Claims
- 1. A mammalian cell comprising
an isolated first strand of RNA of 15 to 30 nucleotides in length having a 5′ end and a 3′ end, wherein the first strand is complementary to at least 15 nucleotides of a targeted gene of interest, and wherein the 5′ end of the first strand of RNA is operably linked to a G nucleotide to form a first segment of RNA, and an isolated second strand of RNA of 15 to 30 nucleotides in length having a 5′ end and a 3′ end, wherein at least 12 nucleotides of the first and second strands are complementary to each other and form a small interfering RNA (siRNA) duplex under physiological conditions, and wherein the siRNA silences only one allele of the targeted gene in the cell.
- 2. The mammalian cell of claim 1, wherein the duplex is between 15 and 25 base pairs in length.
- 3. The mammalian cell of claim 1, wherein the duplex is 20 base pairs in length.
- 4. The mammalian cell of claim 1, wherein the first strand is 20 nucleotides in length, and the second strand is 20 nucleotides in length.
- 5. The mammalian cell of claim 4, wherein the first strand is complementary to 19 out of 20 contiguous nucleotides of the targeted gene and is non-complementary to one nucleotide of the targeted gene.
- 6. The mammalian cell of claim 5, wherein the one non-complementary nucleotide is at position 9, 10, or 11, as measured from the 5′ end of the first strand of RNA.
- 7. The mammalian cell of claim 5, wherein the one non-complementary nucleotide is at position 10, as measured from the 5′ end of the first strand of RNA.
- 8. The mammalian cell of claim 4, wherein the first strand is complementary to 18 out of 20 contiguous nucleotides of the targeted gene and is non-complementary to two nucleotides of the targeted gene.
- 9. The mammalian cell of claim 8, wherein two non-complementary nucleotides are at nucleotide position 9, 10, 11, or 12 as measured from the 5′ end of the first strand of RNA.
- 10. The mammalian cell of claim 5, wherein the two non-complementary nucleotides are at nucleotide position 10 and 11, as measured from the 5′ end of the first strand of RNA.
- 11. The mammalian cell of claim 1, wherein the 5′ end of the second strand of RNA is operably linked to a G nucleotide.
- 12. The mammalian cell of claim 1, wherein the first strand and the second strand are operably linked by means of an RNA loop strand to form a hairpin structure comprising a duplex structure and a loop structure.
- 13. The mammalian cell of claim 12, wherein the loop structure contains from 4 to 10 nucleotides.
- 14. The mammalian cell of claim 13, wherein the loop structure contains 4, 5 or 6 nucleotides.
- 15. The mammalian cell of claim 1, wherein the targeted gene is a gene associated with a condition amenable to siRNA therapy.
- 16. The mammalian cell of claim 15, wherein the gene encodes a transcript for Swedish double amyloid precursor protein (APPsw) mutation or a transcript for Tau.
- 17. A mammalian cell comprising an expression cassette encoding an isolated first strand of RNA of 15 to 30 nucleotides in length having a 5′ end and a 3′ end, wherein the first strand is complementary to at least 15 nucleotides of a targeted gene of interest, and wherein the 5′ end of the first strand of RNA is operably linked to a G nucleotide to form a first strand of RNA, and an isolated second strand of RNA of 15 to 30 nucleotides in length having a 5′ end and a 3′ end, and wherein at least 12 nucleotides of the first and second strands are complementary to each other and form a small interfering RNA (siRNA) duplex under physiological conditions, and wherein the siRNA silences only one allele of the targeted gene in the cell.
- 18. The mammalian cell of claim 17, wherein the expression cassette is contained in a vector.
- 19. The mammalian cell of claim 18, wherein the vector is an adenoviral, lentiviral, adeno-associated viral (AAV), poliovirus, HSV, or murine Maloney-based viral vector.
- 20. The mammalian cell of claim 18, wherein the vector is an adenoviral vector.
- 21. An isolated RNA duplex comprising a first strand of RNA having a 5′ end and a 3′ end, and a second strand of RNA, wherein the first strand comprises 20 nucleotides complementary to mutant Tau transcript encoded by siA10 GGTGGCCAGATGGAAGTAAA (SEQ ID NO:63), wherein the 5′ end of the first strand of RNA is operably linked to a G nucleotide to form a first segment of RNA, and wherein the second strand is complementary to all the nucleotides of the first strand.
- 22. The RNA duplex of claim 21, wherein the first strand and the second strand are operably linked by means of an RNA loop strand to form a hairpin structure comprising a duplex structure and a loop structure.
- 23. The RNA duplex of claim 21, wherein the loop structure contains from 4 to 10 nucleotides.
- 24. The RNA duplex of claim 21, wherein the loop structure contains 4, 5 or 6 nucleotides.
- 25. An expression cassette comprising a nucleic acid encoding at least one strand of the RNA duplex of claims 21.
- 26. A vector comprising the expression cassette of claim 25.
- 27. A vector comprising two expression cassettes, a first expression cassette comprising a nucleic acid encoding the first strand of the RNA duplex of claim 21 and a second expression cassette comprising a nucleic acid encoding the second strand of the RNA duplex of claim 21.
- 28. A cell comprising the expression cassette of claim 25.
- 29. The cell of claim 28, wherein the cell is a mammalian cell.
- 30. A non-human mammal comprising the expression cassette of claim 25.
- 31. An isolated RNA duplex comprising a first strand of RNA having a 5′ end and a 3′ end, and a second strand of RNA, wherein the first strand comprises 20 nucleotides complementary to Swedish double amyloid precursor protein (APPsw) mutation transcript encoded by siT10/C11 TGAAGTGAATCTGGATGCAG (SEQ ID NO:64), wherein the 5′ end of the first strand of RNA is operably linked to a G nucleotide to form a first segment of RNA, and wherein the second strand is complementary to all the nucleotides of the first strand.
- 32. The RNA duplex of claim 31, wherein the first strand and the second strand are operably linked by means of an RNA loop strand to form a hairpin structure comprising a duplex structure and a loop structure.
- 33. The RNA duplex of claim 31, wherein the loop structure contains from 4 to 10 nucleotides.
- 34. The RNA duplex of claim 31, wherein the loop structure contains 4, 5 or 6 nucleotides.
- 35. An expression cassette comprising a nucleic acid encoding at least one strand of the RNA duplex of claims 22.
- 36. A vector comprising the expression cassette of claim 35.
- 37. A vector comprising two expression cassettes, a first expression cassette comprising a nucleic acid encoding the first strand of the RNA duplex of claim 31 and a second expression cassette comprising a nucleic acid encoding the second strand of the RNA duplex of claim 31.
- 38. A cell comprising the expression cassette of claim 26.
- 39. The cell of claim 38, wherein the cell is a mammalian cell.
- 40. A method of performing allele-specific gene silencing in a mammal comprising administering to the mammal an isolated first strand of RNA of 15 to 30 nucleotides in length having a 5′ end and a 3′ end, wherein the first strand is complementary to at least 15 nucleotides of a targeted gene of interest, and wherein the 5′ end of the first strand of RNA is operably linked to a G nucleotide to form a first segment of RNA, and an isolated second strand of RNA of 15 to 30 nucleotides in length having a 5′ end and a 3′ end, wherein at least 12 nucleotides of the first and second strands are complementary to each other and form a small interfering RNA (siRNA) duplex under physiological conditions, and wherein the siRNA silences only one allele of the targeted gene in the mammal.
- 41. The method of claim 40, wherein the duplex is between 15 and 25 base pairs in length.
- 42. The method of claim 40, wherein the duplex is 20 base pairs in length.
- 43. The method of claim 40, wherein the first strand is 20 nucleotides in length, and the second strand is 20 nucleotides in length.
- 44. The method of claim 43, wherein the first strand is complementary to 19 out of 20 contiguous nucleotides of the targeted gene and is non-complementary to one nucleotide of the targeted gene.
- 45. The method of claim 44, wherein the one non-complementary nucleotide is at position 9, 10, or 11, as measured from the 5′ end of the first strand of RNA.
- 46. The method of claim 44, wherein the one non-complementary nucleotide is at position 10, as measured from the 5′ end of the first strand of RNA.
- 47. The method of claim 43, wherein the first strand is complementary to 18 out of 20 contiguous nucleotides of the targeted gene and is non-complementary to two nucleotides of the targeted gene.
- 48. The method of claim 47, wherein two non-complementary nucleotides are at nucleotide position 9, 10, 11, or 12 as measured from the 5′ end of the first strand of RNA.
- 49. The method of claim 44, wherein the two non-complementary nucleotides are at nucleotide position 10 and 11, as measured from the 5′ end of the first strand of RNA.
- 50. The method of claim 40, wherein the 5′ end of the second strand of RNA is operably linked to a G nucleotide.
- 51. The method of claim 40, wherein the first strand and the second strand are operably linked by means of an RNA loop strand to form a hairpin structure comprising a duplex structure and a loop structure.
- 52. The method of claim 51, wherein the loop structure contains from 4 to 10 nucleotides.
- 53. The method of claim 52, wherein the loop structure contains 4, 5 or 6 nucleotides.
- 54. The method of claim 40, wherein the targeted gene is a gene associated with a condition amenable to siRNA therapy.
- 55. The method of claim 54, wherein the gene encodes a transcript for Swedish double amyloid precursor protein (APPsw) mutation or a transcript for Tau.
- 56. A method of producing an RNA comprising
(a) producing an isolated first strand of RNA of 15 to 30 nucleotides in length having a 5′ end and a 3′ end, wherein the first strand is complementary to at least 15 nucleotides of a targeted gene of interest, and wherein the 5′ end of the first strand of RNA is operably linked to a G nucleotide to form a first segment of RNA, (b) producing an isolated second strand of RNA of 15 to 30 nucleotides in length having a 5′ end and a 3′ end, and (c) contacting the first strand and the second strand under hybridizing conditions to form a siRNA duplex, wherein the siRNA silences only one allele of the targeted gene in the cell.
- 57. The method of claim 56, wherein the duplex is between 15 and 25 base pairs in length.
- 58. The method of claim 56, wherein the duplex is 20 base pairs in length.
- 59. The method of claim 56, wherein the first strand is 20 nucleotides in length, and the second strand is 20 nucleotides in length.
- 60. The method of claim 59, wherein the first strand is complementary to 19 out of 20 contiguous nucleotides of the targeted gene and is non-complementary to one nucleotide of the targeted gene.
- 61. The method of claim 60, wherein the one non-complementary nucleotide is at position 9, 10, or 11, as measured from the 5′ end of the first strand of RNA.
- 62. The method of claim 60, wherein the one non-complementary nucleotide is at position 10, as measured from the 5′ end of the first strand of RNA.
- 63. The method of claim 59, wherein the first strand is complementary to 18 out of 20 contiguous nucleotides of the targeted gene and is non-complementary to one nucleotide of the targeted gene.
- 64. The method of claim 63, wherein the two non-complementary nucleotides are at nucleotide position 9, 10, 11, or 12 as measured from the 5′ end of the first strand of RNA.
- 65. The method of claim 63, wherein the two non-complementary nucleotides are at nucleotide position 10 and 11, as measured from the 5′ end of the first strand of RNA.
- 66. The method of claim 63, wherein the 5′ end of the second strand of RNA is operably linked to a G nucleotide.
CLAIM OF PRIORITY
[0001] This is a continuation-in-part of International Application No. PCT/US03/16887 filed on May 26, 2003, which is a continuation-in-part of application U.S. application Ser. No. 10/430,351 filed on May 5, 2003, which is a continuation of U.S. application Ser. No. 10/322,086 filed on Dec. 17, 2002, which is a continuation-in-part application of U.S. application Ser. No. 10/212,322, filed Aug. 5, 2002, all of which applications are incorporated herein by reference.
STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT
[0002] Work relating to this application was supported by grants from the National Institutes of Health (NS044494 and NS38712). The government may have certain rights in the invention.
Continuations (1)
|
Number |
Date |
Country |
Parent |
10322086 |
Dec 2002 |
US |
Child |
10430351 |
May 2003 |
US |
Continuation in Parts (3)
|
Number |
Date |
Country |
Parent |
PCT/US03/16887 |
May 2003 |
US |
Child |
10738642 |
Dec 2003 |
US |
Parent |
10430351 |
May 2003 |
US |
Child |
PCT/US03/16887 |
May 2003 |
US |
Parent |
10212322 |
Aug 2002 |
US |
Child |
10322086 |
Dec 2002 |
US |