Seven transmembrane receptors

Abstract

DNA sequences encoding seven novel seven transmembrane receptors and variants thereof are disclosed as well as materials and methods for production of the same by recombinant techniques. Antibody substances specific for each of the seven transmembrane receptors are disclosed as useful for the modulation of the ligand/receptor binding reactions of the receptors.

Description

FIELD OF THE INVENTION

The present invention relates generally to a family of cellular receptors involved in signal transduction, the seven transmembrane receptors, and more particularly to the cloning and expression of DNA sequences encoding seven novel seven transmembrane receptors.

BACKGROUND

The seven transmembrane receptors (also known as heptahelical, serpentine, or G protein-coupled receptors) comprise a superfamily of structurally related molecules. Possible relationships among seven transmembrane receptors (7TM receptors) for which amino acid sequence had previously been reported are reviewed in Probst et al., DNA and Cell Biology, 11(1): 1-20 (1992). Briefly, the 7TM receptors exhibit detectable amino acid sequence similarity and all appear to share a number of structural characteristics including: an extracellular amino terminus; seven predominantly hydrophobic a-helical domains (of about 20-30 amino acids) which are believed to span the cell membrane and are referred to as transmembrane domains 1-7; approximately twenty well-conserved amino acids; and a cytoplasmic carboxy terminus. The amino acid similarity among different 7TM receptors ranges from about 10% to more than 80% and receptors which recognize similar or identical ligands generally exhibit high levels of homology. The 7TM receptors can be grouped based on their homology levels and/or the ligands they recognize. For example, the interleukin-8 receptor, the angiotensin II receptor, the thrombin receptor, the endothelin receptors, the N-formyl peptide receptor and the C5a receptor all bind peptide ligands and share 20-40% amino acid similarity.

7TM receptors recognize a great diversity of ligands (for example, light, odorants, neurotransmitters, peptide hormones and small molecules) and transduce their signals via heterotrimeric guanine nucleotide-binding proteins (G-proteins) effecting a broad array of biological activities (including visual excitation, olfactory reception, and neurotransmission) through various intracellular enzymes, ion channels and transporters. Signal transduction pathways have been elucidated for rhodopsin [Khorana, J. Biol. Chem., 267: 1-4 (1992) and Stryer, J. Biol. Chem., 266: 10711-10714 (1991)] and the beta-adrenergic receptors [Dohlman et al., Ann.-Rev. Biochem., 60. 653-688 (1991)] and are thought to illustrate the pathways utilized by other 7TM receptors. Each 7TM receptor is predicted to associate with a particular G protein at the intracellular surface of the plasma membrane. The binding of the receptor to its ligand is thought to result in activation (i.e., the exchange of GTP for GDP on the .alpha.-subunit) of the G protein which in turn stimulates specific intracellular signal-transducing enzymes and channels. Thus, the function of each 7TM receptor is to discriminate its specific ligand from the complex extracellular milieu and then to activate G proteins to produce a specific intracellular signal. Cotecchia et al., Proc. Natl. Acad. Sci. USA, 87: 2896-2900 (1990) reports that the intracellular loop of the third transmembrane domain of the 7TM receptors comprises important determinants for receptor coupling to specific G proteins, however, Lefkowitz, Nature, 265: 603-604 (1993) summarizes reports that other regions of 7TM receptors may also be essential in maintaining 7TM receptors in a constrained, inactive conformation until ligand binding occurs.

Recently, several 7TM receptors have been identified which recognize ligands important for immunological and hemostatic activities. Holmes et al., Science, 253: 1278-1280 (1991) describes the interleukin 8 receptor (IL8R1) as involved in neutrophil chemotaxis and Sasaki et al., Nature, 351: 230-233 (1991) reports the angiotensin II receptor (AT2R) is involved in vascular hemostasis. Similarly, the endothelin receptors [Arai et al., Nature, 348: 730-732 (1990)] regulate vasoconstriction and smooth muscle tone. The C5a receptor mediates chemotaxis, granule enzyme release and superoxide generation in vitro and appears to be involved in anaphylaxis and septic shock in vivo [Gerard and Gerard, Nature, 349: 614-617 (1991)]. Thrombin is also recognized by a 7TM receptor and is a potent activator of platelet aggregation, monocyte chemotaxis, lymphocyte mitogenesis and mediates inflammatory responses to vascular injury. The N-formyl peptide (f-met-leu-phe) receptor is responsible for neutrophil chemotaxis and activation [Thomas et al., J. Biol. Chem., 265: 20061 (1990)]. While these 7TM receptors all have peptide ligands, other 7TM receptors that recognize small organic compounds also mediate proinflammatory activities. For example, the Platelet Activating Factor receptor recognizes a bioactive phospholipid [Honda et al., Nature, 349: 342-346 (1991)] which causes platelet aggregation and endotoxic shock. The thromboxane A.sub.2 receptor recognizes an arachidonate metabolite which also stimulates vasoconstriction and platelet aggregation and is implicated in stroke and bronchial asthma [Hirata et al., Nature, 349: 617-620 (1991)].

Mutations in the third intracellular loop of one 7TM receptor (the thyrotropin receptor) and in the adjacent sixth transmembrane domain of another 7TM receptor (the luteinizing hormone receptor) have been reported to be the genetic defects responsible for an uncommon form of hyperthyroidism [Parma et al., Nature, 365: 649-651 (1993)] and for familial precocious puberty [Shenker et al. Nature, 365: 652-654 (1993)], respectively. In both cases the mutations result in constitutive activation of the 7TM receptors. Previously, other studies have shown that mutations that prevent the activation of 7TM receptors are responsible for states of hormone resistance which are responsible for diseases such as congenital nephrogenic diabetes insipidus. See Rosenthal et al., J. Biol. Chem., 268: 13030-13033 (1993). Still other studies have shown that several 7TM receptors can function as protooncogenes and be activated by mutational alteration. See, for example, Allen et al., Proc. Natl. Acad. Sci. USA, 88: 11354-11358 (1991) which suggests that spontaneously occuring mutations in some 7TM receptors may alter the normal function of the receptors and result in uncontrolled cell growth associated with human disease states such as neoplasia and atherosclerosis. Therefore, mutations in 7TM receptors may underlie a number of human pathologies.

Because a variety of therapeutic uses may be projected for 7TM receptors involved in immunological processes in both health and disease states and because it is generally believed that numerous proteins are involved in immunological processes, there continues to exist a need in the art for the identification of additional 7TM receptors that participate in such processes and especially a need for information specifically identifying and characterizing such proteins in terms of their amino acid sequence. Isolation of DNA encoding a novel 7TM receptor also provides the basis for determination of the role of receptor in health and disease states. To the extent that such receptors might form the basis for the development of therapeutic and/or diagnostic agents, it is essential that the DNA encoding them be isolated. The isolated DNA would, for example, provide for the large scale production of the 7TM proteins, allow for the identification of cells naturally producing them, and permit the preparation/identification of antibody substances and/or other novel binding substances (including natural ligands, agonists and antagonists) which are specifically reactive with a particular 7TM receptor (or group of receptors) and which have the capacity to modulate the biological activities of the receptor(s).

SUMMARY OF THE INVENTION

The present invention provides purified and isolated polynucleotides (i.e., DNA sequences and RNA transcripts thereof) encoding seven novel 7TM receptors designated V28, V31, V112, R20, R2, R12, and RM3 as well as polypeptide variants (including fragments and analogs) thereof which possess at least one ligand/receptor binding activity or immunological property specific to one of the seven 7TM receptors. Fragments of a 7TM receptor of the invention which correspond to the N-terminal extracellular domain; the transmembrane domains; the individual extracellular and intracellular loops connecting the transmembrane domains; the C-terminal cytoplasmic domain and fusions thereof are specifically contemplated. Preferred DNA sequences of the invention include genomic and cDNA sequences as well as wholly or partially chemically synthesized DNA sequences.

Specifically illustrating polynucleotide sequences of the present invention are the DNA inserts encoding the V28, V31, V112, R2, R12 and R20 7TM receptors in plasmids which were deposited with the American Type Culture Collection (ATCC), 12301 Parklawn Drive, Rockville, Md. 20852, on Oct. 12, 1992 and were respectively assigned ATCC Accession Nos. 75330, 75327, 75326, 75329, 75331 and 75328. Also illustrating polynucleotide sequences of the invention is the DNA insert encoding the RM3 7TM receptor in a plasmid which was deposited with the ATCC on Nov. 2, 1992 and was assigned ATCC Accession No. 75340.

According to another aspect of the invention, biologically active plasmid and viral DNA vectors incorporating DNA sequences of the invention are provided as well as vectors wherein the DNA encoding a 7TM receptor or 7TM receptor variant is operatively linked to an endogenous or heterologous expression control sequence. Also provided by the invention are procaryotic or eucaryotic host cells stably transformed or transfected with a DNA sequence of the invention so that the 7TM receptor polypeptide or variant polypeptide encoded by the DNA sequence is expressed in the host cell. Host cells expressing such 7TM products can serve a variety of purposes. To the extent that the expressed products are "displayed" on host cell surfaces, the cells may constitute a valuable immunogen for the development of antibody substances specifically immunoreactive with 7TM receptors or 7TM receptor variants. Host cells of the invention are conspicuously useful in methods for the large scale production of 7TM receptors when the cells are grown in a suitable culture medium and the 7TM receptor polypeptide products are isolated from the cells or from the medium in which the cells are grown. Host cells expressing the novel 7TM receptors are also useful in assays for identifying antagonists or agonists of 7TM receptor binding.

Novel 7TM receptors of the invention may be obtained as isolates from natural cell sources, but are preferably produced by recombinant procedures involving host cells of the invention. The products may be obtained in fully or partially glycosylated, partially or wholly de-glycosylated, or non-glycosylated forms, depending on the host cell selected for recombinant production and/or post-isolation processing. 7TM receptor variants of the invention may comprise water soluble and insoluble polypeptide or peptide fragments, and may also comprise polypeptide analogs wherein one or more of the naturally specified amino acids is deleted or replaced: (1) without loss, and preferably with enhancement, of one or more biological activities or immunological characteristics specific for the 7TM receptor; or (2) with specific disablement of a particular ligand/receptor binding function. Analog polypeptides including additional amino acid (e.g., lysine) residues that facilitate multimer formation are contemplated.

Also comprehended by the present invention are antibody substances (e.g., monoclonal and polyclonal antibodies, single chain antibodies, chimeric antibodies, CDR-grafted antibodies and the like) or other binding proteins which are specifically reactive with 7TM receptor or 7TM receptor variants of the invention. Antibody substances can be developed using isolated natural or recombinant 7TM receptor products (including peptides) or cells expressing such products on their surfaces. The antibody substances are useful, in turn, in complexes for immunization to generate anti-idiotypic antibodies as well as for purifying polypeptides of the invention and for identifying cells producing the polypeptides on their surfaces. Assays for the detection and quantification of 7TM receptors on cell surfaces and in fluids such as serum may involve a single antibody substance or multiple antibody substances in a "sandwich" assay format. The antibody substances as well as agonists or antagonists of 7TM receptor binding (e.g., small molecules or peptides) are also manifestly useful in modulating (i.e., blocking, inhibiting or stimulating) ligand/receptor binding reactions of 7TM receptors of the invention, especially those reactions involved in immunological and/or inflammatory events in vivo.

The scientific value of the information contributed through the disclosures of DNA and amino acid sequences of the present invention is manifest. As one series of examples, knowledge of the sequence of a cDNA for a 7TM receptor makes possible the isolation by DNA/DNA hybridization of genomic DNA sequences encoding the 7TM receptor and specifying the 7TM receptor gene expression control regulatory sequences such as promoters, operators and the like. DNA/DNA hybridization procedures carried out with DNA sequences of the invention and under stringent conditions are likewise expected to allow the identification of DNAs encoding allelic variants of a 7TM receptor, mutant forms of a 7TM receptor associated with a particular disease state, other structurally related proteins sharing the biological and/or immunological specificity of the 7TM receptor, and non-human species proteins homologous to the 7TM receptor. DNAs of the invention are useful in DNA/RNA hybridization assays to detect the capacity of cells to synthesize a 7TM-receptor.

Also made available by the provision of DNA sequences of the invention are therapeutically useful oligonucleotides (e.g., antisense oligonucleotides, oligonucleotides for triplex formation or aptamers) relevant to regulating expression of a 7TM receptor by those cells which ordinarily express the same [as is described for other oligonucleotides in Crooke et al., BIO/TECHNOLOGY, 10. 882-886 (1992) and in Alper, BIO/TECHNOLOGY, 11: 1225 (1993)]. DNA sequences of the invention may also be used in vectors which have been developed for gene therapy such as those described in Mitani et al., TIBTECH, 11: 162-166 (1993) (delivering therapeutic genes); Sikora, TIBTECH, 11: 197-201 (1993) (gene therapy for cancer); and Findeis et al., TIBTECH, 11: 202-205 (1993) (gene therapy via receptors).

Numerous aspects and advantages of the present invention will be apparent upon consideration of the following drawings and detailed description.

BRIEF DESCRIPTION OF THE DRAWING

FIG. 1 is a schematic illustration of a possible conformation of the V31 7TM receptor in a cell membrane wherein transmembrane domain 1 is between points A and B, transmembrane domain 2 is between points C and D, transmembrane domain 3 is between points E and F, transmembrane domain 4 is between points G and H, transmembrane domain 5 is between points I and J, transmembrane domain 6 is between points K and L, and transmembrane domain 7 is between points M and N.

DETAILED DESCRIPTION

The present invention is illustrated by the following examples relating to the isolation of human genomic and cDNA sequences encoding the novel 7TM receptors herein designated V28, V31, V112, R20, R2, R12 and RM3. More particularly, Example 1 describes the isolation of PCR fragments encoding portions of the R20, V31, V28 and V112 7TM receptors. Example 2 describes the isolation of a full length human V31 genomic clone. Example 3 describes the isolation of a V31 human cDNA clone and further characterization of the V31 genomic clone. Example 4 describes the cloning of a full length murine V31 genomic clone. The cloning of a full length, human genomic clones for V28 is described in Example 5. Example 6 describes the isolation of a full length human V28 cDNA. Example 7 sets out a description of a human V112 cDNA. Example 8 describes the isolation of a full length genomic DNA encoding human R20. Example 9 presents experiments which reveal the chromosomal location of the human V31, V28 and R20 genes. The isolation of full length R2 and R12 7TM receptor genes from a human genomic fetal liver library is detailed in Example 10. Example 11 describes the cloning of a cDNA encoding the RM3 7TM receptor. Example 12 presents a comparison of the amino acid sequences of 7TM receptors of the invention with amino acid sequences of previously described 7TM receptors. The transfection of human cells with genomic and cDNA sequences encoding the 7TM receptor V31 and the phenotype of the transfected cells are detailed in Example 13. Expression of 7TM receptors of invention in various human tissues and hematopoietic cell lines as assayed by Northern blot and in situ hybridization is described in Example 14. Examples 15 and 16 respectively describe the expression of V31 and R20 genomic sequences as fusion proteins with Glutathione-S-Transferase in E. coli, while Example 17 describes the expression of V31 and V28 cDNA sequences as fusion proteins with Glutathione-S-Transferase in E. coli. Example 18 describes the generation of polyclonal sera reactive with the V31 fusion proteins and V31 peptides useful for generating monoclonal and polyclonal antibodies specific for V31. Example 19 presents various methods for identifying extracellular and intracellular ligands of the 7TM receptors of the invention.

EXAMPLE 1

The polymerase chain reaction (PCR) was chosen as a method for identifying new members of the 7TM receptor superfamily.

Design and Synthesis of PCR Primers

Initially, eight different degenerate oligonucleotide primer pools were designed based on the amino acid sequence of the Platelet Activating Factor receptor. PCR with the eight primer pools failed to amplify any new 7TM receptor sequences although several Platelet Activating Factor receptor clones were amplified.

A second set of degenerate primers was then designed from regions of amino acid sequence high similarity between IL8R1 and AT2R which have an overall amino acid similarity of 30%. The first region of high similarity occurs in the second transmembrane domain and contains 16 of 20 residues that are identical in both receptors. A 5' degenerate primer pool (where each primer was 45 nucleotides in length plus a cloning site, a longer primer than typically is used for PCR) was synthesized based on this sequence. The sequence of the upstream primer is set out in IUPAC nomenclature below, wherein the underlined nucleotides represent a BamH1 site introduced to facilitate cloning.

Primer pool 1 (SEQ ID NO: 1) GAC GGA TCC GTT TTT CTG TTG AAT TTG GCT CTG GCT GAC YTA YKC TTT KYM CTG ACY TTG CCM MTS TGG This oligonucleotide pool was degenerate at ten positions to account for multiple codon choices and the four amino acid differences between IL8R1 and AT2R. Ten positions were not degenerate, but were designed instead with a single `best guess` nucleotide based on human codon frequency tables in Wada et al., Nucl. Acids Res., 19S: 1981-1986 (1991).

A second region of extended identity between IL8R1 and AT2R occurs in the putative second cytoplasmic domain where eight identical adjacent residues are shared: This region was utilized to design a downstream antisense PCR primer pool (21 nucleotides in length plus a restriction site). The sequence of the downstream primer is set out in IUPAC nomenclature below, wherein the underlined nucleotides represent a HindIII site introduced to facilitate cloning.

Primer pool 2 (SEQ ID NO: 2) GGC TAA GCT TGI ACI ATI GC(Y or I) AGR TAI CGR TC This oligonucleotide contained the nucleotide inosine at several of the degenerate positions because of its ability to base pair with multiple nucleotides. Isolation of Genomic DNA Sequences Encoding Novel 7TM Receptors by PCR

Oligonucleotide primer pools 1 and 2 were used to amplify human genomic DNA purified from leukocytes by the method of Blin and Stafford, Nucl. Acids Res., 3: 2303-2308 (1976). PCR was performed in a Perkin-Elmer-Cetus machine with the following thermocycling parameters: an initial four minutes to bring the reaction to 94.degree. C., followed by 25 cycles of (1) 94.degree. C. denaturation step for 30 seconds, (2) 50.degree. C. annealing step for 45 seconds, and (3) 72.degree. C. extension step for two minutes. The reaction mixture contained 1.times. PCR buffer, 0.25 mM dGTP, 0.25 mM dATP, 0.25 mM dCTP, 0.25 mM TTP, 0.01 .mu.g/.mu.l primer pool 1, 0.01 .mu.g/.mu.l primer pool 2, 0.125 mg/ml human genomic DNA, and 2.5 units Taq polymerase in a total reaction volume of 40 .mu.l. The predominate PCR product observed was the predicted size of 192 base pairs (bp) as determined by electrophoresis on a 1.2% agarose gel. Eight different PCR reactions were performed with increasing amounts of MgCl.sub.2 ranging from 0.5 mM to 2.25 mM. The concentration of MgCl.sub.2 did not appear to change the quantity of PCR product so all eight reactions were pooled, extracted with phenol and chloroform, ethanol precipitated, and then digested with restriction endonucleases BamHI and HindIII. The digested DNA was electrophoresed on 1.2% agarose and the 192 bp band was excised and eluted from the gel. The recovered DNA was then ligated into BamHI-HindIII digested plasmid Bluescript SK- (Stratagene Cloning Systems, La Jolla, Calif.) and transformed into bacterial host XL-1Blue. Several thousand clones were obtained and most appeared to be recombinants as determined by blue-white color selection.

Twenty different clones were chosen for DNA sequence analysis. Plasmid DNA was prepared and sequenced by the dideoxy chain termination method. Most of the plasmids contained sequences corresponding to IL8R1 or AT2R, but two of the twenty clones contained a unique sequence which encoded a peptide with 28% similarity to IL8R1 and 46% similarity to AT2R. This novel sequence was termed R20 and encoded a series of amino acids consistent with a 7TM receptor: the first 17 residues were generally hydrophilic and contained a highly conserved cysteine residue and the last 22 residues were hydrophobic, corresponding to the third transmembrane domain.

In order to identify additional novel sequences, the clones obtained by PCR using primer pools 1 and 2 were screened by hybridization to eliminate IL8R1, AT2R and R20 clones. Approximately 1000 clones were individually isolated and grown in microtitre wells. With the aid of a pronging device, the colonies were stamped onto plates, grown overnight, and transferred to nitrocellulose. DNA on the blots was denatured and prepared by standard methods. Hybridization was then performed with .sup.32 P-labelled probes specific for IL8R1, AT2R, and R20. Clones which did not hybridize were then chosen for sequence analysis. Three new clones were identified that appeared to encode 7TM receptor segments. The inserts of the clones were designated V31, V28, and V112. The sequence of the insert encoding V112 (ATCC 75326) is set out in SEQ ID NO: 3. Entire genes encoding the putative 7TM receptor genes designated V31, V28 and R20 were isolated from human genomic DNA libraries cloned in lambda phage as described below in Examples 2, 5 and 8, respectively.

EXAMPLE 2

A V31 genomic clone was isolated by PCR using the specific primers set out below.

Primer V31-forward (SEQ ID NO: 4) TGG GCC TAC AGC GCG GCC AA Primer V31-reverse (SEQ ID NO: 5) TC AAT GCT GAT GCA AAG AAG A human genomic DNA lambda library (ATCC 37333) was fractionated into 150 pools of approximately 3000 clones each. The 150 pools were divided into 15 groups, each containing .about.30,000 phage. PCR with the V31 specific primers was performed with the following parameters: an initial four minutes to bring the reaction to 94.degree. C., followed by 30 cycles of (1) 94.degree. C. denaturation step for 30 seconds, (2) 50.degree. C. annealing step for 45 seconds, and (3) 72.degree. C. extension step for two minutes. The reaction mixture contained 1.times. PCR buffer, 0.25 mM dGTP, 0.25 mM dATP, 0.25 mM dCTP, 0.25 mM TTP, 0.01 .mu.g/.mu.d V31 forward primer, 0.01 .mu.g/.mu.l V31 reverse primer, 1 .mu.l phage pool lysate, and 2.5 units Taq polymerase in a total reaction volume of 50 .mu.l. One of the 15 groups yielded a PCR fragment of the predicted size of 114 bp, and a single pool of this group also produced the same fragment when subjected to the same PCR conditions. Hybridization was then used to identify the V31 coding phage. Approximately 6000 phage were plated on five 15 cm plates. Duplicate filters were absorbed to each plate and processed for hybridization by standard methods. A 32P labeled probe was prepared from the V31 segment plasmid by incorporating .sup.1 P-DCTP into a PCR reaction with the V31 specific primers. Hybridization with this radiolabeled probe and washing of filters was performed under conditions of reduced stringency. The hybridization solution was 20% formamide, 5.times. SSC (0.75 M sodium chloride, 0.075 M sodium citrate), 5.times. Denhardt's solution [1% polyvinyl pyrolidone (Sigma, St. Louis, Mo.), 1% ficoll, 1% bovine serum albumin-fraction V], 0.05 M sodium phosphate, pH 6.5, and 50 ng/ml sonicated salmon sperm DNA (Sigma). After overnight hybridization at 42.degree. C., the filters were washed extensively in 2.times. SSC at 42.degree. C. A hybridizing clone was chosen for plaque purification, DNA isolation, and restriction endonuclease analysis. Hybridizing EcoRI and KpnI fragments were subcloned and subjected to DNA sequence analysis. The sequence demonstrated that the V31 coding sequence had indeed been isolated and matched completely the 114 bp sequence cloned by PCR. However, the sequence did not contain the entire 5' end of the coding region.

Consequently, more V31 genomic sequences were isolated from a different human placenta genomic library in vector lambda-Fix-II (Stratagene). Approximately 600,000 phage were screened by hybridization with the 5' end of the V31 coding sequence (EcoRI-PstI fragment). The probe was prepared by labeling approximately 100 ng of the denatured V31 DNA fragment in a reaction containing .sup.32 P-dCTP, .sup.32 P-dTTP, dGTP, dATP, random hexamer primers, and the Klenow fragment of DNA Polymerase I. Unincorporated nucleotides were removed by passing the reaction mixture over a G-25 Sephadex Quick Spin Column (Boehringer Mannheim). The probe was denatured by boiling and then incubated with the phage filters overnight at 42.degree. C. in hybridization solution (50% formamide, 5.times. SSC, 5.times. Denhardt's, 0.05 M sodium phosphate, pH 6.5) and 50 ng/ml sonicated salmon sperm DNA. Filters were washed three times in 0.2.times. SSC, 0.1% SDS at 42.degree. C. for 10 minutes. Filters were air dried and then autoradiographed. Six independently hybridizing clones were chosen for plaque purification and restriction endonuclease analysis. Four of these clones produced hybridization patterns identical with genomic Southern blots using the V31 coding sequence probe. The hybridizing 1.9 Kb PstI fragment from one of these phage was isolated and subcloned into the PstI site of plasmid Bluescript SK+ (Stratagene). The resulting plasmid was subjected to DNA sequence analysis and was found to contain the entire V31 coding sequence. The predicted ATG initiation codon was preceded immediately by nucleotides agreeing with the Kozak consensus sequence for translation initiation [Kozak, Nucl. Acids Res., 12: 857-872 (1984)]. The DNA and amino acid sequences of the V31 genomic clone (ATCC 75327) are respectively presented in SEQ ID NOs: 6 and 7. The sequence of the V31 clone is more homologous to the IL8R1 (31%) and AT2R (27%) than to other members of the 7TM receptor superfamily (e.g., rhodopsin, the adrenergic receptors or the olfactory receptors).

EXAMPLE 3

Isolation of a Human V31 cDNA

A human cDNA encoding the 7TM receptor V31 was isolated. First, a partial cDNA clone was amplified by PCR from a human tonsil cDNA library made by standard methods in vector pCDM8 [Invitrogen, San Diego, Calif.]. The primers utilized in the PCR reaction were:

Primer V31-G+ (SEQ ID NO: 8) GGTGAATTCAGGCTTTAAAGTTCCGCAC Primer CDM8-Down (SEQ ID NO: 9) GCAGAACTGGTAGGTATGGA Primer V31-G+ corresponds to the complement of nucleotides 418 to 437 of SEQ ID NO: 6 and includes an EcoR1 site (underlined) and three additional nucleotides at its 5' end to facilitate cloning. Primer CDM8-Down annealed to the polylinker of the vector pCDM8. The resulting PCR products were blotted to nitrocellulose and probed with a radioactive V31-specific probe. The radioactive probe was produced by annealling two oligonucleotides, the sequences of which are set out in SEQ ID NOs: 10 and 11, and filling in the ends of the annealled oligonucleotides with 3P-labelled nucleotides. A hybridizing band was isolated from the gel and cloned in Bluescript (SK-) (Stratagene). The resulting clone was named pV31-5'end and its DNA sequence is set out in SEQ ID NO: 12. Nucleotides 58-117 of pV31-5'end comprise coding sequences that are different from the orignal genomic clone set out in SEQ ID NO: 6, while nucleotides 118-232 are identical to nucleotides 322 to 437 of SEQ ID NO: 6.

A full length cDNA clone was isolated from a peripheral blood mononuclear cell cDNA library. PCR using V31-specific oligonucleotide primers was performed to identify fractions of the library containing V31 clones. The primers utlized were:

Primer V31-B1 (SEQ ID NO: 13) GCACAGCCTTCCTGTGTGG Primer V31-reverse (SEQ ID NO: 5) Prime V31-B1 corresponds to nucleotides 18 to 36 of SEQ ID NO: 12. Individual fractions positive for V31 were plated out and probed with the V31-specific radioactive probe described above for isolation of the V31-5'end clone. Clone PBMC75 was isolated and included a poly-A tail but was five nucleotides shorter at the 5' end than the partial tonsil cDNA set out in SEQ ID NO: 12. The V31 cDNA insert in clone PBMC75, which includes the complete coding sequences for the V31 7TM receptor, was named cDNA V31-B.

RACE PCR performed using a 5'-Amplifinder RACE kit (Clonetech) was used to amplify and clone the 5' end of the V31 cDNA. Primers V31-F (SEQ ID NO: 52) and V31-G+ (SEQ ID NO: 8) were utilized in the reactions along with primers included in the kit to clone cDNAs which included seventeen additional noncoding nucleotides (five of which were the same as the additional five identified in the original tonsil clone) upstream of the V31-B cDNA. A composite sequence including the seventeen nucleotides and the V31-B cDNA sequence is presented in SEQ ID NO: 14 and in GenBank under Accession No. L31581. The amino acid sequence deduced from the cDNA is presented in SEQ ID NO: 15. The predicted seven transmembrane domains of the V31 7TM receptor (schematically marked in FIG. 1 as regions A to B, C to D, E to F, G to H, I to J, K to L, and M to N) correspond to amino acid residues 58 to 86, 96 to 119, 131 to 152, 171 to 196, 219 to 247, 264 to 285 and 306 to 331 of SEQ ID NO: 15.

Recharacterization of the Human V31 Genomic Clone

A comparison of the amino acid sequence deduced from V31-B with the amino acid sequence deduced from the V31 genomic clone described in Example 2 revealed that the two sequences differed at the amino terminus. The first fifty-two amino acids deduced from the genomic clone (residues 1 to 52 of SEQ ID NO: 7) were not present in the amino acid sequence deduced from V31-B cDNA and were replaced instead with twenty different amino acids (residues 1-20 of SEQ ID NO: 15). This result indicated that that the 5' end of the genomic clone was likely to contain an intron or introns.

Consequently, the V31-B cDNA sequence was used to identify three exons in the human V31 genomic clone described in Example 2. The DNA and deduced amino acid sequences of exons 1 and 3 (along with partial intron sequences) of the V31 genomic clone are set out in SEQ ID NOs: 16 and 17, and 18 and 19, respectively. The DNA sequence of exon 2 of V31 as well as intron sequences flanking the exon are set out in SEQ ID NO: 21 while the deduced amino acid sequence of exon 2 is set out in SEQ ID NO: 22. Nucleotides 151-156 of SEQ ID NO: 16 (exon 1) comprise a putative TATA box while nucleotide 180 appears to be the site of transcription initiation and nucleotides 243-245 appear to comprise the start codon. Another promoter region, a CAAT box, which is thought to modulate transcription by RNA polymerase II [Benoist et al., Nuc. Acids. Res., 8: 127-142 (1980)] has the consensus sequence GG(C/T)CAATCT (SEQ ID NO: 20). A similar sequence sequence is found at nucleotides 104-113 of SEQ ID NO: 16. Amino acids 6-15 of SEQ ID NO: 22 (exon 2) comprise a hydrophobic sequence shorter than, but similar to, that identified in a corresponding region of the serotonin receptor [Ruat et al., Proc. Natl. Acad. Sci. USA, 90: 8547-8551 (1993)] as a possible additional transmembrane domain or a cleavable signal sequence. The intron sequences set out in SEQ ID NO: 18 (exon 3) include a stretch of nucleotides encoding an alu repeat.

The sequences of the human V31 exons are also deposited with GenBank as Accession Nos. L31582 (exon 1), L31583 (exon 2) and L31584 (exon 3).

EXAMPLE 4

A murine V31 genomic clone was isolated from a genomic library library made by standard methods from a mouse cell line named C6VL using the 1.9 Kb human V31 gene as a probe. The library was probed at reduced stringency (30% formamide at 42.degree. C.). The DNA and deduced amino acid sequences of the murine V31 genomic clone isolated are set out in SEQ ID NOs: 23 and 24, respectively. The murine cDNA sequence is also deposited in GenBank as Accession No. L31580.

A murine V31 cDNA was also isolated. A mouse thymus cDNA library (Stratagene #935303) was screened using a 1 kb probe generated by PCR with primers specific to the mouse V31 genomic clone:

Nucleotides 692 to 711 of SEQ ID NO: 23 5'-GTGTGCITCTGCCAAGATGA-3' Nucleotides 1736 to 1719 of SEQ ID NO: 23 5'-TGCTCACCGACGCGTTCC-3' The nucleotide and deduced amino acid sequences of the murine V31 cDNA are set out in SEQ ID NOs: 65 and 66.

Both the mouse and human cDNA clones have open reading frames of 1134 nucleotides and encode proteins of 378 amino acids. The deduced amino acid sequences of the two proteins are 86% identical. These proteins contain many of the features common to members of the G protein-coupled receptor family: seven hydrophobic stretches that could serve as transmembrane domains, a pair of cysteines in the second and third extracellular domains, potential N-linked glycosylation sites in the amino terminal extracellular domain, potential phosphorylation sites in the carboxy terminal cytoplasmic domain, and key amino acids conserved among members of the family.

The mouse cDNA clone is 2084 nucleotides in length and contains 175 nucleotides of 5' untranslated sequence and 775 nucleotides 3' untranslated sequence in addition to the coding region of the gene. The mouse and human clones are 85% identical throughout the coding region of the gene, but untranslated sequences 5' and 3' of the coding sequence diverge significantly. The mouse cDNA clone contains two polyadenylation signals at positions 1985-1992 and 2036-2042.

EXAMPLE 5

The PCR fragment, the isolation of which is described in Example 1, encoding the 7TM receptor V28 was used to design synthetic oligonucleotides probes specific for V28. Two overlapping oligonucleotides were synthesized as shown below which represented coding and non-coding strands of the fragment with a 9 bp overlap in the center.

Primer V28L (SEQ ID NO: 25) TGG ACT CAC TAT TTG ATA AAT GAA AAG GGC CTC CAC AAT GCC ATG TGC AAA TTC ACT ACC Primer V28R (SEQ ID NO: 26) AAT GCT GAT GAC GGT GAT GAA GAA TAT GCT TCC AAA AAA GCC GAT GAA GAA GAA GGC GGT AGT GAA The two synthetic DNAs were annealed, and Klenow polymerase was used to incorporate .sup.32 P radiolabeled nucleotides into the resulting V28 specific probe (114 bp in length following reaction). The reaction contained 0.76 .mu.g of each V28 oligonucleotide, 1.times. Klenow Buffer, 0.015 mM dATP, 0.015 mM dGTP, 10 .mu.l .sup.32 P-dCTP (Amersham), 10 .mu.l .alpha.-.sup.32 P-dTTP (Amersham) and 1.5 .mu.l Klenow polymerase. The reaction was incubated at room temperature for 15 minutes and unincorporated counts were removed with the aid of a Quick-Spin G25 column.

The V28 probe (46.times.10.sup.6 cpm) was denatured by boiling for 2 minutes and hybridized to the human placenta genomic library (Stratagene). The library contained 360,000 phage on 12 nitrocellulose filters and hybridization was performed overnight at 42.degree. C. in the hybridization solution described above containing 30% formamide. Filters were washed extensively in 2.times. SSC at 32.degree. C. and then exposed three days. Several strongly hybridizing signals were observed and plaque purified. The V28 probe hybridized to single restriction endonuclease fragments in Southern blots of the phage DNA and human genomic DNA. Both HindIII (about 2 kbp) and Pst I (about 3.5 kbp) fragments were isolated, subcloned in pBluescript and sequenced. The DNA and deduced amino acid sequences of the full length V28 genomic clone (ATCC 75330) are respectively set out in SEQ ID NOs: 27 and 28. The gene contained the exact V28 sequence isolated by PCR. The encoded amino acid sequence predicts a structure consistent with typical 7TMR structure: there are seven hydrophobic domains separated by hydrophilic domains and highly conserved residues are found in their typical positions. The predicted seven transmbrane domains of the V28 7TM receptor correspond to amino acid residues 26 to 56, 68 to 92, 107 to 125, 146 to 167, 197 to 219, 232 to 253, and 273 to 297 of SEQ ID NO: 28. The V28 coding sequence is 29% homologous with IL8R1 and 27% homologous to AT2R.

EXAMPLE 6

A human V28 cDNA was isolated from a peripheral blood mononuclear cell cDNA library generated by standard methods in vector pRc/CMV (Stratagene). PCR using V28-specific oligonucleotide primers was performed to identify fractions of the library containing V28 clones. The primers utilized were:

Primer V28F (SEQ ID NO: 29) TGG ACT CAC TAT TTG ATA AA Primer V28X (SEQ ID NO: 30) AAG ATT TGA GAG TCA GAG Primer V28F corresponds to nucleotides 852 to 871 of SEQ ID NO: 27, while primer V28X corresponds to the complement of nucleotides 2047 to 2064 of SEQ ID NO: 27. The PCR reaction produced a 1.2 Kb DNA product that was labelled with .sup.33 P by random priming and then used as a probe to identify individual V28 clones. Hybridization and washing conditions were similar to the stringent methods described in Example 2.

The DNA and deduced amino acid sequences of the V28 cDNA clone are set out in SEQ ID NOs: 31 and 32, respectively. A comparison of the V28 genomic and cDNA clones revealed that there is an intron in the 5' untranslated portion of the V28 gene, the splice junction for which appear at nucleotides 84 to 85 of SEQ ID NO: 31.

EXAMPLE 7

A human V112 cDNA corresponding to the V112 genomic fragment described in Example 1 was isolated from a macrophage cDNA library made by standard procedures in vector pRc/CMV (Stratagene). PCR using V112-specific oligonucleotide primers was performed to identify fractions of the library containing V112 clones. The primers utilized were:

Primer V112-F (SEQ ID NO: 33) TGGGTGGATAAAGAAGCATCTC Primer V112-R (SEQ ID NO: 34) AACACTCATGCAAGTGAGCA Primer V112-F corresponds to nucleotides 1 to 19 of SEQ ID NO: 3, while primer V1 12-R corresponds to the complement of nucleotides 101 to 120 of SEQ ID NO: 3. The PCR reaction produced a 123 bp DNA product that was labelled with .sup.32 P by random priming and then used as a probe to identify individual V112 clones. Hybridization and washing conditions were similar to the reduced stringency methods described in Example 2.

Partial DNA and deduced amino acid sequences of the approximately 850 bp V112 cDNA clone are set out in SEQ ID NOs: 35 and 36, respectively. The partial sequence presented in SEQ ID NO: 35 contains V112 5' untranslated sequence and encodes the amino terminal portion of V112 up to the fourth transmembrane domain. The predicted seven transmbrane domains 1-3 of the V112 7TM receptor correspond to amino acid residues 36 to 58, 70 to 90, and 108 to 127 of SEQ ID NO: 36.

EXAMPLE 8

The R20 sequence isolated by PCR as described in Example 1 was used to screen a genomic library for the entire gene. A probe specific for R20 was prepared by amplifying the R20 partial sequence by PCR using the specific primer sequences set out below and .sup.32 P-labeled nucleotides, wherein primer R20-61 corresponds to the first 21 bases of the coding strand and primer R20-153RC corresponds to the first 20 bases of the non-coding strand.

Primer R20-61 (SEQ ID NO: 37) CTA CAC GTA CCG GGA CTA TGA Primer R20-153RC (SEQ ID NO: 38) AGA AGA CGC TGG CGT ACA TG The PCR reaction contained 0.07 .mu.g R20 target sequence (Hind III-Bam fragment isolated from the R20 plasmid cloned in pBluescript SK-), 0.25 mM dATP, 0.25 mM dGTP, 0.25 mM dTTP, 1 .mu.M DCTP, 4 .mu.l .sup.32 P-dCTP (Amersham), 0.01 mg/ml R20 specific primers, 1.times. PCR buffer, and 0.5 .mu.l Taq polymerase in a volume of 40 .mu.l. The PCR was performed with the following thermocycling parameters: an initial four minutes to bring the reaction to 94.degree. C., followed by 12 cycles of (1) 93.degree. C. denaturation step for 30 seconds, (2) 50.degree. C. annealing step for 30 seconds, and (3) 72.degree. C. extension step for one minute. The unincorporated counts were removed with a Quick-Spin G25 column.

The probe was denatured by boiling for 2 minutes and then used to screen the human placenta genomic DNA library (Stratagene). Filters were hybridized overnight at 42.degree. C. in hybridization solution containing 40% formamide, washed at 42.degree. C. in 0.2.times. SSC and exposed overnight. Four strongly hybridizing signals were plaque purified, subcloned and sequenced. The R20 sequence identified by PCR was present in the isolated gene. The gene encodes a protein that has a structure similar to other 7TM receptors. The DNA and deduced amino acid sequences of the full length genomic R20 clone (ATCC 75328) are respectively set out in SEQ ID NOs: 39 and 40. The predicted seven transmbrane domains of the R20 7TM receptor correspond to amino acid residues 28 to 54, 66 to 90, 107 to 125, 146 to 167, 208 to 232, 246 to 267, and 285 to 312 of SEQ ID NO: 40. The R20 gene product is 28% homologous with the IL8R1 and 29% homologous with the AT2R.

EXAMPLE 9

The chromosomal position of the V31 gene was determined by Southern blot analysis of human-murine somatic cell hybrids [Naylor et al., J. Exp. Med., 57: 1020-1027 (1983)] and in situ hybridization of metaphase chromosomes [Cherif et al., Hum. Genet., 81: 358-362 (1989) and Fan et al., Proc. Natl. Acad. Sci. USA, 87: 6223-6227 (1990)]. The chromosomal positions of the V28 and R20 genes were also determined by Southern blot analysis of human-murine somatic cell hybrids.

Localization of the V31 Gene

DNA was isolated from human-mouse somatic cell hybrids, digested with EcoRI, and hybridized on Southern blots using the human V31 gene (the 1.9 Kb PstI fragment described in Example 2) as a probe. Hybridization of the V31 gene consistently segregated with human chromosome 17. To localize the V31 gene more specifically, in situ hybridization was performed on human metaphase chromosomes with a fluorescently labelled V31 gene probe (again the 1.9 Kb PstI fragment described in Example 2). Fluorescent in situ hybridization to metaphase chromosomes was used to localize the V31 genomic clone to the q12-q21.2 region of chromosome 17. Metaphase chromosomes were prepared from 5-bromodeoxyuridine synchronized lymphocyte cultures. The probe was biotinylated, hybridized to the chromosome spreads and detected by fluorescein-conjugated avidin (Vector Labs). Slides were evaluated with a Nikon fluorescence microscope. Forty-five metaphase preparations were examined. Q-(DAPI counterstaining) and R-banding (propidium iodide counterstaining) were used to confirm the identity of the chromosome. Fluorescent signal was detected at 17q12-21.2 on both chromatids of chromosome 17 in eighteen out of the forty-five cells. This is the same chromosomal localization identified for inherited familial breast cancer [Hall et al., Science, 250. 1684-1689 (1990)].

Localization of the V28 Gene

DNA was isolated from human-mouse somatic cell hybrids, digested with EcoRI, and hybridized on Southern blots using the coding region of the human V28 gene (Example 5) as a probe. Hybridization of the V28 gene consistently segregated with human chromosome 3. To localize the V28 gene specifically, hybridization was observed to a cell line with a 17/3 translocation containing 17qter-17p13 :: 3p21-3pter. This hybrid scored positive and localizes the V28 gene to the p21-ter region of chromosome 3. This region of chromosome 3 has been implicated in the following conditions: von Hippel-Lindau syndrome, thyroid hormone resistance, small cell cancer of lung, Pseudo-Zellweger syndrome, GM1-gangliosidosis and Morquio syndrome (type B). See, O'Brien, Ed., Generic Maps: Locus Maps of Complex Genomes, Sixth Edition, Book 5, pp. 5.108-5.109, Cold Spring Harbor Laboratory Press, Plainview, N.Y. (1993). Interestingly, the gene encoding the CC chemokine receptor, to which the V28 polypeptide exhibits 41% sequence similarity, localizes to the same region of chromosome 3. The CC chemokine receptor recognizes beta chemokines which appear to participate in signalling pathways affecting lymphocytes and macrophages. The 7TM receptor V28 may recognize ligands similar to those recognized by the CC chemokine receptor.

Localization of the R20 Gene

DNA was isolated from human-mouse somatic cell hybrids, digested with EcoRI, and hybridized on Southern blots using the human R20 coding region (Example 8) as a probe. Hybridization of the R20 gene consistently segregated with human chromosome 11. Seven hybrids with chromosome 11 translocations (and no intact chromosome 11) further localize R20 to the p11q13 region of chromosome 11. This region of chromosome 11 has been implicated in the following conditions: hypoprothrobinemia and dysprothrombinemia (O'Brien et al., supra).

EXAMPLE 10

During the isolation of the R20 gene, two weakly hybridizing sequences were identified which have significant homology to other 7TM receptor genes. The R20 specific probe (described in Example 8) was used to screen a human genomic fetal liver DNA library (ATCC 37333) by the methods described in Example 8. While the R20 gene could not be identified in this library, several weakly hybridizing clones were plaque purified, subcloned, and sequenced. The two clones were designated R2 (ATCC 75329) and R12 (ATCC 75331). The full length DNA and deduced amino acid sequences of R2 and R12 (which are respectively presented in SEQ ID NOs: 41 and 42, and 43 and 44) exhibit homology with other 7TM receptors. The predicted seven transmbrane domains of the R2 7TM receptor correspond to amino acid residues 41 to 69, 77 to 104, 120 to 138, 161 to 186, 207 to 226, 247 to 270, and 294 to 318 of SEQ ID NO: 42, while the predicted seven transmbrane domains of the R12 ?TM receptor correspond to amino acid residues 33 to 57, 68 to 90, 106 to 127, 145 to 168, 193 to 217, 233 to 251, and 290 to 312 of SEQ ID NO: 44. R2 is 25% homologous to the IL8R1 and 24% homologous to the AT2R, while R12 is 26% homologous to the IL8R1 and 19% homologous to the AT2R.

EXAMPLE 11

Another novel 7TM receptor was identified by methods similar to those described in Example 1. The two degenerate primer pools (having SEQ ID NOs: 1 and 2, respectively) were used in a PCR reaction containing a human macrophage cDNA library in plasmid pRc/CMV (Stratagene). The reaction mixture contained 1.times. PCR buffer, 0.25 mM dGTP, 0.25 mM dCT?, 0.25 mM dAT?, 0.25 mM TTP, 0.01 .mu.g/.mu.l primer pool 1, 0.01 .mu.g/.mu.l primer pool 2, 0.2 .mu.g human macrophage cDNA library and 2.5 .mu.l Taq polymerase in a reaction volume of 40 .mu.l. When the PCR products were subjected to agarose gel electrophoresis a faint band of 180-200 bp was observed. To facilitate cloning, this DNA was eluted from the gel and re-amplified by PCR under the same conditions. Substantially more DNA was isolated following the second PCR. The re-amplified material was digested with BamHI and HindIII and cloned into the plasmid Bluescript SK-, as described in Example 1. Of sixteen clones sequenced, fourteen corresponded to R20 and two contained a unique sequence termed RM3. Specific primers for the partial RM3 clone were used to identify a full length RM3 cDNA clone by the PCR methods described in Example 2. The DNA and deduced amino acid sequence of the RM3 cDNA are respectively presented in SEQ ID NOs: 45 and 46. The predicted seven transmbrane domains of the RM3 7TM receptor correspond to amino acid residues 48 to 69, 82 to 100, 115 to 136, 159 to 179, 198 to 220, 246 to 274, and 287 to 311 of SEQ ID NO: 46. The sequence of the RM3 partial clone (ATCC 75340) is represented in SEQ ID NO: 45 as nucleotides 438 to 551. The RM3 deduced amino acid sequence exhibits 34% identity to the IL-8R and 32% identity to the AT2R.

EXAMPLE 12

Amino acid identity values among five of the seven novel 7TM receptors described in Examples 1 to 6 as well as values in comparison to various previously identified 7TM receptors are presented in Table 1 below, wherein fMLP is the N-formyl peptide receptor and ThrR is the thrombin receptor. The amino acid sequences of the previously identified 7TM receptors have been published as follows: IL8R1 in Holmes et al., supra; IL8R2 receptor in Murphy et al., Science, 253: 1280-1283 (1991); AT2R in Sasaki et al., supra; C5aR in Gerard and Gerard, supra; fMLPR in Boulay, BBRC, 168: 1103-1109 (1990); ThrR in Vu et al., Cell, 64: 1057-1068 (1991); and PAFR in Honda et al., supra.

TABLE 1______________________________________ V31-B V28 RM3 R20 R12 R2______________________________________IL8R1 33 30 35 28 25 23IL8R2 34 32 34 30 27 27AT2R 28 28 32 29 28 24C5aR 27 24 26 25 26 27fMLPR 25 24 29 24 23 29ThrR 19 25 20 21 29 21PAFR 27 25 23 24 27 20R2 27 24 24 24 25 --R12 23 25 25 29 -- --R20 25 25 26 -- -- --RM3 32 33 -- -- -- --V28 31 -- -- -- -- --______________________________________

EXAMPLE 13

V31 genomic DNA was transfected into CHO/DHFR.sup.- cells (ATCC CRL9096) and 293 cells (ATCC CRL1573) and the cells were assayed for expression of V31 by Northern blot. V28 coding sequences were also transfected into and expressed in 293 cells.

Vector Constructs for Expression of V31 and V28 in Mammalian Cells

The V31 coding sequence was excised from the full length lambda genomic clone described in Example 2 (.lambda.S-V31-3) as a 1.9 kb PstI fragment and ligated into commercial plasmid Bluescript SK+ (Stratagene) cut with PstI, to create an intermediate construct designated pV31-Pst. The entire V31 fragment plus 60 bp of flanking polylinker sequence was then cut out of pV3 l-Pst with Hinds and XbaI and ligated into commercial mammalian expression plasmid pRc/CMV (Invitrogen Corporation, San Diego, Calif.) cut with HindIII and XbaI to generate the expression construct pV31XP.

By standard PCR methods, the entire coding sequence of the V28 gene was isolated from the genomic clone described in Example 5. The coding sequences were then cloned into the expression plasmid pRc/CMV to generate the expression construct 293/V28-L.

Transfection of CHO and 293 Cells

The V31 and V28 expression constructs were transfected into CHO or 293 cells by lipofection using the commercial transfection reagent DOTAP (Boehringer Mannheim Corporation, Indianapolis, Ind.). Following selection for G418 resistance, individual V31 and V28 transfectants were subcloned.

Northern Blot Analysis

Specific expression of the V31 mRNA in transfected cells was assayed by Northern blot hybridization with a .sup.32 P-labelled V31 probe. Transfectants were grown to log phase, then centrifuged and washed one time with Phosphate Buffered Saline. mRNA was isolated from cells using the commercial Micro-Fast Track mRNA isolation kit (Invitrogen Corporation). mRNA species were separated by electrophoresis through 1% agarose gels with 2.2 M formaldehyde. Samples were first denatured by incubating 15 minutes at 65.degree. C. in 50% formamide and 2.2 M formaldehyde, then bromphenol blue and ethidium bromide were added prior to loading the gel. mRNA was electrophoresed at 50 V for approximately 4 hours. After visualizing by UV trans-illumination and photography, mRNA in the gel was transferred to nitrocellulose (Schleicher & Schuell, Keene, N.H.) by capillary action overnight in 20.times. SSC. Nitrocellulose blots were baked at 80.degree. C. in a vacuum oven for 1-2 hours prior to hybridizing with probes.

To generate the radiolabelled V31 probe, template DNA (1.9 kb HindIII-XbaI fragment containing entire V31 coding sequence) was denatured by boiling, then annealed to a mixture of random hexamer primers. Primers were extended for 30 minutes at room temperature using Klenow enzyme and a mixture of .sup.32 P-dCTP, .sup.32 P-dTTP, dATP, and dGTP. Unincorporated nucleotides were removed by passing the reaction mixture over a G-25 Sephadex Quick Spin Column (Boehringer Mannheim). Incorporation of .sup.32 P was assessed by Cherenkov counting. The probe was denatured by boiling and then incubated with the mRNA blot overnight at 42.degree. C. in hybridization solution (50% formamide, 5.times. SSC, 5.times. Denhardts, 50 mM NaPO4, 10 ug/ml denatured salmon DNA). Blots were washed in 2.times. SSC, 0.1% SDS at room temperature 2 times for 10 minutes each, and then in 0.1.times. SSC at 50.degree. C. 3-4 times for 10 minutes each. Blots were air dried and then exposed to X-ray film for varying lengths of time.

Only one of twelve transfected CH0 clones expressed V31 mRNA as determined by hybridization. This cell line was designated CHO-V31-10. The signal from this cell line was observable within eight hours, while the other lines failed to produce significant amounts of signal.

Of the nine transfected 293 cell lines, two expressed V31 mRNA at very high levels (designated 293-V31-1 and 293-V316), three expressed at moderate levels (designated 293-V31-5, 293-V31-7, and 293-V31-9) and four failed to expre ss significantly.

Also by Northern blot analysis, ten out of twelve 293 clones transfected with V28 coding sequences expressed V28 mRNA. The clone designated V28-k expressed V28 mRNA at the highest levels.

Phenotype of Transfected 293 Cells Expressing V31 mRNA

The phenotype of transfected 293 cells expressing V31 mRNA is altered in comparison to parental 293 cells. Parental 293 cells contain processes which protrude from the cellular surface. Such protrusions (or "spikes") are a common feature of many transformed cell types. The cells do not flatten out onto plastic but show a high profile with localized points of adhesion (thus the spikey description) and do not form a smooth epithelial sheet. In contrast, 293 transfectants expressing high levels of V31 mRNA (293-V31-1 and 293-V316) appear flat and smooth in culture. The cells make close and continuous contact with each other to form a smooth epithelial sheet with a cobbled appearance. The V31 transfected 293 cells also exhibit a marked decrease in their growth rate compared with the parental 293 cell line. These morphological and growth rate differences are consistent with a "less transformed" phenotype for V31 gene expression. These results are in marked contrast to other 7TM receptor-transfected cells. For example, the serotonin receptor confers a more transformed phenotype when transfected into mammalian cells [Julius et al., Science, 244: 1057 (1989)].

Expression of V31 cDNA in Mammalian Cells

The V31-B cDNA was also engineered for mammalian cell expression in pRc/CMV by methods similar to those described above. The resulting expression plasmid was designated pRcV31-B. The 293 clones transfected with the expression plasmid which were expressing V31-B mRNA exhibited a phenotype similar to parental 293 cells rather than to 293 cells transfected with the V31 genomic DNA constructs. The 293 clone expressing V31 mRNA at the highest levels was V31B-i.

EXAMPLE 14

Expression of mRNA of the novel 7TM receptors V31, V28 and R20 was assayed by Northern blot analysis and in situ hybridization with radio-labelled probes in a variety of human tissues and hematopoietic cell lines.

Hybridization of V31 Probes to Human Tissues in situ

Frozen sections from various human tissues were hybridized in situ with radiolabelled single-stranded RNA probes derived from V31. Tissue samples obtained from lymph node, spleen, thymus, and tonsil were frozen in OTC blocks and stored at -70.degree. C. Blocks were cut into 6 micron sections using a cryostat 2800M (Leica) and applied to slides coated in Vectabond (Vector Laboratories, Burlingame, Calif.). Slides were air dried overnight at room temperature than placed at -70.degree. C. for storage. Prior to use, slides were removed from 70.degree. C. and placed at 55.degree. C. for 5 minutes. Sections were then fixed in 4% paraformaldehyde for 20 minutes at 4.degree. C., rinsed 3 times in PBS, dehydrated (70-95-100% ethanol, one minute each at room temperature), and then allowed to dry for 30 minutes. Sections were denatured in 70% formamide, 2.times. SSC for 2 minutes at 70.degree. C., rinsed in 2.times. SSC, dehydrated, and then air dried for 30 minutes. The sections were then incubated in prehybridization solution (50% formamide, 0.3 M NaCl, 20 mM Tris pH 8.0, 10% dextran sulfate, 1.times. Denhardt's solution, 100 mM DTT and 5 mM EDTA) for 2 hours at 42.degree. C., radiolabelled probe was added to the solution (6.times.10.sup.5 cpm/section) and the sections allowed to hybridize for 12-16 hours at 50.degree. C. To generate sense and anti-sense V31 probes, T7 and T3 RNA polymerases were used to synthesize .sup.35 S-labelled transcripts from a linearized, gel purified plasmid containing a 727 bp HincII fragment of V31.

After hybridization, sections were washed in 4.times. SSC, 10 mM DTT for 1 hour at room temperature, then in 50% formamide, 1.times. SSC, 10 mM DTT for 40 minutes at 60.degree. C., and finally in 2.times. SSC and 0.1.times. SSC for 30 minutes each at room temperature. After alcohol dehydration, the air dried slides were dipped in Kodak NTB2 Nuclear Emulsion (heated to 42.degree. C.) and allowed to dry for 2 hours at room temperature in complete darkness until time of development. Slides were then placed in Kodak D19 developer for 4 minutes at 4.degree. C., dipped 4 times in Acid Stop (1 ml Glacial acetic acid/500 ml distilled water) and then placed in Kodak fixer for 4 minutes at 4.degree. C. The slides were rinsed 3 times in tap water and then counterstained with hematoxylin/eosin.

The V31 antisense probe hybridized intensely with each of the four human tissue samples (lymph node, spleen, thymus, and tonsil). In contrast, the control probe produced from the V31 sense strand did not hybridize significantly to these tissues.

Northern Blot Analysis of V31 Expression in Human Tissues

Specific expression of V31 mRNA in normal human tissues was also assayed by Northern blot hybridization. RNA was prepared from human tissues by standard methods [see, for example, Chirgwin et al., Biochemistry, 18: 5294-5299 (1979)] and fractionated on oligo-dT cellulose for enrichment of mRNA. The mRNA samples were separated on a formaldehyde-agarose gel, transferred to nitrocellulose, and hybridized to the V31 .sup.32 P-labeled probe as described in Example 3. The V31 probe clearly hybridized to the human lymphoid tissues, tonsil, lymph node and spleen. No hybridization was observed to adrenal gland, brain, heart, kidney, liver, lung, pancreas or testis. Small amounts of hybridization were observed to small intestine, which may represent lymphoid projections into this tissue.

Northern Blot Analysis of V31 Expression in Hematopoietic Cell Lines

Cells from several hematopoietic cell lines were grown to log phase, harvested by centrifugation, washed two times with 150 mM NaCl, and the pellets stored frozen at -70w.degree. C. To extract RNA, pellets were resuspended in guanidinium isothiocyanate buffer (GIT) and sheared in a polytron mixer for 20 seconds. RNA/GIT mixtures were layered on top of CsCl and centrifuged at 35,000 rpm (179,000.times. g) for 21 hours. RNA pellets were resuspended in H.sub.2 O, ethanol precipitated, and treated with Proteinase K to remove any RNase contamination. After a phenol/chloroform extraction, the RNA was reprecipitated, resuspended in H.sub.2 O and quantitated spectrophotometrically.

10 ug of each RNA sample was used for northern blot analysis. Samples were denatured and electrophoresed through a formaldehyde/agarose gel, transferred to nitrocellulose and hybridized to the .sup.32 P-labelled V31 probe essentially as described in Example 3.

The V31 probe hybridized strongly to the T cell line Hut 78 and the B cell lines Raji and Jijoye. The T cell line CEM also hybridized with V31, but less intensely. In contrast the T cell lines SKW3 and Molt4 failed to hybridize to V31, as did the myeloid lines KG1, K562, HL-60, and U937. These results confirm the Northern and in situ hybridization results on human tissues; V31 is expressed specifically in lymphoid cells and tissues. Results of Northern blot assays for expression of V31 mRNA in other hematopoietic cell lines are presented below in Table 2.

TABLE 2______________________________________ V32 Northern Blot Signal______________________________________T Cell LinesH9 ++MOLT3 -JurkatE6-1 -J.RT3-T3.5 -CCRF-HSB-2 +B Cell LinesMC116 +Ramos -Daudi -CA46 -HS602 ++++______________________________________ Northern Blot Analysis of V28 Expression in Human Tissues and Cell Lines

Expression of V28 mRNA in a variety of human tissues was assayed by northern blot analysis using .sup.32 P-labelled V28 probes. Frozen tissue samples were pulverized in liquid nitrogen using mortar and pestle, and RNA was isolated following the APGC protocol of Chomczynski and Sacchi, Analytical Biochemistry, 162: 156-159 (1986). Briefly, samples were homogenized in a 4 M guanidium thiocyanate buffer and then subjected to several rounds of acid phenol extraction and isopropanol precipitation. RNA samples were treated with RNase-free DNase (Stratagene Cloning Systems, La Jolla, Calif.) for 30 minutes at 37.degree. C. to remove any contaminating DNA, then phenol/chloroform extracted twice, ethanol precipitated, resuspended in DEPC-treated H.sub.2 O and stored at -70.degree. C. until further use. RNA from cell lines was prepared as described above for the analysis of V31.

Ten to 30 .mu.g of each RNA sample were denatured by incubating in 50% formamide and 3.5 M formaldehyde for 10 minutes at 60.degree. C.; bromphenol blue and ethidium bromide were added prior to electrophoresis. Samples were electrophoresed through 1.2% agarose gels containing 2% formaldehyde for 4 hours at 90 volts. After visualizing by UV trans-illumination and photography, RNA was transferred from the gel to nitrocellulose (Schleicher and Schuell) by capillary action overnight in 20.times. SSC. Nitrocellulose blots were baked at 80.degree. C. in a vacuum over for 1-2 hours prior to hybridization.

A 1.5 kb Eco RI fragment containing the entire V28 coding sequence was used as a template to generate the radiolabelled V28 probes. Details of the labeling, hybridization and washing are exactly as described in Example 2. Results of the Northern blot analysis are presented in Table 3 below.

TABLE 3______________________________________Tissue or Cell Line V28 Northern Blot Signal______________________________________Spleen +Thymus +Tonsil +Lymph Node +/-Placenta +Ovary +Testis +Kidney +/-Liver -Brain -Heart -H9 (T cell line) -MOLT3 (T cell line) -Daudi (B cell line) -HL60 (Promyelocytic cell line) +U937 (Promyelocytic cell line) +THP.1 (Promyelocytic cell line) ++++______________________________________ Northern Blot Analysis of R20 in Human Tissues

Expression of the R20 gene in various human tissues was assayed by Northern blot analysis. Poly-A mRNA was isolated from various human tissues, fractionated by denaturing agarose gel electrophoresis, and blotted onto a nitrocellulose membrane.

A probe was prepared from the 1.5 kb HindIII-PstI fragment of R20 as follows. Fifty ng of gel-purified fragment was annealed to 1 .mu.g of random hexamers. The sample was treated with Klenow enzyme in the presence of Klenow buffer (See Example 2), dATP, dGTP, .sup.32 P-dCTP, and 2P-TTP at room temperature for 75 minutes. The labelled fragment was separated from unincorporated nucleotides by passage through a G-25 Quickspin column (Boehringer Mannheim), denatured by boiling, and cooled on ice. This probe was hybridized to the filter for 16 hours at 42.degree. C. in a solution of 5.times. SSC, 50 mM NaPO.sub.4, 5.times. Denhardt's solution, and 10 .mu.g/ml salmon sperm DNA. The filter was subsequently washed in 0.1.times. SSC at 50.degree. C. Hybridization was visualized by autoradiography.

Of the tissues analyzed, the strongest signal was detected in placental RNA. A weaker band of the same apparent molecular weight was also visible in RNA from lymph nodes, kidney, and thymus. No hybridization to liver, ovary, or testis RNA was evident.

EXAMPLE 15

The coding sequence for V31 (and fragments thereof) were engineered for expression in E. coli as a fusion protein with Glutathione-S-Transferase (GST) [Smith et al., Gene, 67: 31-40 (1988)]. Fusion proteins with GST are generally expressed at high levels and can often be easily purified on glutathione-agarose beads. These fusions are useful for providing material for biochemical studies and as immunogens for the preparation of antibodies.

The entire coding sequence of V31 was engineered for expression in the plasmid pGEX-2T such that a fusion protein was produced containing GST at the amino terminal end and V31 at the carboxyl terminal end. The plasmid pGEX-2T contains a lac promoter which drives the expression of GST. The 3' end of the GST gene contains BamHI and EcoRI sites and encodes a thrombin cleavage site. The V31 gene was cloned into pGEX-2T digested with BamHI and EcoRI by first introducing a BamHI site at the 5' end of the V31 gene and an EcoRI site at its 3' end by PCR directed mutagenesis. A 5' oligonucleotide (V31-A, SEQ ID NO: 47) contained a BamHI site encoding residues 225 and 226 of pGEX-2T and 17 bases of the V31 gene, starting with the methionine initiation codon (ATG). The downstream, antisense oligonucleotide (V31-B, SEQ ID NO: 48) contained an EcoRI site and 17 bases of the 3' end of the V31 coding sequence including the natural stop codon. PCR was performed in a Perkin Elmer Cetus machine with the following thermocycling protocol: an initial four minutes to bring the reaction to 94.degree. C., followed by 25 cycles of (1) 94.degree. C. denaturation step for 30 seconds, (2) 60.degree. C. annealing step for 30 seconds, and (3) 72.degree. C. extension step for 30 seconds. The reaction mixture contained 1.times. PCR buffer, 0.25 mM dGTP, 0.25 mM dATP, 0.25 mM dCTP, 0.25 mM TTP, 0.01 .mu.g/.mu.l of each primer, 3.times.10.sup.-7 mg template DNA and 2.5 units Taq polymerase in a total reaction volume of 50 .mu.l. Following PCR, the reaction was extracted with phenol and chloroform and ethanol precipitated. The DNA was then digested at 37.degree. C. with BamHI and EcoRI and electrophoresed on 1% agarose/2% Nusieve agarose gel. The predominant PCR product exhibited an electrophoretic mobility consistent with the predicted size of 1241 bp. This DNA was electroluted and then ligated to a pGEX-2T DNA fragment that had been treated with BamHI and EcoRI and isolated by electrophoresis. The ligated DNA was transformed into competent E. coli and a clone containing the plasmid designated pGEX-V31-F4 was chosen for analysis. The insert DNA coding for the V31 fusion protein was sequenced by the dideoxy chain termination technique.

A shorter fusion protein, containing only the first 90 amino acids of V31 (the predicted first extracellular domain), was also prepared with GST. Simil ar to the above example, BamHI and EcoRI sites were introduced into the V31 coding sequence by PCR directed mutagenesis. The 5' oligonucleotide (V31-A) was identical to that utilized for the first GST fusion and contained a BamHI site for the GST gene and 17-bases of the V31 gene. The downstream antisense oligonucleotide (V31-C, SEQ ID NO: 49) contained 18 bases of the V31 gene and introduced a stop codon (after V31 amino acid 90) followed by an EcoRI site. PCR conditions were performed exactly as above for the first GST fusion. The PCR products were phenol/chloroform extracted and digested with BamHI and EcoRI. The DNA was electrophoresed on a 1% agarose/2% Nusieve agarose gel and exhibited a mobility consistent with a predicted size of 281 bp. This DNA was electroeluted and also ligated into pGEX-2T. The insert of the resulting plasmid, pGEX-V31-N1, was confirmed by sequence analysis.

A third fusion protein was prepared which contained GST fused to all of the four putative extracellular domains. Regions of the V31 amino acid sequence were defined as domains based on their predicted hydrophillicity and contained one to five hydrophobic residues at each end (forming portions of transmembrane segments); this design provides some separation between domains and yet does not change the general hydrophilic nature of the fusion protein. Four separate PCR reactions were performed to amplify DNA encoding each separate domain. The method used to then fuse the domain coding sequences is outlined in Erlich, Ed., pp. 61-70 in PCR Technology, Stockton Press, New York, (1989). The most 5' oligonucleotide (V31-A) used was identical to that used in the two V31 fusions described in the foregoing paragraphs and contained the BamHI site for ligation to the GST gene sequence. The most 3' oligonucleotide (V31-J, SEQ ID NO: 56) contained 17 bases of the V31 gene and introduced a stop codon after V31 amino acid 343, followed by an EcoRI site.

Oligonucleotide V31-D (SEQ ID NO: 50) was paired with the upstream oligonucleotide V31-A to amplify a 294 bp fragment that coded for the first extracellular domain; the V31-A oligonucleotide also contains 12 bases which are homologous with the second extracellular domain oligonucleotide (V31-E, SEQ ID NO: 51). The second extracellular domain was amplified with oligonucleotides V31-E and V31-F (SEQ ID NO: 52). Oligonucleotide V31-E contains 12 bases of first extracellular domain followed by 17 bases of second extracellular domain sequence. Consequently the 3' end of the first extracellular domain PCR product contains 24 identical nucleotides when compared with the 5' end of the second extracellular domain PCR product allowing the two PCR products to be annealed together and reamplified as a fused DNA fragment (using PCR and oligonucleotides V31-A and V31-F). This strategy was also applied to the third and fourth extracellular domains: the third extracellular domain was amplified using oligos V31-G (SEQ ID NO: 53) and V31-H (SEQ ID NO; 54) and the fourth extracellular domain was amplfied using oligos V31-I (SEQ ID NO: 55) and V31-J, and the resulting PCR fragments were annealed and reamplified using oligos V31G and V31-J. Finally, the two DNA fragments containing the first/second and third/fourth extracellular domains were fused together by annealing the fragments and amplifying with oligonucleotides V31-A and V31-J in a tertiary PCR reaction. PCR conditions and digestion with Barn HI and EcoRI were performed as as described for the first two V31 fusion proteins. Products of the initial four PCR reactions were electrophoresed on 1% agarose/2% Nusieve agarose and each reaction yielded the predicted size fragment (294 bp, 75 bp, 105 bp, and 111 bp for extracellular domains one through four, respectively). Secondary reamplification reactions were performed with the same PCR conditions, but the target sequences came from the electrophoresed gels which had been excised by stabbing the appropriate band with a micropipetor tip. The captured agarose (two or three microliters in volume) was then extruded into the secondary PCR reaction. These reactions produced the predicted size DNA fragments of 345 bp (first/second extracellular domains) and 192 bp (third/fourth extracellular domains). These DNA fragments once aneealed were similarly used as template DNA in the final PCR reaction using oligos V31-A and V31-J. The final PCR product was digested with BamHI and EcoRI and exhibited a mobility consistent with the expected 513 bp. The DNA was electroeluted and ligated into pGEX-2T. The resulting plasmid was designated pGEX-V31-X10 and was confirmed to have the predicted DNA sequence.

The amplified sequences and junctions with the GST gene were sequenced to determine that all three designed genes were properly constructed. The three GST/V31 fusion genes were grown in E. coli and their synthesis was induced with IPTG. Cultures were grown to late exponential phase and harvested by centrifugation. Cells were resuspended in PBS and disrupted by sonication. Cellular debris was removed by centrifugation and the supernatant was mixed with Glutathione-agarose beads (Sigma). The beads were then extensively washed in PBS. Proteins bound to the beads were eluted with reduced glutathione (Sigma). Aliquots from each stage of purification were analyzed for protein by SDS-polyacrylamide gel electrophoresis. GST is easily purified by this method and represents the major (greater than 90%) protein eluted from glutathione agarose. The GST fusion protein containing the full length V31 coding sequence produced several protein bands of lower molecular weight (1000, 2500, and 4000 Da larger than GST) than that predicted for the full length fusion protein. These products were eluted from glutathione-agarose beads, but were expressed at lower levels than GST. These proteins may be the products of the fusion proteolysis (see below). No protein band was observed at the predicted molecular weight for the full length V31-GST fusion protein.

The GST fusion protein containing the first extracellular domain (pGEX-V31-N1) produced several protein bands that were purified on glutathione-agarose. One of these corresponded with the approximate predicted size (10,000 Da larger than GST) and three smaller bands exhibited mobilities identical with the GST fusion protein containing full length V31.

Purification of the GST fusion protein containing all four extracellular domains (pGEX-V31-X10) was also attempted. Only small amounts of protein were eluted from glutathione-agarose beads, and these had the same mobility as the PGEX-V31-F4 bands and the smaller pGEX-V31-X10 bands. However, a large amount of protein remained associated with the cell pellet and exhibited a mobility consistent with the predicted fusion protein size. Amino terminal amino acid sequencing was performed on this electrophoretically purified material, and the sequence was determined to be the amino terminal sequence of GST. This protein may thus represent the GST fusion protein with the four V31 extracellular domains which may form inclusion bodies during synthesis and therefore be insoluble and associated with the cell pellet.

There are several observations that suggest that V31 may recognize a protease. The structure of V31 is very similar to the thrombin receptor. V31 shares 30% similarity to the thrombin receptor and both molecules have unusually long first extracellular domains (89 residues for V31, 100 for thrombin). The thrombin receptor contains a thrombin cleavage site in this first extracellular domain and the receptor becomes activated following proteolysis. V31 contains a prominent proteolytic recognition sequence including five adjacent lysines (amino acid positions 18-22) that should be a good target for a protease specific for basic residues (several such proteases exist, such as trypsin). Moreover, experimental observations with GST-V31 fusion proteins suggest that the first extracellular domain is an obvious target for an E. coli protease. During the isolation of each of the three fusion proteins, some of the material was found to be partially degraded as described in the foregoing paragraphs. The sites of proteolysis are presumably in the first extracellular domain since that is the only sequence common to the three fusion proteins. The size (2500 Da larger than GST) of at least one of these potential degradation products is consistent with cleavage at or near adjacent lysines. This result suggests that the first extracellular domain is accessible to cleavage by E. coli proteases; such accessibility to a human protease may result in cleavage and subsequent V31 signal transduction events in vivo.

EXAMPLE 16

The extracellular domains of the R20 sequence were also engineered for expression in E. coli as a fusion protein with GST. As described in Example 15 for V31 domains, the R20 domains were chosen by their predicted hydrophillicity. Four independent PCR reactions were performed to amplify each domain.

The 5' oligonucleotide (R20-X1, SEQ ID NO: 57) encodes a BamHI site for ligation to the GST gene, followed by 15 nucleotides of the R20 gene (beginning with the methionine initiation codon). The most 3' oligonucleotide (R20 Y4, SEQ ID NO: 64) contained 18 residues of the R20 gene (fourth extracellular coding segment), introduced a stop codon after R20 amino acid 286, and was followed by an EcoRI site. The first extracellular domain coding sequence was prepared by PCR with oligonucleotides R20-X1 and R20-Y1 (SEQ ID NO: 58) using conditions described in Example 15. Similarly, the second, third, and fourth extracellular domain coding sequences were amplified with primer pairs R20-X2 (SEQ ID NO: 59) and R20-Y2 (SEQ ID NO: 60); R20X3 (SEQ ID NO: 61) and R20-Y3 (SEQ ID NO:62); and R20-X4 (SEQ ID NO: 63) and R20Y4, respectively. The first and second extracellular domain coding sequences were fused together by a secondary PCR reaction, similar to that described in Example 15 (primers R20Y1 and R20-X2 share 30 overlapping nucleotides which allow the two primary PCR products to anneal together for the amplification of a fused DNA fragment; the PCR reaction contains the two primary PCR products and primers R2-X1 and R20Y2). The third and fourth extracellular domain coding sequences were similarly fused together in a PCR reaction with primers R20-X3 and R20Y4. Finally, the PCR products from the secondary reactions were annealed and amplified in a tertiary PCR with primers R20-X1 and R20Y4; this reaction produced a DNA which encoded the four extracellular domains. The DNA was digested with BamHI and EcoRI and then ligated into pGEX-2T as described in Example 15. The resulting plasmid was designated pGEX-RDF6 and the insert was confirmed by DNA sequence analysis.

As described in Example 15, E. coli harboring this plasmid were grown and analyzed for production of a GST-R20 domain fusion protein. A protein band of the appropriate mobility was observed on SDS-PAGE of glutathione agarose purified material. Several lower molecular weight species (about 1000 Da smaller) were also observed which may represent proteolytic cleavage products. All of these bands could be cleaved with thrombin to yield a band which emigrated with GST. This result suggests that the E. coli cultures produce GST fusion proteins with R20 extracellular domain sequences. The material purified on glutathione agarose was directly used for immunization of mice for the preparation of antibodies as described below in Example 18.

EXAMPLE 17

By methods similar to those described in Examples 15 and 16, V31-B and V28 coding sequences were engineered to be expressed as GST fusion proteins.

The coding sequence of interest (from the V31-B cDNA described in Example 3 or the V28 cDNA described in Example 6) was cloned into the BamHI and EcoRI sites of pGEX-2T. Single bacterial colonies containing the resulting V31-B or V28 plasmids were used to inoculate 50 ml L broth/carbenicillin and was grown overnight at 37.degree. C. The overnight cultures were diluted 10-fold to 500 ml with L broth/carbenicillin and incubated for 1.5 hours at 37.degree. C. IPTG was added to 1 mM and the culture was incubated for 3.5 hours at 37.degree. C. Bacteria were pelleted, resuspended in 15 ml PBS/1% Triton X-100 and sonicated with five 45-second bursts while keeping ice cold. Homogenate was aliquoted and spun in a microfuge at full speed for 5 minutes. Pellets were resuspended in a total of 3 ml PBS/1% Triton X-100. Half of the sample was brought to 10 ml with 3.5 ml H.sub.2 O, 4.5 ml 2.times. sample buffer and 0.5 ml 2M DTT. The sample was boiled for 3 minutes and spun before loading on two 10% acrylamide SDS preparative gels. Gels were run at 30 mA for approximately 15 hours then incubated in ice cold 0.4 M KCl to visualize protein bands. The induced band was cut out and electroeluted for 4 hours at 50 mA into approximately 10 ml Tris-glycine buffer (no SDS) in dialysis tubing. When necessary, the eluted fusion protein was concentrated in Amicon microconcentrators with 30 kD molecular weight cut-off.

EXAMPLE 18

Generation of Antibodies to V31 and V28 Fusion Proteins

The GST-V31 fusion proteins V31-N1 and V31-X10 described in Example 15 were purified on glutathione-agarose and emulsified with an equal volume of Freunds adjuvant (complete for the first injection and incomplete for all subsequent injections). Two Balb/c mice were initially immunized subcutaneously with approximately 200 .mu.l of each construct. Subsequent boosts were made at two week intervals and the mice were bled retro-orbitally after three boosts.

Immunological reactivity was assessed by Western blot analysis. Approximately 25 .mu.g of either the immunizing protein or GST was resolved on a 10% polyacrylamide gel and transferred to nitrocellulose. The filter was blocked in PBS containing 5% non-fat dried milk and 1% BSA for 2-15 hours at 4.degree. C. The sera (either pre-immune or immune) was diluted 1:50 in blocking buffer in a final volume of 2 ml, incubated with the filter strip for 1 hour at 4.degree. C. and washed three times with 50 ml of PBS. Sheep anti-mouse Ig conjugated to horseradish peroxidase (Amersham) was diluted 1:500 in PBS and incubated with each filter for 1 hour at-4.degree. C. The filters were washed 3 times in 100 ml of PBS and placed in s ml of 3,3'diaminobenzidine (0.6 mg/ml in 10 mM Tris-HCl; 0.6% NiCl.sub.2 ; 0.06% H.sub.2 O.sub.2). Immunoreactivity to V31 fusion proteins was observed from sera of mice immunized to V31-N1 and V31-X10. In addition, immunoreactivity was observed to the thrombin cleaved V31-N1 products (both GST and the V31 amino terminal domain).

The extracellular domains of V31-B and V28 were also used to immunize rabbits as GST fusion proteins. Antibodies raised in rabbits recognized the respective fusion protein on Western blots. In addition, the antiserum also recognized the respective fusion protein on Western blots and the thrombin cleaved fusion proteins including the fragments corresponding to the ext acellular domains of V31B or V28.

Generation of Antibodies to V31 Peptides

V31 peptides to be used to generate V31 specific antibodies include, for example:

Peptide ECDN-B (Amino acids 1 to 15 of SEQ ID NO: 15) MDLGKPMKSVLC Amino acid residue 12 (a cysteine) was added to the peptide to facilitate conjugation of the peptide to an immunogen carrier. Another peptide is: Peptide ECD2 (Amino acids 116 to 129 of SEQ ID NO: 15) YSAAKSWVFGVHFC Peptide ECDN-B corresponds to the amino terminal end of the first extracellular domain of V31 while peptide ECD2 corresponds to a region of the second extracellular domain of V31.

EXAMPLE 19

Various methods may be used to identify extracellular and intracellular ligands for the 7TM receptors of the invention.

For example, because 7TM receptors are coupled to G proteins to effect biological responses, the secondary signal transduction events [reviewed by Linder et al., Sci. Am., 267: 56-65, (1992)] that are utilize by G proteins can be utilized to assay for recombinant 7TM receptor function. Assays for the activity of G protein effector molecules (e.g., adenylyl cyclase, phospholipase C, ion channels, and phosphodiesterases) have previously been described. For example, concentration of cyclic AMP can be measured by a commercial radioimmunoassay; phosphoinositide production can easily be monitored [Downes et al., Biochem. J., 198: 133-140 (1981)]; and the transient release of intracellular calcium ion stores can be observed with spectrofluorimetry. These assays can be performed on mammalian cells expressing 7TM receptors of the invention in the presence and absence of test compounds to identify or purify potential ligands of the 7TM receptors and such assays may also be used for the identification or purification of agonists or antagonists of 7TM receptors.

As another example, a calcium flux assay can be used to identify solutions or cellular extracts containing ligands for 7TM recpetors of the invention. Specifically, 293 cells transfected with DNA sequences of the invention encoding a 7TM receptor are grown in a 10 cm dish to .about.90% confluence in MEM +10% serum. Cells are washed with CMF-PBS and loaded with Fura-2 by incubating in 4 ml MEM+10% serum+1 uM Fura-2 AM (Molecular Probes--1 mM stock made in DMSO and frozen in aliquots) for 30 minutes at room temperature. Cells are again washed and removed from plate with versene. Cells are pelleted, washed in D-PBS (containing 1 mM Ca.sup.++) and resuspended in .about.500 ul D-PBS for a concentration of .about.10.sup.7 /ml. Fluorescence changes are monitored in a Hitachi F-4010 fluorescence spectrophotometer. Approximately 101 cells are suspended in a total of 1.8 ml D-PBS with stirring in a cuvette maintained at 37.degree. C. Excitation wavelengths alternate between 340 nm and 380 nm at 4 second intervals while emission is monitored at 510 nm. Test compounds are added through an injection port. At the end of the experiment, ionomycin is added to measure the maximal Ca.sup.++ flux.

A transient Ca.sup.++ flux is indicative of the presence of a ligand for the 7TM receptor in the solution being tested.

Transfected 293 cell lines expressing V28 or V31 RNA (Example 13) were examined in the Ca.sup.++ flux assay using several chemokines as potential ligands for the 7TM receptors. None of the tested ligands stimulated a Ca.sup.++ flux through either V28 or V31. The chemokines tested were: EL8, NAP-2, GRO/MGSA, IP-10, M1P-1.alpha., M1P-1.beta., MCP-1, and RANTES. There were two controls for the assay. First, untransfected 293 cells express the thrombin receptor and treatment of untransfected 293 cells with thrombin resulted in an observable Ca.sup.++ flux. Second, 293 cells were transfected with sequences encoding the IL-8 receptor and treatment of transfected cells with IL-8 also resulted in an observable Ca.sup.++ flux.

The foregoing illustrative examples relate to presently preferred embodiments of the invention and numerous modifications and variations thereof will be expected to occur to those in the art. Thus only such limitations as appear in the appended claims should be placed upon the scope of the present invention.

__________________________________________________________________________# SEQUENCE LISTING- (1) GENERAL INFORMATION:- (iii) NUMBER OF SEQUENCES: 66- (2) INFORMATION FOR SEQ ID NO:1:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 69 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:- GACGGATCCG TTTTTCTGTT GAATTTGGCT CTGGCTGACY TAYKCTTTKY MC - #TGACYTTG 60# 69- (2) INFORMATION FOR SEQ ID NO:2:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 32 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA- (ix) FEATURE: (A) NAME/KEY: modified.sub.-- - #base (B) LOCATION: 12#/note= "The modified base at this#is an inosine."osition- (ix) FEATURE: (A) NAME/KEY: modified.sub.-- - #base (B) LOCATION: 15#/note= "The modified base at this#is an inosine."osition- (ix) FEATURE: (A) NAME/KEY: modified.sub.-- - #base (B) LOCATION: 18#/note= "The modified base at this#is an inosine."osition- (ix) FEATURE: (A) NAME/KEY: misc.sub.-- - #difference#"") (B) LOCATION: replace(21,#/note= "The nucleotide at this:#is cytosine or thymine or uracil or inosine."- (ix) FEATURE: (A) NAME/KEY: modified.sub.-- - #base (B) LOCATION: 27#/note= "The modified base at this#is an inosine."osition- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:# 32 TNGC NAGRTANCGR TC- (2) INFORMATION FOR SEQ ID NO:3:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 120 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:- GTGGATAAAG AAGCATCTCT AGGACTGTGG AGGACGGGCT CCTTCCTGTG CA - #AAGGGAGC 60- TCCTACATGA TCTCCGTCAA TATGCACTGC AGTGTCCTCC TGCTCACTTG CA - #TGAGTGTT 120- (2) INFORMATION FOR SEQ ID NO:4:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 20 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:# 20 CCAA- (2) INFORMATION FOR SEQ ID NO:5:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 20 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:# 20 GAAG- (2) INFORMATION FOR SEQ ID NO:6:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 2058 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 166..1395- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:- GATGAACCAC TATTCCTCCG CCTGGGCAAC ATGGCAGAAT CCCATCTCTA CT - #AAAAATAC 60- AAAAATTCGC TGGGGTGTGG TGGCATAAGG CTGTGGTCCC AGCTACTCAG GA - #GGCTGAAG 120#ATT GCA 174GCCT GGAGAGGCCG AGGCTGCAGG GAGCC ATG# Met Ile A - #la# 1- CCA CTG CAC TCC AGC CTG GGC AAC AGA GTG AG - #A CCA TGT CTC AAG AAA 222Pro Leu His Ser Ser Leu Gly Asn Arg Val Ar - #g Pro Cys Leu Lys Lys# 15- AAA AAA AAA GAA AGA AAC CAC TGC TCT AGG CT - #A AAT CCC AGC CAG AGT 270Lys Lys Lys Glu Arg Asn His Cys Ser Arg Le - #u Asn Pro Ser Gln Ser# 35- TGG AGC CAC CCA GCT AAA CTG GCC TGT TTT CC - #C TCA TTT CCT TCC CCG 318Trp Ser His Pro Ala Lys Leu Ala Cys Phe Pr - #o Ser Phe Pro Ser Pro# 50- AAG GTA TGC CTG TGT CAA GAT GAG GTC ACG GA - #C GAT TAC ATC GGA GAC 366Lys Val Cys Leu Cys Gln Asp Glu Val Thr As - #p Asp Tyr Ile Gly Asp# 65- AAC ACC ACA GTG GAC TAC ACT TTG TTC GAG TC - #T TTG TGC TCC AAG AAG 414Asn Thr Thr Val Asp Tyr Thr Leu Phe Glu Se - #r Leu Cys Ser Lys Lys# 80- GAC GTG CGG AAC TTT AAA GCC TGG TTC CTC CC - #T ATC ATG TAC TCC ATC 462Asp Val Arg Asn Phe Lys Ala Trp Phe Leu Pr - #o Ile Met Tyr Ser Ile# 95- ATT TGT TTC GTG GGC CTA CTG GGC AAT GGG CT - #G GTC GTG TTG ACC TAT 510Ile Cys Phe Val Gly Leu Leu Gly Asn Gly Le - #u Val Val Leu Thr Tyr100 1 - #05 1 - #10 1 -#15- ATC TAT TTC AAG AGG CTC AAG ACC ATG ACC GA - #T ACC TAC CTG CTC AAC 558Ile Tyr Phe Lys Arg Leu Lys Thr Met Thr As - #p Thr Tyr Leu Leu Asn# 130- CTG GCG GTG GCA GAC ATC CTC TTC CTC CTG AC - #C CTT CCC TTC TGG GCC 606Leu Ala Val Ala Asp Ile Leu Phe Leu Leu Th - #r Leu Pro Phe Trp Ala# 145- TAC AGC GCG GCC AAG TCC TGG GTC TTC GGT GT - #C CAC TTT TGC AAG CTC 654Tyr Ser Ala Ala Lys Ser Trp Val Phe Gly Va - #l His Phe Cys Lys Leu# 160- ATC TTT GCC ATC TAC AAG ATG AGC TTC TTC AG - #T GGC ATG CTC CTA CTT 702Ile Phe Ala Ile Tyr Lys Met Ser Phe Phe Se - #r Gly Met Leu Leu Leu# 175- CTT TGC ATC AGC ATT GAC CGC TAC GTG GCC AT - #C GTC CAG GCT GTC TCA 750Leu Cys Ile Ser Ile Asp Arg Tyr Val Ala Il - #e Val Gln Ala Val Ser180 1 - #85 1 - #90 1 -#95- GCT CAC CGC CAC CGT GCC CGC GTC CTT CTC AT - #C AGC AAG CTG TCC TGT 798Ala His Arg His Arg Ala Arg Val Leu Leu Il - #e Ser Lys Leu Ser Cys# 210- GTG GGC ATC TGG ATA CTA GCC ACA GTG CTC TC - #C ATC CCA GAG CTC CTG 846Val Gly Ile Trp Ile Leu Ala Thr Val Leu Se - #r Ile Pro Glu Leu Leu# 225- TAC AGT GAC CTC CAG AGG AGC AGC AGT GAG CA - #A GCG ATG CGA TGC TCT 894Tyr Ser Asp Leu Gln Arg Ser Ser Ser Glu Gl - #n Ala Met Arg Cys Ser# 240- CTC ATC ACA GAG CAT GTG GAG GCC TTT ATC AC - #C ATC CAG GTG GCC CAG 942Leu Ile Thr Glu His Val Glu Ala Phe Ile Th - #r Ile Gln Val Ala Gln# 255- ATG GTG ATC GGC TTT CTG GTC CCC CTG CTG GC - #C ATG AGC TTC TGT TAC 990Met Val Ile Gly Phe Leu Val Pro Leu Leu Al - #a Met Ser Phe Cys Tyr260 2 - #65 2 - #70 2 -#75- CTT GTC ATC ATC CGC ACC CTG CTC CAG GCA CG - #C AAC TTT GAG CGC AAC1038Leu Val Ile Ile Arg Thr Leu Leu Gln Ala Ar - #g Asn Phe Glu Arg Asn# 290- AAG GCC ATC AAG GTG ATC ATC GCT GTG GTC GT - #G GTC TTC ATA GTC TTC1086Lys Ala Ile Lys Val Ile Ile Ala Val Val Va - #l Val Phe Ile Val Phe# 305- CAG CTG CCC TAC AAT GGG GTG GTC CTG GCC CA - #G ACG GTG GCC AAC TTC1134Gln Leu Pro Tyr Asn Gly Val Val Leu Ala Gl - #n Thr Val Ala Asn Phe# 320- AAC ATC ACC AGT AGC ACC TGT GAG CTC AGT AA - #G CAA CTC AAC ATC GCC1182Asn Ile Thr Ser Ser Thr Cys Glu Leu Ser Ly - #s Gln Leu Asn Ile Ala# 335- TAC GAC GTC ACC TAC AGC CTG GCC TGC GTC CG - #C TGC TGC GTC AAC CCT1230Tyr Asp Val Thr Tyr Ser Leu Ala Cys Val Ar - #g Cys Cys Val Asn Pro340 3 - #45 3 - #50 3 -#55- TTC TTG TAC GCC TTC ATC GGC GTC AAG TTC CG - #C AAC GAT CTC TTC AAG1278Phe Leu Tyr Ala Phe Ile Gly Val Lys Phe Ar - #g Asn Asp Leu Phe Lys# 370- CTC TTC AAG GAC CTG GGC TGC CTC AGC CAG GA - #G CAG CTC CGG CAG TGG1326Leu Phe Lys Asp Leu Gly Cys Leu Ser Gln Gl - #u Gln Leu Arg Gln Trp# 385- TCT TCC TGT CGG CAC ATC CGG CGC TCC TCC AT - #G AGT GTG GAG GCC GAG1374Ser Ser Cys Arg His Ile Arg Arg Ser Ser Me - #t Ser Val Glu Ala Glu# 400- ACC ACC ACC ACC TTC TCC CCA TAGGCGACTC TTCTGCCTG - #G ACTAGAGGGA1425Thr Thr Thr Thr Phe Ser Pro# 410- CCTCTCCCAG GGTCCCTGGG GCGGGGATAG GGAGNAGATG CAATGACTCA GG - #ACATCCCC1485- CCGCCAAAAG CTGCTCAGGG AAAAGCAGCT CTCCCCTCAG AGTGCAAGCC CT - #GCTCCAGA1545- AGTTAGCTTC ACCCCAATCC CAGCTACCTC AACCAATGCC GAAAAAGACA GG - #GCTGATAA1605- GCTAACACCA GACAGACAAC ACTGGGAAAC AGAGGCTATT GTCCCCTAAA CC - #AAAAACTG1665- AAAGTGAAAG TCCAGAAACT GTTCCCACCT GCTGGAGTGA AGGGGCCAAG GA - #GGGTGAGT1725- GCAAGGGGCN GTGGGAGTGG CCTGAAGAGT CCTCTGAATG AACCTTCTGG CC - #TCCCACAG1785- ACTCAAATGC TCAGACCAGC TCTTCCGAAA ACCAGGCCTT ATCTCCAAGA CC - #AGAGATAG1845- TGGGGAGACT TCTTGGCTTG GTGAGGAAAA GCGGACATCA GCAGCTGGTC AA - #ACAAACTC1905- TCTGAACCCC TCCCTCCATC GTTTTCTTCA CTGTCCTCCA AGCCAGCGGG AA - #TGCAGCTG1965- CCACGCCGCC CTAAAAGCAC ACTCATCCCC TCACTTGCCG CGTCGCCCTC CC - #AGGCTCTC2025# 2058 GTGT TTCCTTCCTG CAG- (2) INFORMATION FOR SEQ ID NO:7:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 410 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:- Met Ile Ala Pro Leu His Ser Ser Leu Gly As - #n Arg Val Arg Pro Cys# 15- Leu Lys Lys Lys Lys Lys Glu Arg Asn His Cy - #s Ser Arg Leu Asn Pro# 30- Ser Gln Ser Trp Ser His Pro Ala Lys Leu Al - #a Cys Phe Pro Ser Phe# 45- Pro Ser Pro Lys Val Cys Leu Cys Gln Asp Gl - #u Val Thr Asp Asp Tyr# 60- Ile Gly Asp Asn Thr Thr Val Asp Tyr Thr Le - #u Phe Glu Ser Leu Cys# 80- Ser Lys Lys Asp Val Arg Asn Phe Lys Ala Tr - #p Phe Leu Pro Ile Met# 95- Tyr Ser Ile Ile Cys Phe Val Gly Leu Leu Gl - #y Asn Gly Leu Val Val# 110- Leu Thr Tyr Ile Tyr Phe Lys Arg Leu Lys Th - #r Met Thr Asp Thr Tyr# 125- Leu Leu Asn Leu Ala Val Ala Asp Ile Leu Ph - #e Leu Leu Thr Leu Pro# 140- Phe Trp Ala Tyr Ser Ala Ala Lys Ser Trp Va - #l Phe Gly Val His Phe145 1 - #50 1 - #55 1 -#60- Cys Lys Leu Ile Phe Ala Ile Tyr Lys Met Se - #r Phe Phe Ser Gly Met# 175- Leu Leu Leu Leu Cys Ile Ser Ile Asp Arg Ty - #r Val Ala Ile Val Gln# 190- Ala Val Ser Ala His Arg His Arg Ala Arg Va - #l Leu Leu Ile Ser Lys# 205- Leu Ser Cys Val Gly Ile Trp Ile Leu Ala Th - #r Val Leu Ser Ile Pro# 220- Glu Leu Leu Tyr Ser Asp Leu Gln Arg Ser Se - #r Ser Glu Gln Ala Met225 2 - #30 2 - #35 2 -#40- Arg Cys Ser Leu Ile Thr Glu His Val Glu Al - #a Phe Ile Thr Ile Gln# 255- Val Ala Gln Met Val Ile Gly Phe Leu Val Pr - #o Leu Leu Ala Met Ser# 270- Phe Cys Tyr Leu Val Ile Ile Arg Thr Leu Le - #u Gln Ala Arg Asn Phe# 285- Glu Arg Asn Lys Ala Ile Lys Val Ile Ile Al - #a Val Val Val Val Phe# 300- Ile Val Phe Gln Leu Pro Tyr Asn Gly Val Va - #l Leu Ala Gln Thr Val305 3 - #10 3 - #15 3 -#20- Ala Asn Phe Asn Ile Thr Ser Ser Thr Cys Gl - #u Leu Ser Lys Gln Leu# 335- Asn Ile Ala Tyr Asp Val Thr Tyr Ser Leu Al - #a Cys Val Arg Cys Cys# 350- Val Asn Pro Phe Leu Tyr Ala Phe Ile Gly Va - #l Lys Phe Arg Asn Asp# 365- Leu Phe Lys Leu Phe Lys Asp Leu Gly Cys Le - #u Ser Gln Glu Gln Leu# 380- Arg Gln Trp Ser Ser Cys Arg His Ile Arg Ar - #g Ser Ser Met Ser Val385 3 - #90 3 - #95 4 -#00- Glu Ala Glu Thr Thr Thr Thr Phe Ser Pro# 410- (2) INFORMATION FOR SEQ ID NO:8:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 28 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:# 28 AAAG TTCCGCAC- (2) INFORMATION FOR SEQ ID NO:9:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 20 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:# 20 TGGA- (2) INFORMATION FOR SEQ ID NO:10:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 60 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:- GTATGCCTGT GTCAAGATGA GGTCACGGAC GATTACATCG GAGACAACAC CA - #CAGTGGAC 60- (2) INFORMATION FOR SEQ ID NO:11:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 60 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:11:- TTAAAGTTCC GCACGTCCTT CTTGGAGCAC AAAGACTCGA ACAAAGTGTA GT - #CCACTGTG 60- (2) INFORMATION FOR SEQ ID NO:12:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 238 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:12:- GAATTCTGCG AGGCCGGGCA CAGCCTTCCT GTGTGGTTTT ACCGCCCAGA GA - #GCGTCATG 60- GACCTGGGGA AACCAATGAA AAGCGTGCTG GTGGTGGCTC TCCTTGTCAT TT - #TCCAGGTA 120- TGCCTGTGTC AAGATGAGGT CACGGACGAT TACATCGGAG ACAACACCAC AG - #TGGACTAC 180- ACTTTGTTCG AGTCTTTGTG CTCCAAGAAG GACGTGCGGA ACTTTAAAGC CT - #GAATTC 238- (2) INFORMATION FOR SEQ ID NO:13:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 19 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:13:# 19 TGG- (2) INFORMATION FOR SEQ ID NO:14:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 2160 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 64..1197- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:14:- AGACAGGGGT AGTGCGAGGC CGGGCACAGC CTTCCTGTGT GGTTTTACCG CC - #CAGAGAGC 60- GTC ATG GAC CTG GGG AAA CCA ATG AAA AGC GT - #G CTG GTG GTG GCT CTC 108#Ser Val Leu Val Val Ala LeuMet Lys# 15- CTT GTC ATT TTC CAG GTA TGC CTG TGT CAA GA - #T GAG GTC ACG GAC GAT 156Leu Val Ile Phe Gln Val Cys Leu Cys Gln As - #p Glu Val Thr Asp Asp# 30- TAC ATC GGA GAC AAC ACC ACA GTG GAC TAC AC - #T TTG TTC GAG TCT TTG 204Tyr Ile Gly Asp Asn Thr Thr Val Asp Tyr Th - #r Leu Phe Glu Ser Leu# 45- TGC TCC AAG AAG GAC GTG CGG AAC TTT AAA GC - #C TGG TTC CTC CCT ATC 252Cys Ser Lys Lys Asp Val Arg Asn Phe Lys Al - #a Trp Phe Leu Pro Ile# 60- ATG TAC TCC ATC ATT TGT TTC GTG GGC CTA CT - #G GGC AAT GGG CTG GTC 300Met Tyr Ser Ile Ile Cys Phe Val Gly Leu Le - #u Gly Asn Gly Leu Val# 75- GTG TTG ACC TAT ATC TAT TTC AAG AGG CTC AA - #G ACC ATG ACC GAT ACC 348Val Leu Thr Tyr Ile Tyr Phe Lys Arg Leu Ly - #s Thr Met Thr Asp Thr# 95- TAC CTG CTC AAC CTG GCG GTG GCA GAC ATC CT - #C TTC CTC CTG ACC CTT 396Tyr Leu Leu Asn Leu Ala Val Ala Asp Ile Le - #u Phe Leu Leu Thr Leu# 110- CCC TTC TGG GCC TAC AGC GCG GCC AAG TCC TG - #G GTC TTC GGT GTC CAC 444Pro Phe Trp Ala Tyr Ser Ala Ala Lys Ser Tr - #p Val Phe Gly Val His# 125- TTT TGC AAG CTC ATC TTT GCC ATC TAC AAG AT - #G AGC TTC TTC AGT GGC 492Phe Cys Lys Leu Ile Phe Ala Ile Tyr Lys Me - #t Ser Phe Phe Ser Gly# 140- ATG CTC CTA CTT CTT TGC ATC AGC ATT GAC CG - #C TAC GTG GCC ATC GTC 540Met Leu Leu Leu Leu Cys Ile Ser Ile Asp Ar - #g Tyr Val Ala Ile Val# 155- CAG GCT GTC TCA GCT CAC CGC CAC CGT GCC CG - #C GTC CTT CTC ATC AGC 588Gln Ala Val Ser Ala His Arg His Arg Ala Ar - #g Val Leu Leu Ile Ser160 1 - #65 1 - #70 1 -#75- AAG CTG TCC TGT GTG GGC ATC TGG ATA CTA GC - #C ACA GTG CTC TCC ATC 636Lys Leu Ser Cys Val Gly Ile Trp Ile Leu Al - #a Thr Val Leu Ser Ile# 190- CCA GAG CTC CTG TAC AGT GAC CTC CAG AGG AG - #C AGC AGT GAG CAA GCG 684Pro Glu Leu Leu Tyr Ser Asp Leu Gln Arg Se - #r Ser Ser Glu Gln Ala# 205- ATG CGA TGC TCT CTC ATC ACA GAG CAT GTG GA - #G GCC TTT ATC ACC ATC 732Met Arg Cys Ser Leu Ile Thr Glu His Val Gl - #u Ala Phe Ile Thr Ile# 220- CAG GTG GCC CAG ATG GTG ATC GGC TTT CTG GT - #C CCC CTG CTG GCC ATG 780Gln Val Ala Gln Met Val Ile Gly Phe Leu Va - #l Pro Leu Leu Ala Met# 235- AGC TTC TGT TAC CTT GTC ATC ATC CGC ACC CT - #G CTC CAG GCA CGC AAC 828Ser Phe Cys Tyr Leu Val Ile Ile Arg Thr Le - #u Leu Gln Ala Arg Asn240 2 - #45 2 - #50 2 -#55- TTT GAG CGC AAC AAG GCC ATC AAG GTG ATC AT - #C GCT GTG GTC GTG GTC 876Phe Glu Arg Asn Lys Ala Ile Lys Val Ile Il - #e Ala Val Val Val Val# 270- TTC ATA GTC TTC CAG CTG CCC TAC AAT GGG GT - #G GTC CTG GCC CAG ACG 924Phe Ile Val Phe Gln Leu Pro Tyr Asn Gly Va - #l Val Leu Ala Gln Thr# 285- GTG GCC AAC TTC AAC ATC ACC AGT AGC ACC TG - #T GAG CTC AGT AAG CAA 972Val Ala Asn Phe Asn Ile Thr Ser Ser Thr Cy - #s Glu Leu Ser Lys Gln# 300- CTC AAC ATC GCC TAC GAC GTC ACC TAC AGC CT - #G GCC TGC GTC CGC TGC1020Leu Asn Ile Ala Tyr Asp Val Thr Tyr Ser Le - #u Ala Cys Val Arg Cys# 315- TGC GTC AAC CCT TTC TTG TAC GCC TTC ATC GG - #C GTC AAG TTC CGC AAC1068Cys Val Asn Pro Phe Leu Tyr Ala Phe Ile Gl - #y Val Lys Phe Arg Asn320 3 - #25 3 - #30 3 -#35- GAT CTC TTC AAG CTC TTC AAG GAC CTG GGC TG - #C CTC AGC CAG GAG CAG1116Asp Leu Phe Lys Leu Phe Lys Asp Leu Gly Cy - #s Leu Ser Gln Glu Gln# 350- CTC CGG CAG TGG TCT TCC TGT CGG CAC ATC CG - #G CGC TCC TCC ATG AGT1164Leu Arg Gln Trp Ser Ser Cys Arg His Ile Ar - #g Arg Ser Ser Met Ser# 365- GTG GAG GCC GAG ACC ACC ACC ACC TTC TCC CC - #A TAGGCGACTC TTCTGCCTGG1217Val Glu Ala Glu Thr Thr Thr Thr Phe Ser Pr - #o# 375- ACTAGAGGGA CCTCTCCCAG GGTCCCTGGG GTGGGGATAG GGAGCAGATG CA - #ATGACTCA1277- GGACATCCCC CCGCCAAAAG CTGCTCAGGG AAAAGCAGCT CTCCCCTCAG AG - #TGCAAGCC1337- CTGCTCCAGA AGTTAGCTTC ACCCCAATCC CAGCTACCTC AACCAATGCC GA - #AAAAGACA1397- GGGCTGATAA GCTAACACCA GACAGACAAC ACTGGGAAAC AGAGGCTATT GT - #CCCCTAAA1457- CCAAAAACTG AAAGTGAAAG TCCAGAAACT GTTCCCACCT GCTGGAGTGA AG - #GGGCCAAG1517- GAGGGTGAGT GCAAGGGGCG TGGGAGTGGC CTGAAGAGTC CTCTGAATGA AC - #CTTCTGGC1577- CTCCCACAGA CTCAAATGCT CAGACCAGCT CTTCCGAAAA CCAGGCCTTA TC - #TCCAAGAC1637- CAGAGATAGT GGGGAGACTT CTTGGCTTGG TGAGGAAAAG CGGACATCAG CA - #GCTGGTCA1697- AACAAACTCT CTGAACCCCT CCCTCCATCG TTTTCTTCAC TGTCCTCCAA GC - #CAGCGGGA1757- ATGCAGCTGC CACGCCGCCC TAAAAGCACA CTCATCCCCT CACTTGCCGC GT - #CGCCCTCC1817- CAGGCTCTCA ACAGGGGAGA GTGTGGTGTT TCCTGCAGGC CAGGCCAGCT GC - #CTCCGCGT1877- GATCAAAGCC ACACTCTGGG CTCCAGAGTG GGGATGACAT GCACTCAGCT CT - #TGGCTCCA1937- CTGGGATGGG AGGAGAGGAC AAGGGAAATG TCAGGGGCGG GGAGGGTGAC AG - #TGGCCGCC1997- CAAGGCCCAC GAGCTTGTTC TTTGTTCTTT GTCACAGGGA CTGAAAACCT CT - #CCTCATGT2057- TCTGCTTTCG ATTCGTTAAG AGAGCAACAT TTTACCCACA CACAGATAAA GT - #TTTCCCTT2117# 216 - #0AAAAAAAA AAAAAAAGAA TTC- (2) INFORMATION FOR SEQ ID NO:15:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 378 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:15:- Met Asp Leu Gly Lys Pro Met Lys Ser Val Le - #u Val Val Ala Leu Leu# 15- Val Ile Phe Gln Val Cys Leu Cys Gln Asp Gl - #u Val Thr Asp Asp Tyr# 30- Ile Gly Asp Asn Thr Thr Val Asp Tyr Thr Le - #u Phe Glu Ser Leu Cys# 45- Ser Lys Lys Asp Val Arg Asn Phe Lys Ala Tr - #p Phe Leu Pro Ile Met# 60- Tyr Ser Ile Ile Cys Phe Val Gly Leu Leu Gl - #y Asn Gly Leu Val Val# 80- Leu Thr Tyr Ile Tyr Phe Lys Arg Leu Lys Th - #r Met Thr Asp Thr Tyr# 95- Leu Leu Asn Leu Ala Val Ala Asp Ile Leu Ph - #e Leu Leu Thr Leu Pro# 110- Phe Trp Ala Tyr Ser Ala Ala Lys Ser Trp Va - #l Phe Gly Val His Phe# 125- Cys Lys Leu Ile Phe Ala Ile Tyr Lys Met Se - #r Phe Phe Ser Gly Met# 140- Leu Leu Leu Leu Cys Ile Ser Ile Asp Arg Ty - #r Val Ala Ile Val Gln145 1 - #50 1 - #55 1 -#60- Ala Val Ser Ala His Arg His Arg Ala Arg Va - #l Leu Leu Ile Ser Lys# 175- Leu Ser Cys Val Gly Ile Trp Ile Leu Ala Th - #r Val Leu Ser Ile Pro# 190- Glu Leu Leu Tyr Ser Asp Leu Gln Arg Ser Se - #r Ser Glu Gln Ala Met# 205- Arg Cys Ser Leu Ile Thr Glu His Val Glu Al - #a Phe Ile Thr Ile Gln# 220- Val Ala Gln Met Val Ile Gly Phe Leu Val Pr - #o Leu Leu Ala Met Ser225 2 - #30 2 - #35 2 -#40- Phe Cys Tyr Leu Val Ile Ile Arg Thr Leu Le - #u Gln Ala Arg Asn Phe# 255- Glu Arg Asn Lys Ala Ile Lys Val Ile Ile Al - #a Val Val Val Val Phe# 270- Ile Val Phe Gln Leu Pro Tyr Asn Gly Val Va - #l Leu Ala Gln Thr Val# 285- Ala Asn Phe Asn Ile Thr Ser Ser Thr Cys Gl - #u Leu Ser Lys Gln Leu# 300- Asn Ile Ala Tyr Asp Val Thr Tyr Ser Leu Al - #a Cys Val Arg Cys Cys305 3 - #10 3 - #15 3 -#20- Val Asn Pro Phe Leu Tyr Ala Phe Ile Gly Va - #l Lys Phe Arg Asn Asp# 335- Leu Phe Lys Leu Phe Lys Asp Leu Gly Cys Le - #u Ser Gln Glu Gln Leu# 350- Arg Gln Trp Ser Ser Cys Arg His Ile Arg Ar - #g Ser Ser Met Ser Val# 365- Glu Ala Glu Thr Thr Thr Thr Phe Ser Pro# 375- (2) INFORMATION FOR SEQ ID NO:16:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 360 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (ix) FEATURE: (A) NAME/KEY: intron (B) LOCATION: 253..360- (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 243..251- (ix) FEATURE: (A) NAME/KEY: TATA.sub.-- - #signal (B) LOCATION: 151..156- (ix) FEATURE: (A) NAME/KEY: 5'UTR (B) LOCATION: 180..242- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:16:- GGATCCTATG ACCAGCGACT GTCACCCTCT GTCACCTTTC TTCTGCCCTT TA - #TCTCTGAA 60- GGCATTGAAG GGGCCCTGCA TGAGTCAGGG AGGGCTGGGG GGAGGAGCAA GG - #GTGGGAGG 120- GGCAGGGAAG AGGGTGGCTT CTCCGACAAC TTAAAAGGGG CTTGAACCAC TT - #CCTCCCCA 180- GACAGGGGTA GTGCGAGGCC GGGCACAGCC TTCCTGTGTG GTTTTACCGC CC - #AGAGAGCG 240- TC ATG GAC CTG GGTGAGTGAG CCTCTTCATG TGAGAAGGAA CAG - #TACCAGG 291 Met Asp Leu 1- GTCTTGGACA CCCAGACTGA CCCTGTGGAA TGGGGGTGGA GGATGCGGGT GG - #AGCGCATA 351# 360- (2) INFORMATION FOR SEQ ID NO:17:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 3 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:17:- Met Asp Leu 1- (2) INFORMATION FOR SEQ ID NO:18:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 1900 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (ix) FEATURE: (A) NAME/KEY: intron (B) LOCATION: 1..168- (ix) FEATURE: (A) NAME/KEY: exon (B) LOCATION: 169..1245- (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 169..1242- (ix) FEATURE: (A) NAME/KEY: 3'UTR (B) LOCATION: 1246..1900- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:18:- CTGCAGGGAG CCATGATTGC ACCACTGCAC TCCAGCCTGG GCAACAGAGT GA - #GACCATGT 60- CTCAAGAAAA AAAAAAAAGA AAGAAACCAC TGCTCTAGGC TAAATCCCAG CC - #AGAGTTGG 120#TGC CTG 177AACTGGC CTGTTTTCCC TCATTTCCTT CCCCGAAG GTA# Val - # Cys Leu# 1- TGT CAA GAT GAG GTC ACG GAC GAT TAC ATC GG - #A GAC AAC ACC ACA GTG 225Cys Gln Asp Glu Val Thr Asp Asp Tyr Ile Gl - #y Asp Asn Thr Thr Val# 15- GAC TAC ACT TTG TTC GAG TCT TTG TGC TCC AA - #G AAG GAC GTG CGG AAC 273Asp Tyr Thr Leu Phe Glu Ser Leu Cys Ser Ly - #s Lys Asp Val Arg Asn# 35- TTT AAA GCC TGG TTC CTC CCT ATC ATG TAC TC - #C ATC ATT TGT TTC GTG 321Phe Lys Ala Trp Phe Leu Pro Ile Met Tyr Se - #r Ile Ile Cys Phe Val# 50- GGC CTA CTG GGC AAT GGG CTG GTC GTG TTG AC - #C TAT ATC TAT TTC AAG 369Gly Leu Leu Gly Asn Gly Leu Val Val Leu Th - #r Tyr Ile Tyr Phe Lys# 65- AGG CTC AAG ACC ATG ACC GAT ACC TAC CTG CT - #C AAC CTG GCG GTG GCA 417Arg Leu Lys Thr Met Thr Asp Thr Tyr Leu Le - #u Asn Leu Ala Val Ala# 80- GAC ATC CTC TTC CTC CTG ACC CTT CCC TTC TG - #G GCC TAC AGC GCG GCC 465Asp Ile Leu Phe Leu Leu Thr Leu Pro Phe Tr - #p Ala Tyr Ser Ala Ala# 95- AAG TCC TGG GTC TTC GGT GTC CAC TTT TGC AA - #G CTC ATC TTT GCC ATC 513Lys Ser Trp Val Phe Gly Val His Phe Cys Ly - #s Leu Ile Phe Ala Ile100 1 - #05 1 - #10 1 -#15- TAC AAG ATG AGC TTC TTC AGT GGC ATG CTC CT - #A CTT CTT TGC ATC AGC 561Tyr Lys Met Ser Phe Phe Ser Gly Met Leu Le - #u Leu Leu Cys Ile Ser# 130- ATT GAC CGC TAC GTG GCC ATC GTC CAG GCT GT - #C TCA GCT CAC CGC CAC 609Ile Asp Arg Tyr Val Ala Ile Val Gln Ala Va - #l Ser Ala His Arg His# 145- CGT GCC CGC GTC CTT CTC ATC AGC AAG CTG TC - #C TGT GTG GGC ATC TGG 657Arg Ala Arg Val Leu Leu Ile Ser Lys Leu Se - #r Cys Val Gly Ile Trp# 160- ATA CTA GCC ACA GTG CTC TCC ATC CCA GAG CT - #C CTG TAC AGT GAC CTC 705Ile Leu Ala Thr Val Leu Ser Ile Pro Glu Le - #u Leu Tyr Ser Asp Leu# 175- CAG AGG AGC AGC AGT GAG CAA GCG ATG CGA TG - #C TCT CTC ATC ACA GAG 753Gln Arg Ser Ser Ser Glu Gln Ala Met Arg Cy - #s Ser Leu Ile Thr Glu180 1 - #85 1 - #90 1 -#95- CAT GTG GAG GCC TTT ATC ACC ATC CAG GTG GC - #C CAG ATG GTG ATC GGC 801His Val Glu Ala Phe Ile Thr Ile Gln Val Al - #a Gln Met Val Ile Gly# 210- TTT CTG GTC CCC CTG CTG GCC ATG AGC TTC TG - #T TAC CTT GTC ATC ATC 849Phe Leu Val Pro Leu Leu Ala Met Ser Phe Cy - #s Tyr Leu Val Ile Ile# 225- CGC ACC CTG CTC CAG GCA CGC AAC TTT GAG CG - #C AAC AAG GCC ATC AAG 897Arg Thr Leu Leu Gln Ala Arg Asn Phe Glu Ar - #g Asn Lys Ala Ile Lys# 240- GTG ATC ATC GCT GTG GTC GTG GTC TTC ATA GT - #C TTC CAG CTG CCC TAC 945Val Ile Ile Ala Val Val Val Val Phe Ile Va - #l Phe Gln Leu Pro Tyr# 255- AAT GGG GTG GTC CTG GCC CAG ACG GTG GCC AA - #C TTC AAC ATC ACC AGT 993Asn Gly Val Val Leu Ala Gln Thr Val Ala As - #n Phe Asn Ile Thr Ser260 2 - #65 2 - #70 2 -#75- AGC ACC TGT GAG CTC AGT AAG CAA CTC AAC AT - #C GCC TAC GAC GTC ACC1041Ser Thr Cys Glu Leu Ser Lys Gln Leu Asn Il - #e Ala Tyr Asp Val Thr# 290- TAC AGC CTG GCC TGC GTC CGC TGC TGC GTC AA - #C CCT TTC TTG TAC GCC1089Tyr Ser Leu Ala Cys Val Arg Cys Cys Val As - #n Pro Phe Leu Tyr Ala# 305- TTC ATC GGC GTC AAG TTC CGC AAC GAT CTC TT - #C AAG CTC TTC AAG GAC1137Phe Ile Gly Val Lys Phe Arg Asn Asp Leu Ph - #e Lys Leu Phe Lys Asp# 320- CTG GGC TGC CTC AGC CAG GAG CAG CTC CGG CA - #G TGG TCT TCC TGT CGG1185Leu Gly Cys Leu Ser Gln Glu Gln Leu Arg Gl - #n Trp Ser Ser Cys Arg# 335- CAC ATC CGG CGC TCC TCC ATG AGT GTG GAG GC - #C GAG ACC ACC ACC ACC1233His Ile Arg Arg Ser Ser Met Ser Val Glu Al - #a Glu Thr Thr Thr Thr340 3 - #45 3 - #50 3 -#55- TTC TCC CCA TAGGCGACTC TTCTGCCTGG ACTAGAGGGA CCTCTCCCA - #G1282Phe Ser Pro- GGTCCCTGGG GTGGGGATAG GGAGCAGATG CAATGACTCA GGACATCCCC CC - #GCCAAAAG1342- CTGCTCAGGG AAAAGCAGCT CTCCCCTCAG AGTGCAAGCC CTGCTCCAGA AG - #TTAGCTTC1402- ACCCCAATCC CAGCTACCTC AACCAATGCC GAAAAAGACA GGGCTGATAA GC - #TAACACCA1462- GACAGACAAC ACTGGGAAAC AGAGGCTATT GTCCCCTAAA CCAAAAACTG AA - #AGTGAAAG1522- TCCAGAAACT GTTCCCACCT GCTGGAGTGA AGGGGCCAAG GAGGGTGAGT GC - #AAGGGGCG1582- TGGGAGTGGC CTGAAGAGTC CTCTGAATGA ACCTTCTGGC CTCCCACAGA CT - #CAAATGCT1642- CAGACCAGCT CTTCCGAAAA CCAGGCCTTA TCTCCAAGAC CAGAGATAGT GG - #GGAGACTT1702- CTTGGCTTGG TGAGGAAAAG CGGACATCAG CAGCTGGTCA AACAAACTCT CT - #GAACCCCT1762- CCCTCCATCG TTTTCTTCAC TGTCCTCCAA GCCAGCGGGA ATGCAGCTGC CA - #CGCCGCCC1822- TAAAAGCACA CTCATCCCCT CACTTGCCGC GTCGCCCTCC CAGGCTCTCA AC - #AGGGGAGA1882#1900 AG- (2) INFORMATION FOR SEQ ID NO:19:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 358 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:19:- Val Cys Leu Cys Gln Asp Glu Val Thr Asp As - #p Tyr Ile Gly Asp Asn# 15- Thr Thr Val Asp Tyr Thr Leu Phe Glu Ser Le - #u Cys Ser Lys Lys Asp# 30- Val Arg Asn Phe Lys Ala Trp Phe Leu Pro Il - #e Met Tyr Ser Ile Ile# 45- Cys Phe Val Gly Leu Leu Gly Asn Gly Leu Va - #l Val Leu Thr Tyr Ile# 60- Tyr Phe Lys Arg Leu Lys Thr Met Thr Asp Th - #r Tyr Leu Leu Asn Leu# 80- Ala Val Ala Asp Ile Leu Phe Leu Leu Thr Le - #u Pro Phe Trp Ala Tyr# 95- Ser Ala Ala Lys Ser Trp Val Phe Gly Val Hi - #s Phe Cys Lys Leu Ile# 110- Phe Ala Ile Tyr Lys Met Ser Phe Phe Ser Gl - #y Met Leu Leu Leu Leu# 125- Cys Ile Ser Ile Asp Arg Tyr Val Ala Ile Va - #l Gln Ala Val Ser Ala# 140- His Arg His Arg Ala Arg Val Leu Leu Ile Se - #r Lys Leu Ser Cys Val145 1 - #50 1 - #55 1 -#60- Gly Ile Trp Ile Leu Ala Thr Val Leu Ser Il - #e Pro Glu Leu Leu Tyr# 175- Ser Asp Leu Gln Arg Ser Ser Ser Glu Gln Al - #a Met Arg Cys Ser Leu# 190- Ile Thr Glu His Val Glu Ala Phe Ile Thr Il - #e Gln Val Ala Gln Met# 205- Val Ile Gly Phe Leu Val Pro Leu Leu Ala Me - #t Ser Phe Cys Tyr Leu# 220- Val Ile Ile Arg Thr Leu Leu Gln Ala Arg As - #n Phe Glu Arg Asn Lys225 2 - #30 2 - #35 2 -#40- Ala Ile Lys Val Ile Ile Ala Val Val Val Va - #l Phe Ile Val Phe Gln# 255- Leu Pro Tyr Asn Gly Val Val Leu Ala Gln Th - #r Val Ala Asn Phe Asn# 270- Ile Thr Ser Ser Thr Cys Glu Leu Ser Lys Gl - #n Leu Asn Ile Ala Tyr# 285- Asp Val Thr Tyr Ser Leu Ala Cys Val Arg Cy - #s Cys Val Asn Pro Phe# 300- Leu Tyr Ala Phe Ile Gly Val Lys Phe Arg As - #n Asp Leu Phe Lys Leu305 3 - #10 3 - #15 3 -#20- Phe Lys Asp Leu Gly Cys Leu Ser Gln Glu Gl - #n Leu Arg Gln Trp Ser# 335- Ser Cys Arg His Ile Arg Arg Ser Ser Met Se - #r Val Glu Ala Glu Thr# 350- Thr Thr Thr Phe Ser Pro 355- (2) INFORMATION FOR SEQ ID NO:20:- (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 9 base p - #airs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:20:# 9- (2) INFORMATION FOR SEQ ID NO:21:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 305 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (ix) FEATURE: (A) NAME/KEY: intron (B) LOCATION: 1..219- (ix) FEATURE: (A) NAME/KEY: exon (B) LOCATION: 220..270- (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 220..270- (ix) FEATURE: (A) NAME/KEY: intron (B) LOCATION: 271..305- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:21:- ACCTGGGAGT GGAGGAGGAC AAGAAGGAGG TGAGGACAGT GTTGCCGGGC AG - #CAGGCCAG 60- GTGTTCAAAG GCACAATCTG GTTCTGATGT TCTCTTTCAG CAAACACAGT GC - #CTGGAGCT 120- TGGGAGGAAA GTTCCCAACA GCGTCTCCCC CTCCACTGCT TTCTTTAATA AC - #AAAGACTT 180- GTCCTGCCAA GCAATAACTT TCTCGCCTTG TCTCCTACA GGG AAA CCA - # ATG AAA 234# Gly Lys Pro Met Lys# 5 1- AGC GTG CTG GTG GTG GCT CTC CTT GTC ATT TT - #C CAG GTGAGGTCTC 280Ser Val Leu Val Val Ala Leu Leu Val Ile Ph - #e Gln# 15# 305 GTTC CTTCT- (2) INFORMATION FOR SEQ ID NO:22:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 17 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:22:- Gly Lys Pro Met Lys Ser Val Leu Val Val Al - #a Leu Leu Val Ile Phe# 15- Gln- (2) INFORMATION FOR SEQ ID NO:23:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 2751 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (ix) FEATURE: (A) NAME/KEY: intron (B) LOCATION: 1..691- (ix) FEATURE: (A) NAME/KEY: exon (B) LOCATION: 692..1771- (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 692..1768- (ix) FEATURE: (A) NAME/KEY: polyA.sub.-- - #signal (B) LOCATION: 2341..2348- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:23:- CTGCAGGGCC AGACGTTTAC ATCTTAACTA GATCCTCCCT GAGTAATTCA TA - #CATGTGCT 60- AACATCGTTA CTTAGATTTA TTTTTTGTTT TGGTTTGGTT TTTTGGCTTT TT - #AAGATTTT 120- TTTATTCATT GAACGTAAAT GCATACACTG TAGCTATCTT TAGACACATG AG - #AAGAAGGT 180- ATCAGACCCA TTACAGATGG TTGTGAGCCA CCGTGGTGTT TGCTGGGAAT TG - #AACCCAGG 240- ACTTTTGGAA GAGCAGTCCG TATTCTTAAC CTATTAGATA TTATTTATGG GT - #ATAAACAT 300- TTTGCCTGCG TGCATAGAAG TACACCACAT GCACAGAGGA GGTCAGAGTT GG - #GCATCAGA 360- GCCCATGGAA CTAGAGTTAC AGAGAGCCAC GACGCACCGT GTGGGTGCTG GG - #AACCGAAC 420- CGGCCTTCTC TACCAGAGCT ACACGCACTC TGCTCTTAAC CCCTGAGCCA GT - #TCTTCAGC 480- CCCACATGCT GAGGCTTAAG AGGTGTGGAT TTCTAGTCAA AGACTCACTT GG - #GGTTTGAG 540- GGGGAAACTA TAGTTTCCTG GGCTCCTCCG TCTAAGATGC TGACCCAAAG GG - #TCTAAGGT 600- CTGAGAGTCT GCAAGAGAAC AGAAGCCCCG GGCAATGTCC TGACTGTGAG AT - #CCGGACTG 660#CAA GAT GAG 712C TTCCCCCGGA G GTG TGC TTC TGC# Val - # Cys Phe Cys Gln Asp Glu# 1 5- GTC ACG AGT GAC TAC ATC GGC GAG AAT ACC AC - #G GTG GAC TAC ACC CTG 760Val Thr Ser Asp Tyr Ile Gly Glu Asn Thr Th - #r Val Asp Tyr Thr Leu# 20- TAC GAG TCG GTG TGC TTC AAG AAG GAT GTG CG - #G AAC TTT AAG GCC TGG 808Tyr Glu Ser Val Cys Phe Lys Lys Asp Val Ar - #g Asn Phe Lys Ala Trp# 35- TTC CTG CCT CTC ATG TAT TCT GTC ATC TGC TT - #C GTG GGC CTG CTC GGC 856Phe Leu Pro Leu Met Tyr Ser Val Ile Cys Ph - #e Val Gly Leu Leu Gly# 55- AAC GGG CTG GTG ATA CTG ACG TAC ATC TAT TT - #C AAG AGG CTC AAG ACC 904Asn Gly Leu Val Ile Leu Thr Tyr Ile Tyr Ph - #e Lys Arg Leu Lys Thr# 70- ATG ACG GAT ACC TAC CTG CTC AAC CTG GCC GT - #G GCA GAC ATC CTT TTC 952Met Thr Asp Thr Tyr Leu Leu Asn Leu Ala Va - #l Ala Asp Ile Leu Phe# 85- CTC CTA ATT CTT CCC TTC TGG GCC TAC AGC GA - #A GCC AAG TCC TGG ATC1000Leu Leu Ile Leu Pro Phe Trp Ala Tyr Ser Gl - #u Ala Lys Ser Trp Ile# 100- TTT GGC GTC TAC CTG TGT AAG GGC ATC TTT GG - #C ATC TAT AAG TTA AGC1048Phe Gly Val Tyr Leu Cys Lys Gly Ile Phe Gl - #y Ile Tyr Lys Leu Ser# 115- TTC TTC AGC GGG ATG CTG CTG CTC CTA TGC AT - #C AGC ATT GAC CGC TAC1096Phe Phe Ser Gly Met Leu Leu Leu Leu Cys Il - #e Ser Ile Asp Arg Tyr120 1 - #25 1 - #30 1 -#35- GTA GCC ATC GTC CAG GCC GTG TCG CGT CAT CG - #C CAC CGC GCC CGC GTG1144Val Ala Ile Val Gln Ala Val Ser Arg His Ar - #g His Arg Ala Arg Val# 150- CTT CTC ATC AGC AAG CTG TCC TGT GTG GGC AT - #C TGG ATG CTG GCC CTC1192Leu Leu Ile Ser Lys Leu Ser Cys Val Gly Il - #e Trp Met Leu Ala Leu# 165- TTC CTC TCC ATC CCG GAG CTG CTC TAC AGC GG - #C CTC CAG AAG AAC AGC1240Phe Leu Ser Ile Pro Glu Leu Leu Tyr Ser Gl - #y Leu Gln Lys Asn Ser# 180- GGC GAG GAC ACG CTG AGA TGC TCA CTG GTC AG - #T GCC CAA GTG GAG GCC1288Gly Glu Asp Thr Leu Arg Cys Ser Leu Val Se - #r Ala Gln Val Glu Ala# 195- TTG ATC ACC ATC CAA GTG GCC CAG ATG GTT TT - #T GGG TTC CTA GTG CCT1336Leu Ile Thr Ile Gln Val Ala Gln Met Val Ph - #e Gly Phe Leu Val Pro200 2 - #05 2 - #10 2 -#15- ATG CTG GCT ATG AGT TTC TGC TAC CTC ATT AT - #C ATC CGT ACC TTG CTC1384Met Leu Ala Met Ser Phe Cys Tyr Leu Ile Il - #e Ile Arg Thr Leu Leu# 230- CAG GCA CGC AAC TTT GAG CGG AAC AAG GCC AT - #C AAG GTG ATC ATT GCC1432Gln Ala Arg Asn Phe Glu Arg Asn Lys Ala Il - #e Lys Val Ile Ile Ala# 245- GTG GTG GTA GTC TTC ATA GTC TTC CAG CTG CC - #C TAC AAT GGG GTG GTC1480Val Val Val Val Phe Ile Val Phe Gln Leu Pr - #o Tyr Asn Gly Val Val# 260- CTG GCT CAG ACG GTG GCC AAC TTC AAC ATC AC - #C AAT AGC AGC TGC TGC1528Leu Ala Gln Thr Val Ala Asn Phe Asn Ile Th - #r Asn Ser Ser Cys Cys# 275- GAA ACC AGC AAG CAG CTC AAC ATT GCC TAT GA - #C GTC ACC TAC AGC CTG1576Glu Thr Ser Lys Gln Leu Asn Ile Ala Tyr As - #p Val Thr Tyr Ser Leu280 2 - #85 2 - #90 2 -#95- GCC TCC GTC CGC TGC TGC GTC AAC CCT TTC TT - #G TAT GCC TTC ATC GGC1624Ala Ser Val Arg Cys Cys Val Asn Pro Phe Le - #u Tyr Ala Phe Ile Gly# 310- GTC AAG TTC CGC AGC GAC CTC TTC AAG CTC TT - #C AAG GAC TTG GGC TGC1672Val Lys Phe Arg Ser Asp Leu Phe Lys Leu Ph - #e Lys Asp Leu Gly Cys# 325- CTC AGC CAG GAA CGG CTC CGG CAC TGG TCT TC - #C TGC CGG CAT GTA CGG1720Leu Ser Gln Glu Arg Leu Arg His Trp Ser Se - #r Cys Arg His Val Arg# 340- AAC GCG TCG GTG AGC ATG GAG GCG GAG ACC AC - #C ACA ACC TTC TCC CCG1768Asn Ala Ser Val Ser Met Glu Ala Glu Thr Th - #r Thr Thr Phe Ser Pro# 355- TAGGGGGCTC CCCTGCCCGG ACTACAAGGA CCTCTCCCAG GAGCCTTAAT GT - #GGTGCACA1828- CATGCACAGA CTCTCCATCC ACCGAATTGC TGCTGAGGGA AGAGCAATTC TG - #GCCAGTCA1888- GGTTGACATG AGGACCTAAG AAACTGCTTA ACCCCATCCC ACTTATAACT AC - #CTCAACCA1948- AAGCTGTAAA AGATATGGCT GAGAAGTTAA CACTCAAGCC AAGACAGCTA TC - #CCCAAAAC2008- GACAGCCAAA AGTGAAAGTG AGAGGCTCCA CACTTTCCGG AGTGAGGGAT GT - #GGGGCCAG2068- TGAACACCCT GGTTGAGTAG TCTTCGGAGG CCTCTGAATG AACCTGCTTC TA - #GCTTAGAG2128- AGATGTCCCG GAGATTCAAG ACAGAGCTTA TCTCCACACT TAGCAAGCAA GC - #AAGAGATG2188- ACAGTCTCTC TAAATGCTCC CACAGAGCAC CCCTGCCCCT CCCTTCTGCC TC - #TCCACCGC2248- CTTTCCTGAG GTCCAGGCCA CACCATGACG CTGAGGCAGT CCCAGCTGGG GC - #TCTGGATG2308- GCAATGACAA GTAGTTGGGT CTCTATGATG GGAATAAAAA GGTAGGGGAA AG - #GTGACAGG2368- AAGGAGAGAA GGTGACCCTG CTGGCTGACA GAGGCCAGCA AGCTACTTCT TT - #GTTCTCTG2428- TCAGCCAGCC ACTGATACCT TTCCTCATGT TCTGCTTTTG ATTCATATAT CT - #TTTATGAA2488- GAAACAAATA AAAAAAAAAT TTTCCCTCGA GGAAACAACT TGGAAAGAAG GG - #AGGTAAAT2548- TCCTTGGTTA AATGGCGAGT GAGTGAGTTG TCCCCCCATT CCACCTGAGA GT - #CCTGCGCC2608- CCACACCCCT CCGCCCCAGC CTTCCTTTCT CAGCACTCAG AACCATGAGG TC - #ACAGAGCC2668- TCTCCGGAGA TGCAAACCCA GGAGGCTGCA AGAGGTGGAA AAAGAGCGAA GA - #CAGGATGT2728# 2751CCTG CAG- (2) INFORMATION FOR SEQ ID NO:24:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 359 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:24:- Val Cys Phe Cys Gln Asp Glu Val Thr Ser As - #p Tyr Ile Gly Glu Asn# 15- Thr Thr Val Asp Tyr Thr Leu Tyr Glu Ser Va - #l Cys Phe Lys Lys Asp# 30- Val Arg Asn Phe Lys Ala Trp Phe Leu Pro Le - #u Met Tyr Ser Val Ile# 45- Cys Phe Val Gly Leu Leu Gly Asn Gly Leu Va - #l Ile Leu Thr Tyr Ile# 60- Tyr Phe Lys Arg Leu Lys Thr Met Thr Asp Th - #r Tyr Leu Leu Asn Leu# 80- Ala Val Ala Asp Ile Leu Phe Leu Leu Ile Le - #u Pro Phe Trp Ala Tyr# 95- Ser Glu Ala Lys Ser Trp Ile Phe Gly Val Ty - #r Leu Cys Lys Gly Ile# 110- Phe Gly Ile Tyr Lys Leu Ser Phe Phe Ser Gl - #y Met Leu Leu Leu Leu# 125- Cys Ile Ser Ile Asp Arg Tyr Val Ala Ile Va - #l Gln Ala Val Ser Arg# 140- His Arg His Arg Ala Arg Val Leu Leu Ile Se - #r Lys Leu Ser Cys Val145 1 - #50 1 - #55 1 -#60- Gly Ile Trp Met Leu Ala Leu Phe Leu Ser Il - #e Pro Glu Leu Leu Tyr# 175- Ser Gly Leu Gln Lys Asn Ser Gly Glu Asp Th - #r Leu Arg Cys Ser Leu# 190- Val Ser Ala Gln Val Glu Ala Leu Ile Thr Il - #e Gln Val Ala Gln Met# 205- Val Phe Gly Phe Leu Val Pro Met Leu Ala Me - #t Ser Phe Cys Tyr Leu# 220- Ile Ile Ile Arg Thr Leu Leu Gln Ala Arg As - #n Phe Glu Arg Asn Lys225 2 - #30 2 - #35 2 -#40- Ala Ile Lys Val Ile Ile Ala Val Val Val Va - #l Phe Ile Val Phe Gln# 255- Leu Pro Tyr Asn Gly Val Val Leu Ala Gln Th - #r Val Ala Asn Phe Asn# 270- Ile Thr Asn Ser Ser Cys Cys Glu Thr Ser Ly - #s Gln Leu Asn Ile Ala# 285- Tyr Asp Val Thr Tyr Ser Leu Ala Ser Val Ar - #g Cys Cys Val Asn Pro# 300- Phe Leu Tyr Ala Phe Ile Gly Val Lys Phe Ar - #g Ser Asp Leu Phe Lys305 3 - #10 3 - #15 3 -#20- Leu Phe Lys Asp Leu Gly Cys Leu Ser Gln Gl - #u Arg Leu Arg His Trp# 335- Ser Ser Cys Arg His Val Arg Asn Ala Ser Va - #l Ser Met Glu Ala Glu# 350- Thr Thr Thr Thr Phe Ser Pro 355- (2) INFORMATION FOR SEQ ID NO:25:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 60 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:25:- TGGACTCACT ATTTGATAAA TGAAAAGGGC CTCCACAATG CCATGTGCAA AT - #TCACTACC 60- (2) INFORMATION FOR SEQ ID NO:26:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 66 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:26:- AATGCTGATG ACGGTGATGA AGAATATGCT TCCAAAAAAG CCGATGAAGA AG - #AAGGCGGT 60# 66- (2) INFORMATION FOR SEQ ID NO:27:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 2254 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 593..1657- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:27:- AAGCTTCAAA AAGCCTAGAG CTGGCTGGGC GCTGTGGCTC ACGCCTGTAA TC - #CTAGCATT 60- TTGGGAGGCT GAGGCGGAAG GATAACTGAG GTCAGGAGTT TGAGACCAGC CT - #GGCTAACA 120- TGATGAAACC CCATCTCTAC TAAAAATACA AAAATTAGCC AGGCATGGTA GT - #GCACGCTA 180- TAANCCCAGC TATTTGGGAG GCTGAGGCAG GAGAATCGCT TGAACCCCAG GG - #ACAGAGGT 240- TGCAGTGAGC TGAGATCGCA CCACTGCACT CCAGCCTGGG TGACACAGCG AG - #ACTCCATT 300- TAAAAAAAAA AAAATGCCTA GAGCCAAATG CTCACAGAGC CATTTACTGC AT - #GGCTTTGG 360- GCAAGTCAAA GGAGTCCGCC TCTCCTGTCA GAAGAGTCTG TTGCAGTCTT CA - #TCACAAGA 420- CTGTTGTGGG GATTAAACAA GATGGCAAGT GGGAAGTTGG GAAATGTAGT GT - #GCACCCAA 480- CCAATATTTG TTTCTTCCTG CCTGCCTACA TATGAGGCCA CACAGAATTC CA - #ACTTTGTT 540- TCTCTGATAA CTAACACAGT TACTTGTTTT TCTTTCTGAT CCAGGCCTTC AC - #C ATG 596# Met# 1- GAT CAG TTC CCT GAA TCA GTG ACA GAA AAC TT - #T GAG TAC GAT GAT TTG 644Asp Gln Phe Pro Glu Ser Val Thr Glu Asn Ph - #e Glu Tyr Asp Asp Leu# 15- GCT GAG GCC TGT TAT ATT GGG GAC ATC GTG GT - #C TTT GGG ACT GTG TTC 692Ala Glu Ala Cys Tyr Ile Gly Asp Ile Val Va - #l Phe Gly Thr Val Phe# 30- CTG TCC ATA TTC TAC TCC GTC ATC TTT GCC AT - #T GGC CTG GTG GGA AAT 740Leu Ser Ile Phe Tyr Ser Val Ile Phe Ala Il - #e Gly Leu Val Gly Asn# 45- TTG TTG GTA GTG TTT GCC CTC ACC AAC AGC AA - #G AAG CCC AAG AGT GTC 788Leu Leu Val Val Phe Ala Leu Thr Asn Ser Ly - #s Lys Pro Lys Ser Val# 65- ACC GAC ATT TAC CTC CTG AAC CTG GCC TTG TC - #T GAT CTG CTG TTT GTA 836Thr Asp Ile Tyr Leu Leu Asn Leu Ala Leu Se - #r Asp Leu Leu Phe Val# 80- GCC ACT TTG CCC TTC TGG ACT CAC TAT TTG AT - #A AAT GAA AAG GGC CTC 884Ala Thr Leu Pro Phe Trp Thr His Tyr Leu Il - #e Asn Glu Lys Gly Leu# 95- CAC AAT GCC ATG TGC AAA TTC ACT ACC GCC TT - #C TTC TTC ATC GGC TTT 932His Asn Ala Met Cys Lys Phe Thr Thr Ala Ph - #e Phe Phe Ile Gly Phe# 110- TTT GGA AGC ATA TTC TTC ATC ACC GTC ATC AG - #C ATT GAT AGG TAC CTG 980Phe Gly Ser Ile Phe Phe Ile Thr Val Ile Se - #r Ile Asp Arg Tyr Leu# 125- GCC ATC GTC CTG GCC GCC AAC TCC ATG AAC AA - #C CGG ACC GTG CAG CAT1028Ala Ile Val Leu Ala Ala Asn Ser Met Asn As - #n Arg Thr Val Gln His130 1 - #35 1 - #40 1 -#45- GGC GTC ACC ATC AGC CTA GGC GTC TGG GCA GC - #A GCC ATT TTG GTG GCA1076Gly Val Thr Ile Ser Leu Gly Val Trp Ala Al - #a Ala Ile Leu Val Ala# 160- GCA CCC CAG TTC ATG TTC ACA AAG CAG AAA GA - #A AAT GAA TGC CTT GGT1124Ala Pro Gln Phe Met Phe Thr Lys Gln Lys Gl - #u Asn Glu Cys Leu Gly# 175- GAC TAC CCC GAG GTC CTC CAG GAA ATC TGG CC - #C GTG CTC CGC AAT GTG1172Asp Tyr Pro Glu Val Leu Gln Glu Ile Trp Pr - #o Val Leu Arg Asn Val# 190- GAA ACA AAT TTT CTT GGC TTC CTA CTC CCC CT - #G CTC ATT ATG AGT TAT1220Glu Thr Asn Phe Leu Gly Phe Leu Leu Pro Le - #u Leu Ile Met Ser Tyr# 205- TGC TAC TTC AGA ATC ATC CAG ACG CTG TTT TC - #C TGC AAG AAC CAC AAG1268Cys Tyr Phe Arg Ile Ile Gln Thr Leu Phe Se - #r Cys Lys Asn His Lys210 2 - #15 2 - #20 2 -#25- AAA GCC AAA GCC ATT AAA CTG ATC CTT CTG GT - #G GTC ATC GTG TTT TTC1316Lys Ala Lys Ala Ile Lys Leu Ile Leu Leu Va - #l Val Ile Val Phe Phe# 240- CTC TTC TGG ACA CCC TAC AAC GTT ATG ATT TT - #C CTG GAG ACG CTT AAG1364Leu Phe Trp Thr Pro Tyr Asn Val Met Ile Ph - #e Leu Glu Thr Leu Lys# 255- CTC TAT GAC TTC TTT CCC AGT TGT GAC ATG AG - #G AAG GAT CTG AGG CTG1412Leu Tyr Asp Phe Phe Pro Ser Cys Asp Met Ar - #g Lys Asp Leu Arg Leu# 270- GCC CTC AGT GTG ACT GAG ACG GTT GCA TTT AG - #C CAT TGT TGC CTG AAT1460Ala Leu Ser Val Thr Glu Thr Val Ala Phe Se - #r His Cys Cys Leu Asn# 285- CCT CTC ATC TAT GCA TTT GCT GGG GAG AAG TT - #C AGA AGA TAC CTT TAC1508Pro Leu Ile Tyr Ala Phe Ala Gly Glu Lys Ph - #e Arg Arg Tyr Leu Tyr290 2 - #95 3 - #00 3 -#05- CAC CTG TAT GGG AAA TGC CTG GCT GTC CTG TG - #T GGG CGC TCA GTC CAC1556His Leu Tyr Gly Lys Cys Leu Ala Val Leu Cy - #s Gly Arg Ser Val His# 320- GTT GAT TTC TCC TCA TCT GAA TCA CAA AGG AG - #C AGG CAT GGA AGT GTT1604Val Asp Phe Ser Ser Ser Glu Ser Gln Arg Se - #r Arg His Gly Ser Val# 335- CTG AGC AGC AAT TTT ACT TAC CAC ACG AGT GA - #T GGA GAT GCA TTG CTC1652Leu Ser Ser Asn Phe Thr Tyr His Thr Ser As - #p Gly Asp Ala Leu Leu# 350- CTT CTC TGAAGGGAAT CCCAAAGCCT TGTGTCTACA GAGAACCTGG AG - #TTCCTGAA1708Leu Leu 355- CCTGATGCTG ACTAGTGAGG AAAGATTTTT GTTGTTATTT CTTACAGGCA CA - #AAATGATG1768- GACCCAATGC ACACAAAACA ACCCTAGAGT GTTGTTGAGA ATTGTGCTCA AA - #ATTTGAAG1828- AATGAACAAA TTGAACTCTT TGAATGACAA AGAGTAGACA TTTCTCTTAC TG - #CAAATGTC1888- ATCAGAACTT TTTGGTTTGC AGATGACAAA AATTCAATCT AGACTAGTTT AG - #TTAAATGA1948- GGGTGGTGAA TATTGTTCAT ATTGTGGCAC AAGCAAAAGG GTGTCTGAGC CC - #TCAAAGTG2008- AGGGGAAACC AGGCCTGAGC CAAGCTAGAA TTCCCTCTCT CTGACTCTCA AA - #TCTTTTAG2068- TCATTATAGA TCCCCCAGAC TTTACATGAC ACAGCTTTAT CACCAGAGAG GG - #ACTGTCTC2128- CCATGTTTCT CTGCGCCCAA GGGCAAAATT CCCAGGGAAG TGCTCTGATA GG - #CCAAGTTT2188- GTATCAGGTG CCCATCCCTG GAAGGTGCTG TTATCCATGG GGAAGGGATA TA - #TAAGATGG2248# 2254- (2) INFORMATION FOR SEQ ID NO:28:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 355 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:28:- Met Asp Gln Phe Pro Glu Ser Val Thr Glu As - #n Phe Glu Tyr Asp Asp# 15- Leu Ala Glu Ala Cys Tyr Ile Gly Asp Ile Va - #l Val Phe Gly Thr Val# 30- Phe Leu Ser Ile Phe Tyr Ser Val Ile Phe Al - #a Ile Gly Leu Val Gly# 45- Asn Leu Leu Val Val Phe Ala Leu Thr Asn Se - #r Lys Lys Pro Lys Ser# 60- Val Thr Asp Ile Tyr Leu Leu Asn Leu Ala Le - #u Ser Asp Leu Leu Phe# 80- Val Ala Thr Leu Pro Phe Trp Thr His Tyr Le - #u Ile Asn Glu Lys Gly# 95- Leu His Asn Ala Met Cys Lys Phe Thr Thr Al - #a Phe Phe Phe Ile Gly# 110- Phe Phe Gly Ser Ile Phe Phe Ile Thr Val Il - #e Ser Ile Asp Arg Tyr# 125- Leu Ala Ile Val Leu Ala Ala Asn Ser Met As - #n Asn Arg Thr Val Gln# 140- His Gly Val Thr Ile Ser Leu Gly Val Trp Al - #a Ala Ala Ile Leu Val145 1 - #50 1 - #55 1 -#60- Ala Ala Pro Gln Phe Met Phe Thr Lys Gln Ly - #s Glu Asn Glu Cys Leu# 175- Gly Asp Tyr Pro Glu Val Leu Gln Glu Ile Tr - #p Pro Val Leu Arg Asn# 190- Val Glu Thr Asn Phe Leu Gly Phe Leu Leu Pr - #o Leu Leu Ile Met Ser# 205- Tyr Cys Tyr Phe Arg Ile Ile Gln Thr Leu Ph - #e Ser Cys Lys Asn His# 220- Lys Lys Ala Lys Ala Ile Lys Leu Ile Leu Le - #u Val Val Ile Val Phe225 2 - #30 2 - #35 2 -#40- Phe Leu Phe Trp Thr Pro Tyr Asn Val Met Il - #e Phe Leu Glu Thr Leu# 255- Lys Leu Tyr Asp Phe Phe Pro Ser Cys Asp Me - #t Arg Lys Asp Leu Arg# 270- Leu Ala Leu Ser Val Thr Glu Thr Val Ala Ph - #e Ser His Cys Cys Leu# 285- Asn Pro Leu Ile Tyr Ala Phe Ala Gly Glu Ly - #s Phe Arg Arg Tyr Leu# 300- Tyr His Leu Tyr Gly Lys Cys Leu Ala Val Le - #u Cys Gly Arg Ser Val305 3 - #10 3 - #15 3 -#20- His Val Asp Phe Ser Ser Ser Glu Ser Gln Ar - #g Ser Arg His Gly Ser# 335- Val Leu Ser Ser Asn Phe Thr Tyr His Thr Se - #r Asp Gly Asp Ala Leu# 350- Leu Leu Leu 355- (2) INFORMATION FOR SEQ ID NO:29:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 20 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:29:# 20 TAAA- (2) INFORMATION FOR SEQ ID NO:30:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 18 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:30:# 18 AG- (2) INFORMATION FOR SEQ ID NO:31:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 3119 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (ix) FEATURE: (A) NAME/KEY: exon (B) LOCATION: 7..80- (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 94..1158- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:31:- GAATTCACTC GTCTCTGGTA AAGTCTGAGC AGGACAGGGT GGCTGACTGG CA - #GATCCAGA 60- GGTTCCCTTG GCAGTCCACG CCAGGCCTTC ACC ATG GAT CAG TT - #C CCT GAA TCA 114# Met Asp Gln Phe Pro Glu Ser#5 1- GTG ACA GAA AAC TTT GAG TAC GAT GAT TTG GC - #T GAG GCC TGT TAT ATT 162Val Thr Glu Asn Phe Glu Tyr Asp Asp Leu Al - #a Glu Ala Cys Tyr Ile# 20- GGG GAC ATC GTG GTC TTT GGG ACT GTG TTC CT - #G TCC ATA TTC TAC TCC 210Gly Asp Ile Val Val Phe Gly Thr Val Phe Le - #u Ser Ile Phe Tyr Ser# 35- GTC ATC TTT GCC ATT GGC CTG GTG GGA AAT TT - #G TTG GTA GTG TTT GCC 258Val Ile Phe Ala Ile Gly Leu Val Gly Asn Le - #u Leu Val Val Phe Ala# 55- CTC ACC AAC AGC AAG AAG CCC AAG AGT GTC AC - #C GAC ATT TAC CTC CTG 306Leu Thr Asn Ser Lys Lys Pro Lys Ser Val Th - #r Asp Ile Tyr Leu Leu# 70- AAC CTG GCC TTG TCT GAT CTG CTG TTT GTA GC - #C ACT TTG CCC TTC TGG 354Asn Leu Ala Leu Ser Asp Leu Leu Phe Val Al - #a Thr Leu Pro Phe Trp# 85- ACT CAC TAT TTG ATA AAT GAA AAG GGC CTC CA - #C AAT GCC ATG TGC AAA 402Thr His Tyr Leu Ile Asn Glu Lys Gly Leu Hi - #s Asn Ala Met Cys Lys# 100- TTC ACT ACC GCC TTC TTC TTC ATC GGC TTT TT - #T GGA AGC ATA TTC TTC 450Phe Thr Thr Ala Phe Phe Phe Ile Gly Phe Ph - #e Gly Ser Ile Phe Phe# 115- ATC ACC GTC ATC AGC ATT GAT AGG TAC CTG GC - #C ATC GTC CTG GCC GCC 498Ile Thr Val Ile Ser Ile Asp Arg Tyr Leu Al - #a Ile Val Leu Ala Ala120 1 - #25 1 - #30 1 -#35- AAC TCC ATG AAC AAC CGG ACC GTG CAG CAT GG - #C GTC ACC ATC AGC CTA 546Asn Ser Met Asn Asn Arg Thr Val Gln His Gl - #y Val Thr Ile Ser Leu# 150- GGC GTC TGG GCA GCA GCC ATT TTG GTG GCA GC - #A CCC CAG TTC ATG TTC 594Gly Val Trp Ala Ala Ala Ile Leu Val Ala Al - #a Pro Gln Phe Met Phe# 165- ACA AAG CAG AAA GAA AAT GAA TGC CTT GGT GA - #C TAC CCC GAG GTC CTC 642Thr Lys Gln Lys Glu Asn Glu Cys Leu Gly As - #p Tyr Pro Glu Val Leu# 180- CAG GAA ATC TGG CCC GTG CTC CGC AAT GTG GA - #A ACA AAT TTT CTT GGC 690Gln Glu Ile Trp Pro Val Leu Arg Asn Val Gl - #u Thr Asn Phe Leu Gly# 195- TTC CTA CTC CCC CTG CTC ATT ATG AGT TAT TG - #C TAC TTC AGA ATC ATC 738Phe Leu Leu Pro Leu Leu Ile Met Ser Tyr Cy - #s Tyr Phe Arg Ile Ile200 2 - #05 2 - #10 2 -#15- CAG ACG CTG TTT TCC TGC AAG AAC CAC AAG AA - #A GCC AAA GCC ATT AAA 786Gln Thr Leu Phe Ser Cys Lys Asn His Lys Ly - #s Ala Lys Ala Ile Lys# 230- CTG ATC CTT CTG GTG GTC ATC GTG TTT TTC CT - #C TTC TGG ACA CCC TAC 834Leu Ile Leu Leu Val Val Ile Val Phe Phe Le - #u Phe Trp Thr Pro Tyr# 245- AAC GTT ATG ATT TTC CTG GAG ACG CTT AAG CT - #C TAT GAC TTC TTT CCC 882Asn Val Met Ile Phe Leu Glu Thr Leu Lys Le - #u Tyr Asp Phe Phe Pro# 260- AGT TGT GAC ATG AGG AAG GAT CTG AGG CTG GC - #C CTC AGT GTG ACT GAG 930Ser Cys Asp Met Arg Lys Asp Leu Arg Leu Al - #a Leu Ser Val Thr Glu# 275- ACG GTT GCA TTT AGC CAT TGT TGC CTG AAT CC - #T CTC ATC TAT GCA TTT 978Thr Val Ala Phe Ser His Cys Cys Leu Asn Pr - #o Leu Ile Tyr Ala Phe280 2 - #85 2 - #90 2 -#95- GCT GGG GAG AAG TTC AGA AGA TAC CTT TAC CA - #C CTG TAT GGG AAA TGC1026Ala Gly Glu Lys Phe Arg Arg Tyr Leu Tyr Hi - #s Leu Tyr Gly Lys Cys# 310- CTG GCT GTC CTG TGT GGG CGC TCA GTC CAC GT - #T GAT TTC TCC TCA TCT1074Leu Ala Val Leu Cys Gly Arg Ser Val His Va - #l Asp Phe Ser Ser Ser# 325- GAA TCA CAA AGG AGC AGG CAT GGA AGT GTT CT - #G AGC AGC AAT TTT ACT1122Glu Ser Gln Arg Ser Arg His Gly Ser Val Le - #u Ser Ser Asn Phe Thr# 340- TAC CAC ACG AGT GAT GGA GAT GCA TTG CTC CT - #T CTC TGAAGGGAAT1168Tyr His Thr Ser Asp Gly Asp Ala Leu Leu Le - #u Leu# 355- CCCAAAGCCT TGTGTCTACA GAGAACCTGG AGTTCCTGAA CCTGATGCTG AC - #TAGTGAGG1228- AAAGATTTTT GTTGTTATTT CTTACAGGCA CAAAATGATG GACCCAATGC AC - #ACAAAACA1288- ACCCTAGAGT GTTGTTGAGA ATTGTGCTCA AAATTTGAAG AATGAACAAA TT - #GAACTCTT1348- TGAATGACAA AGAGTAGACA TTTCTCTTAC TGCAAATGTC ATCAGAACTT TT - #TGGTTTGC1408- AGATGACAAA AATTCAATCT AGACTAGTTT AGTTAAATGA GGGTGGTGAA TA - #TTGTTCAT1468- ATTGTGGCAC AAGCAAAAGG GTGTCTGAGC CCTCAAAGTG AGGGGAAACC AG - #GCCTGAGC1528- CAAGCTAGAA TTCCCTCTCT CTGACTCTCA AATCTTTTAG TCATTATAGA TC - #CCCCAGAC1588- TTTACATGAC ACAGCTTTAT CACCAGAGAG GGACTGACAC CCATGTTTCT CT - #GGCCCCAA1648- GGGAAAATTC CCAGGGAAGT GCTCTGATAG GCCAAGTTTG TATCAGGTGC CC - #ATCCCTGG1708- AAGGTGCTGT TATCCATGGG GAAGGGATAT ATAAGATGGA AGCTTCCAGT CC - #AATCTCAT1768- GGAGAAGCAG AAATACATAT TTCCAAGAAG TTGGATGGGT GGGTACTATT CT - #GATTACAC1828- AAAACAAATG CCACACATCA CCCTTACCAT GTGCCTGATC CAGCCTCTCC CC - #TGATTACA1888- CCAGCCTCGT CTTCATTAAG CCCTCTTCCA TCATGTCCCC AACCTGCAAG GG - #CTCCCCAC1948- TGCCTACTGC ATCGAGTCAA AACTCAAATG CTTGGCTTCT CATACGTCCA CC - #ATGGGGTC2008- CTACCAATAG ATTCCCCATT GCCTCCTCCT TNCCAAAGGA CTCCACCCAT CC - #TATCAGCC2068- TGTCTCTTCC ATATGACCTC ATGCATCTCC ACCTGCTCCC AGGCCAGTAA GG - #GAAATAGA2128- AAAACCCTGC CCCCAAATAA GAAGGGATGG ATTCCAACCC AACTCCAGTA GC - #TTGGGACA2188- AATCAAGCTT CAGTTTCCTG GTCTGTAGAA GAGGGATAAG GTACCTTTCA CA - #TAGAGATC2248- ATCCTTTCCA GCATGAGGAA CTAGCCACCA ACTCTTGCAG GTCTCAACCC TT - #TTGTCTGC2308- CTCTTAGACT TCTGCTTTCC ACACCTGCAC TGCTGTGCTG TGCCCAAGTT GT - #GGTGCTGA2368- CAAAGCTTGG AAGAGCCTGC AGGTGCCTTG GCCGCGTGCA TAGCCCAGAC AC - #AGAAGAGG2428- CTGGTTCTTA CGATGGCACC CAGTGAGCAC TCCCAAGTCT ACAGAGTGAT AG - #CCTTCCGT2488- AACCCAACTC TCCTGGACTG CCTTGAATAT CCCCTCCCAG TCACCTTGTG CA - #AGCCCCTG2548- CCCATCTGGG AAAATACCCC ATCATTCATG CTACTGCCAA CCTGGGGAGC CA - #GGGCTATG2608- GGAGCAGCTT TTTTTTCCCC CCTAGAAACG TTTGGAACAA TGTAAAACTT TA - #AAGCTCGA2668- AAACAATTGT AATAATGCTA AAGAAAAAGT CATCCAATCT AACCACATCA AT - #ATTGTCAT2728- TCCTGTATTC ACCCGTCCAG ACCTTGTTCA CACTCTCACA TGTTTAGAGT TG - #CAATCGTA2788- ATGTACAGAT NNNNTTATAA TCTGATTTGT TTTCCTCTTA ACGTTAGACC AC - #AAATAGTG2848- CTCGCTTTCT ATGTAGTTTG GTAATTATCA TTTTAGAAGA CTCTACCAGA CT - #GTGTATTC2908- ATTGAAGTCA GATGTGGTAA CTGTTAAATT GCTGTGTATC TGATAGCTCT TT - #GGCAGTCT2968- ATATGTTTGT ATAATGAATG AGAGAATAAG TCATGTTCCT TCAAGATCAT GT - #ACCCCAAT3028- TTACTTGCCA TTACTCAATT GATAAACATT TAACTTGTTT CCAATGTTTT AG - #CAAATACA3088# 3119 AAAA AAAAAAAAAA A- (2) INFORMATION FOR SEQ ID NO:32:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 355 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:32:- Met Asp Gln Phe Pro Glu Ser Val Thr Glu As - #n Phe Glu Tyr Asp Asp# 15- Leu Ala Glu Ala Cys Tyr Ile Gly Asp Ile Va - #l Val Phe Gly Thr Val# 30- Phe Leu Ser Ile Phe Tyr Ser Val Ile Phe Al - #a Ile Gly Leu Val Gly# 45- Asn Leu Leu Val Val Phe Ala Leu Thr Asn Se - #r Lys Lys Pro Lys Ser# 60- Val Thr Asp Ile Tyr Leu Leu Asn Leu Ala Le - #u Ser Asp Leu Leu Phe# 80- Val Ala Thr Leu Pro Phe Trp Thr His Tyr Le - #u Ile Asn Glu Lys Gly# 95- Leu His Asn Ala Met Cys Lys Phe Thr Thr Al - #a Phe Phe Phe Ile Gly# 110- Phe Phe Gly Ser Ile Phe Phe Ile Thr Val Il - #e Ser Ile Asp Arg Tyr# 125- Leu Ala Ile Val Leu Ala Ala Asn Ser Met As - #n Asn Arg Thr Val Gln# 140- His Gly Val Thr Ile Ser Leu Gly Val Trp Al - #a Ala Ala Ile Leu Val145 1 - #50 1 - #55 1 -#60- Ala Ala Pro Gln Phe Met Phe Thr Lys Gln Ly - #s Glu Asn Glu Cys Leu# 175- Gly Asp Tyr Pro Glu Val Leu Gln Glu Ile Tr - #p Pro Val Leu Arg Asn# 190- Val Glu Thr Asn Phe Leu Gly Phe Leu Leu Pr - #o Leu Leu Ile Met Ser# 205- Tyr Cys Tyr Phe Arg Ile Ile Gln Thr Leu Ph - #e Ser Cys Lys Asn His# 220- Lys Lys Ala Lys Ala Ile Lys Leu Ile Leu Le - #u Val Val Ile Val Phe225 2 - #30 2 - #35 2 -#40- Phe Leu Phe Trp Thr Pro Tyr Asn Val Met Il - #e Phe Leu Glu Thr Leu# 255- Lys Leu Tyr Asp Phe Phe Pro Ser Cys Asp Me - #t Arg Lys Asp Leu Arg# 270- Leu Ala Leu Ser Val Thr Glu Thr Val Ala Ph - #e Ser His Cys Cys Leu# 285- Asn Pro Leu Ile Tyr Ala Phe Ala Gly Glu Ly - #s Phe Arg Arg Tyr Leu# 300- Tyr His Leu Tyr Gly Lys Cys Leu Ala Val Le - #u Cys Gly Arg Ser Val305 3 - #10 3 - #15 3 -#20- His Val Asp Phe Ser Ser Ser Glu Ser Gln Ar - #g Ser Arg His Gly Ser# 335- Val Leu Ser Ser Asn Phe Thr Tyr His Thr Se - #r Asp Gly Asp Ala Leu# 350- Leu Leu Leu 355- (2) INFORMATION FOR SEQ ID NO:33:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 22 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:33:# 22ATC TC- (2) INFORMATION FOR SEQ ID NO:34:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 20 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:34:# 20 AGCA- (2) INFORMATION FOR SEQ ID NO:35:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 720 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 258..719- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:35:- GAATTCTTTT TGTATTCTAA TACAGTTCAA ATCAGTGTGG CTGGTTCATT TC - #AACTCCTT 60- CACTACCAAA CTAGGAGGCA GGGACTGGCT TCAGTTTTTC TGCCTTCTCT TT - #TTCACTGA 120- TGACCAGGGT ATAAAGATAT CTGCTGCATC GAACTTTAAA CTTCACATTG TC - #CTTATTTT 180- TCTTGATCTT GACAGATTCA GCATCCTTTC ATTGGGCTGT GAACAGAAAG TC - #CAGATTTG 240#GTT TAT TTG GAT 290AC CCA GAA GAA ACT TCA#Aspt Asp Pro Glu Glu Thr Ser Val Tyr Leu#10- TAT TAC TAT GCT ACG AGC CCA AAC TCT GAC AT - #C AGG GAG ACC CAC TCC 338Tyr Tyr Tyr Ala Thr Ser Pro Asn Ser Asp Il - #e Arg Glu Thr His Ser# 25- CAT GTT CCT TAC ACC TCT GTC TTC CTT CCA GT - #C TTT TAC ACA GCT GTG 386His Val Pro Tyr Thr Ser Val Phe Leu Pro Va - #l Phe Tyr Thr Ala Val# 40- TTC CTG ACT GGA GTG CTG GGG AAC CTT GTT CT - #C ATG GGA GCG TTG CAT 434Phe Leu Thr Gly Val Leu Gly Asn Leu Val Le - #u Met Gly Ala Leu His# 55- TTC AAA CCC GGC AGC CGA AGA CTG ATC GAC AT - #C TTT ATC ATC AAT CTG 482Phe Lys Pro Gly Ser Arg Arg Leu Ile Asp Il - #e Phe Ile Ile Asn Leu# 75- GCT GCC TCT GAC TTC ATT TTT CTT GTC ACA TT - #G CCT CTC TGG GTG GAT 530Ala Ala Ser Asp Phe Ile Phe Leu Val Thr Le - #u Pro Leu Trp Val Asp# 90- AAA GAA GCA TCT CTA GGA CTG TGG CGG ACG GG - #C TCC TTC CTG TGC AAA 578Lys Glu Ala Ser Leu Gly Leu Trp Arg Thr Gl - #y Ser Phe Leu Cys Lys# 105- GGG AGC TCC TAC ATG ATC TCC GTC AAT ATG CA - #C TGC AGT GTC CTC CTG 626Gly Ser Ser Tyr Met Ile Ser Val Asn Met Hi - #s Cys Ser Val Leu Leu# 120- CTC ACT TGC ATG AGT GTT GAC CGC TAC CTG GC - #C ATT GTG TGG CCA GTC 674Leu Thr Cys Met Ser Val Asp Arg Tyr Leu Al - #a Ile Val Trp Pro Val# 135- GTA TCC AGG AAA TTC AGA AGG ACA GAC TGT GC - #A TAT GTA GTC TGT G 720Val Ser Arg Lys Phe Arg Arg Thr Asp Cys Al - #a Tyr Val Val Cys140 1 - #45 1 - #50- (2) INFORMATION FOR SEQ ID NO:36:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 154 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:36:- Met Asp Pro Glu Glu Thr Ser Val Tyr Leu As - #p Tyr Tyr Tyr Ala Thr# 15- Ser Pro Asn Ser Asp Ile Arg Glu Thr His Se - #r His Val Pro Tyr Thr# 30- Ser Val Phe Leu Pro Val Phe Tyr Thr Ala Va - #l Phe Leu Thr Gly Val# 45- Leu Gly Asn Leu Val Leu Met Gly Ala Leu Hi - #s Phe Lys Pro Gly Ser# 60- Arg Arg Leu Ile Asp Ile Phe Ile Ile Asn Le - #u Ala Ala Ser Asp Phe# 80- Ile Phe Leu Val Thr Leu Pro Leu Trp Val As - #p Lys Glu Ala Ser Leu# 95- Gly Leu Trp Arg Thr Gly Ser Phe Leu Cys Ly - #s Gly Ser Ser Tyr Met# 110- Ile Ser Val Asn Met His Cys Ser Val Leu Le - #u Leu Thr Cys Met Ser# 125- Val Asp Arg Tyr Leu Ala Ile Val Trp Pro Va - #l Val Ser Arg Lys Phe# 140- Arg Arg Thr Asp Cys Ala Tyr Val Val Cys145 1 - #50- (2) INFORMATION FOR SEQ ID NO:37:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 21 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:37:#21 TATG A- (2) INFORMATION FOR SEQ ID NO:38:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 20 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:38:# 20 CATG- (2) INFORMATION FOR SEQ ID NO:39:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 1872 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 202..1341- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:39:- CTGCAGGAGA CAGGCTTCCT CCAGGGTCTG GAGAACCCAG AGGCAGCTCC TC - #CTGAGTGC 60- TGGGAAGGAC TCTGGGCATC TTCAGCCCTT CTTACTCTCT GAGGCTCAAG CC - #AGAAATTC 120- AGGCTGCTTG CAGAGTGGGT GACAGAGCCA CGGAGCTGGT GTCCCTGGGA CC - #CTCTGCCC 180#TTT GAC AAC TAC 231 ATG GAG GAA GGT GGT GAT#Asp Asn Tyrlu Glu Gly Gly Asp Phe# 10- TAT GGG GCA GAC AAC CAG TCT GAG TGT GAG TA - #C ACA GAC TGG AAA TCC 279Tyr Gly Ala Asp Asn Gln Ser Glu Cys Glu Ty - #r Thr Asp Trp Lys Ser# 25- TCG GGG GCC CTC ATC CCT GCC ATC TAC ATG TT - #G GTC TTC CTC CTG GGC 327Ser Gly Ala Leu Ile Pro Ala Ile Tyr Met Le - #u Val Phe Leu Leu Gly# 40- ACC ACG GGA AAC GGT CTG GTG CTC TGG ACC GT - #G TTT CGG AGC AGC CGG 375Thr Thr Gly Asn Gly Leu Val Leu Trp Thr Va - #l Phe Arg Ser Ser Arg# 55- GAG AAG AGG CGC TCA GCT GAT ATC TTC ATT GC - #T AGC CTG GCG GTG GCT 423Glu Lys Arg Arg Ser Ala Asp Ile Phe Ile Al - #a Ser Leu Ala Val Ala# 70- GAC CTG ACC TTC GTG GTG ACG CTG CCC CTG TG - #G GCT ACC TAC ACG TAC 471Asp Leu Thr Phe Val Val Thr Leu Pro Leu Tr - #p Ala Thr Tyr Thr Tyr# 90- CGG GAC TAT GAC TGG CCC TTT GGG ACC TTC TT - #C TGC AAG CTC AGC AGC 519Arg Asp Tyr Asp Trp Pro Phe Gly Thr Phe Ph - #e Cys Lys Leu Ser Ser# 105- TAC CTC ATC TTC GTC AAC ATG TAC GCC AGC GT - #C TTC TGC CTC ACC GGC 567Tyr Leu Ile Phe Val Asn Met Tyr Ala Ser Va - #l Phe Cys Leu Thr Gly# 120- CTC AGC TTC GAC CGC TAC CTG GCC ATC GTG AG - #G CCA GTG GCC AAT GCT 615Leu Ser Phe Asp Arg Tyr Leu Ala Ile Val Ar - #g Pro Val Ala Asn Ala# 135- CGG CTG AGG CTG CGG GTC AGC GGG GCC GTG GC - #C ACG GCA GTT CTT TGG 663Arg Leu Arg Leu Arg Val Ser Gly Ala Val Al - #a Thr Ala Val Leu Trp# 150- GTG CTG GCC GCC CTC CTG GCC ATG CCT GTC AT - #G GTG TTA CGC ACC ACC 711Val Leu Ala Ala Leu Leu Ala Met Pro Val Me - #t Val Leu Arg Thr Thr155 1 - #60 1 - #65 1 -#70- GGG GAC TTG GAG AAC ACC ACT AAG GTG CAG TG - #C TAC ATG GAC TAC TCC 759Gly Asp Leu Glu Asn Thr Thr Lys Val Gln Cy - #s Tyr Met Asp Tyr Ser# 185- ATG GTG GCC ACT GTG AGC TCA GAG TGG GCC TG - #G GAG GTG GGC CTT GGG 807Met Val Ala Thr Val Ser Ser Glu Trp Ala Tr - #p Glu Val Gly Leu Gly# 200- GTC TCG TCC ACC ACC GTG GGC TTT GTG GTG CC - #C TTC ACC ATC ATG CTG 855Val Ser Ser Thr Thr Val Gly Phe Val Val Pr - #o Phe Thr Ile Met Leu# 215- ACC TGT TAC TTC TTC ATC GCC CAA ACC ATC GC - #T GGC CAC TTC CGC AAG 903Thr Cys Tyr Phe Phe Ile Ala Gln Thr Ile Al - #a Gly His Phe Arg Lys# 230- GAA CGC ATC GAG GGC CTG CGG AAG CGG CGC CG - #G CTG CTC AGC ATC ATC 951Glu Arg Ile Glu Gly Leu Arg Lys Arg Arg Ar - #g Leu Leu Ser Ile Ile235 2 - #40 2 - #45 2 -#50- GTG GTG CTG GTG GTG ACC TTT GCC CTG TGC TG - #G ATG CCC TAC CAC CTG 999Val Val Leu Val Val Thr Phe Ala Leu Cys Tr - #p Met Pro Tyr His Leu# 265- GTG AAG ACG CTG TAC ATG CTG GGC AGC CTG CT - #G CAC TGG CCC TGT GAC1047Val Lys Thr Leu Tyr Met Leu Gly Ser Leu Le - #u His Trp Pro Cys Asp# 280- TTT GAC CTC TTC CTC ATG AAC ATC TTC CCC TA - #C TGC ACC TGC ATC AGC1095Phe Asp Leu Phe Leu Met Asn Ile Phe Pro Ty - #r Cys Thr Cys Ile Ser# 295- TAC GTC AAC AGC TGC CTC AAC CCC TTC CTC TA - #T GCC TTT TTC GAC CCC1143Tyr Val Asn Ser Cys Leu Asn Pro Phe Leu Ty - #r Ala Phe Phe Asp Pro# 310- CGC TTC CGC CAG GCC TGC ACC TCC ATG CTC TG - #C TGT GGC CAG AGC AGG1191Arg Phe Arg Gln Ala Cys Thr Ser Met Leu Cy - #s Cys Gly Gln Ser Arg315 3 - #20 3 - #25 3 -#30- TGC GCA GGC ACC TCC CAC AGC AGC AGT GGG GA - #G AAG TCA GCC AGC TAC1239Cys Ala Gly Thr Ser His Ser Ser Ser Gly Gl - #u Lys Ser Ala Ser Tyr# 345- TCT TCG GGG CAC AGC CAG GGG CCC GGC CCC AA - #C ATG GGC AAG GGT GGA1287Ser Ser Gly His Ser Gln Gly Pro Gly Pro As - #n Met Gly Lys Gly Gly# 360- GAA CAG ATG CAC GAG AAA TCC ATC CCC TAC AG - #C CAG GAG ACC CTT GTG1335Glu Gln Met His Glu Lys Ser Ile Pro Tyr Se - #r Gln Glu Thr Leu Val# 375- GTT GAC TAGGGCTGGG AGCAGAGAGA AGCCTGGCGC CCTCGGCCCT CC - #CCGGCCTT1391Val Asp 380- TGCCCTTGCT TTCTGAAAAT CAGGTAGTGT GGCTACTCCC TTGTCCTATG CA - #CATCCTTT1451- AACTGTCCCC TGATTCTGCC CGCCCTGTCC TCCTCTACTG CTTTATTCTT TC - #TCAGAGGT1511- TTGTGGTTTA GGGGAAAGAG ACTGGGCTCT ACAGACCTGA CCCTGCACAA GC - #CATTTAAT1571- CTCACTCAGC CTCAGTTTCT CCATTGGTAT GAAATGGGGG AAAGTCATAT TG - #ATCCTAAA1631- ATGTTGAAGC CTGAGTCTGG ACGCAGTAAA AGCTTGTTTC CCTCTGCTGC TT - #TCTTAGAT1691- CTGCAATCGT CTTTCCTCCC CTCTTTCCTT GTAGTTTTTC CCCNCACNAC TC - #TCTGCACG1751- TGCCGCTCNT TATCCCNGCT TCTGGCACCA ATCCCCTCCT ACAGCTCGTC CC - #CCTCNCTC1811- GATCCATCCT TCTCGCCTGT CTACTTTCTT GTTCTGAAGG GCTACTAAGG GT - #TAAGGATC1871# 1872- (2) INFORMATION FOR SEQ ID NO:40:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 380 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:40:- Met Glu Glu Gly Gly Asp Phe Asp Asn Tyr Ty - #r Gly Ala Asp Asn Gln# 15- Ser Glu Cys Glu Tyr Thr Asp Trp Lys Ser Se - #r Gly Ala Leu Ile Pro# 30- Ala Ile Tyr Met Leu Val Phe Leu Leu Gly Th - #r Thr Gly Asn Gly Leu# 45- Val Leu Trp Thr Val Phe Arg Ser Ser Arg Gl - #u Lys Arg Arg Ser Ala# 60- Asp Ile Phe Ile Ala Ser Leu Ala Val Ala As - #p Leu Thr Phe Val Val# 80- Thr Leu Pro Leu Trp Ala Thr Tyr Thr Tyr Ar - #g Asp Tyr Asp Trp Pro# 95- Phe Gly Thr Phe Phe Cys Lys Leu Ser Ser Ty - #r Leu Ile Phe Val Asn# 110- Met Tyr Ala Ser Val Phe Cys Leu Thr Gly Le - #u Ser Phe Asp Arg Tyr# 125- Leu Ala Ile Val Arg Pro Val Ala Asn Ala Ar - #g Leu Arg Leu Arg Val# 140- Ser Gly Ala Val Ala Thr Ala Val Leu Trp Va - #l Leu Ala Ala Leu Leu145 1 - #50 1 - #55 1 -#60- Ala Met Pro Val Met Val Leu Arg Thr Thr Gl - #y Asp Leu Glu Asn Thr# 175- Thr Lys Val Gln Cys Tyr Met Asp Tyr Ser Me - #t Val Ala Thr Val Ser# 190- Ser Glu Trp Ala Trp Glu Val Gly Leu Gly Va - #l Ser Ser Thr Thr Val# 205- Gly Phe Val Val Pro Phe Thr Ile Met Leu Th - #r Cys Tyr Phe Phe Ile# 220- Ala Gln Thr Ile Ala Gly His Phe Arg Lys Gl - #u Arg Ile Glu Gly Leu225 2 - #30 2 - #35 2 -#40- Arg Lys Arg Arg Arg Leu Leu Ser Ile Ile Va - #l Val Leu Val Val Thr# 255- Phe Ala Leu Cys Trp Met Pro Tyr His Leu Va - #l Lys Thr Leu Tyr Met# 270- Leu Gly Ser Leu Leu His Trp Pro Cys Asp Ph - #e Asp Leu Phe Leu Met# 285- Asn Ile Phe Pro Tyr Cys Thr Cys Ile Ser Ty - #r Val Asn Ser Cys Leu# 300- Asn Pro Phe Leu Tyr Ala Phe Phe Asp Pro Ar - #g Phe Arg Gln Ala Cys305 3 - #10 3 - #15 3 -#20- Thr Ser Met Leu Cys Cys Gly Gln Ser Arg Cy - #s Ala Gly Thr Ser His# 335- Ser Ser Ser Gly Glu Lys Ser Ala Ser Tyr Se - #r Ser Gly His Ser Gln# 350- Gly Pro Gly Pro Asn Met Gly Lys Gly Gly Gl - #u Gln Met His Glu Lys# 365- Ser Ile Pro Tyr Ser Gln Glu Thr Leu Val Va - #l Asp# 380- (2) INFORMATION FOR SEQ ID NO:41:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 2098 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 551..1681- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:41:- AGTTTCCTGG GAGCGGCCGT GGTTGTGGTG GTGGTGGGAC AGTGTGCAGC CA - #TGAAAGAA 60- GGTGCAAAGG AATCTCCAAA GAAAGCCTGA CCAGCGTAAA AAGTTGGGAG GC - #TTTGTCCT 120- TGTCACTTGT CCACTAAACT CCTCCCCTCC CTGTTATCCT GGTTGACCCT GG - #GCATCTCT 180- GGGGACAGTA GGCAGGTGAT TGGGAAAGTT AATGGGATTG AGGGGCTGAG GG - #CTGGCAGG 240- GGGCAAAAAG ACTGGCCTTT CAAGGGGTGC AGCATTGGTA GGAACTCTGT TT - #GGTTCTGG 300- GCTTTAGGGT CTCCTAAGGG AGGAGACTGA AAAGGTCTGG AAATGCTGCT GC - #TGCTGTGG 360- TCACTGTATA TTTTGCAATT GGGTCTGTGG ACAGGAAGGG GCCGCATGAC CC - #AGTTAGGA 420- AACTAGTCTT TGTACTCAAC CAGATCCCTT TAAGTTGTCA GTCTGCAGCG AT - #GGGGGCAG 480- TATATTTCAG GGGGACCTCT GATGCTGCTG ACCCTGGAGA TAGACTAGAG TT - #CTCAGCCT 540- AGGTGTGTCC ATG GCG TCA GGA AAC CCT TGG TCC TC - #T ACT CTC ATG CGT 589#Asn Pro Trp Ser Ser Thr Leu Met Arg# 10- GTG TCC GCC CTC ACT CTC CAG GTC CTC CCG AC - #G GCC ATG AAC ACT ACA 637Val Ser Ala Leu Thr Leu Gln Val Leu Pro Th - #r Ala Met Asn Thr Thr# 25- TCT TCT GCA GCA CCC CCC TCA CTA GGT GTA GA - #G TTC ATC TCT CTG CTG 685Ser Ser Ala Ala Pro Pro Ser Leu Gly Val Gl - #u Phe Ile Ser Leu Leu# 45- GCT ATC ATC CTG CTG TCA GTG GCG CTG GCT GT - #G GGG CTT CCC GGC AAC 733Ala Ile Ile Leu Leu Ser Val Ala Leu Ala Va - #l Gly Leu Pro Gly Asn# 60- AGC TTT GTG GTG TGG AGT ATC CTG AAA AGG AT - #G CAG AAG CGC TCT GTC 781Ser Phe Val Val Trp Ser Ile Leu Lys Arg Me - #t Gln Lys Arg Ser Val# 75- ACT GCC CTG ATG GTG CTG AAC CTG GCC CTG GC - #C GAC CTG GCC GTA TTG 829Thr Ala Leu Met Val Leu Asn Leu Ala Leu Al - #a Asp Leu Ala Val Leu# 90- CTC ACT GCT CCC TTT TTC CTT CAC TTC CTG GC - #C CAA GGC ACC TGG AGT 877Leu Thr Ala Pro Phe Phe Leu His Phe Leu Al - #a Gln Gly Thr Trp Ser# 105- TTT GGA CTG GCT GGT TGC CGC CTG TGT CAC TA - #T GTC TGC GGA GTC AGC 925Phe Gly Leu Ala Gly Cys Arg Leu Cys His Ty - #r Val Cys Gly Val Ser110 1 - #15 1 - #20 1 -#25- ATG TAC GCC AGC GTC CTG CTT ATC ACG GCC AT - #G AGT CTA GAC CGC TCA 973Met Tyr Ala Ser Val Leu Leu Ile Thr Ala Me - #t Ser Leu Asp Arg Ser# 140- CTG GCG GTG GCC CGC CCC TTT GTG TCC CAG AA - #G CTA CGC ACC AAG GCG1021Leu Ala Val Ala Arg Pro Phe Val Ser Gln Ly - #s Leu Arg Thr Lys Ala# 155- ATG GCC CGG CGG GTG CTG GCA GGC ATC TGG GT - #G TTG TCC TTT CTG CTG1069Met Ala Arg Arg Val Leu Ala Gly Ile Trp Va - #l Leu Ser Phe Leu Leu# 170- GCC ACA CCC GTC CTC GCG TAC CGC ACA GTA GT - #G CCC TGG AAA ACG AAC1117Ala Thr Pro Val Leu Ala Tyr Arg Thr Val Va - #l Pro Trp Lys Thr Asn# 185- ATG AGC CTG TGC TTC CCG CGG TAC CCC AGC GA - #A GGG CAC CGG GCC TTC1165Met Ser Leu Cys Phe Pro Arg Tyr Pro Ser Gl - #u Gly His Arg Ala Phe190 1 - #95 2 - #00 2 -#05- CAT CTA ATC TTC GAG GCT GTC ACG GGC TTC CT - #G CTG CCC TTC CTG GCT1213His Leu Ile Phe Glu Ala Val Thr Gly Phe Le - #u Leu Pro Phe Leu Ala# 220- GTG GTG GCC AGC TAC TCG GAC ATA GGG CGT CG - #G CTA CAG GCC CGG CGC1261Val Val Ala Ser Tyr Ser Asp Ile Gly Arg Ar - #g Leu Gln Ala Arg Arg# 235- TTC CGC CGC AGC CGC CGC ACC GGC CGC CTG GT - #G GTG CTC ATC ATC CTG1309Phe Arg Arg Ser Arg Arg Thr Gly Arg Leu Va - #l Val Leu Ile Ile Leu# 250- ACC TTC GCC GCC TTC TGG CTG CCC TAC CAC GT - #G GTG AAC CTG GCT GAG1357Thr Phe Ala Ala Phe Trp Leu Pro Tyr His Va - #l Val Asn Leu Ala Glu# 265- GCC CGC CGC GCG CTG GCC GGC CAG GCC GCC GG - #G TTA GGG CTC GTG GGG1405Ala Arg Arg Ala Leu Ala Gly Gln Ala Ala Gl - #y Leu Gly Leu Val Gly270 2 - #75 2 - #80 2 -#85- AAG CGG CTG AGC CTG GCC CGC AAC GTG CTC AT - #C GCA CTC GCC TTC CTG1453Lys Arg Leu Ser Leu Ala Arg Asn Val Leu Il - #e Ala Leu Ala Phe Leu# 300- AGC AGC AGC GTG AAC CCC GTG CTG TAC GCG TG - #C GCC GGC GGC GGC CTG1501Ser Ser Ser Val Asn Pro Val Leu Tyr Ala Cy - #s Ala Gly Gly Gly Leu# 315- CTG CGC TCG GCG GGC GTG GGC TTC GTC GCC AA - #G CTG CTG GAG GGC ACG1549Leu Arg Ser Ala Gly Val Gly Phe Val Ala Ly - #s Leu Leu Glu Gly Thr# 330- GGC TCC GAG GCG TCC AGC ACG CGC CGC GGG GG - #C AGC CTG GGC CAG ACC1597Gly Ser Glu Ala Ser Ser Thr Arg Arg Gly Gl - #y Ser Leu Gly Gln Thr# 345- GCT AGG AGC GGC CCC GCC GCT CTG GAG CCC GG - #C CCT TCC GAG AGC CTC1645Ala Arg Ser Gly Pro Ala Ala Leu Glu Pro Gl - #y Pro Ser Glu Ser Leu350 3 - #55 3 - #60 3 -#65- ACT GCC TCC AGC CCT CTC AAG TTA AAC GAA CT - #G AAC TAGGCCTGGT1691Thr Ala Ser Ser Pro Leu Lys Leu Asn Glu Le - #u Asn# 375- GGAAGGAGGC GCACTTTCCT CCTGGCAGAA TCGTAGCTCT GAGCCAGTTC AG - #TACCTGGA1751- GGAGGAGCAG GGGCGTGGAG GGCGTGGAGG GCGTGGGAGC GTGGGAGGCG GG - #AGTGGAGT1811- GGAAGAAGAG GGAGAGATGG AGCAAAGTGA GGGCCGAGTG AGAGCGTGCT CC - #AGCCTGGC1871- TCCCACAGGC AGCTTTAACC ATTAAAACTG AAGTCTGAAA TTTGGTCAAC CT - #TGTGAGTG1931- GGGTACATGT GCTGTGGGTA TCGGGGTGCT CGTGGGCGCC CTGGTGGGGC CC - #CTCTCGGT1991- AGTTGAGAGT CACGTCCTTT AGTTCCCCAT GATTTACAAT TTTGGAAGGG AC - #ACAAAGAA2051# 2098TCCC AGATGATTCC GAGTACATAG TCTGCAG- (2) INFORMATION FOR SEQ ID NO:42:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 377 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:42:- Met Ala Ser Gly Asn Pro Trp Ser Ser Thr Le - #u Met Arg Val Ser Ala# 15- Leu Thr Leu Gln Val Leu Pro Thr Ala Met As - #n Thr Thr Ser Ser Ala# 30- Ala Pro Pro Ser Leu Gly Val Glu Phe Ile Se - #r Leu Leu Ala Ile Ile# 45- Leu Leu Ser Val Ala Leu Ala Val Gly Leu Pr - #o Gly Asn Ser Phe Val# 60- Val Trp Ser Ile Leu Lys Arg Met Gln Lys Ar - #g Ser Val Thr Ala Leu# 80- Met Val Leu Asn Leu Ala Leu Ala Asp Leu Al - #a Val Leu Leu Thr Ala# 95- Pro Phe Phe Leu His Phe Leu Ala Gln Gly Th - #r Trp Ser Phe Gly Leu# 110- Ala Gly Cys Arg Leu Cys His Tyr Val Cys Gl - #y Val Ser Met Tyr Ala# 125- Ser Val Leu Leu Ile Thr Ala Met Ser Leu As - #p Arg Ser Leu Ala Val# 140- Ala Arg Pro Phe Val Ser Gln Lys Leu Arg Th - #r Lys Ala Met Ala Arg145 1 - #50 1 - #55 1 -#60- Arg Val Leu Ala Gly Ile Trp Val Leu Ser Ph - #e Leu Leu Ala Thr Pro# 175- Val Leu Ala Tyr Arg Thr Val Val Pro Trp Ly - #s Thr Asn Met Ser Leu# 190- Cys Phe Pro Arg Tyr Pro Ser Glu Gly His Ar - #g Ala Phe His Leu Ile# 205- Phe Glu Ala Val Thr Gly Phe Leu Leu Pro Ph - #e Leu Ala Val Val Ala# 220- Ser Tyr Ser Asp Ile Gly Arg Arg Leu Gln Al - #a Arg Arg Phe Arg Arg225 2 - #30 2 - #35 2 -#40- Ser Arg Arg Thr Gly Arg Leu Val Val Leu Il - #e Ile Leu Thr Phe Ala# 255- Ala Phe Trp Leu Pro Tyr His Val Val Asn Le - #u Ala Glu Ala Arg Arg# 270- Ala Leu Ala Gly Gln Ala Ala Gly Leu Gly Le - #u Val Gly Lys Arg Leu# 285- Ser Leu Ala Arg Asn Val Leu Ile Ala Leu Al - #a Phe Leu Ser Ser Ser# 300- Val Asn Pro Val Leu Tyr Ala Cys Ala Gly Gl - #y Gly Leu Leu Arg Ser305 3 - #10 3 - #15 3 -#20- Ala Gly Val Gly Phe Val Ala Lys Leu Leu Gl - #u Gly Thr Gly Ser Glu# 335- Ala Ser Ser Thr Arg Arg Gly Gly Ser Leu Gl - #y Gln Thr Ala Arg Ser# 350- Gly Pro Ala Ala Leu Glu Pro Gly Pro Ser Gl - #u Ser Leu Thr Ala Ser# 365- Ser Pro Leu Lys Leu Asn Glu Leu Asn# 375- (2) INFORMATION FOR SEQ ID NO:43:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 1901 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 701..1717- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:43:- GGATCCAGAA AGCCCCCAAG AGAGATGCTG AAACTCTCAG GTGGGTAAAA AG - #AGTAGACC 60- TCTGACGTCC CAGGGTACAG CCCTTGCTGC CATCCTGGGG GCACCCTCCT AA - #GTGCCAGG 120- GGCAAGCCAT GGTCAGGGGA AGCAGAAAGC GGTGACACCC CGGCCACTGC AC - #CTGTGGGC 180- AGGTGGGTCA GGGAGGGTCC AGGCACTCAG GATGAACAGA ACTCACCTGC CA - #AGGCTTGG 240- GCTGAGGAGG AGCTGGAATC CTGGAGACAC ACTGCCCCCG CCCCTCACCA CC - #CCTGTCAC 300- TCAGACAGCA CACCTCAGAG GCAGAACAGA AAACCCAGAG CCTCACCCAG GC - #AAGGCTCA 360- CGTCCCATTC CCCGCCATGG CACTGACCCG GTCCTCCCAG CTCTGAGGAG CC - #TCAGATCT 420- CCTGGGTGGC AGGGGTGCAG CTGCATAGCG CCGAAATTCC AAGCCCTGGT TC - #TGCGTTTG 480- CCTTGTGCTG AAGTTCAGAA TGCCTCTGAC GCTCACGCAC ACCAAATGGA CA - #AGGAGGTC 540- CCCTCAGCAG CCCCGTGGGC GGTGCTGAGC TTGAAAGTGG GAGGTTCTGA AG - #GCATTGGA 600- GGCCTGACTT CTGGACTTCA GAGAGCGTGA AGCTGCCTAG ATCGCAAGCT CA - #TTGTGAAC 660- TGTTTGCTTG TTCCCTCCAG GCTCTGACTC CAGCCAAAGC ATG AAT GG - #C CTT GAA 715# Met Asn Gly Leu Glu# 5 1- GTG GCT CCC CCA GGT CTG ATC ACC AAC TTC TC - #C CTG GCC ACG GCA GAG 763Val Ala Pro Pro Gly Leu Ile Thr Asn Phe Se - #r Leu Ala Thr Ala Glu# 20- CAA TGT GGC CAG GAG ACG CCA CTG GAG AAC AT - #G CTG TTC GCC TCC TTC 811Gln Cys Gly Gln Glu Thr Pro Leu Glu Asn Me - #t Leu Phe Ala Ser Phe# 35- TAC CTT CTG GAT TTT ATC CTG GCT TTA GTT GG - #C AAT ACC CTG GCT CTG 859Tyr Leu Leu Asp Phe Ile Leu Ala Leu Val Gl - #y Asn Thr Leu Ala Leu# 50- TGG CTT TTC ATC CGA GAC CAC AAG TCC GGG AC - #C CCG GCC AAC GTG TTC 907Trp Leu Phe Ile Arg Asp His Lys Ser Gly Th - #r Pro Ala Asn Val Phe# 65- CTG ATG CAT CTG GCC GTG GCC GAC TTG TCG TG - #C GTG CTG GTC CTG CCC 955Leu Met His Leu Ala Val Ala Asp Leu Ser Cy - #s Val Leu Val Leu Pro# 85- ACC CGC CTG GTC TAC CAC TTC TCT GGG AAC CA - #C TGG CCA TTT GGG GAA1003Thr Arg Leu Val Tyr His Phe Ser Gly Asn Hi - #s Trp Pro Phe Gly Glu# 100- ATC GCA TGC CGT CTC ACC GGC TTC CTC TTC TA - #C CTC AAC ATG TAC GCC1051Ile Ala Cys Arg Leu Thr Gly Phe Leu Phe Ty - #r Leu Asn Met Tyr Ala# 115- AGC ATC TAC TTC CTC ACC TGC ATC AGC GCC GA - #C CGT TTC CTG GCC ATT1099Ser Ile Tyr Phe Leu Thr Cys Ile Ser Ala As - #p Arg Phe Leu Ala Ile# 130- GTG CAC CCG GTC AAG TCC CTC AAG CTC CGC AG - #G CCC CTC TAC GCA CAC1147Val His Pro Val Lys Ser Leu Lys Leu Arg Ar - #g Pro Leu Tyr Ala His# 145- CTG GCC TGT GCC TTC CTG TGG GTG GTG GTG GC - #T GTG GCC ATG GCC CCG1195Leu Ala Cys Ala Phe Leu Trp Val Val Val Al - #a Val Ala Met Ala Pro150 1 - #55 1 - #60 1 -#65- CTG CTG GTG AGC CCA CAG ACC GTG CAG ACC AA - #C CAC ACG GTG GTC TGC1243Leu Leu Val Ser Pro Gln Thr Val Gln Thr As - #n His Thr Val Val Cys# 180- CTG CAG CTG TAC CGG GAG AAG GCC TCC CAC CA - #T GCC CTG GTG TCC CTG1291Leu Gln Leu Tyr Arg Glu Lys Ala Ser His Hi - #s Ala Leu Val Ser Leu# 195- GCA GTG GCC TTC ACC TTC CCG TTC ATC ACC AC - #G GTC ACC TGC TAC CTG1339Ala Val Ala Phe Thr Phe Pro Phe Ile Thr Th - #r Val Thr Cys Tyr Leu# 210- CTG ATC ATC CGC AGC CTG CGG CAG GGC CTG CG - #T GTG GAG AAG CGC CTC1387Leu Ile Ile Arg Ser Leu Arg Gln Gly Leu Ar - #g Val Glu Lys Arg Leu# 225- AAG ACC AAG GCA GTG CGC ATG ATC GCC ATA GT - #G CTG GCC ATC TTC CTG1435Lys Thr Lys Ala Val Arg Met Ile Ala Ile Va - #l Leu Ala Ile Phe Leu230 2 - #35 2 - #40 2 -#45- GTC TGC TTC GTG CCC TAC CAC GTC AAC CGC TC - #C GTC TAC GTG CTG CAC1483Val Cys Phe Val Pro Tyr His Val Asn Arg Se - #r Val Tyr Val Leu His# 260- TAC CGC AGC CAT GGG GCC TCC TGC GCC ACC CA - #G CGC ATC CTG GCC CTG1531Tyr Arg Ser His Gly Ala Ser Cys Ala Thr Gl - #n Arg Ile Leu Ala Leu# 275- GCA AAC CGC ATC ACC TCC TGC CTC ACC AGC CT - #C AAC GGG GCA CTC GAC1579Ala Asn Arg Ile Thr Ser Cys Leu Thr Ser Le - #u Asn Gly Ala Leu Asp# 290- CCC ATC ATG TAT TTC TTC GTG GCT GAG AAG TT - #C CGC CAC GCC CTG TGC1627Pro Ile Met Tyr Phe Phe Val Ala Glu Lys Ph - #e Arg His Ala Leu Cys# 305- AAC TTG CTC TGT GGC AAA AGG CTC AAG GGC CC - #G CCC CCC AGC TTC GAA1675Asn Leu Leu Cys Gly Lys Arg Leu Lys Gly Pr - #o Pro Pro Ser Phe Glu310 3 - #15 3 - #20 3 -#25- GGG AAA ACC AAC GAG AGC TCG CTG AGT GCC AA - #G TCA GAG CTG#1717Gly Lys Thr Asn Glu Ser Ser Leu Ser Ala Ly - #s Ser Glu Leu# 335- TGAGCGGGGG GCGCCGTCCA GCGCGAGCGC AGACTGTTTA GGACTCAGCA GA - #CCCAGCAA1777- GAGGCATCTG CCCTTTCCCC AGCCACCTCC CCGGCAAGCA ACCTGAAATC TC - #AGCAGATG1837- CCCACCATTT CTCTAGATCG CCTAGTCTCA ACCCATAAAA AGGAAGAACT GA - #CAAAGGGG1897# 1901- (2) INFORMATION FOR SEQ ID NO:44:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 339 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:44:- Met Asn Gly Leu Glu Val Ala Pro Pro Gly Le - #u Ile Thr Asn Phe Ser# 15- Leu Ala Thr Ala Glu Gln Cys Gly Gln Glu Th - #r Pro Leu Glu Asn Met# 30- Leu Phe Ala Ser Phe Tyr Leu Leu Asp Phe Il - #e Leu Ala Leu Val Gly# 45- Asn Thr Leu Ala Leu Trp Leu Phe Ile Arg As - #p His Lys Ser Gly Thr# 60- Pro Ala Asn Val Phe Leu Met His Leu Ala Va - #l Ala Asp Leu Ser Cys# 80- Val Leu Val Leu Pro Thr Arg Leu Val Tyr Hi - #s Phe Ser Gly Asn His# 95- Trp Pro Phe Gly Glu Ile Ala Cys Arg Leu Th - #r Gly Phe Leu Phe Tyr# 110- Leu Asn Met Tyr Ala Ser Ile Tyr Phe Leu Th - #r Cys Ile Ser Ala Asp# 125- Arg Phe Leu Ala Ile Val His Pro Val Lys Se - #r Leu Lys Leu Arg Arg# 140- Pro Leu Tyr Ala His Leu Ala Cys Ala Phe Le - #u Trp Val Val Val Ala145 1 - #50 1 - #55 1 -#60- Val Ala Met Ala Pro Leu Leu Val Ser Pro Gl - #n Thr Val Gln Thr Asn# 175- His Thr Val Val Cys Leu Gln Leu Tyr Arg Gl - #u Lys Ala Ser His His# 190- Ala Leu Val Ser Leu Ala Val Ala Phe Thr Ph - #e Pro Phe Ile Thr Thr# 205- Val Thr Cys Tyr Leu Leu Ile Ile Arg Ser Le - #u Arg Gln Gly Leu Arg# 220- Val Glu Lys Arg Leu Lys Thr Lys Ala Val Ar - #g Met Ile Ala Ile Val225 2 - #30 2 - #35 2 -#40- Leu Ala Ile Phe Leu Val Cys Phe Val Pro Ty - #r His Val Asn Arg Ser# 255- Val Tyr Val Leu His Tyr Arg Ser His Gly Al - #a Ser Cys Ala Thr Gln# 270- Arg Ile Leu Ala Leu Ala Asn Arg Ile Thr Se - #r Cys Leu Thr Ser Leu# 285- Asn Gly Ala Leu Asp Pro Ile Met Tyr Phe Ph - #e Val Ala Glu Lys Phe# 300- Arg His Ala Leu Cys Asn Leu Leu Cys Gly Ly - #s Arg Leu Lys Gly Pro305 3 - #10 3 - #15 3 -#20- Pro Pro Ser Phe Glu Gly Lys Thr Asn Glu Se - #r Ser Leu Ser Ala Lys# 335- Ser Glu Leu- (2) INFORMATION FOR SEQ ID NO:45:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 1317 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 201..1211- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:45:- GAGTTGTAGG ATTCTACATT AATTCTCTTG TGCCCTTAGC CCACTACTTC AG - #AATTTCCT 60- GAAGAAAGCA AGCCTGAATT GGTTTTTTAA ATTGCTTTAA AAATTTTTTT TA - #ACTGGGTT 120- AATGCTTGCT GAATTGGAAG TGAATGTCCA TTCCTTTGCC TCTTTTGCAG AT - #ATACACTT 180- CAGATAACTA CACCGAGGAA ATG GGC TCA GGG GAC TAT GA - #C TCC ATG AAG 230#Met Lys Gly Ser Gly Asp Tyr Asp Ser# 10- GAA CCC TGT TTC CGT GAA GAA AAT GCT AAT TT - #C AAT AAA ATC TTC CTG 278Glu Pro Cys Phe Arg Glu Glu Asn Ala Asn Ph - #e Asn Lys Ile Phe Leu# 25- CCC ACC ATC TAC TCC ATC ATC TTC TTA ACT GG - #C ATT GTG GGC AAT GGA 326Pro Thr Ile Tyr Ser Ile Ile Phe Leu Thr Gl - #y Ile Val Gly Asn Gly# 40- TTG GTC ATC CTG GTC ATG GGT TAC CAG AAG AA - #A CTG AGA AGC ATG ACG 374Leu Val Ile Leu Val Met Gly Tyr Gln Lys Ly - #s Leu Arg Ser Met Thr# 55- GAC AAG TAC AGG CTG CAC CTG TCA GTG GCC GA - #C CTC CTC TTT GTC ATC 422Asp Lys Tyr Arg Leu His Leu Ser Val Ala As - #p Leu Leu Phe Val Ile# 70- ACG CTT CCC TTC TGG GCA GTT GAT GCC GTG GC - #A AAC TGG TAC TTT GGG 470Thr Leu Pro Phe Trp Ala Val Asp Ala Val Al - #a Asn Trp Tyr Phe Gly# 90- AAC TTC CTA TGC AAG GCA GTC CAT GTC ATC TA - #C ACA GTC AAC CTC TAC 518Asn Phe Leu Cys Lys Ala Val His Val Ile Ty - #r Thr Val Asn Leu Tyr# 105- AGC AGT GTC CTC ATC CTG GCC TTC ATC AGT CT - #G GAC CGC TAC CTG GCC 566Ser Ser Val Leu Ile Leu Ala Phe Ile Ser Le - #u Asp Arg Tyr Leu Ala# 120- ATC GTC CAC GCC ACC AAC AGT CAG AGG CCA AG - #G AAG CTG TTG GCT GAA 614Ile Val His Ala Thr Asn Ser Gln Arg Pro Ar - #g Lys Leu Leu Ala Glu# 135- AAG GTG GTC TAT GTT GGC GTC TGG ATC CCT GC - #C CTC CTG CTG ACT ATT 662Lys Val Val Tyr Val Gly Val Trp Ile Pro Al - #a Leu Leu Leu Thr Ile# 150- CCC GAC TTC ATC TTT GCC AAC GTC AGT GAG GC - #A GAT GAC AGA TAT ATC 710Pro Asp Phe Ile Phe Ala Asn Val Ser Glu Al - #a Asp Asp Arg Tyr Ile155 1 - #60 1 - #65 1 -#70- TGT GAC CGC TTC TAC CCC AAT GAC TTG TGG GT - #G GTT GTG TTC CAG TTT 758Cys Asp Arg Phe Tyr Pro Asn Asp Leu Trp Va - #l Val Val Phe Gln Phe# 185- CAG CAC ATC ATG GTT GGC CTT ATC CTG CCT GG - #T ATT GTC ATC CTG TCC 806Gln His Ile Met Val Gly Leu Ile Leu Pro Gl - #y Ile Val Ile Leu Ser# 200- TGC TAT TGC ATT ATC ATC TCC AAG CTG TCA CA - #C TCC AAG GGC CAC CAG 854Cys Tyr Cys Ile Ile Ile Ser Lys Leu Ser Hi - #s Ser Lys Gly His Gln# 215- AAG CGC AAG GCC CTC AAG ACC ACA GTC ATC CT - #C ATC CTG GCT TTC TTC 902Lys Arg Lys Ala Leu Lys Thr Thr Val Ile Le - #u Ile Leu Ala Phe Phe# 230- GCC TGT TGG CTG CCT TAC TAC ATT GGG ATC AG - #C ATC GAC TCC TTC ATC 950Ala Cys Trp Leu Pro Tyr Tyr Ile Gly Ile Se - #r Ile Asp Ser Phe Ile235 2 - #40 2 - #45 2 -#50- CTC CTG GAA ATC ATC AAG CAA GGG TGT GAG TT - #T GAG AAC ACT GTG CAC 998Leu Leu Glu Ile Ile Lys Gln Gly Cys Glu Ph - #e Glu Asn Thr Val His# 265- AAG TGG ATT TCC ATC ACC GAG GCC CTA GCT TT - #C TTC CAC TGT TGT CTG1046Lys Trp Ile Ser Ile Thr Glu Ala Leu Ala Ph - #e Phe His Cys Cys Leu# 280- AAC CCC ATC CTC TAT GCT TTC CTT GGA GCC AA - #A TTT AAA ACC TCT GCC1094Asn Pro Ile Leu Tyr Ala Phe Leu Gly Ala Ly - #s Phe Lys Thr Ser Ala# 295- CAG CAC GCA CTC ACC TCT GTG AGC AGA GGG TC - #C AGC CTC AAG ATC CTC1142Gln His Ala Leu Thr Ser Val Ser Arg Gly Se - #r Ser Leu Lys Ile Leu# 310- TCC AAA GGA AAG CGA GGT GGA CAT TCA TCT GT - #T TCC ACT GAG TCT GAG1190Ser Lys Gly Lys Arg Gly Gly His Ser Ser Va - #l Ser Thr Glu Ser Glu315 3 - #20 3 - #25 3 -#30- TCT TCA AGT TTT CAC TCC AGC TAACACAGAT GTAAAAGAC - #T TTTTTTATAC1241Ser Ser Ser Phe His Ser Ser 335- GATAAATAAC CTTTTTTTAA GTTACACATT TTTCAGATAT AAAAGACTGA CC - #AATATTGA1301# 1317- (2) INFORMATION FOR SEQ ID NO:46:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 337 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:46:- Met Gly Ser Gly Asp Tyr Asp Ser Met Lys Gl - #u Pro Cys Phe Arg Glu# 15- Glu Asn Ala Asn Phe Asn Lys Ile Phe Leu Pr - #o Thr Ile Tyr Ser Ile# 30- Ile Phe Leu Thr Gly Ile Val Gly Asn Gly Le - #u Val Ile Leu Val Met# 45- Gly Tyr Gln Lys Lys Leu Arg Ser Met Thr As - #p Lys Tyr Arg Leu His# 60- Leu Ser Val Ala Asp Leu Leu Phe Val Ile Th - #r Leu Pro Phe Trp Ala# 80- Val Asp Ala Val Ala Asn Trp Tyr Phe Gly As - #n Phe Leu Cys Lys Ala# 95- Val His Val Ile Tyr Thr Val Asn Leu Tyr Se - #r Ser Val Leu Ile Leu# 110- Ala Phe Ile Ser Leu Asp Arg Tyr Leu Ala Il - #e Val His Ala Thr Asn# 125- Ser Gln Arg Pro Arg Lys Leu Leu Ala Glu Ly - #s Val Val Tyr Val Gly# 140- Val Trp Ile Pro Ala Leu Leu Leu Thr Ile Pr - #o Asp Phe Ile Phe Ala145 1 - #50 1 - #55 1 -#60- Asn Val Ser Glu Ala Asp Asp Arg Tyr Ile Cy - #s Asp Arg Phe Tyr Pro# 175- Asn Asp Leu Trp Val Val Val Phe Gln Phe Gl - #n His Ile Met Val Gly# 190- Leu Ile Leu Pro Gly Ile Val Ile Leu Ser Cy - #s Tyr Cys Ile Ile Ile# 205- Ser Lys Leu Ser His Ser Lys Gly His Gln Ly - #s Arg Lys Ala Leu Lys# 220- Thr Thr Val Ile Leu Ile Leu Ala Phe Phe Al - #a Cys Trp Leu Pro Tyr225 2 - #30 2 - #35 2 -#40- Tyr Ile Gly Ile Ser Ile Asp Ser Phe Ile Le - #u Leu Glu Ile Ile Lys# 255- Gln Gly Cys Glu Phe Glu Asn Thr Val His Ly - #s Trp Ile Ser Ile Thr# 270- Glu Ala Leu Ala Phe Phe His Cys Cys Leu As - #n Pro Ile Leu Tyr Ala# 285- Phe Leu Gly Ala Lys Phe Lys Thr Ser Ala Gl - #n His Ala Leu Thr Ser# 300- Val Ser Arg Gly Ser Ser Leu Lys Ile Leu Se - #r Lys Gly Lys Arg Gly305 3 - #10 3 - #15 3 -#20- Gly His Ser Ser Val Ser Thr Glu Ser Glu Se - #r Ser Ser Phe His Ser# 335- Ser- (2) INFORMATION FOR SEQ ID NO:47:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 26 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:47:# 26 CACC ACTGCA- (2) INFORMATION FOR SEQ ID NO:48:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 29 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:48:# 29 GCTT TAAAGTTCC- (2) INFORMATION FOR SEQ ID NO:49:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 29 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:49:# 29 ACAG CGCGGCCAA- (2) INFORMATION FOR SEQ ID NO:50:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 29 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:50:# 29 TTGC AAAAGTGGA- (2) INFORMATION FOR SEQ ID NO:51:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 30 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:51:# 30 ACAG TGACCTCCAG- (2) INFORMATION FOR SEQ ID NO:52:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 30 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:52:# 30 AAGG CCTCCACATG- (2) INFORMATION FOR SEQ ID NO:53:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 29 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:53:# 29 TGGC CCAGACGGT- (2) INFORMATION FOR SEQ ID NO:54:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 27 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:54:# 27 GTCG TAGGCGA- (2) INFORMATION FOR SEQ ID NO:55:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 25 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:55:# 25 AGAA GGTGG- (2) INFORMATION FOR SEQ ID NO:56:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 28 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:56:# 28 AAAG TTCCGCAC- (2) INFORMATION FOR SEQ ID NO:57:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 23 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:57:# 23AGGT GGT- (2) INFORMATION FOR SEQ ID NO:58:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 30 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:58:# 30 GCCC CCGAGGATTT- (2) INFORMATION FOR SEQ ID NO:59:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 30 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:59:# 30 CGTA CCGGGACTAT- (2) INFORMATION FOR SEQ ID NO:60:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 32 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:60:# 32 AGGT AGCTGCTGAG CT- (2) INFORMATION FOR SEQ ID NO:61:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 33 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:61:# 33 TACG CACCACCGGG GAC- (2) INFORMATION FOR SEQ ID NO:62:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 31 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:62:# 31 AGCC CACGGTGGTG G- (2) INFORMATION FOR SEQ ID NO:63:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 33 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:63:# 33 TGAA AGACGCTGTA CAT- (2) INFORMATION FOR SEQ ID NO:64:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 28 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:64:# 28 GTCA AAGTCACA- (2) INFORMATION FOR SEQ ID NO:65:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 2085 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 177..1310- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:65:- CGGACATGGA CTGCTATCTG CGTCGCCTCA AACAGGAGCT GATGTCCATG AA - #GGAGGTGG 60- GGGATGGCTT GCAGGATCAG ATGAACTGCA TGATGGGCGC AGACTGGGCT AG - #CTGGAGAG 120- AGACAAGAAC CAAAAGCACA GCCTTCCTGT GTGATTTCTA CAGCCCCCAG AG - #CACC 176- ATG GAC CCA GGG AAA CCC AGG AAA AAC GTG CT - #G GTG GTG GCT CTC CTT 224Met Asp Pro Gly Lys Pro Arg Lys Asn Val Le - #u Val Val Ala Leu Leu# 15- GTC ATT TTC CAG GTG TGC TTC TGC CAA GAT GA - #G GTC ACC GAT GAC TAC 272Val Ile Phe Gln Val Cys Phe Cys Gln Asp Gl - #u Val Thr Asp Asp Tyr# 30- ATC GGC GAG AAT ACC ACG GTG GAC TAC ACC CT - #G TAC GAG TCG GTG TGC 320Ile Gly Glu Asn Thr Thr Val Asp Tyr Thr Le - #u Tyr Glu Ser Val Cys# 45- TTC AAG AAG GAT GTG CGG AAC TTT AAG GCC TG - #G TTC CTG CCT CTC ATG 368Phe Lys Lys Asp Val Arg Asn Phe Lys Ala Tr - #p Phe Leu Pro Leu Met# 60- TAT TCT GTC ATC TGC TTC GTG GGC CTG CTC GG - #C AAC GGG CTG GTG ATA 416Tyr Ser Val Ile Cys Phe Val Gly Leu Leu Gl - #y Asn Gly Leu Val Ile# 80- CTG ACG TAC ATC TAT TTC AAG AGG CTC AAG AC - #C ATG ACG GAT ACC TAC 464Leu Thr Tyr Ile Tyr Phe Lys Arg Leu Lys Th - #r Met Thr Asp Thr Tyr# 95- CTG CTC AAC CTG GCC GTG GCA GAC ATC CTT TT - #C CTC CTA ATT CTT CCC 512Leu Leu Asn Leu Ala Val Ala Asp Ile Leu Ph - #e Leu Leu Ile Leu Pro# 110- TTC TGG GCC TAC AGC GAA GCC AAG TCC TGG AT - #C TTT GGC GTC TAC CTG 560Phe Trp Ala Tyr Ser Glu Ala Lys Ser Trp Il - #e Phe Gly Val Tyr Leu# 125- TGT AAG GGC ATC TTT GGC ATC TAT AAG TTA AG - #C TTC TTC AGC GGG ATG 608Cys Lys Gly Ile Phe Gly Ile Tyr Lys Leu Se - #r Phe Phe Ser Gly Met# 140- CTG CTG CTC CTA TGC ATC AGC ATT GAC CGC TA - #C GTA GCC ATC GTC CAG 656Leu Leu Leu Leu Cys Ile Ser Ile Asp Arg Ty - #r Val Ala Ile Val Gln145 1 - #50 1 - #55 1 -#60- GCC GTG TCG CGT CAT CGC CAC CGC GCC CGC GT - #G CTT CTC ATC AGC AAG 704Ala Val Ser Arg His Arg His Arg Ala Arg Va - #l Leu Leu Ile Ser Lys# 175- CTG TCC TGT GTG GGC ATC TGG ATG CTG GCC CT - #C TTC CTC TCC ATC CCG 752Leu Ser Cys Val Gly Ile Trp Met Leu Ala Le - #u Phe Leu Ser Ile Pro# 190- GAG CTG CTC TAC AGC GGC CTC CAG AAG AAC AG - #C GGC GAG GAC ACG CTG 800Glu Leu Leu Tyr Ser Gly Leu Gln Lys Asn Se - #r Gly Glu Asp Thr Leu# 205- AGA TGC TCA CTG GTC AGT GCC CAA GTG GAG GC - #C TTG ATC ACC ATC CAA 848Arg Cys Ser Leu Val Ser Ala Gln Val Glu Al - #a Leu Ile Thr Ile Gln# 220- GTG GCC CAG ATG GTT TTT GGG TTC CTA GTG CC - #T ATG CTG GCT ATG AGT 896Val Ala Gln Met Val Phe Gly Phe Leu Val Pr - #o Met Leu Ala Met Ser225 2 - #30 2 - #35 2 -#40- TTC TGC TAC CTC ATT ATC ATC CGT ACC TTG CT - #C CAG GCA CGC AAC TTT 944Phe Cys Tyr Leu Ile Ile Ile Arg Thr Leu Le - #u Gln Ala Arg Asn Phe# 255- GAG CGG AAC AAG GCC ATC AAG GTG ATC ATT GC - #C GTG GTG GTA GTC TTC 992Glu Arg Asn Lys Ala Ile Lys Val Ile Ile Al - #a Val Val Val Val Phe# 270- ATA GTC TTC CAG CTG CCC TAC AAT GGG GTG GT - #C CTG GCT CAG ACG GTG1040Ile Val Phe Gln Leu Pro Tyr Asn Gly Val Va - #l Leu Ala Gln Thr Val# 285- GCC AAC TTC AAC ATC ACC AAT AGC AGC TGC GA - #A ACC AGC AAG CAG CTC1088Ala Asn Phe Asn Ile Thr Asn Ser Ser Cys Gl - #u Thr Ser Lys Gln Leu# 300- AAC ATT GCC TAT GAC GTC ACC TAC AGC CTG GC - #C TCC GTC CGC TGC TGC1136Asn Ile Ala Tyr Asp Val Thr Tyr Ser Leu Al - #a Ser Val Arg Cys Cys305 3 - #10 3 - #15 3 -#20- GTC AAC CCT TTC TTG TAT GCC TTC ATC GGC GT - #C AAG TTC CGC AGC GAC1184Val Asn Pro Phe Leu Tyr Ala Phe Ile Gly Va - #l Lys Phe Arg Ser Asp# 335- CTC TTC AAG CTC TTC AAG GAC TTG GGC TGC CT - #C AGC CAG GAA CGG CTC1232Leu Phe Lys Leu Phe Lys Asp Leu Gly Cys Le - #u Ser Gln Glu Arg Leu# 350- CGG CAC TGG TCT TCC TGC CGG CAT GTA CGG AA - #C GCG TCG GTG AGC ATG1280Arg His Trp Ser Ser Cys Arg His Val Arg As - #n Ala Ser Val Ser Met# 365- GAG GCG GAG ACC ACC ACA ACC TTC TCC CCG TA - #GGGGGCTC CCCTGCCCGG1330Glu Ala Glu Thr Thr Thr Thr Phe Ser Pro# 375- ACTACAAGGA CCTCTCCCAG GAGCCTTAAT GTGGTGCACA CATGCACAGA CT - #CTCCATCC1390- ACCGAATTGC TGCTGAGGGA AGAGCAATTC TGGCCAGTCA GGTTGACATG AG - #GACCTAAG1450- AAACTGCTTA ACCCCATCCC ACTTATAACT ACCTCAACCA AAGCTGTAAA AG - #ATATGGCT1510- GAGAAGTTAA CACTCAAGCC AAGACAGCTA TCCCCAAAAC GACAGCCAAA AG - #TGAAAGTG1570- AGAGGCTCCA CACTTTCCGG AGTGAGGGAT GTGGGGCCAG TGAACACCCT GG - #TTGAGTAG1630- TCTTCGGAGG CCTCTGAATG AACCTGCTTC TAGCTTAGAG AGATGTCCCG GA - #GATTCAAG1690- ACAGAGCTTA TCTCCACACT TAGCAAGCAA GCAAGAGATG ACAGTCTCTC TA - #AATGCTCC1750- CACAGAGCAC CCCTGCCCCT CCCTTCTGCC TCTCCACCGC CTTTCCTGAG GT - #CCAGGCCA1810- CACCATGACG CTGAGGCAGT CCCAGCTGGG GCTCTGGATG GCAATGACAA GT - #AGTTGGGT1870- CTCTATGATG GGAATAAAAA GGTAGGGGAA AGGTGACAGG AAGGAGAGAA GG - #TGACCCTG1930- CTGGCTGACA GAGGCCAGCA AGCTACTTCT TTGTTCTCTG TCAGCCAGCC AC - #TGATACCT1990- TTCCTCATGT TCTGCTTTTG ATTCATATAT CTTTTATGAA GAAACAAATA AA - #AAAAAAAT2050# 2085 AACT TGGAAAAAAA AAAAA- (2) INFORMATION FOR SEQ ID NO:66:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 378 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:66:- Met Asp Pro Gly Lys Pro Arg Lys Asn Val Le - #u Val Val Ala Leu Leu# 15- Val Ile Phe Gln Val Cys Phe Cys Gln Asp Gl - #u Val Thr Asp Asp Tyr# 30- Ile Gly Glu Asn Thr Thr Val Asp Tyr Thr Le - #u Tyr Glu Ser Val Cys# 45- Phe Lys Lys Asp Val Arg Asn Phe Lys Ala Tr - #p Phe Leu Pro Leu Met# 60- Tyr Ser Val Ile Cys Phe Val Gly Leu Leu Gl - #y Asn Gly Leu Val Ile# 80- Leu Thr Tyr Ile Tyr Phe Lys Arg Leu Lys Th - #r Met Thr Asp Thr Tyr# 95- Leu Leu Asn Leu Ala Val Ala Asp Ile Leu Ph - #e Leu Leu Ile Leu Pro# 110- Phe Trp Ala Tyr Ser Glu Ala Lys Ser Trp Il - #e Phe Gly Val Tyr Leu# 125- Cys Lys Gly Ile Phe Gly Ile Tyr Lys Leu Se - #r Phe Phe Ser Gly Met# 140- Leu Leu Leu Leu Cys Ile Ser Ile Asp Arg Ty - #r Val Ala Ile Val Gln145 1 - #50 1 - #55 1 -#60- Ala Val Ser Arg His Arg His Arg Ala Arg Va - #l Leu Leu Ile Ser Lys# 175- Leu Ser Cys Val Gly Ile Trp Met Leu Ala Le - #u Phe Leu Ser Ile Pro# 190- Glu Leu Leu Tyr Ser Gly Leu Gln Lys Asn Se - #r Gly Glu Asp Thr Leu# 205- Arg Cys Ser Leu Val Ser Ala Gln Val Glu Al - #a Leu Ile Thr Ile Gln# 220- Val Ala Gln Met Val Phe Gly Phe Leu Val Pr - #o Met Leu Ala Met Ser225 2 - #30 2 - #35 2 -#40- Phe Cys Tyr Leu Ile Ile Ile Arg Thr Leu Le - #u Gln Ala Arg Asn Phe# 255- Glu Arg Asn Lys Ala Ile Lys Val Ile Ile Al - #a Val Val Val Val Phe# 270- Ile Val Phe Gln Leu Pro Tyr Asn Gly Val Va - #l Leu Ala Gln Thr Val# 285- Ala Asn Phe Asn Ile Thr Asn Ser Ser Cys Gl - #u Thr Ser Lys Gln Leu# 300- Asn Ile Ala Tyr Asp Val Thr Tyr Ser Leu Al - #a Ser Val Arg Cys Cys305 3 - #10 3 - #15 3 -#20- Val Asn Pro Phe Leu Tyr Ala Phe Ile Gly Va - #l Lys Phe Arg Ser Asp# 335- Leu Phe Lys Leu Phe Lys Asp Leu Gly Cys Le - #u Ser Gln Glu Arg Leu# 350- Arg His Trp Ser Ser Cys Arg His Val Arg As - #n Ala Ser Val Ser Met# 365- Glu Ala Glu Thr Thr Thr Thr Phe Ser Pro# 375__________________________________________________________________________

Claims

1. A purified and isolated polynucleotide comprising a nucleotide sequence encoding the amino acid sequence of R2 seven transmembrane receptor set out in SEQ ID NO.: 42 or encoding a fragment thereof possessing at least one ligand/antiligand binding activity or immunological property specific to said seven transmembrane receptor.

2. The polynucleotide of claim 1 which is a DNA.

3. The polynucleotide of claim 1 which is a cDNA.

4. The polynucleotide of claim 1 which is a genomic DNA.

5. The polynucleotide of claim 1 which is wholly or partially chemically synthesized DNA.

6. A DNA vector comprising a DNA according to claim 1.

7. The vector of claim 6 wherein said DNA is operatively linked to a DNA comprising an expression control DNA sequence.

8. A host cell stably transformed or transfected with a DNA according to claim 1 in a manner allowing the expression in said host cell of a seven transmembrane receptor polypeptide or a fragment or variant thereof possessing a ligand/antiligand binding activity or immunological property specific to said seven transmembrane receptor.

9. A method for producing a seven transmembrane receptor polypeptide comprising the steps of growing a host cell according to claim 8 in a suitable nutrient medium and isolating said polypeptide or variant thereof from said cell or said medium.

10. A purified and isolated R2 seven transmembrane receptor comprising the amino acid sequence set out in SEQ ID NO: 42 or a fragment or variant thereof possessing at least one ligand/antiligand binding activity or immunological property specific to said seven transmembrane receptor.

11. An antibody substance specific for the R2 seven transmembrane receptor of claim 10.

12. The antibody substance of claim 11 which is a monoclonal antibody.

13. An anti-idiotypic antibody substance specific for an antibody substance according to claim 11 .

14. A humanized antibody substance according to claim 12.

15. A method for modulating ligand/antiligand binding of a seven transmembrane receptor according to claim 10 comprising the step of contacting said seven transmembrane receptor with an antibody specific for said seven transmembrane receptor.

16. A method for modulating ligand/antiligand binding of a seven transmembrane receptor according to claim 10 comprising the step of contacting said seven transmembrane receptor with an agonist or antagonist of said seven transmembrane receptor.

17. A method for treating inflammation comprising the step of administering to a mammal in need of such treatment an amount of an antibody substance according to claim 11 sufficient to suppress inflammation.

18. A purified and isolated DNA comprising a nucleotide sequence encoding a R2 seven transmembrane receptor and selected from the group consisting of:

(a) nucleotides 551 to 1681 of SEQ ID NO.: 41;

(b) the insert of the plasmid having ATCC Accession No. 75330; and

(c) a DNA which hybridizes under stringent conditions to DNA sequence of (a) or (b).

19. A polynucleotide according to claim 1 comprising a nucleotide sequence that encodes the amino acid sequence of R2 seven transmembrane receptor set out in SEQ ID NO: 42.

20. A purified and isolated DNA according to claim 18 comprising the insert of the plasmid having ATCC Accession No. 75330.

21. A purified and isolated polypeptide comprising a R2 seven transmembrane receptor fragment selected from the group consisting of the N-terminal extracellular domain of R2, transmembrane domains of R2, extracellular loops connecting transmembrane domains of R2, intracellular loops connecting transmembrane domains of R2, the C-terminal cytoplasmic domain of R2, and fusions thereof.

22. A purified and isolated polypeptide according to claim 21 comprising the N-terminal extracellular domain of R2.

23. A purified and isolated polypeptide according to claim 21 comprising at least one extracellular domain of R2.

24. A purified and isolated polynucleotide comprising a nucleotide sequence that encodes a polypeptide according to claim 21.

25. A purified and isolated polynucleotide according to claim 24 comprising a continuous portion of SEQ ID NO: 41, said continuous portion encoding the amino acid sequence of a R2 seven transmembrane receptor fragment, said fragment selected from the group consisting of the N-terminal extracellular domain of R2, transmembrane domains of R2, extracellular loops connecting transmembrane domains of R2, intracellular loops connecting transmembrane domains of R2, the C-terminal cytoplasmic domain of R2, and fusions thereof.

26. A vector comprising a polynucleotide according to claim 24.

27. A host cell transformed or transfected with a polynucleotide according to claim 24.

28. A method for producing a recombinant polypeptide comprising the steps of growing a host cell in a suitable medium and isolating said recombinant polypeptide from said cell or said medium, wherein said host cell is a host cell transformed or transfected with a polynucleotide according to claim 24, and wherein said recombinant polypeptide comprises a R2 seven transmembrane receptor fragment said fragment selected from the group consisting of the N-terminal extracellular domain of R2, transmembrane domains of R2, extracellular loops connecting transmembrane domains of R2, intracellular loops connecting transmembrane domains of R2, the C-terminal cytoplasmic domain of R2, and fusions thereof.

29. A method according to claim 28 wherein said host cell is transformed or transfected with a polynucleotide that encodes the N-terminal extracellular domain of R2.

30. An antibody substance specific for V28 seven transmembrane receptor.

31. An antibody that specifically binds a polypeptide comprising the V28 seven transmembrane receptor amino acid sequence in SEQ ID NO: 28.

32. A monoclonal antibody according to claim 31.

33. A hybridoma that produces a monoclonal antibody according to claim 32.

34. An antibody according to claim 31 that is a humanized antibody.

35. An antibody according to claim 31 that specifically binds an extracellular epitope of the V28 seven transmembrane receptor.

36. An antibody according to claim 31 that specifically binds to the amino-terminal extracellular domain of the V28 seven transmembrane receptor.

37. A composition comprising polyclonal antibodies, wherein at least one of said antibodies is an antibody according to claim 31.

38. A polypeptide comprising a fragment of an antibody according to claim 31, wherein said fragment and said polypeptide bind to the V28 seven transmembrane receptor.

39. A polypeptide according to claim 38 that is selected from the group consisting of single chain antibodies and CDR-grafted antibodies.

40. A composition comprising a polypeptide according to claim 38 and a pharmaceutically-acceptable diluent or carrier.

41. An antiserum produced by a process comprising the steps of:

immunizing a mammal with a composition comprising a V28 seven transmembrane receptor polypeptide having the amino acid sequence set forth in SEQ ID NO: 28 or fragment thereof, wherein said fragment comprises at least one V28 extracellular or intracellular domain; and

obtaining antiserum from said mammal after said immunizing step, said antiserum containing antibodies that bind to the V28 seven transmembrane receptor.

42. An antiserum according to claim 41 wherein the mammal is immunized multiple times prior to obtaining antiserum from said mammal.

43. An antiserum according to claim 41 wherein said V28 polypeptide or fragment is purified prior to said immunizing step, and wherein said composition further includes an adjuvant.

44. Polyclonal antibodies purified from an antiserum according to claim 41, said polyclonal antibodies comprising antibodies that bind to said V28 polypeptide.

45. A method of modulating ligand/antiligand binding of a V28 seven transmembrane receptor comprising the step of contacting said V28 seven transmembrane receptor with an antibody according to claim 31.

46. A method of modulating ligand/antiligand binding of a V28 seven transmembrane receptor comprising the step of contacting said V28 seven transmembrane receptor with a polypeptide according to claim 38.