T cell receptor libraries

TECHNICAL FIELD

[0002] The invention relates to the field of molecular biology, in particular molecular biology related to specific receptor-ligand interactions, more in particular an immune response or its absence.

BACKGROUND

[0003] The acquired immune system (in mammalians) comprises two major kinds of responses; the so-called humoral response involving antibodies and the so-called cellular response involving T cells.

[0004] T-cells, the prime mediators of adaptive cellular immunity, exert their action through the TCR-mediated recognition of a peptide epitope bound to a major histocompatibility complex (MHC) molecule. The immune system contains a large collection of T cells that covers a broad range of peptide/MHC specificities and thereby can identify subtle changes in MHC epitope presentation. However, negative and positive selection processes in the thymus impose a restriction on T cell diversity and thereby limit the spectrum of in vivo T cell reactivity. For instance, self-tolerance leads to the removal of the high affinity T cell repertoire specific for self antigens, and this will include T cells with desirable specificities, such as for self antigens expressed on tumor tissues. Because of the potential value of an experimental approach that can be used to isolate T cell receptors with desirable specificities we set out to develop a strategy for in vitro TCR selection.

DISCLOSURE OF THE INVENTION

[0005] For the in vitro isolation and generation of monoclonal antibodies, antibody phage display has proven to be a useful technology to replace hybridoma technology and animal immunization. Recently, the expression of single-chain TCRs by filamentous phages has likewise been achieved and this approach may conceivably used to produce phage display libraries for TCR selection purposes. In addition, single chain T cell receptors have successfully been expressed on the yeast cell wall (Kieke, 1999). However the ability of T cell membrane-associated TCRs to discriminate between closely related ligands appears to be directly related to the property of TCRs to cluster upon encounter of the cognate ligands, and it may prove difficult to copy this process on phage or the yeast cell wall. The present invention in one embodiment therefore provides a strategy for TCR-display that closely mimics the in vivo situation, meaning at least a stable expression of TCRs to be displayed in mammalian cells exemplified by retroviral insertion of a T cell receptor library into a TCR-negative T cell host. Such mammalian cell line TCR libraries would not only allow the selection of the desirable TCRs by biochemical means, but also offer the possibility to directly test the functional behavior of selected TCRs.

[0006] This approach however may not be limited to T cell receptors alone. Other receptors that need to undergo a functional reorganization, such as a conformation change, binding to other proteinaceous substances, clustering and/or internalization may also be treated and developed in accordance with the present invention.

[0007] Thus the invention provides a method for generating at least on receptor having a desired specificity for a ligand, whereby said receptor undergoes functional processing in order to provide a biological response (thus the receptor should have this capability) after ligand-binding, comprising constructing a sequence encoding such a receptor and allowing for the product of said sequence to be expressed in a suitable environment (in particular a mammalian cell line provided with TCR encoding genes in a stable manner (i.e. present in following generations)) wherein said processing after ligand binding can occur. A receptor according to the invention may be a recombinantly produced natural receptor or a mutated receptor in which any (binding) characteristic has been altered. A ligand for such a receptor may range from a steroid (a small organic molecule) to a proteinaceous substance, including preferred ligands such as peptides. As stated herein before, the receptor can according to the invention be functionally tested in its environment because the environment allows for the normal fucntional changes that such a receptor undergoes upon binding of its ligand. A preferred group of receptors typically often undergoing such processing are membrane associated receptors. These include transmembrane receptors such as T cell receptors, immunoglobulins, NK cell receptors, olfactory receptors

[0008] The suitable environment for these kind of receptors of course includes a membrane-like structure, such as a liposome, a microsome, or a cell, of which the last one is preferred. The last one is preferred, because a cell may provide other components of a suitable environment, such as signalling pathways and the like.

[0009] As stated herein before in a preferred embodiment the invention provides a method for generating at least one receptor having a desired specificity for a ligand, whereby said receptor undergoes functional processing after ligand-binding, comprising constructing a sequence encoding such a receptor and allowing for the product of said sequence to be expressed in a suitable environment wherein said processing after ligand binding can occur, wherein said receptor is a T cell receptor. T cell receptors, as will be explained in the detailed description below are available or produced by mammalians in many specificities. However, naturally occurring TCR specificities are of limited affinity and typically are not present in a number of potential antigens including many antigens derived from self tissues. It is in these specificities that one of the main interests of the present invention lies. These specificities may be the ones that can be used to fight tumours in e.g. a gene therapy setting, whereby a patient's T cells are provided with a receptor produced according to the invention. These preferred T cell receptors can be produced advantageously in T cells lacking T cell receptors themselves, since this is probably the most suitable environment for their post-binding processing. Thus in a preferred embodiment the invention provides a method for generating at least one T cell receptor having a desired specificity for a ligand, whereby said receptor undergoes functional processing after ligand-binding, comprising constructing a sequence encoding such a receptor and allowing for the product of said sequence to be expressed in a suitable host cell wherein said processing after ligand binding can occur, wherein said host cell is a T cell receptor negative T cell. In some instances it may be preferred to have the sequence encoding the produced, optionally mutated, receptor into the genome of the host cell. This can be achieved by techniques known in the art, such as homologous recombination, or viral infection with integrating viruses such as AAV and retroviruses. Integration can be advantageously achieved by providing the sequence encoding the receptor in a retroviral delivery vehicle. The host cell can then be simply infected with a retrovirus provided with such an extra sequence.

[0010] Retroviruses capable of infecting e.g. T cells are known in the art and need no further elaboration here. However, episomal systems which are capable of efficient and stable expression of the desired genus such as EBV can also be used. The present invention is typically also aimed at providing libraries of receptors having all kinds of different known and/or unknown binding affinities for ligands. In order to produce such different affinities natural receptor encoding sequences may be modified by any known means, such as site-directed mutation, genetic drift, shuffling, etc. Libraries of novel heterodimeric T cell receptors may be formed either by mutation of one or both TCR chains or alternatively, by creating novel combinations of TCR chains by “shuffling” of the repertoire of naturally occurring chains. Such shuffling can be achieved both within a host cell line, such as the 34.1Lzeta cell line, but also by introduction of TCR chains into polyclonal T cell populations. All these methods will lead to a modified receptor encoding sequence, or a combination of receptor encoding sequences. For the sake of simplicity such sequences will be referred to as sequences comprising mutations. Specifically any modified receptor encoding sequence or combination of receptor encoding sequences in this invention may be referred to as a mutated constructed sequence. Typically such mutations are directed at modifying the binding affinity of the receptor for a ligand, in the case of e.g. T cell receptors the affinity may be changed to an affinity normally suppressed in said receptor's natural surrounding. It is clear that such affinities are of use in treating diseases such as cancer. Thus in a preferred embodiment the invention provides a method wherein said receptor is a T cell receptor having affinity for a self antigen, a tumour antigen and/or a synthetic antigen.

[0011] As stated before a main goal of the present invention is to arrive at libraries of e.g. cells having receptors of many different affinities. Thus in a further preferred embodiment the invention provides a method as disclosed before wherein a number of different constructed sequences are brought into separate suitable environments providing a library of environments having receptors with different ligand binding affinities. Preferred libraries of receptors according to the invention are libraries wherein said receptors are T cell receptors. The libraries are of course used to identify T cell receptors or other receptors which have affinity for a desired ligand. T cell receptor libraries can be screened by any of the accepted techniques for monitoring the interaction of T cells and TCRs with specific peptide-MHC complexes. This includes the use of multimeric MHC complexes, such as MHC tetramers and MHC-Ig dimers (Altman et al. 199636; Schneck, 200037), but also assay systems that utilize T cell activation as a readout system. The latter category includes the expression of cell activation markers, such as CD69, CD44 or LFA-1 (Baumgarth et al. 199738) or expression of reporter genes, such as NFAT-LacZ and NFAT-GFP (Sanderson and Shastri 199439; Hooijberg et al. 200040).The genetic information encoding a selected receptor may then be taken from its environment and expressed in any desired environment. The original suitable environment may of course also be used. Thus the invention also provides a method for selecting a T cell receptor or a sequence encoding the same, comprising contacting a ligand to be recognised by said T cell receptor with a library according to the invention in the appropriate context and selecting at least one binding T cell receptor from said library. The ligand must of course be offered to the receptor in a suitable context. For T cell receptors this would mean that a peptide must be presented in the right MHC context.

[0012] T cell receptors and their encoding sequences identified and obtained according to any method of the invention are of course also part of the present invention. As an example these T cell receptors or typically the encoding sequence can be brought into a T cell of a host in order to provide such a host with additional capability of attacking e.g. a tumour. Thus the invention also provides a method for providing a T cell with the capability of binding a desired presented antigen, comprising providing said T cell with a T cell receptor or a sequence encoding it according to the invention. The resulting T cell is again part of the invention.

[0013] This T cell can be reintroduced into a patient. Thus the invention further provides a method for providing a subject with additional capability of generating a response against antigens of undesired cells or pathogens, comprising providing said subject with at least one T cell according to the invention. Preferably said T cell is derived from said subject, at least said subject should be matched for an HLA molecule that is utilized by said T cell and/or by a T cell receptor of said cell.

DETAILED DESCRIPTION

[0014] For the development of TCR display two types of developments have been extremely valuable. The elucidation of the structure of human and mouse class I MHC-TCR complexes 7,8 allows the design of TCR libraries that selectively target the peptide specificity of such receptors. In addition, the development of multimeric MHC technology (36,37) and assay systems that can be used to monitor T cell activation (38−3+40)have provided the means with which to isolate cells carrying variant receptors, solely on the basis of their antigen specificity.

[0015] Through the generation and screening of an in vitro T cell library based on an influenza A-specific T cell receptor (FIG. 1), we have isolated variant TCRs that are either specific for the parental viral strain, or that have acquired a specificity for a variant influenza epitope. These in vitro selected T cell receptors recognize peptide-MHC complexes on target cells with high efficiency and high specificity. The ability to control TCR fine specificity in a direct manner by retroviral display provides a general strategy for the generation of T cells with specificities that could previously not be obtained. In addition, retroviral TCR display offers a powerful strategy to dissect structure-function relationships of the T cell receptor in a physiological setting.

[0016] We here describe a strategy used to change the ligand specificity of a T cell receptor. By generating a TCR library that is diversified in its CDR3β structure, we were able to select novel TCRs that either share specificity with the parental TCR, or that have acquired a specificity for a variant T cell epitope. A change in TCR specificity can be thought of as an increase in TCR affinity for the variant epitope. The F5 TCR does not measurably bind to the A/PR8/34 epitope, but we were able to transform it into a high affinity TCR for this antigen. The possibility to change a low affinity, non-functional receptor into a highly potent TCR by retroviral display is useful for the creation of collections of optimized pathogen-specific T cell receptors. In addition, this in vitro strategy is particularly valuable for the development of high affinity tumor-specific T cell receptors. In a number of systems it has been demonstrated that self-tolerance results in the removal of the high avidity T cell repertoire specific for tumor-lineage antigens 22-25. The deletion of self-specific T cells does not affect T cells that have a low affinity for these antigens 26-29 (de Visser et al, ms. submitted). However, it has become clear that these low affinity T cells only display anti-tumor activity in those special cases in which the self-antigen is overexpressed in the tumor tissue 27, and are ineffective in most cases 28,30. The retroviral TCR display system outlined here provides a unique opportunity to convert low affinity receptors into high affinity tumor-lineage-specific TCRs, and the creation of a collection of high affinity T cell receptors that target lineage antigens expressed on tumor tissues is thereby now feasible.

[0017] Creation of a Retroviral TCR Display Library

[0018] As a host for a T cell line-displayed TCR library, an immature T cell line that does not express endogenous T cell receptor α and β chains was selected. This cell line, named 34.1L, expresses all CD3 components required for TCR assembly, but is devoid of CD4 or CD8 co-receptor expression. Because initial experiments indicated that the expression of the CD3ζ TCR component was limiting in this cell line, a variant T cell line (34.1Lζ) was produced in which a CD3ζ encoding vector was introduced by retroviral gene transfer. As a model system for the generation of a TCR display library we used a high affinity murine TCR of which the antigen specificity is well established 10. This F5 T cell receptor (Vα4; Vβ11) specifically recognizes the immunodominant H-2Db-restricted CTL epitope NP366-374 (ASNENMDAM) of the influenza A/NT/60/68 nucleoprotein 11. Following introduction of the F5 TCR in the 34.1Lζ cell line by retroviral transduction, the transduced cell line expresses high levels of the introduced F5 TCR as measured by anti-TCRβ and MHC tetramer flow cytometry (FIG. 2A).

[0019] To test the merits of retroviral TCR display for the selection of TCRs with defined specificities, we aimed to isolate novel T cell receptors with either the same specificity as the parental TCR, or receptors that have acquired a specificity for a variant influenza epitope. In order to modify the peptide specificity of TCRs without generating variant TCRs that are broadly cross-reactive, we set out to mutate those areas of the TCR that primarily interact with the antigenic peptide. Structural analysis of four different human and mouse αβTCRs in complex with their cognate peptide/MHC class I all point to the CDR3 loops of the TCRα and β chain as the major determinants of peptide specificity 7,8,12,13. In all cases examined, the TCR binds diagonally across the MHC class I/peptide complex such that the N-terminal part of the MHC-bound peptide is primarily in contact with the TCRα CDR3, whereas the C-terminal part mainly interacts with the CDR3 of the TCRβ chain. Because in the current set of experiments we were primarily interested in obtaining TCRs that can discriminate between epitopes that differ in the C-terminal half of the peptide (see below), a TCR library was manufactured such that its structural diversity is directed towards the TCRβ CDR3 loop exclusively. Through PCR assembly 14 a F5 TCRβ DNA library was generated that contains a 30% mutational rate in its 7 amino acid CDR3 (FIG. 1). The 34.1L ζ cell line was transduced with the F5 TCRα DNA and the TCRβ DNA library to generate a library of T cells with variant CDR3β loops, and 3.0×104 surface TCR expressing cells were isolated by flow cytometry. Sequence analysis of single cell clones from TCR expressing cells were used to provide an estimate of the structural requirements for TCR cell surface expression. and the CDR3β sequence was determined. These data indicate that the serine on position 1 in the CDR3 is conserved and that for the glycine pair on positions 4 and 5 only conservative amino acid substitutions (alanine/serine) are allowed for all mutant TCRs that are expressed at the cell surface (data not shown).

[0020] Isolation of Variant T Cell Receptors

[0021] To examine whether variant TCRs could be obtained that retain the ligand specificity of the parental F5 TCR, the T cell library was screened for binding of tetrameric H-2Db complexes containing the A/NT/60/68 nucleoprotein CTL epitope (ASNENMDAM) (FIG. 2B). Following a first selection round, a population of H-2Db tetramer reactive cells was isolated by flow cytometry. Sequence analysis of the CDR3β loops within this population reveals that although this population is divers, at most positions within the CDR3β only conservative amino acid mutations are allowed for recognition of the A/NT/60/68 NP366-374 tetramers (data not shown). In order to enrich for TCRs with highest affinity for the A/NT/60/68 epitope, a subsequent more stringent selection round was performed in which tetramer-high, TCR-low cells were isolated. In this population two different clones persisted: the parental F5 clone and a variant clone named NT-1. The CDR3β DNA sequence of the NT-1 TCR contains five mutations that result in three conservative amino acid substitutions (table 1). This variant TCR appears to bind the A/NT/60/68 NP366-374 tetramers with similar efficiency as the F5 TCR (FIG. 2A).

[0022] The TCRβ CDR3 library was subsequently screened for the presence of T cell receptors that bind H-2Db tetramers containing a variant influenza A nucleoprotein epitope. This variant NP366-374 epitope (ASNENMETM), derived from the influenza A/PR8/34 strain, differs from the A/NT/60/68 CTL epitope by two conservative amino acid substitutions in the C-terminal half of the peptide and is not recognized by the F5 T cell receptor 10 (FIG. 2A). The TCRβ CDR3 library was subjected to multiple rounds of selection with H-2Db tetramers that contain the variant epitope, in order to select for the TCR clone(s) that exhibit highest affinity for this epitope. After four selection rounds a single TCR clone emerged (named PR-1) that avidly binds to the A/PR8/34 NP366-374 tetramers (FIG. 2B). Interestingly, although in this library screen we did not select against reactivity with the A/NT/60/68 T cell epitope, the PR-1 TCR appears to have lost the ability to react with H-2Db tetramers that contain this original epitope. Sequence analysis of the PR-1 TCR reveals 7 nucleotide mutations in its CDR3β DNA sequence compared to the parental F5 TCR. These mutations result in 4 conservative amino acid changes and one non-conservative Arg to Trp substitution (Table 1).

[0023] In Vitro Function of Selected T Cell Receptors

[0024] To examine whether in vitro selected variant TCRs can evoke T cell activation upon peptide recognition, ligand-induced IL-2 gene transcription was measured. To this purpose we used a self-inactivating (SIN) retroviral vector containing multiple NFAT binding sites upstream of a minimal IL2 promoter and the reporter gene YFP. In T cells that are transfected with this construct, the binding of NFAT transcription factors to the NFAT promotor element offers a direct reflection of T cell activation 15,16 (Hooijberg et al, ms. submitted). 34.1Lζ cells expressing the F5, NT-1 or PR-1 TCR were virally transduced with the NFAT-YFP reporter construct and these transduced cells were subsequently exposed to target cells in the presence of different concentrations of either the A/NT/60/68 or A/PR8/34 T cell epitope. Both variant clones NT-1 and PR-1 efficiently induce T cell activation upon specific antigen recognition with an absolute specificity for the epitope used during the in vitro selections (FIG. 3). Remarkably, the PR-1 TCR shows a greater than ten-fold increased sensitivity for its ligand, as compared to the recognition of the A/NT/60/68 epitope by the F5 TCR. Even though F5 T cells obtained from TCR-transgenic mice are readily activated by low levels of endogenously produced A/NT/60/68 epitopes, both the NT-1 and F5 TCR-transduced 34.1Lζ cells do not efficiently recognize EL4 cells that endogenously produce the A/NT/60/68 CTL epitope, presumably due to the absence of the CD8 co-receptor on this cell line (not shown). In contrast, recognition of endogenously produced A/PR8/34 nucleoprotein epitopes is readily observed for the PR-1 receptor, indicating that this receptor can function in a CD8-independent fashion (FIG. 4, left). This high TCR sensitivity is not a result of an increased TCR cell surface expression (FIG. 2B) and may therefore be a direct reflection of a decrease in TCR-MHC off-rate 17-19. To address this issue, MHC-TCR dissociation rates were determined, by measuring the decay of peptide/H-2Db-tetramer staining upon addition of an excess of the homologous H-2Db monomer (FIG. 5). The half-life of the PR-1/MHC complex as measured in this assay is approximately 4 fold longer, as compared to that of the F5/MHC complex. In line with the functional data, the off-rate of the NT-1/MHC complex is similar to that of the high affinity F5 TCR.

[0025] These experiments reveal that in vitro selection of variant T cell receptors by retroviral TCR display can yield receptors with high potency, as revealed by both biochemical means and functional assays. This despite the fact that in the current set of experiments only the CDR3 region of the TCRβ chain was targeted, and that the length of this CDR3 loop was kept constant. In addition, the diversity of the library used in these experiments (3×104 independent clones) was relatively modest. However, we estimate that through optimization of transduction and sorting strategies retroviral TCR display libraries of 106-107 in size are technically achievable in this system. Such in vitro TCR libraries will then enclose a diversity of ligand specificities that approaches that of the total human naive TCR repertoire (2.5×107) 20. Because retroviral TCR libraries can be focussed towards specific antigen recognition as shown here, the isolation of TCRs with desirable specificities from such in vitro display systems may in fact be relatively straightforward. The T cell receptors that are isolated in this manner may be used for the creation of redirected T cell populations, through gene transfer of peripheral T cell populations21. To provide a first estimate of the risk of autoreactivity following creation of cells that carry in vitro manipulated T cell receptors, PR-1 expressing cells were exposed to an array of different tissue samples from H-2Db-expressing mice. Even though a strong T cell responses is induced by splenocytes that are incubated with the influenza A CTL epitope, no T cell activation above background values is observed upon incubation with a range of self tissues (FIG. 4, right).

[0026] Function of T cells provided with TCR selected in vitro The feasiblility of imposing a desired in vivo antigen-specificity onto a T cell by TCR gene transfer is demonstrated by the following experiment. A vector containing the alpha and beta chains of an Influenza A/NT/60/68 nucleoprotein-specific T cell receptor (F5-TCR) was introduced into murine peripheral T cells. As a control, murine peripheral T cells were left unmodified. Subsequently, both cell populations were introduced into mice and mice were infected with Influenza A/NT/60/68 or with a control virus (A/PR8/34). At various timepoints following infection, peripheral blood of animals was collected and analyzed for the presence of transferred cells that expressed the introduced TCR. Importantly, following infection of mice with influenza A/NT/60/68, a massive expansion of transferred T cells is observed in mice that received F5-modified T cells. This expansion is not observed in mice that had received control cells, or in mice that had received F5-modified cells but were infected with a control virus. These data demonstrate that T cell receptor genes transfer is sufficient to generate T cell populations that respond to antigen in vivo with the desired specificity.

METHODS

[0027] Preparation of H-2Db tetramers. Peptides were produced using standard Fmoc chemistry. Soluble allophycocyanin (APC)-labeled H-2Db tetramers were produced as described previously 9, 31 and stored frozen in Tris-buffered saline/16% glycerol/0.5% BSA.

[0028] Cell Lines and viruses. The 34.1L cell line is a day 14 fetal thymus derived prethymocyte cell line 32 and was a kind gift of Dr. A. Kruisbeek (NCI, amsterdam, the Netherlands). The Phoenix-A cell line, a derivative of the human embryonic kidney cell line 293T, was a kind gift of Dr. G. Nolan (Stanford University, Palo Alto, Calif.). The EL4 tumor cell line is a murine thyoma cell line of the H-2b haplotype. The EL4PR cell line was obtained by transduction of EL4 cells with a retrovirus encoding the eGFP gene with the A/PR/8/34 CTL epitope as a C-terminal fusion, and was isolated by fluorescence-activated cell sorting of eGFP-expressing cells (M. C. Wolkers et al., in preparation). For the generation of the 34.1Lζ cell line, CD3ζ cDNA was amplified by PCR with primers CD3ζtop (CCCAAGCTTATGAAGTGGAAAGTGTCTTTG) (SEQ ID NO 1) and CD3ζbottom (ATAAGAATGCGGCCGCTTACTGGTAAAGGCCATCGTG) (SEQ ID NO 2) (Isogen Bioscience BV, Maarssen, the Netherlands), and subcloned into the retroviral vector pMX (a kind gift from Dr. T. Kitamura, University of Tokyo, Japan). Retroviral supernatant was produced in Phoenix-A cells and was used to transduce 34.1L cells. Following transduction, 34.1Lζ cells were cloned and expression of the transduced CD3ζ chain was assessed by RT-PCR. All cell lines were grown in Iscove's modified Dulbecco's medium (Life Technologies BV, Scotland) supplemented with 5% fetal calf serum (BioWhittaker, Belgium), 0.5 mM β-mercaptoethanol (Merck, Darmstadt, Germany), penicillin (100 U/ml) and streptomycin (100 μg/ml) (Boehringer Mannheim, Germany).

[0029] Production of retroviral supernatants and retroviral transduction. Plasmid DNA was transfected into Phoenix-A cells by pfx-2 lipid transfection (Invitrogen). After transfection the cells were cultured for 48 hours prior to the transduction procedure. The recombinant human fibronectin fragments CH-296 transduction procedure (RetroNectin™; Takara, Otsu, Japan) was based on a method developed by Hanenberg et al34. Non-tissue culture treated Falcon petridishes (3 cm diameter) (Becton Dickinson) were coated with 2 ml of 30 μg/ml recombinant human fibronectin fragment CH-296 at room temperature for 2 hours. The CH-296 solution was removed and replaced with 2 ml 2% bovine serum albumin (Sigma) in PBS for 30 min at room temperature. The target cells were plated on RetroNectin™ coated dishes (0.5×106 cells/petridish) in 1 ml of retroviral supernatant. Cells were cultured at 37° C. for 24 hours, washed and transferred to 25 cm2 culture flasks (Falcon plastics, Becton Dickinson).

[0030] Construction of the F5 TCR CDR3 library. TCR cDNAs were generated from F5 TCR transgenic T cells by reverse transcriptase reaction (Boehringer Mannheim, Germany). The F5 TCRα cDNA was amplified by PCR with F5α-top (GGGGGATCCTAAACCATGAACTATTCTCCAGCTTTAGTG) (SEQ ID NO 3) and F5α-bottom (GGAAGGGGGCGGCCGCTCAACTGGACCACAGCCTCAG) (SEQ ID NO 4) primers (Perkin Elmer, Nieuwekerk a/d Ijassel, The Netherlands) and ligated into the pMX-IRES-eGFP vector. The F5 TCRβ cDNA was amplified by PCR with F5β-top (GGGGGATCCT AAACCATGGCCCCCAGGCTCCTTTTC) (SEQ ID NO 5) and F5β-bottom (GGAAGGGGGC GGCCGCTAGGAATTTTTTTTCTTGACCATGG) (SEQ ID NO 6) primers and ligated into the pMX vector. In order to diversify the CDR3 region of the F5 TCRβ chain, the F5β-CDR3-HM primer (CTGGTCCGAAGAACTGCTCAGCATGCCCCCCAGTCCGGGAGCTGCTTGCACAAAGAT ACAC) (SEQ ID NO 7) was synthesized, in which the CDR3 coding sequence contains 70% of the original nucleotide (underlined) and 10% of each of the other 3 nucleotides. A 5′ fragment of the F5 TCRβ was amplified by PCR with F5β-top and F5β-CDR3-3′top (GAGCAGTTCTTCGGACCAG) (SEQ ID NO 8) and F5β-bottom primers. Both resulting F5 TCRβ fragments were assembled by PCR in the presence of F5β-top and F5β-bottom primers and this TCRβ CDR3 DNA library was ligated into the pMX vector. Ligation products were introduced into Escherichia coli MC1061 cells by electroporation to generate a CDR3 library with a complexity of 3×106 clones. Flow cytometric analysis and TCR CDR3 library screening. A specific staining to 34.1L cells was blocked with 0.5 μg/ml anti-FcgRII/IIImAB (clone 2.4G2). Cells were stained with PE conjugated anti-TCRβ chain (H57-597)mAB (Pharmingen) or MHC tetramers at 4 degress C. (unless indicated otherwise). Propidium iodide (1 μg/ml) (Sigma) was included prior to analysis. Data acquisition and analysis was performed on a FacsCalibur (Becton Dickinson, MountainView, Calif.) using Lysis II software. 34.1Lζ stimulation assay. The SIN-(NFAT)6-YFP retroviral construct was produced as described previously (Hooijberg et al., ms. submitted). TCR expressing 34.1Lζ cells were transduced with the self-inactivating retroviral construct. Transduced cells, as revealed by YFP expression after overnight PMA (10 μg/ml) (Sigma) and ionomycin (1.67 μg/ml) (Sigma) stimulation, were isolated by flow cytometry. Transduced 34.1Lζ cells were incubated overnight at 37° C. with EL4 target cells at an effector:target ratio of 1:10 in the presence of peptides at the indicated concentrations. The percentage of YFP expressing 34.1Lζ cells was determined by flow cytometric analysis.

[0031] Determination of MHC-TCR dissociation rates. Cells were stained with (APC) -labeled H-2Db tetramers for 20 minutes at 4° C., and subsequently washed once with PBS/0.5% BSA/0.02% NaN3. Following addition of unlabeled homologous H-2Db monomers (10 μM) the decay of tetramer staining was measured by flow cytometry. MHC/TCR dissociation was calculated as follows: (FIexp−FI0)/(FImax−FI0)×100%. Simultaneous addition of H-2Db tetramers and 10 μM unlabeled homologous H-2Db monomers during cell labeling completely prevents the binding of tetrameric MHC complexes (not shown).

1TABLE 1Selection of variant T cell receptors by retroviral TCRdisplay. A/NT/60/68 and A/PR/8/34 nucleoprotein-specific T cellreceptors were selected from the TCR library F5 TCR-1.Sequences of the CDR3 of the F5 and variant TCRβ chainsare boxed. Mutations and resulting amino acid substitutions areindicated in bold.F5AGC AGC {overscore (|TCC CGG ACT GGG GGG CAT GCT|)} GAG CAG(SEQ ID NO 9) S S | S R T G G H A | E Q(SEQ ID NO 10)NT-1AGC AGC {overscore (|TCC CGG AGT GGG GCA CGA GCT|)} GAG CAG(SEQ ID NO 11) S S | S R S G A | R A E Q(SEQ ID NO 12)PR-1AGC AGC {overscore (|TCT TGG AGT GGG AGC AAT GGT|)} GAG CAG (SEQ ID NO 13) S S | S W S G S N G | E Q(SEQ ID NO 14)

References

[0032] 1. Sprent, J. & Kishimoto, H. T cell tolerance and the thymus. Ann N Y Acad Sci 841, 236-245 (1998).

[0033] 2. Stockinger, B. T lymphocyte tolerance: from thymic deletion to peripheral control mechanisms. Adv Immunol 71, 229-265 (1999).

[0034] 3. Clackson, T., Hoogenboom, H. R., Griffiths, A. D. & Winter, G. Making antibody fragments using phage display libraries, Nature 352, 624-628 (1991).

[0035] 4. Weidanz, J. A., Card, K. F., Edwards, A., Perlstein, E. & Wong, H. C. Display of functional alphabeta single-chain T-cell receptor molecules on the surface of bacteriophage. J Immunol Methods 221, 59-76 (1998).

[0036] 5. Monks, C. R., Freiberg, B. A., Kupfer, H., Sciaky, N. & Kupfer, A. Three-dimensional segregation of supramolecular activation clusters in T cells. Nature 395, 82-86 (1998).

[0037] 6. Grakoui, A. et al. The immunological synapse: a molecular machine controlling T cell activation. Science 285, 221-227 (1999).

[0038] 7. Garboczi, D. N. et al. Structure of the complex between human T-cell receptor, viral peptide and HLA-A2. Nature 384, 134-141 (1996).

[0039] 8. Garcia, K. C. et al. An alphabeta T cell receptor structure at 2.5 A and its orientation in the TCR-MHC complex. Science 274, 209-219 (1996).

[0040] 9. Altman, J. D. et al. Phenotypic analysis of antigen-specific T lymphocytes. Science 274, 94-96 (1996).

[0041] 10. Moskophidis, D. & Kioussis, D. Contribution of virus-specific CD8+ cytotoxic T cells to virus clearance or pathologic manifestations of influenza virus infection in a T cell receptor transgenic mouse model. J Exp Med 188, 223-232 (1998).

[0042] 11. Townsend, A. R., Gotch, F. M. & Davey, J. Cytotoxic T cells recognize fragments of the influenza nucleoprotein. Cell 42, 457-467 (1985).

[0043] 12. Ding, Y. H. et al. Two human T cell receptors bind in a similar diagonal mode to the HLA-A2/Tax peptide complex using different TCR amino acids. Immunity 8, 403-411 (1998).

[0044] 13. Teng, M. K. et al. Identification of a common docking topology with substantial variation among different TCR-peptide-MHC complexes. Curr Biol 8, 409-412 (1998).

[0045] 14. Crameri, A., Cwirla, S. & Stemmer, W. P. Construction and evolution of antibody-phage libraries by DNA shuffling. Nat Med 2, 100-102 (1996).

[0046] 15. Fiering, S. et al. Single cell assay of a transcription factor reveals a threshold in transcription activated by signals emanating from the T-cell antigen receptor. Genes Dev 4, 1823-1834 (1990).

[0047] 16. Karttunen, J. & Shastri, N. Measurement of ligand-induced activation in single viable T cells using the lacZ reporter gene. Proc Natl Acad Sci U S A 88, 3972-3976 (1991).

[0048] 17. Kersh, G. J., Kersh, E. N., Fremont, D. H. & Allen, P. M. High- and low-potency ligands with similar affinities for the TCR: the importance of kinetics in TCR signaling. Immunity 9, 817-826 (1998).

[0049] 18. Busch, D. H. & Pamer, E. G. T cell affinity maturation by selective expansion during infection. J Exp Med 189, 701-710 (1999).

[0050] 19. Savage; P. A., Boniface, J. J. & Davis, M. M. A kinetic basis for T cell receptor repertoire selection during an immune response. Immunity 10, 485-492 (1999).

[0051] 20. Arstila, T. P. et al. A direct estimate of the human alphabeta T cell receptor diversity. Science 286, 958-961 (1999).

[0052] 21. Clay, T. M. et al. Efficient transfer of a tumor antigen-reactive TCR to human peripheral blood lymphocytes confers anti-tumor reactivity. J Immunol 163, 507-513 (1999).

[0053] 22. Kappler, J. W., Roehm, N. & Marrack, P. T cell tolerance by clonal elimination in the thymus. Cell 49, 273-280 (1987).

[0054] 23. Kisielow, P., Bluthmann, H., Staerz, U. D., Steinmetz, M. & von Boehmer, H. Tolerance in T-cell-receptor transgenic mice involves deletion of nonmature CD4+8+ thymocytes. Nature 333, 742-746 (1988).

[0055] 24. Sha, W. C. et al. Positive and negative selection of an antigen receptor on T cells in transgenic mice. Nature 336, 73-76 (1988).

[0056] 25. Pircher, H., Burki, K., Lang, R., Hengartner, H. & Zinkernagel, R. M. Tolerance induction in double specific T-cell receptor transgenic mice varies with antigen. Nature 342, 559-561 (1989).

[0057] 26. Theobald, M. et al. Tolerance to p53 by A2.1-restricted cytotoxic T lymphocytes. J Exp Med 185, 833-841 (1997).

[0058] 27. Morgan, D. J. et al. Activation of low avidity CTL specific for a self epitope results in tumor rejection but not autoimmunity. J Immunol 160, 643-651 (1998).

[0059] 28. Romieu, R. et al. Passive but not active CD8+ T cell-based immunotherapy interferes with liver tumor progression in a transgenic mouse model. J Immunol 161, 5133-5137 (1998).

[0060] 29. Wang, R., Wang-Zhu, Y., Gabaglia, C. R., Kimachi, K. & Grey, H. M. The stimulation of low-affinity, nontolerized clones by heteroclitic antigen analogues causes the breaking of tolerance established to an immunodominant T cell epitope. J Exp Med 190, 983-994 (1999).

[0061] 30. Zeh, H. J., 3rd, Perry-Lalley, D., Dudley, M. E., Rosenberg, S. A. & Yang, J. C. High avidity CTLs for two self-antigens demonstrate superior in vitro and in vivo antitumor efficacy. J Immunol 162, 989-994 (1999).

[0062] 31. Haanen, J. B. et al. Systemic T cell expansion during localized viral infection. Eur J Immunol 29, 1168-1174 (1999).

[0063] 32. Oosterwegel, M., Timmerman, J., Leiden, J. & Clevers, H. Expression of GATA-3 during lymphocyte differentiation and mouse embryogenesis. Dev Immunol 3, 1-11 (1992).

[0064] 33. Gorer, P. A. Studies in antibody response of mice to tumour inoculation. Br. J. Cancer 4, 372-379 (1950).

[0065] 34. Hanenberg, H. et al. Colocalization of retrovirus and target cells on specific fibronectin fragments increases genetic transduction of mammalian cells. Nat Med 2, 876-882 (1996).

[0066] 35. Whelan, J. A. et al. Specificity of CTL interactions with peptide-MHC class I tetrameric complexes is temperature dependent. J Immunol 163, 4342-4348 (1999).

[0067] 36. Altman J D, Moss P A H, Goulder P J R, Barouch D H, McHeyzer-Williams M G, Bell J I, McMichael A J, Davis M M. Phenotypic analysis of antigen-specific T lymphocytes.

[0068] 37. Schneck J P. Monitoring antigen-specific T cells using MHC-Ig dimers. Immunol Invest. May 2000;29(2):163-9.

[0069] 38. Baumgarth N, Egerton M, Kelso A. Activated T cells from draining lymph nodes and an effector site differ in their responses to TCR stimulation. J Immunol. Aug. 1, 1997;159(3):1182-91.

[0070] 39. Sanderson S, Shastri N. LacZ inducible, antigen/MHC-specific T cell hybrids. Int Immunol. March 1994;6(3):369-76.

[0071] 40. Hooijberg E, Bakker A Q, Ruizendaal J J, Spits H. NFAT-controlled expression of GFP permits visualization and isolation of antigen-stimulated primary human T cells. Blood. Jul. 15, 2000;96(2):459-66.

[0072] 41. Mazda O, Satoh E, Yasutomi K, Imanishi J J Immunol Methods May 26, 1997;204(2):143-51 Extremely efficient gene transfection into lympho-hematopoietic cell lines by Epstein-Barr virus-based vectors.

[0073] 42. Cachianes G, Ho C, Weber R F, Williams S R, Goeddel D V, Leung D W Biotechniques August 1993;15(2):255-9 Epstein-Barr virus-derived vectors for transient and stable expression of recombinant proteins.

[0074] 43. Kieke M C, Shusta E V, Boder E T, Teyton L, Wittrup K D, Kranz D M Selection of functional T cell receptor mutants from a yeast surface-display library. Proc Natl Acad Sci USA May 11, 1999;96 (10):5651-6

LEGENDS TO FIGURES

[0075]
FIG. 1: Left: schematic representation of the generation and screening of retroviral TCR display libraries. Right: generation of the TCR library F5 TCR-1. Complementari y-determining regions of the TCRα and β chains are depic ed as solid boxes. The complementarity-determining region 3 DNA sequence of the β chain targeted in the current experiments is depicted in bold.

[0076]
FIG. 2: MHC tetramer analysis of in vitro-selected TCRs. 2A. Flow cytometric analysis of 34.1ζ cells expressi g the F5 (top panels), NT-1 (middle panels), or PR-1 TCRs (bottom panels). Left panels represent staining with anti-TCR antibody. Middle panels represent staining with APC-labeled tetrameric H-2Db complexes containing the A/NT/60/68 nucleoprotein epitope (ASNENMDAM), right panels repres nt staining with APC-labeled H-2Db tetramers containing the A/PR8/34 nucleoprotein epitope (ASNENMETM). Tetramer staining was performed at 37° C. 35. 2B. Selection of influenza A-reactive TCRs from in vitro TCR libraries. Panels represent staining of the TCRβ CDR3 library with APC-labeled tetrameric H-2Db complexes containing the A/NT/60/68 nucleoprotein epitope prior to screening (top panel) and after 1 (middle panel) and 2 (bottom panel) sorts with A/NT/60/68 H-2Db tetramers.

[0077]
FIG. 3: Signaling function of in vitro selected TCRs. 34.1Lζ TCR-expressing cells transduced with the NFAT-YFP construct were exposed to EL4 target cells (E:T ratio 1:10) in the presence of different concentrations of either the A/NT/60/68 (open squares) or A/PR8/34 (filled circles ) T cell epitope. Sensitivity and specificity of the different TCRs were determined by flow cytometric analysis of the percentage of YFP expressing 34.1L cells. In accordance with previous results, the distribution of YFP expression upon stimulation is bimodal 15,16 and T cell activation upon stimulation with PMA and ionomycin results in 60-65% YFP expressing cells (not shown). Data shown are means of triplicates +/±S. D.

[0078]
FIG. 4: Specificity of the PR-1 TCR. Left: 34.1Lζ PR-1-expressing cells transduced with the NFAT-YFP construct were exposed to EL4 target cells or EL4PR cells that endogenously produce the A/PR8/34 CTL epitope, at an E:T ratio of 1:10. Right: 34.1Lζ PR-1-expressing cells were incubated with cell suspensions from the indicated tissues at an E:T ratio of 1:100. In the left panel the percentage of YFP-positive cells in the absence of target cells is depicted. In the right panel the percentage of YFP-positive cells in the presence of spleen cells incubated with 0.5 μM of the ASNENMETM peptide is depicted. Data shown are means of triplicates (left) or duplicates (right).

[0079]
FIG. 5: Determination of MHC-TCR dissociation rates. 34.1Lζ-TCR expressing cells were stained with their cognate APC-labeled peptide/H-2Db tetramers at 4° C. and subsequently exposed to an excess of homologous unlabeled H-2Db monomers at 25° C. Decay of H-2Db tetramer staining was measured by flow cytometry and is plotted as the percentage of maximum staining.

	Number	Date	Country
Parent	PCT/NL01/00021	Jan 2001	US
Child	10196730	Jul 2002	US

T cell receptor libraries

Information

Publication Number

Date Filed

Date Published

Inventors

CPC

US Classifications

International Classifications

Abstract

Description

Claims

Priority Claims (1)

CROSS-REFERENCE TO RELATED APPLICATIONS

Continuations (1)