Ile Phe Gln Leu Cys Ser Ile Thr Leu Se - #r Ala Glu Val Met Ala# 415- TAT ATT CAC ACA ATG AAT CCC TCT GTT TTG GA - #A GAC TGG AAC TTT GGG1296Tyr Ile His Thr Met Asn Pro Ser Val Leu Gl - #u Asp Trp Asn Phe Gly# 430- TTA TCG CCT CCC CCA AAT GGT ACA TTA GAA GA - #T ACC TAT AGG TAT GTG1344Leu Ser Pro Pro Pro Asn Gly Thr Leu Glu As - #p Thr Tyr Arg Tyr Val# 445- CAG TCA CAG GCC ATT ACC TGT CAA AAG CCC AC - #T CCT GAA AAG GAA AAG1392Gln Ser Gln Ala Ile Thr Cys Gln Lys Pro Th - #r Pro Glu Lys Glu Lys# 460- CCA GAT CCC TAT AAG AAC CTT AGT TTT TGG GA - #G GTT AAT TTA AAA GAA1440Pro Asp Pro Tyr Lys Asn Leu Ser Phe Trp Gl - #u Val Asn Leu Lys Glu465 4 - #70 4 - #75 4 -#80- AAG TTT TCT AGT GAA TTG GAT CAG TAT CCT TT - #G GGA CGC AAG TTT TTG1488Lys Phe Ser Ser Glu Leu Asp Gln Tyr Pro Le - #u Gly Arg Lys Phe Leu# 495- TTA CAA AGT GGA TAT AGG GGA CGG TCC TCT AT - #T CGT ACA GGT GTT AAG1536Leu Gln Ser Gly Tyr Arg Gly Arg Ser Ser Il - #e Arg Thr Gly Val Lys# 510- CGC CCT GCT GTT TCC AAA GCC TCT GCT GCC CC - #T AAA CGT AAG CGC GCC1584Arg Pro Ala Val Ser Lys Ala Ser Ala Ala Pr - #o Lys Arg Lys Arg Ala# 525# 1599 AALys Thr Lys Arg 530- (2) INFORMATION FOR SEQ ID NO:6:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 532 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:- Met Arg Gly Ser His His His His His His Gl - #y Met Ala Ser Met Thr# 15- Gly Gly Gln Gln Met Gly Arg Asp Leu Tyr As - #p Asp Asp Asp Lys Asp# 30- Met Trp Arg Pro Ser Asp Ser Thr Val Tyr Va - #l Pro Pro Pro Asn Pro# 45- Val Ser Lys Val Val Ala Thr Asp Ala Tyr Va - #l Thr Arg Thr Asn Ile# 60- Phe Tyr His Ala Ser Ser Ser Arg Leu Leu Al - #a Val Gly His Pro Tyr# 80- Phe Ser Ile Lys Arg Ala Asn Lys Thr Val Va - #l Pro Lys Val Ser Gly# 95- Tyr Gln Tyr Arg Val Phe Lys Val Val Leu Pr - #o Asp Pro Asn Lys Phe# 110- Ala Leu Pro Asp Ser Ser Leu Phe Asp Pro Th - #r Thr Gln Arg Leu Val# 125- Trp Ala Cys Thr Gly Leu Glu Val Gly Arg Gl - #y Gln Pro Leu Gly Val# 140- Gly Val Ser Gly His Pro Phe Leu Asn Lys Ty - #r Asp Asp Val Glu Asn145 1 - #50 1 - #55 1 -#60- Ser Gly Ser Gly Gly Asn Pro Gly Gln Asp As - #n Arg Val Asn Val Gly# 175- Met Asp Tyr Lys Gln Thr Gln Leu Cys Met Va - #l Gly Cys Ala Pro Pro# 190- Leu Gly Glu His Trp Gly Lys Gly Lys Gln Cy - #s Thr Asn Thr Pro Val# 205- Gln Ala Gly Asp Cys Pro Pro Leu Glu Leu Il - #e Thr Ser Val Ile Gln# 220- Asp Gly Asp Met Val Asp Thr Gly Phe Gly Al - #a Met Asn Phe Ala Asp225 2 - #30 2 - #35 2 -#40- Leu Gln Thr Asn Lys Ser Asp Val Pro Ile As - #p Ile Cys Gly Thr Thr# 255- Cys Lys Tyr Pro Asp Tyr Leu Gln Met Ala Al - #a Asp Pro Tyr Gly Asp# 270- Arg Leu Phe Phe Phe Leu Arg Lys Glu Gln Me - #t Phe Ala Arg His Phe# 285- Phe Asn Arg Ala Gly Glu Val Gly Glu Pro Va - #l Pro Asp Thr Leu Ile# 300- Ile Lys Gly Ser Gly Asn Arg Thr Ser Val Gl - #y Ser Ser Ile Tyr Val305 3 - #10 3 - #15 3 -#20- Asn Thr Pro Ser Gly Ser Leu Val Ser Ser Gl - #u Ala Gln Leu Phe Asn# 335- Lys Pro Tyr Trp Leu Gln Lys Ala Gln Gly Hi - #s Asn Asn Gly Ile Cys# 350- Trp Gly Asn Gln Leu Phe Val Thr Val Val As - #p Thr Thr Arg Ser Thr# 365- Asn Met Thr Leu Cys Ala Ser Val Thr Thr Se - #r Ser Thr Tyr Thr Asn# 380- Ser Asp Tyr Lys Glu Tyr Met Arg His Val Gl - #u Glu Tyr Asp Leu Gln385 3 - #90 3 - #95 4 -#00- Phe Ile Phe Gln Leu Cys Ser Ile Thr Leu Se - #r Ala Glu Val Met Ala# 415- Tyr Ile His Thr Met Asn Pro Ser Val Leu Gl - #u Asp Trp Asn Phe Gly# 430- Leu Ser Pro Pro Pro Asn Gly Thr Leu Glu As - #p Thr Tyr Arg Tyr Val# 445- Gln Ser Gln Ala Ile Thr Cys Gln Lys Pro Th - #r Pro Glu Lys Glu Lys# 460- Pro Asp Pro Tyr Lys Asn Leu Ser Phe Trp Gl - #u Val Asn Leu Lys Glu465 4 - #70 4 - #75 4 -#80- Lys Phe Ser Ser Glu Leu Asp Gln Tyr Pro Le - #u Gly Arg Lys Phe Leu# 495- Leu Gln Ser Gly Tyr Arg Gly Arg Ser Ser Il - #e Arg Thr Gly Val Lys# 510- Arg Pro Ala Val Ser Lys Ala Ser Ala Ala Pr - #o Lys Arg Lys Arg Ala# 525- Lys Thr Lys Arg 530__________________________________________________________________________

Claims

1. A recombinant papilloma virus L1 protein which has an amino acid sequence shown in FIGS. 1(a)-1(c) (SEQ ID NO:6).

2. A multimeric structure comprising a plurality of recombinant papilloma virus L1 proteins, wherein each of said recombinant papilloma virus L1 proteins is a recombinant papilloma virus L1 protein as claimed in claim 1.

3. A multimeric structure as claimed in claim 2, which is able to induce an immune response that recognizes papilloma virus VLP.

4. A multimeric structure as claimed in claim 2, wherein the multimeric structure is a pentamer.

5. A method for preparing a multimeric structure, comprising:

(i) expressing in a bacterium a recombinant DNA molecule which encodes a recombinant papilloma virus L1 protein according to claim 1;

(ii) substantially purifying said recombinant papilloma virus L1 protein; and

(iii) forming said multimeric structure extracellularly from a plurality of molecules of said papilloma virus L1 protein.

6. A method as claimed in claim 5, wherein the nucleotide sequence encoding said papilloma L1 virus protein is inserted into pTrcHiSB in a correct reading frame with respect to expression of the papilloma virus L1 protein; and wherein said papilloma virus L1 protein is produced by a strain of E. coli.

7. A recombinant papilloma virus L1 protein which has an N terminal amino acid sequence including:

MetArgGlySerHisHisHisHisHisHisGlyMetAlaSerMetThrGlyGlyGlnMetGlyArgAspLeuTyrAspAspAspAspLysAsp (SEQ ID NO:1).

8. A multimeric structure comprising a plurality of recombinant papilloma virus L1 proteins, wherein each of said recombinant papilloma virus L1 proteins is a recombinant papilloma virus L1 protein as claimed in claim 7.

9. A multimeric structure as claimed in claim 8, which is able to induce an immune response that recognizes papilloma virus VLP.

10. A multimeric structure as claimed in claim 8, wherein the multimeric structure is a pentamer.

11. A method for preparing a multimeric structure, comprising:

(i) expressing in a bacterium a recombinant DNA molecule which encodes a recombinant papilloma virus L1 protein according to claim 7;

(ii) substantially purifying said recombinant papilloma virus L1 protein; and

(iii) forming said multimeric structure extracellularly from a plurality of molecules of said papilloma virus L1 protein.

12. A method as claimed in claim 11, wherein the nucleotide sequence encoding said papilloma virus L1 protein is inserted into pTrcHisB in a correct reading frame with respect to expression of the papilloma virus L1 protein; and wherein said papilloma virus L1 protein is produced by a strain of E. coli.

13. A multimeric structure comprising a plurality of recombinant papilloma virus L1 proteins, wherein each of said recombinant papilloma virus L1 proteins has an N terminal amino acid sequence including (His).sub.6.

14. A multimeric structure as claimed in claim 13 which is able to induce an immune response that recognises papilloma virus VLP.

15. A multimeric structure as claimed in claim 13 wherein the multimeric structure is a pentamer.

16. The multimeric structure of claim 13, wherein said recombinant papilloma virus L1 proteins are bacterially-expressed.

17. A recombinant DNA molecule having a nucleotide sequence selected from any one of the following:

(a) A nucleotide sequence encoding a recombinant papilloma virus L1 protein and having a 5' nucleotide sequence including:

ATGCGGGGTTCTCATCATCATCATCATCATGGTATGGCTAGCATGACTGGTGGACAGCAAATGGGTCGGGATCTGTACGACGATGACGATAAGGAT (SEQ ID NO:2);

(b) A nucleotide sequence that is complementary to the sequence in (a); and

(c) A nucleotide sequence that is a synonymous sequence to the sequence in (a).

18. A method for preparing a multimeric structure, comprising:

(i) expressing in a bacterium a recombinant DNA molecule which encodes a recombinant papilloma virus L1 protein comprising an N terminal amino acid sequence including (His).sub.6 ;

(ii) substantially purifying said recombinant papilloma virus L1 protein; and

(iii) forming said multimeric structure extracellularly from a plurality of molecules of said papilloma virus L1 protein,

wherein said recombinant DNA molecule is the recombinant DNA molecule as claimed in claim 17.

19. A method for preparing a multimeric structure, comprising:

(i) expressing in a bacterium a recombinant DNA molecule which encodes a recombinant papilloma virus L1 protein comprising an N terminal amino acid sequence including:

MetArgGlySerHisHisHisHisHisHisGlyMetAlaSerMetThrGlyGlyGlnMetGlyArgAspLeuTyrAspAspAspAspLysAsp (SEQ ID NO:1);

(ii) substantially purifying said recombinant papilloma virus L1 protein; and

(iii) forming said multimeric structure extracellularly from a plurality of molecules of said papilloma virus L1 protein

wherein said recombinant DNA molecule is the recombinant DNA molecule as claimed in claim 17.

20. A method for preparing a multimeric structure, comprising:

(i) expressing in a bacterium a recombinant DNA molecule which encodes a recombinant papilloma virus L1 protein comprising an amino acid sequence as shown in FIGS. 1(a)-1(c) (SEQ ID NO:6);

(ii) substantially purifying said recombinant papilloma virus L1 protein; and

(iii) forming said multimeric structure extracellularly from a plurality of molecules of said papilloma virus L1 protein,

wherein said recombinant DNA molecule is the recombinant DNA molecule as claimed in claim 17.

21. A recombinant DNA molecule encoding a recombinant papilloma virus L1 protein and having a 5' nucleotide sequence which includes six repeats of the trinucleotide sequence CAT wherein the recombinant DNA molecule has a nucleotide sequence as shown in FIGS. 1(a)-1(c) (SEQ ID NO:5).

22. A method for preparing a multimeric structure, comprising:

(i) expressing in a bacterium a recombinant DNA molecule which encodes a recombinant papilloma virus L1 protein comprising an N terminal amino acid sequence including (His).sub.6 ;

(ii) substantially purifying said recombinant papilloma virus L1 protein; and

(iii) forming said multimeric structure extracellularly from a plurality of molecules of said papilloma virus L1 protein,

wherein said recombinant DNA molecule is the recombinant DNA molecule as claimed in claim 21.

23. A method for preparing a multimeric structure, comprising:

(i) expressing in a bacterium a recombinant DNA molecule which encodes a recombinant papilloma virus L1 protein comprising an N terminal amino acid sequence including:

MetArgGlySerHisHisHisHisHisHisGlyMetAlaSerMetThrGlyGlyGlnMetGlyArgAspLeuTyrAspAspAspAspLysAsp (SEQ ID NO:1);

(ii) substantially purifying said recombinant papilloma virus L1 protein; and

(iii) forming said multimeric structure extracellularly from a plurality of molecules of said papilloma virus L1 protein

wherein said recombinant DNA molecule is the recombinant DNA molecule as claimed in claim 21.

24. A method for preparing a multimeric structure, comprising:

(i) expressing in a bacterium a recombinant DNA molecule which encodes a recombinant papilloma virus L1 protein comprising an amino acid sequence as shown in FIGS. 1(a)-1(c) (SEQ ID NO:6);

(ii) substantially purifying said recombinant papilloma virus L1 protein; and

(iii) forming said multimeric structure extracellularly from a plurality of molecules of said papilloma virus L1 protein,

wherein said recombinant DNA molecule is the recombinant DNA molecule as claimed in claim 21.

25. A method for preparing a multimeric structure, comprising:

(i) expressing in a bacterium a recombinant DNA molecule which encodes a recombinant papilloma virus L1 protein which has an N terminal amino acid sequence including (His).sub.6 ;

(ii) substantially purifying said recombinant papilloma virus L1 protein; and

(iii) forming said multimeric structure extracellularly from a plurality of molecules of said papilloma virus L1 protein.

26. The method of claim 25, wherein said DNA molecule comprises a 5' nucleotide sequence having six repeats of the trinucleotide sequence CAT.

27. The method of claim 26, wherein said N terminal amino acid sequence encoding by said DNA comprises:

MetArgGlySerHisHisHisHisHisHisGlyMetAlaSerMetThrGlyGlyGlnMetGlyArgAspLeuTyrAspAspAspAspLysAsp (SEQ ID NO:1).

28. The method of claim 26, wherein said N terminal amino acid sequence encoded by said DNA comprises an amino acid sequence as shown in FIGS. 1(a)-1(c) (SEQ ID NO:6).

29. A method as claimed in claim 25, wherein the nucleotide sequence encoding said papilloma virus L1 protein is inserted into pTrcHisB in a correct reading frame with respect to expression of the papilloma virus L1 protein; and wherein said papilloma virus L1 protein is produced by a strain of E. coli.

30. A vaccine, comprising one or more multimeric structures as claimed in any one of claims 13, 14 or 15, together with a pharmaceutically acceptable vaccine adjuvant.

31. A vaccine comprising one or more multimeric structures as claimed in any one of claims 8, 9 or 10, together with a pharmaceutically acceptable vaccine adjuvant.

32. A vaccine comprising one or more multimeric structures as claimed in any one of claims 2, 3 or 4, together with a pharmaceutically acceptable vaccine adjuvant.