Therapeutic uses of interleukin-3 (IL-3) multiple mutation polypeptides

Description

FIELD OF THE INVENTION
The present invention relates to mutants or variants of human interleukin-3 (hIL-3) which contain multiple amino acid substitutions and which may have portions of the native hIL-3 molecule deleted. These hIL-3 multiple mutation polypeptides retain one or more activities of native hIL-3 and may also show improved hematopoietic cell-stimulating activity and/or an improved activity profile which may include reduction of undesirable biological activities associated with native hIL-3.
BACKGROUND OF THE INVENTION
Colony stimulating factors (CSFs) which stimulate the differentiation and/or proliferation of bone marrow cells have generated much interest because of their therapeutic potential for restoring depressed levels of hematopoietic stem cell-derived cells. CSFs in both human and murine systems have been identified and distinguished according to their activities. For example, granulocyte-CSF (G-CSF) and macrophage-CSF (M-CSF) stimulate the in vitro formation of neutrophilic granulocyte and macrophage colonies, respectively while GM-CSF and interleukin-3 (IL-3) have broader activities and stimulate the formation of both macrophage, neutrophilic and eosinophilic granulocyte colonies. IL-3 also stimulates the formation of mast, megakaryocyte and pure and mixed erythroid colonies.
Because of its ability to stimulate the proliferation of a number of different cell types and to support the growth and proliferation of progenitor cells, IL-3 has potential for therapeutic use in restoring hematopoietic cells to normal amounts in those cases where the number of cells has been reduced due to diseases or to therapeutic treatments such as radiation and chemotherapy.
Interleukin-3 (IL-3) is a hematopoietic growth factor which has the property of being able to promote the survival, growth and differentiation of hematopoietic cells. Among the biological properties of IL-3 are the ability (a) to support the growth and differentiation of progenitor cells committed to all, or virtually all, blood cell lineages; (b) to interact with early multipotential stem cells; (c) to sustain the growth of pluripotent precursor cells; (d) to stimulate proliferation of chronic myelogenous leukemia (CML) cells; (e) to stimulate proliferation of mast cells, eosinophils and basophils; (f) to stimulate DNA synthesis by human acute myelogenous leukemia (AML) cells; (g) to prime cells for production of leukotrienes and histamines; (h) to induce leukocyte chemotaxis; and (i) to induce cell surface molecules needed for leukocyte adhesion.
Mature human interleukin-3 (hIL-3) consists of 133 amino acids. It has one disulfide bridge and two potential glycosylation sites (Yang, et al., CELL 47:3 (1986)).
Murine IL-3 (mIL-3) was first identified by Ihle, et al., J. IMMUNOL. 12:2184 (1981) as a factor which induced expression of a T cell associated enzyme, 20-hydroxysteroid dehydrogenase. The factor was purified to homogeneity and shown to regulate the growth and differentiation of numerous subclasses of early hematopoietic and lymphoid progenitor cells.
In 1984, cDNA clones coding for murine IL-3 were isolated (Fung, et al., NATURE 30:233 (1984) and Yokota, et al., PROC. NATL. ACAD. SCI. USA 82:1070 (1984)). The murine DNA sequence coded for a polypeptide of 166 amino acids including a putative signal peptide.
The gibbon IL-3 sequence was obtained using a gibbon cDNA expression library. The gibbon IL-3 sequence was then used as a probe against a human genomic library to obtain a human IL-3 sequence.
Gibbon and human genomic DNA homologues of the murine IL-3 sequence were disclosed by Yang, et al., CELL 47:3 (1986). The human sequence reported by Yang, et al. included a serine residue at position 8 of the mature protein sequence. Following this finding, others reported isolation of Pro.sup.8 hIL-3 cDNAs having proline at position 8 of the protein sequence. Thus it appears that there may be two allelic forms of hIL-3.
Dorssers, et al., GENE 5:115 (1987), found a clone from a human cDNA library which hybridized with mIL-3. This hybridization was the result of the high degree of homology between the 3' noncoding regions of mIL-3 and hIL-3. This CDNA coded for an hIL-3 (Pro.sup.8) sequence.
U.S. Pat. No. 4,877,729 and U.S. Pat. No. 4,959,454 disclose human IL-3 and gibbon IL-3 cDNAs and the protein sequences for which they code. The hIL-3 disclosed has serine rather than proline at position 8 in the protein sequence.
Clark-Lewis, et al., SCIENCE 231:134 (1986) performed a functional analysis of murine IL-3 analogues synthesized with an automated peptide synthesizer. The authors concluded that the stable tertiary structure of the complete molecule was required for full activity. A study on the role of the disulfide bridges showed that replacement of all four cysteines by alanine gave a molecule with 1/500th the activity as the native molecule. Replacement of two of the four Cys residues by Ala(Cys.sup.79, Cys.sup.140 .fwdarw.Ala.sup.79, Ala.sup.140) resulted in an increased activity. The authors concluded that in murine IL-3 a single disulfide bridge is required between cysteines 17 and 80 to get biological activity that approximates physiological levels and that this structure probably stabilizes the tertiary structure of the protein to give a conformation that is optimal for function. (Clark-Lewis, et al., PROC. NATL. ACAD. SCI. USA B:7897 (1988)).
International Patent Application (PCT) WO 88/00598 discloses gibbon- and human-like IL-3. The hIL-3 contains a Ser.sup.8 .fwdarw.Pro8 replacement. Suggestions are made to replace Cys by Ser, thereby breaking the disulfide bridge, and to replace one or more amino acids at the glycosylation sites.
EP-A-0275598 (WO 88/04691) illustrates that Ala.sup.1 can be deleted while retaining biological activity. Some mutant hIL-3 sequences are provided, e.g., two double mutants, Ala.sup.1 .fwdarw.Asp.sup.1, Trp13.fwdarw.Arg.sup.13 (pGB/IL-302) and Ala.sup.1 .fwdarw.Asp.sup.1, Met.sup.3 .fwdarw.Thr.sup.3 (pGB/IL-304) and one triple mutant Ala.sup.1 .fwdarw.Asp.sup.1, Leu.sup.9 .fwdarw.Pro.sup.9, Trp.sup.13 .fwdarw.Arg.sup.13 (pGB/IL-303).
WO 88/05469 describes how deglycosylation mutants can be obtained and suggests mutants of Arg.sup.54 Arg.sup.55 and ArglO.sup.8 ArglO.sup.9 LysllO might avoid proteolysis upon expression in Saccharomyces cerevisiae by KEX2 protease. No mutated proteins are disclosed. Glycosylation and the KEX2 protease activity are only important, in this context, upon expression in yeast.
WO 88/06161 mentions various mutants which theoretically may be conformationally and antigenically neutral. The only actually performed mutations are Met.sup.2 .fwdarw.Ile.sup.2 and Ile.sup.131 .fwdarw.Leu.sup.131. It is not disclosed whether the contemplated neutralities were obtained for these two mutations.
WO 91/00350 discloses nonglycosylated hIL-3 analog proteins, for example, hIL-3 (Pro.sup.8 Asp.sup.15 Asp.sup.70), Met.sup.3 rhul-3 (Pro.sup.8 Asp.sup.15 Asp.sup.70); Thr.sup.4 rhuL-3 (Pro.sup.8 Asp.sup.15 Asp.sup.70)and Thr.sup.6 rhuIL-3 (Pro.sup.8 Asp.sup.15 Asp.sup.70). It is said that these protein compositions do not exhibit certain adverse side effects associated with native hIL-3 such as urticaria resulting from infiltration of mast cells and lymphocytes into the dermis. The disclosed analog hIL-3 proteins may have N termini at Met.sup.3, Thr.sup.4, or Thr.sup.6.
WO 91/12874 discloses cysteine added variants (CAVs) of IL-3 which have at least one Cys residue substituted for a naturally occurring amino acid residue.
SUMMARY OF THE INVENTION
The present invention relates to recombinant human interleukin-3 (hIL-3) variant or mutant proteins (muteins). These hIL-3 muteins contain amino acid substitutions and may also have amino acid deletions at either/or both the N- and C-termini. Preferably, these mutant polypeptides of the present invention contain four or more amino acids which differ from the amino acids found at the corresponding positions in the native hIL-3 polypeptide. The invention also relates to pharmaceutical compositions containing the hIL-3 muteins, DNA coding for the muteins, and methods for using the muteins. Additionally, the present invention relates to recombinant expression vectors comprising nucleotide sequences encoding the hIL-3 muteins, related microbial expression systems, and processes for making the hIL-3 muteins using the microbial expression systems.
The present invention includes mutants of hIL-3 in which from 1 to 14 amino acids have been deleted from the N-terminus and/or from 1 to 15 amino acids have been deleted from the C-terminus, and in which multiple amino acid substitutions have been made. Preferred muteins of the present invention are those in which amino acids 1 to 14 have been deleted from the N-terminus, amino acids 126 to 133 have been deleted from the C-terminus, and which also contain from about four to about twenty-six amino acid substitutions in the polypeptide sequence. These hIL-3 multiple mutation polypeptides may have biological activities similar to or better than hIL-3 and, in some cases, may also have an improved side effect profile, i.e., some muteins may have a better therapeutic index than native hIL-3. The present invention also provides muteins which may function as IL-3 antagonists or as discrete antigenic fragments for the production of antibodies useful in immunoassay and immunotherapy protocols. In addition to the use of the hIL-3 multiple mutation polypeptides of the present invention in vivo, it is envisioned that in vitro uses would include the ability to stimulate bone marrow and blood cell activation and growth before infusion into patients.
Antagonists of hIL-3 would be particularly useful in blocking the growth of certain cancer cells like AML, CML and certain types of B lymphoid cancers. Other conditions where antagonists would be useful include those in which certain blood cells are produced at abnormally high numbers or are being activated by endogenous ligands. Antagonists would effectively compete for ligands, presumably naturally occurring hemopoietins including and not limited to IL-3, GM-CSF and IL-5, which might trigger or augment the growth of cancer cells by virtue of their ability to bind to the IL-3 receptor complex while intrinsic activation properties of the ligand are diminished. IL-3, GM-CSF and/or IL-5 also play a role in certain asthmatic responses. An antagonist of the IL-3 receptor may have the utility in this disease by blocking receptor-mediated activation and recruitment of inflammatory cells.

BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 is the human IL-3 gene for E. coli expression (pMON5873), encoding the polypeptide sequence of natural (wild type) human IL-3 [SEQ ID NO:128), plus an initiator methionine, as expressed in E. coli, with the amino acids numbered from the N-terminus of the natural hIL-3.
FIG. 2: ClaI to NsiI Replacement Fragment. FIG. 2 shows the nucleotide sequence of the replacement fragment used between the ClaI and NsiI sites of the hIL-3 gene. The codon choice used in the fragment corresponds to that found in highly expressed E. coli genes (Gouy and Gautier, 1982). Three new unique restriction sites, EcoRV, XhoI and PstI were introduced for the purpose of inserting synthetic gene fragments. The portion of the coding sequence shown encodes hIL-3 amino acids 20-70.
FIGS. 3A-3B show the nucleotide and amino acid sequence of the gene in pMON5873 with the sequence extending from NcoI through HindIII. The codon choices used to encode amino acids 1-14 and 107-133 correspond to that found in highly expressed E. coli genes.
FIG. 4 shows the construction of the plasmid vector pMON5846 which encodes [Met-(1-133) hIL-3 (Arg.sup.129)].
FIG. 5 shows the construction of the plasmid vector pMON5847 (ATCC 68912) which encodes [Met-(1-133) hIL-3 (Arg.sup.129)].
FIG. 6 shows the construction of plasmid vector pMON5853 which encodes [Met-(15-133) hIL-3 (Arg.sup.129)].
FIG. 7 shows the construction of the plasmid vector pMON5854 which encodes [Met-(1-133) hIL-3 (Arg.sup.129)].
FIG. 8 shows the DNA sequence and resulting amino acid sequence of the LamB signal peptide.
FIG. 9 shows the construction of the plasmid vector pMON5978 which encodes Met-Ala-(15-125)hIL-3.
FIG. 10 shows the construction of the plasmid vector pMON5988 which encodes Met-Ala(15-125)hIL-3.
FIG. 11 shows the construction of the plasmid vector pMON5887 which encodes Met-(1-125)hIL-3.
FIG. 12 shows the construction of pMON6457 which encodes (15-125)hIL-3; it contains the araBAD promoter and the LamB signal peptide fused to the variant hIL-3 amino acids 15-125.
FIG. 13 shows the construction of pMON6458; it contains the araBAD promoter and the LamB signal peptide fused to the variant hIL-3 amino acids 15-125.
FIG. 14 shows the construction of pMON13359.
FIG. 15 shows the construction of pMON13352.
FIG. 16 shows the construction of pMON13360.
FIG. 17 shows the construction of pMON13363.
FIG. 18 shows the construction of pMON13364.
FIG. 19 shows the construction of pMON13365.
FIG. 20 shows the construction of pMON13287.
FIG. 21 shows the construction of pMON13288.
FIG. 22 shows the construction of pMON13289.
FIG. 23 shows the construction of pMON5723.
FIG. 24 shows the construction of pMON13438.

DETAILED DESCRIPTION OF THE INVENTION
The present invention relates to muteins of human interleukin-3 (hIL-3) in which amino acid substitutions have been made at four or more positions in amino acid sequence of the polypeptide and to muteins which have substantially the same structure and substantially the same biological activity. Preferred muteins of the present invention are (15-125)hIL-3 deletion mutants which have deletions of amino acids 1 to 14 at the N-terminus and 126 to 133 at the C-terminus and which also have four or more amino acid substitutions in the polypeptide and muteins having substantially the same structure and substantially the same biological activity. Among the preferred muteins are those having twenty-six amino acid substitutions. As used herein human interleukin-3 corresponds to the amino acid sequence (1-133) as depicted in FIG. 1 and (15-125) hIL-3 corresponds to the 15 to 125 amino acid sequence of the hIL-3 polypeptide. Naturally occurring variants of hIL-3 polypeptide amino acids are also included in the present invention (for example, the allele in which proline rather than serine is at position 8 in the hIL-3 polypeptide sequence) as are variant hIL-3 molecules which are modified post-translationally (e.g. glycosylation).
The present invention also includes the DNA sequences which code for the mutant polypeptides, DNA sequences which are substantially similar and perform substantially the same function, and DNA sequences which differ from the DNAs encoding the muteins of the invention only due to the degeneracy of the genetic code.
Included in the present invention are novel mutant human interleukin-3 polypeptides comprising a polypeptide having the amino acid sequence of native human interleukin-3 wherein amino acids 126 to 133 have been deleted from the C-terminus of the native human interleukin-3 polypeptide and amino acids 1 to 14 have been deleted from the N-terminus of the native human interleukin-3 polypeptide and, in addition, polypeptides also have four or more amino acid substitutions in the polypeptide sequence.
Also included in the present invention are the DNA sequences coding for the muteins of the present invention; the oligonucleotide intermediates used to construct the mutant DNAS; and the polypeptides coded for by these oligonucleotides. These polypeptides may be useful as antagonists or as antigenic fragments for the production of antibodies useful in immunoassay and immunotherapy protocols.
The mutant hIL-3 polypeptides of the present invention may also have methionine, alanine, or methionine-alanine residues inserted at the N-terminus.
The present invention includes human interleukin-3 mutant polypeptide Formula I:Ala Pro Met Thr Gln Thr Thr Ser Leu Lys Thr Ser Trp Val Asn [SEQ ID NO:15] 1 5 10 15Cys Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 20 25 30Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 35 40 45Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 50 55 60Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 65 70 75Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 80 85 90Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 95 100 105Xaa Phe Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 110 115 120Xaa Xaa Xaa Gln Gln Thr Thr Leu Ser Leu Ala Ile Phe 125 130
wherein
Xaa at position 17 is Ser, Lys, Gly, Asp, Met, Gln, or Arg;
Xaa at position 18 is Asn, His, Leu, Ile, Phe, Arg, or Gln;
Xaa at position 19 is Met, Phe, Ile, Arg, Gly, Ala, or Cys;
Xaa at position 20 is Ile, Cys, Gln, Glu, Arg, Pro, or Ala;
Xaa at position 21 is Asp, Phe, Lys, Arg, Ala, Gly, Glu, Gln, Asn, Thr, Ser or Val;
Xaa at position 22 is Glu, Trp, Pro, Ser, Ala, His, Asp, Asn, Gln, Leu, Val or Gly;
Xaa at position 23 is Ile, Val, Ala, Leu, Gly, Trp, Lys, Phe, Leu, Ser, or Arg;
Xaa at position 24 is Ile, Gly, Val, Arg, Ser, Phe, or Leu;
Xaa at position 25 is Thr, His, Gly, Gln, Arg, Pro, or Ala;
Xaa at position 26 is His, Thr, Phe, Gly, Arg, Ala, or Trp;
Xaa at position 27 is Leu, Gly, Arg, Thr, Ser, or Ala;
Xaa at position 28 is Lys, Arg, Leu, Gln, Gly, Pro, Val or Trp;
Xaa at position 29 is Gln, Asn, Leu, Pro, Arg, or Val;
Xaa at position 30 is Pro, His, Thr, Gly, Asp, Gln, Ser, Leu, or Lys;
Xaa at position 31 is Pro, Asp, Gly, Ala, Arg, Leu, or Gln;
Xaa at position 32 is Leu, Val, Arg, Gln, Asn, Gly, Ala, or Glu;
Xaa at position 33 is Pro, Leu, Gln, Ala, Thr, or Glu;
Xaa at position 34 is Leu, Val, Gly, Ser, Lys, Glu, Gln, Thr, Arg, Ala, Phe, Ile or Met;
Xaa at position 35 is Leu, Ala, Gly, Asn, Pro, Gln, or Val;
Xaa at position 36 is Asp, Leu, or Val;
Xaa at position 37 is Phe, Ser, Pro, Trp, or Ile;
Xaa at position 38 is Asn, or Ala;
Xaa at position 40 is Leu, Trp, or Arg;
Xaa at position 41 is Asn, Cys, Arg, Leu, His, Met, or Pro;
Xaa at position 42 is Gly, Asp, Ser, Cys, Asn, Lys, Thr, Leu, Val, Glu, Phe, Tyr, Ile, Met or Ala;
Xaa at position 43 is Glu, Asn, Tyr, Leu, Phe, Asp, Ala, Cys, Gln, Arg, Thr, Gly or Ser;
Xaa at position 44 is Asp, Ser, Leu, Arg, Lys, Thr, Met, Trp, Glu, Asn, Gln, Ala or Pro;
Xaa at position 45 is Gln, Pro, Phe, Val, Met, Leu, Thr, Lys, Trp, Asp, Asn, Arg, Ser, Ala, Ile, Glu or His;
Xaa at position 46 is Asp, Phe, Ser, Thr, Cys, Glu, Asn, Gln, Lys, His, Ala, Tyr, Ile, Val or Gly;
Xaa at position 47 is Ile, Gly, Val, Ser, Arg, Pro, or His;
Xaa at position 48 is Leu, Ser, Cys, Arg, Ile, His, Phe, Glu, Lys, Thr, Ala, Met, Val or Asn;
Xaa at position 49 is Met, Arg, Ala, Gly, Pro, Asn, His, or Asp;
Xaa at position 50 is Glu, Leu, Thr, Asp, Tyr, Lys, Asn, Ser, Ala, Ile, Val, His, Phe, Met or Gln;
Xaa at position 51 is Asn, Arg, Met, Pro, Serf Thr, or His;
Xaa at position 52 is Asn, His, Arg, Leu, Gly, Ser, or Thr;
Xaa at position 53 is Leu, Thr, Ala, Gly, Glu, Pro, Lys, Ser, or Met;
Xaa at position 54 is Arg, Asp, Ile, Ser, Val, Thr, Gln, Asn, Lys, His, Ala or Leu;
Xaa at position 55 is Arg, Thr, Val, Ser, Leu, or Gly;
Xaa at position 56 is Pro, Gly, Cys, Ser, Gln, Glu, Arg, His, Thr, Ala, Tyr, Phe, Leu, Val or Lys;
Xaa at position 57 is Asn or Gly;
Xaa at position 58 is Leu, Ser, Asp, Arg, Gln, Val, or Cys;
Xaa at position 59 is Glu Tyr, His, Leu, Pro, or Arg;
Xaa at position 60 is Ala, Ser, Pro, Tyr, Asn, or Thr;
Xaa at position 61 is Phe, Asn, Glu, Pro, Lys, Arg, or Ser;
Xaa at position 62 is Asn His, Val, Arg, Pro, Thr, Asp, or Ile;
Xaa at position 63 is Arg, Tyr, Trp, Lys, Ser, His, Pro, or Val;
Xaa at position 64 is Ala, Asn, Pro, Ser, or Lys;
Xaa at position 65 is Val, Thr, Pro, His, Leu, Phe, or Ser;
Xaa at position 66 is Lys, Ile, Arg, Val, Asn, Glu, or Ser;
Xaa at position 67 is Ser, Ala, Phe, Val, Gly, Asn, Ile, Pro, or His;
Xaa at position 68 is Leu, Val, Trp, Ser, Ile, Phe, Thr, or His;
Xaa at position 69 is Gln, Ala, Pro, Thr, Glu, Arg, Trp, Gly, or Leu;
Xaa at position 70 is Asn, Leu, Val, Trp, Pro, or Ala;
Xaa at position 71 is Ala, Met, Leu, Pro, Arg, Glu, Thr, Gln, Trp, or Asn;
Xaa at position 72 is Ser, Glu, Met, Ala, His, Asn, Arg, or Asp;
Xaa at position 73 is Ala, Glu, Asp, Leu, Ser, Gly, Thr, or Arg;
Xaa at position 74 is Ile, Met, Thr, Pro, Arg, Gly, Ala;
Xaa at position 75 is Glu, Lys, Gly, Asp, Pro, Trp, Arg, Ser, Gln, or Leu;
Xaa at position 76 is Serf Val, Ala, Asn, Trp, Glu, Pro, Gly, or Asp;
Xaa at position 77 is Ile, Ser, Arg, Thr, or Leu;
Xaa at position 78 is Leu, Ala, Ser, Glu, Phe, Gly, or Arg;
Xaa at position 79 is Lys, Thr, Asn, Met, Arg, Ile, Gly, or Asp;
Xaa at position 80 is Asn, Trp, Val, Gly, Thr, Leu, Glu, or Arg;
Xaa at position 81 is Leu, Gln, Gly, Ala, Trp, Arg, Val, or Lys;
Xaa at position 82 is Leu, Gln, Lys, Trp, Arg, Asp, Glu, Asn, His, Thr, Ser, Ala, Tyr, Phe, Ile, Met or Val;
Xaa at position 83 is Pro, Ala, Thr, Trp, Arg, or Met;
Xaa at position 84 is Cys, Glu, Gly, Arg, Met, or Val;
Xaa at position 85 is Leu, Asn, Val, or Gln;
Xaa at position 86 is Pro, Cys, Arg, Ala, or Lys;
Xaa at position 87 is Leu, Ser, Trp, or Gly;
Xaa at position 88 is Ala, Lys, Arg, Val, or Trp;
Xaa at position 89 is Thr, Asp, Cys, Leu, Val, Glu, His, Asn, or Ser;
Xaa at position 90 is Ala, Pro, Ser, Thr, Gly, Asp, Ile, or Met;
Xaa at position 91 is Ala, Pro, Ser, Thr, Phe, Leu, Asp, or His;
Xaa at position 92 is Pro, Phe, Arg, Ser, Lys, His, Ala, Gly, Ile or Leu;
Xaa at position 93 is Thr, Asp, Ser, Asn, Pro, Ala, Leu, or Arg;
Xaa at position 94 is Arg, Ile, Ser, Glu, Leu, Val, Gln, Lys, His, Ala, or Pro;
Xaa at position 95 is His, Gln, Pro, Arg, Val, Leu, Gly, Thr, Asn, Lys, Ser, Ala, Trp, Phe, Ile, or Tyr;
Xaa at position 96 is Pro, Lys, Tyr, Gly, Ile, or Thr;
Xaa at position 97 is Ile, Val, Lys, Ala, or Asn;
Xaa at position 98 is His, Ile, Asn, Leu, Asp, Ala, Thr, Glu, Gln, Ser, Phe, Met, Val, Lys, Arg, Tyr or Pro;
Xaa at position 99 is Ile, Leu, Arg, Asp, Val, Pro, Gln, Gly, Ser, Phe, or His;
Xaa at position 100 is Lys, Tyr, Leu, His, Arg, Ile, Ser, Gln, or Pro;
Xaa at position 101 is Asp, Pro, Met, Lys, His, Thr, Val, Tyr, Glu, Asn, Ser, Ala, Gly, Ile, Leu, or Gln;
Xaa at position 102 is Gly, Leu, Glu, Lys, Ser, Tyr, or Pro;
Xaa at position 103 is Asp, or Ser;
Xaa at position 104 is Trp, Val, Cys, Tyr, Thr, Met, Pro, Leu, Gln, Lys, Ala, Phe, or Gly;
Xaa at position 105 is Asn, Pro, Ala, Phe, Ser, Trp, Gln, Tyr, Leu, Lys, Ile, Asp, or His;
Xaa at position 106 is Glu, Ser, Ala, Lys, Thr, Ile, Gly, or Pro;
Xaa at position 108 is Arg, Lys, Asp, Leu, Thr, Ile, Gln, His, Ser, Ala or Pro;
Xaa at position 109 is Arg, Thr, Pro, Glu, Tyr, Leu, Ser, or Gly;
Xaa at position 110 is Lys, Ala, Asn, Thr, Leu, Arg, Gln, His, Glu, Ser, or Trp;
Xaa at position 111 is Leu, Ile, Arg, Asp, or Met;
Xaa at position 112 is Thr, Val, Gln, Tyr, Glu, His, Ser, or Phe;
Xaa at position 113 is Phe, Ser, Cys, His, Gly, Trp, Tyr, Asp, Lys, Leu, Ile, Val or Asn;
Xaa at position 114 is Tyr, Cys, His, Ser, Trp, Arg, or Leu;
Xaa at position 115 is Leu, Asn, Val, Pro, Arg, Ala, His, Thr, Trp, or Met;
Xaa at position 116 is Lys, Leu, Pro, Thr, Met, Asp, Val, Glu, Arg, Trp, Ser, Asn, His, Ala, Tyr, Phe, Gln, or Ile;
Xaa at position 117 is Thr, Ser, Asn, Ile, Trp, Lys, or Pro;
Xaa at position 118 is Leu, Ser, Pro, Ala, Glu, Cys, Asp, or Tyr;
Xaa at position 119 is Glu, Ser, Lys, Pro, Leu, Thr, Tyr, or Arg;
Xaa at position 120 is Asn, Ala, Pro, Leu, His, Val, or Gln;
Xaa at position 121 is Ala, Ser, Ile, Asn, Pro, Lys, Asp, or Gly;
Xaa at position 122 is Gln, Ser, Met, Trp, Arg, Phe, Pro, His, Ile, Tyr, or Cys;
Xaa at position 123 is Ala, Met, Glu, His, Ser, Pro, Tyr, or Leu;
and which can additionally have Met- preceding the amino acid in position 1; and wherein from 1 to 14 amino acids can be deleted from the N-terminus and/or from 1 to 15 amino acids can be deleted from the C-terminus; and wherein from 4 to 44 of the amino acids designated by Xaa are different from the corresponding amino acids of native (1-133) human interleukin-3.
Included in the present invention are human interleukin-3 mutant polypeptide of the Formula II:Ala Pro Met Thr Gln Thr Thr Ser Leu Lys Thr Ser Trp Val Asn [SEQ ID NO:16] 1 5 10 15Cys Xaa Xaa Xaa Xaa Xaa Glu Xaa Xaa Xaa Xaa Leu Xaa Xaa Xaa 20 25 30Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Leu Xaa Xaa Glu Xaa Xaa 35 40 45Xaa Xaa Leu Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Leu Xaa Xaa 50 55 60Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 65 70 75Xaa Xaa Leu Xaa Xaa Xaa Xaa Xaa Cys Xaa Pro Xaa Xaa Xaa Xaa 80 85 90Xaa Xaa Xaa Arg Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Asp Xaa Xaa 95 100 105Xaa Phe Xaa Xaa Lys Leu Xaa Phe Xaa Xaa Xaa Xaa Leu Xaa Xaa 110 115 120Xaa Xaa Xaa Gln Gln Thr Thr Leu Ser Leu Ala Ile Phe 125 130
wherein
Xaa at position 17 is Ser, Gly, Asp, Met, or Gln;
Xaa at position 18 is Asn, His, Leu, Ile, Phe, Arg, or Gln;
Xaa at position 19 is Met, Phe, Ile, Arg, or Ala;
Xaa at position 20 is Ile or Pro;
Xaa at position 21 is Asp or Glu;
Xaa at position 23 is Ile, Val, Ala, Leu, or Gly;
Xaa at position 24 is Ile, Val, Phe, or Leu;
Xaa at position 25 is Thr, His, Gly, Gln, Arg, Pro, or Ala;
Xaa at position 26 is His, Phe, Gly, Arg, or Ala;
Xaa at position 28 is Lys, Leu, Gln, Gly, Pro, or Val;
Xaa at position 29 is Gln, Asn, Leu, Arg, or Val;
Xaa at position 30 is Pro, His, Thr, Gly, or Gln;
Xaa at position 31 is Pro, Asp, Gly, Ala, Arg, Leu, or Gln;
Xaa at position 32 is Leu, Arg, Gln, Asn, Gly, Ala, or Glu;
Xaa at position 33 is Pro, Leu, Gln, Ala, or Glu;
Xaa at position 34 is Leu, Val, Gly, Ser, Lys, Ala, Arg, Gln, Glu, Ile, Phe, Thr or Met;
Xaa at position 35 is Leu, Ala, Asn, Pro, Gln, or Val;
Xaa at position 36 is Asp or Leu;
Xaa at position 37 is Phe, Ser, Pro, Trp, or Ile;
Xaa at position 38 is Asn or Ala;
Xaa at position 41 is Asn, Cys, Arg, His, Met, or Pro;
Xaa at position 42 is Gly, Asp, Ser, Cys, Ala, Asn, Ile, Leu, Met, Tyr, Val or Arg;
Xaa at position 44 is Asp or Glu;
Xaa at position 45 is Gln, Val, Met, Leu, Thr, Lys, Ala, Asn, Glu, Ser, or Trp;
Xaa at position 46 is Asp, Phe, Ser, Thr, Cys, Ala, Asn, Gln, Glu, His, Ile, Lys, Tyr, Val or Gly;
Xaa at position 47 is Ile, Val, or His;
Xaa at position 49 is Met, Asn, or Asp;
Xaa at position 50 is Glu, Thr, Ala, Asn, Ser or Asp;
Xaa at position 51 is Asn, Arg, Met, Pro, Ser, Thr, or His;
Xaa at position 52 is Asn or Gly;
Xaa at position 53 is Leu, Met, or Phe;
Xaa at position 54 is Arg, Ala, or Ser;
Xaa at position 55 is Arg, Thr, Val, Leu, or Gly;
Xaa at position 56 is Pro, Gly, Cys, Ser, Gln, Ala, Arg, Asn, Glu, His, Leu, Thr, Val or Lys;
Xaa at position 59 is Glu, Tyr, His, Leu, or Arg;
Xaa at position 60 is Ala, Ser, Asn, or Thr;
Xaa at position 61 is Phe or Ser;
Xaa at position 62 is Asn, Val, Pro, Thr, or Ile;
Xaa at position 63 is Arg, Tyr, Lys, Ser, His, or Val;
Xaa at position 64 is Ala or Asn;
Xaa at position 65 is Val, Thr, Leu, or Ser;
Xaa at position 66 is Lys, Ile, Arg, Val, Asn, Glu, or Ser;
Xaa at position 67 is Ser, Phe, Val, Gly, Asn, Ile, or His;
Xaa at position 68 is Leu, Val, Ile, Phe, or His;
Xaa at position 69 is Gln, Ala, Pro, Thr, Glu, Arg, or Gly;
Xaa at position 70 is Asn or Pro;
Xaa at position 71 is Ala, Met, Pro, Arg, Glu, Thr, or Gln;
Xaa at position 72 is Ser, Glu, Met, Ala, His, Asn, Arg, or Asp;
Xaa at position 73 is Ala, Glu, Asp, Leu, Ser, Gly, Thr, Arg, or Pro;
Xaa at position 74 is Ile or Met;
Xaa at position 75 is Glu, Gly, Asp, Ser, or Gln;
Xaa at position 76 is Ser, Val, Ala, Asn, Glu, Pro, Gly, or Asp;
Xaa at position 77 is Ile, Ser, or Leu;
Xaa at position 79 is Lys, Thr, Gly, Asn, Met, Arg, Ile, Gly, or Asp;
Xaa at position 80 is Asn, Val, Gly, Thr, Leu, Glu, or Arg;
Xaa at position 81 is Leu, or Val;
Xaa at position 82 is Leu, Gln, Trp, Arg, Asp, Ala, Asn, Glu, His, Met, Phe, Ser, Thr, Tyr or Val;
Xaa at position 83 is Pro, Ala, Thr, Trp, or Met;
Xaa at position 85 is Leu or Val;
Xaa at position 87 is Leu or Ser;
Xaa at position 88 is Ala, Arg, or Trp;
Xaa at position 89 is Thr, Asp, Glu, His, Asn, or Ser;
Xaa at position 90 is Ala, Asp, or Met;
Xaa at position 91 is Ala, Pro, Ser, Thr, Phe, Leu, or Asp;
Xaa at position 92 is Pro or Ser;
Xaa at position 93 is Thr, Asp, Ser, Pro, Ala, Leu, or Arg;
Xaa at position 95 is His, Pro, Arg, Val, Leu, Gly, Asn, Ile, Phe, Ser or Thr;
Xaa at position 96 is Pro or Tyr;
Xaa at position 97 is Ile, Val, or Ala;
Xaa at position 98 is His, Ile, Asn, Leu, Asp, Ala, Thr, Leu, Arg, Gln, Glu, lys, Met, Ser, Tyr, Val or Pro;
Xaa at position 99 is Ile, Leu, Val, or Phe;
Xaa at position 100 is Lys, Leu, His, Arg, Ile, Gln, Pro, or Ser;
Xaa at position 101 is Asp, Pro, Met, Lys, His, Thr, Val, Asn, Ile, Leu or Tyr;
Xaa at position 102 is Gly, Glu, Lys, or Ser;
Xaa at position 104 is Trp, Val, Tyr, Met, or Leu;
Xaa at position 105 is Asn, Pro, Ala, Phe, Ser, Trp, Gln, Tyr, Leu, Lys, Ile, Asp, or His;
Xaa at position 106 is Glu, Ser, Ala, or Gly;
Xaa at position 108 is Arg, Ala, Gln, Ser or Lys;
Xaa at position 109 is Arg, Thr, Glu, Leu, Ser, or Gly;
Xaa at position 112 is Thr, Val, Gln, Glu, His, or Ser;
Xaa at position 114 is Tyr or Trp;
Xaa at position 115 is Leu or Ala;
Xaa at position 116 is Lys, Thr, Met, Val, Trp, Ser, Leu, Ala, Asn, Gln, His, Met, Phe, Tyr or Ile;
Xaa at position 117 is Thr, Ser, or Asn;
Xaa at position 119 is Glu, Ser, Pro, Leu, Thr, or Tyr;
Xaa at position 120 is Asn, Pro, Leu, His, Val, or Gln;
Xaa at position 121 is Ala, Serf Ile, Asn, Pro, Lys, Asp, or Gly;
Xaa at position 122 is Gln, Ser, Met, Trp, Arg, Phe, Pro, His, Ile, Tyr, or Cys;
Xaa at position 123 is Ala, Met, Glu, His, Ser, Pro, Tyr, or Leu;
and which can additionally have Met- preceding the amino acid in position 1; and wherein from 1 to 14 amino acids can be deleted from the N-terminus and/or from 1 to 15 amino acids can be deleted from the C-terminus; and wherein from 4 to 44 of the amino acids designated by Xaa are different from the corresponding amino acids of native (1-133) human interleukin-3.
Included in the present invention are human interleukin-3 mutant polypeptide of the Formula III:Ala Pro Met Thr Gln Thr Thr Ser Leu Lys Thr Ser Trp Val Asn [SEQ ID NO:17] 1 5 10 15Cys Xaa Xaa Xaa Ile Xaa Glu Xaa Xaa Xaa Xaa Leu Lys Xaa Xaa 20 25 30Xaa Xaa Xaa Xaa Xaa Asp Xaa Xaa Asn Leu Asn Xaa Glu Xaa Xaa 35 40 45Xaa Ile Leu Met Xaa Xaa Asn Leu Xaa Xaa Xaa Asn Leu Glu Xaa 50 55 60Phe Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Asn Xaa Xaa Xaa Ile Glu 65 70 75Xaa Xaa Leu Xaa Xaa Leu Xaa Xaa Cys Xaa Pro Xaa Xaa Thr Ala 80 85 90Xaa Pro Xaa Arg Xaa Xaa Xaa Xaa Xaa Xaa Xaa Gly Asp Xaa Xaa 95 100 105Xaa Phe Xaa Xaa Lys Leu Xaa Phe Xaa Xaa Xaa Xaa Leu Glu Xaa 110 115 120Xaa Xaa Xaa Gln Gln Thr Thr Leu Ser Leu Ala Ile Phe 125 130
wherein
Xaa at position 17 is Ser, Gly, Asp, Met, or Gln;
Xaa at position 18 is Asn, His, or Ile;
Xaa at position 19 is Met or Ile;
Xaa at position 21 is Asp or Glu;
Xaa at position 23 is Ile, Ala, Leu, or Gly;
Xaa at position 24 is Ile, Val, or Leu;
Xaa at position 25 is Thr, His, Gln, or Ala;
Xaa at position 26 is His or Ala;
Xaa at position 29 is Gln, Asn, or Val;
Xaa at position 30 is Pro, Gly, or Gln;
Xaa at position 31 is Pro, Asp, Gly, or Gln;
Xaa at position 32 is Leu, Arg, Gln, Asn, Gly, Ala, or Glu;
Xaa at position 33 is Pro or Glu;
Xaa at position 34 is Leu, Val, Gly, Ser, Lys, Ala, Arg, Gln, Glu, Ile, Phe, Thr or Met;
Xaa at position 35 is Leu, Ala, Asn, Pro, Gln, or Val;
Xaa at position 37 is Phe, Ser, Pro, or Trp;
Xaa at position 38 is Asn or Ala;
Xaa at position 42 is Gly, Asp, Ser, Cys, Ala, Asn, Ile, Leu, Met, Tyr or Arg;
Xaa at position 44 is Asp or Glu;
Xaa at position 45 is Gln, Val, Met, Leu, Thr, Ala, Asn, Glu, Ser or Lys;
Xaa at position 46 is Asp, Phe, Ser, Thr, Ala, Asn Gln, Glu, His, Ile, Lys, Tyr, Val or Cys;
Xaa at position 50 is Glu, Ala, Asn, Ser or Asp;
Xaa at position 51 is Asn, Arg, Met, Pro, Ser, Thr, or His;
Xaa at position 54 is Arg or Ala;
Xaa at position 54 is Arg or Ala;
Xaa at position 55 is Arg, Thr, Val, Leu, or Gly;
Xaa at position 56 is Pro, Gly, Ser, Gln, Ala, Arg, Asn, Glu, Leu, Thr, Val or Lys;
Xaa at position 60 is Ala or Ser;
Xaa at position 62 is Asn, Pro, Thr, or Ile;
Xaa at position 63 is Arg or Lys;
Xaa at position 64 is Ala or Asn;
Xaa at position 65 is Val or Thr;
Xaa at position 66 is Lys or Arg;
Xaa at position 67 is Ser. Phe, or His;
Xaa at position 68 is Leu, Ile, Phe, or His;
Xaa at position 69 is Gln, Ala, Pro, Thr, Glu, Arg, or Gly;
Xaa at position 71 is Ala, Pro, or Arg;
Xaa at position 72 is Ser, Glu, Arg, or Asp;
Xaa at position 73 is Ala or Leu;
Xaa at position 76 is Ser, Val, Ala, Asn, Glu, Pro, or Gly;
Xaa at position 77 is Ile or Leu;
Xaa at position 79 is Lys, Thr, Gly, Asn, Met, Arg, Ile, Gly, or Asp;
Xaa at position 80 is Asn, Gly, Glu, or Arg;
Xaa at position 82 is Leu, Gln, Trp, Arg, Asp, Ala, Asn, Glu, His, Ile, Met, Phe, Ser, Thr, Tyr or Val;
Xaa at position 83 is Pro or Thr;
Xaa at position 85 is Leu or Val;
Xaa at position 87 is Leu or Ser;
Xaa at position 88 is Ala or Trp;
Xaa at position 91 is Ala or Pro;
Xaa at position 93 is Thr, Asp, Ser, Pro, Ala, Leu, or Arg;
Xaa at position 95 is His, Pro, Arg, Val, Leu, Gly, Asn, Phe, Ser or Thr;
Xaa at position 96 is Pro or Tyr;
Xaa at position 97 is Ile or Val;
Xaa at position 98 is His, Ile, Asn, Leu, Ala, Thr, Arg, Gln, Lys, Met, Ser, Tyr, Val or Pro;
Xaa at position 99 is Ile, Leu, or Val;
Xaa at position 100 is Lys, Arg, Ile, Gln, Pro, or Ser;
Xaa at position 101 is Asp, Pro, Met, Lys, His, Thr, Pro, Asn, Ile, Leu or Tyr;
Xaa at position 104 is Trp or Leu;
Xaa at position 105 is Asn, Pro, Ala, Ser, Trp, Gln, Tyr, Leu, Lys, Ile, Asp, or His;
Xaa at position 106 is Glu or Gly;
Xaa at position 108 is Arg, Ala, or Ser;
Xaa at position 109 is Arg, Thr, Glu, Leu, or Ser;
Xaa at position 112 is Thr, Val, or Gln;
Xaa at position 114 is Tyr or Trp;
Xaa at position 115 is Leu or Ala;
Xaa at position 116 is Lys, Thr, Val, Trp, Ser, Ala, His, Met, Phe, Tyr or Ile;
Xaa at position 117 is Thr or Ser;
Xaa at position 120 is Asn, Pro, Leu, His, Val, or Gln;
Xaa at position 121 is Ala, Ser, Ile, Asn, Pro, Asp, or Gly;
Xaa at position 122 is Gln, Ser, Met, Trp, Arg, Phe, Pro, His, Ile, Tyr, or Cys;
Xaa at position 123 is Ala, Met, Glu, His, Ser, Pro, Tyr, or Leu;
and which can additionally have Met- preceding the amino acid in position 1; and wherein from 1 to 14 amino acids can be deleted from the N-terminus and/or from 1 to 15 amino acids can be deleted from the C-terminus; and wherein from 4 to 35 of the amino acids designated by Xaa are different from the corresponding amino acids of native (1-133)human interleukin-3.
Included in the present invention arehuman interleukin-3 mutant polypeptide of the Formula IV:Ala Pro Met Thr Gln Thr Thr Ser Leu Lys Thr Ser Trp Val Asn [SEQ ID NO:18] 1 5 10 15Cys Xaa Xaa Met Ile Asp Glu Xaa Ile Xaa Xaa Leu Lys Xaa Xaa 20 25 30Pro Xaa Pro Xaa Xaa Asp Phe Xaa Asn Leu Asn Xaa Glu Asp Xaa 35 40 45Xaa Ile Leu Met Xaa Xaa Asn Leu Arg Xaa Xaa Asn Leu Glu Ala 50 55 60Phe Xaa Arg Xaa Xaa Lys Xaa Xaa Xaa Asn Ala Ser Ala Ile Glu 65 70 75Xaa Xaa Leu Xaa Xaa Leu Xaa Pro Cys Leu Pro Xaa Xaa Thr Ala 80 85 90Xaa Pro Xaa Arg Xaa Pro Ile Xaa Xaa Xaa Xaa Gly Asp Trp Xaa 95 100 105Glu Phe Xaa Xaa Lys Leu Xaa Phe Tyr Leu Xaa Xaa Leu Glu Xaa 110 115 120Xaa Xaa Xaa Gln Gln Thr Thr Leu Ser Leu Ala Ile Phe 125 130
wherein
Xaa at position 17 is Ser, Gly, Asp, or Gln;
Xaa at position 18 is Asn, His, or Ile;
Xaa at position 23 is Ile, Ala, Leu, or Gly;
Xaa at position 25 is Thr, His, or Gln;
Xaa at position 26 is His or Ala;
Xaa at position 29 is Gln or Asn;
Xaa at position 30 is Pro or Gly;
Xaa at position 32 is Leu, Arg, Asn, or Ala;
Xaa at position 34 is Leu, Val, Ser, Ala, Arg, Gln, Glu, Ile, Phe, Thr, or Met;
Xaa at position 35 is Leu, Ala, Asn, or Pro;
Xaa at position 38 is Asn or Ala;
Xaa at position 42 is Gly, Asp, Ser, Ala, Asn, Ile, Leu, Met, Tyr or Arg;
Xaa at position 45 is Gln, Val, Met, Leu, Ala, Asn, Glu, or Lys;
Xaa at position 46 is Asp, Phe, Ser, Gln, Glu, His, Val or Thr;
Xaa at position 50 is Glu Asn, Ser or Asp;
Xaa at position 51 is Asn, Arg, Pro, Thr, or His;
Xaa at position 55 is Arg, Leu, or Gly;
Xaa at position 56 is Pro, Gly, Ser, Ala, Asn, Val, Leu or Gln;
Xaa at position 62 is Asn, Pro, or Thr;
Xaa at position 64 is Ala or Asn;
Xaa at position 65 is Val or Thr;
Xaa at position 67 is Ser or Phe;
Xaa at position 68 is Leu or Phe;
Xaa at position 69 is Gln, Ala, Glu, or Arg;
Xaa at position 76 is Ser, Val, Asn, Pro, or Gly;
Xaa at position 77 is Ile or Leu;
Xaa at position 79 is Lys, Asn, Met, Arg, Ile, or Gly;
Xaa at position 80 is Asn, Gly, Glu, or Arg;
Xaa at position 82 is Leu, Gln, Trp, Arg, Asp, Asn, Glu, His, Met, Phe, Ser, Thr, Tyr or Val;
Xaa at position 87 is Leu or Ser;
Xaa at position 88 is Ala or Trp;
Xaa at position 91 is Ala or Pro;
Xaa at position 93 is Thr, Asp, or Ala;
Xaa at position 95 is His, Pro, Arg, Val, Gly, Asn, Ser or Thr;
Xaa at position 98 is His, Ile, Asn, Ala, Thr, Gln, Glu, Lys, Met, Ser, Tyr, Val or Leu;
Xaa at position 99 is Ile or Leu;
Xaa at position 100 is Lys or Arg;
Xaa at position 101 is Asp, Pro, Met, Lys, Thr, His, Pro, Asn, Ile, Leu or Tyr;
Xaa at position 105 is Asn, Pro, Ser, Ile or Asp;
Xaa at position 108 is Arg, Ala, or Ser;
Xaa at position 109 is Arg, Thr, Glu, Leu, or Ser;
Xaa at position 112 is Thr or Gln;
Xaa at position 116 is Lys, Val, Trp, Ala, His, Phe, Tyr or Ile;
Xaa at position 117 is Thr or Ser;
Xaa at position 120 is Asn, Pro, Leu, His, Val, or Gln;
Xaa at position 121 is Ala, Ser, Ile, Pro, or Asp;
Xaa at position 122 is Gln, Met, Trp, Phe, Pro, His, Ile, or Tyr;
Xaa at position 123 is Ala, Met, Glu, Ser, or Leu;
and which can additionally have Met- preceding the amino acid in position 1; and wherein from 1 to 14 amino acids can be deleted from the N-terminus and/or from 1 to 15 amino acids can be deleted from the C-terminus; and wherein from 4 to 44 of the amino acids designated by Xaa are different from the corresponding amino acids of native (1-133)human interleukin-3.
Included in the present invention are (15-125)human interleukin-3 mutant polypeptides of the Formula V:Asn Cys Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa [SEQ ID NO:19] 1 5 10 15Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Asn Xaa Xaa Xaa Xaa Xaa 20 25 30Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 35 40 45Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 50 55 60Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 65 70 75Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 80 85 90Xaa Xaa Phe Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 95 100 105Xaa Xaa Xaa Xaa Gln Gln 110
wherein
Xaa at position 3 is Ser. Lys, Gly, Asp, Met, Gln, or Arg;
Xaa at position 4 is Asn, His, Leu, Ile, Phe, Arg, or Gln;
Xaa at position 5 is Met, Phe, Ile, Arg, Gly, Ala, or Cys;
Xaa at position 6 is Ile, Cys, Gln, Glu, Arg, Pro, or Ala;
Xaa at position 7 is Asp, Phe, Lys, Arg, Ala, Gly, Glu, Gln, Asn, Thr, Ser or Val;
Xaa at position 8 is Glu, Trp, Pro, Ser, Ala, His, Asp, Asn, Gln, Leu, Val, or Gly;
Xaa at position 9 is Ile, Val, Ala, Leu, Gly, Trp, Lys, Phe, Leu, Ser, or Arg;
Xaa at position 10 is Ile, Gly, Val, Arg, Ser, Phe, or Leu;
Xaa at position 11 is Thr, His, Gly, Gln, Arg, Pro, or Ala;
Xaa at position 12 is His, Thr, Phe, Gly, Arg, Ala, or Trp;
Xaa at position 13 is Leu, Gly, Arg, Thr, Ser, or Ala;
Xaa at position 14 is Lys, Arg, Leu, Gln, Gly, Pro, Val or Trp;
Xaa at position 15 is Gln, Asn, Leu, Pro, Arg, or Val;
Xaa at position 16 is Pro, His, Thr, Gly, Asp, Gln, Ser, Leu, or Lys;
Xaa at position 17 is Pro, Asp, Gly, Ala, Arg, Leu, or Gln;
Xaa at position 18 is Leu, Val, Arg, Gln, Asn, Gly, Ala, or Glu;
Xaa at position 19 is Pro, Leu, Gln, Ala, Thr, or Glu;
Xaa at position 20 is Leu, Val, Gly, Ser, Lys, Glu, Gln, Thr, Arg, Ala, Phe, Ile or Met;
Xaa at position 21 is Leu, Ala, Gly, Asn, Pro, Gln, or Val;
Xaa at position 22 is Asp, Leu, or Val;
Xaa at position 23 is Phe, Ser, Pro, Trp, or Ile;
Xaa at position 24 is Asn, or Ala;
Xaa at position 26 is Leu, Trp, or Arg;
Xaa at position 27 is Asn, Cys, Arg, Leu, His, Met, Pro;
Xaa at position 28 is Gly, Asp, Ser, Cys, Ala, Lys, Asn, Thr, Leu, Val, Glu, Phe, Tyr, Ile or Met;
Xaa at position 29 is Glu, Asn, Tyr, Leu, Phe, Asp, Ala, Cys, Gln, Arg, Thr, Gly or Ser;
Xaa at position 30 is Asp, Ser, Leu, Arg, Lys, Thr,Met, Trp, Glu, Asn, Gln, Ala or Pro;
Xaa at position 31 is Gln, Pro, Phe, Val, Met, Leu, Thr, Lys, Asp, Asn, Arg, Ser, Ala, Ile, Glu, His or Trp;
Xaa at position 32 is Asp, Phe, Ser, Thr, Cys, Glu, Asn, Gln, Lys, His, Ala, Tyr, Ile, Val or Gly;
Xaa at position 33 is Ile, Gly, Val, Ser, Arg, Pro, or His;
Xaa at position 34 is Leu, Ser, Cys, Arg, Ile, His, Phe, Glu, Lys, Thr, Ala, Met, Val or Asn;
Xaa at position 35 is Met, Arg, Ala, Gly, Pro, Asn, His, or Asp;
Xaa at position 36 is Glu, Leu, Thr, Asp, Tyr, Lys, Asn, Ser, Ala, Ile, Val, His, Phe, Met or Gln;
Xaa at position 37 is Asn, Arg, Met, Pro, Ser, Thr, or His;
Xaa at position 38 is Asn, His, Arg, Leu, Gly, Ser, or Thr;
Xaa at position 39 is Leu, Thr, Ala, Gly, Glu, Pro, Lys, Ser, Met, or;
Xaa at position 40 is Arg, Asp, Ile, Ser, Val, Thr, Gln, Asn, Lys, His, Ala or Leu;
Xaa at position 41 is Arg, Thr, Val, Ser, Leu, or Gly;
Xaa at position 42 is Pro, Gly, Cys, Ser, Gln, Glu, Arg, His, Thr, Ala, Tyr, Phe, Leu, Val or Lys;
Xaa at position 43 is Asn or Gly;
Xaa at position 44 is Leu, Ser, Asp, Arg, Gln, Val, or Cys;
Xaa at position 45 is Glu Tyr, His, Leu, Pro, or Arg;
Xaa at position 46 is Ala, Ser, Pro, Tyr, Asn, or Thr;
Xaa at position 47 is Phe, Asn, Glu, Pro, Lys, Arg, or Ser;
Xaa at position 48 is Asn, His, Val, Arg, Pro, Thr, Asp, or Ile;
Xaa at position 49 is Arg, Tyr, Trp, Lys, Ser, His, Pro, or Val;
Xaa at position 50 is Ala, Asn, Pro, Ser, or Lys;
Xaa at position 51 is Val, Thr, Pro, His, Leu, Phe, or Ser;
Xaa at position 52 is Lys, Ile, Arg, Val, Asn, Glu, or Ser;
Xaa at position 53 is Ser, Ala, Phe, Val, Gly, Asn, Ile, Pro, or His;
Xaa at position 54 is Leu, Val, Trp, Ser, Ile, Phe, Thr, or His;
Xaa at position 55 is Gln, Ala, Pro, Thr, Glu, Arg, Trp, Gly, or Leu;
Xaa at position 56 is Asn, Leu, Val, Trp, Pro, or Ala;
Xaa at position 57 is Ala, Met, Leu, Pro, Arg, Glu, Thr, Gln, Trp, or Asn;
Xaa at position 58 is Ser, Glu, Met, Ala, His, Asn, Arg, or Asp;
Xaa at position 59 is Ala, Glu, Asp, Leu, Ser, Gly, Thr, or Arg;
Xaa at position 60 is Ile, Met, Thr, Pro, Arg, Gly, Ala;
Xaa at position 61 is Glu, Lys, Gly, Asp, Pro, Trp, Arg, Ser, Gln, or Leu;
Xaa at position 62 is Ser, Val, Ala, Asn, Trp, Glu, Pro, Gly, or Asp;
Xaa at position 63 is Ile, Ser, Arg, Thr, or Leu;
Xaa at position 64 is Leu, Ala, Ser, Glu, Phe, Gly, or Arg;
Xaa at position 65 is Lys, Thr, Gly, Asn, Met, Arg, Ile, or Asp;
Xaa at position 66 is Asn, Trp, Val, Gly, Thr, Leu, Glu, or Arg;
Xaa at position 67 is Leu, Gln, Gly, Ala, Trp, Arg, Val, or Lys;
Xaa at position 68 is Leu, Gln, Lys, Trp, Arg, Asp, Glu, Asn, His, Thr, Ser, Ala, Tyr, Phe, Ile, Met or Val;
Xaa at position 69 is Pro, Ala, Thr, Trp, Arg, or Met;
Xaa at position 70 is Cys, Glu, Gly, Arg, Met, or Val;
Xaa at position 71 is Leu, Asn, Val, or Gln;
Xaa at position 72 is Pro, Cys, Arg, Ala, or Lys;
Xaa at position 73 is Leu, Ser, Trp, or Gly;
Xaa at position 74 is Ala, Lys, Arg, Val, or Trp;
Xaa at position 75 is Thr, Asp, Cys, Leu, Val, Glu, His, Asn, or Ser;
Xaa at position 76 is Ala, Pro, Ser, Thr, Gly, Asp, Ile, or Met;
Xaa at position 77 is Ala, Pro, Ser, Thr, Phe, Leu, Asp, or His;
Xaa at position 78 is Pro, Phe, Arg, Ser, Lys, His, Ala, Gly, Ile or Leu;
Xaa at position 79 is Thr, Asp, Ser, Asn, Pro, Ala, Leu, or Arg;
Xaa at position 80 is Arg, Ile, Ser, Glu, Leu, Val, Gln, Lys, His, Ala or Pro;
Xaa at position 81 is His, Gln, Pro, Arg, Val, Leu, Gly, Thr, Asn, Lys, Ser, Ala, Trp, Phe, Ile or Tyr;
Xaa at position 82 is Pro, Lys, Tyr, Gly, Ile, or Thr;
Xaa at position 83 is Ile, Val, Lys, Ala, or Asn;
Xaa at position 84 is His, Ile, Asn, Leu, Asp, Ala, Thr, Glu, Gln, Ser, Phe, Met, Val, Lys, Arg, Tyr or Pro;
Xaa at position 85 is Ile, Leu, Arg, Asp, Val, Pro, Gln, Gly, Ser, Phe, or His;
Xaa at position 86 is Lys, Tyr, Leu, His, Arg, Ile, Ser, Gln, Pro;
Xaa at position 87.is Asp, Pro, Met, Lys, His, Thr, Val, Tyr, Glu, Asn, Ser, Ala, Gly, Ile, Leu or Gln;
Xaa at position 88 is Gly, Leu, Glu, Lys, Ser, Tyr, or Pro;
Xaa at position 89 is Asp, or Ser;
Xaa at position 90 is Trp, Val, Cys, Tyr, Thr, Met, Pro, Leu, Gln, Lys, Ala, Phe, or Gly;
Xaa at position 91 is Asn, Pro, Ala, Phe, Ser, Trp, Gln, Tyr, Leu, Lys, Ile, Asp, or His;
Xaa at position 92 is Glu, Ser, Ala, Lys, Thr, Ile, Gly, or Pro;
Xaa at position 94 is Arg, Lys, Asp, Leu, Thr, Ile, Gln, His, Ser, Ala, or Pro;
Xaa at position 95 is Arg, Thr, Pro, Glu, Tyr, Leu, Ser, or Gly;
Xaa at position 96 is Lys, Asn, Thr, Leu, Gln, Arg, His, Glu, Ser, Ala or Trp;
Xaa at position 97 is Leu, Ile, Arg, Asp, or Met;
Xaa at position 98 is Thr, Val, Gln, Tyr, Glu, His, Ser, or Phe;
Xaa at position 99 is Phe, Ser, Cys, His, Gly, Trp, Tyr, Asp, Lys, Leu, Ile, Val or Asn;
Xaa at position 100 is Tyr, Cys, His, Ser, Trp, Arg, or Leu;
Xaa at position 101 is Leu, Asn, Val, Pro, Arg, Ala, His, Thr, Trp, or Met;
Xaa at position 102 is Lys, Leu, Pro, Thr, Met, Asp, Val, Glu, Arg, Trp, Ser, Asn, His, Ala, Tyr, Phe, Gln, or Ile;
Xaa at position 103 is Thr, Ser, Asn, Ile, Trp, Lys, or Pro;
Xaa at position 104 is Leu, Ser, Pro, Ala, Glu, Cys, Asp, or Tyr;
Xaa at position 105 is Glu, Ser, Lys, Pro, Leu, Thr, Tyr, or Arg;
Xaa at position 106 is Asn, Ala, Pro, Leu, His, Val, or Gln;
Xaa at position 107 is Ala, Ser, Ile, Asn, Pro, Lys, Asp, or Gly;
Xaa at position 108 is Gln, Ser, Met, Trp, Arg, Phe, Pro, His, Ile, Tyr, or Cys;
Xaa at position 109 is Ala, Met, Glu, His, Ser, Pro, Tyr, or Leu;
and which can additionally have Met- or Met-Ala- preceding the amino acid in position 1; and wherein from 4 to 44 of the amino acids designated by Xaa are different from the corresponding native amino acids of (1-133) human interleukin-3; or a polypeptide having substantially the same structure and substantially the same biological activity.
Included in the present invention are (15-125)human interleukin-3 mutant polypeptides of the Formula VI:Asn Cys Xaa Xaa Xaa Xaa Xaa Glu Xaa Xaa Xaa Xaa Leu Xaa Xaa [SEQ ID NO:20] 1 5 10 15Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Asn Leu Xaa Xaa Glu Xaa 20 25 30Xaa Xaa Xaa Leu Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Asn Leu Xaa 35 40 45Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 50 55 60Xaa Xaa Xaa Leu Xaa Xaa Xaa Xaa Xaa Cys Xaa Pro Xaa Xaa Xaa 65 70 75Xaa Xaa Xaa Xaa Arg Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Asp Xaa 80 85 90Xaa Xaa Phe Xaa Xaa Lys Leu Xaa Phe Xaa Xaa Xaa Xaa Leu Xaa 95 100 105Xaa Xaa Xaa Xaa Gln Gln 110
wherein
Xaa at position 3 is Ser, Gly, Asp, Met, or Gln;
Xaa at position 4 is Asn, His, Leu, Ile, Phe, Arg, or Gln;
Xaa at position 5 is Met, Phe, Ile, Arg, or Ala;
Xaa at position 6 is lie or Pro;
Xaa at position 7 is Asp, or Glu;
Xaa at position 9 is Ile, Val, Ala, Leu, or Gly;
Xaa at position 10 is Ile, Val, Phe, or Leu;
Xaa at position 11 is Thr, His, Gly, Gln, Arg, Pro, or Ala;
Xaa at position 12 is His, Phe, Gly, Arg, or Ala;
Xaa at position 14 is Lys, Leu, Gln, Gly, Pro, or Val;
Xaa at position 15 is Gln, Asn, Leu, Arg, or Val;
Xaa at position 16 is Pro, His, Thr, Gly, or Gln:
Xaa at position 17 is Pro, Asp, Gly, Ala, Arg, Leu, or Gln;
Xaa at position 18 is Leu, Arg, Gln, Asn, Gly, Ala, or Glu;
Xaa at position 19 is Pro, Leu, Gln, Ala, or Glu;
Xaa at position 20 is Leu, Val, Gly, Ser, Lys, Ala, Arg, Gln, Glu, Ile, Phe, Thr or Met;
Xaa at position 21 is Leu, Ala, Asn, Pro, Gln, or Val;
Xaa at position 22 is Asp or Leu;
Xaa at position 23 is Phe, Ser, Pro, Trp, or Ile;
Xaa at position 24 is Asn or Ala;
Xaa at position 27 is Asn, Cys, Arg, His, Met, or Pro;
Xaa at position 28 is Gly, Asp, Ser, Cys, Ala, Asn, Ile, Leu, Met, Tyr, or Arg;
Xaa at position 30 is Asp, or Glu;
Xaa at position 31 is Gln, Val, Met, Leu, Thr, Lys, Ala, Asn Glu, Ser or Trp;
Xaa at position 32 is Asp, Phe, Ser, Thr, Cys, Ala, Asn, Gln, Glu, His, Ile, Lys, Tyr, Val or Gly;
Xaa at position 33 is Ile, Val, or His;
Xaa at position 35 is Met, Asn, or Asp;
Xaa at position 36 is Glu, Thr, Ala, Asn, Ser or Asp;
Xaa at position 37 is Asn, Arg, Met, Pro, Ser, Thr, or His;
Xaa at position 38 is Asn or Gly;
Xaa at position 39 is Leu, Met, or Phe;
Xaa at position 40 is Arg, Ala or Ser;
Xaa at position 41 is Arg, Thr, Val, Leu, or Gly;
Xaa at position 42 is Pro, Gly, Cys, Ser, Gln, Ala, Arg, Asn, Glu, His, Leu, Thr, Val or Lys;
Xaa at position 45 is Glu, Tyr, His, Leu, or Arg;
Xaa at position 46 is Ala, Ser, Asn, or Thr;
Xaa at position 47 is Phe or Ser;
Xaa at position 48.is Asn, Val, Pro, Thr, or Ile;
Xaa at position 49 is Arg, Tyr, Lys, Ser, His, or Val;
Xaa at position 50 is Ala or Asn;
Xaa at position 51 is Val, Thr, Leu, or Ser;
Xaa at position 52 is Lys, Ile, Arg, Val, Asn, Glu, or Ser;
Xaa at position 53 is Ser, Phe, Val, Gly, Asn, Ile, or His;
Xaa at position 54 is Leu, Val, Ile, Phe, or His;
Xaa at position 55 is Gln, Ala, Pro, Thr, Glu, Arg, or Gly;
Xaa at position 56 is Asn or Pro;
Xaa at position 57 is Ala, Met, Pro, Arg, Glu, Thr, or Gln;
Xaa at position 58 is Ser, Glu, Met, Ala, His, Asn, Arg, or Asp;
Xaa at position 59 is Ala, Glu, Asp, Leu, Ser, Gly, Thr, Arg, or Pro;
Xaa at position 60 is Ile or Met;
Xaa at position 61 is Glu, Gly, Asp, Ser, or Gln;
Xaa at position 62 is Ser, Val, Ala, Asn, Glu, Pro, Gly, or Asp;
Xaa at position 63 is Ile, Ser, or Leu;
Xaa at position 65 is Lys, Thr, Gly, Asn, Met, Arg, Ile, or Asp;
Xaa at position 66 is Asn, Val, Gly, Thr, Leu, Glu, or Arg;
Xaa at position 67 is Leu, or Val;
Xaa at position 68 is Leu, Gln, Trp, Arg, Asp, Ala, Asn, Glu, His, Met, Phe, Ser, Thr, Tyr or Val;
Xaa at position 69 is Pro, Ala, Thr, Trp, or Met;
Xaa at position 71 is Leu or Val;
Xaa at position 73 is Leu or Ser;
Xaa at position 74 is Ala, Arg, or Trp;
Xaa at position 75 is Thr, Asp, Glu, His, Asn, or Ser;
Xaa at position 76 is Ala, Asp, or Met;
Xaa at position 77 is Ala, Pro, Ser, Thr, Phe, Leu, or Asp;
Xaa at position 78 is Pro or Ser;
Xaa at position 79 is Thr, Asp, Ser, Pro, Ala, Leu, or Arg;
Xaa at position 81 is His, Pro, Arg, Val, Leu, Gly, Asn, Ile, Phe, Ser or Thr;
Xaa at position 82 is Pro or Tyr;
Xaa at position 83 is Ile, Val, or Ala;
Xaa at position 84 is His, Ile, Asn, Leu, Asp, Ala, Thr, Arg, Gln, Glu, Lys, Met, Ser, Tyr, Val or Pro;
Xaa at position 85 is Ile, Leu, Val, or Phe;
Xaa at position 86 is Lys, Leu, His, Arg, Ile, Gln, Pro or Ser;
Xaa at position 87 is Asp, Pro, Met, Lys, His, Thr, Val, Asn, Ile, Leu or Tyr;
Xaa at position 88 is Gly, Glu, Lys, or Ser;
Xaa at position 90 is Trp, Val, Tyr, Met, or Leu;
Xaa at position 91 is Asn, Pro, Ala, Phe, Ser, Trp, Gln, Tyr, Leu, Lys, Ile, Asp, or His;
Xaa at position 92 is Glu, Ser, Ala, or Gly;
Xaa at position 94 is Arg, Ala, Gln, Ser or Lys;
Xaa at position 95 is Arg, Thr, Glu, Leu, Ser, or Gly;
Xaa at position 98 is Thr, Val, Gln, Glu, His, or Ser;
Xaa at position 100 is Tyr or Trp;
Xaa at position 101 is Leu or Ala;
Xaa at position 102 is Lys, Thr, Met, Val, Trp, Ser, Leu, Ala, Asn, Gln, His, Met, Phe, Tyr or Ile;
Xaa at position 103 is Thr, Ser, or Asn;
Xaa at position 105 is Glu, Ser, Pro, Leu, Thr, or Tyr;
Xaa at position 106 is Asn, Pro, Leu, His, Val, or Gln;
Xaa at position 107 is Ala, Ser, Ile, Asn, Pro, Lys, Asp, or Gly;
Xaa at position 108 is Gln, Ser, Met, Trp, Arg, Phe, Pro, His, Ile, Tyr, or Cys;
Xaa at position 109 is Ala, Met, Glu, His, Ser, Pro, Tyr, or Leu;
and which can additionally have Met- or Met-Ala- preceding the amino acid in position 1; and wherein from 4 to 44 of the amino acids designated by Xaa are different from the corresponding amino acids of native (1-133) human interleukin-3; or a polypeptide having substantially the same structure and substantially the same biological activity.
Included in the present invention are (15-125)human interleukin-3 mutant polypeptides of the Formula VII:Asn Cys Xaa Xaa Xaa Ile Xaa Glu Xaa Xaa Xaa Xaa Leu Lys Xaa [SEQ ID NO:21] 1 5 10 15Xaa Xaa Xaa Xaa Xaa Xaa Asp Xaa Xaa Asn Leu Asn Xaa Glu Xaa 20 25 30Xaa Xaa Ile Leu Met Xaa Xaa Asn Leu Xaa Xaa Xaa Asn Leu Glu 35 40 45Xaa Phe Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Asn Xaa Xaa Xaa Ile 50 55 60Glu Xaa Xaa Leu Xaa Xaa Leu Xaa Xaa Cys Xaa Pro Xaa Xaa Thr 65 70 75Ala Xaa Pro Xaa Arg Xaa Xaa Xaa Xaa Xaa Xaa Xaa Gly Asp Xaa 80 85 90Xaa Xaa Phe Xaa Xaa Lys Leu Xaa Phe Xaa Xaa Xaa Xaa Leu Glu 95 100 105Xaa Xaa Xaa Xaa Gln Gln 110
wherein
Xaa at position 3 is Ser, Gly, Asp, Met, or Gln;
Xaa at position 4 is Asn, His, or Ile;
Xaa at position 5 is Met or Ile;
Xaa at position 7 is Asp or Glu;
Xaa at position 9 is Ile, Ala, Leu, or Gly;
Xaa at position 10 is Ile, Val, or Leu;
Xaa at position 11 is Thr, His, Gln, or Ala;
Xaa at position 12 is His or Ala;
Xaa at position 15 is Gln, Asn, or Val;
Xaa at position 16 is Pro, Gly, or Gln;
Xaa at position 17 is Pro, Asp, Gly, or Gln;
Xaa at position 18 is Leu, Arg, Gln, Asn, Gly, Ala, or Glu;
Xaa at position 19 is Pro or Glu;
Xaa at position 20 is Leu, Val, Gly, Ser, Lys, Ala, Arg, Gln, Glu, Ile, Phe, Thr or Met;
Xaa at position 21 is Leu, Ala, Asn, Pro, Gln, or Val;
Xaa at position 23 is Phe, Ser, Pro, or Trp;
Xaa at position 24 is Asn or Ala;
Xaa at position 28 is Gly, Asp, Ser, Cys, Ala, Asn, Ile, Leu, Met Tyr or Arg;
Xaa at position 30 is Asp or Glu;
Xaa at position 31 is Gln, Val, Met, Leu, Thr, Ala, Asn, Glu, Ser or Lys;
Xaa at position 32 is Asp, Phe, Ser, Thr, Ala, Asn, Gln, Glu, His, Ile, Lys, Tyr, Val or Cys;
Xaa at position 36 is Glu, Ala, Asn, Ser or Asp;
Xaa at position 37 is Asn, Arg, Met, Pro, Ser, Thr, or His;
Xaa at position 40 is Arg or Ala;
Xaa at position 41 is Arg, Thr, Val, Leu, or Gly;
Xaa at position 42 is Pro, Gly, Ser, Gln, Ala, Arg, Asn, Glu, Leu, Thr, Val or Lys;
Xaa at position 46 is Ala or Ser;
Xaa at position 48 is Asn, Pro, Thr, or Ile;
Xaa at position 49 is Arg or Lys;
Xaa at position 50 is Ala or Asn;
Xaa at position 51 is Val or Thr;
Xaa at position 52 is Lys or Arg;
Xaa at position 53 is Ser, Phe, or His;
Xaa at position 54 is Leu, Ile, Phe, or His;
Xaa at position 55 is Gln, Ala, Pro, Thr, Glu, Arg, or Gly;
Xaa at position 57 is Ala, Pro, or Arg;
Xaa at position 58 is Ser, Glu, Arg, or Asp;
Xaa at position 59 is Ala or Leu;
Xaa at position 62 is Ser, Val, Ala, Asn, Glu, Pro, or Gly;
Xaa at position 63 is Ile or Leu;
Xaa at position 65 is Lys, Thr, Gly, Asn, Met, Arg, Ile, Gly, or Asp;
Xaa at position 66 is Asn, Gly, Glu, or Arg;
Xaa at position 68 is Leu, Gln, Trp, Arg, Asp, Ala, Asn, Glu, His, Ile, Met, Phe, Ser, Thr, Tyr or Val;
Xaa at position 69 is Pro or Thr;
Xaa at position 71 is Leu or Val;
Xaa at position 73 is Leu or Ser;
Xaa at position 74 is Ala or Trp;
Xaa at position 77 is Ala or Pro;
Xaa at position 79 is Thr, Asp, Ser, Pro, Ala, Leu, or Arg;
Xaa at position 81 is His, Pro, Arg, Val, Leu, Gly, Asn, Phe, Ser or Thr;
Xaa at position 82 is Pro or Tyr;
Xaa at position 83 is Ile or Val;
Xaa at position 84 is His, Ile, Asn, Leu, Ala, Thr, Arg, Gln, Lys, Met, Ser, Tyr, Val or Pro;
Xaa at position 85 is Ile, Leu, or Val;
Xaa at position 86 is Lys, Arg, Ile, Gln, Pro, or Ser;
Xaa at position 87 is Asp, Pro, Met, Lys, His, Thr, Asn, Ile, Leu or Tyr;
Xaa at position 90 is Trp or Leu;
Xaa at position 91 is Asn, Pro, Ala, Ser, Trp, Gln, Tyr, Leu, Lys, Ile, Asp, or His;
Xaa at position 92 is Glu, or Gly;
Xaa at position 94 is Arg, Ala, or Ser;
Xaa at position 95 is Arg, Thr, Glu, Leu, or Ser;
Xaa at position 98 is Thr, Val, or Gln;
Xaa at position 100 is Tyr or Trp;
Xaa at position 101 is Leu or Ala;
Xaa at position 102 is Lys, Thr, Val, Trp, Ser, Ala, His, Met, Phe, Tyr or Ile;
Xaa at position 103 is Thr or Ser;
Xaa at position 106 is Asn, Pro, Leu, His, Val, or Gln;
Xaa at position 107 is Ala, Ser, Ile, Asn, Pro, Asp, or Gly;
Xaa at position 108 is Gln, Ser, Met, Trp, Arg, Phe, Pro, His, Ile, Tyr, or Cys;
Xaa at position 109 is Ala, Met, Glu, His, Ser. Pro, Tyr, or Leu;
which can additionally have Met- or Met-Ala- preceding the amino acid in position 1; and wherein from 4 to 35 of the amino acids designated by Xaa are different from the corresponding amino acids of native human interleukin-3.
Included in the present invention are (15-125)human interleukin-3 mutant polypeptides of the Formula VIII:
[SEQ ID NO:22]Asn Cys Xaa Xaa Met Ile Asp Glu Xaa Ile Xaa Xaa Leu Lys Xaa 1 5 10 15Xaa Pro Xaa Pro Xaa Xaa Asp Phe Xaa Asn Leu Asn Xaa Glu Asp 20 25 30Xaa Xaa Ile Leu Met Xaa Xaa Asn Leu Arg Xaa Xaa Asn Leu Glu 35 40 45Ala Phe Xaa Arg Xaa Xaa Lys Xaa Xaa Xaa Asn Ala Ser Ala Ile 50 55 60Glu Xaa Xaa Leu Xaa Xaa Leu Xaa Pro Cys Leu Pro Xaa Xaa Thr 65 70 75Ala Xaa Pro Xaa Arg Xaa Pro Ile Xaa Xaa Xaa Xaa Gly Asp Trp 80 85 90Xaa Glu Phe Xaa Xaa Lys Leu Xaa Phe Tyr Leu Xaa Xaa Leu Glu 95 100 105Xaa Xaa Xaa Xaa Gln Gln 110
wherein
Xaa at position 3 is Ser. Gly, Asp, or Gln;
Xaa at position 4 is Asn, His, or Ile;
Xaa at position 9 is Ile, Ala, Leu, or Gly;
Xaa at position 11 is Thr, His, or Gln;
Xaa at position 12 is His or Ala;
Xaa at position 15 is Gln or Asn;
Xaa at position 16 is Pro or Gly;
Xaa at position 18 is Leu, Arg, Asn, or Ala;
Xaa at position 20 is Leu, Val, Ser, Ala, Arg, Gln, Glu, Ile, Phe, Thr or Met;
Xaa at position 21 is Leu, Ala, Asn, or Pro;
Xaa at position 24 is Asn or Ala;
Xaa at position 28 is Gly, Asp, Ser, Ala, Asn, Ile, Leu, Met, Tyr or Arg;
Xaa at position 31 is Gln, Val, Met, Leu, Ala, Asn, Glu or Lys;
Xaa at position 32 is Asp, Phe, Ser, Ala, Gln, Glu, His, Val or Thr;
Xaa at position 36 is Glu, Asn, Ser or Asp;
Xaa at position 37 is Asn, Arg, Pro, Thr, or His;
Xaa at position 41 is Arg, Leu, or Gly;
Xaa at position 42 is Pro, Gly, Ser, Ala, Asn, Val, Leu or Gln;
Xaa at position 48 is Asn, Pro, or Thr;
Xaa at position 50 is Ala or Asn;
Xaa at position 51 is Val or Thr;
Xaa at position 53 is Ser or Phe;
Xaa at position 54 is Leu or Phe;
Xaa at position 55 is Gln, Ala, Glu, or Arg;
Xaa at position 62 is Ser, Val, Asn, Pro, or Gly;
Xaa at position 63 is Ile or Leu;
Xaa at position 65 is Lys, Asn, Met, Arg, Ile, or Gly;
Xaa at position 66 is Asn, Gly, Glu, or Arg;
Xaa at position 68 is Leu, Gln, Trp, Arg, Asp, Asn, Glu, His, Met, Phe, Ser, Thr, Tyr or Val;
Xaa at position 73 is Leu or Ser;
Xaa at position 74 is Ala or Trp;
Xaa at position 77 is Ala or Pro;
Xaa at position 79 is Thr, Asp, or Ala;
Xaa at position 81 is His, Pro, Arg, Val, Gly, Asn, Ser or Thr;
Xaa at position 84 is His, Ile, Asn, Ala, Thr, Arg, Gln, Glu, Lys, Met, Ser, Tyr, Val or Leu;
Xaa at position 85 is Ile or Leu;
Xaa at position 86 is Lys or Arg;
Xaa at position 87 is Asp, Pro, Met, Lys, His, Pro, Asn, Ile, Leu or Tyr;
Xaa at position 91 is Asn, Pro, Ser, Ile or Asp;
Xaa at position 94 is Arg, Ala, or Ser;
Xaa at position 95 is Arg, Thr, Glu, Leu, or Ser;
Xaa at position 98 is Thr or Gln;
Xaa at position 102 is Lys, Val, Trp, or Ile;
Xaa at position 103 is Thr, Ala, His, Phe, Tyr or Ser;
Xaa at position 106 is Asn, Pro, Leu, His, Val, or Gln;
Xaa at position 107 is Ala, Ser, Ile, Pro, or Asp;
Xaa at position 108 is Gln, Met, Trp, Phe, Pro, His, Ile, or Tyr;
Xaa at position 109 is Ala, Met, Glu, Ser, or Leu;
and which can additionally have Met- or Met-Ala- preceding the amino acid in position 1; and wherein from 4 to 26 of the amino acids designated by Xaa are different from the corresponding amino acids of native (1-133)human interleukin-3; or a polypeptide having substantially the same structure and substantially the same biological activity.
The present invention includes polypeptides of the formula
[SEQ ID NO:129] 1 5 10(Met).sub.m -Ala Pro Met Thr Gln Thr Thr Ser Leu Lys Thr 15 20Ser Trp Val Asn Cys Ser Xaa Xaa Xaa Asp Glu Xaa Ile25 30 35Xaa His Leu Lys Xaa Pro Pro Xaa Pro Xaa Leu Asp Xaa 40 45 50Xaa Asn Leu Asn Xaa Glu Asp Xaa Xaa Ile Leu Xaa Xaa 55 60Xaa Asn Leu Arg Xaa Xaa Asn Leu Xaa Xaa Phe Xaa Xaa 65 70 75Ala Xaa Lys Xaa Leu Xaa Asn Ala Ser Xaa Ile Glu Xaa 80 85Ile Leu Xaa Asn Leu Xaa Pro Cys Xaa Pro Xaa Xaa Thr90 95 100Ala Xaa Pro Xaa Arg Xaa Pro Ile Xaa Ile Xaa Xaa Gly 105 110 115Asp Trp Xaa Glu Phe Arg Xaa Lys Leu Xaa Phe Tyr Leu 120 125Xaa Xaa Leu Glu Xaa Ala Gln Xaa Gln Gln Thr Thr Leu 130Ser Leu Ala Ile Phe
wherein m is 0 or 1; Xaa at position 18 is Asn or Ile; Xaa at position 19 is Met, Ala or Ile; Xaa at position 20 is Ile, Pro or Leu; Xaa at position 23 is Ile, Ala or Leu; Xaa at position 25 is Thr or His; Xaa at position 29 is Gln, Arg, Val or Leu; Xaa at position 32 is Leu, Ala, Asn or Arg; Xaa at position 34 is Leu or Ser; Xaa at position 37 is Phe, Pro, or Ser; Xaa at position 38 is Asn or Ala; Xaa at position 42 is Gly, Ala, Ser, Asp or Asn; Xaa at position 45 is Gln, Val, or Met; Xaa at position 46 is Asp or Ser; Xaa at position 49 is Met, Ile, Leu or Asp; Xaa at position 50 is Glu or Asp; Xaa at position 51 is Asn Arg or Ser; Xaa at position 55 is Arg, Leu, or Thr; Xaa at position 56 is Pro or Ser; Xaa at position 59 is Glu or Leu; Xaa at position 60 is Ala or Ser; Xaa at position 62 is Asn, Val or Pro; Xaa at position 63 is Arg or His; Xaa at position 65 is Val or Ser; Xaa at position 67 is Ser, Asn, His or Gly; Xaa at position 69 is Gln or Glu; Xaa at position 73 is Ala or Gly; Xaa at position 76 is Ser, Ala or Pro; Xaa at position 79 is Lys, Arg or Ser; Xaa at position 82 is Leu, Glu, Val or Trp; Xaa at position 85 is Leu or Val; Xaa at position 87 is Leu, Ser, Trp; Xaa at position 88 is Ala or Trp; Xaa at position 91 is Ala or Pro; Xaa at position 93 is Pro or Ser; Xaa at position 95 is His or Thr; Xaa at position 98 is His, Ile, or Thr; Xaa at position 100 is Lys or Arg; Xaa at position 101 is Asp, Ala or Met; Xaa at position 105 is Asn or Gln; Xaa at position 109 is Arg, Glu or Leu; Xaa at position 112 is Thr or Gln; Xaa at position 116 is Lys, Val, Trp or Ser; Xaa at position 117 is Thr or Ser; Xaa at position 120 is Asn, Gln, or His; Xaa at position 123 is Ala or Glu; with the proviso that from four to twenty-six of the amino acids designated by Xaa are different from the corresponding amino acids of native human interleukin-3; or a polypeptide having substantially the same structure and substantially the same biological activity.
Preferred polypeptides of the present invention are those of the formula
[SEQ ID NO:130] 1 5 10(Met.sub.m -Ala.sub.n).sub.p -Asn Cys Ser Xaa Xaa Xaa Asp Glu Xaa Ile 15 20Xaa His Leu Lys Xaa Pro Pro Xaa Pro Xaa Leu Asp Xaa 25 30 35Xaa Asn Leu Asn Xaa Glu Asp Xaa Xaa Ile Leu Xaa Xaa 40 45Xaa Asn Leu Arg Xaa Xaa Asn Leu Xaa Xaa Phe Xaa Xaa50 55 60Ala Xaa Lys Xaa Leu Xaa Asn Ala Ser Xaa Ile Glu Xaa 65 70 75Ile Leu Xaa Asn Xaa Xaa Pro Cys Xaa Pro Xaa Xaa Thr 80 85Ala Xaa Pro Xaa Arg Xaa Pro Ile Xaa Ile Xaa Xaa Gly 90 95 100Asp Trp Xaa Glu Phe Arg Xaa Lys Leu Xaa Phe Tyr Leu 105 110Xaa Xaa Leu Glu Xaa Ala Gln Xaa Gln Gln
wherein m is 0 or 1; n is 0 or 1; p is 0 or 1; Xaa at position 4 is Asn or Ile; Xaa at position 5 is Met, Ala or Ile: Xaa at position 6 is Ile, Pro or Leu; Xaa at position 9 is Ile, Ala or Leu; Xaa at position 11 is Thr or His; Xaa at position 15 is Gln, Arg, Val or Leu; Xaa at position 18 is Leu, Ala, Asn or Arg; Xaa at position 20 is Leu or Ser;
Xaa at position 23 is Phe, Pro, or Ser; Xaa at position 24 is Asn or Ala; Xaa at position 28 is Gly, Ala, Ser, Asp or Asn; Xaa at position 31 is Gln, Val, or Met; Xaa at position 32 is Asp or Ser; Xaa at position 35 is Met, Ile, Leu or Asp; Xaa at position 36 is Glu or Asp; Xaa at position 37 is Asn, Arg or Ser; Xaa at position 41 is Arg, Leu, or Thr; Xaa at position 42 is Pro or Ser; Xaa at position 45 is Glu or Leu; Xaa at position 46 is Ala or Ser; Xaa at position 48 is Asn, Val or Pro; Xaa at position 49 is Arg or His; Xaa at position 51 is Val or Ser; Xaa at position 53 is Ser, Asn, His or Gly; Xaa at position 55 is Gln or Glu; Xaa at position 59 is Ala or Gly; Xaa at position 62 is Ser, Ala or Pro; Xaa at position 65 is Lys, Arg or Ser;
Xaa at position 67 is Leu, Glu, or Val; Xaa at position 68 is Leu, Glu, Val or Trp; Xaa at position 71 is Leu or Val;
Xaa at position 73 is Leu, Ser or Trp; Xaa at position 74 is Ala or Trp; Xaa at position 77 is Ala or Pro; Xaa at position 79 is Pro or Ser; Xaa at position 81 is His or Thr; Xaa at position 84 is His, Ile, or Thr; Xaa at position 86 is Lys or Arg; Xaa at position 87 is Asp, Ala or Met; Xaa at position 91 is Asn or Glu; Xaa at position 95 is Arg, Glu, Leu; Xaa at position 98 Thr or Gln; Xaa at position 102 is Lys, Val, Trp or Ser; Xaa at position 103 is Thr or Ser; Xaa at position 106 is Asn, Gln, or His; Xaa at position 109 is Ala or Glu; with the proviso that from four to twenty-six of the amino acids designated by Xaa are different from the corresponding amino acids of native (15-125)human interleukin-3; or a polypeptide having substantially the same structure and substantially the same biological activity.
"Mutant amino acid sequence," "mutant protein" or "mutant polypeptide" refers to a polypeptide having an amino acid sequence which varies from a native sequence or is encoded by a nucleotide sequence intentionally made variant from a native sequence. "Mutant protein," "variant protein" or "mutein" means a protein comprising a mutant amino acid sequence and includes polypeptides which differ from the amino acid sequence of native hIL-3 due to amino acid deletions, substitutions, or both. "Native sequence", refers to an amino acid or nucleic acid sequence which is identical to a wild-type or native form of a gene or protein.
Human IL-3 can be characterized by its ability to stimulate colony formation by human hematopoietic progenitor cells. The colonies formed include erythroid, granulocyte, megakaryocyte, granulocytic macrophages and mixtures thereof. Human IL-3 has demonstrated an ability to restore bone marrow function and peripheral blood cell populations to therapeutically beneficial levels in studies performed initially in primates and subsequently in humans (Gillio, A. P., et al. (1990); Ganser, A, et al. (1990); Falk, S., et al. (1991). Additional activities of hIL-3 include the ability to stimulate leukocyte migration and chemotaxis; the ability to prime human leukocytes to produce high levels of inflammatory mediators like leukotrienes and histamine; the ability to induce cell surface expression of molecules needed for leukocyte adhesion; and the ability to trigger dermal inflammatory responses and fever. Many or all of these biological activities of hIL-3 involve signal transduction and high affinity receptor binding. Mutant polypeptides of the present invention may exhibit useful properties such as having similar or greater biological activity when compared to native hIL-3 or by having improved half-life or decreased adverse side effects, or a combination of these properties. They may also be useful as antagonists. hIL-3 mutant polypeptides which have little or no activity when compared to native hIL-3 may still be useful as antagonists, as antigens for the production of antibodies for use in immunology or immunotherapy, as genetic probes or as intermediates used to construct other useful hIL-3 muteins. Since hIL-3 functions by binding to its receptor(s) and triggering second messages resulting in competent signal transduction, hIL-3 muteins of this invention may be useful in helping to determine which specific amino acid sequences are responsible for these activities.
The novel hIL-3 mutant polypeptides of the present invention will preferably have at least one biological property of human IL-3 or of an IL-3-like growth factor and may have more than one IL-3-like biological property, or an improved property, or a reduction in an undesirable biological property of human IL-3. Some mutant polypeptides of the present invention may also exhibit an improved side effect profile. For example, they may exhibit a decrease in leukotriene release or histamine release when compared to native hIL-3 or (15-125) hIL-3. Such hIL-3 or hIL-3-like biological properties may include one or more of the following biological characteristics and in vivo and in vitro activities.
One such property is the support of the growth and differentiation of progenitor cells committed to erythroid, lymphoid, and myeloid lineages. For example, in a standard human bone marrow assay, an IL-3-like biological property is the stimulation of granulocytic type colonies, megakaryocytic type colonies, monocyte/macrophage type colonies, and erythroid bursts. Other IL-3-like properties are the interaction with early multipotential stem cells, the sustaining of the growth of pluripotent precursor cells, the ability to stimulate chronic myelogenous leukemia (CML) cell proliferation, the stimulation of proliferation of mast cells, the ability to support the growth of various factor-dependent cell lines, and the ability to trigger immature bone marrow cell progenitors. Other biological properties of IL-3 have been disclosed in the art. Human IL-3 also has some biological activities which may in some cases be undesirable, for example the ability to stimulate leukotriene release and the ability to stimulate increased histamine synthesis in spleen and bone marrow cultures and in vivo.
Biological activity of hIL-3 and hIL-3 mutant proteins of the present invention is determined by DNA synthesis by human acute myelogenous leukemia cells (AML). The factor-dependent cell line AML 193 was adapted for use in testing biological activity.
One object of the present invention is to provide hIL-3 muteins and hIL-3 deletion muteins with four or more amino acid substitutions in the polypeptide sequence which have similar or improved biological activity in relation to native hIL-3 or native (15-125)hIL-3.
The present invention includes mutant polypeptides comprising minimally amino acids residues 15 to 118 of hIL-3 with or without additional amino acid extensions to the N-terminus and/or C-terminus which further contain four or more amino acid substitutions in the amino acid sequence of the polypeptide. It has been found that the (15-125)hIL-3 mutant is more soluble than is hIL-3 when expressed in the cytoplasm of E. coli, and the protein is secreted to the periplasm in E. coli at higher levels compared to native hIL-3.
When expressed in the E. coli cytoplasm, the above-mentioned mutant hIL-3 polypeptides of the present invention may also be constructed with Met-Ala- at the N-terminus so that upon expression the Met is cleaved off leaving Ala at the N-terminus. These mutant hIL-3 polypeptides may also be expressed in E. coli by fusing a signal peptide to the N-terminus. This signal peptide is cleaved from the polypeptide as part of the secretion process. Secretion in E. coli can be used to obtain the correct amino acid at the N-terminus (e.g., Asn.sup.15 in the (15-125) hIL-3 polypeptide) due to the precise nature of the signal peptidase. This is in contrast to the heterogeneity often observed at the N-terminus of proteins expressed in the cytoplasm in E. coli.
The hIL-3 mutant polypeptides of the present invention may have hIL-3 or hIL-3-like activity. For example, they may possess one or more of the biological activities of native hIL-3 and may be useful in stimulating the production of hematopoietic cells by human or primate progenitor cells. The hIL-3 muteins of the present invention and pharmaceutical compositions containing them may be useful in the treatment of conditions in which hematopoietic cell populations have been reduced or destroyed due to disease or to treatments such as radiation or chemotherapy.
hIL-3 muteins of the present invention may also be useful as antagonists which block the hIL-3 receptor by binding specifically to it and preventing binding of the agonist.
One potential advantage of the (15-125) hIL-3 muteins of the present invention, particularly those which retain activity similar to or better than that of native hIL-3, is that it may be possible to use a smaller amount of the biologically active mutein to produce the desired therapeutic effect. This may make it possible to reduce the number of treatments necessary to produce the desired therapeutic effect. The use of smaller amounts may also reduce the possibility of any potential antigenic effects or other possible undesirable side effects. For example, if a desired therapeutic effect can be achieved with a smaller amount of polypeptide it may be possible to reduce or eliminate side effects associated with the administration of native IL-3 such as the stimulation of leukotriene and/or histamine release. The hIL-3 muteins of the present invention may also be useful in the activation of stem cells or progenitors which have low receptor numbers. Pharmaceutical compositions containing (15-125) hIL-3 muteins of the present invention can be administered parenterally, intravenously, or subcutaneously.
As another aspect of the present invention, there is provided a novel method for producing the novel family of human IL-3 muteins. The method of the present invention involves culturing a suitable cell or cell line, which has been transformed with a vector containing a DNA sequence coding for expression of a novel hIL-3 mutant polypeptide. Suitable cells or cell lines may be bacterial cells. For example, the various strains of E. coli are well-known as host cells in the field of biotechnology. Examples of such strains include E. coli strains JM101 (Yanish-Perron, et al. (1985)] and MON105 [Obukowicz, et al. (1992)]. Various strains of B. subtilis may also be employed in this method. Many strains of yeast cells known to those skilled in the art are also available as host cells for expression of the polypeptides of the present invention.
Also suitable for use in the present invention are mammalian cells, such as Chinese hamster ovary cells (CHO). General methods for expression of foreign genes in mammalian cells are reviewed in: Kaufman, R. J. (1987) High level production of proteins in mammalian cells, in Genetic Engineering, Principles and Methods, Vol. 9, J. K. Setlow, editor, Plenum Press, New York. An expression vector is constructed in which a strong promoter capable of functioning in mammalian cells drives transcription of a eukaryotic secretion signal peptide coding region, which is translationally fused to the coding region for the hIL-3 variant. For example, plasmids such as pcDNA I/Neo, pRc/RSV, and pRc/CMV (obtained from Invitrogen Corp., San Diego, Calif.) can be used. The eukaryotic secretion signal peptide coding region can be from the hIL-3 gene itself or it can be from another secreted mammalian protein (Bayne, M. L. et al. (1987) Proc. Natl. Acad. Sci. USA 84, 2638-2642). After construction of the vector containing the hIL-3 variant gene, the vector DNA is transfected into mammalian cells. Such cells can be, for example, the COS7, HeLa, BHK, CHO, or mouse L lines. The cells can be cultured, for example, in DMEM media (JRH Scientific). The hIL-3 variant secreted into the media can be recovered by standard biochemical approaches following transient expression 24-72 hours after transfection of the cells or after establishment of stable cell lines following selection for neomycin resistance. The selection of suitable mammalian host cells and methods for transformation, culture, amplification, screening and product production and purification are known in the art. See, e.g., Gething and Sambrook, Nature, 293:620-625 (1981), or alternatively, Kaufman et al, Mol. Cell. Biol., 5(7):1750-1759 (1985) or Howley et al., U.S. Pat. No. 4,419,446. Another suitable mammalian cell line is the monkey COS-1 cell line. A similarly useful mammalian cell line is the CV-1 cell line.
Where desired, insect cells may be utilized as host cells in the method of the present invention. See, e.g. Miller et al, Genetic Engineering, 8:277-298 (Plenum Press 1986) and references cited therein. In addition, general methods for expression of foreign genes in insect cells using Baculovirus vectors are described in: Summers, M. D. and Smith, G. E. (1987)--A manual of methods for Baculovirus vectors and insect cell culture procedures, Texas Agricultural Experiment Station Bulletin No. 1555. An expression vector is constructed comprising a Baculovirus transfer vector, in which a strong Baculovirus promoter (such as the polyhedron promoter) drives transcription of a eukaryotic secretion signal peptide coding region, which is translationally fused to the coding region for the hIL-3 variant polypeptide. For example, the plasmid pVL1392 (obtained from Invitrogen Corp., San Diego, Calif.) can be used. After construction of the vector carrying the hIL-3 variant gene, two micrograms of this DNA is cotransfected with one microgram of Baculovirus DNA (see Summers & Smith, 1987) into insect cells, strain SF9. Pure recombinant Baculovirus carrying the hIL-3 variant is used to infect cells cultured, for example, in Excell 401 serum-free medium (JRH Biosciences, Lenexa, Kansas). The hIL-3 variant secreted into the medium can be recovered by standard biochemical approaches.
Another aspect of the present invention provides plasmid DNA vectors for use in the method of expression of these novel hIL-3 muteins. These vectors contain the novel DNA sequences described above which code for the novel polypeptides of the invention. Appropriate vectors which can transform microorganisms capable of expressing the hIL-3 muteins include expression vectors comprising nucleotide sequences coding for the hIL-3 muteins joined to transcriptional and translational regulatory sequences which are selected according to the host cells used.
Vectors incorporating modified sequences as described above are included in the present invention and are useful in the production of the hIL-3 mutant polypeptides. The vector employed in the method also contains selected regulatory sequences in operative association with the DNA coding sequences of the invention and capable of directing the replication and expression thereof in selected host cells.
Additional details may be found in WO 94/12639, which is hereby incorporated by reference in its entirety.
All references, patents or applications cited herein are incorporated by reference in their entirety.
The present invention also includes the construction and expression of (15-125)human interleukin-3 muteins having four or more amino acid substitutions in secretion vectors that optimize accumulation of correctly folded, active polypeptide. While many heterologous proteins have been secreted in E. coli there is still a great deal of unpredictability and limited success (Stader and Silhavy 1990). Full-length hIL-3 is such a protein, where attempts to secrete the protein in E. coli resulted in low secretion levels. Secretion of the variant (15-125) hIL-3 mutant polypeptides of the present invention as a fusion with a signal peptide such as LamB results in correctly folded protein that can be removed from the periplasm of E. coli by osmotic shock fractionation. This property of the variant (15-125) hIL-3 muteins allows for the direct and rapid screening for bioactivity of the secreted material in the crude osmotic shock fraction, which is a significant advantage. Furthermore, it provides a means of using the (15-125)hIL-3 muteins to conduct structure activity relationship (SAR) studies of the hIL-3 molecule. A further advantage of secretion of (15-125) hIL-3 muteins fused to the LamB signal peptide is that the secreted polypeptide has the correct N-terminal amino acid (Asn) due to the precise nature of the cleavage of the signal peptide by signal peptidase, as part of the secretion process.
The (15-125)hIL-3 muteins of the present invention may include hIL-3 polypeptides having Met-, Ala- or Met-Ala-attached to the N-terminus. When the muteins are expressed in the cytoplasm of E. coli, polypeptides with and without Met attached to the N-terminus are obtained. The methionine can in some cases be removed by methionine aminopeptidase.
Amino terminal sequences of hIL-3 muteins made in E. coli were determined using the method described by Hunkapillar et al., (1983). It was found that hIL-3 proteins made in E. coli from genes encoding Met-(15-125)hIL-3 were isolated as Met-(15-125) hIL-3. Proteins produced from genes encoding Met-Ala-(15-125) hIL-3 were produced as Ala-(15-125) hIL-3. The N-termini of proteins made in the cytoplasm of E. coli are affected by posttranslational processing by methionine aminopeptidase (Ben-Bassat et al., 1987) and possibly by other peptidases.
One method of creating the preferred hIL-3 (15-125) mutant genes is cassette mutagenesis [Wells, et al. (1985)] in which a portion of the coding sequence of hIL-3 in a plasmid is replaced with synthetic oligonucleotides that encode the desired amino acid substitutions in a portion of the gene between two restriction sites. In a similar manner amino acid substitutions could be made in the full-length hIL-3 gene, or genes encoding variants of hIL-3 in which from 1 to 14 amino acids have been deleted from the N-terminus and/or from 1 to 15 amino acids have been deleted from the C-terminus. When properly assembled these oligonucleotides would encode hIL-3 variants with the desired amino acid substitutions and/or deletions from the N-terminus and/or C-terminus. These and other mutations could be created by those skilled in the art by other mutagenesis methods including; oligonucleotide-directed mutagenesis [Zoller and Smith (1982, 1983, 1984), Smith (1985), Kunkel (1985), Taylor, et al. (1985), Deng and Nickoloff (1992)] or polymerase chain reaction (PCR) techniques [Saiki, (1985)].
Pairs of complementary synthetic oligonucleotides encoding portions of the amino terminus of the hIL-3 gene can be made and annealed to each other. Such pairs would have protruding ends compatible with ligation to NcoI at one end. The NcoI site would include the codon for the initiator methionine. At the other end of oligonucleotide pairs, the protruding (or blunt) ends would be compatible with a restriction site that occurs within the coding sequence of the hIL-3 gene. The DNA sequence of the oligonucleotide would encode sequence for amino acids of hIL-3 with the exception of those substituted and/or deleted from the sequence.
The NcoI enzyme and the other restriction enzymes chosen should have recognition sites that occur only once in the DNA of the plasmid chosen. Plasmid DNA can be treated with the chosen restriction endonucleases then ligated to the annealed oligonucleotides. The ligated mixtures can be used to transform competent JM101 cells to resistance to an appropriate antibiotic. Single colonies can be picked and the plasmid DNA examined by restriction analysis and/or DNA sequencing to identify plasmids with mutant hIL-3 genes.
One example of a restriction enzyme which cleaves within the coding sequence of the hIL-3 gene is ClaI whose recognition site is at codons 20 and 21. The use of ClaI to cleave the sequence of hIL-3 requires that the plasmid DNA be isolated from an E. coli strain that fails to methylate adenines in the DNA at GATC recognition sites. This is because the recognition site for ClaI, ATCGAT, occurs within the sequence GATCGAT which occurs at codons 19, 20 and 21 in the hIL-3 gene. The A in the GATC sequence is methylated in most E. coli host cells. This methylation prevents ClaI from cleaving at that particular sequence. An example of a strain that does not methylate adenines is GM48.
Interpretation of activity of single amino acid mutants in IL-3 (15-125)
As illustrated in Tables 6 and 9, there are certain positions in the IL-3 (15-125) molecule which are intolerant of substitutions, in that most or all substitutions at these positions resulted in a considerable decrease in bioactivity. There are two likely classes of such "down-mutations": mutations that affect overall protein structure, and mutations that interfere directly with the interaction between the IL-3 molecule and its receptor. Mutations affecting the three-dimensional structure of the protein will generally lie in the interior of the protein, while mutations affecting receptor binding will generally lie on the surface of the protein. Although the three-dimensional structure of IL-3 is unknown, there are simple algorithms which can aid in the prediction of the structure. One such algorithm is the use of "helical wheels" (Kaiser, E. T. & Kezdy, F. J., Science, 223:249-255 (1984)). In this method, the presence of alpha helical protein structures can be predicted by virtue of their amphipathic nature. Helices in globular proteins commonly have an exposed hydrophilic side and a buried hydrophobic side. As a broad generalization, in globular proteins, hydrophobic residues are present in the interior of the protein, and hydrophilic residues are present on the surface. By displaying the amino acid sequence of a protein on such a "helical wheel" it is possible to derive a model for which amino acids in alpha helices are exposed and which are buried in the core of the protein. Such an analysis of the IL-3 (15-125) molecule predicts that the following helical residues are buried in the core: M19, I20, I23, I24, L27, L58, F61, A64, L68, A71, 174, I77, L78, L81, W104, F107, L111, Y114, L115, L118.
In addition, cysteine residues at positions 16 and 84 are linked by a disulfide bond, which is important for the overall structure or "folding" of the protein. Finally, mutations which result in a major disruption of the protein structure may be expressed at low level in the secretion system used in our study, for a variety of reasons: either because the mis-folded protein is poorly recognized by the secretion machinery of the cell; because mis-folding of the protein results in aggregation, and hence the protein cannot be readily extracted from the cells; or because the mis-folded protein is more susceptible to degradation by cellular proteases. Hence, a block in secretion may indicate which positions in the IL-3 molecule which are important for maintenance of correct protein structure.
In order to retain the activity of a variant of IL-3, it is necessary to retain both the structural integrity of the protein, and retain the specific residues important for receptor contact. Hence it is possible to define specific amino acid residues in IL-3 (15-125) which must be retained in order to preserve biological activity.
Residues predicted to be important for interaction with the receptor: D21, E22, E43, D44, L48, R54, R94, D103, K110, F113.
Residues predicted to be structurally important: C16, L58, F61, A64, I74, L78, L81, C84, P86, P92, P96, F107, L111, L115, L118.
The hIL-3 muteins of the present invention may be useful in the treatment of diseases characterized by a decreased levels of either myeloid, erythroid, lymphoid, or megakaryocyte cells of the hematopoietic system or combinations thereof. In addition, they may be used to activate mature myeloid and/or lymphoid cells. Among conditions susceptible to treatment with the polypeptides of the present invention is leukopenia, a reduction in the number of circulating leukocytes (white cells) in the peripheral blood. Leukopenia may be induced by exposure to certain viruses or to radiation. It is often a side effect of various forms of cancer therapy, e.g., exposure to chemotherapeutic drugs and of infection or hemorrhage. Therapeutic treatment of leukopenia with these hIL-3 mutant polypeptides of the present invention may avoid undesirable side effects caused by treatment with presently available drugs.
The hIL-3 muteins of the present invention may be useful in the treatment of neutropenia and, for example, in the treatment of such conditions as aplastic anemia, cyclic neutropenia, idiopathic neutropenia, Chediak-Higashi syndrome, systemic lupus erythematosus (SLE), leukemia, myelodysplastic syndrome and myelofibrosis.
Many drugs may cause bone marrow suppression or hematopoietic deficiencies. Examples of such drugs are AZT, DDI, alkylating agents and anti-metabolites used in chemotherapy, antibiotics such as chloramphenicol, penicillin and sulfa drugs, phenothiazones, tranquilizers such as meprobamate, and diuretics. The hIL-3 muteins of the present invention may be useful in preventing or treating the bone marrow suppression or hematopoietic deficiencies which often occur in patients treated with these drugs.
Hematopoietic deficiencies may also occur as a result of viral, microbial or parasitic infections and as a result of treatment for renal disease or renal failure, e.g., dialysis. The hIL-3 muteins of the present invention may be useful in treating such hematopoietic deficiency.
The treatment of hematopoietic deficiency may include administration of the hIL-3 mutein of a pharmaceutical composition containing the hIL-3 mutein to a patient. The hIL-3 muteins of the present invention may also be useful for the activation and amplification of hematopoietic precursor cells by treating these cells in vitro with the muteins of the present invention prior to injecting the cells into a patient.
Various immunodeficiencies e.g., in T and/or B lymphocytes, or immune disorders, e.g., rheumatoid arthritis, may also be beneficially affected by treatment with the hIL-3 mutant polypeptides of the present invention. Immunodeficiencies may be the result of viral infections e.g. HTLVI, HTLVII, HTLVIII, severe exposure to radiation, cancer therapy or the result of other medical treatment. The hIL-3 mutant polypeptides of the present invention may also be employed, alone or in combination with other hematopoietins, in the treatment of other blood cell deficiencies, including thrombocytopenia (platelet deficiency), or anemia. Other uses for these novel polypeptides are in the treatment of patients recovering from bone marrow transplants in vivo and ex vivo, and in the development of monoclonal and polyclonal antibodies generated by standard methods for diagnostic or therapeutic use.
Other aspects of the present invention are methods and therapeutic compositions for treating the conditions referred to above. Such compositions comprise a therapeutically effective amount of one or more of the hIL-3 muteins of the present invention in a mixture with a pharmaceutically acceptable carrier. This composition can be administered either parenterally, intravenously or subcutaneously. When administered, the therapeutic composition for use in this invention is preferably in the form of a pyrogen-free, parenterally acceptable aqueous solution. The preparation of such a parenterally acceptable protein solution, having due regard to pH, isotonicity, stability and the like, is within the skill of the art.
The dosage regimen involved in a method for treating the above-described conditions will be determined by the attending physician considering various factors which modify the action of drugs, e.g. the condition, body weight, sex and diet of the patient, the severity of any infection, time of administration and other clinical factors. Generally, a daily regimen may be in the range of 0.2-150 .mu.g/kg of non-glycosylated IL-3 protein per kilogram of body weight. This dosage regimen is referenced to a standard level of biological activity which recognizes that native IL-3 generally possesses an EC.sub.50 at or about 10 picoMolar to 100 picoMolar in the AML proliferation assay described herein. Therefore, dosages would be adjusted relative to the activity of a given mutein vs. the activity of native (reference) IL-3 and it would not be unreasonable to note that dosage regimens may include doses as low as 0.1 microgram and as high as 1 milligram per kilogram of body weight per day. In addition, there may exist specific circumstances where dosages of IL-3 mutein would be adjusted higher or lower than the range of 10-200 micrograms per kilogram of body weight. These include co-administration with other CSF or growth factors; co-administration with chemotherapeutic drugs and/or radiation; the use of glycosylated IL-3 mutein; and various patient-related issues mentioned earlier in this section. As indicated above, the therapeutic method and compositions may also include co-administration with other human factors. A non-exclusive list of other appropriate hematopoietins, CSFs and interleukins for simultaneous or serial co-administration with the polypeptides of the present invention includes GM-CSF, CSF-1, G-CSF, Meg-CSF, M-CSF, erythropoietin (EPO), IL-1, IL-4, IL-2, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, LIF, B-cell growth factor, B-cell differentiation factor and eosinophil differentiation factor, stem cell factor (SCF) also known as steel factor or c-kit ligand, or combinations thereof. The dosage recited above would be adjusted to compensate for such additional components in the therapeutic composition. Progress of the treated patient can be monitored by periodic assessment of the hematological profile, e.g., differential cell count and the like.
Materials and methods for hTL-3 Mutein Expression in E. coli
Unless noted otherwise, all specialty chemicals were obtained from Sigma Co., (St. Louis, Mo.). Restriction endonucleases, T4 poly-nucleotides kinase, E. coli DNA polymerase I large fragment (Klenow) and T4 DNA ligase were obtained from New England Biolabs (Beverly, Mass.).
Escherichia coli strains
Strain JM101: delta (pro lac), supE, thi, F'(traD36, rpoAB, lacI-Q, lacZdeltaM15) (Messing, 1979). This strain can be obtained from the American Type Culture Collection (ATCC), 12301 Parklawn Drive, Rockville, Md. 20852, accession number 33876. MON 105 (W3110 rpoH358) is a derivative of W3110 (Bachmann, 1972) and has been assigned ATCC accession number 55204. Strain GM48: dam-3, dcm-6, gal, ara, lac, thr, leu, tonA, tsx (Marinus, 1973) was used to make plasmid DNA that is not methylated at the sequence GATC.
Genes and plasmids
The gene used for hIL-3 production in E. coli was obtained from British Biotechnology Incorporated, Cambridge, England, catalogue number BBG14. This gene is carried on a pUC based plasmid designated pP0518.
The plasmids used for production of hIL-3 in E. coli contain genetic elements whose use has been described (Olins et al., 1988; Olins and Rangwala, 1990). The replicon used is that of pBR327 (Covarrubias, et al., 1981) which is maintained at a copy number of about 100 in the cell (Soberon et al., 1980). A gene encoding the beta-lactamase protein is present on the plasmids. This protein confers ampicillin resistance on the cell. This resistance serves as a selectable phenotype for the presence of the plasmid in the cell.
For cytoplasmic expression vectors the transcription promoter was derived from the recA gene of E. coli (Sancar et al., 1980). This promoter, designated precA, includes the RNA polymerase binding site and the lexa repressor binding site (the operator). This segment of DNA provides high level transcription that is regulated even when the recA promoter is on a plasmid with the pBR327 origin of replication (Olins et al., 1988) incorporated herein by reference.
In secretion expression plasmids the transcription promoter was derived from the ara B, A, and D genes of E. coli (Greenfield et al., 1978). This promoter is designated pAraBAD and is contained on a 323 base pair Sac.T, BglII restriction fragment. The LamB secretion leader (Wong et al., 1988, Element et al., 1981) was fused to the N-terminus of the hIL-3 gene at the recognition sequence for the enzyme NcoI (5'CCATGG3'). The hIL-3 genes used were engineered to have a HindIII recognition site (5'AAGCTT3') following the coding sequence of the gene.
These hIL-3 variants were expressed as a fusion with the LamB signal peptide shown in FIG. 8, operatively joined to the araBAD promoter (Greenfield, 1978) and the g10-L ribosome binding site (Olins et al. 1988). The processed form was selectively released from the periplasm by osmotic shock as a correctly folded and fully active molecule. Secretion of (15-125) hIL-3 was further optimized by using low inducer (arabinose) concentration and by growth at 30.degree. C. These conditions resulted in lower accumulation levels of unprocessed LamB signal peptide (15-125) hIL-3 fusion, maximal accumulation levels of processed (15-125) hIL-3 and selective release of (15-125) hIL-3 by osmotic shock fractionation. The use of a tightly regulated promoter such as araBAD from which the transcription level and hence the expression level can be modulated allowed for the optimization of secretion of (15-125) hIL-3.
The ribosome binding site used is that from gene 10 of phage T7 (Olins et al., 1988). This is encoded in a 100 base pair (bp) fragment placed adjacent to precA. In the plasmids used herein, the recognition sequence for the enzyme NcoI (CCATGG) follows the g10-L. It is at this NcoI site that the hIL-3 genes are joined to the plasmid. It is expected that the nucleotide sequence at this junction will be recognized in mRNA as a functional start site for translation (Olins et al., 1988). The hIL-3 genes used were engineered to have a HindIII recognition site (AAGCTT) downstream from the coding sequence of the gene. At this HindIII site is a 514 base pair RsaI fragment containing the origin of replication of the single stranded phage f1 (Dente et al., 1983; Olins, et al., 1990) both incorporated herein by reference. A plasmid containing these elements is pMON2341. Another plasmid containing these elements is pMON5847 which has been deposited at the American Type Culture Collection, 12301 Parklawn Drive, Rockville, Md. 20852 under the accession number ATCC 68912.
Synthesis of Oligonucleotides
Oligonucleotides were synthesized on Nucleotide Synthesizer model 380A or 380B from Applied Biosystems, Inc. (Foster City, Calif.). Oligonucleotides were purified by polyacrylamide gel electrophoresis at concentrations from 12-20% (19:1 crosslinked) in 0.5.times. Tris borate buffer (0.045 M Tris, 0.045 M boric acid, 1.25 mM EDTA) followed by passage through a Nensorb column obtained from New England Nuclear (Boston, Mass.) using a PREP Automated Sample Processor obtained from DuPont, Co. (Wilmington, Del.).
Quantitation of synthetic oligonucleotides
Synthetic oligonucleotides were resuspended in water and quantitated by reading the absorbance at 260nm on a Beckman DU40 Spectrophotometer (Irvine, California) using a one centimeter by one millimeter quartz cuvette (Maniatis, 1982). The concentration was determined using an extinction coefficient of 1.times.10.sup.4 (Voet et al., 1963; Mahler and Cordes, 1966). The oligonucleotides were then diluted to a desired concentration.
Quantitation of synthetic DNA fragments can also be achieved by adding 10 to 100 picomoles of DNA to a solution containing kinase buffer (25 mM Tris pH 8.0, 10 mM MgCl.sub.2, 10 mM DTT and 2 mM spermidine). To the reaction mix is added ATP to 20 micromolar, ATP radiolabeled at the gamma phosphate (5000-10,0000 dpm/pmol) and 5 units of T4 polynucleotide kinase. Radiolabelled material is obtained from New England Nuclear (Boston, Mass.). The 10 microliter mixture is incubated at 37.degree. C. for one hour. A 1 microliter aliquot of the mixture was chromatographed on DEAE paper (Whatman) in 0.3 M ammonium bicarbonate. The counts that remained at the origin were used to determine the concentration of the synthetic DNA.
Recombinant DNA methods
Isolation of plasmid DNA from E. coli cultures was performed as described (Birnboim and Doly, 1979). Some DNAs were purified by Magic.TM. columns, available from Promega (Madison, Wis.).
Purified plasmid DNA was treated with restriction endonucleases according to manufacturer's instructions. Analysis of the DNA fragments produced by treatment with restriction enzymes was done by agarose or polyacrylamide gel electrophoresis. Agarose (DNA grade from Fisher, Pittsburgh Pa.) was used at a concentration of 1.0% in a Tris-acetate running buffer (0.04 M Tris-acetate, 0.001M EDTA). Polyacrylamide (BioRad, Richmond Calif.) was used at a concentration of 6% (19:1 crosslinked) in 0.5.times. Tris-borate buffer (0.045 M Tris, 0.045 M boric acid, 1.25 mM EDTA), hereafter referred to as PAGE.
DNA polymerase I, large fragment, Klenow enzyme was used according to manufacturers instructions to catalyze the addition of mononucleotides from 5' to 3' of DNA fragments which had been treated with restriction enzymes that leave protruding ends. The reactions were incubated at 65.degree. C. for 10 minutes to heat inactivate the Klenow enzyme.
The synthetic oligonucleotides were made without 5' or 3' terminal phosphates. In cases where such oligonucleotides were ligated end to end, the oligonucleotides were treated at a concentration of 10 picomoles per microliter with T4 polynucleotide kinase in the following buffer: 25 mM Tris, pH 8.0, 10 wM MgCl.sub.2, 10 mM dithiothreitol, 2 mM spermidine, 1 mM rATP. After incubation for 30 minutes at 37.degree. C., the samples were incubated at 65.degree. C. for five minutes to heat inactivate the kinase.
Synthetic gene assembly
The (15-125) hIL-3 gene was divided into four regions separated by five convenient restriction sites. In each of the four regions synthetic oligonucleotides were designed so that they would anneal in complementary pairs, with protruding single stranded ends, and when the pairs were properly assembled would result in a DNA sequence that encoded a portion of the hIL-3 gene. Amino acid substitutions in the hIL-3 gene were made by designing the oligonucleotides to encode the desired substitutions. The complementary oligonucleotides were annealed at concentration of 1 picomole per microliter in ligation buffer plus 50 mM NaCl. The samples were heated in a 100 ml beaker of boiling water and permitted to cool slowly to room temperature. One picomole of each of the annealed pairs of oligonucleotides were ligated with approximately 0.2 picomoles of plasmid DNA, digested with the appropriate restriction enzymes, in ligation buffer (25 mM Tris pH 8.0, 10 mM MgCl2, 10 mM dithiothreitol, 1 mM ATP, 2mM spermidine) with T4 DNA ligase obtained from New England Biolabs (Beverly, Mass.) in a total volume of 20 .mu.l at room temperature overnight.
DNA fragments were isolated from agarose gels by intercepting the restriction fragments on DEAE membranes from Schleicher and Schuell (Keene, New Hampshire) and eluting the DNA in 10 mM Tris, 1 mM EDTA, 1 M NaCl at 55.degree. C. for 1 hour, according to manufacturer's directions. The solutions containing the DNA fragment were concentrated and desalted by using Centricon 30 concentrators from Amicon (W. R. Grace, Beverly Mass.) according to the manufacturer's directions. Ligations were performed at 15.degree. C. overnight, except as noted, in ligation buffer.
Polymerase Chain Reaction
Polymerase Chain Reaction (hereafter referred to as PCR) techniques (Saiki, 1985) used the reagent kit and thermal cycler from Perkin-Elmer Cetus (Norwalk, Conn.). PCR is based on a thermostable DNA polymerase from Thermus aquaticus. The PCR technique is a DNA amplification method that mimics the natural DNA replication process in that the number of DNA molecules doubles after each cycle, in a way similar to in vivo replication. The DNA polymerase mediated extension is in a 5' to 3' direction. The term "primer" as used herein refers to an oligonucleotide sequence that provides an end to which the DNA polymerase can add nucleotides that are complementary to a nucleotide sequence. The latter nucleotide sequence is referred to as the "template", to which the primers are annealed. The amplified PCR product is defined as the region comprised between the 5' ends of the extension primers. Since the primers have defined sequences, the product will have discrete ends, corresponding to the primer sequences. The primer extension reaction was carried out using 20 picomoles (pmoles) of each of the oligonucleotides and 1 picogram of template plasmid DNA for 35 cycles (1 cycle is defined as 94 degrees C. for one minute, 50 degrees C. for two minutes and 72 degrees for three minutes.). The reaction mixture was extracted with an equal volume of phenol/chloroform (50% phenol and 50% chloroform, volume to volume) to remove proteins. The aqueous phase, containing the amplified DNA, and solvent phase were separated by centrifugation for 5 minutes in a microcentrifuge (Model 5414 Eppendorf Inc, Fremont Calif.). To precipitate the amplified DNA the aqueous phase was removed and transferred to a fresh tube to which was added 1/10 volume of 3M NaOAc (pH 5.2) and 2.5 volumes of ethanol (100% stored at minus 20 degrees C.). The solution was mixed and placed on dry ice for 20 minutes. The DNA was pelleted by centrifugation for minutes in a microcentrifuge and the solution was removed from the pellet. The DNA pellet was washed with 70% ethanol, ethanol removed and dried in a speedvac concentrator (Savant, Farmingdale, N.Y.). The pellet was resuspended in 25 microliters of TE (20 mM Tris-HCl pH 7.9, 1 mM EDTA). Alternatively the DNA was precipitated by adding equal volume of 4M NH.sub.4 OAc and one volume of isopropanol [Treco et al., (1988)]. The solution was mixed and incubated at room temperature for 10 minutes and centrifuged. These conditions selectively precipitate DNA fragments larger than .about.20 bases and were used to remove oligonucleotide primers. One quarter of the reaction was digested with restriction enzymes [Higuchi, (1989)] an on completion heated to 70 degrees C. to inactivate the enzymes.
Recovery of recombinant plasmids from ligation mixes
E. coli JM101 cells were made competent to take up DNA. Typically, 20 to 100 ml of cells were grown in LB medium to a density of approximately 150 Klett units and then collected by centrifugation. The cells were resuspended in one half culture volume of 50 mM CaCl.sub.2 and held at 4.degree. C. for one hour. The cells were again collected by centrifugation and resuspended in one tenth culture volume of 50 mM CaCl.sub.2. DNA was added to a 150 microliter volume of these cells, and the samples were held at 4.degree. C. for minutes. The samples were shifted to 42.degree. C. for one minute, one milliliter of LB was added, and the samples were shaken at 37.degree. C. for one hour. Cells from these samples were spread on plates containing ampicillin to select for transformants. The plates were incubated overnight at 37.degree. C. Single colonies were picked, grown in LB supplemented with ampicillin overnight at 37.degree. C. with shaking. From these cultures DNA was isolated for restriction analysis.
Culture medium
LB medium (Maniatis et al., 1982) was used for growth of cells for DNA isolation. M9 minimal medium supplemented with 1.0% casamino acids, acid hydrolyzed casein, Difco (Detroit, Mich.) was used for cultures in which recombinant hIL-3 was produced. The ingredients in the M9 medium were as follows: 3 g/liter KH.sub.2 PO.sub.4, 6 g/l Na.sub.2 HPO.sub.4, 0.5 g/l NaCl, 1 g/l NH.sub.4 Cl, 1.2 mM MgSO.sub.4, 0.025 mM CaCl.sub.2, 0.2% glucose (0.2% glycerol with the AraBAD promoter), 1% casamino acids, 0.1 ml/l trace minerals (per liter 108 g FeCl.sub.3.6H.sub.2 O, 4.0 g ZnSO.sub.4.7H.sub.2 O, 7.0 CoCl.sub.2.2H.sub.2 O, 7.0 g Na.sub.2 MoO.sub.4.2H.sub.2 O, 8.0 g CuSO.sub.4.5H.sub.2 O, 2.0 g H.sub.3 BO.sub.3, 5.0 g MnSO.sub.4.H.sub.2 O, 100 ml concentrated HCl). Bacto agar was used for solid media and ampicillin was added to both liquid and solid LB media at 200 micrograms per milliliter.
DNA sequence analysis
The nucleotide sequencing of plasmid DNA was determined using a Genesis 2000 sequencer obtained from DuPont (Wilmington, Delaware) according to the methods of Prober et al. (1987) and Sanger et al. (1977).Some DNA sequences were performed using Sequenase.TM. polymerase (U.S. Biochemicals, Cleveland, Ohio) according to manufacturer's directions.
Production of recombinant hIL-3 muteins in E. coli with vectors employing the recA promoter
E. coli strains harboring the plasmids of interest were grown at 37.degree. C. in M9 plus casamino acids medium with shaking in a Gyrotory water bath Model G76 from New Brunswick Scientific (Edison, N.J.). Growth was monitored with a Klett Summerson meter (green 54 filter), Klett Mfg. Co. (New York, N.Y.). At a Klett value of approximately 150, an aliquot of the culture (usually one milliliter) was removed for protein analysis. To the remaining culture, nalidixic acid (10 mg/ml) in 0.1 N NaOH was added to a final concentration of 50 .mu.g/ml. The cultures were shaken at 37.degree. C. for three to four hours after addition of nalidixic acid. A high degree of aeration was maintained throughout the bacterial growth in order to achieve maximal production of the desired gene product. The cells were examined under a light microscope for the presence of refractile bodies (RBs). One milliliter aliquots of the culture were removed for analysis of protein content.
Production of recombinant hTL-3 proteins from the pAraBAD promoter in E. coli
E. coli strains harboring the plasmids of interest were grown at 30.degree. C. with shaking in M9 medium plus casamino acids and glycerol. Growth was monitored with a Klett Summerson calorimeter, using a green 54 filter. At a Klett value of about 150, an aliquot of the culture (usually one milliliter) was removed for protein analysis. To the remaining culture, 20% arabinose was added to a final concentration of 0.05%. The cultures were shaken at 30.degree. C. for three to four hours after addition of arabinose. A high degree of aeration was maintained throughout the bacterial growth in order to achieve maximal production of the desired gene product. One milliliter aliquots of the culture were removed for analysis of protein content.
Secretion and osmotic shock
Three hour post induction samples were fractionated by osmotic shock [Neu and Heppel (1965)]. The optical density (Klett value) of the cultures was determined and 1 ml of cells were centrifuged in a Sigma microcentrifuge (West Germany) model 202MK in 1.5 mls snap top microcentrifuge tubes for 5 minutes at 10,000 rpm. The cell pellet was resuspended very gently by pipeting in a room temperature sucrose solution (20% sucrose w/v, 30 mM Tris-Hcl pH7.5, lmM EDTA), using 1 .mu.l/1 Klett unit. Following a 10 minute incubation at room temperature, the cells were centrifuged for 5 minutes at 10,000 rpm. The sucrose fraction was carefully removed from the cell pellet. The cell pellet was then resuspended very gently by pipeting in ice cold distilled water, using 1 .mu.l/1 Klett unit. Following a 10 minute incubation on ice, the cells were centrifuged for 5 minutes at 12,000 rpm. The water fraction was carefully removed. Equal volumes of the sucrose and water fractions were pooled and aliquoted to provide samples for activity screening.
Analysis of protein content of E. coli cultures producing hIL-3 mutant polypeptides
Bacterial cells from cultures treated as described above were collected from the medium by centrifugation. Aliquots of these cells were resuspended in SDS loading buffer (4.times.: 6 g SDS, 10 ml beta-mercaptoethanol, 25 ml upper Tris gel stock (0.5 M Tris HCl pH 6.8, 0.4% SDS) brought to 50 ml with glycerol, 0.2% bromophenol blue was added) at a concentration of one microliter per Klett unit. These samples were incubated at 85.degree. C. for five minutes and vortexed. Five or ten microliter aliquots of these samples were loaded on 15% polyacrylamide gels prepared according to the method of Laemmli (1970). Protein bands were visualized by staining the gels with a solution of acetic acid, methanol and water at 5:1:5 ratio (volume to volume) to which Coomassie blue had been added to a final concentration of 1%. After staining, the gels were washed in the same solution without the Coomassie blue and then washed with a solution of 7% acetic acid, 5% methanol. Gels were dried on a gel drier Model SE1160 obtained from Hoeffer (San Francisco, Calif.). The amount of stained protein was measured using a densitometer obtained from Joyce-Loebl (Gateshead, England). The values obtained were a measure of the amount of the stained hIL-3 protein compared to the total of the stained protein of the bacterial cells.
Western blot analysis of hIL-3 muteins made in E. coli
In some E. coli cultures producing hIL-3, the level of accumulation of the hIL-3 protein is lower than 5% of total bacterial protein. To detect hIL-3 produced at this level, Western blot analysis was used. Proteins from cultures induced with nalidixic acid or arabinose were run on polyacrylamide gels as described above except that volumes of sample loaded were adjusted to produce appropriate signals. After electrophoresis, the proteins were electroblotted to APT paper, Transa-bind, Schleicher and Schuell (Keene, N.H.) according to the method of Renart et al. (1979). Antisera used to probe these blots had been raised in rabbits, using peptides of the sequence of amino acids 20 to 41 and 94 to 118 of hIL-3 as the immunogens. The presence of bound antibody was detected with Staphylococcal protein A radiolabeled with 125j, obtained from New England Nuclear (Boston, Massachusetts).
Fractionation of E. coli cells producing hIL-1 proteins in the cytoplasm
Cells from E. coli cultures harboring plasmids that produce hIL-3 muteins were induced with nalidixic acid. After three hours, the hIL-3 muteins accumulated in refractile bodies. The first step in purification of the hIL-3 muteins was to sonicate cells. Aliquots of the culture were resuspended from cell pellets in sonication buffer: 10 mM Tris, pH 8.0, 1 mM EDTA, 50 mM NaCl and 0.1 mM PMSF. These resuspended cells were subjected to several repeated sonication bursts using the microtip from a Sonicator cell disrupter, Model W-375 obtained from Heat Systems-Ultrasonics Inc. (Farmingdale, N.Y.). The extent of sonication was monitored by examining the homogenates under a light microscope. When nearly all of the cells had been broken, the homogenates were fractionated by centrifugation. The pellets, which contain most of the refractile bodies, are highly enriched for hIL-3 muteins.
Methods-Extraction, Refolding and Purification of Interleukin-3 (IL-3) Muteins Expressed as Refractile Bodies in E. coli.
Extraction of refractile bodies (RB's):
For each gram of RB's (and typically one gram is obtained from a 300 ml E. coli culture), 5 ml of a solution containing 6M guanidine hydrochloride (GnHCl), 50 mM 2-N-cyclohexylaminoethanesulfonic acid (CHES) pH 9.5 and 20 mM dithiothreitol (DTT) was added. The RB's were extracted with a Bio-Homogenizer for 15-30 seconds and gently rocked for 2 hours at 5 degrees centigrade (5.degree. C.) to allow the protein to completely reduce and denature.
Refolding of the IL-3 muteins
The protein solution was transferred to dialysis tubing (1000 molecular weight cut-off) and dialyzed against at least 100 volumes of 4M GnHCl--50 mM CHES pH 8.0. The dialysis was continued overnight at 5.degree. C. while gently stirring. Subsequently dialysis was continued against at least 100 volumes of 2M GnHCl--50 mM CHES pH 8.0 and dialyzed overnight at 5.degree. C. while gently stirring.
Purification of the IL-3 muteins
The protein solution was removed from the dialysis tubing and acidified by the addition of 40% acetonitrile (CH.sub.3 CN)--0.2% trifluoroacetic acid (TFA) to a final concentration of 20% CH.sub.3 CN--0.1% TFA. This was centrifuged (16,000.times. g for 5 minutes) to clarify and the supernatant was loaded onto a Vydac C-18 reversed phase column (10.times.250 mm) available from Vydac (Hesperia, Calif.) previously equilibrated in 20% CH.sub.3 CN--0.1% TFA. The column was eluted with a linear gradient (0.2% CH3CN/minute) between 40-50% CH.sub.3 CN--0.1% TFA at a flow rate of 3 ml/minute while collecting 1.5 ml fractions. The fractions were analyzed by polyacrylamide gel electrophoresis (SDS-PAGE) and the appropriate fractions pooled. The pooled material was dried by lyophilization or in a Speed Vac concentrator. The dry powder was reconstituted with 10 mM ammonium bicarbonate pH 7.5, centrifuged (16,000.times. g for 5 minutes) to clarify and assayed for protein concentration by the method of Bradford (1976) with bovine serum albumin as the standard. Such protein can be further analyzed by additional techniques such as, SDS-PAGE, electrospray mass spectrometry, reverse phase HPLC, capillary zone electrophoresis, amino acid composition analysis, and ELISA (enzyme-linked immunosorbent assay).
hIL-3 SANDWICH ELISA
IL-3 protein concentrations can be determined using a sandwich ELISA based on an affinity purified polyclonal goat anti-rhIL-3. Microtiter plates (Dynatech Immulon II) were coated with 150 .mu.l goat-anti-rhIL-3 at a concentration of approximately 1 .mu.g/ml in 100 mM NaHCO.sub.3, pH 8.2. Plates were incubated overnight at room temperature in a chamber maintaining 100% humidity. Wells were emptied and the remaining reactive sites on the plate were blocked with 200 .mu.l of solution containing 10 mM PBS, 3% BSA and 0.05% Tween 20, pH 7.4 for 1 hour at 37.degree. C. and 100% humidity. Wells were emptied and washed 4.times. with 150 mM NaCl containing 0.05% Tween 20 (wash buffer). Each well then received 150 .mu.l of dilution buffer (10 mM PBS containing 0.1% BSA, 0.01% Tween 20, pH 7.4), containing rhIL-3 standard, control, sample or dilution buffer alone. A standard curve was prepared with concentrations ranging from 0.125 ng/ml to 5 ng/ml using a stock solution of rhIL-3 (concentration determined by amino acid composition analysis). Plates were incubated 2.5 hours at 37.degree. C. and 100% humidity. Wells were emptied and each plate was washed 4.times. with wash buffer. Each well then received 150 .mu.l of an optimal dilution (as determined in a checkerboard assay format) of goat anti-rhIL-3 conjugated to horseradish peroxidase. Plates were incubated 1.5 hours at 37.degree. C. and 100% humidity. Wells were emptied and each plate was washed 4.times. with wash buffer. Each well then received 150 .mu.l of ABTS substrate solution (Kirkegaard and Perry). Plates were incubated at room temperature until the color of the standard wells containing 5 ng/ml rhIL-3 had developed enough to yield an absorbance between 0.5-1.0 when read at a test wavelength of 410 nm and a reference wavelength of 570 nm on a Dynatech microtiter plate reader. Concentrations of immunoreactive rhIL-3 in unknown samples were calculated from the standard curve using software supplied with the plate reader.
AML Proliferation Assay for Bioactive Human Interleukin-3
The factor-dependent cell line AML 193 was obtained from the American Type Culture Collection (ATCC, Rockville, Md.). This cell line, established from a patient with acute myelogenous leukemia, is a growth factor dependent cell line which displayed enhanced growth in GM/CSF supplemented medium (Lange, B., et al., (1987); Valtieri, M., et al., (1987). The ability of AML 193 cells to proliferate in the presence of human IL-3 has also been documented. (Santoli, D., et al., (1987)). A cell line variant was used, AML 193 1.3, which was adapted for long term growth in IL-3 by washing out the growth factors and starving the cytokine dependent AML 193 cells for growth factors for 24 hours. The cells were then replated at 1.times.10.sup.5 cells/well in a 24 well plate in media containing 100 U/ml IL-3. It took approximately 2 months for the cells to grow rapidly in IL-3. These cells were maintained as AML 193 1.3 thereafter by supplementing tissue culture medium (see below) with human IL-3.
AML 193 1.3 cells were washed 6 times in cold Hanks balanced salt solution (HBSS, Gibco, Grand Island, N.Y.) by centrifuging cell suspensions at 250.times. g for 10 minutes followed by decantation of supernatant. Pelleted cells were resuspended in HBSS and the procedure was repeated until six wash cycles were completed. Cells washed six times by this procedure were resuspended in tissue culture medium at a density ranging from 2.times.10.sup.5 to 5.times.10.sup.5 viable cells/ml. This medium was prepared by supplementing Iscove's modified Dulbecco's Medium (IMDM, Hazleton, Lenexa, Kans.) with albumin, transferrin, lipids and 2-mercaptoethanol. Bovine albumin (Boehringer-Mannheim, Indianapolis, Ind.) was added at 500 .mu.g/ml; human transferrin (Boehringer-Mannheim, Indianapolis, Ind.) was added at 100 .mu.g/ml; soybean lipid (Boehringer-Mannheim, Indianapolis, Ind.) was added at 50 .mu.g/ml; and 2-mercaptoethanol (Sigma, St. Louis, Mo.) was added at 5.times.10.sup.-5 M.
Serial dilutions of human interleukin-3 or human interleukin-3 variant protein (hIL-3 mutein) were made in triplicate series in tissue culture medium supplemented as stated above in 96 well Costar 3596 tissue culture plates. Each well contained 50 .mu.l of medium containing interleukin-3 or interleukin-3 variant protein once serial dilutions were completed. Control wells contained tissue culture medium alone (negative control). AML 193 1.3 cell suspensions prepared as above were added to each well by pipetting 50 .mu.l (2.5.times.10.sup.4 cells) into each well. Tissue culture plates were incubated at 37.degree. C. with 5% CO.sub.2 in humidified air for 3 days. On day 3, 0.5 .mu.Ci .sup.3 H-thymidine (2 Ci/mM, New England Nuclear, Boston, Mass.) was added in 50 .mu.l of tissue culture medium. Cultures were incubated at 37.degree. C. with 5% CO.sub.2 in humidified air for 18-24 hours. Cellular DNA was harvested onto glass filter mats (Pharmacia LKB, Gaithersburg, Md.) using a TOMTEC cell harvester (TOMTEC, Orange, Conn.) which utilized a water wash cycle followed by a 70% ethanol wash cycle. Filter mats were allowed to air dry and then placed into sample bags to which scintillation fluid (Scintiverse II, Fisher Scientific, St. Louis, Mo. or BetaPlate Scintillation Fluid, Pharmacia LKB, Gaithersburg, Md.) was added. Beta emissions of samples from individual tissue culture wells were counted in a LKB Betaplate model 1205 scintillation counter (Pharmacia LKB, Gaithersburg, Md.) and data was expressed as counts per minute of .sup.3 H-thymidine incorporated into cells from each tissue culture well. Activity of each human interleukin-3 preparation or human interleukin-3 variant preparation was quantitated by measuring cell proliferation (.sup.3 H-thymidine incorporation) induced by graded concentrations of interleukin-3 or interleukin-3 variant.
Typically, concentration ranges from 0.05 pM-10.sup.5 pM are quantitated in these assays. Activity is determined by measuring the dose of interleukin-3 or interleukin-3 variant which provides 50% of maximal proliferation [EC.sub.50 =0.5.times.(maximum average counts per minute of .sup.3 H-thymidine incorporated per well among triplicate cultures of all concentrations of interleukin-3 tested background proliferation measured by .sup.3 H-thymidine incorporation observed in triplicate cultures lacking interleukin-3]. This EC.sub.50 value is also equivalent to 1 unit of bioactivity. Every assay was performed with native interleukin-3 as a reference standard so that relative activity levels could be assigned.
Relative biological activities of IL-3 muteins of the present invention are shown in Table 1. The Relative Biological Activity of IL-3 mutants is calculated by dividing the EC.sub.50 of (1-133) hIL-3 by the EC.sub.50 of the mutant. The Relative Biological Activity may be the average of replicate assays.
TABLE 1______________________________________BIOLOGICAL ACTIVITY OF IL-3 MUTEINS Relative*Plasmid Polypeptide BiologicalCode Structure Activity______________________________________Reference (1-133)hIL-3 1pMON13298 SEQ ID NO. 82 3pMON13299 SEQ ID NO. 83 2pMON13300 SEQ ID NO. 84 3pMON13301 SEQ ID NO. 85 2pMON13302 SEQ ID NO. 86 1.2pMON13303 SEQ ID NO. 87 0.6pMON13287 SEQ ID NO. 88 26pMON13288 SEQ ID NO. 89 24pMON13289 SEQ ID NO. 90 13pMON13290 SEQ ID NO. 91 20pMON13292 SEQ ID NO. 92 6pMON13294 SEQ ID NO. 93 3pMON13295 SEQ ID NO. 94 3pMON13312 SEQ ID NO. 95 4pMON13313 SEQ ID NO. 96 8pMON13285 SEQ ID NO. 259 32pMON13286 SEQ ID NO. 260 8pMON13325 SEQ ID NO. 261 8pMON13326 SEQ ID NO. 262 25pMON13330 SEQ ID NO. 263 19pMON13329 SEQ ID NO. 406 10pMON13364 SEQ ID NO. 117 13pMON13475 SEQ ID NO. 280 7pMON13366 SEQ ID NO. 281 38pMON13367 SEQ ID NO. 282 36pMON13368 SEQ ID NO. 278 1.6pMON13369 SEQ ID NO. 283 10pMON13370 SEQ ID NO. 284 6pMON13373 SEQ ID NO. 285 12pMON13374 SEQ ID NO. 286 6pMON13375 SEQ ID NO. 287 14pMON13376 SEQ ID NO. 288 0.4pMON13377 SEQ ID NO. 289 0.4pMON13379 SEQ ID NO. 291 0.9pMON13380 SEQ ID NO. 279 0.05pMON13381 SEQ ID NO. 293 10pMON13382 SEQ ID NO. 313 38pMON13383 SEQ ID NO. 294 0.5pMON13384 SEQ ID NO. 295 0.25pMON13385 SEQ ID NO. 292 1pMON13387 SEQ ID NO. 308 32pMON13388 SEQ ID NO. 296 23pMON13389 SEQ ID NO. 297 10pMON13391 SEQ ID NO. 298 30pMON13392 SEQ ID NO. 299 17pMON13393 SEQ ID NO. 300 32pMON13394 SEQ ID NO. 301 20pMON13395 SEQ ID NO. 302 11pMON13396 SEQ ID NO. 303 20pMON13397 SEQ ID NO. 304 16pMON13398 SEQ ID NO. 305 36pMON13399 SEQ ID NO. 306 18pMON13404 SEQ ID NO. 307 1.3pMON13417 SEQ ID NO. 310 24pMON13420 SEQ ID NO. 311 19pMON13421 SEQ ID NO. 331 0.5pMON13432 SEQ ID NO. 312 10pMON13400 SEQ ID NO. 317 0.09pMON13402 SEQ ID NO. 318 20pMON13403 SEQ ID NO. 321 0.03pMON13405 SEQ ID NO. 267 9pMON13406 SEQ ID NO. 264 5pMON13407 SEQ ID NO. 266 16pMON13408 SEQ ID NO. 269 7pMON13409 SEQ ID NO. 270 15pMON13410 SEQ ID NO. 271 0.4pMON13411 SEQ ID NO. 322 1.2pMON13412 SEQ ID NO. 323 0.5pMON13413 SEQ ID NO. 324 0.6pMON13414 SEQ ID NO. 265 4pMON13415 SEQ ID NO. 268 4pMON13418 SEQ ID NO. 326 0.5pMON13419 SEQ ID NO. 325 0.015pMON13422 SEQ ID NO. 272 0.4pMON13423 SEQ ID NO. 273 0.4pMON13424 SEQ ID NO. 274 3pMON13425 SEQ ID NO. 275 6pMON13426 SEQ ID NO. 276 >0.0003pMON13429 SEQ ID NO. 277 >0.0002pMON13440 SEQ ID NO. 319 9pMON13451 SEQ ID NO. 320 0.1pMON13459 SEQ ID NO. 328 0.003pMON13416 SEQ ID NO. 309 19.9pMON13428 SEQ ID NO. 327 0.008pMON13467 SEQ ID NO. 329 0.16pMON13446 SEQ ID NO. 315 21.5pMON13390 SEQ ID NO. 316 20______________________________________ *The Relative Biological Activity of IL3 mutants is calculated by dividin the EC.sub.50 of (1133) hIL3 by the EC.sub.50 of the mutant.
The following assay is used to measure IL-3 mediated sulfidoleukotriene release from human mononuclear cells.
IL-3 mediated sulfidoleukotriene release from human mononuclear cells
Heparin-containing human blood was collected and layered onto an equal volume of Ficoll-Paque (Pharmacia # 17-0840-02) ready to use medium (density 1.077 g/ml.). The Ficoll was warmed to room temperature prior to use and clear 50 ml polystyrene tubes were utilized. The Ficoll gradient was spun at 300.times.g for 30 minutes at room temperature using a H1000B rotor in a Sorvall RT6000B refrigerated centrifuge. The band containing the mononuclear cells was carefully removed, the volume adjusted to 50 mls with Dulbecco's phosphate-buffered saline (Gibco Laboratories cat. # 310-4040PK), spun at 400 .times. g for 10 minutes at 4.degree. C. and the supernatant was carefully removed. The cell pellet was washed twice with HA Buffer mM Hepes (Sigma # H-3375), 125 mM NaCl (Fisher # S271-500), 5 mM KCl (Sigma # P-9541), 0.5 mM glucose (Sigma # G-5000),0.025% Human Serum Albumin (Calbiochem # 126654) and spun at 300.times. g, 10 min., 4.degree. C. The cells were resuspended in HACM Buffer (HA buffer supplemented with 1 mM CaCl2 (Fisher # C79-500) and 1 mM MgCl2 (Fisher # M-33) at a concentration of 1.times.106 cells/ml and 180 .mu.l were transferred into each well of 96 well tissue culture plates. The cells were allowed to acclimate at 37.degree. C. for 15 minutes. The cells were primed by adding 10 .mu.ls of a 20.times. stock of various concentrations of cytokine to each well (typically 100000, 20000, 4000, 800, 160, 32, 6.4, 1.28, 0 fM IL3). The cells were incubated for 15 minutes at 37.degree. C. Sulfidoleukotriene release was activated by the addition of 10 .mu.ls of 20.times. (1000 nM) fmet-leu-phe (Calbiochem # 344252) final concentration 50 nM FMLP and incubated for 10 minutes at 37.degree. C. The plates were spun at 350.times. g at 4.degree. C. for 20 minutes. The supernatants were removed and assayed for sulfidoleukotrienes using Cayman's Leukotriene C4 EIA kit (Cat. #420211) according to manufacturers' directions. Native (15-125)hIL-3 was run as a standard control in each assay.
Native hIL-3 possesses considerable inflammatory activity and has been shown to stimulate synthesis of the arachidonic acid metabolites LTC.sub.4, LTD.sub.4, and LTE.sub.4 ; histamine synthesis and histamine release. Human clinical trials with native hIL-3 have documented inflammatory responses (Biesma, et al., BLOOD, 80:1141-1148 (1992) and Postmus, et al., J. CLIN. ONCOL., 10:1131-1140 (1992)). A recent study indicates that leukotrienes are involved in IL-3 actions in vivo and may contribute significantly to the biological effects of IL-3 treatment (Denzlinger, C., et al., BLOOD, 81:2466-2470 (1993))
Some muteins of the present invention may have an improved therapeutic profile as compared to native hIL-3 or (15-125)hIL-3. For example, some muteins of the present invention may have a similar or more potent growth factor activity relative to native hIL-3 or (15-125)hIL-3 without having a similar or corresponding increase in the stimulation of leukotriene or histamine. These muteins would be expected to have a more favorable therapeutic profile since the amount of polypeptide which needs to be given to achieve the desired growth factor activity (e. g. cell proliferation) would have a lesser leukotriene or histamine stimulating effect. In studies with native hIL-3, the stimulation of inflammatory factors has been an undesirable side effect of the treatment. Reduction or elimination of the stimulation of mediators of inflammation would provide an advantage over the use of native hIL-3.
The pMON13288 polypeptide has demonstrated a more potent growth factor activity relative to native hIL-3 in the AML 193 cell proliferation assay (EC.sub.50 =0.8-3.8 pM for pMON13288 and EC.sub.50 =30.2 pM for native hIL-3) without demonstrating a corresponding increase in the stimulation of leukotriene C4 (LTC.sub.4) production and histamine release, i. e., it stimulated LTC.sub.4 production and histamine release with a potency similar to that of native hIL-3 while having an improved ability to stimulate cell proliferation compared to native hIL-3. Thus with the pMON13288 polypeptide it would be expected that one would be able to produce a desired therapeutic response, e. g., cell proliferation, with less stimulation of the undesirable inflammatory mediators.
Some muteins of the present invention have antigenic profiles which differ from that of native hIL-3. For example, in a competition ELISA with an affinity purified polyclonal goat anti-hIL-3 antibody, native hIL-3 significantly blocked the binding of labeled hIL-3 to polyclonal anti-hIL-3 antibody whereas the pMON13288 polypeptide failed to block the binding of hIL-3 to anti-hIL-3 antibody.
Table 2 lists the sequences of some oligonucleotides used in making the muteins of the present invention.
Table 3 lists the amino acid sequence of native (15-125)hIL-3 (Peptide #1) and the amino acid sequences of some mutant polypeptides of the present invention. The sequences are shown with the amino acid numbering corresponding to that of native hIL-3 [FIG. 1].
Table 4 lists the nucleotide sequences of some DNA sequences which encode mutant polypeptides of the present invention.
TABLE 2__________________________________________________________________________OLIGONUCLEOTIDES__________________________________________________________________________Oligo #1 Length: 000040 CATGGCTAAC TGCTCTATAA TGATCGATGA AATTATACAT [SEQ ID NO:15]Oligo #2 Length: 000045 CTTTAAGTGA TGTATAATTT CATCGATCAT TATAGAGCAG TTAGC [SEQ ID NO:16]Oligo #3 Length: 000036 CACTTAAAGA GACCACCTGC ACCTTTGCTG GACCCG [SEQ ID NO:17]Oligo #4 Length: 000036 GAGGTTGTTC GGGTCCAGCA AAGGTGCAGG TGGTCT [SEQ ID NO:18]Oligo #5 Length: 000036 CACTTAAAGA GACCACCTAA CCCTTTGCTG GACCCG [SEQ ID NO:19]Oligo #6 Length: 000036 GAGGTTGTTC GGGTCCAGCA AAGGGTTAGG TGGTCT [SEQ ID NO:20]Oligo #7 Length: 000036 CACTTAAAGG TTCCACCTGC ACCTTTGCTG GACAGT [SEQ ID NO:21]Oligo #8 Length: 000036 GAGGTTGTTA CTGTCCAGCA AAGGTGCAGG TGGAAC [SEQ ID NO:22]Oligo #9 Length: 000027 AACAACCTCA ATGCTGAAGA CGTTGAT [SEQ ID NO:23]Oligo #10 Length: 000018 ATCAACGTCT TCAGCATT [SEQ ID NO:24]Oligo #11 Length: 000027 AACAACCTCA ATTCTGAAGA CATGGAT [SEQ ID NO:25]Oligo #12 Length: 000018 ATCCATGTCT TCAGAATT [SEQ ID NO:26]Oligo #13 Length: 000022 CATGGGAACC ATATGTCAGG AT [SEQ ID NO:27]Oligo #14 Length: 000018 ATCCTGACAT ATGGTTCC [SEQ ID NO:28]Oligo #15 Length: 000016 TGAACCATAT GTCAGG [SEQ ID NO:29]Oligo #16 Length: 000024 AATTCCTGAC ATATGGTTCA TGCA [SEQ ID NO:30]Oligo #17 Length: 000020 AATTCGAACC ATATGTCAGA [SEQ ID NO:31]Oligo #18 Length: 000020 AGCTTCTGAC ATATGGTTCG [SEQ ID NO:32]Oligo #19 Length: 000022 ATCGAACCAT ATGTCAGATG CA [SEQ ID NO:33]Oligo #20 Length: 000018 TCTGACATAT GGTTCGAT [SEQ ID NO:34]Oligo #21 Length: 000036 ATCCTGATGG AACGAAACCT TCGACTTCCA AACCTG [SEQ ID NO:35]Oligo #22 Length: 000027 AAGTCGAAGG TTTCGTTCCA TCAGGAT [SEQ ID NO:36]Oligo #23 Length: 000036 ATCCTGATGG AACGAAACCT TCGAACTCCA AACCTG [SEQ ID NO:37]Oligo #24 Length: 000027 AGTTCGAAGG TTTCGTTCCA TCAGGAT [SEQ ID NO:38]Oligo #25 Length: 000024 CTCGCATTCG TAAGGGCTGT CAAG [SEQ ID NO:39]Oligo #26 Length: 000024 CCTTACGAAT GCGAGCAGGT TTGG [SEQ ID NO:40]Oligo #27 Length: 000024 GAGAGCTTCG TAAGGGCTGT CAAG [SEQ ID NO:41]Oligo #28 Length: 000024 CCTTACGAAG CTCTCCAGGT TTGG [SEQ ID NO:42]Oligo #29 Length: 000015 CACTTAGAAA ATGCA [SEQ ID NO:43]Oligo #30 Length: 000020 TTTTCTAAGT GCTTGACAGC [SEQ ID NO:44]Oligo #31 Length: 000015 AACTTAGAAA ATGCA [SEQ ID NO:45]Oligo #32 Length: 000020 TTTTCTAAGT TCTTGACAGC [SEQ ID NO:46]Oligo #33 Length: 000048 GGTGATTGGA TGTCGAGAGG GTGCGGCCGT GGCAGAGGGC AGACATGG [SEQ ID NO:47]Oligo #34 Length: 000048 CTGCCCTCTG CCACGGCCGC ACCCTCTCGA CATCCAATCA CCATCAAG [SEQ ID NO:48]Oligo #35 Length: 000048 GATGATTGGA TGTCGAGAGG GTGCGGCCGT GGCAGAGGGC AGACATGG [SEQ ID NO:49]Oligo #36 Length: 000048 CTGCCCTCTG CCACGGCCGC ACCCTCTCGA CATCCAATCA TCATCAAG [SEQ ID NO:50]Oligo #37 Length: 000018 TACGAGATTA CGAAGAAT [SEQ ID NO:51]Oligo #38 Length: 000018 CGTAATCTCG TACCATGT [SEQ ID NO:52]Oligo #39 Length: 000018 TTGGAGATTA CGAAGAAT [SEQ ID NO:53]Oligo #40 Length: 000018 CGTAATCTCC AACCATGT [SEQ ID NO:54]Oligo #41 Length: 000019 TGCCTCAATA CCTGATGCA [SEQ ID NO:55]Oligo #42 Length: 000021 TCAGGTATTG AGGCAATTCT T [SEQ ID NO:56]Oligo #43 Length: 000026 AATTCTTGCC AGTCACCTGC CTTGAT [SEQ ID NO:57]Oligo #44 Length: 000016 GCAGGTGACT GGCAAG [SEQ ID NO:58]Oligo #45 Length: 000032 AATTCCGGGA AAAACTGACG TTCTATCTGG TT [SEQ ID NO:59]Oligo #46 Length: 000037 CTCAAGGGAA ACCAGATAGA ACGTCAGTTT TTCCCGG [SEQ ID NO:60]Oligo #47 Length: 000032 ACCCTTGAGC ACGCGCAGGA ACAACAGTAA TA [SEQ ID NO:61]Oligo #48 Length: 000027 AGCTTATTAC TGTTGTTCCT GCGCGTG [SEQ ID NO:62]Oligo #49 Length: 000032 ACCCTTGAGC AAGCGCAGGA ACAACAGTAA TA [SEQ ID NO:63]Oligo #50 Length: 000027 AGCTTATTAC TGTTGTTCCT GCGCTTG [SEQ ID NO:64]Oligo #51 Length: 000034 GCCGATACCGCGGCATACTCCCACCATTCAGAGA [SEQ ID NO:155]Oligo #52 Length: 000033 GCCGATAAGATCTAAAACGGGTATGGAGAAACA [SEQ ID NO:156]Oligo #53 ATAGTCTTCCCCAGATATCTAACGCTTGAG [SEQ ID NO:157]Oligo #54 Length: 000024 CAATACCTGATGCGTTTTCTAAGT [SEQ ID NO:158]Oligo #55 Length: 000033 GGTTTCGTTCCATCAGAATGTCCATGTCTTCAG [SEQ ID NO:159]Oligo #165 NCOECV1.REQ Length: 000040 CATGGCTAAC TGCTCTAACA TGATCGATGA AATTATAACA [SEQ ID NO:162]Oligo #166 NCOECRV4.REQ Length: 000045 CTTTAAGTGT GTTATAATTT CATCGATCAT GTTAGAGCAG TTAGC [SEQ ID NO:163]Oligo #167 NCOECRV2.REQ Length: 000036 CACTTAAAGC AGCCACCTTT GCCTTTGCTG GACTTC [SEQ ID NO:164]Oligo #168 NCOECRV5.REQ Length: 000036 GAGGTTGTTG AAGTCCAGCA AAGGCAAAGG TGGCTG [SEQ ID NO:165]Oligo #169 2D5M6SUP.REQ Length: 000027 AACAACCTCA ATGACGAAGA CATGTCT [SEQ ID NO:166]Oligo #170 2D5M6SLO.REQ Length: 000018 AGACATGTCT TCGTCATT [SEQ ID NO:167]Oligo #15(A) Length: 000016 TGAACCATAT GTCAGG [SEQ ID NO:168]Oligo #16(A) Length: 000024 AATTCCTGAC ATATGGTTCA TGCA [SEQ ID NO:169]Oligo #B1 19ALA1.REQ Length: 000040 CATGGCAAAC TGCTCTATAG CTATCGATGA AATTATACAT [SEQ ID NO:170]Oligo #B2 19ALA4.REQ Length: 000045 CTTTAAGTGA TGTATAATTT CATCGATAGC TATAGAGCAG TTTGC [SEQ ID NO:171]Oligo #B3 19ILE1.REQ Length: 000040 CATGGCAAAC TGCTCTATAA TCATCGATGA AATTATACAT [SEQ ID NO:172]Oligo #B4 19ILE4.REQ Length: 000045 CTTTAAGTGA TGTATAATTT CATCGATGAT TATAGAGCAG TTTGC [SEQ ID NO:173]Oligo #B5 49ASP1.REQ Length: 000036 ATCCTGGACG AACGAAAACT TCGAACTCCA AACCTG [SEQ ID NO:174]Oligo #B6 49ASP4.REQ Length: 000027 AGTTCGAAGG TTTCGTTCGT CCAGGAT [SEQ ID NO:175]Oligo #B7 49ILE1.REQ Length: 000036 ATCCTGATCG AACGAAACCT TCGAACTCCA AACCTG [SEQ ID NO:176]Oligo #B8 49ILE4.REQ Length: 000027 AGTTCGAAGG TTTCGTTCGA TCAGGAT [SEQ ID NO:177]Oligo #B9 49LEU1.REQ Length: 000036 ATCCTGCTGG AACGAAACCT TCGAACTCCA AACCTG [SEQ ID NO:178]Oligo #B10 49LEU4.REQ Length: 000027 AGTTCGAAGG TTTCGTTCCA GCAGGAT [SEQ ID NO:179]Oligo #B11 42S45V3.REQ Length: 000027 AACAACCTCA ATTCTGAAGA CGTTGAT [SEQ ID NO:180]Oligo #B12 42S45V6.REQ Length: 000018 ATCAACGTCT TCAGAATT [SEQ ID NO:181]Oligo #B13 18I23A5H.REQ Length: 000051 CGCGCCATGG CTAACTGCTC TATAATGATC GATGAAGCAA TACATCACTTA [SEQ ID NO:182]Oligo #B14 2341HIN3.REQ Length: 000018 CGCGTCGATA AGCTTATT [SEQ ID NO:183]Oligo #B15 2341NCO.REQ Length: 000018 GGAGATATAT CCATGGCT [SEQ ID NO:184]Oligo #B16 2A5M6S0D.REQ Length: 000042 TCGGTCCATC AGAATAGACA TGTCTTCAGC ATTGAGGTTG TT [SEQ ID NO:185]Oligo #B17 2A5V6S0D.REQ Length: 000042 TCGGTCCATC AGAATAGAAA CGTCTTCAGC ATTGAGGTTG TT [SEQ ID NO:186]Oligo #B18 2D5M6S0D.REQ Length: 000042 TCGGTCCATC AGAATAGACA TGTCTTCGTC ATTGAGGTTG TT [SEQ ID NO:187]Oligo #B19 2D5V6S0D.REQ Length: 000042 TCGGTCCATC AGAATAGAAA CGTCTTCGTC ATTGAGGTTG TT [SEQ ID NO:188]Oligo #B20 2S5M6S0D.REQ Length: 000042 TCGGTCCATC AGAATAGACA TGTCTTCAGA ATTGAGGTTG TT [SEQ ID NO:189]Oligo #B21 2S5V6S0D.REQ Length: 000042 TCGGTCCATC AGAATAGAAA CGTCTTCAGA ATTGAGGTTG TT [SEQ ID NO:190]Oligo #B22 100ARG3.REQ Length: 000048 CTGCCCTCTG CCACGGCCGC ACCCTCTCGA CATCCAATCA TCATCCGT [SEQ ID NO:191]Oligo #B23 100ARG8.REQ Length: 000026 AATTCTTGCC AGTCACCTGC ACGGAT [SEQ ID NO:192]Oligo #B24 101MET4.REQ Length: 000016 ATGGGTGACT GGCAAG [SEQ ID NO:193]Oligo #B25 10R01M8.REQ Length: 000026 AATTCTTGCC AGTCACCCAT ACGGAT [SEQ ID NO:194]Oligo #B26 23ALA1.REQ Length: 000040 CATGGCTAAC TGCTCTATTA TGATCGATGA AGCAATACAT [SEQ ID NO:195]Oligo #B27 23ALA4.REQ Length: 000045 CTTTAAGTGA TGTATTGCTT CATCGATCAT AATAGAGCAG TTAGC [SEQ ID NO:196]Oligo #B28 29V2R4S2.REQ Length: 000036 CACTTAAAGG TACCACCTCG CCCTTCCCTG GACCCG [SEQ ID NO:197]Oligo #B29 29V2R4S5.REQ Length: 000036 GAGGTTGTTC GGGTCCAGGG AAGGGCGAGG TGGTAC [SEQ ID NO:198]Oligo #B30 34SER2.REQ Length: 000036 CACTTAAAGA GACCACCTGC ACCTTCCCTG GACCCG [SEQ ID NO:199]Oligo #B31 34SER5.REQ Length: 000036 GAGGTTGTTC GGGTCCAGGG AAGGTGCAGG TGGTCT [SEQ ID NO:200]Oligo #B32 42D45M3.REQ Length: 000027 AACAACCTCA ATGACGAAGA CATGGAT [SEQ ID NO:201]Oligo #B33 42D45M6.REQ Length: 000018 ATCCATGTCT TCGTCATT [SEQ ID NO:202]Oligo #B34 42D45V3.REQ Length: 000027 AACAACCTCA ATGACGAAGA CGTCGAT [SEQ ID NO:203]Oligo #B35 42D45V6.REQ Length: 000018 ATCGACGTCT TCGTCATT [SEQ ID NO:204]Oligo #B36 42D5M6S3.REQ Length: 000027 AACAACCTCA ATGACGAAGA CATGTCT [SEQ ID NO:205]Oligo #B37 42D5M6S6.REQ Length: 000018 AGACATGTCT TCGTCATT [SEQ ID NO:206]Oligo #B38 42D5V6S3.REQ Length: 000027 AACAACCTCA ATGACGAAGA CGTCTCT [SEQ ID NO:207]Oligo #B39 42D5V6S6.REQ Length: 000018 AGAGACGTCT TCGTCATT [SEQ ID NO:208]Oligo #B40 50ASP1.REQ Length: 000036 ATCCTGATGG ACCGAAACCT TCGACTTCCA AACCTG [SEQ ID NO:209]Oligo #B41 50ASP4.REQ Length: 000027 AAGTCGAAGG TTTCGGTCCA TCAGGAT [SEQ ID NO:210]Oligo #B42 50D56S1.REQ Length: 000036 ATCCTGATGG ACCGAAACCT TCGACTTAGC AACCTG [SEQ ID NO:211]Oligo #B43 56SER5.REQ Length: 000024 CCTTACGAAG CTCTCCAGGT TGCT [SEQ ID NO:212]Oligo #B44 82TRP2.REQ Length: 000018 CGTAATCTCT GGCCATGT [SEQ ID NO:213]Oligo #B45 82TRP6.REQ Length: 000018 CCAGAGATTA CGAAGAAT [SEQ ID NO:214]Oligo #B46 9E12Q6W1.REQ Length: 000032 AATTCCGGGA AAAACTGCAA TTCTATCTGT GG [SEQ ID NO:215]Oligo #B47 9E12Q6W3.REQ Length: 000037 CTCAAGGGTC CACAGATAGA ATTGCAGTTT TTCCCGG [SEQ ID NO:216]Oligo #B48 9E12Q6V1.REQ Length: 000032 AATTCCGGGA AAAACTGCAA TTCTATCTGG TT [SEQ ID NO:217]Oligo #B49 9E12Q6V3.REQ Length: 000037 CTCAAGGGTA ACCAGATAGA ATTGCAGTTT TTCCCGG [SEQ ID NO:218]Oligo #B50 S09E16V1.REQ Length: 000023 AATTCCGGGA AAAACTGACG TTC [SEQ ID NO:219]Oligo #B51 S09E16V3.REQ Length: 000028 AACCAGATAG AACGTCAGTT TTTCCCGG [SEQ ID NO:220]Oligo #B52 S116VD31.REQ Length: 000023 TATCTGGTTA CCCTTGAGTA ATA [SEQ ID NO:221]Oligo #B53 SECR1D33.REQ Length: 000018 AGCTTATTAC TTCAAGGGT [SEQ ID NO:222]Oligo #B54 S9E2Q6V1.REQ Length: 000023 AATTCCGGGA AAAACTGCAA TTC [SEQ ID NO:223]Oligo #B55 S9E2Q6V3.REQ Length: 000028 AACCAGATAG AATTGCAGTT TTTCCCGG [SEQ ID NO:224]Oligo #B56 Ent338.Lo Length: 61 CGATCATTAT AGAGCAGTTA GCCTTGTCAT CGTCGTCCTT GTAATCAGTT TCTGGATATG C [SEQ ID NO:225]Oligo #B57 Ent338.UP Length: 63 CATGGCATAT CCAGAAACTG ATTACAAGGA CGACGATGAC AAGGCTAACT GCTCTATAAT GAT [SEQ ID NO:226]09L2Q6S1.REQ Length: 000032 AATTCCGGCT TAAACTGCAA TTCTATCTGT CT [SEQ ID NO:227]09L2Q6S3.REQ Length: 000037 CTCAAGGGTA GACAGATAGA ATTGCAGTTT AAGCCGG [SEQ ID NO:228]117S2.REQ Length: 000032 TCTCTTGAGC AAGCGCAGGA ACAACAGTAA TA [SEQ ID NO:229]19I0L3A1.REQ Length: 000040 CATGGCAAAC TGCTCTATAA TACTCGATGA AGCAATACAT [SEQ ID NO:230]19I0L3A4.REQ Length: 000045 CTTTAAGTGA TGTATTGCTT CATCGAGTAT TATAGAGCAG TTTGC [SEQ ID NO:231]20P23A1.REQ Length: 000040 CATGGCAAAC TGCTCTATAA TGCCAGATGA AGCAATACAT [SEQ ID NO:232]20P23A4.REQ Length: 000045 CTTTAAGTGA TGTATTGCTT CATCTGGCAT TATAGAGCAG TTTGC [SEQ ID NO:233]23L1.REQ Length: 000040 CATGGCaAAC TGCTCTATAA TGATCGATGA AactgATACAT [SEQ ID NO:234]23L4.REQ Length: 000045 CTTTAAGTGA TGTATcagTT CATCGATCAT TATAGAGCAG TTtGC [SEQ ID NO:235]29I4S7S2.REQ Length: 000036 CACTTAAAGA TACCACCTAA CCCTAGCCTG GACAGT [SEQ ID NO:236]29I4S7S5.REQ Length: 000036 GAGGTTAGCA CTGTCCAGGC TAGGGTTAGG TGGTAT [SEQ ID NO:237]38A5V6S3.REQ Length: 000027 GCTAACCTCA ATTCCGAAGA CGTCTCT [SEQ ID NO:238]38A5V6S6.REQ Length: 000018 AGAGACGTCT TCGGAATT [SEQ ID NO:239]50D51S1.REQ Length: 000036 ATCCTGATGG ACTCCAACCT TCGAACTCCA AACCTG [SEQ ID NO:240]50D51S4.REQ Length: 000027 AGTTCGAAGG TTGGAGTCCA TCAGGAT [SEQ ID NO:241]5VYWPTT3.REQ Length: 000048 GTTCCCTATT GGACGGCCCC TCCCTCTCGA ACACCAATCA CGATCAAG [SEQ ID NO:242]5VYWPTT7.REQ Length: 000048 CGTGATTGGT GTTCGAGAGG GAGGGGCCGT CCAATAGGGA ACACATGG [SEQ ID NO:243]62P3H5S2.REQ Length: 000024 CTCGCATTCC CACATGCTTC TAAG [SEQ ID NO:244]62P63H2.REQ Length: 000024 CTCGCATTCC CACATGCTGT CAAG [SEQ ID NO:245]62P63H5.REQ Length: 000024 ATGTGGGAAT GCGAGCAGGT TTGG [SEQ ID NO:246]65S67Q6.REQ Length: 000020 TTTTCTAATT GCTTAGAAGC [SEQ ID NO:247]67Q3.REQ Length: 000015 CAATTAGAAA ATGCA [SEQ ID NO:248]67Q6.REQ Length: 00002] TTTTCTAATT GCTTGACAGC [SEQ ID NO:249]76P1.REQ Length: 000021 TCAGGTATTG AGCCAATTCT T [SEQ ID NO:250]76P5.REQ Length: 000019 TGGCTCAATA CCTGATGCA [SEQ ID NO:251]79S2.REQ Length: 000018 TCTAATCTCC AACCATGT [SEQ ID NO:252]79S6.REQ Length: 000018 TTGGAGATTA GAAAGAAT [SEQ ID NO:253]9L2Q67S3.REQ Length: 000037 CTCAAGAGAA GACAGATAGA ATTGCAGTTT AAGCCGG [SEQ ID NO:254]9LQS1181.REQ Length: 000043 AATTCCGGCT TAACTGCAA TTCTATCTGT CTACCCTTTA ATA [SEQ ID NO:256]9LQS1183.REQ Length: 000043 AGCTTATTAA AGGGTAGACA GATAGAATTG CAGTTTAAGC CGG [SEQ ID NO:257]S9L2Q6S1.REQ Length: 000043 AATTCCGGCT TAAACTGCAA TTCTATCTGT CTACCCTTTA ATA [SEQ ID NO:258]__________________________________________________________________________
TABLE 3______________________________________POLYPEPTIDESThe numbering of the mutated amino acid positions whichdescribe the following polypeptides corresponds to thesequence of the full-length, native (1-133)hIL-3.______________________________________PEPTIDE #1: pMON5988 (Example 43), (15-125)hIL-3 SEQ ID NO:65;PEPTIDE #2: pMON13344 (Example 8), (15-125)hIL-3 (18I, 25H, 29R,32A, 37P, 42A and 45V) SEQ ID NO:66;PEPTIDE #3: pMON13345 (Example 9), (15-125)hIL-3 (18I, 25H, 29R,32N, 37P, 42S and 45M) SEQ ID NO:67;PEPTIDE #4: pMON13346 (Example 10), (15-125)hIL-3 (18I, 25H, 29V,32A, 37S, 42S and 45M) SEQ ID NO:68;PEPTIDE #5: pMON13347 (Example 12), (15-125)hIL-3 (51R, 55L, 59L,62V, 67N and 69E) SEQ ID NO:69;PEPTIDE #6: pMON13348 (Example 13), (15-125)hIL-3 (51R, 55L, 60S,62V, 67N and 69E) SEQ ID NO:70;PEPTIDE #7: pMON13349 (Example 14), (15-125)hIL-3 (51R, 55T, 59L,62V, 67H and 69E) SEQ ID NO:71;PEPTIDE #8: pMON13350 (Example 16), (15-125)hIL-3 (73G, 76A,79R, 82Q, 87S, 93S, 98I, 101A and 105Q) SEQ ID NO:72;PEPTIDE #9: pMON13355 (Example 17), (15-125)hIL-3 (73G, 76A,79R, 82V, 87S, 93S, 98T, 101A and 105Q) SEQ ID NO:73;PEPTIDE #10: pMON13352 (Example 19), (15-125)hIL-3 (109E, 116V,120Q and 123E) SEQ ID NO:74;PEPTIDE #11: pMON13354 (Example 20), (15-125)hIL-3 (109E, 116V,117S, 120H and 123E) SEQ ID NO:75;PEPTIDE #12: pMON13360 (Example 21), (15-125)hIL-3 (73G, 76A,79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and 123E)SEQ. ID. NO:76;PEPTIDE #13: pMON13361 (Example 22), (15-125)hIL-3 (73G, 76A,79R, 82V, 87S, 93S, 98T, 101A, 105Q, 109E, 116V, 120Q and 123E),SEQ ID NO:77;PEPTIDE #14: pMON13362 (Example 23), (15-125)hIL-3 (73G, 76A,79R, 82V, 87S, 93S, 98T, 101A, 105Q, 109E, 116V, 117S, 120H and123E) SEQ ID NO:78;PEPTIDE #15: pM0N13363 (Example 24), (15-125)hIL-3 (18I, 25H,29R, 32A, 37P, 42A, 45V, 51R, 55L, 60S, 62V, 67N and 69E)SEQ ID NO:79;PEPTIDE #16: pMON13364 (Example 25), (15-125)hIL-3 (18I, 25H,29R, 32N, 37P, 42S, 45M, 51R, 55T, 59L, 62V, 67H and 69E)SEQ ID NO:80;PEPTIDE #17: pMON13365 (Example 26), (15-125)hIL-3 (18I, 25H,29V, 32A, 37S, 42S, 45M, 51R, 55L, 59L, 62V, 67N and 69E)SEQ ID NO:81;PEPTIDE #18: pMON13298 (Example 27), Met-Ala-(15-125)hIL-3 (73G,76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and123E) SEQ ID NO:82;PEPTIDE #19: pMON13299 (Example 28), Met-Ala-(15-125)hIL-3 (73G,76A, 79R, 82V, 87S, 93S, 98T, 101A, 105Q, 109E, 116V, 120Q and123E); SEQ ID NO:83;PEPTIDE #20: pM0N13300 (Example 29), Met-Ala-(15-125)hIL-3 (73G,76A, 79R, 82V, 87S, 93S, 98T, 101A, 105Q, 109E, 116V, 117S, 120Hand 123E) SEQ ID NO:84;PEPTIDE #21: pMON13301 (Example 30), Met-Ala-(15-125)hIL-3 (18I,25H, 29R, 32A, 37P, 42A, 45V, 51R, 55L, 60S, 62V, 67N and 69E)SEQ ID NO:85;PEPTIDE #22: pMON13302 (Example 31), Met-Ala-(15-125)hIL-3 (18I,25H, 29R, 32N, 37P, 42S, 45M, 51R, 55T, 59L, 62V, 67H and 69E)SEQ ID NO:86;PEPTIDE #23: pMON13303 (Example 32), Met-Ala-(15-125)hIL-3 (18I,25H, 29V, 32A, 37S, 42S, 45M, 51R, 55L, 59L, 62V, 67N and 69E)SEQ ID NO:87;PEPTIDE #24: pMON13287 (Example 33), Met-Ala-(15-125)hIL-3 (18I,25H, 29R, 32A, 37P, 42A, 45V, 51R, 55L, 60S, 62V, 67N, 69E, 73G,76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and123E) SEQ ID NO:88;PEPTIDE #25: pMON13288 (Example 34), Met-Ala-(15-125)hIL-3 (18I,25H, 29R, 32N, 37P, 42S, 45M, 51R, 55T, 59L, 62V, 67H, 69E, 73G,76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and123E) SEQ ID NO:89;PEPTIDE #26: pMON13289 (Example 35), Met-Ala-(15-125)hIL-3 (18I,25H, 29V, 32A, 37S, 42S, 45M, 51R, 55L, 59L, 62V, 67N, 69E, 73G,76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and123E) SEQ ID NO:90;PEPTIDE #27: pMON13290 (Example 36), Met-Ala-(15-125)hIL-3 (18I,25H, 29R, 32A, 37P, 42A, 45V, 51R, 55L, 60S, 62V, 67N, 69E, 73G,76A, 79R, 82V, 87S, 93S, 98T, 101A, 105Q, 109E, 116V, 120Q and123E) SEQ ID NO:91;PEPTIDE #28: pMON13292 (Example 37), Met-Ala-(15-125)hIL-3 (18I,25H, 29V, 32A, 37S, 42S, 45M, 51R, 55L, 59L, 62V, 67N, 69E, 73G,76A, 79R, 82V, 87S, 93S, 98T, 101A, 105Q, 109E, 116V, 120Q and123E) SEQ ID NO:92;PEPTIDE #29: pMON13294 (Example 38), Met-Ala-(15-125)hIL-3 (18I,25H, 29R, 32N, 37P, 42S, 45M, 51R, 55T, 59L, 62V, 67H, 69E, 73G,76A, 79R, 82V, 87S, 93S, 98T, 101A, 105Q, 109E, 116V, 117S, 120Hand 123E) SEQ ID NO:93;PEPTIDE #30: pMON13295 (Example 39), Met-Ala-(15-125)hIL-3 (18I,25H, 29V, 32A, 37S, 42S, 45M, 51R, 55L, 59L, 62V, 67N, 69E, 73G,76A, 79R, 82V, 87S, 93S, 98T, 101A, 105Q, 109E, 116V, 117S, 120Hand 123E) SEQ ID NO:94;PEPTIDE #31: pMON13312 (Example 40), Met-Ala-(15-125)hIL-3 (18I,25H, 29R, 32N, 37P, 42S, 45M, 51R, 55T, 59L, 62V, 67H, 69E, 73G,76A, 79R, 82V, 87S, 93S, 98T, 101A, 105Q, 109E, 116V, 120Q and123E) SEQ ID NO:95;PEPTIDE #32: pMON13313 (Example 41), Met-Ala-(15-125)hIL-3 (18I,25H, 29R, 32A, 37P, 42A, 45V, 51R, 55L, 60S, 62V, 67N, 69E, 73G,76A, 79R, 82V, 87S, 93S, 98T, 101A, 105Q, 109E, 116V, 117S, 120Hand 123E) SEQ ID NO:96;PEPTIDE #A3: pMON13285 (Example 60), Met-Ala-(15-125)hIL-3(42D, 45M, 46S, 50D) SEQ ID NO:259;PEPTIDE #A4: pMON13286 (Example 61), Met-Ala-(15-125)hIL-3(42D, 45M, 46S) SEQ ID NO:260;PEPTIDE #A5: pMON13325 (Example 62), Met-Ala-(15-125)hIL-3(42D, 45M, 46S, 116W) SEQ ID NO:261;PEPTIDE #A6: pMON13326 (Example 63), Met-Ala-(15-125)hIL-3(42D, 45M, 46S, 50D, 116W) SEQ ID NO:262;PEPTIDE #A7: pMON13330 (Example 65), Met-Ala-(15-125)hIL-3(42D, 45M, 46S, 50D, 95R, 98I, 100R, 116W) SEQ ID NO:263;PEPTIDE #A8: pMON13329 (Example 66), Met-Ala-(15-125)hIL-3,(42D, 45M, 46S, 98I, 100R, 116W) SEQ ID NO:406;PEPTIDE #B1: pMON13406 (Example 69), Met-Ala-(15-125)hIL-3(18I, 19A, 25H, 29R, 32N, 37P, 42S, 45M, 51R, 55T, 59L, 62V, 67H,69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V,120Q and 123E) SEQ ID NO:264;PEPTIDE #B2: pMON13414 (Example 70), Met-Ala-(15-125)hIL-3(18I, 19I, 25H, 29R, 32N, 37P, 42S, 45M, 51R, 55T, 59L, 62V, 67H,69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V,120Q and 123E) SEQ ID NO:265;PEPTIDE #B3: pMON13407 (Example 71), Met-Ala-(15-125)hIL-3(18I, 25H, 29R, 32N, 37P, 42S, 45V, 51R, 55T, 59L, 62V, 67H, 69E,73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and123E) SEQ ID NO:266;PEPTIDE #B4: pMON13405 (Example 72), Met-Ala-(15-125)hIL-3(18I, 19A, 25H, 29R, 32N, 37P, 42S, 45V, 51R, 55T, 59L, 62V, 67H,69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V,120Q and 123E) SEQ ID NO:267;PEPTIDE #B5: pMON13415 (Example 73), Met-Ala-(15-125)hIL-3(18I, 19I, 25H, 29R, 32N, 37P, 42S, 45V, 51R, 55T, 59L, 62V, 67H,69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V,120Q and 123E) SEQ ID NO:268;PEPTIDE #B6: pMON13408 (Example 74), Met-Ala-(15-125)hIL-3(18I, 25H, 29R, 32N, 37P, 42S, 45M, 49I, 51R, 55T, 59L, 62V, 67H,69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V,120Q and 123E) SEQ ID NO:269;PEPTIDE #B7: pMON13409 (Example 75), Met-Ala-(15-125)hIL-3(18I, 25H, 29R, 32N, 37P, 42S, 45M, 49L, 51R, 55T, 59L, 62V, 67H,69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V,120Q and 123E) SEQ ID NO:270;PEPTIDE #B8: pMON13410 (Example 76), Met-Ala-(15-125)hIL-3(18I, 25H, 29R, 32N, 37P, 42S, 45M, 49D, 51R, 55T, 59L, 62V, 67H,69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V,120Q and 123E) SEQ ID NO:271;PEPTIDE #B9: pMON13422 (Example 77), Met-Ala-(15-125)hIL-3(18I, 19A, 25H, 29R, 32N, 37P, 42S, 45V, 49I, 51R, 55T, 59L, 62V,67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E,116V, 120Q and 123E) SEQ ID NO:272;PEPTIDE #B10: pMON13423 (Example 78), Met-Ala-(15-125)hIL-3(18I, 19I, 25H, 29R, 32N, 37P, 42S, 45V, 49I, 51R, 55T, 59L, 62V,67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E,116V, 120Q and 123E) SEQ ID NO:273;PEPTIDE #B11: pMON13424 (Example 79), Met-Ala-(15-125)hIL-3(18I, 19A, 25H, 29R, 32N, 37P, 42S, 45V, 49L, 51R, 55T, 59L, 62V,67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E,116V, 120Q and 123E) SEQ ID NO:274;PEPTIDE #B12: pMON13425 (Example 80), Met-Ala-(15-125)hIL-3(18I, 19I, 25H, 29R, 32N, 37P, 42S, 45V, 49L, 51R, 55T, 59L, 62V,67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E,116V, 120Q and 123E) SEQ ID NO:275;PEPTIDE #B13: pMON13426 (Example 81), Met-Ala-(15-125)hIL-3(18I, 19A, 25H, 29R, 32N, 37P, 42S, 45V, 49D, 51R, 55T, 59L, 62V,67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V,120Q and 123E) SEQ ID NO:276;PEPTIDE #B14: pMON13429 (Example 82), Met-Ala-(15-125)hIL-3(18I, 19I, 25H, 29R, 32N, 37P, 42S, 45V, 49D, 51R, 55T, 59L, 62V,67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E,116V, 120Q and 123E) SEQ ID NO:277;PEPTIDE #B15: pMON13368 (Example 83), Met-Ala-(15-125)hIL-3(18I, 23A, 25H, 29V, 32A, 37S, 42S, 45M, 51R, 55L, 59L, 62V, 67N,69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V,120Q and 123E) SEQ ID NO:278;PEPTIDE #B16: pMON13380 (Example 84), Met-Ala-(15-125)hIL-3(18I, 23A, 25H, 29V, 32A, 37S, 42S, 45M, 51R, 55L, 59L, 62V, 67N,69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 112Q,116V, 120Q and 123E) SEQ ID NO:279;PEPTIDE #B17: pMON13475 (Example 86), Met-Ala-(15-125)hIL-3(18I, 23A, 25H, 29R, 32A, 37P, 42D, 45V, 46S, 50D, 51R, 55L, 60S,62V, 67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E,116V, 120Q and 123E) SEQ ID NO:280;PEPTIDE #B18: pMON13366 (Example 87), Met-Ala-(15-125)hIL-3(18I, 25H, 29R, 32A, 37P, 42N, 45V, 46S, 50D, 51R, 55L, 60S, 62V,67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V,120Q and 123E) SEQ ID NO:281;PEPTIDE #B19: pMON13367 (Example 88), Met-Ala-(15-125)hIL-3(18I, 25H, 29R, 32A, 37P, 42A, 45V, 46S, 50D, 51R, 55L, 60S, 62V,67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V,120Q and 123E) SEQ ID NO:282;PEPTIDE #B20: pMON13369 (Example 89), Met-Ala-(15-125)hIL-3(18I, 25H, 29R, 32A, 37P, 42D, 45V, 46S, 50D, 51R, 55L, 60S, 62V,67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V,120Q and 123E) SEQ ID NO:283;PEPTIDE #B21: pMON13370 (Example 90), Met-Ala-(15-125)hIL-3(18I, 25H, 29R, 32A, 37P, 42A, 45M, 46S, 50D, 51R, 55L, 60S, 62V,67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V,120Q and 123E) SEQ ID NO:284;PEPTIDE #B22: pMON13373 (Example 91), Met-Ala-(15-125)hIL-3(18I, 25H, 29R, 32A, 37P, 42D, 45M, 46S, 50D, 51R, 55L, 60S, 62V,67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V,120Q and 123E) SEQ ID NO:285;PEPTIDE #B23: pMON13374 (Example 92), Met-Ala-(15-125)hIL-3(18I, 25H, 29R, 32A, 37P, 42S, 45M, 46S, 50D, 51R, 55L, 60S, 62V,67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V,120Q and 123E) SEQ ID NO:286;PEPTIDE #B24: pMON13375 (Example 93), Met-Ala-(15-119)hIL-3(18I, 25H, 29R, 32A, 37P, 42A, 45V, 51R, 55L, 60S, 62V, 67N, 69E,73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V,) SEQ IDNO:287;PEPTIDE #B25: pMON13376 (Example 94), Met-Asp-(15-119)hIL-3(18I, 23A, 25H, 29R, 32A, 37P, 42A, 45V, 51R, 55L, 60S, 62V, 67N,69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 112Q,116V) SEQ ID NO:288;PEPTIDE #B26: pMON13377 (Example 95), Met-Ala-(15-119)hIL-3(18I, 23A, 25H, 29R, 32A, 37P, 42D, 45V, 46S, 50D, 51R, 55L, 60S,62V, 67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E,112Q, 116V) SEQ ID NO:289;PEPTIDE #B27: pMON13378 (Example 96), Met-Asp-(15-119)hIL-3(18I, 23A, 25H, 29R, 32A, 37P, 42A, 45V, 51R, 55L, 60S, 62V, 67N,69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V) SEQID NO:290;PEPTIDE #B28: pMON13379 (Example 97), Met-Ala-(15-125)hIL-3(18I, 25H, 29R, 32A, 37P, 42A, 45V, 46S, 50D, 51R, 55L, 60S, 62V,67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 112Q,116V, 120Q and 123E) SEQ ID NO:291;PEPTIDE #B29: pMON13385 (Example 98), Met-Ala-(15-125)hIL-3(18I, 25H, 29V, 32R, 34S, 37P, 42A, 45V, 51R, 55L, 60S, 62V, 67N,69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V,120Q and 123E) SEQ ID NO:292;PEPTIDE #B30: pMON13381 (Example 99), Met-Ala-(15-125)hIL-3(18I, 25H, 29R, 32A, 37P, 42A, 45V, 51R, 55L, 60S, 62V, 67N, 69E,73G, 76A, 79R, 82W, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and123E) SEQ ID NO:293;PEPTIDE #B31: pMON13383 (Example 100), Met-Ala-(15-125)hIL-3(18I, 23A, 25H, 29R, 32A, 37P, 42D, 45V, 46S, 50D, 51R, 55L, 60S,62V, 67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E,112Q, 116V, 120Q and 123E) SEQ ID NO:294;PEPTIDE #B32: pMON13384 (Example 101), Met-Ala-(15-125)hIL-3(18I, 25H, 29R, 32A, 37P, 42A, 45V, 51R, 55L, 60S, 62V, 67N, 69E,73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 112Q, 116V,120Q and 123E) SEQ ID NO:295;PEPTIDE #B33: pMON13388 (Example 102), Met-Ala-(15-125)hIL-3(18I, 25H, 29R, 32A, 37P, 42A, 45V, 50D, 51R, 55L, 56S, 60S, 62V,67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V,120Q and 123E) SEQ ID NO:296;PEPTIDE #B34: pMON13389 (Example 103), Met-Ala-(15-125)hIL-3(18I, 25H, 29R, 32A, 37P, 42D, 45M, 51R, 55L, 60S, 62V, 67N, 69E,73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and123E) SEQ ID NO:297;PEPTIDE #B35: pMON13391 (Example 104), Met-Ala-(15-125)hIL-3(18I, 25H, 29R, 32A, 34S, 37P, 42A, 45V, 51R, 55L, 60S, 62V, 67N,69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V,120Q and 123E) SEQ ID NO:298;PEPTIDE #B36: pMON13392 (Example 105), Met-Ala-(15-125)hIL-3(18I, 25H, 29R, 32A, 37P, 42D, 45V, 51R, 55L, 60S, 62V, 67N, 69E,73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and123E) SEQ ID NO:299;PEPTIDE #B37: pMON13393 (Example 106), Met-Ala-(15-125)hIL-3(18I, 23A, 25H, 29R, 32A, 34S, 37P, 42D, 45M, 46S, 51R, 55L, 60S,62V, 67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E,116V, 120Q and 123E) SEQ ID NO:300;PEPTIDE #B38: pMON13394 (Example 107), Met-Ala-(15-125)hIL-3(18I, 25H, 29R, 32A, 37P, 42D, 45M, 46S, 51R, 55L, 60S, 62V, 67N,69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V,120Q and 123E) SEQ ID NO:301;PEPTIDE #B39: pMON13395 (Example 108), Met-Ala-(15-125)hIL-3(18I, 23A, 25H, 29V, 32R, 34S, 37P, 42D, 45V, 46S, 51R, 55L, 60S,62V, 67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E,116V, 120Q and 123E) SEQ ID NO:302;PEPTIDE #B40: pMON13396 (Example 109), Met-Ala-(15-125)hIL-3(18I, 25H, 29R, 32A, 37P, 42A, 45V, 51R, 55L, 60S, 62V, 67N, 69E,73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 100R, 101M,116V, 120Q and 123E) SEQ ID NO:303;PEPTIDE #B41: pMON13397 (Example 110), Met-Ala-(15-125)hIL-3(18I, 25H, 29R, 32A, 37P, 42A, 45V, 51R, 55L, 60S, 62V, 67N, 69E,73G, 76A, 79R, 82W, 87S, 93S, 98I, 101A, 105Q, 109E, 100R, 101M,116V, 120Q and 123E) SEQ ID NO:304;PEPTIDE #B42: pMON13398 (Example 111), Met-Ala-(15-125)hIL-3(18I, 25H, 29R, 32A, 37P, 42D, 45V, 46S, 51R, 55L, 60S, 62V, 67N,69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V,120Q and 123E) SEQ ID NO:305;PEPTIDE #B43: pMON13399 (Example 112), Met-Ala-(15-125)hIL-3(18I, 23A, 25H, 29V, 32R, 34S, 37P, 42D, 45V, 46S, 51R, 55L, 60S,62V, 67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E,116V, 120Q and 123E) SEQ ID NO:306;PEPTIDE #B44: pMON13404 (Example 113), Met-Ala-(15-119)hIL-3(18I, 25H, 29R, 32A, 37P, 42A, 45V, 51R, 55L, 60S, 62V, 67N, 69E,73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 112Q, 116V)SEQ ID NO:307;PEPTIDE #B45: pMON13387 (Example 114), Met-Ala-(15-125)hIL-3(18I, 25H, 29R, 32A, 37P, 42A, 45V, 50D, 51R, 55L, 60S, 62V, 67N,69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V,120Q and 123E) SEQ ID NO:308;PEPTIDE #B46: pMON13416 (Example 115), Met-Ala-(15-125)hIL-3(18I, 25H, 29R, 32A, 37P, 42D, 45V, 46S, 50D, 51R, 55L, 60S, 62V,67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V,120Q and 123E) SEQ ID NO:309;PEPTIDE #B47: pMON13417 (Example 116), Met-Ala-(15-125)hIL-3(18I, 25H, 29R, 32A, 37P, 42D, 45M, 46S, 50D, 51R, 55L, 60S, 62V,67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V,120Q and 123E) SEQ ID NO:310;PEPTIDE #B48: pMON13420 (Example 117), Met-Ala-(15-125)hIL-3(18I, 23A, 25H, 29R, 32A, 34S, 37P, 42D, 45V, 46S, 50D, 51R, 55L,56S, 60S, 62V, 67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A,105Q, 109E, 116V, 120Q and 123E) SEQ ID NO:311;PEPTIDE #B49: pMON13421 (Example 118), Met-Ala-(15-125)hIL-3(18I, 23A, 25H, 29R, 32A, 34S, 37P, 42D, 45M, 46S, 50D, 51R, 55L,56S, 60S, 62V, 67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A,105Q, 109E, 116V, 120Q and 123E) SEQ ID NO:331;PEPTIDE #B50: pMON13432 (Example 119), Met-Ala-(15-125)hIL-3(18I, 23A, 25H, 29R, 32A, 34S, 37P, 42D, 45M, 46S, 50D, 51R, 55L,60S, 62V, 67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q,109E, 116V, 120Q and 123E) SEQ ID NO:312;PEPTIDE #B51: pMON13382 (Example 120), Met-Ala-(15-125)hIL-3(18I, 25H, 29R, 32A, 37P, 42A, 45V, 51R, 55L, 60S, 62V, 67N, 69E,73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 112Q, 116W,120Q and 123E) SEQ ID NO:313;PEPTIDE #B52: pMON13476 (Example 85), Met-Asp-(15-125)hIL-3(18I, 23A, 25H, 29R, 32A, 37P, 42A, 45V, 51R, 55L, 60S, 62V, 67N,69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V,120Q and 123E) SEQ DI NO:314;PEPTIDE #B53: pMON13446 (Example 121), Met-Ala-Tyr-Pro-Glu-Thr-Asp-Tyr-Lys-Asp-Asp-Asp-Asp-Lys-(15-125)hIL-3 (18I, 25H, 29R, 32A,37P, 42A, 45V, 51R, 55L, 60S, 62V, 67N, 69E, 73G, 76A, 79R, 82Q,87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and 123E) SEQ IDNO:315;PEPTIDE #B54: pMON13390 (Example 122), Met-Ala-Tyr-Pro-Glu-Thr-Asp-Tyr-Lys-Asp-Asp-Asp-Asp-Lys-(15-125)hIL-3 (18I, 25H, 29R, 32N,37P, 42S, 45M, 51R, 55T, 59L, 62V, 67H, 69E, 73G, 76A, 79R, 82Q,87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and 123E) SEQ IDNO:316;PEPTIDE #C-2: pMON13400 (Example 124), Met-Ala-(15-125)hIL-3(18I, 20P, 23A, 25H, 29I, 32N, 34S, 37S, 38A, 42S, 45V, 46S, 51R, 55T,59L, 62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q,109E, 116V, 120Q and 123E) SEQ ID NO:317;PEPTIDE #C-3: pMON13402 (Example 125), Met-Ala-(15-125)hIL-3(18I, 23L, 25H, 29I, 32N, 34S, 37S, 38A, 42S, 45V, 46S, 51R, 55T, 59L,62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E,116V, 120Q and 123E) SEQ ID NO:318;PEPTIDE #C-10: pMON13440 (Example 131), Met-Ala-(15-125)hIL-3(18I, 23A, 25H, 29I, 32N, 34S, 37S, 38A, 42S, 45V, 46S, 51R, 55T, 59L,62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E,116V, 120Q and 123E) SEQ ID NO:319;PEPTIDE #C-11: pMON13451 (Example 132), Met-Ala-(15-125)hIL-3(18I, 19I, 20L, 23A, 25H, 29I, 32N, 34S, 37S, 38A, 42S, 45V, 46S, 51R,55T, 59L, 62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A,105Q, 109E, 116V, 120Q and 123E) SEQ ID NO:320;PEPTIDE #C-4: pMON13403 (Example 126), Met-Ala-(15-125)hIL-3(18I, 25H, 29R, 32N, 37P, 42S, 45M, 50D, 51S, 55T, 59L, 62P, 63H,67Q, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V,120Q and 123E) SEQ ID NO:321;PEPTIDE #C-5: pMON13411 (Example 127), Met-Ala-(15-125)hIL-3(18I, 25H, 29R, 32N, 37P, 42S, 45M, 51R, 55T, 59L, 62V, 67H, 69E,73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109L, 112Q, 116S,120Q and 123E) SEQ ID NO:322;PEPTIDE #C-6: pMON13412 (Example 128), Met-Ala-(15-118)hIL-3(18I, 25H, 29R, 32N, 37P, 42S, 45M, 51R, 55T, 59L, 62V, 67H, 69E,73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109L, 112Q, 116S)SEQ ID NO:323.______________________________________
TABLE 4______________________________________DNA SEQUENCESThe numbering of the mutated amino acid positions in themodified hIL-3 proteins corresponds to the sequence ofthe full-length, native (1-133)hIL-3.______________________________________DNA Sequence #1: pMON13287 (Example 33), encoding Met-Ala-(15-125)hIL-3 (18I, 25H, 29R, 32A, 37P, 42A, 45V, 51R, 55L, 60S, 62V,67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E,116V, 120Q and 123E) SEQ ID NO:97;DNA Sequence #2: pMON13290 (Example 36), encoding Met-Ala-(15-125)hIL-3 (18I, 25H, 29R, 32A, 37P, 42A, 45V, 51R, 55L, 60S, 62V,67N, 69E, 73G, 76A, 79R, 82V, 87S, 93S, 98T, 101A, 105Q, 109E,116V, 120Q and 123E) SEQ ID NO:98;DNA Sequence #3: pMON13313 (Example 41), encoding Met-Ala-(15-125)hIL-3 (18I, 25H, 29R, 32A, 37P, 42A, 45V, 51R, 55L, 60S, 62V,67N, 69E, 73G, 76A, 79R, 82V, 87S, 93S, 98T, 101A, 105Q, 109E,116V, 117S, 120H and 123E) SEQ ID NO:98;DNA Sequence #4: pMON13288 (Example 34), encoding Met-Ala-(15-125)hIL-3 (18I, 25H, 29R, 32N, 37P, 42S, 45M, 51R, 55T, 59L,62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E,116V, 120Q and 123E) SEQ ID NO:100;DNA Sequence #5: pMON13312 (Example 40), encoding Met-Ala-(15-125)hIL-3 (18I, 25H, 29R, 32N, 37P, 42S, 45M, 51R, 55T, 59L,62V, 67H, 69E, 73G, 76A, 79R, 82V, 87S, 93S, 98T, 101A, 105Q, 109E,116V, 120Q and 123E) SEQ ID NO:101;DNA Sequence #6: pMON13294 (Example 38), encoding Met-Ala-(15-125)hIL-3 (18I, 25H, 29R, 32N, 37P, 42S, 45M, 51R, 55T, 59L,62V, 67H, 69E, 73G, 76A, 79R, 82V, 87S, 93S, 98T, 101A, 105Q, 109E,116V, 117S, 120H and 123E) SEQ ID NO:102;DNA Sequence #7: pMON13289 (Example 35), encoding Met-Ala-(15-125)hIL-3 (18I, 25H, 29V, 32A, 37S, 42S, 45M, 51R, 55L, 59L,62V, 67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E,116V, 120Q and 123E) SEQ ID NO:103;DNA Sequence #8: pMON13292 (Example 37), encoding Met-Ala-(15-125)hIL-3 (18I, 25H, 29V, 32A, 37S, 42S, 45M, 51R, 55L, 59L,62V, 67N, 69E, 73G, 76A, 79R, 82V, 87S, 93S, 98T, 101A, 105Q, 109E,116V, 120Q and 123E) SEQ ID NO:104;DNA Sequence #9: pMON13295 (Example 39), encoding Met-Ala-(15-125)hIL-3 (18I, 25H, 29V, 32A, 37S, 42S, 45M, 51R, 55L, 59L,62V, 67N, 69E, 73G, 76A, 79R, 82V, 87S, 93S, 98T, 101A, 105Q, 109E,116V, 117S, 120H and 123E) SEQ ID No:105;DNA Sequence #10: pMON13344 (Example 8), (15-125)hIL-3 (18I, 25H,29R, 32A, 37P, 42A and 45V) SEQ ID NO:106;DNA Sequence #11: pMON13345 (Example 9), (15-125)hIL-3 (18I, 25H,29R, 32N, 37P, 42S and 45M) SEQ ID NO:107;DNA Sequence #12: pMON13346 (Example 10), (15-125)hIL-3 (18I,25H, 29V, 32A, 37S, 42S and 45M) SEQ ID NO:108;DNA Sequence #13: pMON13347 (Example 12), (15-125)hIL-3 (51R,55L, 59L, 62V, 67N and 69E) SEQ ID NO:109;DNA Sequence #14: pMON13348 (Example 13), (15-125)hIL-3 (51R,55L, 60S, 62V, 67N and 69E) SEQ ID NO:110;DNA Sequence #15: pMON13349 (Example 14), (15-125)hIL-3 (51R,55T, 59L, 62V, 67H and 69E) SEQ ID NO:111;DNA Sequence #16: pMON13350 (Example 16), (15-125)hIL-3 (73G,76A, 79R, 82Q, 87S, 93S, 98I, 101A and 105Q) SEQ ID NO:112;DNA Sequence #17: pMON13355 (Example 17), (15-125)hIL-3 (73G,76A, 79R, 82V, 87S, 93S, 98T, 101A and 105Q) SEQ ID NO:113;DNA Sequence #18: pMON13352 (Example 19), (15-125)hIL-3 (109E,116V, 120Q and 123E) SEQ ID NO:114;DNA Sequence #19: pMON13354 (Example 20), (15-125)hIL-3 (109E,116V, 117S, 120H and 123E) SEQ ID NO:115;DNA Sequence #20: pMON13363 (Example 24), (15-125)hIL-3 (18I,25H, 29R, 32A, 37P, 42A, 45V, 51R, 55L, 60S, 62V, 67N and 69E)SEQ ID NO:116;DNA Sequence #21: pMON13364 (Example 25), (15-125)hIL-3 (18I,25H, 29R, 32N, 37P, 42S, 45M, 51R, 55T, 59L, 62V, 67H and 69E)SEQ ID NO:117;DNA Sequence #22: pMON13365 (Example 26), (15-125)hIL-3 (18I,25H, 29V, 32A, 37S, 42S, 45M, 51R, 55L, 59L, 62V, 67N and 69E)SEQ ID NO:118;DNA Sequence #23: pMON13360 (Example 21), (15-125)hIL-3 (73G,76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and123E) SEQ ID NO:119;DNA Sequence #24: pMON13361 (Example 22), (15-125)hIL-3 (73G,76A, 79R, 82V, 87S, 93S, 98T, 101A, 105Q, 109E, 116V, 120Q and123E) SEQ ID NO:120;DNA Sequence #25: pMON13362 (Example 23), (15-125)hIL-3 (73G,76A, 79R, 82V, 87S, 93S, 98T, 101A, 105Q, 109E, 116V, 117S, 120Hand 123E) SEQ ID NO:121;DNA Sequence #26: pMON13301 (Example 30), encoding Met-Ala-(15-125)hIL-3 (18I, 25H, 29R, 32A, 37P, 42A, 45V, 51R, 55L, 60S, 62V,67N and 69E) SEQ ID NO:122;DNA Sequence #27: pMON13302 (Example 31), encoding Met-Ala-(15-125)hIL-3 (18I, 25H, 29R, 32N, 37P, 42S, 45M, 51R, 55T, 59L,62V, 67H and 69E) SEQ ID NO:123;DNA Sequence #28: pMON13303 (Example 32), encoding Met-Ala-(15-125)hIL-3 (18I, 25H, 29V, 32A, 37S, 42S, 45M, 51R, 55L, 59L,62V, 67N and 69E) SEQ ID NO:124;DNA Sequence #29: pMON13298 (Example 27), encoding Met-Ala-(15-125)hIL-3 (73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E,116V, 120Q and 123E) SEQ ID NO:125;DNA Sequence #30: pMON13299 (Example 28), encoding Met-Ala-(15-125)hIL-3 (73G, 76A, 79R, 82V, 87S, 93S, 98T, 101A, 105Q, 109E,116V, 120Q and 123E); SEQ ID NO:126;DNA Sequence #31: pMON13300 (Example 29), encoding Met-Ala-(15-125)hIL-3 (73G, 76A, 79R, 82V, 87S, 93S, 98T, 101A, 105Q, 109E,116V, 117S, 120H and 123E) SEQ ID NO:127;DNA Sequence #33: pMON13438 (Example 59), encoding Met-Ala-(15-125)hIL-3 (18I, 25H, 29R, 32N, 37P, 42S, 45M, 51R, 55T, 59L,62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E,116V, 120Q and 123E) SEQ ID NO:161;DNA Sequence #A3: pMON13285 (Example 60), encoding Met-Ala-(15-125)hIL-3 (42D, 45M, 46S, 50D) SEQ ID NO:398;DNA Sequence #A4: pMON13286 (Example 61), encoding Met-Ala-(15-125)hIL-3 (42D, 45M, 46S) SEQ ID NO:399;DNA Sequence #B1: pMON13406 (Example 69), encoding Met-Ala-(15-125)hIL-3 (18I, 19A, 25H, 29R, 32N, 37P, 42S, 45M, 51R, 55T,59L, 62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q,109E, 116V, 120Q and 123E) SEQ ID NO:332;DNA Sequence #B2: pMON13414 (Example 70), encoding Met-Ala-(15-125)hIL-3 (18I, 19I, 25H, 29R, 32N, 37P, 42S, 45M, 51R, 55T, 59L,62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E,116V, 120Q and 123E) SEQ ID NO:333;DNA Sequence #B3: pMON13407 (Example 71), encoding Met-Ala-(15-125)hIL-3 (18I, 25H, 29R, 32N, 37P, 42S, 45V, 51R, 55T, 59L, 62V,67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E,116V, 120Q and 123E) SEQ ID NO:334;DNA Sequence #B4: pMON13405 (Example 72), encoding Met-Ala-(15-125)hIL-3 (18I, 19A, 25H, 29R, 32N, 37P, 42S, 45V, 51R, 55T, 59L,62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E,116V, 120Q and 123E) SEQ ID NO:335;DNA Sequence #B5: pMON13415 (Example 73), encoding Met-Ala-(15-125)hIL-3 (18I, 19I, 25H, 29R, 32N, 37P, 42S, 45V, 51R, 55T, 59L,62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E,116V, 120Q and 123E) SEQ ID NO:336;DNA Sequence #B6: pMON13408 (Example 74), encoding Met-Ala-(15-125)hIL-3 (18I, 25H, 29R, 32N, 37P, 42S, 45M, 49I, 51R, 55T, 59L,62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E,116V, 120Q and 123E) SEQ ID NO:337;DNA Sequence #B7: pMON13409 (Example 75), encoding Met-Ala-(15-125)hIL-3 (18I, 25H, 29R, 32N, 37P, 42S, 45M, 49L, 51R, 55T, 59L,62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E,116V, 120Q and 123E) SEQ ID NO:338;DNA Sequence #B8: pMON13410 (Example 76), encoding Met-Ala-(15-125)hIL-3 (18I, 25H, 29R, 32N, 37P, 42S, 45M, 49D, 51R, 55T,59L, 62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q,109E, 116V, 120Q and 123E) SEQ ID NO:339;DNA Sequence #B9: pMON13422 (Example 77), encoding Met-Ala-(15-125)hIL-3 (18I, 19A, 25H, 29R, 32N, 37P, 42S, 45V, 49I, 51R, 55T,59L, 62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q,109E, 116V, 120Q and 123E) SEQ ID NO:340;DNA Sequence #B10: pMON13423 (Example 78), encoding Met-Ala-(15-125)hIL-3 (18I, 19I, 25H, 29R, 32N, 37P, 42S, 45V, 49I, 51R, 55T,59L, 62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q,109E, 116V, 120Q and 123E) SEQ ID NO:341;DNA Sequence #B11: pMON13424 (Example 79), encoding Met-Ala-(15-125)hIL-3 (18I, 19A, 25H, 29R, 32N, 37P, 42S, 45V, 49L, 51R, 55T,59L, 62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q,109E, 116V, 120Q and 123E) SEQ ID NO:342;DNA Sequence #B12: pMON13425 (Example 80), encoding Met-Ala-(15-125)hIL-3 (18I, 19I, 25H, 29R, 32N, 37P, 42S, 45V, 49L, 51R, 55T,59L, 62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q,109E, 116V, 120Q and 123E) SEQ ID NO:343;DNA Sequence #B13: pMON13426 (Example 81), encoding Met-Ala-(15-125)hIL-3 (18I, 19A, 25H, 29R, 32N, 37P, 42S, 45V, 49D, 51R, 55T,59L, 62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q,109E, 116V, 120Q and 123E) SEQ ID NO:344;DNA Sequence #B14: pMON13429 (Example 82), encoding Met-Ala-(15-125)hIL-3 (18I, 19I, 25H, 29R, 32N, 37P, 42S, 45V, 49D, 51R, 55T,59L, 62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q,109E, 116V, 120Q and 123E) SEQ ID NO:345;DNA Sequence #B15: pMON13368 (Example 83), encoding Met-Ala-(15-125)hIL-3 (18I, 23A, 25H, 29V, 32A, 37S, 42S, 45M, 51R, 55L,59L, 62V, 67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q,109E, 116V, 120Q and 123E) SEQ ID NO:346;DNA Sequence #B16: pMON13380 (Example 84), encoding Met-Ala-(15-125)hIL-3 (18I, 23A, 25H, 29V, 32A, 37S, 42S, 45M, 51R, 55L,59L, 62V, 67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q,109E, 112Q, 116V, 120Q and 123E) SEQ ID NO:347;DNA Sequence #B17: pMON13475 (Example 86), encoding Met-Ala-(15-125)hIL-3 (18I, 23A, 25H, 29R, 32A, 37P, 42D, 45V, 46S, 50D,51R, 55L, 60S, 62V, 67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I,101A, 105Q, 109E, 116V, 120Q and 123E) SEQ ID NO:348;DNA Sequence #B18: pMON13366 (Example 87), encoding Met-Ala-(15-125)hIL-3 (18I, 25H, 29R, 32A, 37P, 42N, 45V, 46S, 50D, 51R, 55L,60S, 62V, 67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q,109E, 116V, 120Q and 123E) SEQ ID NO:349;DNA Sequence #B19: pMON13367 (Example 88), encoding Met-Ala-(15-125)hIL-3 (18I, 25H, 29R, 32A, 37P, 42A, 45V, 46S, 50D, 51R, 55L,60S, 62V, 67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q,109E, 116V, 120Q and 123E) SEQ ID NO:350;DNA Sequence #B20: pMON13369 (Example 89), encoding Met-Ala-(15-125)hIL-3 (18I, 25H, 29R, 32A, 37P, 42D, 45V, 46S, 50D, 51R, 55L,60S, 62V, 67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q,109E, 116V, 120Q and 123E) SEQ ID NO:351;DNA Sequence #B21: pMON13370 (Example 90), encoding Met-Ala-(15-125)hIL-3 (18I, 25H, 29R, 32A, 37P, 42A, 45M, 46S, 50D, 51R,55L, 60S, 62V, 67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A,105Q, 109E, 116V, 120Q and 123E) SEQ ID NO:352;DNA Sequence #B22: pMON13373 (Example 91), encoding Met-Ala-(15-125)hIL-3 (18I, 25H, 29R, 32A, 37P, 42D, 45M, 46S, 50D, 51R,55L, 60S, 62V, 67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A,105Q, 109E, 116V, 120Q and 123E) SEQ ID NO:353;DNA Sequence #B23: pMON13374 (Example 92), encoding Met-Ala-(15-125)hIL-3 (18I, 25H, 29R, 32A, 37P, 42S, 45M, 46S, 50D, 51R, 55L,60S, 62V, 67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q,109E, 116V, 120Q and 123E) SEQ ID NO:354;DNA Sequence #B24: pMON13375 (Example 93), encoding Met-Ala-(15-119)hIL-3 (18I, 25H, 29R, 32A, 37P, 42A, 45V, 51R, 55L, 60S, 62V,67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E,116V,) SEQ ID NO:355;DNA sequence #B25: pMON13376 (Example 94), Met-Asp-(15-119)hIL-3 (18I, 23A, 25H, 29R, 32A, 37P, 42A, 45V, 51R, 55L, 60S,62V, 67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E,112Q, 116V) SEQ ID NO:356;DNA Sequence #B26: pMON13377 (Example 95), encoding Met-Ala-(15-119)hIL-3 (18I, 23A, 25H, 29R, 32A, 37P, 42D, 45V, 46S, 50D,51R, 55L, 60S, 62V, 67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I,101A, 105Q, 109E, 112Q, 116V) SEQ ID NO:357;DNA Sequence #B27: pMON13378 (Example 96), Met-Asp-(15-119)hIL-3 (18I, 23A, 25H, 29R, 32A, 37P, 42A, 45V, 51R, 55L, 60S,62V, 67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E,116V) SEQ ID NO:358;DNA sequence #B28: pMON13379 (Example 97), encoding Met-Ala-(15-125)hIL-3 (18I, 25H, 29R, 32A, 37P, 42A, 45V, 46S, 50D, 51R, 55L,60S, 62V, 67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q,109E, 112Q, 116V, 120Q and 123E) SEQ ID NO:359;DNA sequence #B29: pMON13385 (Example 98), encoding Met-Ala-(15-125)hIL-3 (18I, 25H, 29V, 32R, 34S, 37P, 42A, 45V, 51R, 55L, 60S,62V, 67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E,116V, 120Q and 123E) SEQ ID NO:360;DNA Sequence #B30: pMON13381 (Example 99), encoding Met-Ala-(15-125)hIL-3 (18I, 25H, 29R, 32A, 37P, 42A, 45V, 51R, 55L, 60S, 62V,67N, 69E, 73G, 76A, 79R, 82W, 87S, 93S, 98I, 101A, 105Q, 109E,116V, 120Q and 123E) SEQ ID NO:361;DNA Sequence #B31: pMON13383 (Example 100), encoding Met-Ala-(15-125)hIL-3 (18I, 23A, 25H, 29R, 32A, 37P, 42D, 45V, 46S, 50D,51R, 55L, 60S, 62V, 67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I,101A, 105Q, 109E, 112Q, 116V, 120Q and 123E) SEQ ID NO:362;DNA Sequence #B32: pMON13384 (Example 101), encoding Met-Ala-(15-125)hIL-3 (18I, 25H, 29R, 32A, 37P, 42A, 45V, 51R, 55L, 60S, 62V,67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E,112Q, 116V, 120Q and 123E) SEQ ID NO:363;DNA Sequence #B33: pMON13388 (Example 102), encoding Met-Ala-(15-125)hIL-3 (18I, 25H, 29R, 32A, 37P, 42A, 45V, 50D, 51R, 55L, 56S,60S, 62V, 67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q,109E, 116V, 120Q and 123E) SEQ ID NO:346;DNA Sequence #B34: pMON13389 (Example 103), encoding Met-Ala-(15-125)hIL-3 (18I, 25H, 29R, 32A, 37P, 42D, 45M, 51R, 55L, 60S,62V, 67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E,116V, 120Q and 123E) SEQ ID NO:365;DNA Sequence #B35: pMON13391 (Example 104), encoding Met-Ala-(15-125)hIL-3 (18I, 25H, 29R, 32A, 34S, 37P, 42A, 45V, 51R, 55L, 60S,62V, 67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E,116V, 120Q and 123E) SEQ ID NO:366;DNA Sequence #B36: pMON13392 (Example 105), encoding Met-Ala-(15-125)hIL-3 (18I, 25H, 29R, 32A, 37P, 42D, 45V, 51R, 55L, 60S, 62V,67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E,116V, 120Q and 123E) SEQ ID NO:367;DNA Sequence #B37: pMON13393 (Example 106), encoding Met-Ala-(15-125)hIL-3 (18I, 23A, 25H, 29R, 32A, 34S, 37P, 42D, 45M, 46S,51R, 55L, 60S, 62V, 67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I,101A, 105Q, 109E, 116V, 120Q and 123E) SEQ ID NO:368;DNA Sequence #B38: pMON13394 (Example 107), encoding Met-Ala-(15-125)hIL-3 (18I, 25H, 29R, 32A, 37P, 42D, 45M, 46S, 51R, 55L, 60S,62V, 67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E,116V, 120Q and 123E) SEQ ID NO:369;DNA Sequence #B39: pMON13395 (Example 108), encoding Met-Ala-(15-125)hIL-3 (18I, 23A, 25H, 29V, 32R, 34S, 37P, 42D, 45V, 46S, 51R,55L, 60S, 62V, 67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A,105Q, 109E, 116V, 120Q and 123E) SEQ ID NO:370;DNA Sequence #B40: pMON13396 (Example 109), encoding Met-Ala-(15-125)hIL-3 (18I, 25H, 29R, 32A, 37P, 42A, 45V, 51R, 55L, 60S, 62V,67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E,100R, 101M, 116V, 120Q and 123E) SEQ ID NO:371;DNA Sequence #B41: pMON13397 (Example 110), encoding Met-Ala-(15-125)hIL-3 (18I, 25H, 29R, 32A, 37P, 42A, 45V, 51R, 55L, 60S, 62V,67N, 69E, 73G, 76A, 79R, 82W, 87S, 93S, 98I, 101A, 105Q, 109E,100R, 101M, 116V, 120Q and 123E) SEQ ID NO:372;DNA Sequence #B42: pMON13398 (Example 111), encoding Met-Ala-(15-125)hIL-3 (18I, 25H, 29R, 32A, 37P, 42D, 45V, 46S, 51R, 55L, 60S,62V, 67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E,116V, 120Q and 123E) SEQ ID NO:373;DNA Sequence #B43: pMON13399 (Example 112), encoding Met-Ala-(15-125)hIL-3 (18I, 23A, 25H, 29V, 32R, 34S, 37P, 42D, 45V, 46S, 51R,55L, 60S, 62V, 67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A,105Q, 109E, 116V, 120Q and 123E) SEQ ID NO:374;DNA Sequence #B44: pMON13404 (Example 113), encoding Met-Ala-(15-119)hIL-3 (18I, 25H, 29R, 32A, 37P, 42A, 45V, 51R, 55L, 60S, 62V,67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E,112Q, 116V) SEQ ID NO:375;DNA Sequence #B45: pMON13387 (Example 114), encoding Met-Ala-(15-125)hIL-3 (18I, 25H, 29R, 32A, 37P, 42A, 45V, 50D, 51R, 55L, 60S,62V, 67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E,116V, 120Q and 123E) SEQ ID NO:376;DNA Sequence #B46: pMON13416 (Example 115), encoding Met-Ala-(15-125)hIL-3 (18I, 25H, 29R, 32A, 37P, 42D, 45V, 46S, 50D, 51R, 55L,60S, 62V, 67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q,109E, 116V, 120Q and 123E) SEQ ID NO:377;DNA Sequence #B47: pMON13417 (Example 116), encoding Met-Ala-(15-125)hIL-3 (18I, 25H, 29R, 32A, 37P, 42D, 45M, 46S, 50D, 51R,55L, 60S, 62V, 67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A,105Q, 109E, 116V, 120Q and 123E) SEQ ID NO:378;DNA Sequence #B48: pMON13420 (Example 117), encoding Met-Ala-(15-125)hIL-3 (18I, 23A, 25H, 29R, 32A, 34S, 37P, 42D, 45V, 46S, 50D,51R, 55L, 56S, 60S, 62V, 67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S,98I, 101A, 105Q, 109E, 116V, 120Q and 123E) SEQ ID NO:379;DNA Sequence #B49: pMON13421 (Example 118), encoding Met-Ala-(15-125)hIL-3 (18I, 23A, 25H, 29R, 32A, 34S, 37P, 42D, 45M, 46S,50D, 51R, 55L, 56S, 60S, 62V, 67N, 69E, 73G, 76A, 79R, 82Q, 87S,93S, 98I, 101A, 105Q, 109E, 116V, 120Q and 123E) SEQ ID NO:380;DNA Sequence #B50: pMON13432 (Example 119), encoding Met-Ala-(15-125)hIL-3 (18I, 23A, 25H, 29R, 32A, 34S, 37P, 42D, 45M, 46S,50D, 51R, 55L, 60S, 62V, 67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I,101A, 105Q, 109E, 116V, 120Q and 123E) SEQ ID NO:381;DNA Sequence #B51: pMON13382 (Example 120), encoding Met-Ala-(15-125)hIL-3 (18I, 25H, 29R, 32A, 37P, 42A, 45V, 51R, 55L, 60S, 62V,67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E,112Q, 116W, 120Q and 123E) SEQ ID NO:382;DNA Sequence #B52: pMON13476 (Example 85), Met-Asp-(15-(15-125)hIL-3 (18I, 23A, 25H, 29R, 32A, 37P, 42A, 45V, 51R, 55L, 60S,62V, 67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E,116V, 120Q and 123E) SEQ DI NO:383;DNA Sequence #B53: pMON13446 (Example 121), encoding Met-Ala-Tyr-Pro-Glu-Thr-Asp-Tyr-Lys-Asp-Asp-Asp-Asp-Lys-(15-125)hIL-3(18I, 25H, 29R, 32A, 37P, 42A, 45V, 51R, 55L, 60S, 62V, 67N, 69E,73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and123E) SEQ ID NO:404;DNA Sequence #B54: pMON13390 (Example 122), encoding Met-Ala-Tyr-Pro-Glu-Thr-Asp-Tyr-Lys-Asp-Asp-Asp-Asp-Lys-(15-125)hIL-3(18I, 25H, 29R, 32N, 37P, 42S, 45M, 51R, 55T, 59L, 62V, 67H, 69E,73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and123E) SEQ ID NO:405;DNA Sequence #C-1: pMON13418 (Example 123), encoding Met-Ala-(15-125)hIL-3 (18I, 25H, 29R, 32N, 37P, 42S, 45M, 51R, 55T, 59L,62V, 67H, 69E, 73G, 76P, 793, 82Q, 85V, 87Y, 88W, 91P, 93S, 95T,98T, 101A, 105Q, 109E, 116V, 120Q and 123E) SEQ ID NO:393;DNA Sequence #C-2: pMON13400 (Example 124), encoding Met-Ala-(15-125)hIL-3 (18I, 20P, 23A, 25H, 29I, 32N, 34S, 37S, 38A, 42S, 45V,46S, 51R, 55T, 59L, 62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S,98I, 101A, 105Q, 109E, 116V, 120Q and 123E) SEQ ID NO:384;DNA Sequence #C-3: pMON13402 (Example 125), encoding Met-Ala-(15-125)hIL-3 (18I, 23L, 25H, 29I, 32N, 34S, 37S, 38A, 42S, 45V, 46S,51R, 55T, 59L, 62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I,101A, 105Q, 109E, 116V, 120Q and 123E) SEQ ID NO:385;DNA Sequence #C-4: pMON13403 (Example 126), encoding Met-Ala-(15-125)hIL-3 (18I, 25H, 29R, 32N, 37P, 42S, 45M, 50D, 51S, 55T, 59L,62P, 63H, 67Q, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q,109E, 116V, 120Q and 123E) SEQ ID NO:388;DNA Sequence #C-5: pMON13411 (Example 127), encoding Met-Ala-(15-125)hIL-3 (18I, 25H, 29R, 32N, 37P, 42S, 45M, 51R, 55T, 59L,62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109L,112Q, 116S, 120Q and 123E) SEQ ID NO:390;DNA Sequence #C-6: pMON13412 (Example 128), encoding Met-Ala-(15-118)hIL-3 (18I, 25H, 29R, 32N, 37P, 42S, 45M, 51R, 55T, 59L,62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109L,112Q, 116S) SEQ ID NO:391;DNA Sequence #C-7: pMON13413 (Example 129), encoding Met-Ala-(15-125)hIL-3 (18I, 25H, 29R, 32N, 37P, 42S, 45M, 51R, 55T, 59L,62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E,116V, 120Q and 123E) SEQ ID NO:392;DNA Sequence #C-8: pMON13419 (Example 126), encoding Met-Ala-(15-125)hIL-3 (18I, 25H, 29R, 32N, 37P, 42S, 45M, 50D, 51S, 55T, 59L,62P, 63H, 65S, 67Q, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A,105Q, 109E, 116V, 120Q and 123E) SEQ ID NO:389;DNA Sequence #C-9: pMON13428 (Example 133), encoding Met-Ala-(15-125)hIL-3 (18I, 25H, 29R, 32N, 37P, 42S, 45M, 51R, 55T, 59L,62V, 67H, 69E, 73G, 76P, 79S, 82Q, 85V, 87Y, 91P, 93S, 95T, 98T,101A, 105Q, 109L, 112Q, 116S, 120Q and 123E) SEQ ID NO:394;DNA Sequence #C-10: pMON13440 (Example 131), encoding Met-Ala-(15-125)hIL-3 (18I, 23A, 25H, 29I, 32N, 34S, 37S, 38A, 42S, 45V, 46S,51R, 55T, 59L, 62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I,101A, 105Q, 109E, 116V, 120Q and 123E) SEQ ID NO:386;DNA Sequence #C-11: pMON13451 (Example 132), encoding Met-Ala-(15-125)hIL-3 (18I, 19I, 20L, 23A, 25H, 29I, 32N, 34S, 37S, 38A, 42S,45V, 46S, 51R, 55T, 59L, 62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S,93S, 98I, 101A, 105Q, 109E, 116V, 120Q and 123E) SEQ ID NO:387;DNA Sequence #C-12: pMON13459 (Example 134), encoding Met-Ala-(15-125)hIL-3 (18I, 23L, 25H, 29I, 32N, 34S, 37S, 38A, 42S, 45V, 46S,51R, 55T, 59L, 62V, 67H, 69E, 73G, 76P, 79S, 82Q, 85V, 87Y, 91P,93S, 95T, 98T, 101A, 105Q, 109L, 112Q, 116S, 120Q and 123E) SEQ IDNO:395;DNA Sequence #C-13: pMON13467 (Example 135), encoding Met-Ala-(15-125)hIL-3 (18I, 23L, 25H, 29I, 32N, 34S, 37S, 38A, 42S, 45V, 46S,51R, 55T, 59L, 62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I,101A, 105Q, 109L, 112Q, 116S, 120Q and 123E) SEQ ID NO:396;DNA Sequence #C-14: pMON13492 (Example 136), encoding Met-Ala-(15-125)hIL-3 (18I, 23L, 25H, 29I, 32N, 34S, 37S, 38A, 42S, 45V, 46S,51R, 55T, 59L, 62V, 67H, 69E, 73G, 76P, 79S, 82Q, 85V, 87Y, 91P,93S, 95T, 98T, 101A, 105Q, 109E, 116V, 120Q and 123E) SEQ IDNO:397.______________________________________
Polypeptides corresponding to [SEQ ID NO. 129] comprising (1-133)hIL-3 containing four or more amino acid substitutions can be made using the procedures described above and in the following examples by starting with the appropriate oligonuctiotides and then constructing the DNA encoding the polypeptide and expressing it in an appropriate host cell. In a similar manner polypeptides which correspond to [SEQ ID NO. 130] and contain four or more amino acid substitutions and wherein from 1 to 14 amino acids have been sequentially deleted from the N-terminus, or from 1 to 15 amino acids have been deleted from the C-terminus or deletions of amino acids have been made from both the N-terminus and the C-terminus can also be made by following the procedures described above and in the following examples, beginning with the appropriate starting materials.
Further details known to those skilled in the art may be found in T. Maniatis, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory (1982) and references cited therein, incorporated herein by reference; and in J. Sambrook, et al., Molecular Cloning, A Laboratory Manual, 2nd edition, Cold Spring Harbor Laboratory (1989) and references cited therein, incorporated herein by reference.
The following examples will illustrate the invention in greater detail although it will be understood that the invention is not limited to these specific examples.
Amino acids are shown herein by standard one letter or three letter abbreviations as follows:
______________________________________Abbreviated Designation Amino Acid______________________________________A Ala AlanineC Cys CysteineD Asp Aspartic acidE Glu Glutamic acidF Phe PhenylalanineG Gly GlycineH His HistidineI Ile IsoleucineK Lys LysineL Leu LeucineM Met MethionineN Asn AsparagineP Pro ProlineQ Gln GlutamineR Arg ArginineS Ser SerineT Thr ThreonineV Val ValineW Trp TryptophanY Tyr Tyrosine______________________________________
Various other examples will be apparent to the person skilled in the art after reading the present disclosure without departing from the spirit and scope of the invention. It is intended that all such other examples be included within the scope of the appended claims.
References
Adams, S. P., Kavka, K. S., Wykes, E. J., Holder, S. B. and Galluppi, G. R. Hindered Dialkyamino Nucleoside Phosphate reagents in the synthesis of two DNA 51-mers. J. Am. Chem. Soc., 105, 661-663 (1983).
Atkinson, T. and Smith, M., in Gait, M. J., Oligonucleotide Sythesis (1984) (IRL Press, Oxford England).
Bachmann, B., Pedigrees of some mutant strains of Escherichia coli K-12, Bacteriological Reviews, 36:525-557 (1972).
Bayne, M. L., Expression of a synthetic gene encoding human insulin-like growth factor I in cultured mouse fibroblasts. Proc. Natl. Acad. Sci. USA 84, 2638-2642 (1987).
Ben-Bassat, A., K. Bauer, S -Y. Chang, K. Myambo, A. Boosman and S. Ching. Processing of the initiating methionine from proteins: properties of the Escherichia coli methionine aminopeptidase and its gene structure. J. Bacteriol., 169: 751-757 (1987).
Biesma, B. et al., Effects of interleukin-3 after chemotherapy for advanced ovarian cancer. Blood, 80:1141-1148 (1992).
Birnboim, H. C. and J. Doly. A rapid alkaline extraction method for screening recombinant plasmid DNA. Nucleic Acids Research, 7(6): 1513-1523 (1979).
Bradford, M. M., A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding, Analytical Biochemistry, 72: 248-254 (1976).
Clark-Lewis, I., L. E. Hood and S. B. H. Kent. Role of disulfide bridges in determining the biological activity of interleukin 3, Proc. Natl. Acad. Sci., 85: 7897-7901 (1988).
Clement, J. M. and Hofnung, M. Gene sequence of the receptor, an outer membrane protein of E. coli K12. Cell, 27: 507-514 (1981).
Covarrubias, L., L. Cervantes, A. Covarrubias, X. Soberon, I. Vichido, A. Blanco, Y. M. Kupersztoch-Portnoy and F. Bolivar. Construction and characterization of new cloning vehicles. V. Mobilization and coding properties of pBR322 and several deletion derivates including pBR327 and pBR328. Gene 13: 25-35 (1981).
Deng, W. P. & Nickoloff, J. A. Site-directed mutagenesis of virtually any plasmid by eliminating a unique site Anal. Biochem. 200:81 (1992).
Dente, L., G. Cesareni and R. Cortese, pEMBL: a new family of single stranded plasmids, Nucleic Acids Research, 11: 1645-1655 (1983).
Dunn, J. J. and Studier, F. W., Complete nucleotide sequence of bacteriophage T7 DNA and the locations of T7 genetic elements. J. Mol. Biol. 166:477-535 (1983).
Falk, S., G. Seipelt, A. Ganser, O. G. Ottmann, D. Hoelzer, H. J. Stutte and K. Hubner. Hematopathology 95: 355 (1991).
Fling, M. E., et al. Nucleotide sequence of the transposon Tn7 gene encoding an aminoglycoside-modifying enzyme, 3"(9)-O-nucleotidyltransferase. Nucl. Acids Res. 13:7095-7106 (1985).
Ganser, A., A. Lindemann, G. Seipelt, O. G. Ottmann, F. Herrmann, M. Eder, J. Frisch, G. Schulz, R. Mertelsmann and D. Hoelzer. Effects of Recombinant Human Interleukin-3 in Patients With Normal Hematopoiesis and in Patients with Bone Marrow Failure, Blood 76: 666 (1990).
Gething and Sambrook, Cell-surface expression of influenza haemagglutinin from a cloned DNA copy of the RNA gene, Nature, 293: 620-625 (1981).
Gillio, A. P., C. Gasparetto, J. Laver, M. Abboud, M. A. Bonilla, M. B. Garnick and R. J. O'Reilly. J. Clin. Invest. 85: 1560 (1990).
Gouy, M. and G. Gautier, Codon usage in bacteria: Correlation with gene expressivity, Nucleic Acids Research, 10: 7055-7074 (1982).
Greenfield, L., T. Boone, and G. Wilcox. DNA sequence of the araBAD promoter in Escherichia coli B/r. Proc. Natl. Acad. Sci. USA, 75: 4724-4728 (1978).
Higuchi, R, (1989) in PCR Technology, H. A. Erlich ed., Stockton Press, N.Y. chapter 2-6.
Hunkapiller, M. W., R. W. Hewick, R. J. Dreyer and L. E. Hood. High sensitivity sequencing with a gas-phase sequenator. Methods in Enzymology 153: 399-413 (1983).
Kaufman, et al., Coamplification and Coexpression of Human Tissue-Type Plasminogen Activator and Murine Dihydrofolate Reductase Sequences in Chinese Hamster Ovary Cells, Mol. Cell. Biol., 5(7): 1750-1759 (1985).
Kaufman, R. J. High level production of proteins in mammalian cells, in Genetic Engineering, Principles and Methods, Vol. 9, J. K. Setlow, editor, Plenum Press, New York (1987).
Kunkel, T. A. Rapid and efficient site-specific mutagenesis without phenotypic selection. Proc. Natl. Acad. Sci. USA, 82: 488-492 (1985).
Laemmli, U. K., Cleavage of structural proteins during assembly of the head of bacteriophage T4, Nature, 227:680-685 (1970).
Lange, B., M. Valtieri, D. Santoli, D. Caracciolo, F. Mavilio, I. Gemperlein, C. Griffin, B. Emanuel, J. Finan, P. Nowell, and G. Rovera. Growth factor requirements of childhood acute leukemia: establishment of GM-CSF-defendent cell lines. Blood 70:192 (1987).
Mahler, H. R. and E. H. Cordes, in Biological Chemistry, p. 128, New York, Harper and Row (1966).
Maniatis, T., E. F. Fritsch and J. Sambrook, Molecular Cloning, A Laboratory Manual. Cold Spring Harbor Laboratory (1982).
Marinus, M. G. Location of DNA methylation genes on the Escherichia coli K-12 genetic map. Molec. Gen. Genet. 127: 47-55 (1973).
McBride, L. J. and Caruthers, M. H. An investigation of several deoxynucleoside phosphoramidites. Tetrahedron Lett., 24, 245-248 (1983).
Messing, J., A multipurpose cloning system based on the single-stranded DNA bacteriophage M13. Recombinant DNA Technical Bulletin, NIH Publication No. 79-99, Vol. 2, No. 2, pp. 43-48 (1979).
Neu, H. C. and L. A. Heppel. The release of enzymes from Escherichia coli by osmotic shock and during the formation of spheroplasts. J. Biol. Chem., 240: 3685-3692 (1965).
Obukowicz, M. G., Staten, N. R. and Krivi, G. G., Enhanced Heterologous Gene Expression in Novel rpoH Mutants of Escherichia coli. Applied and Environmental Microbiology 58, No. 5, p. 1511-1523 (1992).
Olins, P. O., C. S. Devine, S. H. Rangwala and K. S. Kavka, The T7 phage gene 10 leader RNA, a ribosome-binding site that dramatically enhances the expression of foreign genes in Escherichia coli, Gene, 73:227-235 (1988).
Olins, P. O. and S. H. Rangwala, Vector for enhanced translation of foreign genes in Escherichia coli, Methods in Enzymology, 185: 115-119 (1990).
Postmus, et al., Effects of recombinant human interleukin-3 in patients with relapsed small-cell lung cancer treated with chemotherapy: a dose-finding study. J. Clin. Oncol., 10:1131-1140 (1992).
Prober, J. M., G. L. Trainor, R. J. Dam, F. W. Hobbs, C. W. Robertson, R. J. Zagursky, A. J. Cocuzza, M. A. Jensen and K. Baumeister. A system for rapid DNA sequencing with fluorescent chain-terminating dideoxynucleotides. Science 238: 336-341 (1987).
Renart J., J. Reiser and G. R. Stark, Transfer of proteins from gels to diazobenzyloxymethyl-paper and detection with anti-sera: a method for studying antibody specificity and antigen structure, Proc. Natl. Acad. Sci. USA, 76:3116-3120 (1979).
Saiki, R. K., Schorf, S., Faloona, F., Mullis, K. B., Horn, G. T., Erlich, H. A. and Arnheim, N., Enzymatic Amplification of B-Globin Genomic Sequences and Restriction Site Analysis for Diagnosis of Sickle Cell Anemia, Science, 230: 1350-1354 (1985).
Sambrook, J., et al., Molecular Cloning, A Laboratory Manual, 2nd edition, Cold Spring Harbor Laboratory (1989).
Sancar, A., C. Stachelek, W. Konigsberg and W. D. Rupp, Sequences of the recA gene and protein, Proc. Natl. Acad. Sci., 77: 2611-2615 (1980).
Sanger, F., S. Nicklen and A. R. Coulson. DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. U. S. A. 74: 5463-5467 (1977).
Santoli, D., Y. Yang, S. C. Clark, B. L. Kreider, D. Caracciolo, and G. Rovera. Synergistic and antagonistic effects of recombinant human interleukin (IL-3), IL-1 , granulocyte and macrophage colony-stimulating factors (G-CSF and M-CSF) on the growth of GM-CSF-dependent leukemic cell lines. J. Immuno. 139:348 (1987).
Smith, M. In vitro mutagenesis. Ann. Rev. Genet., 19:423-462 (1985).
Soberon, X., L. Covarrubias and F. Bolivar, Construction and characterization of new cloning vehicles. IV. Deletion derivatives of pBR322 and pBR325, Gene, 9: 211-223 (1980).
Stader, J. A. and T. J. Silhavy. Engineering Escherichia coli to secrete heterologous gene products, Methods in Enzymology, 185: 166-87 (1990).
Summers, M. D. and G. E. Smith. A manual of methods for Baculovirus vectors and insect cell culture procedures. Texas Agricultural Experiment Station Bulletin No. 1555 (1987).
Taylor, J. W., Ott, J. and Eckstein, F. The rapid generation of oligonucleotide-directed mutants at high frequency using phosphorothioate modified DNA. Nucl. Acids Res., 13:8764-8785 (1985).
Treco, D. A., (1989) in Current protocols in Molecular Biology, Seidman et al., eds. J Wiley N.Y., unit 2.1.
Valtieri, M., D. Santoli, D. Caracciolo, B. L. Kreider, S. W. Altmann, D. J. Tweardy, I. Gemperlein, F. Mavilio, B. J. Lange and G. Rovera. Establishment and characterization of an undifferentiated human T leukemia cell line which requires granulocyte-macrophage colony stimulating factor for growth. J. Immunol. 13:4042 (1987).
Voet, D., W. B. Gatzer, R. A. Cox, P. Doty. Absorption spectra of the common bases. Biopolymers 1: 193 (1963).
Wells, J. A., Vasser, M., and Powers, D. B. Cassette mutagenesis: an effective method for generation of multiple mutants at defined sites. Gene, 34:315-323 (1985).
Wong, Y. Y., R. Seetharam, C. Kotts, R. A. Heeren, B. K. Klein, S. B. Braford, K. J. Mathis, B. F. Bishop, N. R. Siegel, C. E. Smith and W. C. Tacon. Expression of secreted IGF-1 in Escherichia coli. Gene, 68: 193-203 (1988).
Yanisch-Perron, C., J. Viera and J. Messing. Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mp18 and pUC19 vectors. Gene 33: 103-119 (1985).
Zoller, M. J. and Smith, M. Oligonucleotide-directed mutagenesis using M13-derived vectors: an efficient and general procedure for the production of point mutations in any fragment of DNA. Nucleic Acid Research, 10: 6487-6500 (1982).
Zoller, M. J. and Smith, M. Oligonucleotide-directed mutagenesis of DNA fragments cloned into M13 vectors. Methods in Enzymology, 100:468-500 (1983).
Zoller, M. J. and Smith, M. Oligonucleotide-directed Mutagenesis: A simple method using two oligonucleotide primers and a single-stranded DNA template. DNA, 3: 479 (1984).
EXAMPLE 1
Construction of pMON 5846 (FIG. 4) which encodes [Met-(1-133) hIL-3 (Arg.sup.129)]
A plasmid containing the gene for the cDNA of hIL-3 cloned into pUC18 on an EcoRI to HindIII fragment was obtained from British Biotechnology Limited (Cambridge, England). This plasmid was designated pPO518. The purified plasmid DNA was cleaved by the restriction endonucleases NheI and BamHI. Approximately 0.5 micrograms of cleaved plasmid DNA was ligated to 1.0 picomoles of a pair of annealed oligonucleotides with the following sequence:
5'-CTAGCGATCTTTTAATAAGCTTG-3' [SEQ ID NO:1] 3'-GCTAGAAAATTATTCGAACCTAG-5' [SEQ ID NO:2]
The ligation mixture was used to transform competent JM101 cells to ampicillin resistance. Colonies were picked, and plasmid DNA was purified and subjected to restriction enzyme analysis. An isolate was identified in which the above oligonucleotide sequence had replaced the portion of the gene that encodes the extreme C terminus. Within the new sequence was a new stop codon, TAA, and a recognition site for the enzyme HindIII. The new plasmid was designated pMON5846.
EXAMPLE 2
(a) Construction of expression vector plasmid pMON2341
The plasmid pMON2341 was used to supply the particular replicon and expression elements used for construction of many of the plasmids used to produce hIL-3 and hIL-3 muteins in E. coli. These expression elements are described in the materials and methods section. pMON2341 is derived from pMON5515 (Olins et al., 1988) and from pMON2429. pMON2429 consists of the phage mp18 (Yanisch-Perron et al., 1985) with a BclI fragment carrying the chloramphenicol acetyl transferase (cat) gene from pBR328 (Covarrubias et al., 1981) inserted into the BamHI site. The cat gene in pMON2429 has been altered from that in pBR328 by site directed mutagenesis (Kunkel, 1985). The recognition sites for NcoI and EcoRI which occur in the native gene were altered so that these two restriction enzymes no longer recognize these sites. The changes did not alter the protein specified by the gene. Also, an NcoI site was introduced at the N-terminus of the coding sequence so that it overlaps the codon for initiator methionine.
The steps involved in construction of pMON2341 are listed below:
(1) The DNAs of pMON5515 and pMON2429 were treated with NcoI and HindIII. The fragments were ligated and used to transform competent E. coli to ampicillin resistance. From these colonies, some were identified that were chloramphenicol resistant. From one of these colonies, plasmid DNA was isolated in which the rat atriopeptigen gene of pMON5515 had been replaced by the NcoI to HindIII fragment containing the cat gene from pMON2429. This fragment contains the recognition sites for several restriction enzymes in the portion derived from the multilinker region of mp18. The new plasmid was designated pMON2412.
(2) pMON2412 was treated with the enzyme ClaI which cleaves at one location in the pBR327 derived portion of the DNA. The protruding ends were rendered blunt by treatment with Klenow in the presence of nucleotide precursors. This DNA was mixed with an isolated 514 bp RsaI fragment derived from pEMBL8 (Dente et al., 1983). This RsaI fragment contains the origin of replication of phage f1. This ligation mixture was used to transform competent E. coli cells to ampicillin resistance. Among the plasmid DNAs isolated from these cells was pMON5578. This plasmid has the structure of pMON2412 with the f1 origin region inserted into the ClaI site. This is illustrated in the Figures and in Olins and Rangwala (1990).
(3) The DNA of pMON5578 was treated with restriction enzymes HindIII and MstII. The DNA was then treated with Klenow enzyme in the presence of nucleotide precursors to render the ends blunt. This treated DNA was ligated and used to transform competent E. coli to ampicillin resistance. From the ampicillin resistant colonies, one plasmid was recovered from which the portion between HindIII and MstII was absent. This deletion resulted in the removal of sequences from the plasmid which are recognized by a number of restriction endonuclease sites. The new plasmid was designated pMON5582.
(4) The DNA of pMON5582 was treated with SstII and BclII and ligated in the presence of annealed oligonucleotides with the sequences shown below.
5'- GGCAACAATTTCTACAAAACACTTGATACTGTATGAGCATACAGTATAATTGCTTCAACAGAACAGATC-3' [SEQ ID NO:3]3'-CGCCGTTGTTAAAGATGTTTTGTGAACTATGACATACTCGTATGTCATATTAACGAAGTTGTCTTGT-5'[SEQ ID NO:4]
This sequence encodes the essential elements of the recA promoter of E. coli including the transcription start site and the lexA repressor binding site (the operator) (Sancar et al., 1980). The plasmid recovered from the ligation mixes contained this recA promoter in place of the one in pMON5582 (and in pMON5515). The functionality of the recA promoter was illustrated by Olins and Rangwala (1990). The new plasmid was designated pMON5594.
(5) To eliminate the single EcoRI site in pMON5594, the DNA was treated with EcoRI, then with Klenow in the presence of nucleotide precursors to render the ends blunt and then the DNA was ligated. From this ligation mix a plasmid was recovered whose DNA was not cleaved with EcoRI. This plasmid was designated pMON5630.
(6) To alter the single recognition site for PstI, plasmid pMON5630 was subjected to site directed mutagensis (Kunkel, 1985). The oligonucleotide used in this procedure has the sequence shown below.
5'-CCATTGCTGCCGGCATCGTGGTC-3' [SEQ ID NO:5]
The result of the procedure was to construct pMON2341 which differs from pMON5630 in that the PstI site in the beta-lactamase gene was altered so that PstI no longer recognizes the site. The single nucleotide change does not alter the amino acid sequence of the beta-lactamase protein.
(b) Construction of pMON5847 (FIG. 5) which encodes [Met-(1-133)hIL-3(Arg.sup.129)]
Plasmid pMON2341 was used to supply the replicon, promotor, ribosome binding site, transcription terminator and antibiotic resistance marker for the plasmids used to produce hIL-3 in E. coli from cDNA derived hIL-3 genes.
Plasmid pMON2341 was treated with restriction enzymes NcoI and HindIII. The restriction fragment containing the replication origin was purified. The DNA of plasmid pMON5846 was treated with NcoI and HindIII. The restriction fragment containing the hIL-3 gene was gel purified. These purified restriction fragments were mixed and ligated. The ligation mixture was used to transform competent JM101 cells to ampicillin resistance. Colonies were picked, and plasmid DNA was purified and analyzed using restriction enzymes. pMON5847 was identified as a plasmid with the replicon of pMON2341 and the hIL-3 gene in place of the chloramphenicol acetyl transferase gene. JM101 cells harboring this plasmid were cultured in M9 medium and treated with nalidixic acid as described above. Samples of the culture were examined for protein content. It was found that this hIL-3 mutein was produced at about 6% of total cell protein as measured on Coomassie stained polyacrylamide gels.
EXAMPLE 3
Construction of pMON5854 (FIG. 7) which encodes [Met-(1-133)hIL-3(Arg.sup.129)]
To increase the accumulation of hIL-3 in E. coli, the coding sequence of the amino terminal portion of the protein was altered to more closely reflect the codon bias found in E. coli genes that produce high levels of proteins (Gouy and Gautier, 1982). To change the coding sequence for the amino terminal portion of the gene, a pair of synthetic oligonucleotides were inserted between the NcoI and HpaI sites within the coding sequence. About 0.5 micrograms of DNA of the plasmid pMON5847 (Example 2) was treated with NcoI and HpaI. This DNA was mixed with an annealed pair of oligonucleotides with the following sequence:
5'-CATGGCTCCAATGACTCAGACTACTTCTCTTAAGACTTCTTGGGTT-3' [SEQ ID NO:6] 3'-CGAGGTTACTGAGTCTGATGAAGAGAATTCTGAAGAACCCAA-5' [SEQ ID NO:7]
The fragments were ligated. The ligation mixture was used to transform competent JM101 to ampicillin resistance. Colonies were picked into broth. From the cultures plasmid DNA was made and examined for the presence of a DdeI site (CTNAG) which occurs in the synthetic sequence but not between the NcoI and HpaI sites in the sequence of pMON5847. The new recombinant plasmid was designated pMON5854. The nucleotide sequence of the DNA in the coding sequence of the amino terminal portion of the hIL-3 gene in pMON5854 was determined by DNA sequencing and found to be the same as that of the synthetic oligonucleotide used in ligation. Cultures of JM101 cells harboring this plasmid were grown and treated with nalidixic acid to induce production of the hIL-3 mutant protein. Analysis of the proteins on Coomassie gels showed that the accumulation of hIL-3 mutein was about 25% of total cell protein in cultures harboring pMON5854, significantly higher than it was in cultures harboring pMON5847.
EXAMPLE 4
Construction of pMON5887 (FIG. 12) which encodes [Met-(1-125)hTL-3]
The plasmid DNA of pMON5854 (Example 3) was treated with EcoRI and HindIII and the larger fragment gel was purified. About 0.5 microgram of this DNA was ligated to 1 picomole of an annealed pair of oligonucleotides which encode amino acids 107 through 125 of hIL-3. The sequences of these oligonucleotides are shown below.
EcoRI to HindIII5'-AATTCCGTCGTAAACTGACCTTCTATCTGAAAACCTTGGAGAACGCGCAGGCTCAACAGTAATA-3'[SEQ ID NO:8] 3'-GGCAGCATTTGACTGGAAGATAGACTTTTGGAACCTCTTGCGCGTCCGAGTTGTCATTATTCGA-5' [SEQ ID NO:9]
After ligation, the DNA was used to transform competent JM101 cells to ampicillin resistance. Colonies were picked into broth and plasmid DNA was isolated from each culture. Restriction analysis of the plasmid DNA showed the presence of an EcoRI to HindIII fragment smaller than that of pMON5854. The nucleotide sequence of the portion of the coding sequence between the EcoRI and HindIII sites was determined to confirm the accuracy of the replaced sequence. The new plasmid was designated pMON5887 encoding Met-(1-125)hIL-3 which has the following amino acid sequence:
Met Ala Pro Met Thr Gln Thr Thr Ser Leu Lys Thr Ser Trp Val Asn Cys Ser Asn Met Ile Asp Glu Ile Ile Thr His Leu Lys Gln Pro Pro Leu Pro Leu Leu Asp Phe Asn Asn Leu Asn Gly Glu Asp Gln Asp Ile Leu Met Glu Asn Asn Leu Arg Arg Pro Asn Leu Glu Ala Phe Asn Arg Ala Val Lys Ser Leu Gln Asn Ala Ser Ala Ile Glu Ser Ile Leu Lys Asn Leu Leu Pro Cys Leu Pro Leu Ala Thr Ala Ala Pro Thr Arg His Pro Ile His Ile Lys Asp Gly Asp Trp Asn Glu Phe Arg Arg Lys Leu Thr Phe Tyr Leu Lys Thr Leu Glu Asn Ala Gln Ala Gln Gln [SEQ ID NO:10]
EXAMPLE 5
Construction of pMON5967 which encodes [Met-Ala-(15-125)hTL-3]
Plasmid DNA of pMON5887 isolated from E. coli GM48 (dam-) was cleaved with NcoI and ClaI and ligated to 1 picomole of an annealed pair of oligonucleotides, encoding amino acids [Met Ala (15-20)hIL-3]. The sequence of these oligonucleotides is shown below.
5'-CATGGCTAACTGCTCTAACATGAT-3' [SEQ ID NO:11] 3'-CGATTGACGAGATTGTACTAGC-5' [SEQ ID NO:12]
The resulting ligation mix was used to transform competent E. coli JM101 cells to ampicillin resistant colonies. Plasmid DNA was isolated from these cells and the size of the inserted fragment was determined to be smaller than that of pMON5887 by restriction analysis using NcoI and NsiI. The nucleotide sequence of the region between NcoI and ClaI was determined and found to be that of the synthetic oligonucleotides. The new plasmid was designated pMON5967 and cells containing it were induced for protein production. Sonicated cell pellets and supernatants were used for protein purification and bio-assay.
EXAMPLE 6
Construction of gMON5978 which encodes [Met-Ala-(15-125)hTL-3]
Plasmid DNA of pMON5967 isolated from E. coli GM48(dam-) was cleaved with ClaI and NsiI and ligated to 1 picomole of an annealed assembly of six oligonucleotides encoding hIL-3 amino acids 20-70 (FIG. 2). This synthetic fragment encodes three unique restriction sites, EcoRV, XhoI and PstI. The sequence of these oligonucleotides is shown in FIG. 2.
The resulting ligation mix was used to transform competent E. coli JM101 cells to ampicillin resistant colonies. Plasmid DNA was isolated and screened with XbaI and EcoRV for the presence of the new restriction site EcoRV. The DNA sequence of the region between ClaI and NsiI was determined and found to be the same as that of the synthetic oligonucleotides. The new plasmid was designated pMON5978, and cells containing it were induced for protein production. Sonicated cell pellets and supernatants were used for protein purification and bioassay.
Plasmid pMON5978 encodes [Met-Ala-(15-125)hIL-3] which has the following amino acid sequence:
Met Ala Asn Cys Ser Asn Met Ile Asp Glu Ile Ile Thr His Leu Lys Gln Pro Pro Leu Pro Leu Leu Asp Phe Asn Asn Leu Asn Gly Glu Asp Gln Asp Ile Leu Met Glu Asn Asn Leu Arg Arg Pro Asn Leu Glu Ala Phe Asn Arg Ala Val Lys Ser Leu Gln Asn Ala Ser Ala Ile Glu Ser Ile Leu Lys Asn Leu Leu Pro Cys Leu Pro Leu Ala Thr Ala Ala Pro Thr Arg His Pro Ile His Ile Lys Asp Gly Asp Trp Asn Glu Phe Arg Arg Lys Leu Thr Phe Tyr Leu Lys Thr Leu Glu Asn Ala Gln Ala Gln Gln [SEQ ID NO:13]
EXAMPLE 7
Construction of pMON13356
Plasmid pMON5988 DNA was digested with restriction enzymes NcoI and EcoRV, and the resulting 4190 base pair NcoI,EcoRV fragment contains the following genetic elements: beta-lactamase gene (AMP), pBR327 origin of replication, phage f1 origin of replication as the transcription terminator, pAraBAD promoter, g10L ribosome binding site, lamB secretion leader and the bases encoding amino acids 47-125 of (15-125)hIL-3. The 4190 base pair NcoI,EcoRV restriction fragment from pMON5988 was ligated to the following annealed complementary oligonucleotides from Table (2).
Oligo #13 [SEQ ID NO:27]
Oligo #14 [SEQ ID NO:28]
The ligation reaction mixture was used to transform E. coli K-12 strain JM101 and transformant bacteria were selected on ampicillin-containing plates. Plasmid DNA was isolated from a colony grown in LB broth and the size of the inserted fragment was determined by restriction analysis employing restriction enzymes NcoI and HindIII in double digest. In the resulting plasmid the 99 bases between the NcoI and EcoRV restriction sites in the (15-125) hIL-3 gene are replaced with 22 bases from the above mentioned oligonucleotides. This linker also contains a NdeI recognition sequence.
EXAMPLE 8
Construction of pMON13344
Plasmid pMON13356 DNA was digested with restriction enzymes NcoI and EcoRV, and the resulting 4190 base pair NcoI,EcoRV fragment contains the following genetic elements: beta-lactamase gene (AMP), pBR327 origin of replication, phage f1 origin of replication as the transcription terminator, pAraBAD promoter, g10L ribosome binding site, lamB secretion leader and the bases encoding amino acids 47-125 of (15-125)hIL-3. The second DNA fragment was generated by synthetic gene assembly using the following complementary oligonucleotide pairs that have overlapping ends:
Oligo #1 [SEQ ID NO:15]
Oligo #2 [SEQ ID NO:16]
Oligo #3 [SEQ ID NO:17]
Oligo #4 [SEQ ID NO:18]
Oligo #9 [SEQ ID NO:23]
Oligo #10 [SEQ ID NO:24]
The assembled oligonucleotides create NcoI and EcoRV restriction ends and the DNA sequence that encodes amino acids 15-46 of (15-125)hIL-3 with the following amino acid substitutions: 18I, 25H, 29R, 32A, 37P, 42A and 45V. The codons encoding amino acids 15-46 of (15-125)hIL-3 are those found in the hIL-3 cDNA sequence except at those positions where amino acid substitutions were made. The 4190 base pair NcoI,EcoRV restriction fragment from pMON13356 was ligated with the pairs of annealed oligonucleotides. The ligation reaction was digested with NdeI and subsequently used to transform E. coli K-12 strain JM101. Transformant bacteria were selected on ampicillin-containing plates. Plasmid DNA was isolated from a colony grown in LB broth. The DNA sequence was determined to be that of the oligonucleotides. The plasmid, pMON13344, encodes the (15-125)hIL-3 variant with the following amino acid sequence:
Peptide #2
Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His Leu Lys Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn Asn Leu Asn Ala Glu Asp Val Asp Ile Leu Met Glu Asn Asn Leu Arg Arg Pro Asn Leu Glu Ala Phe Asn Arg Ala Val Lys Ser Leu Gln Asn Ala Ser Ala Ile Glu Ser Ile Leu Lys Asn Leu Leu Pro Cys Leu Pro Leu Ala Thr Ala Ala Pro Thr Arg His Pro Ile His Ile Lys Asp Gly Asp Trp Asn Glu Phe Arg Arg Lys Leu Thr Phe Tyr Leu Lys Thr Leu Glu Asn Ala Gln Ala Gln Gln [SEQ ID NO:66]
DNA sequence #10 [SEQ ID NO:106] codes for the foregoing pMON13344 polypeptide.
EXAMPLE 9
Construction of pMON13345
The 4190 base pair NcoI,EcoRV restriction fragment from pMON13356 was ligated with the following pairs of annealed complementary oligonucleotides:
Oligo #1 [SEQ ID NO:15]
Oligo #2 [SEQ ID NO:16]
Oligo #5 [SEQ ID NO:19]
Oligo #6 [SEQ ID NO:20]
Oligo #11 [SEQ ID NO:25]
Oligo #12 [SEQ ID NO:26]
The assembled oligonucleotides create NcoI and EcoRV restriction ends and the DNA sequence that encodes amino acids 15-46 of (15-125)hIL-3 with the following amino acid substitutions: 18I, 25H, 29R, 32N, 37P, 42S and 45M.
The codons encoding amino acids 15-46 of (15-125)hIL-3 are those found in the hIL-3 cDNA sequence except at those positions where amino acid substitutions were made. The ligation reaction was digested with NdeI and used to transform E. coli K-12 strain JM101. Transformant bacteria were selected on ampicillin-containing plates. Plasmid DNA was isolated from a colony grown in LB broth. The DNA was sequenced to determine that the sequence was that of the oligonucleotides. The plasmid, pMON13345, encodes the (15-125)hIL-3 variant with the following amino acid sequence:
Peptide #3
Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His Leu Lys Arg Pro Pro Asn Pro Leu Leu Asp Pro Asn Asn Leu Asn Ser Glu Asp Met Asp Ile Leu Met Glu Asn Asn Leu Arg Arg Pro Asn Leu Glu Ala Phe Asn Arg Ala Val Lys Ser Leu Gln Asn Ala Ser Ala Ile Glu Ser Ile Leu Lys Asn Leu Leu Pro Cys Leu Pro Leu Ala Thr Ala Ala Pro Thr Arg His Pro Ile His Ile Lys Asp Gly Asp Trp Asn Glu Phe Arg Arg Lys Leu Thr Phe Tyr Leu Lys Thr Leu Glu Asn Ala Gln Ala Gln Gln [SEQ ID NO:67]
DNA sequence #11 [SEQ ID NO:107] codes for the foregoing pMON13345 polypeptide.
EXAMPLE 10
Construction of pMON13346
The 4190 base pair NcoI,EcoRV restriction fragment from pMON13356 was ligated with the following pairs of annealed complementary oligonucleotides:
Oligo #1 [SEQ ID NO:15]
Oligo #2 [SEQ ID NO:16]
Oligo #7 [SEQ ID NO:21]
Oligo #8 [SEQ ID NO:22]
Oligo #11 [SEQ ID NO:25]
Oligo #12 [SEQ ID NO:26]
The assembled oligonucleotides create NcoI and EcoRV restriction ends and the DNA sequence that encodes amino acids 15-46 of (15-125)hIL-3 with the following amino acid substitutions: 18I, 25H, 29V, 32A, 37S, 42S and 45M. The codons encoding amino acids 15-46 of (15-125)hIL-3 are those found in the hIL-3 cDNA sequence except at those positions where amino acid substitutions were made. The ligation reaction was digested with NdeI and used to transform E. coli K-12 strain JM101. Transformant bacteria were selected on ampicillin-containing plates. Plasmid DNA was isolated from a colony grown in LB broth and DNA sequenced to determine that the sequence was that of the oligonucleotides. The plasmid, pMON13346, encodes the (15-125)hIL-3 variant with the following amino acid sequence:
Peptide #4
Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His Leu Lys Val Pro Pro Ala Pro Leu Leu Asp Ser Asn Asn Leu Asn Ser Glu Asp Met Asp Ile Leu Met Glu Asn Asn Leu Arg Arg Pro Asn Leu Glu Ala Phe Asn Arg Ala Val Lys Ser Leu Gln Asn Ala Ser Ala Ile Glu Ser Ile Leu Lys Asn Leu Leu Pro Cys Leu Pro Leu Ala Thr Ala Ala Pro Thr Arg His Pro Ile His Ile Lys Asp Gly Asp Trp Asn Glu Phe Arg Arg Lys Leu Thr Phe Tyr Leu Lys Thr Leu Glu Asn Ala Gln Ala Gln Gln [SEQ ID NO:68]
DNA sequence #12 [SEQ ID NO:108] codes for the foregoing pMON13346 polypeptide.
EXAMPLE 11
Construction of pMON13357
Plasmid pMON5988 DNA was digested with restriction enzymes EcoRV and NsiI, and the resulting 4218 base pair EcoRV,NsiI fragment contains the following genetic elements: beta-lactamase gene (AMP), pBR327 origin of replication, phage f1 origin of replication as the transcription terminator, pAraBAD promoter, g10L ribosome binding site, lamB secretion leader and the bases encoding amino acids 15-46 and 72-125 of (15-125)hIL-3. The 4218 base pair EcoRV,NsiI restriction fragment from pMON5988 was ligated to the following annealed complementary oligonucleotides:
Oligo #19 [SEQ ID NO:33]
Oligo #20 [SEQ ID NO:34]
The ligation reaction mixture was used to transform E. coli
K-12 strain JM101. Transformant bacteria were selected on ampicillin-containing plates. Plasmid DNA was isolated from a colony grown in LB broth, and the size of the inserted fragment was determined by restriction analysis employing restriction enzymes NcoI and HindIII in double digest. In the resulting plasmid the 71 bases between the EcoRV and NsiI restriction sites in the (15-125)hIL-3 gene are replaced with 22 bases from the above mentioned oligonucleotides. This linker also contains a NdeI recognition sequence.
EXAMPLE 12
Construction of pMON13347
The 4218 base pair EcoRV,NsiI restriction fragment from pMON13357 was ligated with the following pairs of annealed complementary oligonucleotides:
Oligo #21 [SEQ ID NO:35]
Oligo #22 [SEQ ID NO:36]
Oligo #25 [SEQ ID NO:39]
Oligo #26 [SEQ ID NO:40]
Oligo #31 [SEQ ID NO:45]
Oligo #32 [SEQ ID NO:46]
The assembled oligonucleotides create EcoRV and NsiI restriction ends and the DNA sequence that encodes amino acids 47-71 of (15-125)hIL-3 with the following amino acid substitutions: 51R, 55L, 59L, 62V, 67N and 69E. The codons encoding amino acids 47-71 of (15-125)hIL-3 are those found in the hIL-3 cDNA sequence except at those positions where amino acid substitutions were made. The ligation reaction was digested with NdeI and used to transform E. coli K-12 strain JM101. Transformant bacteria were selected on ampicillin-containing plates. Plasmid DNA was isolated from a colony grown in LB broth. The DNA was sequenced to determine that the sequence was that of the oligonucleotides. The plasmid, pMON13347, encodes the (15-125)hIL-3 variant with the following amino acid sequence:
Peptide #5
Asn Cys Ser Asn Met Ile Asp Glu Ile Ile Thr His Leu Lys Gln Pro Pro Leu Pro Leu Leu Asp Phe Asn Asn Leu Asn Gly Glu Asp Gln Asp Ile Leu Met Glu Arg Asn Leu Arg Leu Pro Asn Leu Leu Ala Phe Val Arg Ala Val Lys Asn Leu Glu Asn Ala Ser Ala Ile Glu Ser Ile Leu Lys Asn Leu Leu Pro Cys Leu Pro Leu Ala Thr Ala Ala Pro Thr Arg His Pro Ile His Ile Lys Asp Gly Asp Trp Asn Glu Phe Arg Arg Lys Leu Thr Phe Tyr Leu Lys Thr Leu Glu Asn Ala Gln Ala Gln Gln [SEQ ID NO:69]
DNA sequence #13 [SEQ ID NO:109] codes for the foregoing pMON13347 polypeptide.
EXAMPLE 13
Construction of pMON13348
The 4218 base pair EcoRV,NsiI restriction fragment from pMON13357 was ligated with the following pairs of annealed complementary oligonucleotides:
Oligo #21 [SEQ ID NO:35]
Oligo #22 [SEQ ID NO:36]
Oligo #27 [SEQ ID NO:41]
Oligo #28 [SEQ ID NO:42]
Oligo #31 [SEQ ID NO:45]
Oligo #32 [SEQ ID NO:46]
The assembled oligonucleotides create EcoRV and NsiI restriction ends and the DNA sequence that encodes amino acids 47-71 of (15-125)hIL-3 with the following amino acid substitutions: 51R, 55L, 60S, 62V, 67N and 69E. The codons encoding amino acids 47-71 of (15-125)hIL-3 are those found in the hIL-3 cDNA sequence except at those positions where amino acid substitutions were made. The ligation reaction was digested with NdeI and used to transform E. coli K-12 strain JM101. Transformant bacteria were selected on ampicillin-containing plates. Plasmid DNA was isolated from a colony grown in LB broth. The DNA was sequenced to determine that the sequence was that of the oligonucleotides. The plasmid, pMON13348, encodes the (15-125)hIL-3 variant with the following amino acid sequence:
Peptide #6
Asn Cys Ser Asn Met Ile Asp Glu Ile Ile Thr His Leu Lys Gln Pro Pro Leu Pro Leu Leu Asp Phe Asn Asn Leu Asn Gly Glu Asp Gln Asp Ile Leu Met Glu Arg Asn Leu Arg Leu Pro Asn Leu Glu Ser Phe Val Arg Ala Val Lys Asn Leu Glu Asn Ala Ser Ala Ile Glu Ser Ile Leu Lys Asn Leu Leu Pro Cys Leu Pro Leu Ala Thr Ala Ala Pro Thr Arg His Pro Ile His Ile Lys Asp Gly Asp Trp Asn Glu Phe Arg Arg Lys Leu Thr Phe Tyr Leu Lys Thr Leu Glu Asn Ala Gln Ala Gln Gln [SEQ ID NO:70]
DNA sequence #14 [SEQ ID NO:110] encodes the foregoing pMON13348 polypeptide.
EXAMPLE 14
Construction of pMON13349
The 4218 base pair EcoRV,NsiI restriction fragment from pMON13357 was ligated with the following pairs of annealed complementary oligonucleotides:
Oligo #23 [SEQ ID NO:37]
Oligo #24 [SEQ ID NO:38]
Oligo #25 [SEQ ID NO:39]
Oligo #26 [SEQ ID NO:40]
Oligo #29 [SEQ ID NO:43]
Oligo #30 [SEQ ID NO:44]
The assembled oligonucleotides create EcoRV and NsiI restriction ends and the DNA sequence that encodes amino acids 47-71 of (15-125)hIL-3 with the following amino acid substitutions: 51R, 55T, 59L, 62V, 67H and 69E. The codons encoding amino acids 47-71 of (15-125)hIL-3 are those found in the hIL-3 cDNA sequence except at those positions where amino acid substitutions were made. The ligation reaction was digested with NdeI and used to transform E. coli K-12 strain JM101. Transformant bacteria were selected on ampicillin-containing plates. Plasmid DNA was isolated from a colony grown in LB broth and the DNA was sequenced to determine that the sequence was that of the oligonucleotides. The plasmid, pMON13349, encodes the (15-125)hIL-3 variant with the following amino acid sequence:
Peptide #7
Asn Cys Ser Asn Met Ile Asp Glu Ile Ile Thr His Leu Lys Gln Pro Pro Leu Pro Leu Leu Asp Phe Asn Asn Leu Asn Gly Glu Asp Gln Asp Ile Leu Met Glu Arg Asn Leu Arg Thr Pro Asn Leu Leu Ala Phe Val Arg Ala Val Lys His Leu Glu Asn Ala Ser Ala Ile Glu Ser Ile Leu Lys Asn Leu Leu Pro Cys Leu Pro Leu Ala Thr Ala Ala Pro Thr Arg His Pro Ile His Ile Lys Asp Gly Asp Trp Asn Glu Phe Arg Arg Lys Leu Thr Phe Tyr Leu Lys Thr Leu Glu Asn Ala Gln Ala Gln Gln [SEQ ID NO:71]
DNA sequence #15 [SEQ ID NO:111] encodes the foregoing pMON13349 polypeptide.
EXAMPLE 15
Construction of pMON13358
Plasmid pMON5988 DNA was digested with restriction enzymes NsiI and EcoRI and the resulting 4178 base pair NsiI,EcoRI fragment contains the following genetic elements: beta-lactamase gene (AMP), pBR327 origin of replication, phage fl origin of replication as the transcription terminator, pAraBAD promoter, g10L ribosome binding site, lamB secretion leader and the bases encoding amino acids 15-71 and 106-125 of (15-125)hIL-3. The 4178 base pair NsiI,EcoRI restriction fragment from pMON5988 was ligated to the following annealed complementary oligonucleotides.
Oligo #15 [SEQ ID NO:29]
Oligo #16 [SEQ ID NO:30]
The ligation reaction mixture was used to transform E. coli K-12 strain JM101. Transformant bacteria were selected on ampicillin-containing plates. Plasmid DNA was isolated from a colony grown in LB broth, and the size of the inserted fragment was determined by restriction analysis employing restriction enzymes NcoI and HindIII in double digest. In the resulting plasmid the 111 bases between the NsiI and EcoRI restriction sites in the (15-125) hIL-3 gene are replaced with 24 bases from the above mentioned oligonucleotides. This linker also contains a NdeI recognition sequence.
EXAMPLE 16
Construction of pMON13350
The 4178 base pair NsiI,EcoRI restriction fragment from pMON13358 was ligated with the following pairs of annealed complementary oligonucleotides:
Oligo #41 [SEQ ID NO:55]
Oligo #42 [SEQ ID NO:56]
Oligo #39 [SEQ ID NO:53]
Oligo #40 [SEQ ID NO:54]
Oligo #35 [SEQ ID NO:49]
Oligo #36 [SEQ ID NO:50]
Oligo #43 [SEQ ID NO:57]
Oligo #44 [SEQ ID NO:58]
The assembled oligonucleotides create NsiI and EcoRI restriction ends and the DNA sequence that encodes amino acids 72-105 of (15-125)hIL-3 with the following amino acid substitutions: 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A and 105Q. The codons encoding amino acids 72-105 of (15-125)hIL-3 are those found in the hIL-3 cDNA sequence except at those positions where amino acid substitutions were made. The ligation reaction was digested with NdeI and used to transform E. coli K-12 strain JM101. Transformant bacteria were selected on ampicillin-containing plates. Plasmid DNA was isolated from a colony grown in LB broth. The DNA was sequenced to determine that the sequence was that of the oligonucleotides. The plasmid, pMON13350, encodes the (15-125)hIL-3 variant with the following amino acid sequence:
Peptide #8
Asn Cys Ser Asn Met Ile Asp Glu Ile Ile Thr His Leu Lys Gln Pro Pro Leu Pro Leu Leu Asp Phe Asn Asn Leu Asn Gly Glu Asp Gln Asp Ile Leu Met Glu Asn Asn Leu Arg Arg Pro Asn Leu Glu Ala Phe Asn Arg Ala Val Lys Ser Leu Gln Asn Ala Ser Gly Ile Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Ser Ala Thr Ala Ala Pro Ser Arg His Pro Ile Ile Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg Arg Lys Leu Thr Phe Tyr Leu Lys Thr Leu Glu Asn Ala Gln Ala Gln Gln [SEQ ID NO:72]
DNA sequence #16 [SEQ ID NO:112] codes for the foregoing pMON13350 polypeptide.
EXAMPLE 17
Construction of pMON13355
The 4178 base pair NsiI,EcoRI restriction fragment from pMON13358 was ligated with the following pairs of annealed complementary oligonucleotides:
Oligo #41 [SEQ ID NO:55]
Oligo #42 [SEQ ID NO:56]
Oligo #37 [SEQ ID NO:51]
Oligo #38 [SEQ ID NO:52]
Oligo #33 [SEQ ID NO:47]
Oligo #34 [SEQ ID NO:48]
Oligo #43 [SEQ ID NO:57]
Oligo #44 [SEQ ID NO:58]
The assembled oligonucleotides create NsiI and EcoRI restriction ends and the DNA sequence that encodes amino acids 72-105 of (15-125)hIL-3 with the following amino acid substitutions: 73G, 76A, 79R, 82V, 87S, 93S, 98T, 101A and 105Q. The codons encoding amino acids 72-105 of (15-125)hIL-3 are those found in the hIL-3 CDNA sequence except at those positions where amino acid substitutions were made. The ligation reaction was digested with NdeI and used to transform E. coli K-12 strain JM101. Transformant bacteria were selected on ampicillin-containing plates. Plasmid DNA was isolated from a colony grown in LB broth. The DNA was sequenced to determine that the sequence was that of the oligonucleotides. The plasmid, pMON13355, encodes the (15-125)hIL-3 variant with the following amino acid sequence:
Peptide #9
Asn Cys Ser Asn Met Ile Asp Glu Ile Ile Thr His Leu Lys Gln Pro Pro Leu Pro Leu Leu Asp Phe Asn Asn Leu Asn Gly Glu Asp Gln Asp Ile Leu Met Glu Asn Asn Leu Arg Arg Pro Asn Leu Glu Ala Phe Asn Arg Ala Val Lys Ser Leu Gln Asn Ala Ser Gly Ile Glu Ala Ile Leu Arg Asn Leu Val Pro Cys Leu Pro Ser Ala Thr Ala Ala Pro Ser Arg His Pro Ile Thr Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg Arg Lys Leu Thr Phe Tyr Leu Lys Thr Leu Glu Asn Ala Gln Ala Gln Gln [SEQ ID NO:73]
DNA sequence #17 [SEQ ID NO:113] codes for the foregoing pMON13355 polypeptide.
EXAMPLE 18
Construction of pMON13359
Plasmid pMON5988 DNA was digested with restriction enzymes EcoRI and HindIII, and the resulting 4225 base pair EcoRI,HindIII fragment contains the following genetic elements: beta-lactamase gene (AMP), pBR327 origin of replication, phage f1 origin of replication as the transcription terminator, pAraBAD promoter, g10L ribosome binding site, lamB secretion leader and the bases encoding amino acids 15-105 of (15-125)hIL-3. The 4225 base pair EcoRI,HindIII restriction fragment from pMON5988 was ligated to the following annealed complementary oligonucleotides.
Oligo #17 [SEQ ID NO:31]
Oligo #18 [SEQ ID NO:32]
The ligation reaction was used to transform E. coli K-12 strain JM101. Transformant bacteria were selected on ampicillin-containing plates. Plasmid DNA was isolated from a colony grown in LB broth, and the size of the inserted fragment was determined by restriction analysis employing restriction enzymes NcoI and HindIII in double digest. In the resulting plasmid the 64 bases between the EcoRI and HindIII restriction sites in the (15-125)hIL-3 gene are replaced with 20 bases from the above mentioned oligonucleotides. This linker also contains an NdeI recognition sequence.
EXAMPLE 19
Construction of pMON13352
The 4225 base pair EcoRI,HindIII restriction fragment from pMON13359 was ligated with the following pairs of annealed complementary oligonucleotides:
Oligo #45 [SEQ ID NO:59]
Oligo #46 [SEQ ID NO:60]
Oligo #49 [SEQ ID NO:63]
Oligo #50 [SEQ ID NO:64]
The assembled oligonucleotides create EcoRI and HindIII restriction ends and the DNA sequence that encodes amino acids 106-125 of (15-125)hIL-3 with the following amino acid substitutions: 109E, 116V, 120Q and 123E. The codons encoding amino acids 106-125 of (15-125)hIL-3 are those found in the hIL-3 cDNA sequence except at those positions where amino acid substitutions were made. The ligation reaction was digested with NdeI and used to transform E. coli K-12 strain JM101. Transformant bacteria were selected on ampicillin-containing plates. Plasmid DNA was isolated from a colony grown in LB broth. The DNA was sequenced to determine that the sequence was that of the oligonucleotides. The plasmid, pMON13352, encodes the (15-125)hIL-3 variant with the following amino acid sequence:
Peptide #10
Asn Cys Ser Asn Met Ile Asp Glu Ile Ile Thr His Leu Lys Gln Pro Pro Leu Pro Leu Leu Asp Phe Asn Asn Leu Asn Gly Glu Asp Gln Asp Ile Leu Met Glu Asn Asn Leu Arg Arg Pro Asn Leu Glu Ala Phe Asn Arg Ala Val Lys Ser Leu Gln Asn Ala Ser Ala Ile Glu Ser Ile Leu Lys Asn Leu Leu Pro Cys Leu Pro Leu Ala Thr Ala Ala Pro Thr Arg His Pro Ile His Ile Lys Asp Gly Asp Trp Asn Glu Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln Ala Gln Glu Gln Gln [SEQ ID NO:74]
DNA sequence #18 [SEQ ID NO:114] codes for the foregoing pMON13352 polypeptide.
EXAMPLE 20
Construction of pMON13354
The 4225 base pair EcoRI,HindIII restriction fragment from pMON13359 was ligated with the following pairs of annealed complementary oligonucleotides:
Oligo #45 [SEQ ID NO:59]
Oligo #46 [SEQ ID NO:60]
Oligo #47 [SEQ ID NO:61]
Oligo #48 [SEQ ID NO:62]
The assembled oligonucleotides create EcoRI and HindIII restriction ends and the DNA sequence that encodes amino acids 106-125 of (15-125)hIL-3 with the following amino acid substitutions: 109E, 116V, 117S, 120H and 123E. The codons encoding amino acids 106-125 of (15-125)hIL-3 are those found in the hIL-3 cDNA sequence except at those positions where amino acid substitutions were made. The ligation reaction was digested with NdeI and used to transform E. coli K-12 strain JM101. Transformant bacteria were selected on ampicillin-containing plates. Plasmid DNA was isolated from a colony grown in LB broth, and the DNA was sequenced to determine that the sequence was that of the oligonucleotides. The plasmid, pMON13354, encodes the (15-125)hIL-3 variant with the following amino acid sequence:
Peptide #11
Asn Cys Ser Asn Met Ile Asp Glu Ile Ile Thr His Leu Lys Gln Pro Pro Leu Pro Leu Leu Asp Phe Asn Asn Leu Asn Gly Glu Asp Gln Asp Ile Leu Met Glu Asn Asn Leu Arg Arg Pro Asn Leu Glu Ala Phe Asn Arg Ala Val Lys Ser Leu Gln Asn Ala Ser Ala Ile Glu Ser Ile Leu Lys Asn Leu Leu Pro Cys Leu Pro Leu Ala Thr Ala Ala Pro Thr Arg His Pro Ile His Ile Lys Asp Gly Asp Trp Asn Glu Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Ser Leu Glu His Ala Gln Glu Gln Gln [SEQ ID NO:75]
DNA sequence #19 [SEQ ID NO:115] codes for the foregoing pMON13354 polypeptide.
EXAMPLE 21
Construction of pMON13360
Plasmid pMON13352 DNA was digested with restriction enzymes NsiI and EcoRI, resulting in a 4178 base pair NsiI,EcoRI fragment. The genetic elements derived from pMON13352 are the beta-lactamase gene (AMP), pBR327 origin of replication, phage f1 origin of replication as the transcription terminator, pAraBAD promoter, g10L ribosome binding site, lamB secretion leader and the bases encoding amino acids 15-71 and 106-125 of (15-125)hIL-3. Plasmid pMON13350 DNA was digested with NsiI and EcoRI. The resulting 111 base pair NsiI, EcoRI fragment encodes amino acids 72-105 of (15-125)hIL-3. The eluted restriction fragments were concentrated and desalted using Centricon concentrators. The restriction fragments were ligated, and the ligation reaction mixture was used to transform E. coli K-12 strain JM101. Transformant bacteria were selected on ampicillin-containing plates. Plasmid DNA was isolated and analyzed by restriction analysis. Clones containing the correct insert lost a XmnI site as compared with pMON13352. Positive clones were identified by the loss of a 615 base pair XmnI fragment. The DNA was sequenced to confirm the correct insert. The resulting (15-125)hIL-3 variant has the following amino acid substitutions: 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and 123E. The codons encoding amino acids 72-125 of (15-125)hIL-3 are those found in the hIL-3 cDNA sequence except at those positions where amino acid substitutions were made. The plasmid, pMON13360, encodes the (15-125)hIL-3 variant with the following amino acid sequence:
Peptide #12
Asn Cys Ser Asn Met Ile Asp Glu Ile Ile Thr His Leu Lys Gln Pro Pro Leu Pro Leu Leu Asp Phe Asn Asn Leu Asn Gly Glu Asp Gln Asp Ile Leu Met Glu Asn Asn Leu Arg Arg Pro Asn Leu Glu Ala Phe Asn Arg Ala Val Lys Ser Leu Gln Asn Ala Ser Gly Ile Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Ser Ala Thr Ala Ala Pro Ser Arg His Pro Ile Ile Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln Ala Gln Glu Gln Gln [SEQ. NO:76]
DNA sequence #23 [SEQ ID NO:i19] encodes the foregoing pMON13360 polypeptide.
EXAMPLE 22
Construction of pMON13361
Plasmid pMON13352 DNA was digested with restriction enzymes NsiI and EcoRI, resulting in a 4178 base pair NsiI,EcoRI fragment. The genetic elements derived from pMON13352 are the beta-lactamase gene (AMP), pBR327 origin of replication, phage f1 origin of replication as the transcription terminator, pAraBAD promoter, g10L ribosome binding site, lamB secretion leader and the bases encoding amino acids 15-71 and 106-125 of (15-125)hIL-3. Plasmid pMON13355 DNA was digested with NsiI and EcoRI. The resulting 111 base pair NsiI, EcoRI fragment encodes amino acids 72-105 of (15-125)hIL-3. The restriction fragments were ligated, and the ligation reaction mixture was used to transform E. coli K-12 strain JM101. Transformant bacteria were selected on ampicillin-containing plates. Clones containing the correct insert contained an additional RsaI site which results in a 1200 base pairs RsaI fragment. The DNA was sequenced to confirm the correct insert. The resulting (15-125)hIL-3 variant has the following amino acid substitutions: 73G, 76A, 79R, 82v, 87S, 93S, 98T, 101A, 105Q, 109E, 116V, 120Q and 123E. The codons encoding amino acids 72-125 of (15-125)hIL-3 are those found in the hIL-3 cDNA sequence except at those positions where amino acid substitutions were made. The plasmid, pMON13361, encodes the (15-125)hIL-3 variant with the following amino acid sequence:
Peptide #13
Asn Cys Ser Asn Met Ile Asp Glu Ile Ile Thr His Leu Lys Gln Pro Pro Leu Pro Leu Leu Asp Phe Asn Asn Leu Asn Gly Glu Asp Gln Asp Ile Leu Met Glu Asn Asn Leu Arg Arg Pro Asn Leu Glu Ala Phe Asn Arg Ala Val Lys Ser Leu Gln Asn Ala Ser Gly Ile Glu Ala Ile Leu Arg Asn Leu Val Pro Cys Leu Pro Ser Ala Thr Ala Ala Pro Ser Arg His Pro Ile Thr Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln Ala Gln Glu Gln Gln [SEQ ID NO:77]
DNA sequence #24 [SEQ ID NO:120] codes for the foregoing pMON13361 polypeptide.
EXAMPLE 23
Construction of pMON13362
Plasmid pMON13354 DNA was digested with restriction enzymes NsiI and EcoRI, resulting in a 4178 base pair NsiI,EcoRI fragment. The genetic elements derived from pMON13354 are the beta-lactamase gene (AMP), pBR327 origin of replication, phage f1 origin of replication as the transcription terminator, pAraBAD promoter, g10L ribosome binding site, lamB secretion leader and the bases encoding amino acids 15-71 and 106-125 of (15-125)hIL-3. Plasmid pMON13355 DNA was digested with NsiI and EcoRI. The resulting 111 base pair NsiI, EcoRI fragment encodes amino acids 72-105 of (15-125)hIL-3. The restriction fragments were ligated, and the ligation reaction mixture was used to transform E. coli K-12 strain JM101. Transformant bacteria were selected on ampicillin-containing plates. Clones containing the correct insert contained an additional RsaI site which results in a 1200 base pairs RsaI fragment. The DNA was sequenced to confirm the correct insert. The resulting (15-125)hIL-3 variant has the following amino acid substitutions: 73G, 76A, 79R, 82V, 87S, 93S, 98T, 101A, 105Q, 109E, 116V, 117S, 120H and 123E. The codons encoding amino acids 72-125 of (15-125)hIL-3 are those found in the hIL-3 cDNA sequence except at those positions where amino acid substitutions were made. The plasmid, pMON13362, encodes the (15-125)hIL-3 variant with the following amino acid sequence:
Peptide #14
Asn Cys Ser Asn Met Ile Asp Glu Ile Ile Thr His Leu Lys Gln Pro Pro Leu Pro Leu Leu Asp Phe Asn Asn Leu Asn Gly Glu Asp Gln Asp Ile Leu Met Glu Asn Asn Leu Arg Arg Pro Asn Leu Glu Ala Phe Asn Arg Ala Val Lys Ser Leu Gln Asn Ala Ser Gly Ile Glu Ala Ile Leu Arg Asn Leu Val Pro Cys Leu Pro Ser Ala Thr Ala Ala Pro Ser Arg His Pro Ile Thr Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Ser Leu Glu His Ala Gln Glu Gln Gln [SEQ ID NO:78]
DNA sequence #25 [SEQ ID NO:121] codes for the foregoing pMON13362 polypeptide.
EXAMPLE 24
Construction of pMON13363
Plasmid pMON13344 DNA was digested with restriction enzymes NsiI and EcoRV, resulting in a 4218 base pair NsiI,EcoRV fragment. The genetic elements derived from pMON13344 are the beta-lactamase gene (AMP), pBR327 origin of replication, phage f1 origin of replication as the transcription terminator, pAraBAD promoter, g10L ribosome binding site, lamB secretion leader and the bases encoding amino acids 15-46 and 72-125 of (15-125)hIL-3. Plasmid pMON13348 DNA was digested with NsiI and EcoRV. The resulting 71 base pair NsiI, EcoRV fragment encodes amino acids 47-71 of (15-125)hIL-3. The restriction fragments were ligated with T4 ligase, and the ligation reaction mixture was used to transform E. coli K-12 strain JM101. Transformant bacteria were selected on ampicillin-containing plates. Clones containing the correct insert contained an additional DdeI site which results in DdeI restriction fragments of 806 and 167 base pairs compared to 973 base pairs in pMON13344. The DNA was sequenced to confirm the correct insert. The resulting (15-125)hIL-3 variant has the following amino acid substitutions: 18I, 25H, 29R, 32A, 37P, 42A, 45V, 51R, 55L, 60S, 62V, 67N and 69E. The codons encoding amino acids 15-71 of (15-125)hIL-3 are those found in the hIL-3 cDNA sequence except at those positions where amino acid substitutions were made. The plasmid, pMON13363, encodes the (15-125)hIL-3 variant with the following amino acid sequence:
Peptide #15
Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His Leu Lys Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn Asn Leu Asn Ala Glu Asp Val Asp Ile Leu Met Glu Arg Asn Leu Arg Leu Pro Asn Leu Glu Ser Phe Val Arg Ala Val Lys Asn Leu Glu Asn Ala Ser Ala Ile Glu Ser Ile Leu Lys Asn Leu Leu Pro Cys Leu Pro Leu Ala Thr Ala Ala Pro Thr Arg His Pro Ile His Ile Lys Asp Gly Asp Trp Asn Glu Phe Arg Arg Lys Leu Thr Phe Tyr Leu Lys Thr Leu Glu Asn Ala Gln Ala Gln Gln [SEQ ID NO:79]
DNA sequence #20 [SEQ ID NO:116] codes for the foregoing pMON13363 polypeptide.
EXAMPLE 25
Construction of pMON13364
Plasmid pMON13345 DNA was digested with restriction enzymes NsiI and EcoRV, resulting in a 4218 base pair NsiI,EcoRV fragment. The genetic elements derived from pMON13345 are the beta-lactamase gene (AMP), pBR327 origin of replication, phage f1 origin of replication as the transcription terminator, pAraBAD promoter, g10L ribosome binding site, lamB secretion leader and the bases encoding amino acids 15-46 and 72-125 of (15-125)hIL-3. Plasmid pMON13349 DNA was digested with NsiI and EcoRV. The resulting 71 base pair NsiI, EcoRV fragment encodes amino acids 47-71 of (15-125)hIL-3. The restriction fragments were ligated, and the ligation reaction mixture was used to transform E. coli K-12 strain JM101. Transformant bacteria were selected on ampicillin-containing plates. Clones containing the correct insert contained an additional DdeI site which results in DdeI restriction fragments of 806 and 167 base pairs compared to 973 base pairs in pMON13344. The DNA was sequenced to confirm the correct insert. The resulting (15-125)hIL-3 variant has the following amino acid substitutions: 18I, 25H, 29R, 32N, 37P, 42S, 45M, S1R, 55T, 59L, 62v, 67H and 69E. The codons encoding amino acids 15-71 of (15-125)hIL-3 are those found in the hIL-3 cDNA sequence except at those positions where amino acid substitutions were made. The plasmid, pMON13364, encodes the (15-125)hIL-3 variant with the following amino acid sequence:
Peptide #16
Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His Leu Lys Arg Pro Pro Asn Pro Leu Leu Asp Pro Asn Asn Leu Asn Ser Glu Asp Met Asp Ile Leu Met Glu Arg Asn Leu Arg Thr Pro Asn Leu Leu Ala Phe Val Arg Ala Val Lys His Leu Glu Asn Ala Ser Ala Ile Glu Ser Ile Leu Lys Asn Leu Leu Pro Cys Leu Pro Leu Ala Thr Ala Ala Pro Thr Arg His Pro Ile His Ile Lys Asp Gly Asp Trp Asn Glu Phe Arg Arg Lys Leu Thr Phe Tyr Leu Lys Thr Leu Glu Asn Ala Gln Ala Gln Gln [SEQ ID NO:80]
DNA sequence #21 [SEQ ID NO:117] codes for the foregoing pMON13364 polypeptide.
EXAMPLE 26
Construction of pMON13365
Plasmid pMON13346 DNA was digested with restriction enzymes NsiI and EcoRV, resulting in a 4218 base pair NsiI,EcoRV fragment. The genetic elements derived from pMON13346 are the beta-lactamase gene (AMP), pBR327 origin of replication, phage f1 origin of replication as the transcription terminator, pAraBAD promoter, g10L ribosome binding site, lamB secretion leader and the bases encoding amino acids 15-46 and 72-125 of (15-125)hIL-3. Plasmid pMON13347 DNA was digested with NsiI and EcoRV. The resulting 71 base pair NsiI, EcoRV fragment encodes amino acids 47-71 of (15-125)hIL-3. The restriction fragments were ligated, and the ligation reaction mixture was used to transform E. coli K-12 strain JM101. Transformant bacteria were selected on ampicillin-containing plates. Clones containing the correct insert contained an additional DdeI site which results in DdeI restriction fragments of 806 and 167 base pairs compared to 973 base pairs in pMON13344. The DNA was sequenced to confirm the correct insert. The resulting (15-125)hIL-3 variant has the following amino acid substitutions: 18I, 25H, 29V, 32A, 37S, 42S, 45M, 51R, 55L, 59L, 62V, 67N and 69E. The codons encoding amino acids 15-71 of (15-125)hIL-3 are those found in the hIL-3 cDNA sequence except at those positions where amino acid substitutions were made. The plasmid, pMON13365, encodes the (15-125)hIL-3 variant with the following amino acid sequence:
Peptide #17
Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His Leu Lys Val Pro Pro Ala Pro Leu Leu Asp Ser Asn Asn Leu Asn Ser Glu Asp Met Asp Ile Leu Met Glu Arg Asn Leu Arg Leu Pro Asn Leu Leu Ala Phe Val Arg Ala Val Lys Asn Leu Glu Asn Ala Ser Ala Ile Glu Ser Ile Leu Lys Asn Leu Leu Pro Cys Leu Pro Leu Ala Thr Ala Ala Pro Thr Arg His Pro Ile His Ile Lys Asp Gly Asp Trp Asn Glu Phe Arg Arg Lys Leu Thr Phe Tyr Leu Lys Thr Leu Glu Asn Ala Gln Ala Gln Gln [SEQ ID NO:81]
DNA sequence #22 [SEQ ID NO:118] codes for the foreging pMON13365 polypeptide.
EXAMPLE 27
Construction of pMON13298
Plasmid pMON5978 DNA was digested with restriction enzymes NsiI and HindIII, resulting in a 3789 base pair NsiI,HindIII fragment. The genetic elements derived from pMON5978 are the beta-lactamase gene (AMP), pBR327 origin of replication, phage f1 origin of replication as the transcription terminator, precA promoter, g10L ribosome binding site, and the bases encoding amino acids 15-71 of (15-125)hIL-3. Plasmid pMON13360 DNA was digested with NsiI and HindIII. The resulting 175 base pair NsiI, HindIII fragment encodes amino acids 72-125 of (15-125)hIL-3. The restriction fragments were ligated, and the ligation reaction mixture was used to transform E. coli K-12 strain JM101. Transformant bacteria were selected on ampicillin-containing plates. Plasmid DNA was isolated, analyzed by restriction analysis, and sequenced to confirm the correct insert. The resulting (15-125)hIL-3 variant has the following amino acid substitutions: 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and 123E. The codons encoding amino acids 72-125 of (15-125)hIL-3 are those found in the hIL-3 cDNA sequence except at those positions where amino acid substitutions were made. The plasmid, pMON13298, encodes the (15-125)hIL-3 variant with the following amino acid sequence:
Peptide #18
Met Ala Asn Cys Ser Asn Met Ile Asp Glu Ile Ile Thr His Leu Lys Gln Pro Pro Leu Pro Leu Leu Asp Phe Asn Asn Leu Asn Gly Glu Asp Gln Asp Ile Leu Met Glu Asn Asn Leu Arg Arg Pro Asn Leu Glu Ala Phe Asn Arg Ala Val Lys Ser Leu Gln Asn Ala Ser Gly Ile Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Ser Ala Thr Ala Ala Pro Ser Arg His Pro Ile Ile Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln Ala Gln Glu Gln Gln [SEQ ID NO:82]
DNA sequence #29 [SEQ ID NO:125] codes for the foregoing pMON13298 polypeptide.
EXAMPLE 28
Construction of pMON13299
Plasmid pMON5978 DNA was digested with restriction enzymes NsiI and HindIII, resulting in a 3789 base pair NsiI,HindIII fragment. The genetic elements derived from pMON5978 are the beta-lactamase gene (AMP), pBR327 origin of replication, phage f1 origin of replication as the transcription terminator, precA promoter, g10L ribosome binding site and the bases encoding amino acids 15-71 of (15-125)hIL-3. Plasmid pMON13361 DNA was digested with NsiI and HindIII, the resulting 175 base pair NsiI, HindIII fragment encodes amino acids 72-125 of (15-125)hIL-3. The restriction fragments were ligated, and the ligation reaction mixture was used to transform E. coli K-12 strain JM101. Transformant bacteria were selected on ampicillin-containing plates. Plasmid DNA was isolated, analyzed by restriction analysis, and sequenced to confirm the correct insert. The resulting (15-125)hIL-3 variant has the following amino acid substitutions: 73G, 76A, 79R, 82v, 87S, 93S, 98T, 101A, 105Q, 109E, 116V, 120Q and 123E. The codons encoding amino acids 72-125 of (15-125)hIL-3 are those found in the hIL-3 cDNA sequence except at those positions where amino acid substitutions were made. The plasmid, pMON13299, encodes the (15-125)hIL-3 variant with the following amino acid sequence:
Peptide #19
Met Ala Asn Cys Ser Asn Met Ile Asp Glu Ile Ile Thr His Leu Lys Gln Pro Pro Leu Pro Leu Leu Asp Phe Asn Asn Leu Asn Gly Glu Asp Gln Asp Ile Leu Met Glu Asn Asn Leu Arg Arg Pro Asn Leu Glu Ala Phe Asn Arg Ala Val Lys Ser Leu Gln Asn Ala Ser Gly Ile Glu Ala Ile Leu Arg Asn Leu Val Pro Cys Leu Pro Ser Ala Thr Ala Ala Pro Ser Arg His Pro Ile Thr Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln Ala Gln Glu Gln Gln [SEQ ID NO:83]
DNA sequence #30 [SEQ ID NO:126] codes for the foregoing pMON13299 polypeptide.
EXAMPLE 29
Construction of pMON13300
Plasmid pMON5978 DNA was digested with restriction enzymes NsiI and HindIII, resulting in a 3789 base pair NsiI,HindIII fragment. The genetic elements derived from pMON5978 are the beta-lactamase gene (AMP), pBR327 origin of replication, phage f1 origin of replication as the transcription terminator, precA promoter, g10L ribosome binding site, and the bases encoding amino acids 15-71 of (15-125)hIL-3. Plasmid pMON13362 DNA was digested with NsiI and HindIII. The resulting 175 base pair NsiI, HindIII fragment encodes amino acids 72-125 of (15-125)hIL-3. The restriction fragments were ligated, and the ligation reaction mixture was used to transform E. coli K-12 strain JM101. Transformant bacteria were selected on ampicillin-containing plates. Plasmid DNA was isolated, analyzed by restriction analysis, and sequenced to confirm the correct insert. The resulting (15-125)hIL-3 variant has the following amino acid substitutions: 73G, 76A, 79R, 82V, 87S, 93S, 98T, 101A, 105Q, 109E, 116V, 117S, 120H and 123E. The codons encoding amino acids 72-125 of (15-125)hIL-3 are those found in the hIL-3 cDNA sequence except at those positions where amino acid substitutions were made. The plasmid, pMON13300, encodes the (15-125)hIL-3 variant with the following amino acid sequence:
Peptide #20
Met Ala Asn Cys Ser Asn Met Ile Asp Glu Ile Ile Thr His Leu Lys Gln Pro Pro Leu Pro Leu Leu Asp Phe Asn Asn Leu Asn Gly Glu Asp Gln Asp Ile Leu Met Glu Asn Asn Leu Arg Arg Pro Asn Leu Glu Ala Phe Asn Arg Ala Val Lys Ser Leu Gln Asn Ala Ser Gly Ile Glu Ala Ile Leu Arg Asn Leu Val Pro Cys Leu Pro Ser Ala Thr Ala Ala Pro Ser Arg His Pro Ile Thr Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Ser Leu Glu His Ala Gln Glu Gln Gln [SEQ ID NO:84]
DNA sequence #31 [SEQ ID NO:127] codes for the foregoing pMON13300 polypeptide.
EXAMPLE 30
Construction of pMON13301
Plasmid pMON5978 DNA was digested with restriction enzymes NcoI and NsiI, resulting in a 3794 base pair NcoI,NsiI fragment. The genetic elements derived from pMON5978 are the beta-lactamase gene (AMP), pBR327 origin of replication, phage f1 origin of replication as the transcription terminator, precA promoter, g10L ribosome binding site and the bases encoding amino acids 72-125 of (15-125)hIL-3. Plasmid pMON13363 DNA was digested with NcoI and NsiI. The resulting 170 base pair NcoI, NsiI fragment encodes amino acids 15-71 of (15-125)hIL-3. The restriction fragments were ligated, and the ligation reaction mixture was used to transform E. coli K-12 strain JM101. Transformant bacteria were selected on ampicillin-containing plates. Plasmid DNA was isolated, analyzed by restriction analysis, and sequenced to confirm the correct insert. The resulting (15-125)hIL-3 variant has the following amino acid substitutions: 18I, 25H, 29R, 32A, 37P, 42A, 45V, 51R, 55L, 60S, 62V, 67N and 69E. The codons encoding amino acids 15-71 of (15-125)hIL-3 are those found in the hIL-3 cDNA sequence except at those positions where amino acid substitutions were made. The plasmid, pMON13301, encodes the (15-125)hIL-3 variant with the following amino acid sequence:
Peptide #21
Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His Leu Lys Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn Asn Leu Asn Ala Glu Asp Val Asp Ile Leu Met Glu Arg Asn Leu Arg Leu Pro Asn Leu Glu Ser Phe Val Arg Ala Val Lys Asn Leu Glu Asn Ala Ser Ala Ile Glu Ser Ile Leu Lys Asn Leu Leu Pro Cys Leu Pro Leu Ala Thr Ala Ala Pro Thr Arg His Pro Ile His Ile Lys Asp Gly Asp Trp Asn Glu Phe Arg Arg Lys Leu Thr Phe Tyr Leu Lys Thr Leu Glu Asn Ala Gln Ala Gln Gln [SEQ ID NO:85]
DNA sequence #26 [SEQ ID NO:122] codes for the foregoing pMON13301 polypeptide.
EXAMPLE 31
Construction of pMON13302
Plasmid pMON5978 DNA was digested with restriction enzymes NcoI and NsiI, resulting in a 3794 base pair NcoI,NsiI fragment. The genetic elements derived from pMON5978 are the beta-lactamase gene (AMP), pBR327 origin of replication, phage f1 origin of replication as the transcription terminator, precA promoter, g10L ribosome binding site, and the bases encoding amino acids 72-125 of (15-125)hIL-3. Plasmid pMON13364 DNA was digested with NcoI and NsiI. The resulting 170 base pair NcoI, NsiI fragment encodes amino acids 15-71 of (15-125)hIL-3. The restriction fragments were ligated, and the ligation reaction mixture was used to transform E. coli K-12 strain JM101. Transformant bacteria were selected on ampicillin-containing plates. Plasmid DNA was isolated, analyzed by restriction analysis, and sequenced to confirm the correct insert. The resulting (15-125)hIL-3 variant has the following amino acid substitutions: 18I, 25H, 29R, 32N, 37P, 42S, 45M, 51R, 55T, 59L, 62V, 67H and 69E. The codons encoding amino acids 15-71 of (15-125)hIL-3 are those found in the hIL-3 cDNA sequence except at those positions where amino acid substitutions were made. The plasmid, pMON13302, encodes the (15-125)hIL-3 variant with the following amino acid sequence:
Peptide #22
Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His Leu Lys Arg Pro Pro Asn Pro Leu Leu Asp Pro Asn Asn Leu Asn Ser Glu Asp Met Asp Ile Leu Met Glu Arg Asn Leu Arg Thr Pro Asn Leu Leu Ala Phe Val Arg Ala Val Lys His Leu Glu Asn Ala Ser Ala Ile Glu Ser Ile Leu Lys Asn Leu Leu Pro Cys Leu Pro Leu Ala Thr Ala Ala Pro Thr Arg His Pro Ile His Ile Lys Asp Gly Asp Trp Asn Glu Phe Arg Arg Lys Leu Thr Phe Tyr Leu Lys Thr Leu Glu Asn Ala Gln Ala Gln Gln [SEQ ID NO:86]
DNA sequence #27 [SEQ ID NO:123] codes for the foregoing pMON13302 polypeptide.
EXAMPLE 32
Construction of pMON13303
Plasmid pMON5978 DNA was digested with restriction enzymes NcoI and NsiI, resulting in a 3794 base pair NcoI,NsiI fragment. The genetic elements derived from pMON5978 are the beta-lactamase gene (AMP), pBR327 origin of replication, phage f1 origin of replication as the transcription terminator, precA promoter, g10L ribosome binding site, and the bases encoding amino acids 72-125 of (15-125)hIL-3. Plasmid pMON13365 DNA was digested with NcoI and NsiI. The resulting 170 base pair NcoI, NsiI fragment encodes amino acids 15-71 of (15-125)hIL-3. The restriction fragments were ligated, and the ligation reaction mixture was used to transform E. coli K-12 strain JM101. Transformant bacteria were selected on ampicillin-containing plates. Plasmid DNA was isolated, analyzed by restriction analysis, and sequenced to confirm the correct insert. The resulting (15-125)hIL-3 variant has the following amino acid substitutions: 18I, 25H, 29V, 32A, 37S, 42S, 45M, 51R, 55L, 59L, 62V, 67N and 69E. The codons encoding amino acids 15-71 of (15-125)hIL-3 are those found in the hIL-3 cDNA sequence except at those positions where amino acid substitutions were made. The plasmid, pMON13303, encodes the (15-125)hIL-3 variant with the following amino acid sequence:
Peptide #23
Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His Leu Lys Val Pro Pro Ala Pro Leu Leu Asp Ser Asn Asn Leu Asn Ser Glu Asp Met Asp Ile Leu Met Glu Arg Asn Leu Arg Leu Pro Asn Leu Leu Ala Phe Val Arg Ala Val Lys Asn Leu Glu Asn Ala Ser Ala Ile Glu Ser Ile Leu Lys Asn Leu Leu Pro Cys Leu Pro Leu Ala Thr Ala Ala Pro Thr Arg His Pro Ile His Ile Lys Asp Gly Asp Trp Asn Glu Phe Arg Arg Lys Leu Thr Phe Tyr Leu Lys Thr Leu Glu Asn Ala Gln Ala Gln Gln [SEQ ID NO:87]
DNA sequence #28 [SEQ ID NO:124] codes for the foregoing pMON13303 polypeptide.
EXAMPLE 33
Construction of pMON13287
Plasmid pMON2341 DNA was digested with restriction enzymes NcoI and HindIII, resulting in a 3619 base pair NcoI,HindIII fragment. The genetic elements derived from pMON2341 are the beta-lactamase gene (AMP), pBR327 origin of replication, phage f1 origin of replication as the transcription terminator, precA promoter and g10L ribosome binding site. Plasmid pMON13363 DNA was digested with NcoI and NsiI. The resulting 170 base pair NcoI, NsiI fragment encodes amino acids 15-71 of (15-125)hIL-3. Plasmid pMON13360 DNA was digested with NsiI and HindIII. The resulting 175 base pair NsiI, HindIII fragment encodes amino acids 72-125 of (15-125)hIL-3. The restriction fragments were ligated, and the ligation reaction mixture was used to transform E. coli K-12 strain JM101. Transformant bacteria were selected on ampicillin-containing plates. Plasmid DNA was isolated, analyzed by restriction analysis, and sequenced to confirm the correct insert. The resulting (15-125)hIL-3 variant has the following amino acid substitutions: 18I, 25H, 29R, 32A, 37P, 42A, 45V, 51R, 55L, 60S, 62V, 67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and 123E. The codons encoding amino acids 15-125 of (15-125)hIL-3 are those found in the hIL-3 cDNA sequence except at those positions where amino acid substitutions were made. The plasmid, pMON13287, encodes the (15-125)hIL-3 variant with the following amino acid sequence:
Peptide #24
Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His Leu Lys Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn Asn Leu Asn Ala Glu Asp Val Asp Ile Leu Met Glu Arg Asn Leu Arg Leu Pro Asn Leu Glu Ser Phe Val Arg Ala Val Lys Asn Leu Glu Asn Ala Ser Gly Ile Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Ser Ala Thr Ala Ala Pro Ser Arg His Pro Ile Ile Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln Ala Gln Glu Gln Gln [SEQ ID NO:88]
DNA sequence #1 [SEQ ID NO:97] codes for the foregoing pMON13287 polypeptide.
EXAMPLE 34
Construction of pMON13288
Plasmid pMON2341 DNA was digested with restriction enzymes NcoI and HindIII, resulting in a 3619 base pair NcoI,HindIII fragment. The genetic elements derived from pMON2341 are the beta-lactamase gene (AMP), pBR327 origin of replication, phage f1 origin of replication as the transcription terminator, precA promoter and g10L ribosome binding site. Plasmid pMON13364 DNA was digested with NcoI and NsiI. The resulting 170 base pair NcoiI, NsiI fragment encodes amino acids 15-71 of (15-125)hIL-3. Plasmid pMON13360 DNA was digested with NsiI and HindIII. The resulting 175 base pair NsiI, HindIII fragment encodes amino acids 72-125 of (15-125)hIL-3. The restriction fragments were ligated, and the ligation reaction mixture was used to transform E. coli K-12 strain JM101. Transformant bacteria were selected on ampicillin-containing plates. Plasmid DNA was isolated, analyzed by restriction analysis, and sequenced to confirm the correct insert. The resulting (15-125)hIL-3 variant has the following amino acid substitutions: 18I, 25H, 29R, 32N, 37P, 42S, 45M, 51R, 55T, 59L, 62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and 123E. The codons encoding amino acids 15-125 of (15-125)hIL-3 are those found in the hIL-3 cDNA sequence except at those positions where amino acid substitutions were made. The plasmid, pMON13288, encodes the (15-125)hIL-3 variant with the following amino acid sequence:
Peptide #25
Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His Leu Lys Arg Pro Pro Asn Pro Leu Leu Asp Pro Asn Asn Leu Asn Ser Glu Asp Met Asp Ile Leu Met Glu Arg Asn Leu Arg Thr Pro Asn Leu Leu Ala Phe Val Arg Ala Val Lys His Leu Glu Asn Ala Ser Gly Ile Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Ser Ala Thr Ala Ala Pro Ser Arg His Pro Ile Ile Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln Ala Gln Glu Gln Gln [SEQ ID NO:89]
DNA sequence #4 [SEQ ID NO:100] codes for the foregoing pMON13288 polypeptide.
EXAMPLE 35
Construction of pMON13289
Plasmid pMON2341 DNA was digested with restriction enzymes NcoI and HindIII, resulting in a 3619 base pair NcoI,HindIII fragment. The genetic elements derived from pMON2341 are the beta-lactamase gene (AMP), pBR327 origin of replication, phage f1 origin of replication as the transcription terminator, precA promoter and g10L ribosome binding site. Plasmid pMON13365 DNA was digested with NcoI and NsiI. The resulting 170 base pair Ncoi, NsiI fragment encodes amino acids 15-71 of (15-125)hIL-3. Plasmid pMON13360 DNA was digested with NsiI and HindIII. The resulting 175 base pair NsiI, HindIII fragment encodes amino acids 72-125 of (15-125)hIL-3. The restriction fragments were ligated, and the ligation reaction mixture was used to transform E. coli K-12 strain JM101. Transformant bacteria were selected on ampicillin-containing plates. Plasmid DNA was isolated, analyzed by restriction analysis, and sequenced to confirm the correct insert. The resulting (15-125)hIL-3 variant has the following amino acid substitutions: 18I, 25H, 29V, 32A, 37S, 42S, 45M, 51R, 55L, 59L, 62V, 67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and 123E. The codons encoding amino acids 15-125 of (15-125)hIL-3 are those found in the hIL-3 cDNA sequence except at those positions where amino acid substitutions were made. The plasmid, pMON13289, encodes the (15-125)hIL-3 variant with the following amino acid sequence:
Peptide #26
Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His Leu Lys Val Pro Pro Ala Pro Leu Leu Asp Ser Asn Asn Leu Asn Ser Glu Asp Met Asp Ile Leu Met Glu Arg Asn Leu Arg Leu Pro Asn Leu Leu Ala Phe Val Arg Ala Val Lys Asn Leu Glu Asn Ala Ser Gly Ile Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Ser Ala Thr Ala Ala Pro Ser Arg His Pro Ile Ile Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln Ala Gln Glu Gln Gln [SEQ ID NO:90]
DNA sequence #7 [SEQ ID NO:103] codes for the foregoing pMON13289 polypeptide.
EXAMPLE 36
Construction of pMON13290
Plasmid pMON2341 DNA was digested with restriction enzymes NcoI and HindIII, resulting in a 3619 base pair NcoI,HindIII fragment. The genetic elements derived from pMON2341 are the beta-lactamase gene (AMP), pBR327 origin of replication, phage f1 origin of replication as the transcription terminator, precA promoter and g10L ribosome binding site. Plasmid pMON13363 DNA was digested with NcoI and NsiI. The resulting 170 base pair NcoI, NsiI fragment encodes amino acids 15-71 of (15-125)hIL-3. Plasmid pMON13361 DNA was digested with NsiI and HindIII. The resulting 175 base pair NsiI, HindIII fragment encodes amino acids 72-125 of (15-125)hIL-3. The restriction fragments were ligated, and the ligation reaction mixture was used to transform E. coli K-12 strain JM101. Transformant bacteria were selected on ampicillin-containing plates. Plasmid DNA was isolated, analyzed by restriction analysis, and sequenced to confirm the correct insert. The resulting (15-125)hIL-3 variant has the following amino acid substitutions: 18I, 25H, 29R, 32A, 37P, 42A, 45V, 51R, 55L, 60S, 62V, 67N, 69E, 73G, 76A, 79R, 82V, 87S, 93S, 98T, 101A, 105Q, 109E, 116V, 120Q and 123E. The codons encoding amino acids 15-125 of (15-125)hIL-3 are those found in the hIL-3 cDNA sequence except at those positions where amino acid substitutions were made. The plasmid, pMON13290, encodes the (15-125)hIL-3 variant with the following amino acid sequence:
Peptide #27
Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His Leu Lys Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn Asn Leu Asn Ala Glu Asp Val Asp Ile Leu Met Glu Arg Asn Leu Arg Leu Pro Asn Leu Glu Ser Phe Val Arg Ala Val Lys Asn Leu Glu Asn Ala Ser Gly Ile Glu Ala Ile Leu Arg Asn Leu Val Pro Cys Leu Pro Ser Ala Thr Ala Ala Pro Ser Arg His Pro Ile Thr Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln Ala Gln Glu Gln Gln [SEQ ID NO:91]
DNA sequence #2 [SEQ ID NO:98] codes for the foregoing pMON13290 polypeptide.
EXAMPLE 37
Construction of pMON13292
Plasmid pMON2341 DNA was digested with restriction enzymes NcoI and HindIII, resulting in a 3619 base pair NcoI,HindIII fragment. The genetic elements derived from pMON2341 are the beta-lactamase gene (AMP), pBR327 origin of replication, phage f1 origin of replication as the transcription terminator, precA promoter and g10L ribosome binding site. Plasmid pMON13365 DNA was digested with NcoI and NsiI. The resulting 170 base pair NcoI, NsiI fragment encodes amino acids 15-71 of (15-125)hIL-3. Plasmid pMON13361 DNA was digested with NsiI and HindIII. The resulting 175 base pair NsiI, HindIII fragment encodes amino acids 72-125 of (15-125)hIL-3. The restriction fragments were ligated, and the ligation reaction mixture was used to transform E. coli K-12 strain JM101. Transformant bacteria were selected on ampicillin-containing plates. Plasmid DNA was isolated, analyzed by restriction analysis, and sequenced to confirm the correct insert. The resulting (15-125)hIL-3 variant has the following amino acid substitutions: 181, 25H, 29V, 32A, 37S, 42S, 45M, 51R, 55L, 59L, 62v, 67N, 69E, 73G, 76A, 79R, 82V, 87S, 93S, 98T, 101A, 105Q, 109E, 116v, 120Q and 123E. The codons encoding amino acids 15-125 of (15-125)hIL-3 are those found in the hIL-3 cDNA sequence except at those positions where amino acid substitutions were made. The plasmid, pMON13292, encodes the (15-125)hIL-3 variant with the following amino acid sequence:
Peptide #28
Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His Leu Lys Val Pro Pro Ala Pro Leu Leu Asp Ser Asn Asn Leu Asn Ser Glu Asp Met Asp Ile Leu Met Glu Arg Asn Leu Arg Leu Pro Asn Leu Leu Ala Phe Val Arg Ala Val Lys Asn Leu Glu Asn Ala Ser Gly Ile Glu Ala Ile Leu Arg Asn Leu Val Pro Cys Leu Pro Ser Ala Thr Ala Ala Pro Ser Arg His Pro Ile Thr Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln Ala Gln Glu Gln Gln [SEQ ID NO:92]
DNA sequence #8 [SEQ ID NO:104] codes for the foregoing pMON13292 polypeptide.
EXAMPLE 38R
Construction of pMON13294
Plasmid pMON2341 DNA was digested with restriction enzymes NcoI and HindIII, resulting in a 3619 base pair NcoI,HindIII fragment. The genetic elements derived from pMON2341 are the beta-lactamase gene (AMP), pBR327 origin of replication, phage f1 origin of replication as the transcription terminator, precA promoter and g10L ribosome binding site. Plasmid pMON13364 DNA was digested with NcoI and NsiI. The resulting 170 base pair NcoI, NsiI fragment encodes amino acids 15-71 of (15-125)hIL-3. Plasmid pMON13362 DNA was digested with NsiI and HindIII. The resulting 175 base pair NsiI, HindIII fragment encodes amino acids 72-125 of (15-125)hIL-3. The restriction fragments were ligated, and the ligation reaction mixture was used to transform E. coli K-12 strain JM101. Transformant bacteria were selected on ampicillin-containing plates. Plasmid DNA was isolated, analyzed by restriction analysis, and sequenced to confirm the correct insert. The resulting (15-125)hIL-3 variant has the following amino acid substitutions: 18I, 25H, 29R, 32N, 37P, 42S, 45M, 51R, 55T, 59L, 62V, 67H, 69E, 73G, 76A, 79R, 82V, 87S, 93S, 98T, 101A, 105Q, 109E, 116V, 117S, 120H and 123E. The codons encoding amino acids 15-125 of (15-125)hIL-3 are those found in the hIL-3 cDNA sequence except at those positions where amino acid substitutions were made. The plasmid, pMON13294, encodes the (15-125)hIL-3 variant with the following amino acid sequence:
Peptide #29
Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His Leu Lys Arg Pro Pro Asn Pro Leu Leu Asp Pro Asn Asn Leu Asn Ser Glu Asp Met Asp Ile Leu Met Glu Arg Asn Leu Arg Thr Pro Asn Leu Leu Ala Phe Val Arg Ala Val Lys His Leu Glu Asn Ala Ser Gly Ile Glu Ala Ile Leu Arg Asn Leu Val Pro Cys Leu Pro Ser Ala Thr Ala Ala Pro Ser Arg His Pro Ile Thr Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Ser Leu Glu His Ala Gln Glu Gln Gln [SEQ ID NO:93]
DNA sequence #6 [SEQ ID NO:102] codes for the foregoing pMON13294 polypeptide.
EXAMPLE 39
Construction of pMON13295
Plasmid pMON2341 DNA was digested with restriction enzymes NcoI and HindIII, resulting in a 3619 base pair NcoI,HindIII fragment. The genetic elements derived from pMON2341 are the beta-lactamase gene (AMP), pBR327 origin of replication, phage f1 origin of replication as the transcription terminator, precA promoter and g10L ribosome binding site. Plasmid pMON13365 DNA was digested with NcoI and NsiI. The resulting 170 base pair NcoI, NsiI fragment encodes amino acids 15-71 of (15-125)hIL-3. Plasmid pMON13362 DNA was digested with NsiI and HindIII. The resulting 175 base pair NsiI, HindIII fragment encodes amino acids 72-125 of (15-125)hIL-3. The restriction fragments were ligated, and the ligation reaction mixture was used to transform E. coli K-12 strain JM101. Transformant bacteria were selected on ampicillin-containing plates. Plasmid DNA was isolated, analyzed by restriction analysis, and sequenced to confirm the correct insert. The resulting (15-125)hIL-3 variant has the following amino acid substitutions: 18I, 25H, 29V, 32A, 37S, 42S, 45M, 51R, 55L, 59L, 62V, 67N, 69E, 73G, 76A, 79R, 82V, 87S, 93S, 98T, 101A, 105Q, 109E, 116V, 117S, 120H and 123E. The codons encoding amino acids 15-125 of (15-125)hIL-3 are those found in the hIL-3 cDNA sequence except at those positions where amino acid substitutions were made. The plasmid, pMON13295, encodes the (15-125)hIL-3 variant with the following amino acid sequence:
Peptide #30
Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His Leu Lys Val Pro Pro Ala Pro Leu Leu Asp Ser Asn Asn Leu Asn Ser Glu Asp Met Asp Ile Leu Met Glu Arg Asn Leu Arg Leu Pro Asn Leu Leu Ala Phe Val Arg Ala Val Lys Asn Leu Glu Asn Ala Ser Gly Ile Glu Ala Ile Leu Arg Asn Leu Val Pro Cys Leu Pro Ser Ala Thr Ala Ala Pro Ser Arg His Pro Ile Thr Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Ser Leu Glu His Ala Gln Glu Gln Gln [SEQ ID NO:94]
DNA sequence #9 [SEQ ID NO:105] codes for the foregoing pMON13295 polypeptide.
EXAMPLE 40
Construction of pMON13312
Plasmid pMON2341 DNA was digested with restriction enzymes NcoI and HindIII, resulting in a 3619 base pair NcoI,HindIII fragment. The genetic elements derived from pMON2341 are the beta-lactamase gene (AMP), pBR327 origin of replication, phage f1 origin of replication as the transcription terminator, precA promoter and g10L ribosome binding site. Plasmid pMON13364 DNA was digested with NcoI and NsiI. The resulting 170 base pair NcoI, NsiI fragment encodes amino acids 15-71 of (15-125)hIL-3. Plasmid pMON13361 DNA was digested with NsiI and HindIII. The resulting 175 base pair NsiI, HindIII fragment encodes amino acids 72-125 of (15-125)hIL-3. The restriction fragments were ligated, and the ligation reaction mixture was used to transform E. coli K-12 strain JM101. Transformant bacteria were selected on ampicillin-containing plates. Plasmid DNA was isolated, analyzed by restriction analysis, and sequenced to confirm the correct insert. The resulting (15-125)hIL-3 variant has the following amino acid substitutions: 18I, 25H, 29R, 32N, 37P, 42S, 45M, 51R, 55T, 59L, 62V, 67H, 69E, 73G, 76A, 79R, 82V, 87S, 93S, 98T, 101A, 105Q, 109E, 116V, 120Q and 123E. The codons encoding amino acids 15-125 of (15-125)hIL-3 are those found in the hIL-3 cDNA sequence except at those positions where amino acid substitutions were made. The plasmid, pMON13312, encodes the (15-125)hIL-3 variant with the following amino acid sequence:
Peptide #31
Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His Leu Lys Arg Pro Pro Asn Pro Leu Leu Asp Pro Asn Asn Leu Asn Ser Glu Asp Met Asp Ile Leu Met Glu Arg Asn Leu Arg Thr Pro Asn Leu Leu Ala Phe Val Arg Ala Val Lys His Leu Glu Asn Ala Ser Gly Ile Glu Ala Ile Leu Arg Asn Leu Val Pro Cys Leu Pro Ser Ala Thr Ala Ala Pro Ser Arg His Pro Ile Thr Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln Ala Gln Glu Gln Gln [SEQ ID NO:95]
DNA sequence #5 [SEQ ID NO:101] codes for the foregoing pMON13312 polypeptide.
EXAMPLE 41
Construction of pMON13313
Plasmid pMON2341 DNA was digested with restriction enzymes NcoI and HindIII, resulting in a 3619 base pair NcoI,HindIII fragment. The genetic elements derived from pMON2341 are the beta-lactamase gene (AMP), pBR327 origin of replication, phage f1 origin of replication as the transcription terminator, precA promoter and g10L ribosome binding site. Plasmid pMON13363 DNA was digested with NcoI and NsiI. The resulting 170 base pair NcoI, NsiI fragment encodes amino acids 15-71 of (15-125)hIL-3. Plasmid pMON13362 DNA was digested with NsiI and HindIII. The resulting 175 base pair NsiI, HindIII fragment encodes amino acids 72-125 of (15-125)hIL-3. The restriction fragments were ligated, and the ligation reaction mixture was used to transform E. coli K-12 strain JM101. Transformant bacteria were selected on ampicillin-containing plates. Plasmid DNA was isolated, analyzed by restriction analysis, and sequenced to confirm the correct insert. The resulting (15-125)hIL-3 variant has the following amino acid substitutions: 18I, 25H, 29R, 32A, 37P, 42A, 45V, 51R, 55L, 60S, 62V, 67N, 69E, 73G, 76A, 79R, 82V, 87S, 93S, 98T, 101A, 105Q, 109E, 116V, 117S, 120H and 123E. The codons encoding amino acids 15-125 of (15-125)hIL-3 are those found in the hIL-3 cDNA sequence except at those positions where amino acid substitutions were made. The plasmid, pMON13313, encodes the (15-125)hIL-3 variant with the following amino acid sequence:
Peptide #32
Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His Leu Lys Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn Asn Leu Asn Ala Glu Asp Val Asp Ile Leu Met Glu Arg Asn Leu Arg Leu Pro Asn Leu Glu Ser Phe Val Arg Ala Val Lys Asn Leu Glu Asn Ala Ser Gly Ile Glu Ala Ile Leu Arg Asn Leu Val Pro Cys Leu Pro Ser Ala Thr Ala Ala Pro Ser Arg His Pro Ile Thr Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Ser Leu Glu His Ala Gln Glu Gln Gln [SEQ ID NO:96)
DNA sequence #3 [SEQ ID NO:99] codes for the foregoing pMON13313 polypeptide.
EXAMPLE 42
Construction of pMON5987
Plasmid pMON6458 DNA was digested with restriction enzymes NcoI and HindIII, resulting in a 3940 base pair NcoI,HindIII fragment. The genetic elements derived from pMON6458 are the beta-lactamase gene (AMP), pBR327 origin of replication, phage f1 origin of replication as the transcription terminator, pAraBAD promoter, g10L ribosome binding site and lamB secretion leader. Plasmid pMON5978 DNA was digested with NcoI and NsiI. The resulting 170 base pair NcoI, NsiI fragment encodes amino acids 15-71 of (15-125)hIL-3. Plasmid pMON5976 DNA was digested with NsiI and HindIII. The resulting 175 base pair NsiI,HindIII fragment encodes amino acids 72-125 of (15-125)hIL-3. The restriction fragments were ligated, and the ligation reaction mixture was used to transform E. coli K-12 strain JM101. Transformant bacteria were selected on ampicillin-containing plates. Plasmid DNA was isolated and screened for the restriction sites EcoRV and NheI and DNA sequenced to confirm the correct insert.
EXAMPLE 43
Construction of pMON5988
The plasmid DNA of pMON5987 was digested with NheI and EcoRI, resulting in a 3903 base pair NheI, EcoRI fragment. The 3903 base pair NheI, EcoRI fragment was ligated to 1.0 picomoles of the following annealed oligonucleotides:
5'-CTAGCCACGGCCGCACCCACGCGACATCCAATCCATATCAAGGACGGTGACTGGAATG-3' [SEQ IDNO:131] 3'-GGTGCCGGCGTGGGTGCGCTGTAGGTTAGGTATAGTTCCTGCCACTGACCTTACAATT-5' [SEQID NO:132]
The ligation reaction mixture was used to transform E. coli K-12 strain JM101 and transformant bacteria were selected on ampicillin-containing plates. Plasmid DNA was isolated and sequenced to confirm positive clones. This plasmid was constructed to change alanine 101 to aspartic acid in the hIL-3 gene (15-125). This plasmid was designated pMON5988.
EXAMPLE 44
Construction of pMON5853 (FIG. 6) which encodes [Met-(15-133)hIL-3(Arg.sup.129)]
Plasmid DNA of pMON5847 (Example 2) was treated with NcoI. The restriction enzyme was inactivated by heat treatment (65.degree. C. for 10 minutes). The DNA was then treated with large fragment of DNA polymerase I (Klenow) in the presence of all four nucleotide precursors. This produces DNA termini with non-overlapping ends. After 5 minutes at 37.degree. C., the polymerase was inactivated by heat treatment at 65.degree. C. for 10 minutes. The DNA was then treated with HpaI, an enzyme which produces non-overlapping termini. The DNA was ethanol precipitated and ligated. The ligation reaction mixture was used to transform competent JM101 cells to ampicillin resistance. Colonies were picked and plasmid DNA was analyzed by restriction analysis. A plasmid designated pMON5853 was identified as one containing a deletion of the amino terminal 14 codons of the hIL-3 gene. The DNA sequence for the junction of the ribosome binding site to the (15-133) hIL-3 gene was determined to be the following:
5'-AAGGAGATATATCCATGAACTGCTCTAAC-3' [SEQ ID NO:133] M N C S N [SEQ ID NO:134]
The lower line contains the one letter code for the amino acids specified by the coding sequence of the amino terminus of the 15-133 hIL-3 gene. These are methionine, asparagine, cysteine, serine and asparagine.
When cultures of JM101 cells harboring this plasmid were induced with nalidixic acid, it was found that hIL-3 (15-133) accumulated at levels higher than hIL-3 (pMON5847).
The plasmid, pMON5853, encodes Met-(15-133) hIL-3 (Arg.sup.129) which has the following amino acid sequence:
Met Asn Cys Ser Asn Met Ile Asp Glu Ile Ile Thr His Leu Lys Gln Pro Pro Leu Pro Leu Leu Asp Phe Asn Asn Leu Asn Gly Glu Asp Gln Asp Ile Leu Met Glu Asn Asn Leu Arg Arg Pro Asn Leu Glu Ala Phe Asn Arg Ala Val Lys Ser Leu Gln Asn Ala Ser Ala Ile Glu Ser Ile Leu Lys Asn Leu Leu Pro Cys Leu Pro Leu Ala Thr Ala Ala Pro Thr Arg His Pro Ile His Ile Lys Asp Gly Asp Trp Asn Glu Phe Arg Arg Lys Leu Thr Phe Tyr Leu Lys Thr Leu Glu Asn Ala Gln Ala Gln Gln Thr Thr Leu Arg Leu Ala Ile Phe [SEQ ID NO:135]
EXAMPLE 45
Construction of pMON5873 which encodes [Met-(1-133)hIL-3]
The gene obtained from British Biotechnology, Ltd. specified arginine at codon position 129. The amino acid specified in the native hIL-3 cDNA is serine. To produce a protein with the native sequence at this position, the portion of the coding sequence between the EcoRI site at codons 106 and 107 and the NheI site at codons 129 and 130 was replaced. Plasmid DNA of pMON5854 (Example 3) and pMON5853 (Example 44) were treated with EcoRI and NheI. The larger fragments of each were gel purified. These were ligated to a pair of an annealed oligonucleotides with the following sequences:
5'-AATTCCGTCGTAAACTGACCTTCTATCTGAAAACCTTGGAGAACGCGCAGGCTCAACAGACCACTCTGTCG-3' [SEQ ID NO:136] 3'-GGCAGCATTTGACTGGAAGATAGACTTTTGGAACCTCTTGCGCGTCCGAGTTGTGAGACAGCGATC-5' [SEQ ID NO:137]
The ligation reaction mixtures were used to transform competent JM101 cells to ampicillin resistance. Colonies were picked into broth and grown. Plasmid DNA was isolated and screened for the presence of a new StyI recognition site present in the synthetic DNA and not in pMON5854 and pMON5853. The nucleotide sequence of the gene in the region between EcoRI and NheI was determined and found to be that of the synthetic oligonucleotides. The new plasmids were designated pMON5873 encoding [Met-(1-133)hIL-3] and pMON5872 encoding [Met-(15-133)hIL-3].
The plasmid, pMON5873, encodes Met-(1-133)hIL-3 which has the following amino acid sequence:
Met Ala Pro Met Thr Gln Thr Thr Ser Leu Lys Thr Ser Trp Val Asn Cys Ser Asn Met Ile Asp Glu Ile Ile Thr His Leu Lys Gln Pro Pro Leu Pro Leu Leu Asp Phe Asn Asn Leu Asn Gly Glu Asp Gln Asp Ile Leu Met Glu Asn Asn Leu Arg Arg Pro Asn Leu Glu Ala Phe Asn Arg Ala Val Lys Ser Leu Gln Asn Ala Ser Ala Ile Glu Ser Ile Leu Lys Asn Leu Leu Pro Cys Leu Pro Leu Ala Thr Ala Ala Pro Thr Arg His Pro Ile His Ile Lys Asp Gly Asp Trp Asn Glu Phe Arg Arg Lys Leu Thr Phe Tyr Leu Lys Thr Leu Glu Asn Ala Gln Ala Gln Gln Thr Thr Leu Ser Leu Ala Ile Phe [SEQ ID NO:128]
EXAMPLE 46
Construction of pMON6458
Plasmid pMON6525 was digested with restriction enzymes HindIII and SalI and the resulting 3172 base pair fragment was isolated from a 1% agarose gel by interception onto DEAE membrane. The genetic elements derived from pMON6525 are the beta-lactamase gene (AMP), pBR327 origin of replication, and phage f1 origin of replication as the transcription terminator. (The genetic elements derived from plasmid pMON6525 are identical to those in plasmid pMON2341 which could also be used to construct pMON6458.) Plasmid pMON6457 was digested with restriction enzymes HindIII and SalI and the resulting 1117 base pair fragment was isolated by PAGE and crush and soak elution. The genetic elements derived from pMON6457 are the pAraBAD promoter, g10L ribosome binding site, lamB secretion leader and the (15-125) hIL-3 gene. The restriction fragments were ligated and the ligation reaction mixture was used to transform E. coli K-12 strain JM101. Transformant bacteria were selected on ampicillin-containing plates. Plasmid DNA was isolated and the size of the inserted fragment was determined by restriction analysis employing restriction enzymes NcoI and HindIII in double digest. Clones containing the hIL-3 gene (encoding amino acids 15-125) contained a 345 base pair NcoI, HindIII restriction fragment. This construct was designated pMON6458. This plasmid was constructed to eliminate an EcoRI restriction site outside the hIL-3 gene coding region in plasmid pMON6457.
EXAMPLE 47
Construction of pMON5976 which encodes [Met-(15-125)hIL-3(Ala.sup.101)]
The plasmid DNA of pMON5941 isolated from the dam-E. coli strain GM48 was cleaved with ClaI and NsiI and ligated to 1 picomole of an annealed assembly of six oligonucleotides encoding amino acids 20-70 of hIL-3 (FIG. 2). This synthetic fragment encodes three unique restriction sites, EcoRV, XhoI and PstI. The sequence of these oligonucleotides is shown in FIG. 2.
The resulting ligation mix was used to transform competent E. coli JM101 cells to ampicillin resistant colonies. Plasmid DNA was isolated and the inserted fragment was determined to have both an EcoRV and NheI site. The nucleotide sequence of the region between ClaI and NsiI was determined and found to be that of the synthetic oligonucleotides. At codons 86-87 of a nucleotide sequence coding for (15-125)hIL-3, an NheI site was introduced. The plasmid with this alteration was designated pMON5941. This plasmid encodes Met-(15-125)hIL-3 which is altered at position 101 by replacement of aspartate by alanine.
Plasmid pMON5976 encodes Met-(15-125)hIL-3(Ala.sup.101) which has the following amino acid sequence:
Met Asn Cys Ser Asn Met Ile Asp Glu Ile Ile Thr His Leu Lys Gln Pro Pro Leu Pro Leu Leu Asp Phe Asn Asn Leu Asn Gly Glu Asp Gln Asp Ile Leu Met Glu Asn Asn Leu Arg Arg Pro Asn Leu Glu Ala Phe Asn Arg Ala Val Lys Ser Leu Gln Asn Ala Ser Ala Ile Glu Ser Ile Leu Lys Asn Leu Leu Pro Cys Leu Pro Leu Ala Thr Ala Ala Pro Thr Arg His Pro Ile His Ile Lys Ala Gly Asp Trp Asn Glu Phe Arg Arg Lys Leu Thr Phe Tyr Leu Lys Thr Leu Glu Asn Ala Gln Ala Gln Gln [SEQ ID NO:138]
EXAMPLE 48
Construction of pMON5917 which encodes [Met-(15-88)hIL-3]
The plasmid DNA of pMON5853 was cleaved with NsiI and HindIII and ligated to an annealed pair of oligonucleotides encoding (70-88)hIL-3 with a new NheI endonuclease restriction site at codons 86-87. The sequence of these oligonucleotides is shown in Example 18.
The ligation mixture was used to transform competent E. coli JM101 cells, and ampicillin resistant colonies were picked. Plasmid DNA isolated from individual colonies was screened for the presence of the new NheI restriction site. The nucleotide sequence of the substituted portion was determined and found to be that of the synthetic oligonucleotides. The new plasmid was designated pMON5917 encoding Met-(15-88)hIL-3 containing a new NheI site at codons 86-87.
Plasmid pMON5917 encodes Met-(15-88)hIL-3 which has the following amino acid sequence:
Met Asn Cys Ser Asn Met Ile Asp Glu Ile Ile Thr His Leu Lys Gln Pro Pro Leu Pro Leu Leu Asp Phe Asn Asn Leu Asn Gly Glu Asp Gln Asp Ile Leu Met Glu Asn Asn Leu Arg Arg Pro Asn Leu Glu Ala Phe Asn Arg Ala Val Lys Ser Leu Gln Asn Ala Ser Ala Ile Glu Ser Ile Leu Lys Asn Leu Leu Pro Cys Leu Pro Leu Ala [SEQ ID NO: 139]
EXAMPLE 49
Construction of pmon5941 which encodes [Met-(15-125)hIL-3 Ala.sup.101 ]
The plasmid DNA of pMON5917 was cleaved with NheI and HindIII and ligated to two annealed pairs of oligonucleotides which encode amino acids 86-106 and 107-125 of hIL-3. The sequences of these oligonucleotides is shown below.
NheI to EcoRI5'-CTAGCCACGGCCGCACCCACGCGACATCCAATCCATATCAAGGCTGGTGACTGGAATG-3' [SEQ IDNO:140] 3'-GGTGCCGGCGTGGGTGCGCTGTAGGTTAGGTATAGTTCCGACCACTGACCTTACTTAA-5' [SEQID NO:141]EcoRI to HindIII5'-AATTCCGTCGTAAACTGACCTTCTATCTGAAAACCTTGGAGAACGCGCAGGCTCAACAGTAATA-3'[SEQ ID NO:142] 3'-GGCAGCATTTGACTGGAAGATAGACTTTTGGAACCTCTTGCGCGTCCGAGTTGTCATTATTCGA-5' [SEQ ID NO:143]
The ligation mixture was used to transform competent E. coli JM10l cells to ampicillin resistant colonies. Plasmid DNA was isolated from these cells and the size of the inserted fragment was determined to be larger by restriction analysis with NcoI and HindIII. The Asp to Ala 101 change is encoded on the NheI to EcoRI fragment. The nucleotide sequence of the portion of the coding region between the NheI and HindIII sites was determined and found to be that of the synthetic oligonucleotides. The new plasmid was designated pMON5941.
The plasmid, pMON5941, encodes Met-(15-125)hIL-3(Ala.sup.101) and contains a new NheI restriction site.
EXAMPLE 50
Construction of pMON6455
Plasmid pMON5905 was digested with restriction enzymes HindIII and NcoI resulting in a 3936 base pair fragment. The genetic elements derived from pMON5905 are the beta-lactamase gene (AMP), pBR327 origin of replication, pAraBAD promoter, g10L ribosome binding site, lamB secretion leader and phage f1 origin of replication as the transcription terminator. The following genetic elements; beta-lactamase gene (AMP), pBR327 origin of replication, g10L ribosome binding site and phage fl origin of replication as the transcription terminator, derived from plasmid pMON5905 are identical to these in plasmid pMON5594 which could also be used to construct pMON6455. The AraBAD promoter is identical to that described in pMON6235. The lamB signal peptide sequence used in pMON6455 is that shown in FIG. 8 fused to hIL-3 (15-125) at the NcoI site. Plasmid pMON5887 was digested with restriction enzymes HindIII and NcoI, resulting in a 384 base pair NcoI, HindIII fragment. The restriction fragments were ligated, and the ligation reaction mixture was used to transform into E. coli K-12 strain JM101. Transformant bacteria were selected on ampicillin-containing plates. Plasmid DNA was isolated and the size of the inserted fragment was determined by restriction analysis employing restriction enzymes NcoI and HindIII in double digest. Positive clones containing the hIL-3 gene (encoding amino acids 1-125) contained a 384 base pair NcoI, HindIII restriction fragment. This construct was designated pMON6455.
EXAMPLE 51
Construction of pMON6456
Plasmid pMON5905 was digested with restriction enzymes HindIII and NcoI resulting in a 3936 base pair fragment. The genetic elements derived from pMON5905 are the beta-lactamase gene (AMP), pBR327 origin of replication, phage f1 origin of replication as the transcription terminator, pAraBAD promoter, g10L ribosome binding site and the lamb secretion leader. Plasmid pMON5871 was digested with restriction enzymes HindIII and NcoI, resulting in a 330 base pair NcoI, HindIII fragment. The genetic element derived from pMON5871 encompassed the bases encoding the (1-107) hIL-3 gene. The restriction fragments were ligated, and the ligation reaction mixture was used to transform E. coli K-12 strain JM101. Transformant bacteria were selected on ampicillin-containing plates. Plasmid DNA was isolated and the size of the inserted fragment was determined by restriction analysis employing restriction enzymes NcoI and HindIII in double digest. Clones containing the hIL-3 gene (encoding amino acids 1-107) contained a 330 base pair NcoI, HindIII restriction fragment. This construct was designated pMON6456.
EXAMPLE 52
Construction of pMON6457
Plasmid pMON6455 DNA grown in E. coli strain GM48 (dam-)was digested with restriction enzymes NcoI and ClaI, resulting in a 4263 base pair NcoI, ClaI fragment. The restriction fragment was ligated to 1.0 picomoles of annealed oligonucleotides with the following sequence coding for Met Ala 14-20 hIL-3:
5'-CATGGCTAACTGCTCTAACATGAT-3' [SEQ ID NO:151] 3'-CGATTGACGAGATTGTACTAGC-5' [SEQ ID NO:152]
The resulting DNA was transformed into E. coli K-12 strain JM101 and transformant bacteria were selected on ampicillin-containing plates. Plasmid DNA was isolated and the size of the inserted fragment was determined by restriction analysis employing restriction enzymes XbaI and EcoRI in double digest. Positive clones containing the hIL-3 gene (encoding aa 15-125 of hIL-3) contained a 433 base pair XbaI, EcoRI restriction fragment. This construct was designated pMON6457. This plasmid was constructed to delete the first 14 amino acids of hIL-3. The coding sequence of the resulting gene begins as follows:
5' ATG GCT AAC TGC... 3' [SEQ ID NO:153] Met Ala Asn Cys... [SEQ ID NO:154] 15
The first two amino acids (Methionine, Alanine) create an NcoI restriction site and a signal peptidase cleavage site between the lamB signal peptide and (15-125) hIL-3. Plasmid pMON6457 encodes (15-125) hIL-3 which has the amino acid sequence designated SEQ ID NO:65.
EXAMPLE 53
Construction of pMON6235
One of the DNA fragments used to create this plasmid was generated by site-directed mutagenesis employing PCR techniques described previously using the following oligonucleotides, Oligo #51 [SEQ ID NO:155] and Oligo #52 [SEQ ID NO:156], were used as primers in this procedure. The template for the PCR reaction was E. coli strain W3110 chromosomal DNA, prepared as described in Maniatis (1982). The oligonucleotide primers were designed to amplify the AraBAD promoter (Greenfield et al., 1978). The resulting DNA product was digested with the restriction enzymes SacII and BglII. The reaction mixture was purified as described previously. Plasmid, pMON5594, DNA was digested with SacII and BglII, resulting in a 4416 base pair SacII,BglII restriction fragment which contains the following genetic elements; beta-lactamase gene (AMP), pBR327 origin of replication, G10L ribosome binding site, phage f1 origin of replication as the transcription terminator and the chloramphenicol acetyl transferase (cat) gene. The 4416 base pair SacII,BglII restriction fragment from pMON5594 was ligated to the PCR-generated SacII, BglII DNA fragment. The ligation mixture was used to transform E. coli K-112 strain JM101. Positive clones contained a 323 base pair SacII,BglII fragment and were DNA sequenced to confirm that the SacII,BglII fragment was the AraBAD promoter. This construct was designated pMON6235.
EXAMPLE 54
Construction of pMON5647
Plasmid pMON5585 [prepared as disclosed in EP 0241446 incorporated herein by reference in its entirety] DNA was digested with restriction enzymes NcoI and HindIII resulting in a 3273 base pair NcoI,HindIII fragment. The genetic elements derived from pMON5585 are the pBR327 origin of replication, precA promoter, g10L ribosome binding protein, bovine somatotropin gene (bST), beta-lactamase gene (AMP) and T7 transcription terminator. Plasmid pMON3267 [prepared as disclosed in EP 0241446 incorporated herein by reference in its entirety] DNA was digested with NcoI and HindIII enzymes resulting in a 580 base pair NcoI,HindIII fragment which contains the porcine somatotropin (pST) gene. The restriction fragments were the ligation reaction mixture was used to transform E. coli strain JM101. The DraI, SspI, HincII and EcoRV restriction sites are lost as a result of the cloning. Transformant bacteria were selected on spectinomycin-containing plates. Plasmid DNA was isolated, analyzed by restriction analysis and sequenced to confirm the correct insert.
EXAMPLE 57
Construction of pMON13361
Plasmid pMON13288 was mutagenized by oligonucleotide site-directed mutagenesis (method described in Kunkel, 1985) to eliminate a NsiI site in the (15-125) hIL-3 variant coding region. Codon 70 of (15-125) hIL-3, encoding asparagine, was converted from AAT to AAC destroying the NsiI recognition site. The oligonucleotide, Oligo # 54 [SEQ ID NO:158], was used in this procedure to eliminate the NsiI site. Transformant bacteria were selected on ampicillin-containing plates. Plasmid DNA was isolated, analyzed by restriction analysis to confirm the loss of the NsiI site and sequenced to confirm the sequence of the (15-125) hIL-3 variant gene. The plasmid, pMON13361, encodes the (15-125) hIL-3 variant with the amino acid sequence of PEPTIDE #25 [SEQ ID NO:89].
DNA sequence # 32 [SEQ ID NO:160] codes for the foregoing pMON13361 polypeptide.
EXAMPLE 58
Construction of pMON14058
Plasmid pMON13361 was mutagenized by oligonucleotide site-directed mutagenesis (method described by Taylor et al., 1985 using a kit from Amersham, Arlington Heights, Ill.) to eliminate a EcoRV site in the (15-125) hIL-3 variant coding region. Codon 46 and 47 of (15-125) hIL-3, encoding asparagine and isoleucine, were converted from ligated and the ligation reaction mixture was used to transform E. coli strain JM101. Transformant bacteria were selected on ampicillin-containing plates. Plasmid DNA was isolated, analyzed by restriction analysis and sequenced to confirm the correct insert.
EXAMPLE 55
Construction of pMON710
Plasmid pMON709 consists of a 1614 base pair AvaI,EcoRI fragment of transposon TN7, containing the streptomycin adenylyltransferase gene (Fling et al., 1985) and a pUC9 linker (XmaI,HindIII) cloned between the HindIII and EcoRI sites of pUC19. The streptomycin adenylyltransferase gene COnfers resistance to streptomycin and spectinomycin. Plasmid pMON709 was mutagenized by oligonucleotide site-directed mutagenesis (methods described in Zoller and Smith, 1982) to introduce an EcoRV site at the 3' end of the streptomycin adenylyltransferase gene. The oligonucleotide, Oligo # 53 [SEQ ID NO:157], was used in this procedure to introduce the EcoRV site. The resulting plasmid was designated pMON710.
EXAMPLE 56
Construction of pMON5723
Plasmid pMON5647 DNA was digested with restriction enzymes DraI and SspI resulting in a 2916 base pair DraI, SspI fragment. The genetic elements derived from pMON5647 are the pBR327 origin of replication, precA promoter, g10L ribosome binding protein, porcine somatotropin gene (pST) and T7 transcription terminator (Dunn and Strudier, 1983). Plasmid pMON710 DNA was digested with restriction enzymes HincII and EcoRV resulting in 940 base pair HincII,EcoRV fragment containing the streptomycin adenylyltransferase gene which infers resistance to streptomycin and spectinomycin. The restriction fragments were ligated and GAT to GAC and ATC to ATT respectively, destroying the EcoRV recognition site. The oligonucleotide, Oligo # 55 [SEQ ID NO:159], was used in this procedure to eliminate the EcoRV site. Transformant bacteria were selected on ampicillin-containing plates. Plasmid DNA was isolated, analyzed by restriction analysis to confirm the loss of the EcoRV site and sequenced to confirm the sequence of the (15-125) hIL-3 variant gene. The plasmid, pMON14058, encodes the (15-125) hIL-3 variant with the amino acid sequence of PEPTIDE #25 [SEQ ID NO:89].
DNA sequence # 33 [SEQ ID NO:161] codes for the foregoing pMON14058 polypeptide.
EXAMPLE 59
Construction of pMON13438
Plasmid pMON5723 DNA was digested with restriction enzymes NcoI and HindIII resulting in a 3278 NcoI,HindIII fragment. The genetic elements derived from pMON5723 are the pBR327 origin of replication, precA promoter, g10L ribosome binding protein, T7 transcription terminator and streptomycin adenylyltransferase gene. Plasmid pMON14058 DNA was digested with NcoI and HindIII resulting in a 345 base pair NcoI,HindIII fragment which contains the (15-125) hIL-3 gene with the following amino acid substitutions: 18I, 25H, 29R, 32N, 37P, 42S, 45M, 51R, 55T, 59L, 62V, 67H, 69E,73G, 76A, 79R, 83Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116v, 120Q and 123E. The restriction fragments were ligated and the ligation reaction mixture was used to transform E. coli strain JM101. Transformant bacteria were selected on spectinomycin-containing plates.
Plasmid DNA was isolated, analyzed by restriction analysis and sequenced to confirm the correct insert. The plasmid, pMON13438, encodes the (15-125) hIL-3 variant with the amino acid sequence of PEPTIDE #25 [SEQ ID NO:89].
DNA sequence # 33 [SEQ ID NO:161] codes for the foregoing pMON13438 polypeptide.
EXAMPLE 60
Construction of pMON13285
Plasmid pMON13252 DNA was digested with restriction enzymes NcoI and EcoRV and the resulting 3669 base pair NcoI,EcoRV fragment contains the following genetic elements; streptomycin adenyltransferase gene, pBR327 origin of replication, phage f1 origin of replication as the transcription terminator, recA promoter, g10L ribosome binding site and the bases encoding amino acids 47-125 of (15-125) hIL-3 with the following amino acid substitution, 50D. The 3669 base pair NcoI,EcoRV restriction fragment from pMON13252 was ligated to the following annealed complementary oligonucleotides.
Oligo #165 [SEQ ID NO:162]
Oligo #166 [SEQ ID NO:163]
Oligo #167 [SEQ ID NO:164]
Oligo #168 [SEQ ID NO:165]
Oligo #169 [SEQ ID NO:166]
Oligo #170 [SEQ ID NO:167]
When assembled, the oligonucleotides create NcoI and EcoRV restriction ends and the DNA sequence that encodes amino acids 15-46 of (15-125) hIL-3 with the following amino acid substitutions; 42D, 45M and 46S. The codons encoding amino acids 15-46 of (15-125) hIL-3 are those found in the hIL-3 cDNA sequence except at those positions where amino acid substitutions were made. The plasmid, pMON13285, encodes the (15-125) hIL-3 variant with the following amino acid sequence:
Peptide #A3 [SEQ ID NO:259]DNA sequence #A3 pMON13285 42D, 45M 46S, 50DATGGCTAACT GCTCTAACAT GATCGATGAA ATCATCACCCACCTGAAGCA GCCACCTCTG CCGCTGCTGG ACTTCAACAACCTCAATGAC GAAGACATGT CTATCCTGAT GGACAATAACCTTCGTCGTC CAAACCTCGA GGCATTCAAC CGTGCTGTCAAGTCTCTGCA GAATGCATCA GCAATTGAGA GCATTCTTAAAAATCTCCTG CCATGTCTGC CCCTGGCCAC GGCCGCACCCACGCGACATC CAATCCATAT CAAGGACGGT GACTGGAATGAATTCCGTCG TAAACTGACC TTCTATCTGA AAACCTTGGAGAACGCGCAG GCTCAACAG[SEQ ID NO:398]
EXAMPLE 61
Construction of pMON13286
Plasmid pMON5978 DNA was digested with restriction enzymes NcoI and EcoRV and the resulting 3865 base pair NcoI,EcoRV fragment contains the following genetic elements; beta-lactamase gene (AMP), pBR327 origin of replication, phage f1 origin of replication as the transcription terminator, precA promoter, g10L ribosome binding site and the bases encoding amino acids 47-125 of (15-125) hIL-3. The 3865 base pair NcoI,EcoRV restriction fragment from pMON5978 was ligated to the following annealed complementary oligonucleotides.
Oligo #165 [SEQ ID NO:162]
Oligo #166 [SEQ ID NO:163]
Oligo #167 [SEQ ID NO:164]
Oligo #168 [SEQ ID NO:165]
Oligo #169 [SEQ ID NO:166]
Oligo #170 [SEQ ID NO:167]
When assembled, the oligonucleotides create NcoI and EcoRV restriction ends and the DNA sequence that encodes amino acids 15-46 of (15-125) hIL-3 with the following amino acid substitutions; 42D, 45M and 46S. The codons encoding amino acids 15-46 of (15-125) hIL-3 are those found in the hIL-3 cDNA sequence except at those positions where amino acid substitutions were made. The plasmid, pMON13286, encodes the (15-125) hIL-3 variant with the following amino acid sequence:
Peptide #A4 [SEQ ID NO:260]DNA sequence #A4 pMON13286 42D, 45M, 46sATGGCTAACT GCTCTAACAT GATCGATGAA ATCATCACCCACCTGAAGCA GCCACCGCTG CCGCTGCTGG ACTTCAACAACCTCAATGAC GAAGACATGT CTATCCTGAT GGAAAATAACCTTCGTCGTC CAAACCTCGA GGCATTCAAC CGTGCTGTCAAGTCTCTGCA GAATGCATCA GCAATTGAGA GCATTCTTAAAAATCTCCTG CCATGTCTGC CCCTGGCCAC GGCCGCACCCACGCGACATC CAATCCATAT CAAGGACGGT GACTGGAATGAATTCCGTCG TAAACTGACC TTCTATCTGA AAACCTTGGAGAACGCGCAG GCTCAACAG[SEQ ID NO:399]
EXAMPLE 62
Construction of pMON13325
The 3704 base pair EcoRI, HindIII DNA fragment from plasmid pMON13286 is ligated to the 64 base pair EcoRI, HindIII DNA fragment from plasmid pMON13215. The following genetic elements are derived from pMON13286; beta-lactamase gene (AMP), pBR327 origin of replication, phage F1 origin of replication as the transcription terminator, precA promoter, g10L ribosome binding site and the bases encoding amino acids 15-105 of the (15-125) hIL-3 gene with the following changes, 42D, 45M, and 46S. The bases encoding amino acids 106-125 of the (15-125) gene with the following change, 116W, are derived from pMON13215. The resulting plasmid, pMON13325, encodes the (15-125) hIL-3 variant with the following amino acid sequence:
Peptide # A5 [SEQ ID NO:261]
EXAMPLE 63
Construction of pMON13326
The 3683 base pair NcoI, EcoRI DNA fragment from plasmid pMON13215 is ligated to the 281 base pair NcoI, EcoRI DNA fragment from plasmid pMON13285. The following genetic elements are derived from pMON13215; beta-lactamase gene (AMP), pBR327 origin of replication, phage F1 origin of replication as the transcription terminator, precA promoter, g10L ribosome binding site and the bases encoding amino acids 106-125 of the (15-125) hIL-3 gene with the following change, 116W. The bases encoding amino acids 15-105 of the (15-125) gene with the following change, 42D, 45M, 46S and 50D derived from pMON13285. The resulting plasmid, pMON13326, encodes the (15-125) hIL-3 variant with the following amino acid sequence:
Peptide # A6 [SEQ ID NO:262]
EXAMPLE 64
Construction of pMON13332
Plasmid pMON13326 DNA is digested with restriction enzymes NsiI and EcoRI and the resulting 3853 base pair NsiI,EcoRI fragment contains the following genetic elements; beta-lactamase gene (AMP), pBR327 origin of replication, phage fl origin of replication as the transcription terminator, recA promoter, g10L ribosome binding site and the bases encoding amino acids 15-71 and 106-125 of (15-125) hIL-3 gene with the following changes 42D, 45M, 46S, 50D and 116W. The 3853 base pair NsiI,EcoRI restriction fragment from pMON13326 is ligated to the following annealed complementary oligonucleotides.
Oligo #15(A) [SEQ ID NO:168]
Oligo #16(A) [SEQ ID NO:169]
In the resulting plasmid the 111 bases between the NsiI and EcoRI restriction sites in the (15-125) hIL-3 gene are replaced with 24 bases from the above mentioned oligonucleotides. This linker also creates a NdeI recognition sequence.
EXAMPLE 65
Construction of pMON13330
The 3846 base pair PstI, EcoRI DNA fragment from plasmid pMON13332 is ligated to the 118 base pair PstI, EcoRI DNA fragment from plasmid pMON13305. The following genetic elements are derived from pMON13332; beta-lactamase gene (AMP), pBR327 origin of replication, phage f1 origin of replication as the transcription terminator, recA promoter, g10L ribosome binding site and the bases encoding amino acids 15-69 and 106-125 of the (15-125) hIL-3 gene with the following change, 42D, 45M, 46S, 50D and 116W. The bases encoding amino acids 70-105 of the (15-125) gene with the following change, 95R, 98I and 100R are derived from pMON13305. The resulting plasmid, pMON13330, encodes the (15-125) hIL-3 variant with the following amino acid sequence:
Peptide # A7 [SEQ ID NO:263]
EXAMPLE 66
Construction of pMON13329
The 3846 base pair PstI, EcoRI DNA fragment from plasmid pMON13332 is ligated to the 118 base pair PstI, EcoRI DNA fragment from plasmid pMON13304. The following genetic elements are derived from pMON13332; beta-lactamase gene (AMP), pBR327 origin of replication, phage f1 origin of replication as the transcription terminator, recA promoter, g10L ribosome binding site and the bases encoding amino acids 15-69 and 106-125 of the (15-125) hIL-3 gene with the following change, 42D, 45M, 46S, and 116W. The bases encoding amino acids 70-105 of the (15-125) gene with the following change, 98I and 100R are derived from pMON13304. The resulting plasmid, pMON13329, encodes the (15-125) hIL-3 variant with the following amino acid sequence:
Peptide # A8 [SEQ ID NO:406]
EXAMPLE 67
Construction of pMON5853 (FIG. 6) which encodes [Met-(15-133)hIL-3(Arg.sup.129)]
Plasmid DNA of pMON5847 (Example 2) was treated with NcoI. The restriction enzyme was inactivated by heat treatment (65.degree. C. for 10 minutes) The DNA was then treated with large fragment of DNA polymerase I (Klenow) in the presence of all four nucleotide precursors. This produces DNA termini with non-overlapping ends. After 5 minutes at 37.degree. C., the polymerase was inactivated by heat treatment at 65.degree. C. for 10 minutes. The DNA was then treated with HpaI, an enzyme which produces non-overlapping termini. The DNA was ethanol precipitated and ligated. The ligation reaction mixture was used to transform competent JM101 cells to ampicillin resistance. Colonies were picked and plasmid DNA was analyzed by restriction analysis. A plasmid designated pMON5853 was identified as one containing a deletion of the amino terminal 14 codons of the hIL-3 gene. The DNA sequence for the junction of the ribosome binding site to the (15-133) hIL-3 gene was determined to be the following:
5'-AAGGAGATATATCCATGAACTGCTCTAAC-3' [SEQ ID NO:400] M N C S N [SEQ ID NO: 401]
The lower line contains the one-letter code for the amino acids specified by the coding sequence of the amino terminus of the 15-133 hIL-3 gene. These are methionine, asparagine, cysteine, serine and asparagine.
When cultures of JM101 cells harboring this plasmid were induced with nalidixic acid, it was found that hIL-3 (15-133) accumulated at levels higher than hIL-3 (pMON5847).
The plasmid, pMON5853, encodes Met-(15-133) hIL-3 (Arg.sup.129) which has the following amino acid sequence:
Met Asn Cys Ser Asn Met Ile Asp Glu Ile Ile ThrHis Leu Lys Gln Pro Pro Leu Pro Leu Leu Asp Phe AsnAsn Leu Asn Gly Glu Asp Gln Asp Ile Leu Met Glu AsnAsn Leu Arg Arg Pro Asn Leu Glu Ala Phe Asn Arg AlaVal Lys Ser Leu Gln Asn Ala Ser Ala Ile Glu Ser IleLeu Lys Asn Leu Leu Pro Cys Leu Pro Leu Ala Thr AlaAla Pro Thr Arg His Pro Ile His Ile Lys Asp Gly AspTrp Asn Glu Phe Arg Arg Lys Leu Thr Phe Tyr Leu LysThr Leu Glu Asn Ala Gln Ala Gln Gln Thr Thr Leu ArgLeu Ala Ile Phe [SEQ ID NO:402]
EXAMPLE 68
Construction of pMON13252
Plasmid, pMON2341, DNA was digested with restriction enzymes NcoI and HindIII resulting in a 3619 base pair NcoI/HindIII fragment. The genetic elements derived from pMON2341 are the beta-lactamase gene (AMP), pBR327 origin of replication F1 phage origin of replication as the transcription terminator, precA, g10L ribosome binding site. The plasmid encoding the hIL-3 (15-125) Asp.sup.(50) variant, was digested with NcoI and HindIII resulting in a 345 base pair NcoI/HindIII fragment. This 345 Base pair NcoI/HindIII fragment was ligated with the 3619 base pair fragment from pMON2341 and the ligation reaction mixture was used to transform E. coli K-12 strain JM101. Plasmid DNA was isolated and screened by restriction analysis using NcoI and HindIII. Positive clones contained a 345 base pair NcoI/HindIII fragment. This construct was designated pMON13252. The plasmid, pMON13252, encodes the (15-125)hIL-3 variant with the following amino acid sequence:
PEPTIDE A10; (15-125)HIL-3 Asp.sup.(50) pMON13252 Asn Cys Ser Asn Met Ile Asp Glu Ile Ile Thr His Leu 15 20 25 Lys Gln Pro Pro Leu Pro Leu Leu Asn Phe Asn Asn Leu Asn Gly 30 35 40 Glu Asp Gln Asp Ile Leu Met Asp Asn Asn Leu Arg Arg Pro Asn 45 50 55 Leu Glu Ala Phe Asn Arg Ala Val Lys Ser Leu Gln Asn Ala Ser 60 65 70 Ala Ile Glu Ser Ile Leu Lys Asn Leu Leu Pro Cys Leu Pro Leu 75 80 85 Ala Thr Ala Ala Pro Thr Arg His Pro Ile His Ile Lys Asp Gly 90 95 100 Asp Trp Asn Glu Phe Arg Arg Lys Leu Thr Phe Tyr Leu Lys Thr 105 110 115 Leu Glu Asn Ala Gln Ala Gln Gln [SEQ ID NO:407] 120 125DNA sequence #A10 pMON13252 50DATGGCTAACT GCTCTAACAT GATCGATGAA ATCATCACCC ACCTGAAGCAGCCACCGCTG CCGCTGCTGG ACTTCAACAA CCTCAATGGT GAAGACCAAGATATCCTGAT GGAACAATAAC CTTCGTCGTC CAAACCTCGA GGCATTCAACCGTGCTGTCA ACTCTCTGCA GAATGCATCA GCAATTGAGA GCATTCTTAAAAATCTCCTG CCATGTCTGC CCCTGGCCAC GGCCGCACCC ACGCGACATCCAATCCATAT CAAGGACGGT GACTGGAATG AATTCCGTCG TAAACTGACCTTCTATCTGA AAACCTTGGA GAACGCGCAG GCTCAACAG[SEQ ID NO:408]
EXAMPLES 69-76
The variants in Table 5 were constructed by cassette mutagenesis using methods described in the Materials and Methods and the Examples contained herein, particularly Examples 54-58. Parental plasmid DNA (Table 5), digested with the appropriate restriction enzymes (Table 5), was ligated with the indicated annealed pairs of complementary oligonucleotides (Table 5). The assembled oligonucleotides create appropriate restriction ends and a portion of the (15-125) hIL-3 gene sequence (pMON13288 (SEQ ID NO:100]). Individual isolates were screened by restriction analysis and DNA sequenced to confirm that the desired changes in the (15-125) hIL-3 variant gene were made. The oligonucleotides create change(s) in the (15-125) hIL-3 gene which encode the corresponding amino acid substitution(s) in the variant polypeptide (Table 5). The amino acids substitutions in addition to and/or different from those in polypeptide # 25 [SEQ ID NO:89] are indicated in Table 5. The table also shows the plasmid designation (pMON number), DNA sequence identification number for the mutated hIL-3 gene and the identification number for the the resulting variant polypeptide. The biological activity (growth promoting activity in AML 193 cells) for some of the variants in Table 5 is shown in Table 1.
EXAMPLES 77-82
The variants in Table 6 were constructed by methods described in the Materials and Methods and the Examples contained herein, particularly in Examples 60 and 61. Parental plasmid DNA (Table 6), digested with the appropriate restriction enzymes (Table 6), was ligated with the indicated restriction fragment (Table 6). Individual isolates were screened by restriction analysis and DNA sequenced to confirm that the desired changes in the (15-125) hIL-3 variant gene were made. The resulting mutated (15-125) hIL-3 genes encode the corresponding amino acid substitutions in the variant polypeptides (Table 6). The amino acids substitutions in addition to and/or different from those in polypeptide # 25 [SEQ ID NO:89] are indicated in Table 6. The table also shows the plasmid designation (pMON number), DNA sequence identification number for the mutated hIL-3 gene and the identification number for the the resulting variant polypeptide. The biological activity (growth promoting activity in AML 193 cells) for some of the variants in Table 6 is shown in Table 1.
EXAMPLE 83
Construction of pMON13368
One of the DNA fragments to construct the plasmid, pMON13368, was generated by site-directed mutagenesis employing PCR techniques described in the Materials and Methods and the Examples contained herein, particularly Example 53. The template for the PCR reaction was plasmid, pMON13289, DNA using the oligonucleotides, Oligo #B13 18I23A25H [SEQ ID NO: 182] and Oligo #B14 2341HIN3 [SEQ ID NO:183], as primers. The resulting DNA product was digested with the restriction enzymes NcoI and HindIII. Upon completion, the digest was heated at 70.degree. C. for 15 minutes to inactivate the enzymes. The restriction fragment was purified by phenol/chloroform extraction and precipitation with equal volume isopropanol in the presence of 2M NH4OAc. The oligonucleotide, Oligo #B13 18I23A25H [SEQ ID NO:182], changes the codon at position 23 of (15-125) hIL-3 variant gene pMON13289 [SEQ ID NO:103] from `ATT` to `GCA` (Ile to Ala). The 3619 base pair NcoI, HindIII restriction fragment from pMON2341 was ligated to the PCR-generated NcoI, HindIII restriction fragment. Individual isolates were screened by restriction analysis and DNA sequenced to confirm that the desired changes in the (15-125) hIL-3 variant gene were made. The plasmid, pMON13368, contains the (15-125) hIL-3 variant gene (DNA sequence #B15 [SEQ ID NO:346]) which encodes the (15-125) hIL-3 variant polypeptide with the following amino acid sequence:
Polypeptide #B15 [SEQ ID NO.:278]
EXAMPLE 84
Construction of pMON13380
Plasmid, pMON13368, DNA was digested with restriction enzymes EcoRI and HindIII. The resulting 3900 base pair EcoRI,HindIII fragment contains the following genetic elements; beta-lactamase gene (AMP), pBR327 origin of replication, phage Fl origin of replication as the transcription terminator, precA promoter, g10L ribosome binding site and the DNA sequence encoding amino acids 15-105 of the variant pMON13368. The 3900 base pair EcoRI,HindIII restriction fragment from pMON13368 was ligated to the following annealed complementary oligonucleotides.
______________________________________Oligo #B48 9E12Q6V1 [SEQ ID NO:217]Oligo #B49 9E12Q6V3 [SEQ ID NO:218]Oligo #49 120Q123E2 [SEQ ID NO:63]Oligo #50 120Q123E4 [SEQ ID NO:64]______________________________________
When assembled, the oligonucleotides create EcoRI and HindIII restriction ends and the DNA sequence that encodes amino acids 106-125 of (15-125) hIL-3 with the following amino acid substitution; 109E, 112Q, 116V, 120Q and 123E. The codons used in the (15-125) hIL-3 gene are those found in the hIL-3 cDNA sequence except at those positions where amino acid substitutions were made. Individual isolates were screened by restriction analysis and DNA sequenced to confirm that the desired changes in the (15-125) hIL-3 variant gene were made. The plasmid, pMON13380, contains the (15-125) hIL-3 variant gene (DNA sequence #B16 [SEQ.ID NO:347]) which encodes the (15-125) hIL-3 variant polypeptide with the following amino acid sequence:
Polypeptide #B16 [SEQ ID NO.:279]
EXAMPLE 85
Construction of pMON13476
One of the DNA fragments to construct the plasmid, pMON13476, was generated by site-directed mutagenesis employing PCR techniques described in the Materials and Methods and the Examples contained herein, particularly Example 54. The template for the PCR reaction was plasmid, pMON13287, DNA using the oligonucleotides, Oligo #B13 18I23A25H [SEQ ID NO:182] and Oligo #B14 2341HIN3 [SEQ ID NO.:183] as primers. The resulting DNA product was digested with the restriction enzymes NcoI and HindIII. Upon completion, the digest was heated at 70.degree. C. for 15 minutes to inactivate the enzymes. The restriction fragment was purified by phenol/chloroform extraction and precipitation with equal volume isopropanol in the presence of 2M NH4OAc. The oligonucleotide, Oligo #B13 18123A25H [SEQ ID NO.:182], changes the codon at position 23 of (15-125) hIL-3 variant gene, pMON13287, [SEQ ID NO:97] from `ATT` to `GCA` (Ile to Ala). The 3619 base pair NcoI, HindIII restriction fragment from pMON2341 was ligated to the PCR-generated NcoI, HindIII restriction fragment. Individual isolates were screened by restriction analysis and DNA sequenced to confirm that the desired changes in the (15-125) hIL-3 variant gene were made. The resulting clone also contained a change, that was not designed in the mutagenic oligonucleotide, which changed the codon at position -1 from `GCT` to `GAT` which changes the amino acid from Alanine to Aspartic Acid. The plasmid, pMON13476, contains the (15-125) hIL-3 variant gene (DNA sequence #B52 [SEQ ID NO:303]) which encodes the (15-125) hIL-3 variant polypeptide with the following amino acid sequence:
Polypeptide #B52 [SEQ ID NO.:314]
EXAMPLES 86-92
The variants in Table 7 were constructed by PCR techniques using methods described in the Materials and Methods and the Example contained herein, particularly Example 51. Two sequential PCR reactions were used to create the variants. In the first PCR reaction pMON13287 plasmid DNA served as the template and the two oligonucleotides indicated in Table 7 served as the primers. Following the PCR extension reaction, the PCR product was partially purified to remove primer that was not extended. In the second PCR reaction pMON13287 plasmid DNA served as the template, the purified PCR product from the first PCR reaction served as one of the primers and the Oligo #B14 2341Hin3 [SEQ ID NO:183] as the second primer. The product from the second PCR reaction was partially purified and digested with restriction enzymes NcoI and HindIII and ligated with the 3619 base pair NcoI,HindIII fragment from pMON2341. Individual isolates were screened by restriction analysis and DNA sequenced to confirm that the desired changes in the (15-125) hIL-3 variant gene were made. The amino acids substitutions in addition to and/or different from those in polypeptide # 24 [SEQ ID NO:88] are indicated in Table 7. The table also shows the plasmid designation (pMON number), DNA sequence identification number for the mutated hIL-3 gene and the identification number for the the resulting variant polypeptide. The biological activity (growth promoting activity in AML 193 cells) for some of the variants in Table 7 is shown in Table 1.
EXAMPLES 93-120
The variants in Table 8 were constructed by cassette mutagenesis using methods described in the Materials and Methods and the Examples contained here, particularly Examples 54-58. Parental plasmid DNA (Table 8), digested with the appropriate restriction enzymes (Table 8), was ligated with the indicated annealed pairs of complementary oligonucleotides (Table 8). The assembled oligonucleotides create the appropriate restriction ends and a portion of (15-125) hIL-3 gene (pMON13288 [SEQ ID NO:100]) sequence. The oligonucleotides create change(s) in the (15-125) hIL-3 variant gene which encode the corresponding amino acid substitution(s); and/or deletions from the C-terminus of the variant polypeptide (Table 8). Individual isolates were screened by restriction analysis and DNA sequenced to confirm that the desired changes in the (15-125) hIL-3 variant gene were made. The amino acids substitutions in addition to and/or different from those in polypeptide # 25 [SEQ ID NO:88] are indicated in Table 8. The table also shows the plasmid designation (pMON number), DNA sequence identification number for the mutated hIL-3 gene and the identification number for the the resulting variant polypeptide. The biological activity (growth promoting activity in AML 193 cells) for some of the variants in Table 5 is shown in Table 1.
EXAMPLE 121
Construction of pMON13446
Plasmid, pMON13287, DNA (purified from the E. coli strain GM48 {dam-}) was digested with restriction enzymes NcoI and ClaI. The resulting 3942 base pair NcoI,ClaI fragment contains the following genetic elements; beta-lactamase gene (AMP), pBR327 origin of replication, phage F1 origin of replication as the transcription terminator, precA promoter, g10L ribosome binding site and the DNA sequence encoding amino acids 21-125 of the (15-125) hIL-3 variant pMON13287. The 3942 base pair NcoI,ClaI restriction fragment from pMON13368 was ligated to the following annealed complementary oligonucleotides.
______________________________________Oligo #B57 338UP [SEQ ID NO:226]Oligo #B56 338DOWN [SEQ ID NO:225]______________________________________
When assembled, the oligonucleotides create NcoI and ClaI restriction ends and the DNA sequence that encodes the following 14 amino acid sequence; Met Ala Tyr Pro Glu Thr Asp Tyr Lys Asp Asp Asp Asp Lys [SEQ ID NO:403] and the DNA sequence which encodes amino acids 15-20 of the (15-125) hIL-3 variant gene, pMON13287 [SEQ ID NO:97]. The resulting variant polypeptide has a 14 amino acid N-terminal extension fused to the (15-125) hIL-3 variant polypeptide, pMON13288 [SEQ ID NO: 88]. The plasmid, pMON13446, contains the (15-125) hIL-3 variant gene (DNA sequence #B53 [SEQ ID NO:404]) which encodes the (15-125) hIL-3 variant polypeptide with the following amino acid sequence;
Polypeptide #B53 [SEQ ID NO.:315]
EXAMPLE 122
Construction of pMON13390
Plasmid, pMON13288, DNA (purified from the E. coli strain GM48 {dam-}) was digested with restriction enzymes NcoI and ClaI. The resulting 3942 base pair NcoI,ClaI fragment contains the following genetic elements; beta-lactamase gene (AMP), pBR327 origin of replication, phage Fl origin of replication as the transcription terminator, precA promoter, g10L ribosome binding site and the DNA sequence encoding amino acids 21-125 of the (15-125) hIL-3 variant pMON13288. The 3942 base pair NcoI,ClaI restriction fragment from pMON13288 was ligated to the following annealed complementary oligonucleotides.
______________________________________Oligo #B57 338UP [SEQ ID NO:226]Oligo #B56 338DOWN [SEQ ID NO:225]______________________________________
When assembled, the oligonucleotides create NcoI and ClaI restriction ends and the DNA sequence which encodes the following 14 amino acid sequence; Met Ala Tyr Pro Glu Thr Asp Tyr Lys Asp Asp Asp Asp Lys [SEQ ID NO:403] and the DNA sequence which encodes amino acids 15-20 of the (15-125) hIL-3 variant gene pMON13288 [SEQ ID NO:100]. The resulting variant has a 14 amino acid N-terminal extension fused to the (15-125) hIL-3 variant polypeptide, pMON13288 [SEQ ID NO:88]. The plasmid, pMON13390, containes the (15-125) hIL-3 variant gene (DNA sequence #B54 [SEQ ID NO.:405] which encodes the (15-125) hIL-3 variant polypeptide with the following amino acid sequence:
Polypeptide #B54 [SEQ ID NO:316]
EXAMPLES 133-136
The variants in Table 10 were constructed by methods described in Materials and Methods and in Examples contained herein, particularly Examples 54-58. Parental plasmid DNA (Table 10), digested with the appropriate restriction enzymes (Table 10) was ligated with the indicated restriction fragment containing the changes listed (Table 10). The resulting mutated (15-125) IL-3 genes encode the corresponding amino acid substitutions in the variant polypeptides (Table 10). The amino acid substitutions in addition to and/or different from those in polypeptide #25 [SEQ ID NO: 89] are indicated in Table 10. The biological activity (growth promoting activity in AML 193 cells) for some of the variants in Table 10 is shown in Table 1.
EXAMPLES 123-132
The variants in Table 9 were constructed by cassett mutagenesis using methods described in Materials and Methods and in Examples 54-58 contained herein. Parental plasmid DNA (Table 9), digested with the appropriate restriction enzymes (Table 9), was ligated with the indicated annealed pairs of complementry oligonucleoties (Table 9). The assembled oligonucleotides create the appropriate restriction fragment which was inserted into the (15-125) hIL-3 gene (pMON13288 [SEQ ID NO:100] between these restriction sites. The deletions or substitutions encoded by the oligonucleotide in the (15-125) IL-3 gene correspond to the amino acid deletions or substitutions in the variant polypeptide (Table 9). The amino acid substitutions or deletions, in addition to and/or different from those in the polypeptide #25 [SEQ ID NO:89] are indicated in Table 9. The biological activity (growth promoting activity in AML 193 cells) for some of the variants in Table 9 is shown in Table 1.
Formula XI shown below is a representation of a [(15-125)hIL-3 mutein] with numbers in bold type added above the amino acids to represent the position at which the amino acid below the bolded number appears in native (1-133)hIL-3 [e. g. the amino acid at position 1 of Formula XI corresponds to the Asn which appears at position 15 in native (1-133)hIL-3]. The number shown in bold indicates the amino acids that correspond to the native IL-3(1-133). The non-bold members below the amino acids sequences are for Seq Id reference numbers. When the muteins are expressed the initial amino acid may be preceded by Met- or Met-Ala-.
15 20 25Asn Cys Ser Asn Met Ile Asp Glu Ile Ile Thr His Leu Lys Gln 1 5 10 15 30 35 40Pro Pro Leu Pro Leu Leu Asp Phe Asn Asn Leu Asn Gly Glu Asp 20 25 30 45 50 55Gln Asp Ile Leu Met Glu Asn Asn Leu Arg Arg Pro Asn Leu Glu 35 40 45 60 65 70Ala Phe Asn Arg Ala Val Lys Ser Leu Gln Asn Ala Ser Ala Ile 50 55 60 75 80 85Glu Ser Ile Leu Lys Asn Leu Leu Pro Cys Leu Pro Leu Ala Thr 65 70 75 90 95 100Ala Ala Pro Thr Arg His Pro Ile His Ile Lys Asp Gly Asp Trp 80 85 90105 110 115Asn Glu Phe Arg Arg Lys Leu Thr Phe Tyr Leu Lys Thr Leu Glu 95 100 105120 125Asn Ala Gln Ala Gln Gln [SEQ ID NO:23] 110
__________________________________________________________________________ Parental plasmid/ amino acid resultingExample pMON number restriction digest oligo pair 1,4 oligo pair 2,5 oligo pair 3,6 changes polypeptide__________________________________________________________________________Example 69 pMON13406 pMON13288/ 19Ala1 29R32N37P2 42S45M3 19Ala polypeptide B1 SEQ ID NO:332 NcoI, EcoRV OLIGO# B1 OLIGO# 5 OLIGO# 11 SEQ ID NO:264 SEQ ID NO:170 SEQ ID NO:19 SEQ ID NO:25 19Ala4 29R32N37P5 42S45M6 OLIGO# B2 OLIGO# 6 OLIGO# 12 SEQ ID NO:171 SEQ ID NO:20 SEQ ID NO:26Example 70 pMON13414 pMON13288/ 19Ile1 29RS2N37P5 42S45M3 19Ile polypeptide B2 SEQ ID NO:333 NcoI, EcoRV OLIGO# B3 OLIGO# 5 OLIGO# 11 SEQ ID NO:265 SEQ ID NO:172 SEQ ID NO:19 SEQ ID NO:25 19Ile4 29R32N37P5 42S45M6 OLIGO# B4 OLIGO# 6 OLIGO# 12 SEQ ID NO:173 SEQ ID NO:20 SEQ ID NO:26Example 71 pMON13407 pMON13288/ 18I25H1 29R32N37P2 42S45V3 45Val polypeptide B3 SEQ ID NO:334 NcoI, EcoRV OLIGO# 1 OLIGO# 5 OLIGO# B11 SEQ ID NO:266 SEQ ID NO:15 SEQ ID NO:19 SEQ ID NO:180 18I25H4 29R32N37P5 42S45V6 OLIGO# 2 OLIGO# 6 OLIGO# B12 SEQ ID NO:16 SEQ ID NO:20 SEQ ID NO:181Example 72 pMON13405 pMON13288/ 19Ala1 29R32N37P5 42S45V3 19Ala, 45Val polypeptide 114 SEQ ID NO:335 NcoI, EcoRV OLIGO# B1 OLIGO# 5 OLIGO# B11 SEQ ID NO:267 SEQ ID NO:170 SEQ ID NO:19 SEQ ID NO:180 19Ala4 29R32N37P5 42S45V6 OLIGO# B2 OLIGO# 6 OLIGO# B12 SEQ ID NO:171 SEQ ID NO:20 SEQ ID NO:181Example 73 pMON13415 pMON13288/ 19Ile1 29R32N37P5 42S45V3 19Ile, 45 polypeptide B5 SEQ ID NO:336 NcoI, EcoRV OLIGO# B3 OLIGO# 5 OLIGO# B11 SEQ ID NO:268 SEQ ID NO:172 SEQ ID NO:19 SEQ ID NO:180 19Ile4 29R32N37P5 42S45V6 OLIGO# B4 OLIGO# 6 OLIGO# B12 SEQ ID NO:173 SEQ ID NO:20 SEQ ID NO:181Example 74 pMON13408 pMON13288/ 49Ile1 59L62V2 67H69E3 49Ile polypeptide B6 SEQ ID NO:337 EcoRV, NsiI OLIGO# B7 OLIGO# 25 OLIGO# 29 SEQ ID NO:269 SEQ ID NO:176 SEQ ID NO:39 SEQ ID NO:43 49Ile4 59L62V5 67H69E6 OLIGO# B8 OLIGO# 26 OLIGO# 30 SEQ ID NO:177 SEQ ID NO:40 SEQ ID NO:44Example 75 pMON13409 pMON13288/ 49Leu1 59L62V2 67H69E3 49Leu polypeptide B7 SEQ ID NO:338 EcoRV, NsiI SEQ ID NO:178 OLIGO# 25 OLIGO# 29 SEQ ID NO:270 OLIGO# B9 SEQ ID NO:39 SEQ ID NO:43 49Leu4 59L62V5 67H69E6 OLIGO# B10 OLIGO# 26 OLJGO# 30 SEQ ID NO:179 SEQ ID NO:40 SEQ ID NO:44Example 76 pMON13410 pMON13288/ 49Asp1 59L62V2 67H69E3 49Asp polypeptide BS SEQ ID NO:339 EcoRV, NsiI OLIGO# B5 OLIGO# 25 OLIGO# 29 SEQ ID NO:271 SEQ ID NO:174 SEQ ID NO:39 SEQ ID NO:43 49Asp4 59L62V5 67H69E6 OLIGO# B6 OLIGO# 26 OLIGO# 30 SEQ ID NO:175 SEQ ID NO:40 SEQ ID NO:44__________________________________________________________________________
__________________________________________________________________________ plasmid pMON Parental plasmid/ restriction amino acid resultingExample No number restriction digest fragment substitutions polypeptide__________________________________________________________________________Example 77 pMON13422 pMON13408/ 99 base pair 19Ala, polypeptide B9 SEQ ID NO:340 NcoI, EcoRV NcoI, EcoRV 45Val, SEQ ID NO:272 fragment from 49Ile pMON13405Example 78 pMON13423 pMON13408/ 99 base pair 19Ile, polypeptide B10 SEQ ID NO:341 NcoI, EcoRV NcoI, EcoRV 45Val, SEQ ID NO:273 fragment from 49Ile pMON13415Example 79 pMON13424 pMON13409/ 99 base pair 19Ala, polypeptide B11 SEQ ID NO:342 NcoI, EcoRV NcoI, EcoRV 45Val, SEQ ID NO:274 fragment from 49Leu pMON13405Example 80 pMON13425 pMON13409/ 99 base pair 19Ile, polypeptide B12 SEQ ID NO:343 NcoI, EcoRV NcoI, EcoRV 45Val, SEQ ID NO:275 fragment from 49Leu pMON13415Example 81 pMON13426/ pMON13410/ 99 base pair 19Ala, polypeptide B13 SEQ ID NO:344 NcoI, EcoRV NcoI, EcoRV 45Val, SEQ ID NO:276 fragment from 49Asp pMON13405Example 82 pMON13429 pMON13410/ 99 base pair 19Ile, polypeptide B14 SEQ ID NO:345 NcoI, EcoRV NcoI, EcoRV 45Val, SEQ ID NO:277 fragment from 49Asp pMON13415__________________________________________________________________________
__________________________________________________________________________ pMON Step one Step one Step two Step two Amino AcidExample number template PCR primer1 PCR primer2 PCR primer1 PCR primer2 Substitutions Polypeptide__________________________________________________________________________Example 86 pMON13475 pMON13287 18I23A25H 42D45V46S50D product from 2341HIN3 42D, 465, Polypeptide SEQ ID NO: OLIGO# B13 OLIGO# B19 step one OLIGO# B14 # B17 348 SEQ ID NO:182 SEQ ID NO:188 SEQ ID NO:183 SEQ ID NO 280Example 87 pMON13366 pMON13287 2341NCO 42D46V46S50D product from 2341HIN3 42N, 465, Polypeptide SEQ ID NO: OLIGO# B15 OLIGO# B19 step one OLIGO# B14 # B18 349 SEQ ID NO:184 SEQ ID NO:188 SEQ ID NO:183 SEQ ID NO 281Example 88 pMON13367 pMON13287 2341NCO 42D45V46S50D product from 2341HIN3 465, 50D Polypeptide SEQ ID NO: OLIGO# B15 OLIGO# B17 step one OLIGO# B14 # B19 350 SEQ ID NO:184 SEQ ID NO:186 SEQ ID NO:183 SEQ ID NO 282Example 89 pMON13369 pMON13287 2341NCO 42D45V46S50D product from 2341HIN3 23A, 42D, Polypeptide SEQ ID NO: OLIGO# B15 OLIGO# B21 step one OLIGO# B14 50D # B20 351 SEQ ID NO:184 SEQ ID NO:190 SEQ ID NO:183 SEQ ID NO 283Example 90 pMON13370 pMON13287 2341NCO 42D45M46S50D product from 2341HIN3 45M, 465, Polypeptide SEQ ID NO: OLIGO# B15 OLIGO# B16 step one OLlGO# B14 # B21 352 SEQ ID NO:184 SEQ ID NO:185 SEQ ID NO:183 SEQ ID NO 284Example 91 pMON13373 pMON13287 2341NCO 42D45M46S50D product from 2341HIN3 42D, 45M, Polypeptide SEQ ID NO: OLIGO# B15 OLIGO# B18 step one OLIGO# B14 50D # B22 353 SEQ ID NO:184 SEQ ID NO:187 SEQ ID NO:183 SEQ ID NO 285Example 92 pMON13374 pMON13287 2341NCO 42S45M46S50D product from 2341HIN3 428, 45M, Polypeptide SEQ ID NO: OLIGO# B15 OLIGO# B20 step one OLIGO# B14 # B23 354 SEQ ID NO:184 SEQ ID NO:189 SEQ ID NO:183 SEQ ID NO__________________________________________________________________________ 286
TABLE 8__________________________________________________________________________ resulting. parental amino poly-Example plasmid plasmid oligo pair oligo pair oligo pair oligo pair sub(s). peptide__________________________________________________________________________Example pMON13375 pMON13287/ S09E16V1 S116VD31 15-119 poly-93 SEQ ID NO: EcoR1, HindIII OLIGO# B50 OLIGO# 552 peptide 355 SEQ ID NO:219 SEQ ID NO:221 B24 S09E16V3 SECR1D33 SEQ ID OLIGO# B51 OLIGO# 553 NO: 287 SEQ ID NO:220 SEQ ID NO:222Example pMON1337E pMON13476/ S9E2Q6V1 S116VD31 15-119, poly-94 SEQ ID NO: EcoR1, HindIII OLIGO# B54 OLIGO# B52 23A, peptide 356 SEQ ID NO:223 SEQ ID NO:221 112Q B25 S9E2Q6V3 SECR1D33 SEQ ID OLIGO# B55 OLIGO# B53 NO:288 SEQ ID NO:224 SEQ ID NO:222Example pMON13377 pMON13475/ S9E2Q6V1 S116VD31 15-119, poly-95 SEQ ID NO: EcoR1, HindIII OLIGO# B54 OLIGO# B52 23A, peptide 357 SEQ ID NO:223 SEQ ID NO:221 46S, B2E, S9E2Q6V3 SECR1D33 112Q SEQ ID OLIGO# B55 OLIGO# B53 NO:289 SEQ ID NO:224 SEQ ID NO:222Example pMON13375 pMON13365/ S09E16V1 S116VD31 15-119, poly-96 SEQ ID NO: EcoR1, HindIII OLIGO# B50 OLIGO# B52 23A peptide 358 SEQ ID NO:219 SEQ ID NO:221 B27 S09E16V3 SECR1D33 SEQ ID OLIGO# B51 OLIGO# B53 NO:290 SEQ ID NO:220 SEQ ID NO:222Example pMON13379 pMON13367/ 9E12Q6V1 120Q123E2 46S, poly-97 SEQ ID NO: EcoR1, HindIII OLIGO# B48 OLIGO# 49 112Q peptide 359 SEQ ID NO:217 SED ID NO:63 B28 9E12Q6V3 120Q123E4 SEQ ID OLIGO# B49 OLIGO# 50 NO:291 SEQ ID NO:218 SED ID NO:64Example pMON13385 pMON13287/ 18I25H1 29V32R34S2 42A45V3 29V, poly-98 SEQ ID NO: NcoI, EcoRV OLIGO# 1 OLIGO# B28 OLIGO# 9 34S peptide 360 SEQ ID NO:15 SED ID NO:197 SEQ ID NO:23 529 18I25H4 29V32R34AS5 42A45V6 SEQ ID OLIGO# 2 OLIGO# B29 OLIGO# 10 NO:292 SEQ ID NO:16 SED ID NO:198 SEQ ID NO:24Example pMON13381 pMON13287/ 73G76A1 82TRP2 87S93S98I3 101A195Q4 82W poly-99 SEQ ID NO: NsiI, EcoRI OLIGO# 41 OLIGO# B44 OLIGO# 35 OLIGO# 43 peptide 361 SEQ ID NO:55 SEQ ID NO:213 SEQ ID NO:49 SEQ ID NO:57 B30 73G76A4 82TRP5 87S93S98I7 101A105Q8 SEQ ID OLIGO# 42 OLIGO# B45 OLIGO# 36 OLIGO# 44 NO:293 SEQ ID NO:56 SEQ ID NO:214 SEQ ID NO:50 SEQ ID NO:58Example pMON13383 pMON13475/ 9E12Q6V1 120Q123E2 23A, poly-100 SEQ ID NO: EcoR1, HindIII OLIGO# B48 OLIGO# 49 46S, peptide 362 SEQ ID NO:217 SED ID NO:63 112Q B31 9E12Q6V5 120Q123E4 SEQ ID OLIGO# B49 OLIGO# 50 NO:294 SEQ ID NO:218 SED ID NO:64Example pMON13384 pMON13287/ 9E12Q6V1 120Q123E2 112Q poly-101 SEQ ID NO: EcoR1, HindIII OLIGO# B48 OLIGO# 49 peptide 363 SEQ ID NO:217 SED ID NO:63 B32 9E12Q6V5 120Q123E4 SEQ ID OLIGO# B49 OLIGO# B50 NO:295 SEQ ID NO:218 SED ID NO:64Example pMON13388 pMON13287/ 50D56S1 60S62V2 67N69E3 50D, poly-102 SEQ ID NO: EcoRV, NsiI OLIGO# B42 OLIGO# 27 OLIGO# 31 peptide 364 SEQ ID NO:211 SEQ ID NO:41 SEQ ID NO:45 B33 50ASP4 56SER5 67N69E6 SEQ ID OLIGO# B41 OLIGO# B43 OLIGO# 32 NO:296 SEQ ID NO:210 SEQ ID NO:212 SEQ ID NO:46Example pNQN13389 pMQN132871 18I25H1 29R32A37P2 42D45M3 42D, poly-103 SEQ ID NO: NcoI, EcoRV OLIGO# 1 OLIGO# 3 OLIGO# B32 peptide 365 SEQ ID NO:15 SEQ ID NO:17 SEQ ID NO:201 B34 18I25H4 29R32A37P5 42D45M6 SEQ ID OLIGO# 2 OLIGO# 4 OLIGO# B33 NO:297 SEQ ID NO:16 SEQ ID NO:18 SEQ ID NO:202Example pMON13391 pMON13287/ 18I25H1 34SER1 42A45V3 OLIGO# 34S poly-104 SEQ ID NO: NcoI, EcoRV OLIGO# 1 OLIGO# B30 9 peptide 366 SEQ ID NO:15 SEQ ID NO:199 SEQ ID NO:23 B35 18I25H4 34SER5 42A45V6 SEQ ID OLIGO# 2 OLIGO# B31 QLIGO# 10 NO:298 SEQ ID NO:16 SEQ ID NO:200 SEQ ID NO:24Example pMON13392 pMON13287/ 18I25H1 29R32A37P2 42D45V3 42D poly-105 SEQ ID NO: NcoI, EcoRV OLIGO# 1 OLIGA# 3 QLIGO# B34 peptide 367 SEQ ID NO:15 SEQ ID NO:17 SEQ ID NO:203 B36 18I25H4 29R32A37P5 42D45V6 SEQ ID OLIGO# 2 OLIGO# 4 OLIGO.multidot. B35 NO:299 SEQ ID NO:16 SEQ ID NO:18 SEQ ID NO:204Example pMON13393 PMON13287/ 23ALA1 34SER1 42D45M46S3 23A, poly-106 SEQ ID NO: NcoI, EcoRV OLIGO# B26 OLIGO# B30 OLIGO.multidot. B36 42D, peptide 368 SEQ ID NO:195 SEQ ID NO:199 SEQ ID NO:205 46S B37 23ALA4 345ER5 42D45M46S6 SEQ ID OLIGO# B27 OLIGO# B31 OLIGO# B37 NO:300 SEQ ID NO:196 SEQ ID NO:200 SEQ ID NO:206Example pMON13394 pMON13287/ 18I25H1 29R32A37P2 42D45M46S3 42D, poly-107 SEQ ID NO: NcoI, EcoRV OLIGO# 1 OLIGO# 3 OLIGO# B36 45M, peptide 369 SEQ ID NO:15 SEQ ID NO:17 SEQ ID NO:205 B38 18I25N4 29R32A37P5 42D45M46S6 SEQ ID OLIGO# 2 OLIGO# 4 OLIGO# B37 NO:301 SEQ ID NO:16 SEQ ID NO:18 SEQ ID NO:206Example pMON13395 pMON13287/ 23ALA1 29V32R34S2 42D45V46S3 23A, poly-108 SEQ ID NO: NcoI, EcoRV OLIGO# B26 OLIGO# B28 OLIGO# B38 32R, peptide 370 SEQ ID NO:195 SEQ ID NO:197 SEO ID NO:207 42D, B39 23ALA4 29V32R34S5 42D45V4656 SEQ ID OLIGO# B27 OLIGO# B29 OLIGO# B39 NO:302 SEQ ID NO:196 SEQ ID NO:198 SEQ ID NO:208Example pMON13396 pMON13287/ 73G76A1 79R82Q2 100ARG3 100MET4 100R, poly-109 SEQ ID NO: NsiI, EcoRI OLIGO# 41 OLIGO# 39 SEQ ID NO: OLIGO# B24 101M peptide 371 SEQ ID NO:55 SEQ ID NO:53 87S93S98I7 SEQ ID NO:193 B40 73G76A4 79R8205 OLIGO# 36 10R01M8 SEQ ID OLIGO# 42 OLIGO# 40 SEQ ID NO:50 OLIGO# B25 NO:303 SEQ ID NO:56 SEQ ID NO:54 SEQ ID NO:194Example pMON13397 pMON13287/ 73G76A1 82TRP2 100ARG3 100MET4 82W, poly-110 SEQ ID NO: NsiI, EcoRI OLIGO# 41 OLIGO# B44 OLIGO# B22 OLIGO# B24 101M peptide 372 SEQ ID NO:55 SEQ ID NO:213 SEQ ID NO:191 SEQ ID NO:193 B41 73G76A4 82TRP5 87S93S98I7 10R01M8 SEQ ID OLIGO# 42 OLIGO# B45 OLIGO# 36 OLIGO# B25 NO:304 SEQ ID NO:56 SEQ ID NO:214 SEQ ID NO:50 SEQ ID NO:194Example pMON13398 pMON13287/ 18I25H1 29R32A37P2 42D45V46S3 42D, poly-111 SEQ ID NO: NcoI, EcoRV OLIGO# 1 OLIGO# 3 OLIGO# B38 peptide 373 SEQ ID NO:15 SEQ ID NO:17 SEQ ID NO:207 B42 18I25N4 29R32A37P5 42D45V46S6 SEQ ID OLIGO# 2 OLIGO# 4 OLIGO# B39 NO:305 SEQ ID NO:16 SEQ ID NO:18 SEQ ID NO:208Example pMON13399 pMON13388/ 23ALA1 29V32R34S2 42D45V46S3 23A, poly-112 SEQ ID NO: NcoI, EcoRV OLIGO# B26 OLIGO# B2B OLIGO# B38 32R, peptide 374 SEQ ID NO:195 SED ID NO:197 SEQ ID NO:207 42D, B43 23ALA4 29V32R34S5 42D45V46S6 SEQ ID OLIGO# B27 OLIGO# B29 OLIGO# B39 NO:306 SEQ ID NO:196 SED ID NO:198 SEQ ID NO:208Example pMON1304 pMON13287/ S9E2Q6V1 SI16VD31 15-119 poly-113 SEQ ID NO: EcoRI, HindIII OLIGO# B54 OLIGO# B52 112Q peptide 375 SEQ ID NO:223 SEQ ID NO:221 B44 S9E2Q6V3 SECR1D33 SEQ ID OLIGO# B55 OLIGO# 53 NO:307 SEQ ID NO:224 SEQ ID NO:222Example pMON13387 pMON13287/ 50ASP1 60S62V2 67N69E3 50D poly-114 SEQ ID NO: EcoRV, NsiI OLIGO# B40 OLIGO# 27 OLIGO# 31 peptide 376 SEQ ID NO:209 SEQ ID NO:41 SEQ ID NO:45 B45 50ASP4 60S62V5 67N69E6 SEQ ID OLIGO# B41 QLIGO# 28 OLIGO# 32 NO:308 SEQ ID NO:210 SEQ ID NO:42 SEQ ID NO:46Example pMON13416 pMON13387/ 18I25H1 29R32A37P2 42D45V4ES3 42D, poly-115 SEQ ID NO: NcoI/EcoRV OLIGO# 1 OLIGO# 3 OLIGO# B38 50D peptide 377 SEQ ID NO:15 SEQ ID NO:17 SEQ ID NO:207 B46 18I25H4 29R32A37P5 42D45V46S6 SEQ ID OLIGO.multidot. 2 OLIGO# 4 OLIGO# B39 NO:309 SEQ ID NO:16 SEQ ID NO:18 SEQ ID NO:208Example pMON13417 pMON13387/ 18I25H1 29R32A37P2 42D45M46S3 42D, poly-116 SEQ ID NO: NcoI/EcoRV OLIGO# 1 OLIGO# 3 OLIGO# B36 46S, peptide 378 SEQ ID NO:15 SEQ ID NO:17 SEQ ID NO:205 B47 18I25N4 29R32A37P5 42D45M46S6 SEQ ID OLIGO# 2 OLIGO# 4 OLIGO# B37 NO:310 SEQ ID NO:16 SEQ ID NO:18 SEQ ID NO:206Example pMON13420 pMON13388/ 23ALA1 34SER1 42D45V46S3 23A, poly-117 SEQ ID NO: NcoI, EcoRV OLIGO# B26 OLIGO# 830 OLIGO# B38 42D, peptide 379 SEQ ID NO:195 SEQ ID NO:199 SEQ ID NO:207 50D, B48 23ALA4 34SER5 42D45V46S6 SEQ ID OLIGO# B27 OLIGO.multidot. B31 OLIGO# B39 NO:311 SEQ ID NO:196 SEQ ID NO:200 SEQ ID NO:208Example pMON13421 pMON13388/ 23ALA1 34SER1 42D45M46S3 23A, poly-118 SEQ ID NO: NcoI, EcoRV OLIGO# B26 OLIGO# B30 OLIGO# B36 42D, peptide 380 SEQ ID NO:195 SEQ ID NO:199 SEQ ID NO:205 46S, B49, 23ALA4 34SER5 42D45M46S6 56S SEQ ID OLIGO# B27 OLIGO.multidot. B31 OLIGO# B37 NO:331 SEQ ID NO:196 SEQ ID NO:200 SEQ ID NO:206Example pMON13432 pMON13387/ 23ALA1 34SER1 42D45M46S3 23A, poly-119 SEQ ID NO: NcoI, EcoRV OLIGO# B26 OLIGO# B30 OLIGO# B36 42D, peptide 381 SEQ ID NO:195 SEQ ID NO:199 SEQ ID NO:205 46S, B50 23ALA4 34SER5 42D45M46S6 SEQ ID OLIGO# B27 OLIGO# B31 OLIGO# B37 NO:312 SEQ ID NO:196 SEQ ID NO:200 SEQ ID NO:206Example pMON13382 pMON13287/ 9E12Q6W1 120Q123E2 112Q, poly-120 SEQ ID NO: EcoRI, HindIII OLIGO# B46 OLIGO# 49 peptide 382 SEQ ID NO:215 SED ID NO:63 B51 9E12Q16W3 120Q123E4 SEQ ID OLIGO# B41 OLIGO# 50 NO:313 SEQ ID NO:216 SED ID NO:64__________________________________________________________________________
__________________________________________________________________________ Parental Plasmid/Example Restriction Amino acidNo. Plasmid Digest Oligo pair Oligo pair Oligo pair Oligo pair changes Polypeptide__________________________________________________________________________Example pMON13400 pMON13288 20P23A1 29I14S7S2 38A5V6S3 20P 23A Polypeptids C-2124 SEQ ID NO: Restriction SEQ ID NO:232 SEQ ID NO:236 SEQ ID NO:238 29I 34S SEQ ID NO:317 384 NcoI-EcoRV 20P23A4 29I14S7S5 38A5V6S3 37S 38A SEQ ID NO:233 SEQ ID NO:237 SEQ ID NO:239 45V 46SExample pMON13402 pMON13288 23L1 29I4S7S2 38A5V6S3 23L 29I Polypeptide C-3125 SEQ ID NO: Restriction SEQ ID NO:234 SEQ ID NO:236 SEQ ID NO:238 34S 37S SEQ ID NO:318 385 NcoI-EcoRV 23L4 29I4S7S2 38A5V6S3 28A 45V 46S SEQ ID NO:235 SEQ ID NO:237 SEQ ID NO:239Example pMON13440 pMON13288 18I3A5H1 29I4S7S2 38A5V6S3 18I 23A Polypeptide C-10131 SEQ ID NO: Restriction SEQ ID NO:195 SEQ ID NO:236 SEQ ID NO:238 29I 34s SEQ ID NO:319 386 NcoI-EcoRV 18I3A5H4 29I148785 38A5V6S3 38A 45V 46S SEQ ID NO:196 SEQ ID NO:237 SEQ ID NO:239Example pMON13451 pMON13288 19I0L3A1 29I4S7S2 38A5V6S3 19I 20L Polypeptide C-11132 SEQ ID NO: Restriction SEQ ID NO:230 SEQ ID NO:236 SEQ ID NO:238 29I 34S SEQ ID NO:320 387 NcoI-EcoRV 19I0L3A4 29I4S7S2 38A5V6S3 38A 45V 46S SEQ ID NO:231 SEQ ID NO:237 SEQ ID NO:239Example pMON13419 pMON13288 50D51S1 62P3H5S2 67Q3 50D 51S Polypeptide C-8130 SEQ ID NO: Restriction SEQ ID NO:240 SEQ ID NO:244 SEQ ID NO:248 63H SEQ ID NO:325 389 EcoRV-NsiI 50D51S4 62P3H5 65S67Q6 65S 67Q SEQ ID NO:241 SEQ ID NO:246 SEQ ID NO:247Example pMON13403 pMON13288 50D51S1 62P3H2 67Q3 50D 51S Polypeptide CA126 SEQ ID NO: Restriction SEQ ID NO:240 SEQ ID NO:245 SEQ ID NO:248 62P 63H SEQ ID NO:321 388 EcoRV-NsiI 50D51S4 62P3H5 67Q6 67Q SEQ ID NO:241 SEQ ID NO:246 SEQ ID NO:249Example pMON13418 pMON13288 76P1 79S2 5VYWPTT3 101A105Q4 76P 79S Polypeptide C-1123 SEQ ID NO: Restriction SEQ ID NO:250 SEQ ID NO:252 SEQ ID NO:242 SEQ ID NO:57 85V 87Y SEQ ID NO:326 393 NsiI-EcoRI 76P5 79S6 5VYWPTT7 101A105Q8 88W 91P SEQ ID NO:251 SEQ ID NO:253 SEQ ID NO:243 SEQ ID NO:58 95T 98TExample pMON13411 pMON13288 09L2Q6S1 120/Q123E2 109L 112Q Polypeptide C-5127 SEQ ID NO: Restriction Seq ID NO:227 SEQ ID NO:63 116S SEQ ID NO:322 390 EcoRI- 09L2Q6S3 120Q123E4 HindIII SEQ ID NO:228 SEQ ID NO:64Example pMON13412 pMON13288 9LQS1181 15-118 Polypeptide C-6128 SEQ ID NO: Restriction Seq ID NO:255 109L 112Q SEQ ID NO:323 391 EcoRI- 9LQS1183 116S HindIII SEQ ID NO:256Example pMON13413 pMON13288 09L2Q6S1 117S2 109L 112Q Polypeptide C-7129 SEQ ID NO: Restriction Seq ID NO:227 SEQ ID NO:229 116S 117S SEQ ID NO:324 392 EcoRI- 09L2Q6S3 120Q123E4 HindIII SEQ ID NO:228 SEQ ID NO 64__________________________________________________________________________
TABLE 10______________________________________ Parental plasmid/ AminoExample Restriction Restriction Acid Poly-No Plasmid digest fragment changes peptide______________________________________Example pMON13428 pMON13411 102 bp 76P Poly-133 SEQ ID NsiI-EcoRI NsiI-EcoRI 79S peptide NO:394 fragment 85V C-9 from 87Y SEQ ID pMON13418 91P NO:327 95T 98T 109L 112Q 116SExample pMON13459 pMON13428 170 bp 23L Poly-134 SEQ ID NcoI-NsiI NcoI-NsiI 29I peptide NO:395 fragment 34S C-12 from 37S SEQ ID pMON13402 38A NO:328 45V 46S 76P 79S 85V 87Y 91P 95T 98T 109L 112Q 116SExample pMON13467 pMON13413 170 bp 23L Poly-135 SEQ ID NcoI-NsiI NcoI-NsiI 29I peptide NO:396 fragment 34S C-13 from 37S SEQ ID pMON13402 38A NO:329 45V 46S 109L 112Q 116S 109L 112Q 116S 117SExample pMON13492 pMON13418 170 bp 23L Poly-136 SEQ ID NcoI-NsiI NcoI-NsiI 29I peptide NO:397 fragment 34S C-14 from 37S SEQ ID pMON13402 38A NO:330 45V 46S 76P 79S 85V 87Y 91P 95T 98T______________________________________
__________________________________________________________________________# SEQUENCE LISTING- (1) GENERAL INFORMATION:- (iii) NUMBER OF SEQUENCES: 415- (2) INFORMATION FOR SEQ ID NO:1:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 23 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:# 23AAGC TTG- (2) INFORMATION FOR SEQ ID NO:2:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 23 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:# 23AAGA TCG- (2) INFORMATION FOR SEQ ID NO:3:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 69 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:- GGCAACAATT TCTACAAAAC ACTTGATACT GTATGAGCAT ACAGTATAAT TG - #CTTCAACA 60# 69- (2) INFORMATION FOR SEQ ID NO:4:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 67 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:- TGTTCTGTTG AAGCAATTAT ACTGTATGCT CATACAGTAT CAAGTGTTTT GT - #AGAAATTG 60# 67- (2) INFORMATION FOR SEQ ID NO:5:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 23 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:# 23CGTG GTC- (2) INFORMATION FOR SEQ ID NO:6:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 46 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:# 46AGA CTACTTCTCT TAAGACTTCT TGGGTT- (2) INFORMATION FOR SEQ ID NO:7:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 42 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:# 42 AGAG AAGTAGTCTG AGTCATTGGA GC- (2) INFORMATION FOR SEQ ID NO:8:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 64 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:- AATTCCGTCG TAAACTGACC TTCTATCTGA AAACCTTGGA GAACGCGCAG GC - #TCAACAGT 60# 64- (2) INFORMATION FOR SEQ ID NO:9:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 64 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:- AGCTTATTAC TGTTGAGCCT GCGCGTTCTC CAAGGTTTTC AGATAGAAGG TC - #AGTTTACG 60# 64- (2) INFORMATION FOR SEQ ID NO:10:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 126 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:- Met Ala Pro Met Thr Gln Thr Thr Ser Leu Ly - #s Thr Ser Trp Val Asn# 15- Cys Ser Asn Met Ile Asp Glu Ile Ile Thr Hi - #s Leu Lys Gln Pro Pro# 30- Leu Pro Leu Leu Asp Phe Asn Asn Leu Asn Gl - #y Glu Asp Gln Asp Ile# 45- Leu Met Glu Asn Asn Leu Arg Arg Pro Asn Le - #u Glu Ala Phe Asn Arg# 60- Ala Val Lys Ser Leu Gln Asn Ala Ser Ala Il - #e Glu Ser Ile Leu Lys#80- Asn Leu Leu Pro Cys Leu Pro Leu Ala Thr Al - #a Ala Pro Thr Arg His# 95- Pro Ile His Ile Lys Asp Gly Asp Trp Asn Gl - #u Phe Arg Arg Lys Leu# 110- Thr Phe Tyr Leu Lys Thr Leu Glu Asn Ala Gl - #n Ala Gln Gln# 125- (2) INFORMATION FOR SEQ ID NO:11:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 24 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:11:# 24AACA TGAT- (2) INFORMATION FOR SEQ ID NO:12:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 22 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:12:# 22TTA GC- (2) INFORMATION FOR SEQ ID NO:13:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 113 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:13:- Met Ala Asn Cys Ser Asn Met Ile Asp Glu Il - #e Ile Thr His Leu Lys# 15- Gln Pro Pro Leu Pro Leu Leu Asp Phe Asn As - #n Leu Asn Gly Glu Asp# 30- Gln Asp Ile Leu Met Glu Asn Asn Leu Arg Ar - #g Pro Asn Leu Glu Ala# 45- Phe Asn Arg Ala Val Lys Ser Leu Gln Asn Al - #a Ser Ala Ile Glu Ser# 60- Ile Leu Lys Asn Leu Leu Pro Cys Leu Pro Le - #u Ala Thr Ala Ala Pro#80- Thr Arg His Pro Ile His Ile Lys Asp Gly As - #p Trp Asn Glu Phe Arg# 95- Arg Lys Leu Thr Phe Tyr Leu Lys Thr Leu Gl - #u Asn Ala Gln Ala Gln# 110- Gln- (2) INFORMATION FOR SEQ ID NO:14:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 27 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:14:- Met Met Ile Thr Leu Arg Lys Leu Pro Leu Al - #a Val Ala Val Ala Ala# 15- Gly Val Met Ser Ala Gln Ala Met Ala Asn Cy - #s# 25- (2) INFORMATION FOR SEQ ID NO:15:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 133 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 1#/note= "Met- may or may not precede the amino aci - #d in position 1"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 17#/note= "Xaa at position 17 is Ser, Lys, Gly, - # Asp, Met, Gln, or Arg"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 18#/note= "Xaa at position 18 is Asn, His, Leu, - # Ile, Phe, Arg, or Gln"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 19#/note= "Xaa at positiion 19 is Met, Phe, Ile, - # Arg, Gly, Ala, or Cys"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 20#/note= "Xaa at position 20 is Ile, Cys, Gln, - # Glu, Arg, Pro, or Ala"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 21#/note= "Xaa at position 21 is Asp, Phe, Lys, - # Arg, Ala, Gly, Glu, Gln, Asn, Thr, Ser, or Val"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 22#/note= "Xaa at position 22 is Glu, Trp, Pro, - # Ser, Ala, His, Asp, Asn, Gln, Leu, Val, or Gly"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 23#/note= "Xaa at position 23 is Ile, Val, Ala, - # Leu, Gly, Trp, Lys, Phe, Ser, or Arg"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 24#/note= "Xaa at position 24 is Ile, Gly, Val, - # Arg, Ser, Phe, or Leu"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 25#/note= "Xaa at position 25 is Thr, His, Gly, - # Gln, Arg, Pro, or Ala"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 26#/note= "Xaa at position 26 is His, Thr, Phe, - # Gly, Arg, Ala, or Trp"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 27#/note= "Xaa at position 27 is Leu, Gly, Arg, - # Thr, Ser, or Ala"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 28#/note= "Xaa at position 28 is Lys, Arg, Leu, - # Gln, Gly, Pro, Val, or Trp"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 29#/note= "Xaa at position 29 is Gln, Asn, Leu, - # Pro, Arg, or Val"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 30#/note= "Xaa at position 30 is Pro, His, Thr, - # Gly, Asp, Gln, Ser, Leu, or Lys"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 31#/note= "Xaa at position 31 is Pro, Asp, Gly, - # Ala, Arg, Leu, or Gln"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 32#/note= "Xaa at position 32 is Leu, Val, Arg, - # Gln, Asn, Gly, Ala, or Glu"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 33#/note= "Xaa at position 33 is Pro, Leu, Gln, - # Ala, Thr, or Glu"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 34#/note= "Xaa at position 34 is Leu, Val, Gly, - # Ser, Lys, Glu, Gln, Thr, Arg, Ala, Phe,#Met" Ile, or- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 35#/note= "Xaa at position 35 is Leu, Ala, Gly, - # Asn, Pro, Gln, or Val"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 36#/note= "Xaa at position 36 is Asp,#Val" Leu, or- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 37#/note= "Xaa at position 37 is Phe, Ser, Pro, - # Trp, or Ile"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 38#/note= "Xaa at position 38 is Asn, or Ala"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 40#/note= "Xaa at position 40 is Leu,#Arg" Trp, or- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 41#/note= "Xaa at position 41 is Asn, Cys, Arg, - # Leu, His, Met, or Pro"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 42#/note= "Xaa at position 42 is Gly, Asp, Ser, - # Cys, Asn, Lys, Thr, Leu, Val, Glu, Phe, Tyr- #, Ile, Met, - # or Ala"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 43#/note= "Xaa at position 43 is Glu, Asn, Tyr, - # Leu, Phe, Asp, Ala, Cys, Gln, Arg, Thr, Gly- #, or Ser"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 44#/note= "Xaa at position 44 is Asp, Ser, Leu, - # Arg, Lys, Thr, Met, Trp, Glu, Asn, Gln, Ala- #, or Pro"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 45#/note= "Xaa at position 45 is Gln, Pro, Phe, - # Val, Met, Leu, Thr, Lys, Trp, Asp, Asn, Arg- #, Ser, Ala, - # Ile, Glu, or His"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 46#/note= "Xaa at position 46 is Asp, Phe, Ser, - # Thr, Cys, Glu, Asn, Gln, Lys, His, Ala, Tyr- #, Ile, Val, - # or Gly"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 47#/note= "Xaa at position 47 is Ile, Gly, Val, - # Ser, Arg, Pro, or His"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 48#/note= "Xaa at position 48 is Leu, Ser, Cys, - # Arg, Ile, His, Phe, Glu, Lys, Thr, Ala, Met- #,#Asn" Val, or- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 49#/note= "Xaa at position 49 is Met, Arg, Ala, - # Gly, Pro, Asn, His, or Asp"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 50#/note= "Xaa at position 50 is Glu, Leu, Thr, - # Asp, Tyr, Lys, Asn, Ser, Ala, Ile, Val, His- #, Phe, Met, - # or Gln"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 51#/note= "Xaa at position 51 is Asn, Arg, Met, - # Pro, Ser, Thr, or His"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 52#/note= "Xaa at position 52 is Asn, His, Arg, - # Leu, Gly, Ser, or Thr"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 53#/note= "Xaa at position 53 isN: Leu, Thr, - # Ala, Gly, Glu, Pro, Lys, Ser, or Met"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 54#/note= "Xaa at position 54 is Arg, Asp, Ile, - # Ser, Val, Thr, Gln, Asn, Lys, His, Ala, or Leu"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 55#/note= "Xaa at position 55 is Arg, Thr, Val, - # Ser, Leu, or Gly"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 56#/note= "Xaa at position 56 is Pro, Gly, Cys, - # Ser, Gln, Glu, Arg, His, Thr, Ala, Tyr, Phe, Leu, - # Val, or Lys"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 57#/note= "Xaa at position 57 is Asn or Gly"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 58#/note= "Xaa at position 58 is Leu, Ser, Asp, - # Arg, Gln, Val, or Cys"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 59#/note= "Xaa at position 59 is Glu, Tyr, His, - # Leu, Pro, or Arg"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 60#/note= "Xaa at position 60 is Ala, Ser, Pro, - # Tyr, Asn, or Thr"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 61#/note= "Xaa at position 61 is Phe, Asn, Glu, - # Pro, Lys, Arg, or Ser"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 62#/note= "Xaa at position 62 is Asn, His, Val, - # Arg, Pro, Thr, Asp, or Ile"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 63#/note= "Xaa at position 63 is Arg, Tyr, Trp, - # Lys, Ser, His, Pro, or Val"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 64#/note= "Xaa at position 64 is Ala, Asn, Pro, - # Ser, or Lys"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 65#/note= "Xaa at position 65 is Val, Thr, Pro, - # His, Leu, Phe, or Ser"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 66#/note= "Xaa at position 66 is Lys, Ile, Arg, - # Val, Asn, Glu, or Ser"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 67#/note= "Xaa at position 67 is Ser, Ala, Phe, - # Val, Gly, Asn, Ile, Pro, or His"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 68#/note= "Xaa at position 68 is Leu, Val, Trp, - # Ser, Ile, Phe, Thr, or His"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 69#/note= "Xaa at position 69 is Gln, Ala, Pro, - # Thr, Glu, Arg, Trp, Gly, or Leu"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 70#/note= "Xaa at position 70 is Asn, Leu, Val, - # Trp, Pro, or Ala"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 71#/note= "Xaa at position 71 isN: Ala,Met,Leu, - #Pro,Arg,Glu,Thr,Gln,Trp,or Asn"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 72#/note= "Xaa at position 72 is Ser, Glu, Met, - # Ala, His, Asn, Arg, or Asp"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 73#/note= "Xaa at position 73 is Ala, Glu, Asp, - # Leu, Ser, Gly, Thr, or Arg"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 74#/note= "Xaa at position 74 is Ile, Met, Thr, - # Pro, Arg, Gly, or Ala"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 75#/note= "Xaa at position 75 isN: Glu, Lys, - # Gly, Asp, Pro, Trp, Arg, Ser, Gln, or Leu"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 76#/note= "Xaa at position 76 is Ser, Val, Ala, - # Asn, Trp, Glu, Pro, Gly, or Asp"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 77#/note= "Xaa at position 77 is Ile, Ser, Arg, - # Thr, or Leu"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 78#/note= "Xaa at position 78 is Leu, Ala, Ser, - # Glu, Phe, Gly, or Arg"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 79#/note= "Xaa at position 79 is Lys, Thr, Asn, Met, - # Arg, Ile, Gly, or Asp"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 80#/note= "Xaa at position 80 is Asn, Trp, Val, - # Gly, Thr, Leu, Glu, or Arg"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 81#/note= "Xaa at position 81 is Leu, Gln, Gly, - # Ala, Trp, Arg, Val, or Lys"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 82#/note= "Xaa at position 82 is Leu, Gln, Lys, - # Trp, Arg, Asp, Glu, Asn, His, Thr, Ser, Ala- #, Tyr, Phe, - # Ile, Met, or Val"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 83#/note= "Xaa at position 83 is Pro, Ala, Thr, - # Trp, Arg, or Met"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 84#/note= "Xaa at position 84 is Cys, Glu, Gly, - # Arg, Met, or Val"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 85#/note= "Xaa at position 85 is Leu, Asn, Val, - # or Gln"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 86#/note= "Xaa at position 86 is Pro, Cys, Arg, - # Ala, or Lys"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 87#/note= "Xaa at position 87 is Leu, Ser, Trp, - # or Gly"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 88#/note= "Xaa at position 88 is Ala, Lys, Arg, - # Val, or Trp"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 89#/note= "Xaa at position 89 is Thr, Asp, Cys, - # Leu, Val, Glu, His, Asn, or Ser"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 90#/note= "Xaa at position 90 is Ala, Pro, Ser, - # Thr, Gly, Asp, Ile, or Met"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 91#/note= "Xaa at position 91 is Ala, Pro, Ser, - # Thr, Phe, Leu, Asp, or His"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 92#/note= "Xaa at position 92 is Pro, Phe, Arg, - # Ser, Lys, His, Ala, Gly, Ile, or Leu"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 93#/note= "Xaa at position 93 is Thr, Asp, Ser, - # Asn, Pro, Ala, Leu, or Arg"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 94#/note= "Xaa at position 94 is Arg, Ile, Ser, - # Glu, Leu, Val, Gln, Lys, His, Ala, or Pro"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 95#/note= "Xaa at position 95 is His, Gln, Pro, - # Arg, Val, Leu, Gly, Thr, Asn, Lys, Ser, Ala- #, Trp, Phe, - # Ile, or Tyr"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 96#/note= "Xaa at position 96 is Pro, Lys, Tyr, - # Gly, Ile, or Thr"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 97#/note= "Xaa at position 97 is Ile, Val, Lys, - # Ala, or Asn"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 98#/note= "Xaa at position 98 is His, Ile, Asn, - # Leu, Asp, Ala, Thr, Glu, Gln, Ser, Phe, Met- #, Val, Lys, - # Arg, Tyr, or Pro"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 99#/note= "Xaa at position 99 is Ile, Leu, Arg, - # Asp, Val, Pro, Gln, Gly, Ser, Phe, or His"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 100#/note= "Xaa at position 100 is: Lys, Tyr, - # Leu, His, Arg, Ile, Ser, Gln, or Pro"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 101#/note= "Xaa at position 101 is: Asp, Pro, - # Met, Lys, His, Thr, Val, Tyr, Glu, Asn, Ser- #, Ala, Gly, - # Ile, Leu, or Gln"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 102#/note= "Xaa at position 102 is Gly, Leu, Glu, - # Lys, Ser, Tyr, or Pro"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 103#/note= "Xaa at position 103 is Asp, or Ser"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 104#/note= "Xaa at position 104 is: Trp, Val, - # Cys, Tyr, Thr, Met, Pro, Leu, Gln, Lys, Ala- #,#Gly" Phe, or- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 105#/note= "Xaa at position 105 is: Asn, Pro, - # Ala, Phe, Ser, Trp, Gln, Tyr, Leu, Lys, Ile- #,#His" Asp, or- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 106#/note= "Xaa at position 106 is Glu, Ser, Ala, - # Lys, Thr, Ile, Gly, or Pro"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 108#/note= "Xaa at position 108 is Arg, Lys, Asp, - # Leu, Thr, Ile, Gln, His, Ser, Ala, or Pro"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 109#/note= "Xaa at position 109 is Arg, Thr, Pro, - # Glu, Tyr, Leu, Ser, or Gly"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 110#/note= "Xaa at position 110 is Lys, Ala, Asn, - # Thr, Leu, Arg, Gln, His, Glu, Ser, or Trp"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 111#/note= "Xaa at position 111 is Leu, Ile, Arg, - # Asp, or Met"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 112#/note= "Xaa at position 112 is Thr, Val, Gln, - # Tyr, Glu, His, Ser, or Phe"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 113#/note= "Xaa at position 113 is Phe, Ser, Cys, - # His, Gly, Trp, Tyr, Asp, Lys, Leu, Ile, Val- #, or Asn"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 114#/note= "Xaa at position 114 is Tyr, Cys, His, - # Ser, Trp, Arg, or Leu"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 115#/note= "Xaa at position 115 is: Leu, Asn, - # Val, Pro, Arg, Ala, His, Thr, Trp, or Met"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 116#/note= "Xaa at position 116 is Lys, Leu, Pro, - # Thr, Met, Asp, Val, Glu, Arg, Trp, Ser, Asn, His, - # Ala, Tyr, Phe, Glu, or Ile"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 117#/note= "Xaa at position 117 is Thr, Ser, Asn, - # Ile, Trp, Lys, or Pro"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 118#/note= "Xaa at position 118 is Leu, Ser, Pro, - # Ala, Glu, Cys, Asp, or Tyr"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 119#/note= "Xaa at position 119 is Glu, Ser, Lys, - # Pro, Leu, Thr, Tyr, or Arg"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 120#/note= "Xaa at position 120 is Asn, Ala, Pro, - # Leu, His, Val, or Gln"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 121#/note= "Xaa at position 121 is Ala, Ser, Ile, - # Asn, Pro, Lys, Asp, or Gly"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 122#/note= "Xaa at position 122 is: Gln, Ser, - # Met, Trp, Arg, Phe, Pro, His, Ile, Tyr, or Cy - #s"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 123#/note= "Xaa at position 123 is Ala, Met, Glu, - # His, Ser, Pro, Tyr, or Leu"- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:15:- Ala Pro Met Thr Gln Thr Thr Ser Leu Lys Th - #r Ser Trp Val Asn Cys# 15- Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xa - #a Xaa Xaa Xaa Xaa Xaa# 30- Xaa Xaa Xaa Xaa Xaa Xaa Asn Xaa Xaa Xaa Xa - #a Xaa Xaa Xaa Xaa Xaa# 45- Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xa - #a Xaa Xaa Xaa Xaa Xaa# 60- Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xa - #a Xaa Xaa Xaa Xaa Xaa#80- Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xa - #a Xaa Xaa Xaa Xaa Xaa# 95- Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Ph - #e Xaa Xaa Xaa Xaa Xaa# 110- Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xa - #a Gln Gln Thr Thr Leu# 125- Ser Leu Ala Ile Phe 130- (2) INFORMATION FOR SEQ ID NO:16:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 133 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 1#/note= "Met- may or may not precede the amino - # acid in position 1"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 17#/note= "Xaa at position 17 is Ser, Gly, Asp, - # Met, or Gln"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 18#/note= "Xaa at position 18 is Asn, His, Leu, - # Ile, Phe, Arg, or Gln"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 19#/note= "Xaa at position 19 is Met, Phe, Ile, - # Arg, or Ala"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 20#/note= "Xaa at position 20 is Ile or Pro"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 21#/note; "Xaa at position 21 is Asp or Glu"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 23#/note= "Xaa at position 23 is Ile, Val, Ala, - # Leu, or Gly"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 24#/note= "Xaa at position 24 is Ile, Val, Phe, - # or Leu"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 25#/note= "Xaa at position 25 is Thr, His, Gly, - # Gln, Arg, Pro, or Ala"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 26#/note= "Xaa at position 26 is His, Phe, Gly, - # Arg, or Ala"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 28#/note= "Xaa at position 28 is Lys, Leu, Gln, - # Gly, Pro, or Val"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 29#/note= "Xaa at position 29 is Gln, Asn, Leu, - # Arg, or Val"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 30#/note= "Xaa at position 30 is Pro, His, Thr, - # Gly, or Gln"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 31#/note= "Xaa at position 31 is Pro, Asp, Gly, - # Ala, Arg, Leu, or Gln"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 32#/note= "Xaa at position 32 Leu, Arg, Gln, - # Asn, Gly, Ala, or Glu"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 33#/note= "Xaa at position 33 is Pro, Leu, Gln, - # Ala, or Glu"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 34#/note= "Xaa at position 34 is Leu, Val, Gly, - # Ser, Lys, Ala, Arg, Gln, Glu, Ile, Phe,#Met" Thr, or- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 35#/note= "Xaa at position 35 is Leu, Ala, Asn, - # Pro, Gln, or Val"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 36#/note= "Xaa at position 36 is Asp or Leu"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 37#/note= "Xaa at position 37 is Phe, Ser, Pro, - # Trp, or Ile"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 38#/note= "Xaa at position 38 is Asn or Ala"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 41#/note= "Xaa at position 41 is Asn, Cys, Arg, - # His, Met, or Pro"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 42#/note= "Xaa at position 42 is Gly, Asp, Ser, - # Cys, Ala, Asn, Ile, Leu, Met, Tyr, Val, or Arg"- (ix) FEATURE: (A) NAME/KEY: Modified - #-site (B) LOCATION: 44# /note="Xaa at position 44 is Asp or Glu"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 45#/note= "Xaa at position 45 is Gln, Val, Met, - # Leu, Thr, Lys, Ala, Asn, Glu, Ser, or Trp"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 46#/note= "Xaa at position 46 is Asp, Phe, Ser, - # Thr, Cys, Ala, Asn, Gln, Glu, His, Ile, Lys- #, Tyr, Val, - # or Gly"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 47#/note= "Xaa at position 47 is Ile, Val, or His"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 49#/note= "Xaa at position 49 is Met,#Asp" Asn, or- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 50#/note= "Xaa at position 50 is Glu, Thr, Ala, - # Asn, Ser, or Asp"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 51#/note= "Xaa at position 51 is Asn, Arg, Met, - # Pro, Ser, Thr, or His"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 52#/note= "Xaa at position 52 is Asn or Gly"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 53#/note= "Xaa at position 53 is Leu,#Phe" Met, or- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 54#/note= "Xaa at position 54 is Arg#Ser" Ala, or- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 55#/note= "Xaa at position 55 is Arg, Thr, Val, - # Leu, or Gly"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 56#/note= "Xaa at position 56 is Pro, Gly, Cys, - # Ser, Gln, Ala, Arg, Asn, Glu, His, Leu, Thr- #,#Lys" Val, or- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 59#/note= "Xaa at position 59 is Glu, Tyr, His, - # Leu, or Arg"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 60#/note= "Xaa at position 60 is Ala, Ser, Asn, - # or Thr"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 61#/note= "Xaa at position 61 is Phe or Ser"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 62#/note= "Xaa at position 62 is Asn, Val, Pro, - # Thr, or Ile"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 63#/note= "Xaa at position 63 is Arg, Tyr, Lys, - # Ser, His, or Val"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 64#/note= "Xaa at position 64 is Ala or Asn"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 65#/note= "Xaa at position 65 is Val, Thr, Leu, - # or Ser"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 66#/note= "Xaa at position 66 is Lys, Ile, Arg, - # Val, Asn, Glu, or Ser"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 67#/note= "Xaa at position 67 is Ser, Phe, Val, - # Gly, Asn, Ile, or His"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 68#/note= "Xaa at position 68 is Leu, Val, Ile, - # Phe, or His"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 69#/note= "Xaa at position 69 is Gln, Ala, Pro, - # Thr, Glu, Arg, or Gly"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 70#/note= "Xaa at position 70 is Asn or Pro"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 71#/note= "Xaa at position 71 is Ala, Met, Pro, - # Arg, Glu, Thr, or Gln"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 72#/note= "Xaa at position 72 is Ser, Glu, Met, - # Ala, His, Asn, Arg, or Asp"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 73#/note= "Xaa at position 73 is Ala, Glu, Asp, - # Leu, Ser, Gly, Thr, Arg, or Pro"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 74#/note= "Xaa at position 74 is Ile or Met"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 75#/note= "Xaa at position 75 is Glu, Gly, Asp, - # Ser, or Gln"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 76#/note= "Xaa at position 76 is Ser, Val, Ala, - # Asn, Glu, Pro, Gly, or Asp"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 77#/note= "Xaa at position 77 is Ile,#Leu" Ser, or- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 79#/note= "Xaa at position 79 is Lys, Thr, Asn, - # Met, Arg, Ile, Gly, or Asp"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 80#/note= "Xaa at position 80 is Asn, Val, Gly, - # Thr, Leu, Glu, or Arg"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 81#/note= "Xaa at position 81 is Leu or Val"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 82#/note= "Xaa at position 82 is Leu, Gln, Trp, - # Arg, Asp, Ala, Asn, Glu, His, Met, Phe, Ser, Thr, - # Tyr, or Val"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 83#/note= "Xaa at position 83 is Pro, Ala, Thr, - # Trp, or Met"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 85#/note= "Xaa at position 85 is Leu or Val"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 87#/note= "Xaa at position 87 is Leu or Ser"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 88#/note= "Xaa at position 88 is Ala,#Trp" Arg, or- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 89#/note= "Xaa at position 89 is Thr, Asp, Glu, - # His, Asn, or Ser"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 90#/note= "Xaa at position 90 is Ala,#Met" Asp, or- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 91#/note= "Xaa at position 91 is Ala, Pro, Ser, - # Thr, Phe, Leu, or Asp"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 92#/note= "Xaa at position 92 is Pro or Ser"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 93#/note= "Xaa at position 93 is Thr, Asp, Ser, - # Pro, Ala, Leu, or Arg"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 95#/note= "Xaa at position 95 is His, Pro, Arg, - # Val, Leu, Gly, Asn, Ile, Phe, Ser, or Thr"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 96#/note= "Xaa at position 96 is Pro or Tyr"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 97#/note= "Xaa at position 97 is Ile,#Ala" Val, or- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 98#/note= "Xaa at position 98 is His, Ile, Asn, - # Leu, Asp, Ala, Thr, Arg, Gln, Glu, Lys, Met, - # Ser, Tyr, Val, or Pro"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 99#/note= "Xaa at position 99 is Ile, Leu, Val, - # or Phe"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 100#/note= "Xaa at position 100 is Lys, Leu, His, - # Arg, Ile, Gln, Pro, or Ser"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 101#/note= "Xaa at position 101 is Asp, Pro, Met, - # Lys, His, Thr, Val, Asn, Ile, Leu, or Tyr"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 102#/note= "Xaa at position 102 is Gly, Glu, Lys, - # or Ser"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 104#/note= "Xaa at position 104 is Trp, Val, Tyr, - # Met, or Leu"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 105#/note= "Xaa at position 105 is: Asn, Pro, - # Ala, Phe, Ser, Trp, Gln, Tyr, Leu, Lys,#or His" Ile, Asp- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 106#/note= "Xaa at position 106 is Glu, Ser, Ala, - # or Gly"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 108#/note= "Xaa at position 108 is Arg, Ala, Gln, - # Ser, or Lys"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 109#/note= "Xaa at position 109 is Arg, Thr, Glu, - # Leu, Ser, or Gly"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 112#/note= "Xaa at position 112 is Thr, Val, Gln, - # Glu, His, or Ser"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 114#/note= "Xaa at position 114 is Tyr or Trp"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 115#/note= "Xaa at position 115 is Leu or Ala"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 116#/note= "Xaa at position 116 is Lys, Thr, Met, - # Val, Trp, Ser, Leu, Ala, Asn, Gln, His, Met- #, Phe, Tyr, - # or Ile"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 117#/note= "Xaa at position 117 is Thr,#Asn" Ser, or- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 119#/note= "Xaa at position 119 is: Glu, Ser, - # Pro, Leu, Thr, or Tyr"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 120#/note= "Xaa at position 120 is Asn, Pro, Leu, - # His, Val, or Gln"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 121#/note= "Xaa at position 121 is Ala, Ser, Ile, - # Asn, Pro, Lys, Asp, or Gly"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 122#/note= "Xaa at position 122 is: Gln, Ser, - # Met, Trp, Arg, Phe, Pro, His, Ile, Tyr, or Cys"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 123#/note= "Xaa at position 123 is Ala, Met, Glu, - # His, Ser, Pro, Tyr, or Leu"- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:16:- Ala Pro Met Thr Gln Thr Thr Ser Leu Lys Th - #r Ser Trp Val Asn Cys# 15- Xaa Xaa Xaa Xaa Xaa Glu Xaa Xaa Xaa Xaa Le - #u Xaa Xaa Xaa Xaa Xaa# 30- Xaa Xaa Xaa Xaa Xaa Xaa Asn Leu Xaa Xaa Gl - #u Xaa Xaa Xaa Xaa Leu# 45- Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Asn Leu Xa - #a Xaa Xaa Xaa Xaa Xaa# 60- Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xa - #a Xaa Xaa Leu Xaa Xaa#80- Xaa Xaa Xaa Cys Xaa Pro Xaa Xaa Xaa Xaa Xa - #a Xaa Xaa Arg Xaa Xaa# 95- Xaa Xaa Xaa Xaa Xaa Xaa Asp Xaa Xaa Xaa Ph - #e Xaa Xaa Lys Leu Xaa# 110- Phe Xaa Xaa Xaa Xaa Leu Xaa Xaa Xaa Xaa Xa - #a Gln Gln Thr Thr Leu# 125- Ser Leu Ala Ile Phe 130- (2) INFORMATION FOR SEQ ID NO:17:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 133 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 1#/note= "Met- may or may not precede the amino - # acid in position 1"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 17#/note= "Xaa at position 17 is Ser, Gly, Asp, - # Met, or Gln"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 18#/note= "Xaa at position 18 is Asn,#Ile" His, or- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 19#/note= "Xaa at position 19 is Met or Ile"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 21#/note= "Xaa at position 21 is Asp or Glu"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 23#/note= "Xaa at position 23 is Ile, Ala, Leu, - # or Gly"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 24#/note= "Xaa at position 24 is Ile,#Leu" Val, or- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 25#/note= "Xaa at position 25 is Thr, His, Gln, - # or Ala"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 26#/note= "Xaa at position 26 is His or Ala"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 29#/note= "Xaa at position 29 is Gln,#Val" Asn, or- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 30#/note= "Xaa at position 30 is Pro,#Gln" Gly, or- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 31#/note= "Xaa at position 31 is Pro, Asp, Gly, - # or Gln"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 32#/note= "Xaa at position 32 is Leu, Arg, Gln, - # Asn, Gly, Ala, or Glu"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 33#/note= "Xaa at position 33 is Pro or Glu"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 34#/note= "Xaa at position 34 is Leu, Val, Gly, - # Ser, Lys, Ala, Arg, Gln, Glu, Ile, Phe#Met" Thr, or- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 35#/note= "Xaa at position 35 is Leu, Ala, Asn, - # Pro, Gln, or Val"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 37#/note= "Xaa at position 37 is Phe, Ser, Pro, - # or Trp"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 38#/note= "Xaa at position 38 is Asn or Ala"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 42#/note= "Xaa at position 42 is Gly, Asp, Ser, - # Cys, Ala, Asn, Ile, Leu, Met, Tyr, or Arg"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 44#/note= "Xaa at position 44 is Asp or Glu"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 45#/note= "Xaa at position 45 is Gln, Val, Met, - # Leu, Thr, Ala, Asn, Glu, Ser, or Lys"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 46#/note= "Xaa at position 46 is Asp, Phe, Ser, - # Thr, Ala, Asn, Gln, Glu, His, Ile, Lys, Tyr, Val, - # or Cys"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 50#/note= "Xaa at position 50 is Glu, Ala, Asn, - # Ser, or Asp"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 51#/note= "Xaa at position 51 is Asn, Arg, Met, - # Pro, Ser, Thr, or His"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 54#/note= "Xaa at position 54 is Arg or Ala"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 55#/note= "Xaa at position 55 is Arg, Thr, Val, - # Leu, or Gly"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 56#/note= "Xaa at position 56 is Pro, Gly, Ser, - # Gln, Ala, Arg, Asn, Glu, Leu, Thr, Val, or Lys"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 60#/note= "Xaa at position 60 is Ala or Ser"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 62#/note= "Xaa at position 62 is Asn, Pro, Thr, - # or Ile"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 63#/note= "Xaa at position 63 is Arg or Lys"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 64#/note= "Xaa at position 64 is Ala or Asn"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 65#/note= "Xaa at position 65 is Val or Thr"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 66#/note= "Xaa at position 66 is Lys or Arg"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 67#/note= "Xaa at position 67 is Ser#His" Phe or- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 68#/note= "Xaa at position 68 is Leu, Ile, Phe, - # or His"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 69#/note= "Xaa at position 69 is Gln, Ala, Pro, - # Thr, Glu, Arg, or Gly"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 71#/note= "Xaa at position 71 is Ala,#Arg" Pro, or- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 72#/note= "Xaa at position 72 is Ser, Glu, Arg, - # or Asp"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 73#/note= "Xaa at position 73 is Ala or Leu"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 76#/note= "Xaa at position 76 is Ser, Val, Ala, - # Asn, Glu, Pro, or Gly"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 77#/note= "Xaa at position 77 is Ile or Leu"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 79#/note= "Xaa at position 79 isN: Lys, Thr, - # Asn, Met, Arg, Ile, Gly, or Asp"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 80#/note= "Xaa at position 80 is Asn, Gly, Glu, - # or Arg"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 82#/note= "Xaa at position 82 is Leu, Gln, Trp, - # Arg, Asp, Ala, Asn, Glu, His, Ile, Met, Phe, Ser, - # Thr, Tyr, or Val"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 83#/note= "Xaa at position 83 is Pro or Thr"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 85#/note= "Xaa at position 85 is Leu or Val"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 87#/note= "Xaa at position 87 is Leu or Ser"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 88#/note= "Xaa at position 88 is Ala or Trp"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 91#/note= "Xaa at position 91 is Ala or Pro"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 93#/note= "Xaa at position 93 is Thr, Asp, Ser, - # Pro, Ala, Leu, or Arg"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 95#/note= "Xaa at position 95 is His, Pro, Arg, - # Val, Leu, Gly, Asn, Phe, Ser, or Thr"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 96#/note= "Xaa at position 96 is Pro or Tyr"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 97#/note= "Xaa at position 97 is Ile or Val"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 98#/note= "Xaa at position 98 is His, Ile, Asn, - # Leu, Ala, Thr, Arg, Gln, Lys, Met, Ser, - # Tyr, Val, or Pro"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 99#/note= "Xaa at position 99 is Ile,#Val" Leu, or- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 100#/note= "Xaa at position 100 is Lys, Arg, Ile, - # Gln, Pro, or Ser"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 101#/note= "Xaa at position 101 is Asp, Pro, Met, - # Lys, His, Thr, Pro, Asn, Ile, Leu, or Tyr"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 104#/note= "Xaa at position 104 is Trp or Leu"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 105#/note= "Xaa at position 105 is: Asn, Pro, - # Ala, Ser, Trp, Gln, Tyr, Leu, Lys, Ile,#His" Asp, or- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 106#/note= "Xaa at position 106 is Glu or Gly"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 109#/note= "Xaa at position 109 is Arg, Thr, Glu, - # Leu, or Ser"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 112#/note= "Xaa at position 112 is Thr,#Gln" Val, or- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 114#/note= "Xaa at position 114 is Tyr or Trp"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 115#/note= "Xaa at position 115 is Leu or Ala"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 116#/note= "Xaa at position 116 is Lys, Thr, Val, - # Trp, Ser, Ala, His, Met, Phe, Tyr, or Ile"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 117#/note= "Xaa at position 117 is Thr or Ser"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 120#/note= "Xaa at position 120 is Asn, Pro, Leu, - # His, Val, or Gln"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 121#/note= "Xaa at position 121 is Ala, Ser, Ile, - # Asn, Pro, Asp, or Gly"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 122#/note= "Xaa at position 122 is: Gln, Ser, - # Met, Trp, Arg, Phe, Pro, His, Ile, Tyr, or Cys"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 123#/note= "Xaa at position 123 is Ala, Met, Glu, - # His, Ser, Pro, Tyr, or Leu"- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:17:- Ala Pro Met Thr Gln Thr Thr Ser Leu Lys Th - #r Ser Trp Val Asn Cys# 15- Xaa Xaa Xaa Ile Xaa Glu Xaa Xaa Xaa Xaa Le - #u Lys Xaa Xaa Xaa Xaa# 30- Xaa Xaa Xaa Asp Xaa Xaa Asn Leu Asn Xaa Gl - #u Xaa Xaa Xaa Ile Leu# 45- Met Xaa Xaa Asn Leu Xaa Xaa Xaa Asn Leu Gl - #u Xaa Phe Xaa Xaa Xaa# 60- Xaa Xaa Xaa Xaa Xaa Asn Xaa Xaa Xaa Ile Gl - #u Xaa Xaa Leu Xaa Xaa#80- Leu Xaa Xaa Cys Xaa Pro Xaa Xaa Thr Ala Xa - #a Pro Xaa Arg Xaa Xaa# 95- Xaa Xaa Xaa Xaa Xaa Gly Asp Xaa Xaa Xaa Ph - #e Xaa Xaa Lys Leu Xaa# 110- Phe Xaa Xaa Xaa Xaa Leu Glu Xaa Xaa Xaa Xa - #a Gln Gln Thr Thr Leu# 125- Ser Leu Ala Ile Phe 130- (2) INFORMATION FOR SEQ ID NO:18:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 133 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 1#/note= "Met- may or may not precede the amino - # acid in position 1"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 17#/note= "Xaa at position 17 is Ser, Gly, Asp, - # or Gln"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 18#/note= "Xaa at position 18 is Asn,#Ile" His, or- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 23#/note= "Xaa at position 23 is Ile, Ala, Leu, - # or Gly"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 25#/note= "Xaa at position 25 is Thr,#Gln" His, or- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 26#/note= "Xaa at position 26 is His or Ala"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 29#/note="Xaa at position 29 is Gln or Asn"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 30#/note= "Xaa at position 30 is Pro or Gly"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 32#/note= "Xaa at position 32 is Leu, Arg, Asn, - # or Ala"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 34#/note= "Xaa at position 34 is Leu, Val, Ser, - # Ala, Arg, Gln, Glu, Ile, Phe, Thr, or Met"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 35#/note= "Xaa at position 35 is Leu, Ala, Asn, - # or Pro"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 38#/note= "Xaa at position 38 is Asn or Ala"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 42#/note= "Xaa at position 42 is Gly, Asp, Ser, - # Ala, Asn, Ile, Leu, Met, Tyr, or Arg"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 45#/note= "Xaa at position 45 is Gln, Val, Met, - # Leu, Ala, Asn, Glu, or Lys"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 46#/note= "Xaa at position 46 is Asp, Phe, Ser, - # Gln, Glu, His, Val, or Thr"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 50#/note= "Xaa at position 50 is Glu, Asn, Ser, - # or Asp"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 51#/note= "Xaa at position 51 is Asn, Arg, Pro, - # Thr, or His"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 55#/note= "Xaa at position 55 is Arg,#Gly" Leu, or- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 56#/note= "Xaa at position 56 is Pro, Gly, Ser, - # Ala, Asn, Val, Leu, or Gln"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 62#/note= "Xaa at position 62 is Asn,#Thr" Pro, or- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 64#/note= "Xaa at position 64 is Ala or Asn"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 65#/note= "Xaa at position 65 is Val or Thr"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 67#/note= "Xaa at position 67 is Ser or Phe"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 68#/note= "Xaa at position 68 is Leu or Phe"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 69#/note= "Xaa at position 69 is Gln, Ala, Glu, - # or Arg"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 76#/note= "Xaa at position 76 is Ser, Val, Asn, - # Pro, or Gly"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 77#/note= "Xaa at position 77 is Ile or Leu"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 79#/note= "Xaa at position 79 is Lys, Asn, Met, - # Arg, Ile, or Gly"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 80#/note= "Xaa at position 80 is Asn, Gly, Glu, - # or Arg"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 82#/note= "Xaa at position 82 is Leu, Gln, Trp, - # Arg, Asp, Asn, Glu, His, Met, Phe, Ser, Thr, Tyr, - # or Val"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 87#/note= "Xaa at position 87 is Leu or Ser"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 88#/note= "Xaa at position 88 is Ala or Trp"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 91#/note= "Xaa at position 91 is Ala or Pro"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 93#/note= "Xaa at position 93 is Thr,#Ala" Asp, or- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 95#/note= "Xaa at position 95 is His, Pro, Arg, - # Val, Gly, Asn, Ser, or Thr"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 98#/note= "Xaa at position 98 is His, Ile, Asn, - # Ala, Thr, Arg, Gln, Glu, Lys, Met, Ser, Tyr, Val, - # or Leu"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 99#/note= "Xaa at position 99 is Ile or Leu"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 100#/note= "Xaa at position 100 is Lys or Arg"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 101#/note= "Xaa at position 101 is Asp, Pro, Met, - # Lys, Thr, His, Pro, Asn, Ile, Leu, or Tyr"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 105#/note= "Xaa at position 105 is Asn, Pro, Ser, - # Ile, or Asp"- (ix) FEATURE: (A) NAME/KEY: Modified - #-site (B) LOCATION: 108# /note= "Xaa at position 108 is Arg,#Ser" Ala, or- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 109#/note= "Xaa at position 109 is Arg, Thr, Glu, - # Leu, or Ser"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 112#/note= "Xaa at position 112 is Thr or Gln"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 116#/note= "Xaa at position 116 is Lys, Val, Trp, - # Ala, His, Phe, Tyr, or Ile"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 117#/note= "Xaa at position 117 is Thr or Ser"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 120#/note= "Xaa at position 120 is Asn, Pro, Leu, - # His, Val, or Gln"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 121#/note= "Xaa at position 121 is Ala, Ser, Ile, - # Pro, or Asp"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 122#/note= "Xaa at position 122 is Gln, Met, Trp, - # Phe, Pro, His, Ile, or Tyr"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 123#/note= "Xaa at position 123 is Ala, Met, Glu, - # Ser, or Leu"- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:18:- Ala Pro Met Thr Gln Thr Thr Ser Leu Lys Th - #r Ser Trp Val Asn Cys# 15- Xaa Xaa Met Ile Asp Glu Xaa Ile Xaa Xaa Le - #u Lys Xaa Xaa Pro Xaa# 30- Pro Xaa Xaa Asp Phe Xaa Asn Leu Asn Xaa Gl - #u Asp Xaa Xaa Ile Leu# 45- Met Xaa Xaa Asn Leu Arg Xaa Xaa Asn Leu Gl - #u Ala Phe Xaa Arg Xaa# 60- Xaa Lys Xaa Xaa Xaa Asn Ala Ser Ala Ile Gl - #u Xaa Xaa Leu Xaa Xaa#80- Leu Xaa Pro Cys Leu Pro Xaa Xaa Thr Ala Xa - #a Pro Xaa Arg Xaa Pro# 95- Ile Xaa Xaa Xaa Xaa Gly Asp Trp Xaa Glu Ph - #e Xaa Xaa Lys Leu Xaa# 110- Phe Tyr Leu Xaa Xaa Leu Glu Xaa Xaa Xaa Xa - #a Gln Gln Thr Thr Leu# 125- Ser Leu Ala Ile Phe 130- (2) INFORMATION FOR SEQ ID NO:19:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 111 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 1#/note= "Met- or Met-Ala- may or may not prece - #de the amino acid in position 1"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 3#/note= "Xaa at position 3 is Ser, Lys, Gly, - # Asp, Met, Gln, or Arg"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 4#/note= "Xaa at position 4 is Asn, His, Leu, - # Ile, Phe, Arg, or Gln"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 5#/note= "Xaa at position 5 is Met, Phe, Ile, - # Arg, Gly, Ala, or Cys"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 6#/note= "Xaa at position 6 is Ile, Cys, Gln, - # Glu, Arg, Pro, or Ala"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 7#/note= "Xaa at position 7 is Asp, Phe, Lys, - # Arg, Ala, Gly, Glu, Gln, Asn, Thr, Ser, or Val"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 8#/note= "Xaa at position 8 is Glu, Trp, Pro, - # Ser, Ala, His, Asp, Asn, Gln, Leu, Val, or Gly"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 9#/note= "Xaa at position 9 isON: Ile, Val, - # Ala, Leu, Gly, Trp, Lys, Phe, Ser or Arg"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 10#/note= "Xaa at position 10 is Ile, Gly, Val, - # Arg, Ser, Phe, or Leu"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 11#/note= "Xaa at position 11 is Thr, His, Gly, - # Gln, Arg, Pro, or Ala"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 12#/note= "Xaa at position 12 is His, Thr, Phe, - # Gly, Arg, Ala, or Trp"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 13#/note= "Xaa at position 13 is Leu, Gly, Arg, - # Thr, Ser, or Ala"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 14#/note= "Xaa at position 14 is Lys, Arg, Leu, - # Gln, Gly, Pro, Val, or Trp"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 15#/note= "Xaa at position 15 is Gln, Asn, Leu, - # Pro, Arg, or Val"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 16#/note= "Xaa at position 16 is Pro, His, Thr, - # Gly, Asp, Gln, Ser, Leu, or Lys"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 17#/note= "Xaa at position 17 is Pro, Asp, Gly, - # Ala, Arg, Leu, or Gln"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 18#/note= "Xaa at position 18 is Leu, Val, Arg, - # Gln, Asn, Gly, Ala, or Glu"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 19#/note= "Xaa at position 19 is Pro, Leu, Gln, - # Ala, Thr, or Glu"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 20#/note= "Xaa at position 20 is Leu, Val, Gly, - # Ser, Lys, Glu, Gln, Thr, Arg, Ala, Phe,#Met" Ile, or- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 21#/note= "Xaa at position 21 is Leu, Ala, Gly, - # Asn, Pro, Gln, or Val"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 22#/note= "Xaa at position 22 is Asp,#Val" Leu, or- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 23#/note= "Xaa at position 23 is Phe, Ser, Pro, - # Trp, or Ile"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 24#/note= "Xaa at position 24 is Asn or Ala"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 26#/note= "Xaa at position 26 is Leu,#Arg" Trp, or- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 27#/note= "Xaa at position 27 is Asn, Cys, Arg, - # Leu, His, Met, or Pro"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 28#/note= "Xaa at position 28 is Gly, Asp, Ser, - # Cys, Ala, Lys, Asn, Thr, Leu, Val, Glu, Phe, Tyr, - # Ile, or Met"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 29#/note= "Xaa at position 29 is Glu, Asn, Tyr, - # Leu, Phe, Asp, Ala, Cys, Gln, Arg, Thr,#Ser" Gly, or- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 30#/note= "Xaa at position 30 is Asp, Ser, Leu, - # Arg, Lys, Thr, Met, Trp, Glu, Asn, Gln,#Pro" Ala, or- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 31#/note= "Xaa at position 31 is Gln, Pro, Phe, - # Val, Met, Leu, Thr, Lys, Asp, Asn, Arg, Ser, Ala, - # Ile, Glu, His, or Trp"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 32#/note= "Xaa at position 32 is Asp, Phe, Ser, - # Thr, Cys, Glu, Asn, Gln, Lys, His, Ala, Tyr, Ile, - # Val, or Gly"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 33#/note= "Xaa at position 33 is Ile, Gly, Val, - # Ser, Arg, Pro, or His"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 34#/note= "Xaa at position 34 is Leu, Ser, Cys, - # Arg, Ile, His, Phe, Glu, Lys, Thr, Ala, Met, Val, - # or Asn"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 35#/note= "Xaa at position 35 is Met, Arg, Ala, - # Gly, Pro, Asn, His, or Asp"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 36#/note= "Xaa at position 36 is Glu, Leu, Thr, - # Asp, Tyr, Lys, Asn, Ser, Ala, Ile, Val, His, Phe, - # Met, or Gln"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 37#/note= "Xaa at position 37 is Asn, Arg, Met, - # Pro, Ser, Thr, or His"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 38#/note= "Xaa at position 38 is Asn, His, Arg, - # Leu, Gly, Ser, or Thr"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 39#/note= "Xaa at position 39 isN: Leu, Thr, - # Ala, Gly, Glu, Pro, Lys, Ser, or Met"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 40#/note= "Xaa at position 40 is Arg, Asp, Ile, - # Ser, Val, Thr, Gln, Asn, Lys, His,#Leu" Ala, or- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 41#/note= "Xaa at position 41 is Arg, Thr, Val, - # Ser, Leu, or Gly"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 42#/note= "Xaa at position 42 is Pro, Gly, Cys, - # Ser, Gln, Glu, Arg, His, Thr, Ala, Tyr, Phe, Leu, - # Val, or Lys"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 43#/note= "Xaa at position 43 is Asn or Gly"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 44#/note= "Xaa at position 44 is Leu, Ser, Asp, - # Arg, Gln, Val, or Cys"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 45#/note= "Xaa at position 45 is Glu, Tyr, His, - # Leu, Pro, or Arg"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 46#/note= "Xaa at position 46 is Ala, Ser, Pro, - # Tyr, Asn, or Thr"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 47#/note= "Xaa at position 47 is Phe, Asn, Glu, - # Pro, Lys, Arg, or Ser"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 48#/note= "Xaa at position 48 is Asn, His, Val, - # Arg, Pro, Thr, Asp, or Ile"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 49#/note= "Xaa at position 49 is Arg, Tyr, Trp, - # Lys, Ser, His, Pro, or Val"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 50#/note= "Xaa at position 50 is Ala, Asn, Pro, - # Ser, or Lys"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 51#/note= "Xaa at position 51 is Val, Thr, Pro, - # His, Leu, Phe, or Ser"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 52#/note= "Xaa at position 52 is Lys, Ile, Arg, - # Val, Asn, Glu, or Ser"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 53#/note= "Xaa at position 53 is Ser, Ala, Phe, - # Val, Gly, Asn, Ile, Pro, or His"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 54#/note= "Xaa at position 54 is Leu, Val, Trp, - # Ser, Ile, Phe, Thr, or His"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 55#/note= "Xaa at position 55 is Gln, Ala, Pro, - # Thr, Glu, Arg, Trp, Gly, or Leu"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 56#/note= "Xaa at position 56 is Asn, Leu, Val, - # Trp, Pro, or Ala"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 57#/note= "Xaa at position 57 is Ala, Met, Leu, - # Pro, Arg, Glu, Thr, Gln, Trp, or Asn"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 58#/note= "Xaa at position 58 is Ser, Glu, Met, - # Ala, His, Asn, Arg, or Asp"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 59#/note= "Xaa at position 59 is Ala, Glu, Asp, - # Leu, Ser, Gly, Thr, or Arg"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 60#/note= "Xaa at position 60 is Ile, Met, Thr, - # Pro, Arg, Gly, Ala"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 61#/note= "Xaa at position 61 isN: Glu, Lys, - # Gly, Asp, Pro, Trp, Arg, Ser, Gln, or Leu"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 62#/note= "Xaa at position 62 is Ser, Val, Ala, - # Asn, Trp, Glu, Pro, Gly, or Asp"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 63#/note= "Xaa at position 63 is Ile, Ser, Arg, - # Thr, or Leu"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 64#/note= "Xaa at position 64 is Leu, Ala, Ser, - # Glu, Phe, Gly, or Arg"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 65#/note= "Xaa at position 65 is Lys, Thr, Gly, - # Asn, Met, Arg, Ile, or Asp"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 66#/note= "Xaa at position 66 is Asn, Trp, Val, - # Gly, Thr, Leu, Glu, or Arg"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 67#/note= "Xaa at position 67 is Leu, Gln, Gly, - # Ala, Trp, Arg, Val, or Lys"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 68#/note= "Xaa at position 68 is Leu, Gln, Lys, - # Trp, Arg, Asp, Glu, Asn, His, Thr, Ser, Ala- #, Tyr, Phe, - # Ile, Met, or Val"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 69#/note= "Xaa at position 69 is Pro, Ala, Thr, - # Trp, Arg, or Met"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 70#/note= "Xaa at position 70 is Cys, Glu, Gly, - # Arg, Met, or Val"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 71#/note= "Xaa at position 71 is Leu, Asn, Val, - # or Gln"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 72#/note= "Xaa at position 72 is Pro, Cys, Arg, - # Ala, or Lys"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 73#/note= "Xaa at position 73 is Leu, Ser, Trp, - # or Gly"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 74#/note= "Xaa at position 74 is Ala, Lys, Arg, - # Val, or Trp"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 75#/note= "Xaa at position 75 is Thr, Asp, Cys, - # Leu, Val, Glu, His, Asn, or Ser"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 76#/note= "Xaa at position 76 is Ala, Pro, Ser, - # Thr, Gly, Asp, Ile, or Met"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 77#/note= "Xaa at position 77 is Ala, Pro, Ser, - # Thr, Phe, Leu, Asp, or His"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 78#/note= "Xaa at position 78 is Pro, Phe, Arg, - # Ser, Lys, His, Ala, Gly, Ile, or Leu"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 79#/note= "Xaa at position 79 is Thr, Asp, Ser, - # Asn, Pro, Ala, Leu, or Arg"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 80#/note= "Xaa at position 80 is Arg, Ile, Ser, - # Glu, Leu, Val, Gln, Lys, His, Ala, or Pro"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 81#/note= "Xaa at position 81 is His, Gln, Pro, - # Arg, Val, Leu, Gly, Thr, Asn, Lys, Ser, Ala, Trp, - # Phe, Ile, or Tyr"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 82#/note= "Xaa at position 82 is Pro, Lys, Tyr, - # Gly, Ile, or Thr"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 83#/note= "Xaa at position 83 is Ile, Val, Lys, - # Ala, or Asn"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 84#/note= "Xaa at position 84 is His, Ile, Asn, - # Leu, Asp, Ala, Thr, Glu, Gln, Ser, Phe, Met, - # Val, Lys, Arg, Tyr, or Pro"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 85#/note= "Xaa at position 85 isN: Ile, Leu, - # Arg, Asp, Val, Pro, Gln, Gly, Ser,#His" Phe, or- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 86#/note= "Xaa at position 86 isN: Lys, Tyr, - # Leu, His, Arg, Ile, Ser, Gln, or Pro"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 87#/note= "Xaa at position 87 isN: Asp, Pro, - # Met, Lys, His, Thr, Val, Tyr, Glu, Asn, Ser, Ala, - # Gly, Ile, Leu, or Gln"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 88#/note= "Xaa at position 88 Gly, Leu, Glu, - # Lys, Ser, Tyr, or Pro"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 89#/note= "Xaa at position 89 is Asp or Ser"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 90#/note= "Xaa at position 90 isN: Trp, Val, - # Cys, Tyr, Thr, Met, Pro, Leu, Gln, Lys, Ala, Phe, - # or Gly"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 91#/note= "Xaa at position 91 isN: Asn, Pro, - # Ala, Phe, Ser, Trp, Gln, Tyr, Leu, Lys, Ile, Asp, - # or His"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 92#/note= "Xaa at position 92 is Glu, Ser, Ala, - # Lys, Thr, Ile, Gly, or Pro"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 94#/note= "Xaa at position 94 is Arg, Lys, Asp, - # Leu, Thr, Ile, Gln, His, Ser, Ala, or Pro"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 95#/note= "Xaa at position 95 is Arg, Thr, Pro, - # Glu, Tyr, Leu, Ser, or Gly"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 96#/note= "Xaa at position 96 is Lys, Asn, Thr, - # Leu, Gln, Arg, His, Glu, Ser, Ala, or Trp"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 97#/note= "Xaa at position 97 is Leu, Ile, Arg, - # Asp, or Met"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 98#/note= "Xaa at position 98 is Thr, Val, Gln, - # Tyr, Glu, His, Ser, or Phe"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 99#/note= "Xaa at position 99 is Phe, Ser, Cys, - # His, Gly, Trp, Tyr, Asp, Lys, Leu, Ile,#Asn" Val, or- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 100#/note= "Xaa at position 100 is Tyr, Cys, His, - # Ser, Trp, Arg, or Leu"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 101#/note= "Xaa at position 101 is Leu, Asn, Val, - # Pro, Arg, Ala, His, Thr, Trp, or Met"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 102#/note= "Xaa at position 102 is: Lys, Leu, - # Pro, Thr, Met, Asp, Val, Glu, Arg, Trp, Ser, Asn, - # His, Ala, Tyr, Phe, Gln, or Ile"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 103#/note= "Xaa at position 103 is Thr, Ser, Asn, - # Ile, Trp, Lys, or Pro"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 104#/note= "Xaa at position 104 is Leu, Ser, Pro, - # Ala, Glu, Cys, Asp, or Tyr"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 105#/note= "Xaa at position 105 is Glu, Ser, Lys, - # Pro, Leu, Thr, Tyr, or Arg"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 106#/note= "Xaa at position 106 is Asn, Ala, Pro, - # Leu, His, Val or Gln"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 107#/note= "Xaa at position 107 is Ala, Ser, Ile, - # Asn, Pro, Lys, Asp, or Gly"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 108#/note= "Xaa at position 108 is: Gln, Ser, - # Met, Trp, Arg, Phe, Pro, His, Ile, Tyr, or Cys"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 109#/note= "Xaa at position 109 is Ala, Met, Glu, - # His, Ser, Pro, Tyr, or Leu"- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:19:- Asn Cys Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xa - #a Xaa Xaa Xaa Xaa Xaa# 15- Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Asn Xaa Xa - #a Xaa Xaa Xaa Xaa Xaa# 30- Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xa - #a Xaa Xaa Xaa Xaa Xaa# 45- Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xa - #a Xaa Xaa Xaa Xaa Xaa# 60- Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xa - #a Xaa Xaa Xaa Xaa Xaa#80- Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xa - #a Xaa Phe Xaa Xaa Xaa# 95- Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xa - #a Xaa Xaa Gln Gln# 110- (2) INFORMATION FOR SEQ ID NO:20:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 111 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 1#/note= "Met- or Met-Ala- may or may not prece - #de the amino acid in position 1"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 3#/note= "Xaa at position 3 is Ser, Gly, Asp, - # Met, or Gln"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 4#/note= "Xaa at position 4 is Asn, His, Leu, - #Ile, Phe, Arg, or Gln"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 5#/note= "Xaa at position 5 is Met, Phe, Ile, - # Arg, or Ala"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 6#/note= "Xaa at position 6 is Ile or Pro"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 7#/note= "Xaa at position 7 is Asp or Glu"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 9#/note= "Xaa at position 9 is Ile, Val, Ala, - # Leu, or Gly"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 10#/note= "Xaa at position 10 is Ile, Val, Phe, - # or Leu"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 11#/note= "Xaa at position 11 is Thr, His, Gly, - # Gln, Arg, Pro, or Ala"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 12#/note= "Xaa at position 12 is His, Phe, Gly, - # Arg, or Ala"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 14#/note= "Xaa at position 14 is Lys, Leu, Gln, - # Gly, Pro, or Val"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 15#/note= "Xaa at position 15 is Gln, Asn, Leu, - # Arg, or Val"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 16#/note= "Xaa at position 16 is Pro, His, Thr, - # Gly, or Gln"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 17#/note= "Xaa at position 17 is Pro, Asp, Gly, - # Ala, Arg, Leu, or Gln"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 18#/note= "Xaa at position 18 is Leu, Arg, Gln, - # Asn, Gly, Ala or Glu"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 19#/note= "Xaa at poisiton 19 is Pro, Leu, Gln, - # Ala, or Glu"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 20#/note= "Xaa at positon 20 is Leu, Val, Gly, - # Ser, Lys, Ala, Arg, Gln, Glu, Ile, Phe,#Met" Thr, or- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 21#/note= "Xaa at position 21 is Leu, Ala, Asn, - # Pro, Gln, or Val"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 22#/note= "Xaa at position 22 is Asp or Leu"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 23#/note= "Xaa at position 23 is Phe, Ser, Pro, - # Trp, or Ile"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 24#/note= "Xaa at position 24 is Asn or Ala"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 27#/note= "Xaa at position 27 is Asn, Cys, Arg, - # His, Met, or Pro"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 28#/note= "Xaa at position 28 is Gly, Asp, Ser, - # Cys, Ala, Asn, Ile, Leu, Met, Tyr, or Arg"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 30# /note= "Xaa at position 30 is Asp or Glu"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 31#/note= "Xaa at position 31 is Gln, Val, Met, - # Leu, Thr, Lys, Ala, Asn, Glu, Ser, or Trp"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 32#/note= "Xaa at position 32 is Asp, Phe, Ser, - # Thr, Cys, Ala, Asn, Gln, Glu, His, Ile, Lys, Tyr, - # Val, or Gly"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 33#/note= "Xaa at position 33 is Ile,#His" Val, or- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 35#/note= "Xaa at position 35 is Met,#Asp" Asn, or- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 36#/note= "Xaa at position 36 is Glu, Thr, Ala, - # Asn, Ser, or Asp"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 37#/note= "Xaa at position 37 is Asn, Arg, Met, - # Pro, Ser, Thr, or His"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 38#/note= "Xaa at position 38 is Asn or Gly"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 39#/note= "Xaa at position 39 is Leu,#Phe" Met, or- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 40#/note= "Xaa at position 40 is Arg,#Ser" Ala, or- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 41#/note= "Xaa at position 41 is Arg, Thr, Val, - # Leu, or Gly"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 42#/note= "Xaa at position 42 is Pro, Gly, Cys, - # Ser, Gln, Ala, Arg, Asn, Glu, His, Leu, Thr, Val, - # or Lys"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 45#/note= "Xaa at position 45 is Glu, Tyr, His, - # Leu, or Arg"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 46#/note= "Xaa at position 46 is Ala, Ser, Asn, - # or Thr"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 47#/note= "Xaa at position 47 is Phe or Ser"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 48#/note= "Xaa at position 48 is Asn, Val, Pro, - # Thr, or Ile"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 49#/note= "Xaa at position 49 is Arg, Tyr, Lys, - # Ser, His, or Val"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 50#/note= "Xaa at position 50 is Ala or Asn"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 51#/note= "Xaa at position 51 is Val, Thr, Leu, - # or Ser"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 52#/note= "Xaa at position 52 is Lys, Ile, Arg, - # Val, Asn, Glu, or Ser"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 53#/note= "Xaa at position 53 is Ser, Phe, Val, - # Gly, Asn, Ile, or His"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 54#/note= "Xaa at position 54 is Leu, Val, Ile, - # Phe, or His"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 55#/note= "Xaa at position 55 is Gln, Ala, Pro, - # Thr, Glu, Arg, or Gly"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 56#/note= "Xaa at position 56 is Asn or Pro"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 57#/note= "Xaa at position 57 is Ala, Met, Pro, - # Arg, Glu, Thr, or Gln"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 58#/note= "Xaa at position 58 is Ser, Glu, Met, - # Ala, His, Asn, Arg, or Asp"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 59#/note= "Xaa at position 59 is Ala, Glu, Asp, - # Leu, Ser, Gly, Thr, Arg, or Pro"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 60#/note= "Xaa at position 60 is Ile or Met"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 61#/note= "Xaa at position 61 is Glu, Gly, Asp, - # Ser, or Gln"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 62#/note= "Xaa at position 62 is Ser, Val, Ala, - # Asn, Glu, Pro, Gly, or Asp"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 63#/note= "Xaa at position 63 is Ile,#Leu" Ser, or- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 65#/note= "Xaa at position 65 is Lys, Thr, Gly, - # Asn, Met, Arg, Ile, or Asp"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 66#/note= "Xaa at position 66 is Asn, Val, Gly, - # Thr, Leu, Glu, or Arg"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 67#/note= "Xaa at position 67 is Leu or Val"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 68#/note= "Xaa at position 68 is Leu, Gln, Trp, - # Arg, Asp, Ala, Asn, Glu, His, Met, Phe, Ser, Thr, - # Tyr, or Val"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 69#/note= "Xaa at position 69 is Pro, Ala, Thr, - # Trp, or Met"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 71#/note= "Xaa at position 71 is Leu or Val"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 73#/note= "Xaa at position 73 is Leu or Ser"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 74#/note= "Xaa at position 74 is Ala,#Trp" Arg, or- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 75#/note= "Xaa at position 75 is Thr, Asp, Glu, - # His, Asn, or Ser"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 76#/note= "Xaa at position 76 is Ala,#Met" Asp, or- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 77#/note= "Xaa at position 77 is Ala, Pro, Ser, - # Thr, Phe, Leu, or Asp"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 78#/note= "Xaa at position 78 is Pro or Ser"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 79#/note= "Xaa at position 79 is Thr, Asp, Ser, - # Pro, Ala, Leu, or Arg"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 81#/note= "Xaa at position 81 is His, Pro, Arg, - # Val, Leu, Gly, Asn, Ile, Phe, Ser, or Thr"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 82#/note= "Xaa at position 82 is Pro or Tyr"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 83#/note= "Xaa at position 83 is Ile,#Ala" Val, or- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 84#/note= "Xaa at position 84 is His, Ile, Asn, - # Leu, Asp, Ala, Thr, Arg, Gln, Glu, Lys, Met, Ser, - # Tyr, Val, or Pro"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 85#/note= "Xaa at position 85 is Ile, Leu, Val, - # or Phe"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 86#/note= "Xaa at position 86 is Lys, Leu, His, - # Arg, Ile, Gln, Pro, or Ser"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 87#/note= "Xaa at position 87 is Asp, Pro, Met, - # Lys, His, Thr, Val, Asn, Ile, Leu, or Tyr"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 88#/note= "Xaa at position 88 is Gly, Glu, Lys, - # or Ser"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 90#/note= "Xaa at position 90 is Trp, Val, Tyr, - # Met, or Leu"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 91#/note= (D) OTHER INFORMATION: "Xaa a - #t position 91 is Asn, Pro, Ala, Phe, Ser, Trp, Gln, - # Tyr, Leu, Lys, Ile, Asp, or His"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 92#/note= "Xaa at position 92 is Glu, Ser, Ala, - # or Gly"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 94#/note= "Xaa at position 94 is Arg, Ala, Gln, - # Ser, or Lys"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 95#/note= "Xaa at position 95 Arg, Thr, Glu, - # Leu, Ser, or Gly"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 98#/note= "Xaa at position 98 is Thr, Val, Gln, - # Glu, His, or Ser"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 100#/note= "Xaa at position 100 is Tyr or Trp"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 101#/note= "Xaa at position 101 is Leu or Ala"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 102#/note= "Xaa at position 102 is Lys, Thr, Met, - # Val, Trp, Ser, Leu, Ala, Asn, Gln, His, Met, Phe, - # Tyr, or Ile"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 103#/note= "Xaa at position 103 is Thr,#Asn" Ser, or- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 105#/note= "Xaa at position 105 is Glu, Ser, Pro, - # Leu, Thr, or Tyr"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 106#/note= "Xaa at position 106 is Asn, Pro, Leu, - # His, Val, or Gln"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 107#/note= "Xaa at position 107 is Ala, Ser, Ile, - # Asn, Pro, Lys, Asp, or Gly"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 108#/note= (D) OTHER INFORMATION: "Xaa a - #t position 108 is Gln, Ser, Met, Trp, Arg, P -#he, Pro, His, - # Ile, Tyr, or Cys"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 109#/note= "Xaa at position 109 is Ala, Met, Glu, - # His, Ser, Pro, Tyr, or Leu"- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:20:- Asn Cys Xaa Xaa Xaa Xaa Xaa Glu Xaa Xaa Xa - #a Xaa Leu Xaa Xaa Xaa# 15- Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Asn Leu Xa - #a Xaa Glu Xaa Xaa Xaa# 30- Xaa Leu Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa As - #n Leu Xaa Xaa Xaa Xaa# 45- Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xa - #a Xaa Xaa Xaa Xaa Leu# 60- Xaa Xaa Xaa Xaa Xaa Cys Xaa Pro Xaa Xaa Xa - #a Xaa Xaa Xaa Xaa Arg#80- Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Asp Xaa Xa - #a Xaa Phe Xaa Xaa Lys# 95- Leu Xaa Phe Xaa Xaa Xaa Xaa Leu Xaa Xaa Xa - #a Xaa Xaa Gln Gln# 110- (2) INFORMATION FOR SEQ ID NO:21:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 111 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 1#/note= "Met- or Met-Ala- may or may not prece - #de the amino acid in position 1"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 3#/note= "Xaa at position 3 is Ser, Gly, Asp, - # Met, or Gln"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 4#/note= "Xaa at position 4 is Asn,#Ile" His, or- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 5#/note= "Xaa at position 5 is Met or Ile"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 7#/note= "Xaa at position 7 is Asp or Glu"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 9#/note= "Xaa at position 9 is Ile, Ala, Leu, - # or Gly"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 10#/note= "Xaa at position 10 is Ile,#Leu" Val, or- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 11#/note= "Xaa at position 11 is Thr, His, Gln, - # or Ala"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 12#/note= "Xaa at position 12 is His or Ala"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 15#/note= "Xaa at position 15 is Gln,#Val" Asn, or- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 16#/note= "Xaa at position 16 is Pro,#Gln" Gly, or- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 17#/note= "Xaa at position 17 is Pro, Asp, Gly, - # or Gln"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 18#/note= "Xaa at position 18 is Leu, Arg, Gln, - # Asn, Gly, Ala, or Glu"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 19#/note= "Xaa at position 19 is Pro or Glu"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 20#/note= "Xaa at position 20 is Leu, Val, Gly, - # Ser, Lys, Ala, Arg, Gln, Glu, Ile, Phe,#Met" Thr, or- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 21#/note= "Xaa at position 21 is Leu, Ala, Asn, - # Pro, Gln, or Val"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 23#/note= "Xaa at position 23 is Phe, Ser, Pro, - # or Trp"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 24#/note= "Xaa at position 24 is Asn or Ala"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 28#/note= "Xaa at position 28 is Gly, Asp, Ser, - # Cys, Ala, Asn, Ile, Leu, Met, Tyr, or Arg"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 30#/note= "Xaa at position 30 is Asp or Glu"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 31#/note= "Xaa at position 31 is Gln, Val, Met, - # Leu, Thr, Ala, Asn, Glu, Ser, or Lys"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 32#/note= "Xaa at position 32 is Asp, Phe, Ser, - # Thr, Ala, Asn, Gln, Glu, His, Ile, Lys, Tyr, Val, - # or Cys"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 36#/note= "Xaa at position 36 is Glu, Ala, Asn, - # Ser, or Asp"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 37#/note= "Xaa at position 37 is Asn, Arg, Met, - # Pro, Ser, Thr, or His"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 40#/note= "Xaa at position 40 is Arg or Ala"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 41#/note= "Xaa at position 41 is Arg, Thr, Val, - # Leu, or Gly"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 42#/note= "Xaa at position 42 is Pro, Gly, Ser, - # Gln, Ala, Arg, Asn, Glu, Leu, Thr, Val, or Lys"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 46#/note= "Xaa at position 46 is Ala or Ser"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 48#/note= "Xaa at position 48 is Asn,#Thr, or Ile" Pro,- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 49#/note= "Xaa at position 49 is Arg or Lys"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 50#/note= "Xaa at position 50 is Ala or Asn"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 51#/note= "Xaa at position 51 is Val or Thr"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 52#/note= "Xaa at position 52 is Lys or Arg"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 53#/note= "Xaa at position 53 is Ser,#His" Phe, or- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 54#/note= "Xaa at position 54 is Leu, Ile, Phe, - # or His"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 55#/note= "Xaa at position 55 is Gln, Ala, Pro, - # Thr, Glu, Arg, or Gly"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 57#/note= "Xaa at position 57 is Ala,#Arg" Pro, or- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 58#/note= "Xaa at position 58 is Ser, Glu, Arg, - # or Asp"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 59#/note= "Xaa at position 59 is Ala or Leu"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 62#/note= "Xaa at position 62 is Ser, Val, Ala, - # Asn, Glu, Pro, or Gly"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 63#/note= "Xaa at position 63 is Ile or Leu"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 65#/note= "Xaa at position 65 is Lys, Thr, Gly, - # Asn, Met, Arg, Ile, Gly, or Asp"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 66#/note= "Xaa at position 66 is Asn, Gly, Glu, - # or Arg"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 68#/note= "Xaa at position 68 is Leu, Gln, Trp, - # Arg, Asp, Ala, Asn, Glu, His, Ile, Met, Phe, Ser, - # Thr, Tyr, or Val"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 69#/note= "Xaa at position 69 is Pro or Thr"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 71#/note= "Xaa at position 71 is Leu or Val"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 73#/note= "Xaa at position 73 is Leu or Ser"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 74#/note= "Xaa at position 74 is Ala or Trp"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 77#/note= "Xaa at position 77 is Ala or Pro"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 79#/note= "Xaa at position 79 is Thr, Asp, Ser, - # Pro, Ala, Leu, or Arg"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 81#/note= "Xaa at position 81 is His, Pro, Arg, - # Val, Leu, Gly, Asn, Phe, Ser, or Thr"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 82#/note= "Xaa at position 82 is Pro or Tyr"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 83#/note= "Xaa at position 83 is Ile or Val"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 84#/note= "Xaa at position 84 is His, Ile, Asn, - # Leu, Ala, Thr, Arg, Gln, Lys, Met, Ser, - # Tyr, Val, or Pro"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 85#/note= "Xaa at position 85 is Ile,#Val" Leu, or- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 86#/note= "Xaa at position 86 is Lys, Arg, Ile, - # Gln, Pro, or Ser"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 87#/note= "Xaa at position 87 is Asp, Pro, Met, - # Lys, His, Thr, Asn, Ile, Leu, or Tyr"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 90#/note= "Xaa at position 90 is Trp or Leu"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 91#/note="Xaa at position 91 is Asn, Pro, Ala, - # Ser, Trp, Gln, Tyr, Leu, Lys, Ile, Asp, or His"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 92#/note= "Xaa at position 92 is Glu or Gly"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 94#/note= "Xaa at position 94 is Arg,#Ser" Ala, or- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 95#/note= "Xaa at position 95 is Arg, Thr, Glu, - # Leu, or Ser"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 98#/note= "Xaa at position 98 is Thr,#Gln" Val, or- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 100#/note= "Xaa at position 100 is Tyr or Trp"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 101#/note= "Xaa at position 101 is Leu or Ala"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 102#/note= "Xaa at position 102 is Lys, Thr, Val, - # Trp, Ser, Ala, His, Met, Phe, Tyr, or Ile"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 103#/note= "Xaa at position 103 is Thr or Ser"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 106#/note= "Xaa at position 106 is Asn, Pro, Leu, - # His, Val, or Gln"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 107#/note= "Xaa at position 107 is Ala, Ser, Ile, - # Asn, Pro, Asp, or Gly"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 108#/note= "Xaa at position 108 is Gln, Ser, Met, - # Trp, Arg, Phe, Pro, His, Ile, Tyr, or Cys"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 109#/note= "Xaa at position 109 is Ala, Met, Glu, - # His, Ser, Pro, Tyr, or Leu"- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:21:- Asn Cys Xaa Xaa Xaa Ile Xaa Glu Xaa Xaa Xa - #a Xaa Leu Lys Xaa Xaa# 15- Xaa Xaa Xaa Xaa Xaa Asp Xaa Xaa Asn Leu As - #n Xaa Glu Xaa Xaa Xaa# 30- Ile Leu Met Xaa Xaa Asn Leu Xaa Xaa Xaa As - #n Leu Glu Xaa Phe Xaa# 45- Xaa Xaa Xaa Xaa Xaa Xaa Xaa Asn Xaa Xaa Xa - #a Ile Glu Xaa Xaa Leu# 60- Xaa Xaa Leu Xaa Xaa Cys Xaa Pro Xaa Xaa Th - #r Ala Xaa Pro Xaa Arg#80- Xaa Xaa Xaa Xaa Xaa Xaa Xaa Gly Asp Xaa Xa - #a Xaa Phe Xaa Xaa Lys# 95- Leu Xaa Phe Xaa Xaa Xaa Xaa Leu Glu Xaa Xa - #a Xaa Xaa Gln Gln# 110- (2) INFORMATION FOR SEQ ID NO:22:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 111 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 1#/note= "Met- or Met-Ala- may or may not prece - #de the amino acid in position 1"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 3#/note= "Xaa at position 3 is Ser, Gly, Asp, - # or Gln"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 4#/note= "Xaa at position 4 is Asn,#Ile" His, or- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 9#/note= "Xaa at position 9 is Ile, Ala, Leu, - # or Gly"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 11#/note= "Xaa at position 11 is Thr,#Gln" His, or- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 12#/note= "Xaa at position 12 is His or Ala"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 15#/note= "Xaa at position 15 is Gln or Asn"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 16#/note= "Xaa at position 16 is Pro or Gly"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 18#/note= "Xaa at position 18 is Leu, Arg, Asn, - # or Ala"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 20#/note= "Xaa at position 20 is Leu, Val, Ser, - # Ala, Arg, Gln, Glu, Ile, Phe, Thr, or Met"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 21#/note= "Xaa at position 21 is Leu, Ala, Asn, - # or Pro"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 24#/note= "Xaa at position 24 is Asn or Ala"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 28#/note= "Xaa at position 28 is Gly, Asp, Ser, - # Ala, Asn, Ile, Leu, Met, Tyr, or Arg"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 31#/note= "Xaa at position 31 is Gln, Val, Met, - # Leu, Ala, Asn, Glu, or Lys"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 32#/note= "Xaa at position 32 is Asp, Phe, Ser, - # Ala, Gln, Glu, His, Val, or Thr"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 36#/note= "Xaa at position 36 is Glu, Asn, Ser, - # or Asp"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 37#/note= "Xaa at position 37 is Asn, Arg, Pro, - # Thr, or His"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 41#/note= "Xaa at position 41 is Arg,#Gly" Leu, or- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 42#/note= "Xaa at position 42 is Pro, Gly, Ser, - # Ala, Asn, Val, Leu, or Gln"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 48#/note= "Xaa at position 48 is Asn,#Thr" Pro, or- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 50#/note= "Xaa at position 50 is Ala or Asn"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 51#/note= "Xaa at position 51 is Val or Thr"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 53#/note= "Xaa at position 53 is Ser or Phe"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 54#/note= "Xaa at position 54 is Leu or Phe"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 55#/note= "Xaa at position 55 is Gln, Ala, Glu, - # or Arg"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 62#/note= "Xaa at position 62 is Ser, Val, Asn, - # Pro, or Gly"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 63#/note= "Xaa at position 63 is Ile or Leu"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 65#/note= "Xaa at position 65 is Lys, Asn, Met, - # Arg, Ile, or Gly"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 66#/note= "Xaa at position 66 is Asn, Gly, Glu, - # or Arg"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 68#/note= "Xaa at position 68 is Leu, Gln, Trp, - # Arg, Asp, Asn, Glu, His, Met, Phe, Ser, Thr, Tyr, - # or Val"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 73#/note= "Xaa at position 73 is Leu or Ser"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 74#/note= "Xaa at position 74 is Ala or Trp"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 77#/note= "Xaa at position 77 is Ala or Pro"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 79#/note= "Xaa at position 79 is Thr,#Ala" Asp, or- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 81#/note= "Xaa at position 81 is His, Pro, Arg, - # Val, Gly, Asn, Ser, or Thr"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 84#/note= "Xaa at position 84 is His, Ile, Asn, - # Ala, Thr, Arg, Gln, Glu, Lys, Met, Ser, Tyr, - # Val, or Leu"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 85#/note= "Xaa at position 85 is Ile or Leu"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 86#/note= "Xaa at position 86 is Lys or Arg"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 87#/note= "Xaa at position 87 is Asp, Pro, Met, - # Lys, His, Pro, Asn, Ile, Leu, or Tyr"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 91#/note= "Xaa at position 91 is Asn, Pro, Ser, - # Ile, or Asp"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 94#/note= "Xaa at position 94 is Arg,#Ser" Ala, or- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 95#/note= "Xaa at position 95 is Arg, Thr, Glu, - # Leu, or Ser"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 98#/note= "Xaa at position 98 is Thr or Gln"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 102#/note= "Xaa at position 102 is Lys, Val, Trp, - # or Ile"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 103#/note= "Xaa at position 103 is Thr, Ala, His, - # Phe, Tyr, or Ser"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 106#/note= "Xaa at position 106 is Asn, Pro, Leu, - # His, Val, or Gln"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 107#/note= "Xaa at position 107 is Ala, Ser, Ile, - # Pro, or Asp"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 108#/note= "Xaa at position 108 is Gln, Met, Trp, - # Phe, Pro, His, Ile, or Tyr"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 109#/note= "Xaa at position 109 is Ala, Met, Glu, - # Ser, or Leu"- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:22:- Asn Cys Xaa Xaa Met Ile Asp Glu Xaa Ile Xa - #a Xaa Leu Lys Xaa Xaa# 15- Pro Xaa Pro Xaa Xaa Asp Phe Xaa Asn Leu As - #n Xaa Glu Asp Xaa Xaa# 30- Ile Leu Met Xaa Xaa Asn Leu Arg Xaa Xaa As - #n Leu Glu Ala Phe Xaa# 45- Arg Xaa Xaa Lys Xaa Xaa Xaa Asn Ala Ser Al - #a Ile Glu Xaa Xaa Leu# 60- Xaa Xaa Leu Xaa Pro Cys Leu Pro Xaa Xaa Th - #r Ala Xaa Pro Xaa Arg#80- Xaa Pro Ile Xaa Xaa Xaa Xaa Gly Asp Trp Xa - #a Glu Phe Xaa Xaa Lys# 95- Leu Xaa Phe Tyr Leu Xaa Xaa Leu Glu Xaa Xa - #a Xaa Xaa Gln Gln# 110- (2) INFORMATION FOR SEQ ID NO:23:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 27 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:23:# 27 AAGA CGTTGAT- (2) INFORMATION FOR SEQ ID NO:24:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 18 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:24:# 18 TT- (2) INFORMATION FOR SEQ ID NO:25:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 27 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:25:# 27 AAGA CATGGAT- (2) INFORMATION FOR SEQ ID NO:26:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 18 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:26:# 18 TT- (2) INFORMATION FOR SEQ ID NO:27:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 22 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:27:# 22AGG AT- (2) INFORMATION FOR SEQ ID NO:28:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 18 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:28:# 18 CC- (2) INFORMATION FOR SEQ ID NO:29:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 16 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:29:# 16- (2) INFORMATION FOR SEQ ID NO:30:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 24 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:30:# 24TTCA TGCA- (2) INFORMATION FOR SEQ ID NO:31:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 20 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:31:# 20 CAGA- (2) INFORMATION FOR SEQ ID NO:32:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 20 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:32:# 20 TTCG- (2) INFORMATION FOR SEQ ID NO:33:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 22 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:33:# 22ATG CA- (2) INFORMATION FOR SEQ ID NO:34:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 18 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:34:# 18 AT- (2) INFORMATION FOR SEQ ID NO:35:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 36 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:35:# 36 ACCT TCGACTTCCA AACCTG- (2) INFORMATION FOR SEQ ID NO:36:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 27 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:36:# 27 TCCA TCAGGAT- (2) INFORMATION FOR SEQ ID NO:37:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 36 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:37:# 36 ACCT TCGAACTCCA AACCTG- (2) INFORMATION FOR SEQ ID NO:38:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 27 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:38:# 27 TCCA TCAGGAT- (2) INFORMATION FOR SEQ ID NO:39:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 24 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:39:# 24CTGT CAAG- (2) INFORMATION FOR SEQ ID NO:40:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 24 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:40:# 24AGGT TTGG- (2) INFORMATION FOR SEQ ID NO:41:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 24 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:41:# 24CTGT CAAG- (2) INFORMATION FOR SEQ ID NO:42:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 24 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:42:# 24AGGT TTGG- (2) INFORMATION FOR SEQ ID NO:43:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 15 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:43:# 15- (2) INFORMATION FOR SEQ ID NO:44:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 20 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:44:# 20 CAGC- (2) INFORMATION FOR SEQ ID NO:45:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 15 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:45:# 15- (2) INFORMATION FOR SEQ ID NO:46:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 20 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:46:# 20 CAGC- (2) INFORMATION FOR SEQ ID NO:47:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 48 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:47:# 48GAGG GTGCGGCCGT GGCAGAGGGC AGACATGG- (2) INFORMATION FOR SEQ ID NO:48:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 48 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:48:# 48CCGC ACCCTCTCGA CATCCAATCA CCATCAAG- (2) INFORMATION FOR SEQ ID NO:49:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 48 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:49:# 48GAGG GTGCGGCCGT GGCAGAGGGC AGACATGG- (2) INFORMATION FOR SEQ ID NO:50:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 48 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:50:# 48CCGC ACCCTCTCGA CATCCAATCA TCATCAAG- (2) INFORMATION FOR SEQ ID NO:51:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 18 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:51:# 18 AT- (2) INFORMATION FOR SEQ ID NO:52:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 18 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:52:# 18 GT- (2) INFORMATION FOR SEQ ID NO:53:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 18 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:53:# 18 AT- (2) INFORMATION FOR SEQ ID NO:54:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 18 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:54:# 18 GT- (2) INFORMATION FOR SEQ ID NO:55:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 19 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:55:# 19 GCA- (2) INFORMATION FOR SEQ ID NO:56:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 21 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:56:#21 TTCT T- (2) INFORMATION FOR SEQ ID NO:57:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 26 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:57:# 26 CTGC CTTGAT- (2) INFORMATION FOR SEQ ID NO:58:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 16 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:58:# 16- (2) INFORMATION FOR SEQ ID NO:59:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 32 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:59:# 32 GACG TTCTATCTGG TT- (2) INFORMATION FOR SEQ ID NO:60:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 37 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:60:# 37 TAGA ACGTCAGTTT TTCCCGG- (2) INFORMATION FOR SEQ ID NO:61:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 32 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:61:# 32 AGGA ACAACAGTAA TA- (2) INFORMATION FOR SEQ ID NO:62:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 27 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:62:# 27 TCCT GCGCGTG- (2) INFORMATION FOR SEQ ID NO:63:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 32 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:63:# 32 AGGA ACAACAGTAA TA- (2) INFORMATION FOR SEQ ID NO:64:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 27 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:64:# 27 TCCT GCGCTTG- (2) INFORMATION FOR SEQ ID NO:65:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 111 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:65:- Asn Cys Ser Asn Met Ile Asp Glu Ile Ile Th - #r His Leu Lys Gln Pro# 15- Pro Leu Pro Leu Leu Asp Phe Asn Asn Leu As - #n Gly Glu Asp Gln Asp# 30- Ile Leu Met Glu Asn Asn Leu Arg Arg Pro As - #n Leu Glu Ala Phe Asn# 45- Arg Ala Val Lys Ser Leu Gln Asn Ala Ser Al - #a Ile Glu Ser Ile Leu# 60- Lys Asn Leu Leu Pro Cys Leu Pro Leu Ala Th - #r Ala Ala Pro Thr Arg#80- His Pro Ile His Ile Lys Asp Gly Asp Trp As - #n Glu Phe Arg Arg Lys# 95- Leu Thr Phe Tyr Leu Lys Thr Leu Glu Asn Al - #a Gln Ala Gln Gln# 110- (2) INFORMATION FOR SEQ ID NO:66:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 111 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:66:- Asn Cys Ser Ile Met Ile Asp Glu Ile Ile Hi - #s His Leu Lys Arg Pro# 15- Pro Ala Pro Leu Leu Asp Pro Asn Asn Leu As - #n Ala Glu Asp Val Asp# 30- Ile Leu Met Glu Asn Asn Leu Arg Arg Pro As - #n Leu Glu Ala Phe Asn# 45- Arg Ala Val Lys Ser Leu Gln Asn Ala Ser Al - #a Ile Glu Ser Ile Leu# 60- Lys Asn Leu Leu Pro Cys Leu Pro Leu Ala Th - #r Ala Ala Pro Thr Arg#80- His Pro Ile His Ile Lys Asp Gly Asp Trp As - #n Glu Phe Arg Arg Lys# 95- Leu Thr Phe Tyr Leu Lys Thr Leu Glu Asn Al - #a Gln Ala Gln Gln# 110- (2) INFORMATION FOR SEQ ID NO:67:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 111 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:67:- Asn Cys Ser Ile Met Ile Asp Glu Ile Ile Hi - #s His Leu Lys Arg Pro# 15- Pro Asn Pro Leu Leu Asp Pro Asn Asn Leu As - #n Ser Glu Asp Met Asp# 30- Ile Leu Met Glu Asn Asn Leu Arg Arg Pro As - #n Leu Glu Ala Phe Asn# 45- Arg Ala Val Lys Ser Leu Gln Asn Ala Ser Al - #a Ile Glu Ser Ile Leu# 60- Lys Asn Leu Leu Pro Cys Leu Pro Leu Ala Th - #r Ala Ala Pro Thr Arg#80- His Pro Ile His Ile Lys Asp Gly Asp Trp As - #n Glu Phe Arg Arg Lys# 95- Leu Thr Phe Tyr Leu Lys Thr Leu Glu Asn Al - #a Gln Ala Gln Gln# 110- (2) INFORMATION FOR SEQ ID NO:68:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 111 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:68:- Asn Cys Ser Ile Met Ile Asp Glu Ile Ile Hi - #s His Leu Lys Val Pro# 15- Pro Ala Pro Leu Leu Asp Ser Asn Asn Leu As - #n Ser Glu Asp Met Asp# 30- Ile Leu Met Glu Asn Asn Leu Arg Arg Pro As - #n Leu Glu Ala Phe Asn# 45- Arg Ala Val Lys Ser Leu Gln Asn Ala Ser Al - #a Ile Glu Ser Ile Leu# 60- Lys Asn Leu Leu Pro Cys Leu Pro Leu Ala Th - #r Ala Ala Pro Thr Arg#80- His Pro Ile His Ile Lys Asp Gly Asp Trp As - #n Glu Phe Arg Arg Lys# 95- Leu Thr Phe Tyr Leu Lys Thr Leu Glu Asn Al - #a Gln Ala Gln Gln# 110- (2) INFORMATION FOR SEQ ID NO:69:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 111 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:69:- Asn Cys Ser Asn Met Ile Asp Glu Ile Ile Th - #r His Leu Lys Gln Pro# 15- Pro Leu Pro Leu Leu Asp Phe Asn Asn Leu As - #n Gly Glu Asp Gln Asp# 30- Ile Leu Met Glu Arg Asn Leu Arg Leu Pro As - #n Leu Leu Ala Phe Val# 45- Arg Ala Val Lys Asn Leu Glu Asn Ala Ser Al - #a Ile Glu Ser Ile Leu# 60- Lys Asn Leu Leu Pro Cys Leu Pro Leu Ala Th - #r Ala Ala Pro Thr Arg#80- His Pro Ile His Ile Lys Asp Gly Asp Trp As - #n Glu Phe Arg Arg Lys# 95- Leu Thr Phe Tyr Leu Lys Thr Leu Glu Asn Al - #a Gln Ala Gln Gln# 110- (2) INFORMATION FOR SEQ ID NO:70:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 111 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:70:- Asn Cys Ser Asn Met Ile Asp Glu Ile Ile Th - #r His Leu Lys Gln Pro# 15- Pro Leu Pro Leu Leu Asp Phe Asn Asn Leu As - #n Gly Glu Asp Gln Asp# 30- Ile Leu Met Glu Arg Asn Leu Arg Leu Pro As - #n Leu Glu Ser Phe Val# 45- Arg Ala Val Lys Asn Leu Glu Asn Ala Ser Al - #a Ile Glu Ser Ile Leu# 60- Lys Asn Leu Leu Pro Cys Leu Pro Leu Ala Th - #r Ala Ala Pro Thr Arg#80- His Pro Ile His Ile Lys Asp Gly Asp Trp As - #n Glu Phe Arg Arg Lys# 95- Leu Thr Phe Tyr Leu Lys Thr Leu Glu Asn Al - #a Gln Ala Gln Gln# 110- (2) INFORMATION FOR SEQ ID NO:71:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 111 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:71:- Asn Cys Ser Asn Met Ile Asp Glu Ile Ile Th - #r His Leu Lys Gln Pro# 15- Pro Leu Pro Leu Leu Asp Phe Asn Asn Leu As - #n Gly Glu Asp Gln Asp# 30- Ile Leu Met Glu Arg Asn Leu Arg Thr Pro As - #n Leu Leu Ala Phe Val# 45- Arg Ala Val Lys His Leu Glu Asn Ala Ser Al - #a Ile Glu Ser Ile Leu# 60- Lys Asn Leu Leu Pro Cys Leu Pro Leu Ala Th - #r Ala Ala Pro Thr Arg#80- His Pro Ile His Ile Lys Asp Gly Asp Trp As - #n Glu Phe Arg Arg Lys# 95- Leu Thr Phe Tyr Leu Lys Thr Leu Glu Asn Al - #a Gln Ala Gln Gln# 110- (2) INFORMATION FOR SEQ ID NO:72:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 111 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:72:- Asn Cys Ser Asn Met Ile Asp Glu Ile Ile Th - #r His Leu Lys Gln Pro# 15- Pro Leu Pro Leu Leu Asp Phe Asn Asn Leu As - #n Gly Glu Asp Gln Asp# 30- Ile Leu Met Glu Asn Asn Leu Arg Arg Pro As - #n Leu Glu Ala Phe Asn# 45- Arg Ala Val Lys Ser Leu Gln Asn Ala Ser Gl - #y Ile Glu Ala Ile Leu# 60- Arg Asn Leu Gln Pro Cys Leu Pro Ser Ala Th - #r Ala Ala Pro Ser Arg#80- His Pro Ile Ile Ile Lys Ala Gly Asp Trp Gl - #n Glu Phe Arg Arg Lys# 95- Leu Thr Phe Tyr Leu Lys Thr Leu Glu Asn Al - #a Gln Ala Gln Gln# 110- (2) INFORMATION FOR SEQ ID NO:73:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 111 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:73:- Asn Cys Ser Asn Met Ile Asp Glu Ile Ile Th - #r His Leu Lys Gln Pro# 15- Pro Leu Pro Leu Leu Asp Phe Asn Asn Leu As - #n Gly Glu Asp Gln Asp# 30- Ile Leu Met Glu Asn Asn Leu Arg Arg Pro As - #n Leu Glu Ala Phe Asn# 45- Arg Ala Val Lys Ser Leu Gln Asn Ala Ser Gl - #y Ile Glu Ala Ile Leu# 60- Arg Asn Leu Val Pro Cys Leu Pro Ser Ala Th - #r Ala Ala Pro Ser Arg#80- His Pro Ile Thr Ile Lys Ala Gly Asp Trp Gl - #n Glu Phe Arg Arg Lys# 95- Leu Thr Phe Tyr Leu Lys Thr Leu Glu Asn Al - #a Gln Ala Gln Gln# 110- (2) INFORMATION FOR SEQ ID NO:74:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 111 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:74:- Asn Cys Ser Asn Met Ile Asp Glu Ile Ile Th - #r His Leu Lys Gln Pro# 15- Pro Leu Pro Leu Leu Asp Phe Asn Asn Leu As - #n Gly Glu Asp Gln Asp# 30- Ile Leu Met Glu Asn Asn Leu Arg Arg Pro As - #n Leu Glu Ala Phe Asn# 45- Arg Ala Val Lys Ser Leu Gln Asn Ala Ser Al - #a Ile Glu Ser Ile Leu# 60- Lys Asn Leu Leu Pro Cys Leu Pro Leu Ala Th - #r Ala Ala Pro Thr Arg#80- His Pro Ile His Ile Lys Asp Gly Asp Trp As - #n Glu Phe Arg Glu Lys# 95- Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln Al - #a Gln Glu Gln Gln# 110- (2) INFORMATION FOR SEQ ID NO:75:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 111 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:75:- Asn Cys Ser Asn Met Ile Asp Glu Ile Ile Th - #r His Leu Lys Gln Pro# 15- Pro Leu Pro Leu Leu Asp Phe Asn Asn Leu As - #n Gly Glu Asp Gln Asp# 30- Ile Leu Met Glu Asn Asn Leu Arg Arg Pro As - #n Leu Glu Ala Phe Asn# 45- Arg Ala Val Lys Ser Leu Gln Asn Ala Ser Al - #a Ile Glu Ser Ile Leu# 60- Lys Asn Leu Leu Pro Cys Leu Pro Leu Ala Th - #r Ala Ala Pro Thr Arg#80- His Pro Ile His Ile Lys Asp Gly Asp Trp As - #n Glu Phe Arg Glu Lys# 95- Leu Thr Phe Tyr Leu Val Ser Leu Glu His Al - #a Gln Glu Gln Gln# 110- (2) INFORMATION FOR SEQ ID NO:76:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 111 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:76:- Asn Cys Ser Asn Met Ile Asp Glu Ile Ile Th - #r His Leu Lys Gln Pro# 15- Pro Leu Pro Leu Leu Asp Phe Asn Asn Leu As - #n Gly Glu Asp Gln Asp# 30- Ile Leu Met Glu Asn Asn Leu Arg Arg Pro As - #n Leu Glu Ala Phe Asn# 45- Arg Ala Val Lys Ser Leu Gln Asn Ala Ser Gl - #y Ile Glu Ala Ile Leu# 60- Arg Asn Leu Gln Pro Cys Leu Pro Ser Ala Th - #r Ala Ala Pro Ser Arg#80- His Pro Ile Ile Ile Lys Ala Gly Asp Trp Gl - #n Glu Phe Arg Glu Lys# 95- Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln Al - #a Gln Glu Gln Gln# 110- (2) INFORMATION FOR SEQ ID NO:77:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 111 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:77:- Asn Cys Ser Asn Met Ile Asp Glu Ile Ile Th - #r His Leu Lys Gln Pro# 15- Pro Leu Pro Leu Leu Asp Phe Asn Asn Leu As - #n Gly Glu Asp Gln Asp# 30- Ile Leu Met Glu Asn Asn Leu Arg Arg Pro As - #n Leu Glu Ala Phe Asn# 45- Arg Ala Val Lys Ser Leu Gln Asn Ala Ser Gl - #y Ile Glu Ala Ile Leu# 60- Arg Asn Leu Val Pro Cys Leu Pro Ser Ala Th - #r Ala Ala Pro Ser Arg#80- His Pro Ile Thr Ile Lys Ala Gly Asp Trp Gl - #n Glu Phe Arg Glu Lys# 95- Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln Al - #a Gln Glu Gln Gln# 110- (2) INFORMATION FOR SEQ ID NO:78:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 111 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:78:- Asn Cys Ser Asn Met Ile Asp Glu Ile Ile Th - #r His Leu Lys Gln Pro# 15- Pro Leu Pro Leu Leu Asp Phe Asn Asn Leu As - #n Gly Glu Asp Gln Asp# 30- Ile Leu Met Glu Asn Asn Leu Arg Arg Pro As - #n Leu Glu Ala Phe Asn# 45- Arg Ala Val Lys Ser Leu Gln Asn Ala Ser Gl - #y Ile Glu Ala Ile Leu# 60- Arg Asn Leu Val Pro Cys Leu Pro Ser Ala Th - #r Ala Ala Pro Ser Arg#80- His Pro Ile Thr Ile Lys Ala Gly Asp Trp Gl - #n Glu Phe Arg Glu Lys# 95- Leu Thr Phe Tyr Leu Val Ser Leu Glu His Al - #a Gln Glu Gln Gln# 110- (2) INFORMATION FOR SEQ ID NO:79:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 111 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:79:- Asn Cys Ser Ile Met Ile Asp Glu Ile Ile Hi - #s His Leu Lys Arg Pro# 15- Pro Ala Pro Leu Leu Asp Pro Asn Asn Leu As - #n Ala Glu Asp Val Asp# 30- Ile Leu Met Glu Arg Asn Leu Arg Leu Pro As - #n Leu Glu Ser Phe Val# 45- Arg Ala Val Lys Asn Leu Glu Asn Ala Ser Al - #a Ile Glu Ser Ile Leu# 60- Lys Asn Leu Leu Pro Cys Leu Pro Leu Ala Th - #r Ala Ala Pro Thr Arg#80- His Pro Ile His Ile Lys Asp Gly Asp Trp As - #n Glu Phe Arg Arg Lys# 95- Leu Thr Phe Tyr Leu Lys Thr Leu Glu Asn Al - #a Gln Ala Gln Gln# 110- (2) INFORMATION FOR SEQ ID NO:80:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 111 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:80:- Asn Cys Ser Ile Met Ile Asp Glu Ile Ile Hi - #s His Leu Lys Arg Pro# 15- Pro Asn Pro Leu Leu Asp Pro Asn Asn Leu As - #n Ser Glu Asp Met Asp# 30- Ile Leu Met Glu Arg Asn Leu Arg Thr Pro As - #n Leu Leu Ala Phe Val# 45- Arg Ala Val Lys His Leu Glu Asn Ala Ser Al - #a Ile Glu Ser Ile Leu# 60- Lys Asn Leu Leu Pro Cys Leu Pro Leu Ala Th - #r Ala Ala Pro Thr Arg#80- His Pro Ile His Ile Lys Asp Gly Asp Trp As - #n Glu Phe Arg Arg Lys# 95- Leu Thr Phe Tyr Leu Lys Thr Leu Glu Asn Al - #a Gln Ala Gln Gln# 110- (2) INFORMATION FOR SEQ ID NO:81:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 111 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:81:- Asn Cys Ser Ile Met Ile Asp Glu Ile Ile Hi - #s His Leu Lys Val Pro# 15- Pro Ala Pro Leu Leu Asp Ser Asn Asn Leu As - #n Ser Glu Asp Met Asp# 30- Ile Leu Met Glu Arg Asn Leu Arg Leu Pro As - #n Leu Leu Ala Phe Val# 45- Arg Ala Val Lys Asn Leu Glu Asn Ala Ser Al - #a Ile Glu Ser Ile Leu# 60- Lys Asn Leu Leu Pro Cys Leu Pro Leu Ala Th - #r Ala Ala Pro Thr Arg#80- His Pro Ile His Ile Lys Asp Gly Asp Trp As - #n Glu Phe Arg Arg Lys# 95- Leu Thr Phe Tyr Leu Lys Thr Leu Glu Asn Al - #a Gln Ala Gln Gln# 110- (2) INFORMATION FOR SEQ ID NO:82:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 113 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:82:- Met Ala Asn Cys Ser Asn Met Ile Asp Glu Il - #e Ile Thr His Leu Lys# 15- Gln Pro Pro Leu Pro Leu Leu Asp Phe Asn As - #n Leu Asn Gly Glu Asp# 30- Gln Asp Ile Leu Met Glu Asn Asn Leu Arg Ar - #g Pro Asn Leu Glu Ala# 45- Phe Asn Arg Ala Val Lys Ser Leu Gln Asn Al - #a Ser Gly Ile Glu Ala# 60- Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Se - #r Ala Thr Ala Ala Pro#80- Ser Arg His Pro Ile Ile Ile Lys Ala Gly As - #p Trp Gln Glu Phe Arg# 95- Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Gl - #u Gln Ala Gln Glu Gln# 110- Gln- (2) INFORMATION FOR SEQ ID NO:83:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 113 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:83:- Met Ala Asn Cys Ser Asn Met Ile Asp Glu Il - #e Ile Thr His Leu Lys# 15- Gln Pro Pro Leu Pro Leu Leu Asp Phe Asn As - #n Leu Asn Gly Glu Asp# 30- Gln Asp Ile Leu Met Glu Asn Asn Leu Arg Ar - #g Pro Asn Leu Glu Ala# 45- Phe Asn Arg Ala Val Lys Ser Leu Gln Asn Al - #a Ser Gly Ile Glu Ala# 60- Ile Leu Arg Asn Leu Val Pro Cys Leu Pro Se - #r Ala Thr Ala Ala Pro#80- Ser Arg His Pro Ile Thr Ile Lys Ala Gly As - #p Trp Gln Glu Phe Arg# 95- Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Gl - #u Gln Ala Gln Glu Gln# 110- Gln- (2) INFORMATION FOR SEQ ID NO:84:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 113 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:84:- Met Ala Asn Cys Ser Asn Met Ile Asp Glu Il - #e Ile Thr His Leu Lys# 15- Gln Pro Pro Leu Pro Leu Leu Asp Phe Asn As - #n Leu Asn Gly Glu Asp# 30- Gln Asp Ile Leu Met Glu Asn Asn Leu Arg Ar - #g Pro Asn Leu Glu Ala# 45- Phe Asn Arg Ala Val Lys Ser Leu Gln Asn Al - #a Ser Gly Ile Glu Ala# 60- Ile Leu Arg Asn Leu Val Pro Cys Leu Pro Se - #r Ala Thr Ala Ala Pro#80- Ser Arg His Pro Ile Thr Ile Lys Ala Gly As - #p Trp Gln Glu Phe Arg# 95- Glu Lys Leu Thr Phe Tyr Leu Val Ser Leu Gl - #u His Ala Gln Glu Gln# 110- Gln- (2) INFORMATION FOR SEQ ID NO:85:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 113 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:85:- Met Ala Asn Cys Ser Ile Met Ile Asp Glu Il - #e Ile His His Leu Lys# 15- Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn As - #n Leu Asn Ala Glu Asp# 30- Val Asp Ile Leu Met Glu Arg Asn Leu Arg Le - #u Pro Asn Leu Glu Ser# 45- Phe Val Arg Ala Val Lys Asn Leu Glu Asn Al - #a Ser Ala Ile Glu Ser# 60- Ile Leu Lys Asn Leu Leu Pro Cys Leu Pro Le - #u Ala Thr Ala Ala Pro#80- Thr Arg His Pro Ile His Ile Lys Asp Gly As - #p Trp Asn Glu Phe Arg# 95- Arg Lys Leu Thr Phe Tyr Leu Lys Thr Leu Gl - #u Asn Ala Gln Ala Gln# 110- Gln- (2) INFORMATION FOR SEQ ID NO:86:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 113 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:86:- Met Ala Asn Cys Ser Ile Met Ile Asp Glu Il - #e Ile His His Leu Lys# 15- Arg Pro Pro Asn Pro Leu Leu Asp Pro Asn As - #n Leu Asn Ser Glu Asp# 30- Met Asp Ile Leu Met Glu Arg Asn Leu Arg Th - #r Pro Asn Leu Leu Ala# 45- Phe Val Arg Ala Val Lys His Leu Glu Asn Al - #a Ser Ala Ile Glu Ser# 60- Ile Leu Lys Asn Leu Leu Pro Cys Leu Pro Le - #u Ala Thr Ala Ala Pro#80- Thr Arg His Pro Ile His Ile Lys Asp Gly As - #p Trp Asn Glu Phe Arg# 95- Arg Lys Leu Thr Phe Tyr Leu Lys Thr Leu Gl - #u Asn Ala Gln Ala Gln# 110- Gln- (2) INFORMATION FOR SEQ ID NO:87:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 113 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:87:- Met Ala Asn Cys Ser Ile Met Ile Asp Glu Il - #e Ile His His Leu Lys# 15- Val Pro Pro Ala Pro Leu Leu Asp Ser Asn As - #n Leu Asn Ser Glu Asp# 30- Met Asp Ile Leu Met Glu Arg Asn Leu Arg Le - #u Pro Asn Leu Leu Ala# 45- Phe Val Arg Ala Val Lys Asn Leu Glu Asn Al - #a Ser Ala Ile Glu Ser# 60- Ile Leu Lys Asn Leu Leu Pro Cys Leu Pro Le - #u Ala Thr Ala Ala Pro#80- Thr Arg His Pro Ile His Ile Lys Asp Gly As - #p Trp Asn Glu Phe Arg# 95- Arg Lys Leu Thr Phe Tyr Leu Lys Thr Leu Gl - #u Asn Ala Gln Ala Gln# 110- Gln- (2) INFORMATION FOR SEQ ID NO:88:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 113 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:88:- Met Ala Asn Cys Ser Ile Met Ile Asp Glu Il - #e Ile His His Leu Lys# 15- Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn As - #n Leu Asn Ala Glu Asp# 30- Val Asp Ile Leu Met Glu Arg Asn Leu Arg Le - #u Pro Asn Leu Glu Ser# 45- Phe Val Arg Ala Val Lys Asn Leu Glu Asn Al - #a Ser Gly Ile Glu Ala# 60- Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Se - #r Ala Thr Ala Ala Pro#80- Ser Arg His Pro Ile Ile Ile Lys Ala Gly As - #p Trp Gln Glu Phe Arg# 95- Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Gl - #u Gln Ala Gln Glu Gln# 110- Gln- (2) INFORMATION FOR SEQ ID NO:89:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 113 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:89:- Met Ala Asn Cys Ser Ile Met Ile Asp Glu Il - #e Ile His His Leu Lys# 15- Arg Pro Pro Asn Pro Leu Leu Asp Pro Asn As - #n Leu Asn Ser Glu Asp# 30- Met Asp Ile Leu Met Glu Arg Asn Leu Arg Th - #r Pro Asn Leu Leu Ala# 45- Phe Val Arg Ala Val Lys His Leu Glu Asn Al - #a Ser Gly Ile Glu Ala# 60- Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Se - #r Ala Thr Ala Ala Pro#80- Ser Arg His Pro Ile Ile Ile Lys Ala Gly As - #p Trp Gln Glu Phe Arg# 95- Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Gl - #u Gln Ala Gln Glu Gln# 110- Gln- (2) INFORMATION FOR SEQ ID NO:90:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 113 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:90:- Met Ala Asn Cys Ser Ile Met Ile Asp Glu Il - #e Ile His His Leu Lys# 15- Val Pro Pro Ala Pro Leu Leu Asp Ser Asn As - #n Leu Asn Ser Glu Asp# 30- Met Asp Ile Leu Met Glu Arg Asn Leu Arg Le - #u Pro Asn Leu Leu Ala# 45- Phe Val Arg Ala Val Lys Asn Leu Glu Asn Al - #a Ser Gly Ile Glu Ala# 60- Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Se - #r Ala Thr Ala Ala Pro#80- Ser Arg His Pro Ile Ile Ile Lys Ala Gly As - #p Trp Gln Glu Phe Arg# 95- Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Gl - #u Gln Ala Gln Glu Gln# 110- Gln- (2) INFORMATION FOR SEQ ID NO:91:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 113 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:91:- Met Ala Asn Cys Ser Ile Met Ile Asp Glu Il - #e Ile His His Leu Lys# 15- Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn As - #n Leu Asn Ala Glu Asp# 30- Val Asp Ile Leu Met Glu Arg Asn Leu Arg Le - #u Pro Asn Leu Glu Ser# 45- Phe Val Arg Ala Val Lys Asn Leu Glu Asn Al - #a Ser Gly Ile Glu Ala# 60- Ile Leu Arg Asn Leu Val Pro Cys Leu Pro Se - #r Ala Thr Ala Ala Pro#80- Ser Arg His Pro Ile Thr Ile Lys Ala Gly As - #p Trp Gln Glu Phe Arg# 95- Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Gl - #u Gln Ala Gln Glu Gln# 110- Gln- (2) INFORMATION FOR SEQ ID NO:92:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 113 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:92:- Met Ala Asn Cys Ser Ile Met Ile Asp Glu Il - #e Ile His His Leu Lys# 15- Val Pro Pro Ala Pro Leu Leu Asp Ser Asn As - #n Leu Asn Ser Glu Asp# 30- Met Asp Ile Leu Met Glu Arg Asn Leu Arg Le - #u Pro Asn Leu Leu Ala# 45- Phe Val Arg Ala Val Lys Asn Leu Glu Asn Al - #a Ser Gly Ile Glu Ala# 60- Ile Leu Arg Asn Leu Val Pro Cys Leu Pro Se - #r Ala Thr Ala Ala Pro#80- Ser Arg His Pro Ile Thr Ile Lys Ala Gly As - #p Trp Gln Glu Phe Arg# 95- Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Gl - #u Gln Ala Gln Glu Gln# 110- Gln- (2) INFORMATION FOR SEQ ID NO:93:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 113 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:93:- Met Ala Asn Cys Ser Ile Met Ile Asp Glu Il - #e Ile His His Leu Lys# 15- Arg Pro Pro Asn Pro Leu Leu Asp Pro Asn As - #n Leu Asn Ser Glu Asp# 30- Met Asp Ile Leu Met Glu Arg Asn Leu Arg Th - #r Pro Asn Leu Leu Ala# 45- Phe Val Arg Ala Val Lys His Leu Glu Asn Al - #a Ser Gly Ile Glu Ala# 60- Ile Leu Arg Asn Leu Val Pro Cys Leu Pro Se - #r Ala Thr Ala Ala Pro#80- Ser Arg His Pro Ile Thr Ile Lys Ala Gly As - #p Trp Gln Glu Phe Arg# 95- Glu Lys Leu Thr Phe Tyr Leu Val Ser Leu Gl - #u His Ala Gln Glu Gln# 110- Gln- (2) INFORMATION FOR SEQ ID NO:94:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 113 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:94:- Met Ala Asn Cys Ser Ile Met Ile Asp Glu Il - #e Ile His His Leu Lys# 15- Val Pro Pro Ala Pro Leu Leu Asp Ser Asn As - #n Leu Asn Ser Glu Asp# 30- Met Asp Ile Leu Met Glu Arg Asn Leu Arg Le - #u Pro Asn Leu Leu Ala# 45- Phe Val Arg Ala Val Lys Asn Leu Glu Asn Al - #a Ser Gly Ile Glu Ala# 60- Ile Leu Arg Asn Leu Val Pro Cys Leu Pro Se - #r Ala Thr Ala Ala Pro#80- Ser Arg His Pro Ile Thr Ile Lys Ala Gly As - #p Trp Gln Glu Phe Arg# 95- Glu Lys Leu Thr Phe Tyr Leu Val Ser Leu Gl - #u His Ala Gln Glu Gln# 110- Gln- (2) INFORMATION FOR SEQ ID NO:95:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 113 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:95:- Met Ala Asn Cys Ser Ile Met Ile Asp Glu Il - #e Ile His His Leu Lys# 15- Arg Pro Pro Asn Pro Leu Leu Asp Pro Asn As - #n Leu Asn Ser Glu Asp# 30- Met Asp Ile Leu Met Glu Arg Asn Leu Arg Th - #r Pro Asn Leu Leu Ala# 45- Phe Val Arg Ala Val Lys His Leu Glu Asn Al - #a Ser Gly Ile Glu Ala# 60- Ile Leu Arg Asn Leu Val Pro Cys Leu Pro Se - #r Ala Thr Ala Ala Pro#80- Ser Arg His Pro Ile Thr Ile Lys Ala Gly As - #p Trp Gln Glu Phe Arg# 95- Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Gl - #u Gln Ala Gln Glu Gln# 110- Gln- (2) INFORMATION FOR SEQ ID NO:96:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 113 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:96:- Met Ala Asn Cys Ser Ile Met Ile Asp Glu Il - #e Ile His His Leu Lys# 15- Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn As - #n Leu Asn Ala Glu Asp# 30- Val Asp Ile Leu Met Glu Arg Asn Leu Arg Le - #u Pro Asn Leu Glu Ser# 45- Phe Val Arg Ala Val Lys Asn Leu Glu Asn Al - #a Ser Gly Ile Glu Ala# 60- Ile Leu Arg Asn Leu Val Pro Cys Leu Pro Se - #r Ala Thr Ala Ala Pro#80- Ser Arg His Pro Ile Thr Ile Lys Ala Gly As - #p Trp Gln Glu Phe Arg# 95- Glu Lys Leu Thr Phe Tyr Leu Val Ser Leu Gl - #u His Ala Gln Glu Gln# 110- Gln- (2) INFORMATION FOR SEQ ID NO:97:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 339 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:97:- ATGGCTAACT GCTCTATAAT GATCGATGAA ATTATACATC ACTTAAAGAG AC - #CACCTGCA 60- CCTTTGCTGG ACCCGAACAA CCTCAATGCT GAAGACGTCG ATATCCTGAT GG - #AACGAAAC 120- CTTCGACTTC CAAACCTGGA GAGCTTCGTA AGGGCTGTCA AGAACTTAGA AA - #ATGCATCA 180- GGTATTGAGG CAATTCTTCG TAATCTCCAA CCATGTCTGC CCTCTGCCAC GG - #CCGCACCC 240- TCTCGACATC CAATCATCAT CAAGGCAGGT GACTGGCAAG AATTCCGGGA AA - #AACTGACG 300# 339 TTGA GCAAGCGCAG GAACAACAG- (2) INFORMATION FOR SEQ ID NO:98:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 339 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:98:- ATGGCTAACT GCTCTATAAT GATCGATGAA ATTATACATC ACTTAAAGAG AC - #CACCTGCA 60- CCTTTGCTGG ACCCGAACAA CCTCAATGCT GAAGACGTCG ATATCCTGAT GG - #AACGAAAC 120- CTTCGACTTC CAAACCTGGA GAGCTTCGTA AGGGCTGTCA AGAACTTAGA AA - #ATGCATCA 180- GGTATTGAGG CAATTCTTCG TAATCTCGTA CCATGTCTGC CCTCTGCCAC GG - #CCGCACCC 240- TCTCGACATC CAATCACCAT CAAGGCAGGT GACTGGCAAG AATTCCGGGA AA - #AACTGACG 300# 339 TTGA GCAAGCGCAG GAACAACAG- (2) INFORMATION FOR SEQ ID NO:99:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 339 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:99:- ATGGCTAACT GCTCTATAAT GATCGATGAA ATTATACATC ACTTAAAGAG AC - #CACCTGCA 60- CCTTTGCTGG ACCCGAACAA CCTCAATGCT GAAGACGTCG ATATCCTGAT GG - #AACGAAAC 120- CTTCGACTTC CAAACCTGGA GAGCTTCGTA AGGGCTGTCA AGAACTTAGA AA - #ATGCATCA 180- GGTATTGAGG CAATTCTTCG TAATCTCGTA CCATGTCTGC CCTCTGCCAC GG - #CCGCACCC 240- TCTCGACATC CAATCACCAT CAAGGCAGGT GACTGGCAAG AATTCCGGGA AA - #AACTGACG 300# 339 TTGA GCACGCGCAG GAACAACAG- (2) INFORMATION FOR SEQ ID NO:100:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 339 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:100:- ATGGCTAACT GCTCTATAAT GATCGATGAA ATTATACATC ACTTAAAGAG AC - #CACCTAAC 60- CCTTTGCTGG ACCCGAACAA CCTCAATTCT GAAGACATGG ATATCCTGAT GG - #AACGAAAC 120- CTTCGAACTC CAAACCTGCT CGCATTCGTA AGGGCTGTCA AGCACTTAGA AA - #ATGCATCA 180- GGTATTGAGG CAATTCTTCG TAATCTCCAA CCATGTCTGC CCTCTGCCAC GG - #CCGCACCC 240- TCTCGACATC CAATCATCAT CAAGGCAGGT GACTGGCAAG AATTCCGGGA AA - #AACTGACG 300# 339 TTGA GCAAGCGCAG GAACAACAG- (2) INFORMATION FOR SEQ ID NO:101:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 339 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:101:- ATGGCTAACT GCTCTATAAT GATCGATGAA ATTATACATC ACTTAAAGAG AC - #CACCTAAC 60- CCTTTGCTGG ACCCGAACAA CCTCAATTCT GAAGACATGG ATATCCTGAT GG - #AACGAAAC 120- CTTCGAACTC CAAACCTGCT CGCATTCGTA AGGGCTGTCA AGCACTTAGA AA - #ATGCATCA 180- GGTATTGAGG CAATTCTTCG TAATCTCGTA CCATGTCTGC CCTCTGCCAC GG - #CCGCACCC 240- TCTCGACATC CAATCACCAT CAAGGCAGGT GACTGGCAAG AATTCCGGGA AA - #AACTGACG 300# 339 TTGA GCAAGCGCAG GAACAACAG- (2) INFORMATION FOR SEQ ID NO:102:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 339 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:102:- ATGGCTAACT GCTCTATAAT GATCGATGAA ATTATACATC ACTTAAAGAG AC - #CACCTAAC 60- CCTTTGCTGG ACCCGAACAA CCTCAATTCT GAAGACATGG ATATCCTGAT GG - #AACGAAAC 120- CTTCGAACTC CAAACCTGCT CGCATTCGTA AGGGCTGTCA AGCACTTAGA AA - #ATGCATCA 180- GGTATTGAGG CAATTCTTCG TAATCTCGTA CCATGTCTGC CCTCTGCCAC GG - #CCGCACCC 240- TCTCGACATC CAATCACCAT CAAGGCAGGT GACTGGCAAG AATTCCGGGA AA - #AACTGACG 300# 339 TTGA GCACGCGCAG GAACAACAG- (2) INFORMATION FOR SEQ ID NO:103:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 339 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:103:- ATGGCTAACT GCTCTATAAT GATCGATGAA ATTATACATC ACTTAAAGGT TC - #CACCTGCA 60- CCTTTGCTGG ACAGTAACAA CCTCAATTCC GAAGACATGG ATATCCTGAT GG - #AACGAAAC 120- CTTCGACTTC CAAACCTGCT CGCATTCGTA AGGGCTGTCA AGAACTTAGA AA - #ATGCATCA 180- GGTATTGAGG CAATTCTTCG TAATCTCCAA CCATGTCTGC CCTCTGCCAC GG - #CCGCACCC 240- TCTCGACATC CAATCATCAT CAAGGCAGGT GACTGGCAAG AATTCCGGGA AA - #AACTGACG 300# 339 TTGA GCAAGCGCAG GAACAACAG- (2) INFORMATION FOR SEQ ID NO:104:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 339 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:104:- ATGGCTAACT GCTCTATAAT GATCGATGAA ATTATACATC ACTTAAAGGT TC - #CACCTGCA 60- CCTTTGCTGG ACAGTAACAA CCTCAATTCC GAAGACATGG ATATCCTGAT GG - #AACGAAAC 120- CTTCGACTTC CAAACCTGCT CGCATTCGTA AGGGCTGTCA AGAACTTAGA AA - #ATGCATCA 180- GGTATTGAGG CAATTCTTCG TAATCTCGTA CCATGTCTGC CCTCTGCCAC GG - #CCGCACCC 240- TCTCGACATC CAATCACCAT CAAGGCAGGT GACTGGCAAG AATTCCGGGA AA - #AACTGACG 300# 339 TTGA GCAAGCGCAG GAACAACAG- (2) INFORMATION FOR SEQ ID NO:105:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 339 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:105:- ATGGCTAACT GCTCTATAAT GATCGATGAA ATTATACATC ACTTAAAGGT TC - #CACCTGCA 60- CCTTTGCTGG ACAGTAACAA CCTCAATTCC GAAGACATGG ATATCCTGAT GG - #AACGAAAC 120- CTTCGACTTC CAAACCTGCT CGCATTCGTA AGGGCTGTCA AGAACTTAGA AA - #ATGCATCA 180- GGTATTGAGG CAATTCTTCG TAATCTCGTA CCATGTCTGC CCTCTGCCAC GG - #CCGCACCC 240- TCTCGACATC CAATCACCAT CAAGGCAGGT GACTGGCAAG AATTCCGGGA AA - #AACTGACG 300# 339 TTGA GCACGCGCAG GAACAACAG- (2) INFORMATION FOR SEQ ID NO:106:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 333 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:106:- AACTGCTCTA TAATGATCGA TGAAATTATA CATCACTTAA AGAGACCACC TG - #CACCTTTG 60- CTGGACCCGA ACAACCTCAA TGCTGAAGAC GTCGATATCC TGATGGAAAA TA - #ACCTTCGT 120- CGTCCAAACC TCGAGGCATT CAACCGTGCT GTCAAGTCTC TGCAGAATGC AT - #CAGCAATT 180- GAGAGCATTC TTAAAAATCT CCTGCCATGT CTGCCCCTGG CCACGGCCGC AC - #CCACGCGA 240- CATCCAATCC ATATCAAGGA CGGTGACTGG AATGAATTCC GTCGTAAACT GA - #CCTTCTAT 300# 333 ACGC GCAGGCTCAA CAG- (2) INFORMATION FOR SEQ ID NO:107:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 333 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:107:- AACTGCTCTA TAATGATCGA TGAAATTATA CATCACTTAA AGAGACCACC TA - #ACCCTTTG 60- CTGGACCCGA ACAACCTCAA TTCTGAAGAC ATGGATATCC TGATGGAAAA TA - #ACCTTCGT 120- CGTCCAAACC TCGAGGCATT CAACCGTGCT GTCAAGTCTC TGCAGAATGC AT - #CAGCAATT 180- GAGAGCATTC TTAAAAATCT CCTGCCATGT CTGCCCCTGG CCACGGCCGC AC - #CCACGCGA 240- CATCCAATCC ATATCAAGGA CGGTGACTGG AATGAATTCC GTCGTAAACT GA - #CCTTCTAT 300# 333 ACGC GCAGGCTCAA CAG- (2) INFORMATION FOR SEQ ID NO:108:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 333 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:108:- AACTGCTCTA TAATGATCGA TGAAATTATA CATCACTTAA AGGTTCCACC TG - #CACCTTTG 60- CTGGACAGTA ACAACCTCAA TTCCGAAGAC ATGGATATCC TGATGGAAAA TA - #ACCTTCGT 120- CGTCCAAACC TCGAGGCATT CAACCGTGCT GTCAAGTCTC TGCAGAATGC AT - #CAGCAATT 180- GAGAGCATTC TTAAAAATCT CCTGCCATGT CTGCCCCTGG CCACGGCCGC AC - #CCACGCGA 240- CATCCAATCC ATATCAAGGA CGGTGACTGG AATGAATTCC GTCGTAAACT GA - #CCTTCTAT 300# 333 ACGC GCAGGCTCAA CAG- (2) INFORMATION FOR SEQ ID NO:109:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 333 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:109:- AACTGCTCTA ACATGATCGA TGAAATCATC ACCCACCTGA AGCAGCCACC GC - #TGCCGCTG 60- CTGGACTTCA ACAACCTCAA TGGTGAAGAC CAAGATATCC TGATGGAACG AA - #ACCTTCGA 120- CTTCCAAACC TGCTCGCATT CGTAAGGGCT GTCAAGAACT TAGAAAATGC AT - #CAGCAATT 180- GAGAGCATTC TTAAAAATCT CCTGCCATGT CTGCCCCTGG CCACGGCCGC AC - #CCACGCGA 240- CATCCAATCC ATATCAAGGA CGGTGACTGG AATGAATTCC GTCGTAAACT GA - #CCTTCTAT 300# 333 ACGC GCAGGCTCAA CAG- (2) INFORMATION FOR SEQ ID NO:110:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 333 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:110:- AACTGCTCTA ACATGATCGA TGAAATCATC ACCCACCTGA AGCAGCCACC GC - #TGCCGCTG 60- CTGGACTTCA ACAACCTCAA TGGTGAAGAC CAAGATATCC TGATGGAACG AA - #ACCTTCGA 120- CTTCCAAACC TGGAGAGCTT CGTAAGGGCT GTCAAGAACT TAGAAAATGC AT - #CAGCAATT 180- GAGAGCATTC TTAAAAATCT CCTGCCATGT CTGCCCCTGG CCACGGCCGC AC - #CCACGCGA 240- CATCCAATCC ATATCAAGGA CGGTGACTGG AATGAATTCC GTCGTAAACT GA - #CCTTCTAT 300# 333 ACGC GCAGGCTCAA CAG- (2) INFORMATION FOR SEQ ID NO:111:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 333 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:111:- AACTGCTCTA ACATGATCGA TGAAATCATC ACCCACCTGA AGCAGCCACC GC - #TGCCGCTG 60- CTGGACTTCA ACAACCTCAA TGGTGAAGAC CAAGATATCC TGATGGAACG AA - #ACCTTCGA 120- ACTCCAAACC TGCTCGCATT CGTAAGGGCT GTCAAGCACT TAGAAAATGC AT - #CAGCAATT 180- GAGAGCATTC TTAAAAATCT CCTGCCATGT CTGCCCCTGG CCACGGCCGC AC - #CCACGCGA 240- CATCCAATCC ATATCAAGGA CGGTGACTGG AATGAATTCC GTCGTAAACT GA - #CCTTCTAT 300# 333 ACGC GCAGGCTCAA CAG- (2) INFORMATION FOR SEQ ID NO:112:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 333 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:112:- AACTGCTCTA ACATGATCGA TGAAATCATC ACCCACCTGA AGCAGCCACC GC - #TGCCGCTG 60- CTGGACTTCA ACAACCTCAA TGGTGAAGAC CAAGATATCC TGATGGAAAA TA - #ACCTTCGT 120- CGTCCAAACC TCGAGGCATT CAACCGTGCT GTCAAGTCTC TGCAGAATGC AT - #CAGGTATT 180- GAGGCAATTC TTCGTAATCT CCAACCATGT CTGCCCTCTG CCACGGCCGC AC - #CCTCTCGA 240- CATCCAATCA TCATCAAGGC AGGTGACTGG CAAGAATTCC GTCGTAAACT GA - #CCTTCTAT 300# 333 ACGC GCAGGCTCAA CAG- (2) INFORMATION FOR SEQ ID NO:113:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 333 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:113:- AACTGCTCTA ACATGATCGA TGAAATCATC ACCCACCTGA AGCAGCCACC GC - #TGCCGCTG 60- CTGGACTTCA ACAACCTCAA TGGTGAAGAC CAAGATATCC TGATGGAAAA TA - #ACCTTCGT 120- CGTCCAAACC TCGAGGCATT CAACCGTGCT GTCAAGTCTC TGCAGAATGC AT - #CAGGTATT 180- GAGGCAATTC TTCGTAATCT CGTACCATGT CTGCCCTCTG CCACGGCCGC AC - #CCTCTCGA 240- CATCCAATCA CCATCAAGGC AGGTGACTGG CAAGAATTCC GTCGTAAACT GA - #CCTTCTAT 300# 333 ACGC GCAGGCTCAA CAG- (2) INFORMATION FOR SEQ ID NO:114:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 333 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:114:- AACTGCTCTA ACATGATCGA TGAAATCATC ACCCACCTGA AGCAGCCACC GC - #TGCCGCTG 60- CTGGACTTCA ACAACCTCAA TGGTGAAGAC CAAGATATCC TGATGGAAAA TA - #ACCTTCGT 120- CGTCCAAACC TCGAGGCATT CAACCGTGCT GTCAAGTCTC TGCAGAATGC AT - #CAGCAATT 180- GAGAGCATTC TTAAAAATCT CCTGCCATGT CTGCCCCTGG CCACGGCCGC AC - #CCACGCGA 240- CATCCAATCC ATATCAAGGA CGGTGACTGG AATGAATTCC GGGAAAAACT GA - #CGTTCTAT 300# 333 AAGC GCAGGAACAA CAG- (2) INFORMATION FOR SEQ ID NO:115:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 333 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:115:- AACTGCTCTA ACATGATCGA TGAAATCATC ACCCACCTGA AGCAGCCACC GC - #TGCCGCTG 60- CTGGACTTCA ACAACCTCAA TGGTGAAGAC CAAGATATCC TGATGGAAAA TA - #ACCTTCGT 120- CGTCCAAACC TCGAGGCATT CAACCGTGCT GTCAAGTCTC TGCAGAATGC AT - #CAGCAATT 180- GAGAGCATTC TTAAAAATCT CCTGCCATGT CTGCCCCTGG CCACGGCCGC AC - #CCACGCGA 240- CATCCAATCC ATATCAAGGA CGGTGACTGG AATGAATTCC GGGAAAAACT GA - #CGTTCTAT 300# 333 ACGC GCAGGAACAA CAG- (2) INFORMATION FOR SEQ ID NO:116:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 333 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:116:- AACTGCTCTA TAATGATCGA TGAAATTATA CATCACTTAA AGAGACCACC TG - #CACCTTTG 60- CTGGACCCGA ACAACCTCAA TGCTGAAGAC GTCGATATCC TGATGGAACG AA - #ACCTTCGA 120- CTTCCAAACC TGGAGAGCTT CGTAAGGGCT GTCAAGAACT TAGAAAATGC AT - #CAGCAATT 180- GAGAGCATTC TTAAAAATCT CCTGCCATGT CTGCCCCTGG CCACGGCCGC AC - #CCACGCGA 240- CATCCAATCC ATATCAAGGA CGGTGACTGG AATGAATTCC GTCGTAAACT GA - #CCTTCTAT 300# 333 ACGC GCAGGCTCAA CAG- (2) INFORMATION FOR SEQ ID NO:117:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 333 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:117:- AACTGCTCTA TAATGATCGA TGAAATTATA CATCACTTAA AGAGACCACC TA - #ACCCTTTG 60- CTGGACCCGA ACAACCTCAA TTCTGAAGAC ATGGATATCC TGATGGAACG AA - #ACCTTCGA 120- ACTCCAAACC TGCTCGCATT CGTAAGGGCT GTCAAGCACT TAGAAAATGC AT - #CAGCAATT 180- GAGAGCATTC TTAAAAATCT CCTGCCATGT CTGCCCCTGG CCACGGCCGC AC - #CCACGCGA 240- CATCCAATCC ATATCAAGGA CGGTGACTGG AATGAATTCC GTCGTAAACT GA - #CCTTCTAT 300# 333 ACGC GCAGGCTCAA CAG- (2) INFORMATION FOR SEQ ID NO:118:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 333 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:118:- AACTGCTCTA TAATGATCGA TGAAATTATA CATCACTTAA AGGTTCCACC TG - #CACCTTTG 60- CTGGACAGTA ACAACCTCAA TTCCGAAGAC ATGGATATCC TGATGGAACG AA - #ACCTTCGA 120- CTTCCAAACC TGCTCGCATT CGTAAGGGCT GTCAAGAACT TAGAAAATGC AT - #CAGCAATT 180- GAGAGCATTC TTAAAAATCT CCTGCCATGT CTGCCCCTGG CCACGGCCGC AC - #CCACGCGA 240- CATCCAATCC ATATCAAGGA CGGTGACTGG AATGAATTCC GTCGTAAACT GA - #CCTTCTAT 300# 333 ACGC GCAGGCTCAA CAG- (2) INFORMATION FOR SEQ ID NO:119:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 333 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:119:- AACTGCTCTA ACATGATCGA TGAAATCATC ACCCACCTGA AGCAGCCACC GC - #TGCCGCTG 60- CTGGACTTCA ACAACCTCAA TGGTGAAGAC CAAGATATCC TGATGGAAAA TA - #ACCTTCGT 120- CGTCCAAACC TCGAGGCATT CAACCGTGCT GTCAAGTCTC TGCAGAATGC AT - #CAGGTATT 180- GAGGCAATTC TTCGTAATCT CCAACCATGT CTGCCCTCTG CCACGGCCGC AC - #CCTCTCGA 240- CATCCAATCA TCATCAAGGC AGGTGACTGG CAAGAATTCC GGGAAAAACT GA - #CGTTCTAT 300# 333 AAGC GCAGGAACAA CAG- (2) INFORMATION FOR SEQ ID NO:120:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 333 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:120:- AACTGCTCTA ACATGATCGA TGAAATCATC ACCCACCTGA AGCAGCCACC GC - #TGCCGCTG 60- CTGGACTTCA ACAACCTCAA TGGTGAAGAC CAAGATATCC TGATGGAAAA TA - #ACCTTCGT 120- CGTCCAAACC TCGAGGCATT CAACCGTGCT GTCAAGTCTC TGCAGAATGC AT - #CAGGTATT 180- GAGGCAATTC TTCGTAATCT CGTACCATGT CTGCCCTCTG CCACGGCCGC AC - #CCTCTCGA 240- CATCCAATCA CCATCAAGGC AGGTGACTGG CAAGAATTCC GGGAAAAACT GA - #CGTTCTAT 300# 333 AAGC GCAGGAACAA CAG- (2) INFORMATION FOR SEQ ID NO:121:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 333 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:121:- AACTGCTCTA ACATGATCGA TGAAATCATC ACCCACCTGA AGCAGCCACC GC - #TGCCGCTG 60- CTGGACTTCA ACAACCTCAA TGGTGAAGAC CAAGATATCC TGATGGAAAA TA - #ACCTTCGT 120- CGTCCAAACC TCGAGGCATT CAACCGTGCT GTCAAGTCTC TGCAGAATGC AT - #CAGGTATT 180- GAGGCAATTC TTCGTAATCT CGTACCATGT CTGCCCTCTG CCACGGCCGC AC - #CCTCTCGA 240- CATCCAATCA CCATCAAGGC AGGTGACTGG CAAGAATTCC GGGAAAAACT GA - #CGTTCTAT 300# 333 ACGC GCAGGAACAA CAG- (2) INFORMATION FOR SEQ ID NO:122:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 339 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:122:- ATGGCTAACT GCTCTATAAT GATCGATGAA ATTATACATC ACTTAAAGAG AC - #CACCTGCA 60- CCTTTGCTGG ACCCGAACAA CCTCAATGCT GAAGACGTCG ATATCCTGAT GG - #AACGAAAC 120- CTTCGACTTC CAAACCTGGA GAGCTTCGTA AGGGCTGTCA AGAACTTAGA AA - #ATGCATCA 180- GCAATTGAGA GCATTCTTAA AAATCTCCTG CCATGTCTGC CCCTGGCCAC GG - #CCGCACCC 240- ACGCGACATC CAATCCATAT CAAGGACGGT GACTGGAATG AATTCCGTCG TA - #AACTGACC 300# 339 TGGA GAACGCGCAG GCTCAACAG- (2) INFORMATION FOR SEQ ID NO:123:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 339 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:123:- ATGGCTAACT GCTCTATAAT GATCGATGAA ATTATACATC ACTTAAAGAG AC - #CACCTAAC 60- CCTTTGCTGG ACCCGAACAA CCTCAATTCT GAAGACATGG ATATCCTGAT GG - #AACGAAAC 120- CTTCGAACTC CAAACCTGCT CGCATTCGTA AGGGCTGTCA AGCACTTAGA AA - #ATGCATCA 180- GCAATTGAGA GCATTCTTAA AAATCTCCTG CCATGTCTGC CCCTGGCCAC GG - #CCGCACCC 240- ACGCGACATC CAATCCATAT CAAGGACGGT GACTGGAATG AATTCCGTCG TA - #AACTGACC 300# 339 TGGA GAACGCGCAG GCTCAACAG- (2) INFORMATION FOR SEQ ID NO:124:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 339 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:124:- ATGGCTAACT GCTCTATAAT GATCGATGAA ATTATACATC ACTTAAAGGT TC - #CACCTGCA 60- CCTTTGCTGG ACAGTAACAA CCTCAATTCC GAAGACATGG ATATCCTGAT GG - #AACGAAAC 120- CTTCGACTTC CAAACCTGCT CGCATTCGTA AGGGCTGTCA AGAACTTAGA AA - #ATGCATCA 180- GCAATTGAGA GCATTCTTAA AAATCTCCTG CCATGTCTGC CCCTGGCCAC GG - #CCGCACCC 240- ACGCGACATC CAATCCATAT CAAGGACGGT GACTGGAATG AATTCCGTCG TA - #AACTGACC 300# 339 TGGA GAACGCGCAG GCTCAACAG- (2) INFORMATION FOR SEQ ID NO:125:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 339 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:125:- ATGGCTAACT GCTCTAACAT GATCGATGAA ATCATCACCC ACCTGAAGCA GC - #CACCGCTG 60- CCGCTGCTGG ACTTCAACAA CCTCAATGGT GAAGACCAAG ATATCCTGAT GG - #AAAATAAC 120- CTTCGTCGTC CAAACCTCGA GGCATTCAAC CGTGCTGTCA AGTCTCTGCA GA - #ATGCATCA 180- GGTATTGAGG CAATTCTTCG TAATCTCCAA CCATGTCTGC CCTCTGCCAC GG - #CCGCACCC 240- TCTCGACATC CAATCATCAT CAAGGCAGGT GACTGGCAAG AATTCCGGGA AA - #AACTGACG 300# 339 TTGA GCAAGCGCAG GAACAACAG- (2) INFORMATION FOR SEQ ID NO:126:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 339 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:126:- ATGGCTAACT GCTCTAACAT GATCGATGAA ATCATCACCC ACCTGAAGCA GC - #CACCGCTG 60- CCGCTGCTGG ACTTCAACAA CCTCAATGGT GAAGACCAAG ATATCCTGAT GG - #AAAATAAC 120- CTTCGTCGTC CAAACCTCGA GGCATTCAAC CGTGCTGTCA AGTCTCTGCA GA - #ATGCATCA 180- GGTATTGAGG CAATTCTTCG TAATCTCGTA CCATGTCTGC CCTCTGCCAC GG - #CCGCACCC 240- TCTCGACATC CAATCACCAT CAAGGCAGGT GACTGGCAAG AATTCCGGGA AA - #AACTGACG 300# 339 TTGA GCAAGCGCAG GAACAACAG- (2) INFORMATION FOR SEQ ID NO:127:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 339 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:127:- ATGGCTAACT GCTCTAACAT GATCGATGAA ATCATCACCC ACCTGAAGCA GC - #CACCGCTG 60- CCGCTGCTGG ACTTCAACAA CCTCAATGGT GAAGACCAAG ATATCCTGAT GG - #AAAATAAC 120- CTTCGTCGTC CAAACCTCGA GGCATTCAAC CGTGCTGTCA AGTCTCTGCA GA - #ATGCATCA 180- GGTATTGAGG CAATTCTTCG TAATCTCGTA CCATGTCTGC CCTCTGCCAC GG - #CCGCACCC 240- TCTCGACATC CAATCACCAT CAAGGCAGGT GACTGGCAAG AATTCCGGGA AA - #AACTGACG 300# 339 TTGA GCACGCGCAG GAACAACAG- (2) INFORMATION FOR SEQ ID NO:128:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 134 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:128:- Met Ala Pro Met Thr Gln Thr Thr Ser Leu Ly - #s Thr Ser Trp Val Asn# 15- Cys Ser Asn Met Ile Asp Glu Ile Ile Thr Hi - #s Leu Lys Gln Pro Pro# 30- Leu Pro Leu Leu Asp Phe Asn Asn Leu Asn Gl - #y Glu Asp Gln Asp Ile# 45- Leu Met Glu Asn Asn Leu Arg Arg Pro Asn Le - #u Glu Ala Phe Asn Arg# 60- Ala Val Lys Ser Leu Gln Asn Ala Ser Ala Il - #e Glu Ser Ile Leu Lys#80- Asn Leu Leu Pro Cys Leu Pro Leu Ala Thr Al - #a Ala Pro Thr Arg His# 95- Pro Ile His Ile Lys Asp Gly Asp Trp Asn Gl - #u Phe Arg Arg Lys Leu# 110- Thr Phe Tyr Leu Lys Thr Leu Glu Asn Ala Gl - #n Ala Gln Gln Thr Thr# 125- Leu Ser Leu Ala Ile Phe 130- (2) INFORMATION FOR SEQ ID NO:129:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 133 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 1#/note= "Met- may or may not precede the amino - # acid in position 1"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 18#/note= "Xaa at position 18 is Asn or Ile"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 19#/note= "Xaa at position 19 is Met,#Ile" Ala, or- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 20#/note= "Xaa at position 20 is Ile,#Leu" Pro, or- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 23#/note= "Xaa at position 23 is Ile,#Leu" Ala, or- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 25#/note= "Xaa at position 25 is Thr or His"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 29#/note= "Xaa at position 29 is Gln, Arg, Val, - # or Leu"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 32#/note= "Xaa at position 32 is Leu, Ala, Asn, - # or Arg"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 34#/note= "Xaa at position 34 is Leu or Ser"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 37#/note= "Xaa at position 37 is Phe,#Ser" Pro, or- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION:; 38#/note= "Xaa at position 38 is Asn or Ala"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 42#/note= "Xaa at position 42 is Gly, Ala, Ser, - # Asp, or Asn"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 45#/note= "Xaa at position 45 is Gln,#Met" Val, or- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 46#/note= "Xaa at position 46 is Asp or Ser"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 49#/note= "Xaa at position 49 is Met, Ile, Leu, - # or Asp"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 50#/note= "Xaa at position 50 is Glu or Asp"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 51#/note= "Xaa at position 51 is Asn,#Ser" Arg, or- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 55#/note= "Xaa at position 55 is Arg,#Thr" Leu, or- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 56#/note= "Xaa at position 56 is Pro or Ser"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 59#/note= "Xaa at position 59 is Glu or Leu"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 60#/note= "Xaa at position 60 is Ala or Ser"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 62#/note= "Xaa at position 62 is Asn#Pro" Val, or- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 63#/note= "Xaa at position 63 is Arg or His"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 65#/note= "Xaa at position 65 is Val or Ser"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 67#/note= "Xaa at position 67 is Ser, Asn, His, - # or Gly"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 69#/note= "Xaa at position 69 is Gln or Glu"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 73#/note= "Xaa at position 73 is Ala or Gly"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 76#/note= "Xaa at position 76 is Ser,#Pro" Ala, or- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 79#/note= "Xaa at position 79 is Lys,#Ser" Arg, or- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 82#/note= "Xaa at position 82 is Leu, Glu, Val, - # or Trp"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 85#/note= "Xaa at position 85 is Leu or Val"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 87#/note= "Xaa at position 87 is Leu,#Trp" Ser, or- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 88#/note= "Xaa at position 88 is Ala or Trp"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 91#/note= "Xaa at position 91 is Ala or Pro"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 93#/note= "Xaa at position 93 is Pro or Ser"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 95#/note= "Xaa at position 95 is His or Thr"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 98#/note= "Xaa at position 98 is His,#Thr" Ile, or- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 100#/note= "Xaa at position 100 is Lys or Arg"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 101#/note= "Xaa at position 101 is Asp,#Met" Ala, or- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 105#/note= "Xaa at position 105 is Asn or Gln"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 109#/note= "Xaa at position 109 is Arg,#Leu" Glu, or- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 112#/note= "Xaa at position 112 is Thr or Gln"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 116#/note= "Xaa at position 116 is Lys, Val, Trp, - # or Ser"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 117#/note= "Xaa at position 117 is Thr or Ser"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 120#/note= "Xaa at position 120 is Asn,#His" Gln, or- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 123#/note= "Xaa at position 123 is Ala or Glu"- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:129:- Ala Pro Met Thr Gln Thr Thr Ser Leu Lys Th - #r Ser Trp Val Asn Cys# 15- Ser Xaa Xaa Xaa Asp Glu Xaa Ile Xaa His Le - #u Lys Xaa Pro Pro Xaa# 30- Pro Xaa Leu Asp Xaa Xaa Asn Leu Asn Xaa Gl - #u Asp Xaa Xaa Ile Leu# 45- Xaa Xaa Xaa Asn Leu Arg Xaa Xaa Asn Leu Xa - #a Xaa Phe Xaa Xaa Ala# 60- Xaa Lys Xaa Leu Xaa Asn Ala Ser Xaa Ile Gl - #u Xaa Ile Leu Xaa Asn#80- Leu Xaa Pro Cys Xaa Pro Xaa Xaa Thr Ala Xa - #a Pro Xaa Arg Xaa Pro# 95- Ile Xaa Ile Xaa Xaa Gly Asp Trp Xaa Glu Ph - #e Arg Xaa Lys Leu Xaa# 110- Phe Tyr Leu Xaa Xaa Leu Glu Xaa Ala Gln Xa - #a Gln Gln Thr Thr Leu# 125- Ser Leu Ala Ile Phe 130- (2) INFORMATION FOR SEQ ID NO:130:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 111 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 1#/note= "Met- or Met-Ala may or may not prece - #de the amino acid in position 1"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 4#/note= "Xaa at position 4 is Asn or Ile"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 5#/note= "Xaa at position 5 is Met,#Ile" Ala, or- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 6#/note= "Xaa at position 6 is Ile,#Leu" Pro, or- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 9#/note= "Xaa at position 9 is Ile,#Leu" Ala, or- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 11#/note= "Xaa at position 11 is Thr or His"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 15#/note= "Xaa at position 15 is Gln, Arg, Val, - # or Leu"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 18#/note= "Xaa at position 18 is Leu, Ala, Asn, - # or Arg"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 20#/note= "Xaa at position 20 is Leu or Ser"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 23#/note= "Xaa at position 23 is Phe,#Ser" Pro, or- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 24#/note= "Xaa at position 24 is Asn or Ala"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 28#/note= "Xaa at position 28 is Gly, Ala, Ser, - # Asp, or Asn"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 31#/note= "Xaa at position 31 is Gln,#Met" Val, or- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 32#/note= "Xaa at position 32 is Asp or Ser"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 35#/note= "Xaa at position 35 is Met, Ile, Leu, - # or Asp"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 36#/note= "Xaa at position 36 is Glu or Asp"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 37#/note= "Xaa at position 37 is Asn,#Ser" Arg, or- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 41#/note= "Xaa at position 41 is Arg,#Thr" Leu, or- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 42#/note= "Xaa at position 42 is Pro or Ser"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 45#/note= "Xaa at position 45 is Glu or Leu"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 46#/note= "Xaa at position 46 is Ala or Ser"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 48#/note= "Xaa at position 48 is Asn,#Pro" Val, or- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 49#/note= "Xaa at position 49 is Arg or His"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 51#/note= "Xaa at position 51 is Val or Ser"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 53#/note= "Xaa at position 53 is Ser, Asn, His, - # or Gly"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 55#/note= "Xaa at position 55 is Gln or Glu"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 59#/note= "Xaa at position 59 is Ala or Gly"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 62#/note= "Xaa at position 62 is Ser,#Pro" Ala, or- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 65#/note= "Xaa at position 65 is Lys,#Ser" Arg, or- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 67#/note= "Xaa at position 67 is Leu,#Val" Glu, or- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 68#/note= "Xaa at position 68 is Leu, Glu, Val, - # or Trp"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 71#/note= "Xaa at position 71 is Leu or Val"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 73#/note= "Xaa at position 73 is Leu,#Trp" Ser, or- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 74#/note= "Xaa at position 74 is Ala or Trp"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 77#/note= "Xaa at position 77 is Ala or Pro"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 79#/note= "Xaa at position 79 is Pro or Ser"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 81#/note= "Xaa at position 81 is His or Thr"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 84#/note= "Xaa at position 84 is His,#Thr" Ile, or- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 86#/note= "Xaa at position 86 is Lys or Arg"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 87#/note= "Xaa at position 87 is Asp,#Met" Ala, or- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 91#/note= "Xaa at position 91 is Asn or Glu"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 95#/note= "Xaa at position 95 is Arg,#Leu" Glu, or- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 98#/note= "Xaa at position 98 is Thr or Gln"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 102#/note= "Xaa at position 102 is Lys, Val, Trp, - # or Ser"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 103#/note= "Xaa at position 103 is Thr or Ser"- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 106#/note= "Xaa at position 106 is Asn,#His" Gln, or- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 109#/note= "Xaa at position 109 is Ala or Glu"- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:130:- Asn Cys Ser Xaa Xaa Xaa Asp Glu Xaa Ile Xa - #a His Leu Lys Xaa Pro# 15- Pro Xaa Pro Xaa Leu Asp Xaa Xaa Asn Leu As - #n Xaa Glu Asp Xaa Xaa# 30- Ile Leu Xaa Xaa Xaa Asn Leu Arg Xaa Xaa As - #n Leu Xaa Xaa Phe Xaa# 45- Xaa Ala Xaa Lys Xaa Leu Xaa Asn Ala Ser Xa - #a Ile Glu Xaa Ile Leu# 60- Xaa Asn Xaa Xaa Pro Cys Xaa Pro Xaa Xaa Th - #r Ala Xaa Pro Xaa Arg#80- Xaa Pro Ile Xaa Ile Xaa Xaa Gly Asp Trp Xa - #a Glu Phe Arg Xaa Lys# 95- Leu Xaa Phe Tyr Leu Xaa Xaa Leu Glu Xaa Al - #a Gln Xaa Gln Gln# 110- (2) INFORMATION FOR SEQ ID NO:131:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 58 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:131:- CTAGCCACGG CCGCACCCAC GCGACATCCA ATCCATATCA AGGACGGTGA CT - #GGAATG 58- (2) INFORMATION FOR SEQ ID NO:132:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 58 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:132:- TTAACATTCC AGTCACCGTC CTTGATATGG ATTGGATGTC GCGTGGGTGC GG - #CCGTGG 58- (2) INFORMATION FOR SEQ ID NO:133:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 29 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:133:# 29 GAAC TGCTCTAAC- (2) INFORMATION FOR SEQ ID NO:134:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 5 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:134:- Met Asn Cys Ser Asn1 5- (2) INFORMATION FOR SEQ ID NO:135:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 120 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:135:- Met Asn Cys Ser Asn Met Ile Asp Glu Ile Il - #e Thr His Leu Lys Gln# 15- Pro Pro Leu Pro Leu Leu Asp Phe Asn Asn Le - #u Asn Gly Glu Asp Gln# 30- Asp Ile Leu Met Glu Asn Asn Leu Arg Arg Pr - #o Asn Leu Glu Ala Phe# 45- Asn Arg Ala Val Lys Ser Leu Gln Asn Ala Se - #r Ala Ile Glu Ser Ile# 60- Leu Lys Asn Leu Leu Pro Cys Leu Pro Leu Al - #a Thr Ala Ala Pro Thr#80- Arg His Pro Ile His Ile Lys Asp Gly Asp Tr - #p Asn Glu Phe Arg Arg# 95- Lys Leu Thr Phe Tyr Leu Lys Thr Leu Glu As - #n Ala Gln Ala Gln Gln# 110- Thr Thr Leu Arg Leu Ala Ile Phe# 120- (2) INFORMATION FOR SEQ ID NO:136:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 71 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:136:- AATTCCGTCG TAAACTGACC TTCTATCTGA AAACCTTGGA GAACGCGCAG GC - #TCAACAGA 60# 71- (2) INFORMATION FOR SEQ ID NO:137:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 71 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:137:- CTAGCGACAG AGTGGTCTGT TGAGCCTGCG CGTTCTCCAA GGTTTTCAGA TA - #GAAGGTCA 60# 71- (2) INFORMATION FOR SEQ ID NO:138:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 112 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:138:- Met Asn Cys Ser Asn Met Ile Asp Glu Ile Il - #e Thr His Leu Lys Gln# 15- Pro Pro Leu Pro Leu Leu Asp Phe Asn Asn Le - #u Asn Gly Glu Asp Gln# 30- Asp Ile Leu Met Glu Asn Asn Leu Arg Arg Pr - #o Asn Leu Glu Ala Phe# 45- Asn Arg Ala Val Lys Ser Leu Gln Asn Ala Se - #r Ala Ile Glu Ser Ile# 60- Leu Lys Asn Leu Leu Pro Cys Leu Pro Leu Al - #a Thr Ala Ala Pro Thr#80- Arg His Pro Ile His Ile Lys Ala Gly Asp Tr - #p Asn Glu Phe Arg Arg# 95- Lys Leu Thr Phe Tyr Leu Lys Thr Leu Glu As - #n Ala Gln Ala Gln Gln# 110- (2) INFORMATION FOR SEQ ID NO:139:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 75 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:139:- Met Asn Cys Ser Asn Met Ile Asp Glu Ile Il - #e Thr His Leu Lys Gln# 15- Pro Pro Leu Pro Leu Leu Asp Phe Asn Asn Le - #u Asn Gly Glu Asp Gln# 30- Asp Ile Leu Met Glu Asn Asn Leu Arg Arg Pr - #o Asn Leu Glu Ala Phe# 45- Asn Arg Ala Val Lys Ser Leu Gln Asn Ala Se - #r Ala Ile Glu Ser Ile# 60- Leu Lys Asn Leu Leu Pro Cys Leu Pro Leu Al - #a#75- (2) INFORMATION FOR SEQ ID NO:140:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 58 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:140:- CTAGCCACGG CCGCACCCAC GCGACATCCA ATCCATATCA AGGCTGGTGA CT - #GGAATG 58- (2) INFORMATION FOR SEQ ID NO:141:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 58 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:141:- AATTCATTCC AGTCACCAGC CTTGATATGG ATTGGATGTC GCGTGGGTGC GG - #CCGTGG 58- (2) INFORMATION FOR SEQ ID NO:142:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 64 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:142:- AATTCCGTCG TAAACTGACC TTCTATCTGA AAACCTTGGA GAACGCGCAG GC - #TCAACAGT 60# 64- (2) INFORMATION FOR SEQ ID NO:143:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 64 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:143:- AGCTTATTAC TGTTGAGCCT GCGCGTTCTC CAAGGTTTTC AGATAGAAGG TC - #AGTTTACG 60# 64- (2) INFORMATION FOR SEQ ID NO:144:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 408 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:144:- ATGGCTCCAA TGACTCAGAC TACTTCTCTT AAGACTTCTT GGGTTAACTG CT - #CTAACATG 60- ATCGATGAAA TTATAACACA CTTAAAGCAG CCACCTTTGC CTTTGCTGGA CT - #TCAACAAC 120- CTCAATGGGG AAGACCAAGA CATTCTGATG GAAAATAACC TTCGAAGGCC AA - #ACCTGGAG 180- GCATTCAACA GGGCTGTCAA GAGTTTACAG AATGCATCAG CAATTGAGAG CA - #TTCTTAAA 240- AATCTCCTGC CATGTCTGCC CCTGGCCACG GCCGCACCCA CGCGACATCC AA - #TCCATATC 300- AAGGACGGTG ACTGGAATGA ATTCCGTCGT AAACTGACCT TCTATCTGAA AA - #CCTTGGAG 360# 408AGAC CACTCTGTCG CTAGCGATCT TTTAATAA- (2) INFORMATION FOR SEQ ID NO:145:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 157 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 1..156- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:145:- ATC GAT GAA ATC ATC ACC CAC CTG AAG CAG CC - #A CCG CTG CCG CTG CTG 48Ile Asp Glu Ile Ile Thr His Leu Lys Gln Pr - #o Pro Leu Pro Leu Leu# 15- GAC TTC AAC AAC CTC AAT GGT GAA GAC CAA GA - #T ATC CTG ATG GAA AAT 96Asp Phe Asn Asn Leu Asn Gly Glu Asp Gln As - #p Ile Leu Met Glu Asn# 30- AAC CTT CGT CGT CCA AAC CTC GAG GCA TTC AA - #C CGT GCT GTC AAG TCT 144Asn Leu Arg Arg Pro Asn Leu Glu Ala Phe As - #n Arg Ala Val Lys Ser# 45# 157Leu Gln Asn Ala 50- (2) INFORMATION FOR SEQ ID NO:146:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 52 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:146:- Ile Asp Glu Ile Ile Thr His Leu Lys Gln Pr - #o Pro Leu Pro Leu Leu# 15- Asp Phe Asn Asn Leu Asn Gly Glu Asp Gln As - #p Ile Leu Met Glu Asn# 30- Asn Leu Arg Arg Pro Asn Leu Glu Ala Phe As - #n Arg Ala Val Lys Ser# 45- Leu Gln Asn Ala 50- (2) INFORMATION FOR SEQ ID NO:147:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 414 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:147:- CCATGGCTCC AATGACTCAG ACTACTTCTC TTAAGACTTC TTGGGTTAAC TG - #CTCTAACA 60- TGATCGATGA AATTATAACA CACTTAAAGC AGCCACCTTT GCCTTTGCTG GA - #CTTCAACA 120- ACCTCAATGG GGAAGACCAA GACATTCTGA TGGAAAATAA CCTTCGAAGG CC - #AAACCTGG 180- AGGCATTCAA CAGGGCTGTC AAGAGTTTAC AGAATGCATC AGCAATTGAG AG - #CATTCTTA 240- AAAATCTCCT GCCATGTCTG CCCCTGGCCA CGGCCGCACC CACGCGACAT CC - #AATCCATA 300- TCAAGGACGG TGACTGGAAT GAATTCCGTC GTAAACTGAC CTTCTATCTG AA - #AACCTTGG 360- AGAACGCGCA GGCTCAACAG ACCACTCTGT CGCTAGCGAT CTTTTAATAA GC - #TT 414- (2) INFORMATION FOR SEQ ID NO:148:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 414 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:148:- AAGCTTATTA AAAGATCGCT AGCGACAGAG TGGTCTGTTG AGCCTGCGCG TT - #CTCCAAGG 60- TTTTCAGATA GAAGGTCAGT TTACGACGGA ATTCATTCCA GTCACCGTCC TT - #GATATGGA 120- TTGGATGTCG CGTGGGTGCG GCCGTGGCCA GGGGCAGACA TGGCAGGAGA TT - #TTTAAGAA 180- TGCTCTCAAT TGCTGATGCA TTCTGTAAAC TCTTGACAGC CCTGTTGAAT GC - #CTCCAGGT 240- TTGGCCTTCG AAGGTTATTT TCCATCAGAA TGTCTTGGTC TTCCCCATTG AG - #GTTGTTGA 300- AGTCCAGCAA AGGCAAAGGT GGCTGCTTTA AGTGTGTTAT AATTTCATCG AT - #CATGTTAG 360- AGCAGTTAAC CCAAGAAGTC TTAAGAGAAG TAGTCTGAGT CATTGGAGCC AT - #GG 414- (2) INFORMATION FOR SEQ ID NO:149:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 81 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:149:- ATGATGATTA CTCTGCGCAA ACTTCCTCTG GCGGTTGCCG TCGCAGCGGG CG - #TAATGTCT 60#81 ACTG C- (2) INFORMATION FOR SEQ ID NO:150:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 81 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:150:- GCAGTTAGCC ATGGCCTGAG CAGACATTAC GCCCGCTGCG ACGGCAACCG CC - #AGAGGAAG 60#81 ATCA T- (2) INFORMATION FOR SEQ ID NO:151:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 24 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:151:# 24AACA TGAT- (2) INFORMATION FOR SEQ ID NO:152:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 22 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:152:# 22TTA GC- (2) INFORMATION FOR SEQ ID NO:153:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 12 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:153:# 12- (2) INFORMATION FOR SEQ ID NO:154:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 4 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:154:- Met Ala Asn Cys- (2) INFORMATION FOR SEQ ID NO:155:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 34 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:155:# 34 ACTC CCACCATTCA GAGA- (2) INFORMATION FOR SEQ ID NO:156:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 33 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:156:# 33 ACGG GTATGGAGAA ACA- (2) INFORMATION FOR SEQ ID NO:157:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 30 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:157:# 30 ATCT AACGCTTGAG- (2) INFORMATION FOR SEQ ID NO:158:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 24 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:158:# 24TTCT AAGT- (2) INFORMATION FOR SEQ ID NO:159:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 33 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:159:# 33 AATG TCCATGTCTT CAG- (2) INFORMATION FOR SEQ ID NO:160:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 339 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:160:- ATGGCTAACT GCTCTATAAT GATCGATGAA ATTATACATC ACTTAAAGAG AC - #CACCTAAC 60- CCTTTGCTGG ACCCGAACAA CCTCAATTCT GAAGACATGG ATATCCTGAT GG - #AACGAAAC 120- CTTCGAACTC CAAACCTGCT CGCATTCGTA AGGGCTGTCA AGCACTTAGA AA - #ACGCATCA 180- GGTATTGAGG CAATTCTTCG TAATCTCCAA CCATGTCTGC CCTCTGCCAC GG - #CCGCACCC 240- TCTCGACATC CAATCATCAT CAAGGCAGGT GACTGGCAAG AATTCCGGGA AA - #AACTGACG 300# 339 TTGA GCAAGCGCAG GAACAACAG- (2) INFORMATION FOR SEQ ID NO:161:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 338 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:161:- ATGGCTAACT GCTCTATAAT GATCGATGAA ATTATACATC ACTTAAAGAG AC - #CACCTAAC 60- CCTTTGCTGG ACCCGAACAA CCTCAATTCT GAAGACATGG ACATTTGATG GA - #ACGAAACC 120- TTCGAACTCC AAACCTGCTC GCATTCGTAA GGGCTGTCAA GCACTTAGAA AA - #CGCATCAG 180- GTATTGAGGC AATTCTTCGT AATCTCCAAC CATGTCTGCC CTCTGCCACG GC - #CGCACCCT 240- CTCGACATCC AATCATCATC AAGGCAGGTG ACTGGCAAGA ATTCCGGGAA AA - #ACTGACGT 300# 338 TGAG CAAGCGCAGG AACAACAG- (2) INFORMATION FOR SEQ ID NO:162:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 40 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:162:# 40 AACA TGATCGATGA AATTATAACA- (2) INFORMATION FOR SEQ ID NO:163:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 45 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:163:#45 ATTT CATCGATCAT GTTAGAGCAG TTAGC- (2) INFORMATION FOR SEQ ID NO:164:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 36 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:164:# 36 CTTT GCCTTTGCTG GACTTC- (2) INFORMATION FOR SEQ ID NO:165:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 36 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:165:# 36 AGCA AAGGCAAAGG TGGCTG- (2) INFORMATION FOR SEQ ID NO:166:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 27 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:166:# 27 AAGA CATGTCT- (2) INFORMATION FOR SEQ ID NO:167:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 18 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:167:# 18 TT- (2) INFORMATION FOR SEQ ID NO:168:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 16 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:168:# 16- (2) INFORMATION FOR SEQ ID NO:169:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 24 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:169:# 24TTCA TGCA- (2) INFORMATION FOR SEQ ID NO:170:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 40 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:170:# 40 ATAG CTATCGATGA AATTATACAT- (2) INFORMATION FOR SEQ ID NO:171:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 45 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:171:#45 ATTT CATCGATAGC TATAGAGCAG TTTGC- (2) INFORMATION FOR SEQ ID NO:172:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 40 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:172:# 40 ATAA TCATCGATGA AATTATACAT- (2) INFORMATION FOR SEQ ID NO:173:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 45 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:173:#45 ATTT CATCGATGAT TATAGAGCAG TTTGC- (2) INFORMATION FOR SEQ ID NO:174:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 36 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:174:# 36 ACCT TCGAACTCCA AACCTG- (2) INFORMATION FOR SEQ ID NO:175:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 27 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:175:# 27 TCGT CCAGGAT- (2) INFORMATION FOR SEQ ID NO:176:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 36 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:176:# 36 ACCT TCGAACTCCA AACCTG- (2) INFORMATION FOR SEQ ID NO:177:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 27 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:177:# 27 TCGA TCAGGAT- (2) INFORMATION FOR SEQ ID NO:178:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 36 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:178:# 36 ACCT TCGAACTCCA AACCTG- (2) INFORMATION FOR SEQ ID NO:179:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 27 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:179:# 27 TCCA GCAGGAT- (2) INFORMATION FOR SEQ ID NO:180:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 27 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:180:# 27 AAGA CGTTGAT- (2) INFORMATION FOR SEQ ID NO:181:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 18 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:181:# 18 TT- (2) INFORMATION FOR SEQ ID NO:182:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 51 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:182:# 51ACTGCTC TATAATGATC GATGAAGCAA TACATCACTT A- (2) INFORMATION FOR SEQ ID NO:183:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 18 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:183:# 18 TT- (2) INFORMATION FOR SEQ ID NO:184:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 18 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:184:# 18 CT- (2) INFORMATION FOR SEQ ID NO:185:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 42 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:185:# 42 GACA TGTCTTCAGC ATTGAGGTTG TT- (2) INFORMATION FOR SEQ ID NO:186:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 42 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:186:# 42 GAAA CGTCTTCAGC ATTGAGGTTG TT- (2) INFORMATION FOR SEQ ID NO:187:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 42 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:187:# 42 GACA TGTCTTCGTC ATTGAGGTTG TT- (2) INFORMATION FOR SEQ ID NO:188:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 42 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:188:# 42 GAAA CGTCTTCGTC ATTGAGGTTG TT- (2) INFORMATION FOR SEQ ID NO:189:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 42 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:189:# 42 GACA TGTCTTCAGA ATTGAGGTTG TT- (2) INFORMATION FOR SEQ ID NO:190:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 42 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:190:# 42 GAAA CGTCTTCAGA ATTGAGGTTG TT- (2) INFORMATION FOR SEQ ID NO:191:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 48 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:191:# 48CCGC ACCCTCTCGA CATCCAATCA TCATCCGT- (2) INFORMATION FOR SEQ ID NO:192:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 26 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:192:# 26 CTGC ACGGAT- (2) INFORMATION FOR SEQ ID NO:193:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 16 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:193:# 16- (2) INFORMATION FOR SEQ ID NO:194:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 26 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:194:# 26 CCAT ACGGAT- (2) INFORMATION FOR SEQ ID NO:195:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 40 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:195:# 40 ATTA TGATCGATGA AGCAATACAT- (2) INFORMATION FOR SEQ ID NO:196:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 45 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:196:#45 GCTT CATCGATCAT AATAGAGCAG TTAGC- (2) INFORMATION FOR SEQ ID NO:197:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 36 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:197:# 36 CTCG CCCTTCCCTG GACCCG- (2) INFORMATION FOR SEQ ID NO:198:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 36 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:198:# 36 AGGG AAGGGCGAGG TGGTAC- (2) INFORMATION FOR SEQ ID NO:199:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 36 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:199:# 36 CTGC ACCTTCCCTG GACCCG- (2) INFORMATION FOR SEQ ID NO:200:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 36 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:200:# 36 AGGG AAGGTGCAGG TGGTCT- (2) INFORMATION FOR SEQ ID NO:201:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 27 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:201:# 27 AAGA CATGGAT- (2) INFORMATION FOR SEQ ID NO:202:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 18 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:202:# 18 TT- (2) INFORMATION FOR SEQ ID NO:203:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 27 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:203:# 27 AAGA CGTCGAT- (2) INFORMATION FOR SEQ ID NO:204:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 18 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:204:# 18 TT- (2) INFORMATION FOR SEQ ID NO:205:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 27 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:205:# 27 AAGA CATGTCT- (2) INFORMATION FOR SEQ ID NO:206:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 18 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:206:# 18 TT- (2) INFORMATION FOR SEQ ID NO:207:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 27 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:207:# 27 AAGA CGTCTCT- (2) INFORMATION FOR SEQ ID NO:208:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 18 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:208:# 18 TT- (2) INFORMATION FOR SEQ ID NO:209:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 36 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:209:# 36 ACCT TCGACTTCCA AACCTG- (2) INFORMATION FOR SEQ ID NO:210:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 27 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:210:# 27 TCCA TCAGGAT- (2) INFORMATION FOR SEQ ID NO:211:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 36 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:211:# 36 ACCT TCGACTTAGC AACCTG- (2) INFORMATION FOR SEQ ID NO:212:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 24 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:212:# 24AGGT TGCT- (2) INFORMATION FOR SEQ ID NO:213:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 18 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:213:# 18 GT- (2) INFORMATION FOR SEQ ID NO:214:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 18 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:214:# 18 AT- (2) INFORMATION FOR SEQ ID NO:215:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 32 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:215:# 32 GCAA TTCTATCTGT GG- (2) INFORMATION FOR SEQ ID NO:216:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 37 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:216:# 37 TAGA ATTGCAGTTT TTCCCGG- (2) INFORMATION FOR SEQ ID NO:217:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 32 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:217:# 32 GCAA TTCTATCTGG TT- (2) INFORMATION FOR SEQ ID NO:218:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 37 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:218:# 37 TAGA ATTGCAGTTT TTCCCGG- (2) INFORMATION FOR SEQ ID NO:219:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 23 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:219:# 23GACG TTC- (2) INFORMATION FOR SEQ ID NO:220:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 28 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:220:# 28 AGTT TTTCCCGG- (2) INFORMATION FOR SEQ ID NO:221:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 23 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:221:# 23AGTA ATA- (2) INFORMATION FOR SEQ ID NO:222:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 19 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:222:# 19 GGT- (2) INFORMATION FOR SEQ ID NO:223:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 23 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:223:# 23GCAA TTC- (2) INFORMATION FOR SEQ ID NO:224:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 28 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:224:# 28 AGTT TTTCCCGG- (2) INFORMATION FOR SEQ ID NO:225:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 61 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:225:- CGATCATTAT AGAGCAGTTA GCCTTGTCAT CGTCGTCCTT GTAATCAGTT TC - #TGGATATG 60# 61- (2) INFORMATION FOR SEQ ID NO:226:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 63 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:226:- CATGGCATAT CCAGAAACTG ATTACAAGGA CGACGATGAC AAGGCTAACT GC - #TCTATAAT 60# 63- (2) INFORMATION FOR SEQ ID NO:227:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 32 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:227:# 32 GCAA TTCTATCTGT CT- (2) INFORMATION FOR SEQ ID NO:228:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 37 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:228:# 37 TAGA ATTGCAGTTT AAGCCGG- (2) INFORMATION FOR SEQ ID NO:229:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 32 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:229:# 32 AGGA ACAACAGTAA TA- (2) INFORMATION FOR SEQ ID NO:230:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 40 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:230:# 40 ATAA TACTCGATGA AGCAATACAT- (2) INFORMATION FOR SEQ ID NO:231:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 45 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:231:#45 GCTT CATCGAGTAT TATAGAGCAG TTTGC- (2) INFORMATION FOR SEQ ID NO:232:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 40 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:232:# 40 ATAA TGCCAGATGA AGCAATACAT- (2) INFORMATION FOR SEQ ID NO:233:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 45 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:233:#45 GCTT CATCTGGCAT TATAGAGCAG TTTGC- (2) INFORMATION FOR SEQ ID NO:234:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 41 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:234:# 41 ATAA TGATCGATGA AACTGATACA T- (2) INFORMATION FOR SEQ ID NO:235:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 45 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:235:#45 AGTT CATCGATCAT TATAGAGCAG TTTGC- (2) INFORMATION FOR SEQ ID NO:236:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 36 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:236:# 36 CTAA CCCTAGCCTG GACAGT- (2) INFORMATION FOR SEQ ID NO:237:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 36 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:237:# 36 AGGC TAGGGTTAGG TGGTAT- (2) INFORMATION FOR SEQ ID NO:238:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 27 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:238:# 27 AAGA CGTCTCT- (2) INFORMATION FOR SEQ ID NO:239:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 18 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:239:# 18 TT- (2) INFORMATION FOR SEQ ID NO:240:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 36 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:240:# 36 ACCT TCGAACTCCA AACCTG- (2) INFORMATION FOR SEQ ID NO:241:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 27 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:241:# 27 TCCA TCAGGAT- (2) INFORMATION FOR SEQ ID NO:242:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 48 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:242:# 48CCCC TCCCTCTCGA ACACCAATCA CGATCAAG- (2) INFORMATION FOR SEQ ID NO:243:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 48 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:243:# 48GAGG GAGGGGCCGT CCAATAGGGA ACACATGG- (2) INFORMATION FOR SEQ ID NO:244:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 24 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:244:# 24CTTC TAAG- (2) INFORMATION FOR SEQ ID NO:245:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 24 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:245:# 24CTGT CAAG- (2) INFORMATION FOR SEQ ID NO:246:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 24 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:246:# 24AGGT TTGG- (2) INFORMATION FOR SEQ ID NO:247:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 20 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:247:# 20 AAGC- (2) INFORMATION FOR SEQ ID NO:248:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 15 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:248:# 15- (2) INFORMATION FOR SEQ ID NO:249:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 20 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:249:# 20 CAGC- (2) INFORMATION FOR SEQ ID NO:250:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 21 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:250:#21 TTCT T- (2) INFORMATION FOR SEQ ID NO:251:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 19 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:251:# 19 GCA- (2) INFORMATION FOR SEQ ID NO:252:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 18 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:252:# 18 GT- (2) INFORMATION FOR SEQ ID NO:253:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 18 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:253:# 18 AT- (2) INFORMATION FOR SEQ ID NO:254:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 37 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:254:# 37 TAGA ATTGCAGTTT AAGCCGG- (2) INFORMATION FOR SEQ ID NO:255:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 40 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:255:# 40 ATAA TGATCGATGA AATTATACAT- (2) INFORMATION FOR SEQ ID NO:256:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 43 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:256:# 43 GCAA TTCTATCTGT CTACCCTTTA ATA- (2) INFORMATION FOR SEQ ID NO:257:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 43 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:257:# 43 GACA GATAGAATTG CAGTTTAAGC CGG- (2) INFORMATION FOR SEQ ID NO:258:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 43 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:258:# 43 GCAA TTCTATCTGT CTACCCTTTA ATA- (2) INFORMATION FOR SEQ ID NO:259:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 113 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:259:- Met Ala Asn Cys Ser Asn Met Ile Asp Glu Il - #e Ile Thr His Leu Lys# 15- Gln Pro Pro Leu Pro Leu Leu Asp Phe Asn As - #n Leu Asn Asp Glu Asp# 30- Met Ser Ile Leu Met Asp Asn Asn Leu Arg Ar - #g Pro Asn Leu Glu Ala# 45- Phe Asn Arg Ala Val Lys Ser Leu Gln Asn Al - #a Ser Ala Ile Glu Ser# 60- Ile Leu Lys Asn Leu Leu Pro Cys Leu Pro Le - #u Ala Thr Ala Ala Pro#80- Thr Arg His Pro Ile His Ile Lys Asp Gly As - #p Trp Asn Glu Phe Arg# 95- Arg Lys Leu Thr Phe Tyr Leu Lys Thr Leu Gl - #u Asn Ala Gln Ala Gln# 110- Gln- (2) INFORMATION FOR SEQ ID NO:260:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 113 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:260:- Met Ala Asn Cys Ser Asn Met Ile Asp Glu Il - #e Ile Thr His Leu Lys# 15- Gln Pro Pro Leu Pro Leu Leu Asp Phe Asn As - #n Leu Asn Asp Glu Asp# 30- Met Ser Ile Leu Met Glu Asn Asn Leu Arg Ar - #g Pro Asn Leu Glu Ala# 45- Phe Asn Arg Ala Val Lys Ser Leu Gln Asn Al - #a Ser Ala Ile Glu Ser# 60- Ile Leu Lys Asn Leu Leu Pro Cys Leu Pro Le - #u Ala Thr Ala Ala Pro#80- Thr Arg His Pro Ile His Ile Lys Asp Gly As - #p Trp Asn Glu Phe Arg# 95- Arg Lys Leu Thr Phe Tyr Leu Lys Thr Leu Gl - #u Asn Ala Gln Ala Gln# 110- Gln- (2) INFORMATION FOR SEQ ID NO:261:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 113 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:261:- Met Ala Asn Cys Ser Asn Met Ile Asp Glu Il - #e Ile Thr His Leu Lys# 15- Gln Pro Pro Leu Pro Leu Leu Asp Phe Asn As - #n Leu Asn Asp Glu Asp# 30- Met Ser Ile Leu Met Glu Asn Asn Leu Arg Ar - #g Pro Asn Leu Glu Ala# 45- Phe Asn Arg Ala Val Lys Ser Leu Gln Asn Al - #a Ser Ala Ile Glu Ser# 60- Ile Leu Lys Asn Leu Leu Pro Cys Leu Pro Le - #u Ala Thr Ala Ala Pro#80- Thr Arg His Pro Ile His Ile Lys Asp Gly As - #p Trp Asn Glu Phe Arg# 95- Arg Lys Leu Thr Phe Tyr Leu Trp Thr Leu Gl - #u Asn Ala Gln Ala Gln# 110- Gln- (2) INFORMATION FOR SEQ ID NO:262:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 113 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:262:- Met Ala Asn Cys Ser Asn Met Ile Asp Glu Il - #e Ile Thr His Leu Lys# 15- Gln Pro Pro Leu Pro Leu Leu Asp Phe Asn As - #n Leu Asn Asp Glu Asp# 30- Met Ser Ile Leu Met Asp Asn Asn Leu Arg Ar - #g Pro Asn Leu Glu Ala# 45- Phe Asn Arg Ala Val Lys Ser Leu Gln Asn Al - #a Ser Ala Ile Glu Ser# 60- Ile Leu Lys Asn Leu Leu Pro Cys Leu Pro Le - #u Ala Thr Ala Ala Pro#80- Thr Arg His Pro Ile His Ile Lys Asp Gly As - #p Trp Asn Glu Phe Arg# 95- Arg Lys Leu Thr Phe Tyr Leu Trp Thr Leu Gl - #u Asn Ala Gln Ala Gln# 110- Gln- (2) INFORMATION FOR SEQ ID NO:263:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 113 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:263:- Met Ala Asn Cys Ser Asn Met Ile Asp Glu Il - #e Ile Thr His Leu Lys# 15- Gln Pro Pro Leu Pro Leu Leu Asp Phe Asn As - #n Leu Asn Asp Glu Asp# 30- Met Ser Ile Leu Met Asp Asn Asn Leu Arg Ar - #g Pro Asn Leu Glu Ala# 45- Phe Asn Arg Ala Val Lys Ser Leu Gln Asn Al - #a Ser Ala Ile Glu Ser# 60- Ile Leu Lys Asn Leu Leu Pro Cys Leu Pro Le - #u Ala Thr Ala Ala Pro#80- Thr Arg Arg Pro Ile Ile Ile Arg Asp Gly As - #p Trp Asn Glu Phe Arg# 95- Arg Lys Leu Thr Phe Tyr Leu Trp Thr Leu Gl - #u Asn Ala Gln Ala Gln# 110- Gln- (2) INFORMATION FOR SEQ ID NO:264:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 113 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:264:- Met Ala Asn Cys Ser Ile Ala Ile Asp Glu Il - #e Ile His His Leu Lys# 15- Arg Pro Pro Asn Pro Leu Leu Asp Pro Asn As - #n Leu Asn Ser Glu Asp# 30- Met Asp Ile Leu Met Glu Arg Asn Leu Arg Th - #r Pro Asn Leu Leu Ala# 45- Phe Val Arg Ala Val Lys His Leu Glu Asn Al - #a Ser Gly Ile Glu Ala# 60- Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Se - #r Ala Thr Ala Ala Pro#80- Ser Arg His Pro Ile Ile Ile Lys Ala Gly As - #p Trp Gln Glu Phe Arg# 95- Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Gl - #u Gln Ala Gln Glu Gln# 110- Gln- (2) INFORMATION FOR SEQ ID NO:265:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 113 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:265:- Met Ala Asn Cys Ser Ile Ile Ile Asp Glu Il - #e Ile His His Leu Lys# 15- Arg Pro Pro Asn Pro Leu Leu Asp Pro Asn As - #n Leu Asn Ser Glu Asp# 30- Met Asp Ile Leu Met Glu Arg Asn Leu Arg Th - #r Pro Asn Leu Leu Ala# 45- Phe Val Arg Ala Val Lys His Leu Glu Asn Al - #a Ser Gly Ile Glu Ala# 60- Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Se - #r Ala Thr Ala Ala Pro#80- Ser Arg His Pro Ile Ile Ile Lys Ala Gly As - #p Trp Gln Glu Phe Arg# 95- Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Gl - #u Gln Ala Gln Glu Gln# 110- Gln- (2) INFORMATION FOR SEQ ID NO:266:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 113 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:266:- Met Ala Asn Cys Ser Ile Met Ile Asp Glu Il - #e Ile His His Leu Lys# 15- Arg Pro Pro Asn Pro Leu Leu Asp Pro Asn As - #n Leu Asn Ser Glu Asp# 30- Val Asp Ile Leu Met Glu Arg Asn Leu Arg Th - #r Pro Asn Leu Leu Ala# 45- Phe Val Arg Ala Val Lys His Leu Glu Asn Al - #a Ser Gly Ile Glu Ala# 60- Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Se - #r Ala Thr Ala Ala Pro#80- Ser Arg His Pro Ile Ile Ile Lys Ala Gly As - #p Trp Gln Glu Phe Arg# 95- Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Gl - #u Gln Ala Gln Glu Gln# 110- Gln- (2) INFORMATION FOR SEQ ID NO:267:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 113 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:267:- Met Ala Asn Cys Ser Ile Ala Ile Asp Glu Il - #e Ile His His Leu Lys# 15- Arg Pro Pro Asn Pro Leu Leu Asp Pro Asn As - #n Leu Asn Ser Glu Asp# 30- Val Asp Ile Leu Met Glu Arg Asn Leu Arg Th - #r Pro Asn Leu Leu Ala# 45- Phe Val Arg Ala Val Lys His Leu Glu Asn Al - #a Ser Gly Ile Glu Ala# 60- Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Se - #r Ala Thr Ala Ala Pro#80- Ser Arg His Pro Ile Ile Ile Lys Ala Gly As - #p Trp Gln Glu Phe Arg# 95- Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Gl - #u Gln Ala Gln Glu Gln# 110- Gln- (2) INFORMATION FOR SEQ ID NO:268:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 113 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:268:- Met Ala Asn Cys Ser Ile Ile Ile Asp Glu Il - #e Ile His His Leu Lys# 15- Arg Pro Pro Asn Pro Leu Leu Asp Pro Asn As - #n Leu Asn Ser Glu Asp# 30- Val Asp Ile Leu Met Glu Arg Asn Leu Arg Th - #r Pro Asn Leu Leu Ala# 45- Phe Val Arg Ala Val Lys His Leu Glu Asn Al - #a Ser Gly Ile Glu Ala# 60- Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Se - #r Ala Thr Ala Ala Pro#80- Ser Arg His Pro Ile Ile Ile Lys Ala Gly As - #p Trp Gln Glu Phe Arg# 95- Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Gl - #u Gln Ala Gln Glu Gln# 110- Gln- (2) INFORMATION FOR SEQ ID NO:269:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 113 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:269:- Met Ala Asn Cys Ser Ile Met Ile Asp Glu Il - #e Ile His His Leu Lys# 15- Arg Pro Pro Asn Pro Leu Leu Asp Pro Asn As - #n Leu Asn Ser Glu Asp# 30- Met Asp Ile Leu Ile Glu Arg Asn Leu Arg Th - #r Pro Asn Leu Leu Ala# 45- Phe Val Arg Ala Val Lys His Leu Glu Asn Al - #a Ser Gly Ile Glu Ala# 60- Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Se - #r Ala Thr Ala Ala Pro#80- Ser Arg His Pro Ile Ile Ile Lys Ala Gly As - #p Trp Gln Glu Phe Arg# 95- Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Gl - #u Gln Ala Gln Glu Gln# 110- Gln- (2) INFORMATION FOR SEQ ID NO:270:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 113 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:270:- Met Ala Asn Cys Ser Ile Met Ile Asp Glu Il - #e Ile His His Leu Lys# 15- Arg Pro Pro Asn Pro Leu Leu Asp Pro Asn As - #n Leu Asn Ser Glu Asp# 30- Met Asp Ile Leu Leu Glu Arg Asn Leu Arg Th - #r Pro Asn Leu Leu Ala# 45- Phe Val Arg Ala Val Lys His Leu Glu Asn Al - #a Ser Gly Ile Glu Ala# 60- Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Se - #r Ala Thr Ala Ala Pro#80- Ser Arg His Pro Ile Ile Ile Lys Ala Gly As - #p Trp Gln Glu Phe Arg# 95- Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Gl - #u Gln Ala Gln Glu Gln# 110- Gln- (2) INFORMATION FOR SEQ ID NO:271:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 113 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:271:- Met Ala Asn Cys Ser Ile Met Ile Asp Glu Il - #e Ile His His Leu Lys# 15- Arg Pro Pro Asn Pro Leu Leu Asp Pro Asn As - #n Leu Asn Ser Glu Asp# 30- Met Asp Ile Leu Asp Glu Arg Asn Leu Arg Th - #r Pro Asn Leu Leu Ala# 45- Phe Val Arg Ala Val Lys His Leu Glu Asn Al - #a Ser Gly Ile Glu Ala# 60- Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Se - #r Ala Thr Ala Ala Pro#80- Ser Arg His Pro Ile Ile Ile Lys Ala Gly As - #p Trp Gln Glu Phe Arg# 95- Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Gl - #u Gln Ala Gln Glu Gln# 110- Gln- (2) INFORMATION FOR SEQ ID NO:272:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 113 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:272:- Met Ala Asn Cys Ser Ile Ala Ile Asp Glu Il - #e Ile His His Leu Lys# 15- Arg Pro Pro Asn Pro Leu Leu Asp Pro Asn As - #n Leu Asn Ser Glu Asp# 30- Val Asp Ile Leu Ile Glu Arg Asn Leu Arg Th - #r Pro Asn Leu Leu Ala# 45- Phe Val Arg Ala Val Lys His Leu Glu Asn Al - #a Ser Gly Ile Glu Ala# 60- Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Se - #r Ala Thr Ala Ala Pro#80- Ser Arg His Pro Ile Ile Ile Lys Ala Gly As - #p Trp Gln Glu Phe Arg# 95- Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Gl - #u Gln Ala Gln Glu Gln# 110- Gln- (2) INFORMATION FOR SEQ ID NO:273:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 113 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:273:- Met Ala Asn Cys Ser Ile Ile Ile Asp Glu Il - #e Ile His His Leu Lys# 15- Arg Pro Pro Asn Pro Leu Leu Asp Pro Asn As - #n Leu Asn Ser Glu Asp# 30- Val Asp Ile Leu Ile Glu Arg Asn Leu Arg Th - #r Pro Asn Leu Leu Ala# 45- Phe Val Arg Ala Val Lys His Leu Glu Asn Al - #a Ser Gly Ile Glu Ala# 60- Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Se - #r Ala Thr Ala Ala Pro#80- Ser Arg His Pro Ile Ile Ile Lys Ala Gly As - #p Trp Gln Glu Phe Arg# 95- Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Gl - #u Gln Ala Gln Glu Gln# 110- Gln- (2) INFORMATION FOR SEQ ID NO:274:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 113 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:274:- Met Ala Asn Cys Ser Ile Ala Ile Asp Glu Il - #e Ile His His Leu Lys# 15- Arg Pro Pro Asn Pro Leu Leu Asp Pro Asn As - #n Leu Asn Ser Glu Asp# 30- Val Asp Ile Leu Leu Glu Arg Asn Leu Arg Th - #r Pro Asn Leu Leu Ala# 45- Phe Val Arg Ala Val Lys His Leu Glu Asn Al - #a Ser Gly Ile Glu Ala# 60- Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Se - #r Ala Thr Ala Ala Pro#80- Ser Arg His Pro Ile Ile Ile Lys Ala Gly As - #p Trp Gln Glu Phe Arg# 95- Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Gl - #u Gln Ala Gln Glu Gln# 110- Gln- (2) INFORMATION FOR SEQ ID NO:275:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 113 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:275:- Met Ala Asn Cys Ser Ile Ile Ile Asp Glu Il - #e Ile His His Leu Lys# 15- Arg Pro Pro Asn Pro Leu Leu Asp Pro Asn As - #n Leu Asn Ser Glu Asp# 30- Val Asp Ile Leu Leu Glu Arg Asn Leu Arg Th - #r Pro Asn Leu Leu Ala# 45- Phe Val Arg Ala Val Lys His Leu Glu Asn Al - #a Ser Gly Ile Glu Ala# 60- Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Se - #r Ala Thr Ala Ala Pro#80- Ser Arg His Pro Ile Ile Ile Lys Ala Gly As - #p Trp Gln Glu Phe Arg# 95- Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Gl - #u Gln Ala Gln Glu Gln# 110- Gln- (2) INFORMATION FOR SEQ ID NO:276:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 113 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:276:- Met Ala Asn Cys Ser Ile Ala Ile Asp Glu Il - #e Ile His His Leu Lys# 15- Arg Pro Pro Asn Pro Leu Leu Asp Pro Asn As - #n Leu Asn Ser Glu Asp# 30- Val Asp Ile Leu Asp Glu Arg Asn Leu Arg Th - #r Pro Asn Leu Leu Ala# 45- Phe Val Arg Ala Val Lys His Leu Glu Asn Al - #a Ser Gly Ile Glu Ala# 60- Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Se - #r Ala Thr Ala Ala Pro#80- Ser Arg His Pro Ile Ile Ile Lys Ala Gly As - #p Trp Gln Glu Phe Arg# 95- Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Gl - #u Gln Ala Gln Glu Gln# 110- Gln- (2) INFORMATION FOR SEQ ID NO:277:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 113 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:277:- Met Ala Asn Cys Ser Ile Ile Ile Asp Glu Il - #e Ile His His Leu Lys# 15- Arg Pro Pro Asn Pro Leu Leu Asp Pro Asn As - #n Leu Asn Ser Glu Asp# 30- Val Asp Ile Leu Asp Glu Arg Asn Leu Arg Th - #r Pro Asn Leu Leu Ala# 45- Phe Val Arg Ala Val Lys His Leu Glu Asn Al - #a Ser Gly Ile Glu Ala# 60- Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Se - #r Ala Thr Ala Ala Pro#80- Ser Arg His Pro Ile Ile Ile Lys Ala Gly As - #p Trp Gln Glu Phe Arg# 95- Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Gl - #u Gln Ala Gln Glu Gln# 110- Gln- (2) INFORMATION FOR SEQ ID NO:278:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 113 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:278:- Met Ala Asn Cys Ser Ile Met Ile Asp Glu Al - #a Ile His His Leu Lys# 15- Val Pro Pro Ala Pro Leu Leu Asp Ser Asn As - #n Leu Asn Ser Glu Asp# 30- Met Asp Ile Leu Met Glu Arg Asn Leu Arg Le - #u Pro Asn Leu Leu Ala# 45- Phe Val Arg Ala Val Lys Asn Leu Glu Asn Al - #a Ser Gly Ile Glu Ala# 60- Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Se - #r Ala Thr Ala Ala Pro#80- Ser Arg His Pro Ile Ile Ile Lys Ala Gly As - #p Trp Gln Glu Phe Arg# 95- Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Gl - #u Gln Ala Gln Glu Gln# 110- Gln- (2) INFORMATION FOR SEQ ID NO:279:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 113 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:279:- Met Ala Asn Cys Ser Ile Met Ile Asp Glu Al - #a Ile His His Leu Lys# 15- Val Pro Pro Ala Pro Leu Leu Asp Ser Asn As - #n Leu Asn Ser Glu Asp# 30- Met Asp Ile Leu Met Glu Arg Asn Leu Arg Le - #u Pro Asn Leu Leu Ala# 45- Phe Val Arg Ala Val Lys Asn Leu Glu Asn Al - #a Ser Gly Ile Glu Ala# 60- Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Se - #r Ala Thr Ala Ala Pro#80- Ser Arg His Pro Ile Ile Ile Lys Ala Gly As - #p Trp Gln Glu Phe Arg# 95- Glu Lys Leu Gln Phe Tyr Leu Val Thr Leu Gl - #u Gln Ala Gln Glu Gln# 110- Gln- (2) INFORMATION FOR SEQ ID NO:280:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 113 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:280:- Met Ala Asn Cys Ser Ile Met Ile Asp Glu Al - #a Ile His His Leu Lys# 15- Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn As - #n Leu Asn Asp Glu Asp# 30- Val Ser Ile Leu Met Asp Arg Asn Leu Arg Le - #u Pro Asn Leu Glu Ser# 45- Phe Val Arg Ala Val Lys Asn Leu Glu Asn Al - #a Ser Gly Ile Glu Ala# 60- Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Se - #r Ala Thr Ala Ala Pro#80- Ser Arg His Pro Ile Ile Ile Lys Ala Gly As - #p Trp Gln Glu Phe Arg# 95- Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Gl - #u Gln Ala Gln Glu Gln# 110- Gln- (2) INFORMATION FOR SEQ ID NO:281:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 113 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:281:- Met Ala Asn Cys Ser Ile Met Ile Asp Glu Il - #e Ile His His Leu Lys# 15- Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn As - #n Leu Asn Asn Glu Asp# 30- Val Ser Ile Leu Met Asp Arg Asn Leu Arg Le - #u Pro Asn Leu Glu Ser# 45- Phe Val Arg Ala Val Lys Asn Leu Glu Asn Al - #a Ser Gly Ile Glu Ala# 60- Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Se - #r Ala Thr Ala Ala Pro#80- Ser Arg His Pro Ile Ile Ile Lys Ala Gly As - #p Trp Gln Glu Phe Arg# 95- Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Gl - #u Gln Ala Gln Glu Gln# 110- Gln- (2) INFORMATION FOR SEQ ID NO:282:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 113 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:282:- Met Ala Asn Cys Ser Ile Met Ile Asp Glu Il - #e Ile His His Leu Lys# 15- Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn As - #n Leu Asn Ala Glu Asp# 30- Val Ser Ile Leu Met Asp Arg Asn Leu Arg Le - #u Pro Asn Leu Glu Ser# 45- Phe Val Arg Ala Val Lys Asn Leu Glu Asn Al - #a Ser Gly Ile Glu Ala# 60- Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Se - #r Ala Thr Ala Ala Pro#80- Ser Arg His Pro Ile Ile Ile Lys Ala Gly As - #p Trp Gln Glu Phe Arg# 95- Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Gl - #u Gln Ala Gln Glu Gln# 110- Gln- (2) INFORMATION FOR SEQ ID NO:283:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 113 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:283:- Met Ala Asn Cys Ser Ile Met Ile Asp Glu Il - #e Ile His His Leu Lys# 15- Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn As - #n Leu Asn Asp Glu Asp# 30- Val Ser Ile Leu Met Asp Arg Asn Leu Arg Le - #u Pro Asn Leu Glu Ser# 45- Phe Val Arg Ala Val Lys Asn Leu Glu Asn Al - #a Ser Gly Ile Glu Ala# 60- Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Se - #r Ala Thr Ala Ala Pro#80- Ser Arg His Pro Ile Ile Ile Lys Ala Gly As - #p Trp Gln Glu Phe Arg# 95- Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Gl - #u Gln Ala Gln Glu Gln# 110- Gln- (2) INFORMATION FOR SEQ ID NO:284:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 113 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:284:- Met Ala Asn Cys Ser Ile Met Ile Asp Glu Il - #e Ile His His Leu Lys# 15- Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn As - #n Leu Asn Ala Glu Asp# 30- Met Ser Ile Leu Met Asp Arg Asn Leu Arg Le - #u Pro Asn Leu Glu Ser# 45- Phe Val Arg Ala Val Lys Asn Leu Glu Asn Al - #a Ser Gly Ile Glu Ala# 60- Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Se - #r Ala Thr Ala Ala Pro#80- Ser Arg His Pro Ile Ile Ile Lys Ala Gly As - #p Trp Gln Glu Phe Arg# 95- Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Gl - #u Gln Ala Gln Glu Gln# 110- Gln- (2) INFORMATION FOR SEQ ID NO:285:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 113 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:285:- Met Ala Asn Cys Ser Ile Met Ile Asp Glu Il - #e Ile His His Leu Lys# 15- Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn As - #n Leu Asn Asp Glu Asp# 30- Met Ser Ile Leu Met Asp Arg Asn Leu Arg Le - #u Pro Asn Leu Glu Ser# 45- Phe Val Arg Ala Val Lys Asn Leu Glu Asn Al - #a Ser Gly Ile Glu Ala# 60- Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Se - #r Ala Thr Ala Ala Pro#80- Ser Arg His Pro Ile Ile Ile Lys Ala Gly As - #p Trp Gln Glu Phe Arg# 95- Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Gl - #u Gln Ala Gln Glu Gln# 110- Gln- (2) INFORMATION FOR SEQ ID NO:286:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 113 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:286:- Met Ala Asn Cys Ser Ile Met Ile Asp Glu Il - #e Ile His His Leu Lys# 15- Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn As - #n Leu Asn Ser Glu Asp# 30- Met Ser Ile Leu Met Asp Arg Asn Leu Arg Le - #u Pro Asn Leu Glu Ser# 45- Phe Val Arg Ala Val Lys Asn Leu Glu Asn Al - #a Ser Gly Ile Glu Ala# 60- Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Se - #r Ala Thr Ala Ala Pro#80- Ser Arg His Pro Ile Ile Ile Lys Ala Gly As - #p Trp Gln Glu Phe Arg# 95- Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Gl - #u Gln Ala Gln Glu Gln# 110- Gln- (2) INFORMATION FOR SEQ ID NO:287:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 107 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:287:- Met Ala Asn Cys Ser Ile Met Ile Asp Glu Il - #e Ile His His Leu Lys# 15- Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn As - #n Leu Asn Ala Glu Asp# 30- Val Asp Ile Leu Met Glu Arg Asn Leu Arg Le - #u Pro Asn Leu Glu Ser# 45- Phe Val Arg Ala Val Lys Asn Leu Glu Asn Al - #a Ser Gly Ile Glu Ala# 60- Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Se - #r Ala Thr Ala Ala Pro#80- Ser Arg His Pro Ile Ile Ile Lys Ala Gly As - #p Trp Gln Glu Phe Arg# 95- Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Gl - #u# 105- (2) INFORMATION FOR SEQ ID NO:288:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 107 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:288:- Met Asp Asn Cys Ser Ile Met Ile Asp Glu Al - #a Ile His His Leu Lys# 15- Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn As - #n Leu Asn Ala Glu Asp# 30- Val Asp Ile Leu Met Glu Arg Asn Leu Arg Le - #u Pro Asn Leu Glu Ser# 45- Phe Val Arg Ala Val Lys Asn Leu Glu Asn Al - #a Ser Gly Ile Glu Ala# 60- Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Se - #r Ala Thr Ala Ala Pro#80- Ser Arg His Pro Ile Ile Ile Lys Ala Gly As - #p Trp Gln Glu Phe Arg# 95- Glu Lys Leu Gln Phe Tyr Leu Val Thr Leu Gl - #u# 105- (2) INFORMATION FOR SEQ ID NO:289:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 113 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:289:- Met Ala Asn Cys Ser Ile Met Ile Asp Glu Al - #a Ile His His Leu Lys# 15- Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn As - #n Leu Asn Asp Glu Asp# 30- Val Ser Ile Leu Met Asp Arg Asn Leu Arg Le - #u Pro Asn Leu Glu Ser# 45- Phe Val Arg Ala Val Lys Asn Leu Glu Asn Al - #a Ser Gly Ile Glu Ala# 60- Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Se - #r Ala Thr Ala Ala Pro#80- Ser Arg His Pro Ile Ile Ile Lys Ala Gly As - #p Trp Gln Glu Phe Arg# 95- Glu Lys Leu Gln Phe Tyr Leu Val Thr Leu Gl - #u Gln Ala Gln Glu Gln# 110- Gln- (2) INFORMATION FOR SEQ ID NO:290:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 107 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:290:- Met Asp Asn Cys Ser Ile Met Ile Asp Glu Al - #a Ile His His Leu Lys# 15- Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn As - #n Leu Asn Ala Glu Asp# 30- Val Asp Ile Leu Met Glu Arg Asn Leu Arg Le - #u Pro Asn Leu Glu Ser# 45- Phe Val Arg Ala Val Lys Asn Leu Glu Asn Al - #a Ser Gly Ile Glu Ala# 60- Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Se - #r Ala Thr Ala Ala Pro#80- Ser Arg His Pro Ile Ile Ile Lys Ala Gly As - #p Trp Gln Glu Phe Arg# 95- Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Gl - #u# 105- (2) INFORMATION FOR SEQ ID NO:291:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 113 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:291:- Met Ala Asn Cys Ser Ile Met Ile Asp Glu Il - #e Ile His His Leu Lys# 15- Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn As - #n Leu Asn Ala Glu Asp# 30- Val Ser Ile Leu Met Asp Arg Asn Leu Arg Le - #u Pro Asn Leu Glu Ser# 45- Phe Val Arg Ala Val Lys Asn Leu Glu Asn Al - #a Ser Gly Ile Glu Ala# 60- Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Se - #r Ala Thr Ala Ala Pro#80- Ser Arg His Pro Ile Ile Ile Lys Ala Gly As - #p Trp Gln Glu Phe Arg# 95- Glu Lys Leu Gln Phe Tyr Leu Val Thr Leu Gl - #u Gln Ala Gln Glu Gln# 110- Gln- (2) INFORMATION FOR SEQ ID NO:292:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 113 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:292:- Met Ala Asn Cys Ser Ile Met Ile Asp Glu Il - #e Ile His His Leu Lys# 15- Val Pro Pro Arg Pro Ser Leu Asp Pro Asn As - #n Leu Asn Ala Glu Asp# 30- Val Asp Ile Leu Met Glu Arg Asn Leu Arg Le - #u Pro Asn Leu Glu Ser# 45- Phe Val Arg Ala Val Lys Asn Leu Glu Asn Al - #a Ser Gly Ile Glu Ala# 60- Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Se - #r Ala Thr Ala Ala Pro#80- Ser Arg His Pro Ile Ile Ile Lys Ala Gly As - #p Trp Gln Glu Phe Arg# 95- Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Gl - #u Gln Ala Gln Glu Gln# 110- Gln- (2) INFORMATION FOR SEQ ID NO:293:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 113 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:293:- Met Ala Asn Cys Ser Ile Met Ile Asp Glu Il - #e Ile His His Leu Lys# 15- Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn As - #n Leu Asn Ala Glu Asp# 30- Val Asp Ile Leu Met Glu Arg Asn Leu Arg Le - #u Pro Asn Leu Glu Ser# 45- Phe Val Arg Ala Val Lys Asn Leu Glu Asn Al - #a Ser Gly Ile Glu Ala# 60- Ile Leu Arg Asn Leu Trp Pro Cys Leu Pro Se - #r Ala Thr Ala Ala Pro#80- Ser Arg His Pro Ile Ile Ile Lys Ala Gly As - #p Trp Gln Glu Phe Arg# 95- Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Gl - #u Gln Ala Gln Glu Gln# 110- Gln- (2) INFORMATION FOR SEQ ID NO:294:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 113 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:294:- Met Ala Asn Cys Ser Ile Met Ile Asp Glu Al - #a Ile His His Leu Lys# 15- Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn As - #n Leu Asn Asp Glu Asp# 30- Val Ser Ile Leu Met Asp Arg Asn Leu Arg Le - #u Pro Asn Leu Glu Ser# 45- Phe Val Arg Ala Val Lys Asn Leu Glu Asn Al - #a Ser Gly Ile Glu Ala# 60- Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Se - #r Ala Thr Ala Ala Pro#80- Ser Arg His Pro Ile Ile Ile Lys Ala Gly As - #p Trp Gln Glu Phe Arg# 95- Glu Lys Leu Gln Phe Tyr Leu Val Thr Leu Gl - #u Gln Ala Gln Glu Gln# 110- Gln- (2) INFORMATION FOR SEQ ID NO:295:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 113 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:295:- Met Ala Asn Cys Ser Ile Met Ile Asp Glu Il - #e Ile His His Leu Lys# 15- Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn As - #n Leu Asn Ala Glu Asp# 30- Val Asp Ile Leu Met Glu Arg Asn Leu Arg Le - #u Pro Asn Leu Glu Ser# 45- Phe Val Arg Ala Val Lys Asn Leu Glu Asn Al - #a Ser Gly Ile Glu Ala# 60- Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Se - #r Ala Thr Ala Ala Pro#80- Ser Arg His Pro Ile Ile Ile Lys Ala Gly As - #p Trp Gln Glu Phe Arg# 95- Glu Lys Leu Gln Phe Tyr Leu Val Thr Leu Gl - #u Gln Ala Gln Glu Gln# 110- Gln- (2) INFORMATION FOR SEQ ID NO:296:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 113 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:296:- Met Ala Asn Cys Ser Ile Met Ile Asp Glu Il - #e Ile His His Leu Lys# 15- Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn As - #n Leu Asn Ala Glu Asp# 30- Val Asp Ile Leu Met Asp Arg Asn Leu Arg Le - #u Ser Asn Leu Glu Ser# 45- Phe Val Arg Ala Val Lys Asn Leu Glu Asn Al - #a Ser Gly Ile Glu Ala# 60- Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Se - #r Ala Thr Ala Ala Pro#80- Ser Arg His Pro Ile Ile Ile Lys Ala Gly As - #p Trp Gln Glu Phe Arg# 95- Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Gl - #u Gln Ala Gln Glu Gln# 110- Gln- (2) INFORMATION FOR SEQ ID NO:297:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 113 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:297:- Met Ala Asn Cys Ser Ile Met Ile Asp Glu Il - #e Ile His His Leu Lys# 15- Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn As - #n Leu Asn Asp Glu Asp# 30- Met Asp Ile Leu Met Glu Arg Asn Leu Arg Le - #u Pro Asn Leu Glu Ser# 45- Phe Val Arg Ala Val Lys Asn Leu Glu Asn Al - #a Ser Gly Ile Glu Ala# 60- Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Se - #r Ala Thr Ala Ala Pro#80- Ser Arg His Pro Ile Ile Ile Lys Ala Gly As - #p Trp Gln Glu Phe Arg# 95- Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Gl - #u Gln Ala Gln Glu Gln# 110- Gln- (2) INFORMATION FOR SEQ ID NO:298:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 113 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:298:- Met Ala Asn Cys Ser Ile Met Ile Asp Glu Il - #e Ile His His Leu Lys# 15- Arg Pro Pro Ala Pro Ser Leu Asp Pro Asn As - #n Leu Asn Ala Glu Asp# 30- Val Asp Ile Leu Met Glu Arg Asn Leu Arg Le - #u Pro Asn Leu Glu Ser# 45- Phe Val Arg Ala Val Lys Asn Leu Glu Asn Al - #a Ser Gly Ile Glu Ala# 60- Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Se - #r Ala Thr Ala Ala Pro#80- Ser Arg His Pro Ile Ile Ile Lys Ala Gly As - #p Trp Gln Glu Phe Arg# 95- Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Gl - #u Gln Ala Gln Glu Gln# 110- Gln- (2) INFORMATION FOR SEQ ID NO:299:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 113 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:299:- Met Ala Asn Cys Ser Ile Met Ile Asp Glu Il - #e Ile His His Leu Lys# 15- Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn As - #n Leu Asn Asp Glu Asp# 30- Val Asp Ile Leu Met Glu Arg Asn Leu Arg Le - #u Pro Asn Leu Glu Ser# 45- Phe Val Arg Ala Val Lys Asn Leu Glu Asn Al - #a Ser Gly Ile Glu Ala# 60- Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Se - #r Ala Thr Ala Ala Pro#80- Ser Arg His Pro Ile Ile Ile Lys Ala Gly As - #p Trp Gln Glu Phe Arg# 95- Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Gl - #u Gln Ala Gln Glu Gln# 110- Gln- (2) INFORMATION FOR SEQ ID NO:300:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 113 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:300:- Met Ala Asn Cys Ser Ile Met Ile Asp Glu Al - #a Ile His His Leu Lys# 15- Arg Pro Pro Ala Pro Ser Leu Asp Pro Asn As - #n Leu Asn Asp Glu Asp# 30- Met Ser Ile Leu Met Glu Arg Asn Leu Arg Le - #u Pro Asn Leu Glu Ser# 45- Phe Val Arg Ala Val Lys Asn Leu Glu Asn Al - #a Ser Gly Ile Glu Ala# 60- Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Se - #r Ala Thr Ala Ala Pro#80- Ser Arg His Pro Ile Ile Ile Lys Ala Gly As - #p Trp Gln Glu Phe Arg# 95- Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Gl - #u Gln Ala Gln Glu Gln# 110- Gln- (2) INFORMATION FOR SEQ ID NO:301:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 113 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:301:- Met Ala Asn Cys Ser Ile Met Ile Asp Glu Il - #e Ile His His Leu Lys# 15- Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn As - #n Leu Asn Asp Glu Asp# 30- Met Ser Ile Leu Met Glu Arg Asn Leu Arg Le - #u Pro Asn Leu Glu Ser# 45- Phe Val Arg Ala Val Lys Asn Leu Glu Asn Al - #a Ser Gly Ile Glu Ala# 60- Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Se - #r Ala Thr Ala Ala Pro#80- Ser Arg His Pro Ile Ile Ile Lys Ala Gly As - #p Trp Gln Glu Phe Arg# 95- Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Gl - #u Gln Ala Gln Glu Gln# 110- Gln- (2) INFORMATION FOR SEQ ID NO:302:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 113 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:302:- Met Ala Asn Cys Ser Ile Met Ile Asp Glu Al - #a Ile His His Leu Lys# 15- Val Pro Pro Arg Pro Ser Leu Asp Pro Asn As - #n Leu Asn Asp Glu Asp# 30- Val Ser Ile Leu Met Glu Arg Asn Leu Arg Le - #u Pro Asn Leu Glu Ser# 45- Phe Val Arg Ala Val Lys Asn Leu Glu Asn Al - #a Ser Gly Ile Glu Ala# 60- Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Se - #r Ala Thr Ala Ala Pro#80- Ser Arg His Pro Ile Ile Ile Lys Ala Gly As - #p Trp Gln Glu Phe Arg# 95- Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Gl - #u Gln Ala Gln Glu Gln# 110- Gln- (2) INFORMATION FOR SEQ ID NO:303:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 113 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:303:- Met Ala Asn Cys Ser Ile Met Ile Asp Glu Il - #e Ile His His Leu Lys# 15- Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn As - #n Leu Asn Ala Glu Asp# 30- Val Asp Ile Leu Met Glu Arg Asn Leu Arg Le - #u Pro Asn Leu Glu Ser# 45- Phe Val Arg Ala Val Lys Asn Leu Glu Asn Al - #a Ser Gly Ile Glu Ala# 60- Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Se - #r Ala Thr Ala Ala Pro#80- Ser Arg His Pro Ile Ile Ile Arg Met Gly As - #p Trp Gln Glu Phe Arg# 95- Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Gl - #u Gln Ala Gln Glu Gln# 110- Gln- (2) INFORMATION FOR SEQ ID NO:304:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 113 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:304:- Met Ala Asn Cys Ser Ile Met Ile Asp Glu Il - #e Ile His His Leu Lys# 15- Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn As - #n Leu Asn Ala Glu Asp# 30- Val Asp Ile Leu Met Glu Arg Asn Leu Arg Le - #u Pro Asn Leu Glu Ser# 45- Phe Val Arg Ala Val Lys Asn Leu Glu Asn Al - #a Ser Gly Ile Glu Ala# 60- Ile Leu Arg Asn Leu Trp Pro Cys Leu Pro Se - #r Ala Thr Ala Ala Pro#80- Ser Arg His Pro Ile Ile Ile Arg Met Gly As - #p Trp Gln Glu Phe Arg# 95- Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Gl - #u Gln Ala Gln Glu Gln# 110- Gln- (2) INFORMATION FOR SEQ ID NO:305:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 113 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:305:- Met Ala Asn Cys Ser Ile Met Ile Asp Glu Il - #e Ile His His Leu Lys# 15- Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn As - #n Leu Asn Asp Glu Asp# 30- Val Ser Ile Leu Met Glu Arg Asn Leu Arg Le - #u Pro Asn Leu Glu Ser# 45- Phe Val Arg Ala Val Lys Asn Leu Glu Asn Al - #a Ser Gly Ile Glu Ala# 60- Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Se - #r Ala Thr Ala Ala Pro#80- Ser Arg His Pro Ile Ile Ile Lys Ala Gly As - #p Trp Gln Glu Phe Arg# 95- Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Gl - #u Gln Ala Gln Glu Gln# 110- Gln- (2) INFORMATION FOR SEQ ID NO:306:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 113 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:306:- Met Ala Asn Cys Ser Ile Met Ile Asp Glu Al - #a Ile His His Leu Lys# 15- Val Pro Pro Arg Pro Ser Leu Asp Pro Asn As - #n Leu Asn Asp Glu Asp# 30- Val Ser Ile Leu Met Glu Arg Asn Leu Arg Le - #u Pro Asn Leu Glu Ser# 45- Phe Val Arg Ala Val Lys Asn Leu Glu Asn Al - #a Ser Gly Ile Glu Ala# 60- Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Se - #r Ala Thr Ala Ala Pro#80- Ser Arg His Pro Ile Ile Ile Lys Ala Gly As - #p Trp Gln Glu Phe Arg# 95- Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Gl - #u Gln Ala Gln Glu Gln# 110- Gln- (2) INFORMATION FOR SEQ ID NO:307:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 107 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:307:- Met Ala Asn Cys Ser Ile Met Ile Asp Glu Il - #e Ile His His Leu Lys# 15- Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn As - #n Leu Asn Ala Glu Asp# 30- Val Asp Ile Leu Met Glu Arg Asn Leu Arg Le - #u Pro Asn Leu Glu Ser# 45- Phe Val Arg Ala Val Lys Asn Leu Glu Asn Al - #a Ser Gly Ile Glu Ala# 60- Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Se - #r Ala Thr Ala Ala Pro#80- Ser Arg His Pro Ile Ile Ile Lys Ala Gly As - #p Trp Gln Glu Phe Arg# 95- Glu Lys Leu Gln Phe Tyr Leu Val Thr Leu Gl - #u# 105- (2) INFORMATION FOR SEQ ID NO:308:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 113 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:308:- Met Ala Asn Cys Ser Ile Met Ile Asp Glu Il - #e Ile His His Leu Lys# 15- Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn As - #n Leu Asn Ala Glu Asp# 30- Val Asp Ile Leu Met Asp Arg Asn Leu Arg Le - #u Pro Asn Leu Glu Ser# 45- Phe Val Arg Ala Val Lys Asn Leu Glu Asn Al - #a Ser Gly Ile Glu Ala# 60- Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Se - #r Ala Thr Ala Ala Pro#80- Ser Arg His Pro Ile Ile Ile Lys Ala Gly As - #p Trp Gln Glu Phe Arg# 95- Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Gl - #u Gln Ala Gln Glu Gln# 110- Gln- (2) INFORMATION FOR SEQ ID NO:309:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 113 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:309:- Met Ala Asn Cys Ser Ile Met Ile Asp Glu Il - #e Ile His His Leu Lys# 15- Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn As - #n Leu Asn Asp Glu Asp# 30- Val Ser Ile Leu Met Glu Arg Asn Leu Arg Le - #u Pro Asn Leu Glu Ser# 45- Phe Val Arg Ala Val Lys Asn Leu Glu Asn Al - #a Ser Gly Ile Glu Ala# 60- Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Se - #r Ala Thr Ala Ala Pro#80- Ser Arg His Pro Ile Ile Ile Lys Ala Gly As - #p Trp Gln Glu Phe Arg# 95- Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Gl - #u Gln Ala Gln Glu Gln# 110- Gln- (2) INFORMATION FOR SEQ ID NO:310:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 113 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:310:- Met Ala Asn Cys Ser Ile Met Ile Asp Glu Il - #e Ile His His Leu Lys# 15- Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn As - #n Leu Asn Asp Glu Asp# 30- Met Ser Ile Leu Met Glu Arg Asn Leu Arg Le - #u Pro Asn Leu Glu Ser# 45- Phe Val Arg Ala Val Lys Asn Leu Glu Asn Al - #a Ser Gly Ile Glu Ala# 60- Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Se - #r Ala Thr Ala Ala Pro#80- Ser Arg His Pro Ile Ile Ile Lys Ala Gly As - #p Trp Gln Glu Phe Arg# 95- Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Gl - #u Gln Ala Gln Glu Gln# 110- Gln- (2) INFORMATION FOR SEQ ID NO:311:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 113 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:311:- Met Ala Asn Cys Ser Ile Met Ile Asp Glu Al - #a Ile His His Leu Lys# 15- Arg Pro Pro Ala Pro Ser Leu Asp Pro Asn As - #n Leu Asn Asp Glu Asp# 30- Val Ser Ile Leu Met Asp Arg Asn Leu Arg Le - #u Ser Asn Leu Glu Ser# 45- Phe Val Arg Ala Val Lys Asn Leu Glu Asn Al - #a Ser Gly Ile Glu Ala# 60- Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Se - #r Ala Thr Ala Ala Pro#80- Ser Arg His Pro Ile Ile Ile Lys Ala Gly As - #p Trp Gln Glu Phe Arg# 95- Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Gl - #u Gln Ala Gln Glu Gln# 110- Gln- (2) INFORMATION FOR SEQ ID NO:312:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 113 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:312:- Met Ala Asn Cys Ser Ile Met Ile Asp Glu Al - #a Ile His His Leu Lys# 15- Arg Pro Pro Ala Pro Ser Leu Asp Pro Asn As - #n Leu Asn Asp Glu Asp# 30- Met Ser Ile Leu Met Asp Arg Asn Leu Arg Le - #u Pro Asn Leu Glu Ser# 45- Phe Val Arg Ala Val Lys Asn Leu Glu Asn Al - #a Ser Gly Ile Glu Ala# 60- Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Se - #r Ala Thr Ala Ala Pro#80- Ser Arg His Pro Ile Ile Ile Lys Ala Gly As - #p Trp Gln Glu Phe Arg# 95- Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Gl - #u Gln Ala Gln Glu Gln# 110- Gln- (2) INFORMATION FOR SEQ ID NO:313:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 113 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:313:- Met Ala Asn Cys Ser Ile Met Ile Asp Glu Il - #e Ile His His Leu Lys# 15- Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn As - #n Leu Asn Ala Glu Asp# 30- Val Asp Ile Leu Met Glu Arg Asn Leu Arg Le - #u Pro Asn Leu Glu Ser# 45- Phe Val Arg Ala Val Lys Asn Leu Glu Asn Al - #a Ser Gly Ile Glu Ala# 60- Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Se - #r Ala Thr Ala Ala Pro#80- Ser Arg His Pro Ile Ile Ile Lys Ala Gly As - #p Trp Gln Glu Phe Arg# 95- Glu Lys Leu Gln Phe Tyr Leu Trp Thr Leu Gl - #u Gln Ala Gln Glu Gln# 110- Gln- (2) INFORMATION FOR SEQ ID NO:314:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 113 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:314:- Met Asp Asn Cys Ser Ile Met Ile Asp Glu Al - #a Ile His His Leu Lys# 15- Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn As - #n Leu Asn Ala Glu Asp# 30- Val Asp Ile Leu Met Glu Arg Asn Leu Arg Le - #u Pro Asn Leu Glu Ser# 45- Phe Val Arg Ala Val Lys Asn Leu Glu Asn Al - #a Ser Gly Ile Glu Ala# 60- Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Se - #r Ala Thr Ala Ala Pro#80- Ser Arg His Pro Ile Ile Ile Lys Ala Gly As - #p Trp Gln Glu Phe Arg# 95- Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Gl - #u Gln Ala Gln Glu Gln# 110- Gln- (2) INFORMATION FOR SEQ ID NO:315:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 125 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:315:- Met Ala Tyr Pro Glu Thr Asp Tyr Lys Asp As - #p Asp Asp Lys Asn Cys# 15- Ser Ile Met Ile Asp Glu Ile Ile His His Le - #u Lys Arg Pro Pro Ala# 30- Pro Leu Leu Asp Pro Asn Asn Leu Asn Ala Gl - #u Asp Val Asp Ile Leu# 45- Met Glu Arg Asn Leu Arg Leu Pro Asn Leu Gl - #u Ser Phe Val Arg Ala# 60- Val Lys Asn Leu Glu Asn Ala Ser Gly Ile Gl - #u Ala Ile Leu Arg Asn#80- Leu Gln Pro Cys Leu Pro Ser Ala Thr Ala Al - #a Pro Ser Arg His Pro# 95- Ile Ile Ile Lys Ala Gly Asp Trp Gln Glu Ph - #e Arg Glu Lys Leu Thr# 110- Phe Tyr Leu Val Thr Leu Glu Gln Ala Gln Gl - #u Gln Gln# 125- (2) INFORMATION FOR SEQ ID NO:316:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 125 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:316:- Met Ala Tyr Pro Glu Thr Asp Tyr Lys Asp As - #p Asp Asp Lys Asn Cys# 15- Ser Ile Met Ile Asp Glu Ile Ile His His Le - #u Lys Arg Pro Pro Asn# 30- Pro Leu Leu Asp Pro Asn Asn Leu Asn Ser Gl - #u Asp Met Asp Ile Leu# 45- Met Glu Arg Asn Leu Arg Thr Pro Asn Leu Le - #u Ala Phe Val Arg Ala# 60- Val Lys His Leu Glu Asn Ala Ser Gly Ile Gl - #u Ala Ile Leu Arg Asn#80- Leu Gln Pro Cys Leu Pro Ser Ala Thr Ala Al - #a Pro Ser Arg His Pro# 95- Ile Ile Ile Lys Ala Gly Asp Trp Gln Glu Ph - #e Arg Glu Lys Leu Thr# 110- Phe Tyr Leu Val Thr Leu Glu Gln Ala Gln Gl - #u Gln Gln# 125- (2) INFORMATION FOR SEQ ID NO:317:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 113 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:317:- Met Ala Asn Cys Ser Ile Met Pro Asp Glu Al - #a Ile His His Leu Lys# 15- Ile Pro Pro Asn Pro Ser Leu Asp Ser Ala As - #n Leu Asn Ser Glu Asp# 30- Val Ser Ile Leu Met Glu Arg Asn Leu Arg Th - #r Pro Asn Leu Leu Ala# 45- Phe Val Arg Ala Val Lys His Leu Glu Asn Al - #a Ser Gly Ile Glu Ala# 60- Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Se - #r Ala Thr Ala Ala Pro#80- Ser Arg His Pro Ile Ile Ile Lys Ala Gly As - #p Trp Gln Glu Phe Arg# 95- Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Gl - #u Gln Ala Gln Glu Gln# 110- Gln- (2) INFORMATION FOR SEQ ID NO:318:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 113 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:318:- Met Ala Asn Cys Ser Ile Met Ile Asp Glu Le - #u Ile His His Leu Lys# 15- Ile Pro Pro Asn Pro Ser Leu Asp Ser Ala As - #n Leu Asn Ser Glu Asp# 30- Val Ser Ile Leu Met Glu Arg Asn Leu Arg Th - #r Pro Asn Leu Leu Ala# 45- Phe Val Arg Ala Val Lys His Leu Glu Asn Al - #a Ser Gly Ile Glu Ala# 60- Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Se - #r Ala Thr Ala Ala Pro#80- Ser Arg His Pro Ile Ile Ile Lys Ala Gly As - #p Trp Gln Glu Phe Arg# 95- Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Gl - #u Gln Ala Gln Glu Gln# 110- Gln- (2) INFORMATION FOR SEQ ID NO:319:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 113 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:319:- Met Ala Asn Cys Ser Ile Met Ile Asp Glu Al - #a Ile His His Leu Lys# 15- Ile Pro Pro Asn Pro Ser Leu Asp Ser Ala As - #n Leu Asn Ser Glu Asp# 30- Val Ser Ile Leu Met Glu Arg Asn Leu Arg Th - #r Pro Asn Leu Leu Ala# 45- Phe Val Arg Ala Val Lys His Leu Glu Asn Al - #a Ser Gly Ile Glu Pro# 60- Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Se - #r Ala Thr Ala Ala Pro#80- Ser Arg Thr Pro Ile Ile Ile Lys Ala Gly As - #p Trp Gln Glu Phe Arg# 95- Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Gl - #u Gln Ala Gln Glu Gln# 110- Gln- (2) INFORMATION FOR SEQ ID NO:320:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 113 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:320:- Met Ala Asn Cys Ser Ile Ile Leu Asp Glu Al - #a Ile His His Leu Lys# 15- Ile Pro Pro Asn Pro Ser Leu Asp Ser Ala As - #n Leu Asn Ser Glu Asp# 30- Val Ser Ile Leu Met Glu Arg Asn Leu Arg Th - #r Pro Asn Leu Leu Ala# 45- Phe Val Arg Ala Val Lys His Leu Glu Asn Al - #a Ser Gly Ile Glu Pro# 60- Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Se - #r Ala Thr Ala Ala Pro#80- Ser Arg Thr Pro Ile Ile Ile Lys Ala Gly As - #p Trp Gln Glu Phe Arg# 95- Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Gl - #u Gln Ala Gln Glu Gln# 110- Gln- (2) INFORMATION FOR SEQ ID NO:321:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 113 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:321:- Met Ala Asn Cys Ser Ile Met Ile Asp Glu Il - #e Ile His His Leu Lys# 15- Arg Pro Pro Asn Pro Leu Leu Asp Pro Asn As - #n Leu Asn Ser Glu Asp# 30- Met Asp Ile Leu Met Asp Ser Asn Leu Arg Th - #r Pro Asn Leu Leu Ala# 45- Phe Pro His Ala Ser Lys Gln Leu Glu Asn Al - #a Ser Gly Ile Glu Ala# 60- Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Se - #r Ala Thr Ala Ala Pro#80- Ser Arg His Pro Ile Ile Ile Lys Ala Gly As - #p Trp Gln Glu Phe Arg# 95- Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Gl - #u Gln Ala Gln Glu Gln# 110- Gln- (2) INFORMATION FOR SEQ ID NO:322:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 113 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:322:- Met Ala Asn Cys Ser Ile Met Ile Asp Glu Il - #e Ile His His Leu Lys# 15- Arg Pro Pro Asn Pro Leu Leu Asp Pro Asn As - #n Leu Asn Ser Glu Asp# 30- Met Asp Ile Leu Met Glu Arg Asn Leu Arg Th - #r Pro Asn Leu Leu Ala# 45- Phe Val Arg Ala Val Lys His Leu Glu Asn Al - #a Ser Gly Ile Glu Ala# 60- Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Se - #r Ala Thr Ala Ala Pro#80- Ser Arg His Pro Ile Ile Ile Lys Ala Gly As - #p Trp Gln Glu Phe Arg# 95- Leu Lys Leu Gln Phe Tyr Leu Ser Thr Leu Gl - #u Gln Ala Gln Glu Gln# 110- Gln- (2) INFORMATION FOR SEQ ID NO:323:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 106 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:323:- Met Ala Asn Cys Ser Ile Met Ile Asp Glu Il - #e Ile His His Leu Lys# 15- Arg Pro Pro Asn Pro Leu Leu Asp Pro Asn As - #n Leu Asn Ser Glu Asp# 30- Met Asp Ile Leu Met Glu Arg Asn Leu Arg Th - #r Pro Asn Leu Leu Ala# 45- Phe Val Arg Ala Val Lys His Leu Glu Asn Al - #a Ser Gly Ile Glu Ala# 60- Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Se - #r Ala Thr Ala Ala Pro#80- Ser Arg His Pro Ile Ile Ile Lys Ala Gly As - #p Trp Gln Glu Phe Arg# 95- Leu Lys Leu Gln Phe Tyr Leu Ser Thr Leu# 105- (2) INFORMATION FOR SEQ ID NO:324:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 113 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:324:- Met Ala Asn Cys Ser Ile Met Ile Asp Glu Il - #e Ile His His Leu Lys# 15- Arg Pro Pro Asn Pro Leu Leu Asp Pro Asn As - #n Leu Asn Ser Glu Asp# 30- Met Asp Ile Leu Met Glu Arg Asn Leu Arg Th - #r Pro Asn Leu Leu Ala# 45- Phe Val Arg Ala Val Lys His Leu Glu Asn Al - #a Ser Gly Ile Glu Ala# 60- Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Se - #r Ala Thr Ala Ala Pro#80- Ser Arg His Pro Ile Ile Ile Lys Ala Gly As - #p Trp Gln Glu Phe Arg# 95- Leu Lys Leu Gln Phe Tyr Leu Ser Ser Leu Gl - #u Gln Ala Gln Glu Gln# 110- Gln- (2) INFORMATION FOR SEQ ID NO:325:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 113 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:325:- Met Ala Asn Cys Ser Ile Met Ile Asp Glu Il - #e Ile His His Leu Lys# 15- Arg Pro Pro Asn Pro Leu Leu Asp Pro Asn As - #n Leu Asn Ser Glu Asp# 30- Met Asp Ile Leu Met Asp Ser Asn Leu Leu Th - #r Pro Asn Leu Leu Ala# 45- Phe Pro His Ala Ser Lys Gln Leu Glu Asn Al - #a Ser Gly Ile Glu Ala# 60- Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Se - #r Ala Thr Ala Ala Pro#80- Ser Arg His Pro Ile Ile Ile Lys Ala Gly As - #p Trp Gln Glu Phe Arg# 95- Leu Lys Leu Gln Phe Tyr Leu Ser Ser Leu Gl - #u Gln Ala Gln Glu Gln# 110- Gln- (2) INFORMATION FOR SEQ ID NO:326:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 113 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:326:- Met Ala Asn Cys Ser Ile Met Ile Asp Glu Il - #e Ile His His Leu Lys# 15- Arg Pro Pro Asn Pro Leu Leu Asp Pro Asn As - #n Leu Asn Ser Glu Asp# 30- Met Asp Ile Leu Met Glu Arg Asn Leu Arg Th - #r Pro Asn Leu Leu Ala# 45- Phe Val Arg Ala Val Lys His Leu Glu Asn Al - #a Ser Gly Ile Glu Pro# 60- Ile Leu Ser Asn Leu Gln Pro Cys Val Pro Ty - #r Trp Thr Ala Pro Pro#80- Ser Arg Thr Pro Ile Thr Ile Lys Ala Gly As - #p Trp Gln Glu Phe Arg# 95- Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Gl - #u Gln Ala Gln Glu Gln# 110- Gln- (2) INFORMATION FOR SEQ ID NO:327:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 113 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:327:- Met Ala Asn Cys Ser Ile Met Ile Asp Glu Il - #e Ile His His Leu Lys# 15- Arg Pro Pro Asn Pro Leu Leu Asp Pro Asn As - #n Leu Asn Ser Glu Asp# 30- Met Asp Ile Leu Met Glu Arg Asn Leu Arg Th - #r Pro Asn Leu Leu Ala# 45- Phe Val Arg Ala Val Lys His Leu Glu Asn Al - #a Ser Gly Ile Glu Pro# 60- Ile Leu Ser Asn Leu Gln Pro Cys Val Pro Ty - #r Trp Thr Ala Pro Pro#80- Ser Arg Thr Pro Ile Thr Ile Lys Ala Gly As - #p Trp Gln Glu Phe Arg# 95- Leu Lys Leu Gln Phe Tyr Leu Ser Thr Leu Gl - #u Gln Ala Gln Glu Gln# 110- Gln- (2) INFORMATION FOR SEQ ID NO:328:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 113 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:328:- Met Ala Asn Cys Ser Ile Met Ile Asp Glu Le - #u Ile His His Leu Lys# 15- Ile Pro Pro Asn Pro Ser Leu Asp Ser Ala As - #n Leu Asn Ser Glu Asp# 30- Val Ser Ile Leu Met Glu Arg Asn Leu Arg Th - #r Pro Asn Leu Leu Ala# 45- Phe Val Arg Ala Val Lys His Leu Glu Asn Al - #a Ser Gly Ile Glu Pro# 60- Ile Leu Ser Asn Leu Gln Pro Cys Val Pro Ty - #r Trp Thr Ala Pro Pro#80- Ser Arg Thr Pro Ile Thr Ile Lys Ala Gly As - #p Trp Gln Glu Phe Arg# 95- Leu Lys Leu Gln Phe Tyr Leu Ser Thr Leu Gl - #u Gln Ala Gln Glu Gln# 110- Gln- (2) INFORMATION FOR SEQ ID NO:329:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 113 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:329:- Met Ala Asn Cys Ser Ile Met Ile Asp Glu Le - #u Ile His His Leu Lys# 15- Ile Pro Pro Asn Pro Ser Leu Asp Ser Ala As - #n Leu Asn Ser Glu Asp# 30- Val Ser Ile Leu Met Glu Arg Asn Leu Arg Th - #r Pro Asn Leu Leu Ala# 45- Phe Val Arg Ala Val Lys His Leu Glu Asn Al - #a Ser Gly Ile Glu Ala# 60- Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Se - #r Ala Thr Ala Ala Pro#80- Ser Arg His Pro Ile Ile Ile Lys Ala Gly As - #p Trp Gln Glu Phe Arg# 95- Leu Lys Leu Gln Phe Tyr Leu Ser Ser Leu Gl - #u Gln Ala Gln Glu Gln# 110- Gln- (2) INFORMATION FOR SEQ ID NO:330:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 113 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:330:- Met Ala Asn Cys Ser Ile Met Ile Asp Glu Le - #u Ile His His Leu Lys# 15- Ile Pro Pro Asn Pro Ser Leu Asp Ser Ala As - #n Leu Asn Ser Glu Asp# 30- Val Ser Ile Leu Met Glu Arg Asn Leu Arg Th - #r Pro Asn Leu Leu Ala# 45- Phe Val Arg Ala Val Lys His Leu Glu Asn Al - #a Ser Gly Ile Glu Pro# 60- Ile Leu Ser Asn Leu Gln Pro Cys Val Pro Ty - #r Trp Thr Ala Pro Pro#80- Ser Arg Thr Pro Ile Thr Ile Lys Ala Gly As - #p Trp Gln Glu Phe Arg# 95- Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Gl - #u Gln Ala Gln Glu Gln# 110- Gln- (2) INFORMATION FOR SEQ ID NO:331:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 113 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:331:- Met Ala Asn Cys Ser Ile Met Ile Asp Glu Al - #a Ile His His Leu Lys# 15- Arg Pro Pro Ala Pro Ser Leu Asp Pro Asn As - #n Leu Asn Asp Glu Asp# 30- Met Ser Ile Leu Met Asp Arg Asn Leu Arg Le - #u Ser Asn Leu Glu Ser# 45- Phe Val Arg Ala Val Lys Asn Leu Glu Asn Al - #a Ser Gly Ile Glu Ala# 60- Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Se - #r Ala Thr Ala Ala Pro#80- Ser Arg His Pro Ile Ile Ile Lys Ala Gly As - #p Trp Gln Glu Phe Arg# 95- Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Gl - #u Gln Ala Gln Glu Gln# 110- Gln- (2) INFORMATION FOR SEQ ID NO:332:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 339 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:332:- ATGGCAAACT GCTCTATAGC TATCGATGAA ATTATACATC ACTTAAAGAG AC - #CACCTAAC 60- CCTTTGCTGG ACCCGAACAA CCTCAATTCC GAAGACATGG ATATCCTGAT GG - #AACGAAAC 120- CTTCGAACTC CAAACCTGCT CGCATTCGTA AGGGCTGTCA AGCACTTAGA AA - #ATGCATCA 180- GGTATTGAGG CAATTCTTCG TAATCTCCAA CCATGTCTGC CCTCTGCCAC GG - #CCGCACCC 240- TCTCGACATC CAATCATCAT CAAGGCAGGT GACTGGCAAG AATTCCGGGA AA - #AACTGACG 300# 339 TTGA GCAAGCGCAG GAACAACAG- (2) INFORMATION FOR SEQ ID NO:333:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 339 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:333:- ATGGCAAACT GCTCTATAAT CATCGATGAA ATTATACATC ACTTAAAGAG AC - #CACCTAAC 60- CCTTTGCTGG ACCCGAACAA CCTCAATTCC GAAGACATGG ATATCCTGAT GG - #AACGAAAC 120- CTTCGAACTC CAAACCTGCT CGCATTCGTA AGGGCTGTCA AGCACTTAGA AA - #ATGCATCA 180- GGTATTGAGG CAATTCTTCG TAATCTCCAA CCATGTCTGC CCTCTGCCAC GG - #CCGCACCC 240- TCTCGACATC CAATCATCAT CAAGGCAGGT GACTGGCAAG AATTCCGGGA AA - #AACTGACG 300# 339 TTGA GCAAGCGCAG GAACAACAG- (2) INFORMATION FOR SEQ ID NO:334:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 339 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:334:- ATGGCTAACT GCTCTATAAT GATCGATGAA ATTATACATC ACTTAAAGAG AC - #CACCTAAC 60- CCTTTGCTGG ACCCGAACAA CCTCAATTCT GAAGACGTTG ATATCCTGAT GG - #AACGAAAC 120- CTTCGAACTC CAAACCTGCT CGCATTCGTA AGGGCTGTCA AGCACTTAGA AA - #ATGCATCA 180- GGTATTGAGG CAATTCTTCG TAATCTCCAA CCATGTCTGC CCTCTGCCAC GG - #CCGCACCC 240- TCTCGACATC CAATCATCAT CAAGGCAGGT GACTGGCAAG AATTCCGGGA AA - #AACTGACG 300# 339 TTGA GCAAGCGCAG GAACAACAG- (2) INFORMATION FOR SEQ ID NO:335:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 339 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:335:- ATGGCAAACT GCTCTATAGC TATCGATGAA ATTATACATC ACTTAAAGAG AC - #CACCTAAC 60- CCTTTGCTGG ACCCGAACAA CCTCAATTCT GAAGACGTTG ATATCCTGAT GG - #AACGAAAC 120- CTTCGAACTC CAAACCTGCT CGCATTCGTA AGGGCTGTCA AGCACTTAGA AA - #ATGCATCA 180- GGTATTGAGG CAATTCTTCG TAATCTCCAA CCATGTCTGC CCTCTGCCAC GG - #CCGCACCC 240- TCTCGACATC CAATCATCAT CAAGGCAGGT GACTGGCAAG AATTCCGGGA AA - #AACTGACG 300# 339 TTGA GCAAGCGCAG GAACAACAG- (2) INFORMATION FOR SEQ ID NO:336:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 339 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:336:- ATGGCAAACT GCTCTATAAT GATCCATGAA ATTATACATC ACTTAAAGAG AC - #CACCTAAC 60- CCTTTGCTGG ACCCGAACAA CCTCAATTCT GAAGACGTTG ATATCCTGAT GG - #AACGAAAC 120- CTTCGAACTC CAAACCTGCT CGCATTCGTA AGGGCTGTCA AGCACTTAGA AA - #ATGCATCA 180- GGTATTGAGG CAATTCTTCG TAATCTCCAA CCATGTCTGC CCTCTGCCAC GG - #CCGCACCC 240- TCTCGACATC CAATCATCAT CAAGGCAGGT GACTGGCAAG AATTCCGGGA AA - #AACTGACG 300# 339 TTGA GCAAGCGCAG GAACAACAG- (2) INFORMATION FOR SEQ ID NO:337:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 339 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:337:- ATGGCTAACT GCTCTATAAT GATCGATGAA ATTATACATC ACTTAAAGAG AC - #CACCTAAC 60- CCTTTGCTGG ACCCGAACAA CCTCAATTCC GAAGACATGG ATATCCTGAT CG - #AACGAAAC 120- CTTCGAACTC CAAACCTGCT CGCATTCGTA AGGGCTGTCA AGCACTTAGA AA - #ATGCATCA 180- GGTATTGAGG CAATTCTTCG TAATCTCCAA CCATGTCTGC CCTCTGCCAC GG - #CCGCACCC 240- TCTCGACATC CAATCATCAT CAAGGCAGGT GACTGGCAAG AATTCCGGGA AA - #AACTGACG 300# 339 TTGA GCAAGCGCAG GAACAACAG- (2) INFORMATION FOR SEQ ID NO:338:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 339 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:338:- ATGGCTAACT GCTCTATAAT GATCGATGAA ATTATACATC ACTTAAAGAG AC - #CACCTAAC 60- CCTTTGCTGG ACCCGAACAA CCTCAATTCC GAAGACATGG ATATCCTGCT GG - #AACGAAAC 120- CTTCGAACTC CAAACCTGCT CGCATTCGTA AGGGCTGTCA AGCACTTAGA AA - #ATGCATCA 180- GGTATTGAGG CAATTCTTCG TAATCTCCAA CCATGTCTGC CCTCTGCCAC GG - #CCGCACCC 240- TCTCGACATC CAATCATCAT CAAGGCAGGT GACTGGCAAG AATTCCGGGA AA - #AACTGACG 300# 339 TTGA GCAAGCGCAG GAACAACAG- (2) INFORMATION FOR SEQ ID NO:339:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 339 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:339:- ATGGCTAACT GCTCTATAAT GATCGATGAA ATTATACATC ACTTAAAGAG AC - #CACCTAAC 60- CCTTTGCTGG ACCCGAACAA CCTCAATTCC GAAGACATGG ATATCCTGGA CG - #AACGAAAC 120- CTTCGAACTC CAAACCTGCT CGCATTCGTA AGGGCTGTCA AGCACTTAGA AA - #ATGCATCA 180- GGTATTGAGG CAATTCTTCG TAATCTCCAA CCATGTCTGC CCTCTGCCAC GG - #CCGCACCC 240- TCTCGACATC CAATCATCAT CAAGGCAGGT GACTGGCAAG AATTCCGGGA AA - #AACTGACG 300# 339 TTGA GCAAGCGCAG GAACAACAG- (2) INFORMATION FOR SEQ ID NO:340:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 339 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:340:- ATGGCAAACT GCTCTATAGC TATCGATGAA ATTATACATC ACTTAAAGAG AC - #CACCTAAC 60- CCTTTGCTGG ACCCGAACAA CCTCAATTCT GAAGACGTTG ATATCCTGAT CG - #AACGAAAC 120- CTTCGAACTC CAAACCTGCT CGCATTCGTA AGGGCTGTCA AGCACTTAGA AA - #ATGCATCA 180- GGTATTGAGG CAATTCTTCG TAATCTCCAA CCATGTCTGC CCTCTGCCAC GG - #CCGCACCC 240- TCTCGACATC CAATCATCAT CAAGGCAGGT GACTGGCAAG AATTCCGGGA AA - #AACTGACG 300# 339 TTGA GCAAGCGCAG GAACAACAG- (2) INFORMATION FOR SEQ ID NO:341:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 339 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:341:- ATGGCAAACT GCTCTATAAT CATCGATGAA ATTATACATC ACTTAAAGAG AC - #CACCTAAC 60- CCTTTGCTGG ACCCGAACAA CCTCAATTCT GAAGACGTTG ATATCCTGAT CG - #AACGAAAC 120- CTTCGAACTC CAAACCTGCT CGCATTCGTA AGGGCTGTCA AGCACTTAGA AA - #ATGCATCA 180- GGTATTGAGG CAATTCTTCG TAATCTCCAA CCATGTCTGC CCTCTGCCAC GG - #CCGCACCC 240- TCTCGACATC CAATCATCAT CAAGGCAGGT GACTGGCAAG AATTCCGGGA AA - #AACTGACG 300# 339 TTGA GCAAGCGCAG GAACAACAG- (2) INFORMATION FOR SEQ ID NO:342:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 339 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:342:- ATGGCAAACT GCTCTATAGC TATCGATGAA ATTATACATC ACTTAAAGAG AC - #CACCTAAC 60- CCTTTGCTGG ACCCGAACAA CCTCAATTCT GAAGACGTTG ATATCCTGCT GG - #AACGAAAC 120- CTTCGAACTC CAAACCTGCT CGCATTCGTA AGGGCTGTCA AGCACTTAGA AA - #ATGCATCA 180- GGTATTGAGG CAATTCTTCG TAATCTCCAA CCATGTCTGC CCTCTGCCAC GG - #CCGCACCC 240- TCTCGACATC CAATCATCAT CAAGGCAGGT GACTGGCAAG AATTCCGGGA AA - #AACTGACG 300# 339 TTGA GCAAGCGCAG GAACAACAG- (2) INFORMATION FOR SEQ ID NO:343:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 339 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:343:- ATGGCAAACT GCTCTATAAT CATCGATGAA ATTATACATC ACTTAAAGAG AC - #CACCTAAC 60- CCTTTGCTGG ACCCGAACAA CCTCAATTCT GAAGACGTTG ATATCCTGCT GG - #AACGAAAC 120- CTTCGAACTC CAAACCTGCT CGCATTCGTA AGGGCTGTCA AGCACTTAGA AA - #ATGCATCA 180- GGTATTGAGG CAATTCTTCG TAATCTCCAA CCATGTCTGC CCTCTGCCAC GG - #CCGCACCC 240- TCTCGACATC CAATCATCAT CAAGGCAGGT GACTGGCAAG AATTCCGGGA AA - #AACTGACG 300# 339 TTGA GCAAGCGCAG GAACAACAG- (2) INFORMATION FOR SEQ ID NO:344:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 339 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:344:- ATGGCAAACT GCTCTATAGC TATCGATGAA ATTATACATC ACTTAAAGAG AC - #CACCTAAC 60- CCTTTGCTGG ACCCGAACAA CCTCAATTCT GAAGACGTTG ATATCCTGGA CG - #AACGAAAC 120- CTTCGAACTC CAAACCTGCT CGCATTCGTA AGGGCTGTCA AGCACTTAGA AA - #ATGCATCA 180- GGTATTGAGG CAATTCTTCG TAATCTCCAA CCATGTCTGC CCTCTGCCAC GG - #CCGCACCC 240- TCTCGACATC CAATCATCAT CAAGGCAGGT GACTGGCAAG AATTCCGGGA AA - #AACTGACG 300# 339 TTGA GCAAGCGCAG GAACAACAG- (2) INFORMATION FOR SEQ ID NO:345:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 339 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:345:- ATGGCAAACT GCTCTATAAT CATCGATGAA ATTATACATC ACTTAAAGAG AC - #CACCTAAC 60- CCTTTGCTGG ACCCGAACAA CCTCAATTCT GAAGACGTTG ATATCCTGGA CG - #AACGAAAC 120- CTTCGAACTC CAAACCTGCT CGCATTCGTA AGGGCTGTCA AGCACTTAGA AA - #ATGCATCA 180- GGTATTGAGG CAATTCTTCG TAATCTCCAA CCATGTCTGC CCTCTGCCAC GG - #CCGCACCC 240- TCTCGACATC CAATCATCAT CAAGGCAGGT GACTGGCAAG AATTCCGGGA AA - #AACTGACG 300# 339 TTGA GCAAGCGCAG GAACAACAG- (2) INFORMATION FOR SEQ ID NO:346:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 339 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:346:- ATGGCTAACT GCTCTATTAT GATCGATGAA GCAATACATC ACTTAAAGGT TC - #CACCTGCA 60- CCTTTGCTGG ACAGTAACAA CCTCAATTCC GAAGACATGG ATATCCTGAT GG - #AACGAAAC 120- CTTCGACTTC CAAACCTGCT CGCATTCGTA AGGGCTGTCA AGAACTTAGA AA - #ATGCATCA 180- GGTATTGAGG CAATTCTTCG TAATCTCCAA CCATGTCTGC CCTCTGCCAC GG - #CCGCACCC 240- TCTCGACATC CAATCATCAT CAAGGCAGGT GACTGGCAAG AATTCCGGGA AA - #AACTGACG 300# 339 TTGA GCAAGCGCAG GAACAACAG- (2) INFORMATION FOR SEQ ID NO:347:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 339 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:347:- ATGGCTAACT GCTCTATAAT GATCGATGAA GCAATACATC ACTTAAAGGT TC - #CACCTGCA 60- CCTTTGCTGG ACAGTAACAA CCTCAATTCC GAAGACATGG ATATCCTGAT GG - #AACGAAAC 120- CTTCGACTTC CAAACCTGCT CGCATTCGTA AGGGCTGTCA AGAACTTAGA AA - #ATGCATCA 180- GGTATTGAGG CAATTCTTCG TAATCTCCAA CCATGTCTGC CCTCTGCCAC GG - #CCGCACCC 240- TCTCGACATC CAATCATCAT CAAGGCAGGT GACTGGCAAG AATTCCGGGA AA - #AACTGCAA 300# 339 TTGA GCAAGCGCAG GAACAACAG- (2) INFORMATION FOR SEQ ID NO:348:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 339 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:348:- ATGGCTAACT GCTCTATAAT GATCGATGAA GCAATACATC ACTTAAAGAG AC - #CACCTGCA 60- CCTTTGCTGG ACCCGAACAA CCTCAATGAC GAAGACGTTT CTATTCTGAT GG - #ACCGAAAC 120- CTTCGACTTC CAAACCTGGA GAGCTTCGTA AGGGCTGTCA AGAACTTAGA AA - #ATGCATCA 180- GGTATTGAGG CAATTCTTCG TAATCTCCAA CCATGTCTGC CCTCTGCCAC GG - #CCGCACCC 240- TCTCGACATC CAATCATCAT CAAGGCAGGT GACTGGCAAG AATTCCGGGA AA - #AACTGACG 300# 339 TTGA GCAAGCGCAG GAACAACAG- (2) INFORMATION FOR SEQ ID NO:349:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 339 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:349:- ATGGCTAACT GCTCTATAAT GATCGATGAA ATTATACATC ACTTAAAGAG AC - #CACCTGCA 60- CCTTTGCTGG ACCCGAACAA CCTCAATAAC GAAGACGTTT CTATTCTGAT GG - #ACCGAAAC 120- CTTCGACTTC CAAACCTGGA GAGCTTCGTA AGGGCTGTCA AGAACTTAGA AA - #ATGCATCA 180- GGTATTGAGG CAATTCTTCG TAATCTCCAA CCATGTCTGC CCTCTGCCAC GG - #CCGCACCC 240- TCTCGACATC CAATCATCAT CAAGGCAGGT GACTGGCAAG AATTCCGGGA AA - #AACTGACG 300# 339 TTGA GCAAGCGCAG GAACAACAG- (2) INFORMATION FOR SEQ ID NO:350:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 339 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:350:- ATGGCTAACT GCTCTATAAT GATCGATGAA ATTATACATC ACTTAAAGAG AC - #CACCTGCA 60- CCTTTGCTGG ACCCGAACAA CCTCAATGCT GAAGACGTTT CTATTCTGAT GG - #ACCGAAAC 120- CTTCGACTTC CAAACCTGGA GAGCTTCGTA AGGGCTGTCA AGAACTTAGA AA - #ATGCATCA 180- GGTATTGAGG CAATTCTTCG TAATCTCCAA CCATGTCTGC CCTCTGCCAC GG - #CCGCACCC 240- TCTCGACATC CAATCATCAT CAAGGCAGGT GACTGGCAAG AATTCCGGGA AA - #AACTGACG 300# 339 TTGA GCAAGCGCAG GAACAACAG- (2) INFORMATION FOR SEQ ID NO:351:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 339 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:351:- ATGGCTAACT GCTCTATAAT GATCGATGAA ATTATACATC ACTTAAAGAG AC - #CACCTGCA 60- CCTTTGCTGG ACCCGAACAA CCTCAATGAC GAAGACGTTT CTATTCTGAT GG - #ACCGAAAC 120- CTTCGACTTC CAAACCTGGA GAGCTTCGTA AGGGCTGTCA AGAACTTAGA AA - #ATGCATCA 180- GGTATTGAGG CAATTCTTCG TAATCTCCAA CCATGTCTGC CCTCTGCCAC GG - #CCGCACCC 240- TCTCGACATC CAATCATCAT CAAGGCAGGT GACTGGCAAG AATTCCGGGA AA - #AACTGACG 300# 339 TTGA GCAAGCGCAG GAACAACAG- (2) INFORMATION FOR SEQ ID NO:352:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 339 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:352:- ATGGCTAACT GCTCTATAAT GATCGATGAA ATTATACATC ACTTAAAGAG AC - #CACCTGCA 60- CCTTTGCTGG ACCCGAACAA CCTCAATGCT GAAGACATGT CTATTCTGAT GG - #ACCGAAAC 120- CTTCGACTTC CAAACCTGGA GAGCTTCGTA AGGGCTGTCA AGAACTTAGA AA - #ATGCATCA 180- GGTATTGAGG CAATTCTTCG TAATCTCCAA CCATGTCTGC CCTCTGCCAC GG - #CCGCACCC 240- TCTCGACATC CAATCATCAT CAAGGCAGGT GACTGGCAAG AATTCCGGGA AA - #AACTGACG 300# 339 TTGA GCAAGCGCAG GAACAACAG- (2) INFORMATION FOR SEQ ID NO:353:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 339 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:353:- ATGGCTAACT GCTCTATAAT GATCGATGAA ATTATACATC ACTTAAAGAG AC - #CACCTGCA 60- CCTTTGCTGG ACCCGAACAA CCTCAATGAC GAAGACATGT CTATTCTGAT GG - #ACCGAAAC 120- CTTCGACTTC CAAACCTGGA GAGCTTCGTA AGGGCTGTCA AGAACTTAGA AA - #ATGCATCA 180- GGTATTGAGG CAATTCTTCG TAATCTCCAA CCATGTCTGC CCTCTGCCAC GG - #CCGCACCC 240- TCTCGACATC CAATCATCAT CAAGGCAGGT GACTGGCAAG AATTCCGGGA AA - #AACTGACG 300# 339 TTGA GCAAGCGCAG GAACAACAG- (2) INFORMATION FOR SEQ ID NO:354:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 339 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:354:- ATGGCTAACT GCTCTATAAT GATCGATGAA ATTATACATC ACTTAAAGAG AC - #CACCTGCA 60- CCTTTGCTGG ACCCGAACAA CCTCAATGCT GAAGACGTCG ATATCCTGAT GG - #AACGAAAC 120- CTTCGACTTC CAAACCTGGA GAGCTTCGTA AGGGCTGTCA AGAACTTAGA AA - #ATGCATCA 180- GGTATTGAGG CAATTCTTCG TAATCTCCAA CCATGTCTGC CCTCTGCCAC GG - #CCGCACCC 240- TCTCGACATC CAATCATCAT CAAGGCAGGT GACTGGCAAG AATTCCGGGA AA - #AACTGACG 300# 339 TTGA GCAAGCGCAG GAACAACAG- (2) INFORMATION FOR SEQ ID NO:355:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 321 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:355:- ATGGCTAACT GCTCTATAAT GATCGATGAA ATTATACATC ACTTAAAGAG AC - #CACCTGCA 60- CCTTTGCTGG ACCCGAACAA CCTCAATGCT GAAGACGTCG ATATCCTGAT GG - #AACGAAAC 120- CTTCGACTTC CAAACCTGGA GAGCTTCGTA AGGGCTGTCA AGAACTTAGA AA - #ATGCATCA 180- GGTATTGAGG CAATTCTTCG TAATCTCCAA CCATGTCTGC CCTCTGCCAC GG - #CCGCACCC 240- TCTCGACATC CAATCATCAT CAAGGCAGGT GACTGGCAAG AATTCCGGGA AA - #AACTGACG 300# 321GA G- (2) INFORMATION FOR SEQ ID NO:356:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 321 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:356:- ATGGATAACT GCTCTATAAT GATCGATGAA GCAATACATC ACTTAAAGAG AC - #CACCTGCA 60- CCTTTGCTGG ACCCGAACAA CCTCAATGCT GAAGACGTCG ATATCCTGAT GG - #AACGAAAC 120- CTTCGACTTC CAAACCTGGA GAGCTTCGTA AGGGCTGTCA AGAACTTAGA AA - #ATGCATCA 180- GGTATTGAGG CAATTCTTCG TAATCTCCAA CCATGTCTGC CCTCTGCCAC GG - #CCGCACCC 240- TCTCGACATC CAATCATCAT CAAGGCAGGT GACTGGCAAG AATTCCGGGA AA - #AACTGCAA 300# 321GA G- (2) INFORMATION FOR SEQ ID NO:357:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 321 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:357:- ATGGCTAACT GCTCTATAAT GATCGATGAA GCAATACATC ACTTAAAGAG AC - #CACCTGCA 60- CCTTTGCTGG ACCCGAACAA CCTCAATGAC GAAGACGTCT CTATTCTGAT GG - #ACCGAAAC 120- CTTCGACTTC CAAACCTGGA GAGCTTCGTA AGGGCTGTCA AGAACTTAGA AA - #ATGCATCA 180- GGTATTGAGG CAATTCTTCG TAATCTCCAA CCATGTCTGC CCTCTGCCAC GG - #CCGCACCC 240- TCTCGACATC CAATCATCAT CAAGGCAGGT GACTGGCAAG AATTCCGGGA AA - #AACTGCAA 300# 321GA G- (2) INFORMATION FOR SEQ ID NO:358:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 321 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:358:- ATGGCTAACT GCTCTATAAT GATCGATGAA ATTATACATC ACTTAAAGAG AC - #CACCTGCA 60- CCTTTGCTGG ACCCGAACAA CCTCAATGCT GAAGACGTCG ATATCCTGAT GG - #AACGAAAC 120- CTTCGACTTC CAAACCTGGA GAGCTTCGTA AGGGCTGTCA AGAACTTAGA AA - #ATGCATCA 180- GGTATTGAGG CAATTCTTCG TAATCTCCAA CCATGTCTGC CCTCTGCCAC GG - #CCGCACCC 240- TCTCGACATC CAATCATCAT CAAGGCAGGT GACTGGCAAG AATTCCGGGA AA - #AACTGACG 300# 321GA G- (2) INFORMATION FOR SEQ ID NO:359:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 339 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:359:- ATGGCTAACT GCTCTATAAT GATCGATGAA ATTATACATC ACTTAAAGAG AC - #CACCTGCA 60- CCTTTGCTGG ACCCGAACAA CCTCAATGCT GAAGACGTTT CTATCCTGAT GG - #ACCGAAAC 120- CTTCGACTTC CAAACCTGGA GAGCTTCGTA AGGGCTGTCA AGAACTTAGA AA - #ATGCATCA 180- GGTATTGAGG CAATTCTTCG TAATCTCCAA CCATGTCTGC CCTCTGCCAC GG - #CCGCACCC 240- TCTCGACATC CAATCATCAT CAAGGCAGGT GACTGGCAAG AATTCCGGGA AA - #AACTGCAA 300# 339 TTGA GCAAGCGCAG GAACAACAG- (2) INFORMATION FOR SEQ ID NO:360:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 339 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:360:- ATGGCTAACT GCTCTATAAT GATCGATGAA ATTATACATC ACTTAAAGGT AC - #CACCTCGC 60- CCTTCCCTGG ACCCGAACAA CCTCAATGCT GAAGACGTCG ATATCCTGAT GG - #AACGAAAC 120- CTTCGACTTC CAAACCTGGA GAGCTTCGTA AGGGCTGTCA AGAACTTAGA AA - #ATGCATCA 180- GGTATTGAGG CAATTCTTCG TAATCTCCAA CCATGTCTGC CCTCTGCCAC GG - #CCGCACCC 240- TCTCGACATC CAATCATCAT CAAGGCAGGT GACTGGCAAG AATTCCGGGA AA - #AACTGACG 300# 339 TTGA GCAAGCGCAG GAACAACAG- (2) INFORMATION FOR SEQ ID NO:361:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 339 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:361:- ATGGCTAACT GCTCTATAAT GATCGATGAA ATTATACATC ACTTAAAGAG AC - #CACCTGCA 60- CCTTTGCTGG ACCCGAACAA CCTCAATGCT GAAGACGTCG ATATCCTGAT GG - #AACGAAAC 120- CTTCGACTTC CAAACCTGGA GAGCTTCGTA AGGGCTGTCA AGAACTTAGA AA - #ATGCATCA 180- GGTATTGAGG CAATTCTTCG TAATCTCTGG CCATGTCTGC CCTCTGCCAC GG - #CCGCACCC 240- TCTCGACATC CAATCATCAT CAAGGCAGGT GACTGGCAAG AATTCCGGGA AA - #AACTGACG 300# 339 TTGA GCAAGCGCAG GAACAACAG- (2) INFORMATION FOR SEQ ID NO:362:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 339 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:362:- ATGGCTAACT GCTCTATAAT GATCGATGAA GCAATACATC ACTTAAAGAG AC - #CACCTGCA 60- CCTTTGCTGG ACCCGAACAA CCTCAATGAC GAAGACGTTT CTATTCTGAT GG - #ACCGAAAC 120- CTTCGACTTC CAAACCTGGA GAGCTTCGTA AGGGCTGTCA AGAACTTAGA AA - #ATGCATCA 180- GGTATTGAGG CAATTCTTCG TAATCTCCAA CCATGTCTGC CCTCTGCCAC GG - #CCGCACCC 240- TCTCGACATC CAATCATCAT CAAGGCAGGT GACTGGCAAG AATTCCGGGA AA - #AACTGCAA 300# 339 TTGA GCAAGCGCAG GAACAACAG- (2) INFORMATION FOR SEQ ID NO:363:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 339 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:363:- ATGGCTAACT GCTCTATAAT GATCGATGAA ATTATACATC ACTTAAAGAG AC - #CACCTGCA 60- CCTTTGCTGG ACCCGAACAA CCTCAATGCT GAAGACGTCG ATATCCTGAT GG - #AACGAAAC 120- CTTCGACTTC CAAACCTGGA GAGCTTCGTA AGGGCTGTCA AGAACTTAGA AA - #ATGCATCA 180- GGTATTGAGG CAATTCTTCG TAATCTCCAA CCATGTCTGC CCTCTGCCAC GG - #CCGCACCC 240- TCTCGACATC CAATCATCAT CAAGGCAGGT GACTGGCAAG AATTCCGGGA AA - #AACTGCAA 300# 339 TTGA GCAAGCGCAG GAACAACAG- (2) INFORMATION FOR SEQ ID NO:364:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 339 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:364:- ATGGCTAACT GCTCTATAAT GATCGATGAA ATTATACATC ACTTAAAGAG AC - #CACCTGCA 60- CCTTTGCTGG ACCCGAACAA CCTCAATGCT GAAGACGTCG ATATCCTGAT GG - #ACCGAAAC 120- CTTCGACTTA GCAACCTGGA GAGCTTCGTA AGGGCTGTCA AGAACTTAGA AA - #ATGCATCA 180- GGTATTGAGG CAATTCTTCG TAATCTCCAA CCATGTCTGC CCTCTGCCAC GG - #CCGCACCC 240- TCTCGACATC CAATCATCAT CAAGGCAGGT GACTGGCAAG AATTCCGGGA AA - #AACTGACG 300# 339 TTGA GCAAGCGCAG GAACAACAG- (2) INFORMATION FOR SEQ ID NO:365:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 339 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:365:- ATGGCTAACT GCTCTATAAT GATCGATGAA ATTATACATC ACTTAAAGAG AC - #CACCTGCA 60- CCTTTGCTGG ACCCGAACAA CCTCAATGAC GAAGACATGG ATATCCTGAT GG - #AACGAAAC 120- CTTCGACTTC CAAACCTGGA GAGCTTCGTA AGGGCTGTCA AGAACTTAGA AA - #ATGCATCA 180- GGTATTGAGG CAATTCTTCG TAATCTCCAA CCATGTCTGC CCTCTGCCAC GG - #CCGCACCC 240- TCTCGACATC CAATCATCAT CAAGGCAGGT GACTGGCAAG AATTCCGGGA AA - #AACTGACG 300# 339 TTGA GCAAGCGCAG GAACAACAG- (2) INFORMATION FOR SEQ ID NO:366:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 339 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:366:- ATGGCTAACT GCTCTATAAT GATCGATGAA ATTATACATC ACTTAAAGAG AC - #CACCTGCA 60- CCTTCCCTGG ACCCGAACAA CCTCAATGCT GAAGACGTCG ATATCCTGAT GG - #AACGAAAC 120- CTTCGACTTC CAAACCTGGA GAGCTTCGTA AGGGCTGTCA AGAACTTAGA AA - #ATGCATCA 180- GGTATTGAGG CAATTCTTCG TAATCTCCAA CCATGTCTGC CCTCTGCCAC GG - #CCGCACCC 240- TCTCGACATC CAATCATCAT CAAGGCAGGT GACTGGCAAG AATTCCGGGA AA - #AACTGACG 300# 339 TTGA GCAAGCGCAG GAACAACAG- (2) INFORMATION FOR SEQ ID NO:367:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 339 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:367:- ATGGCTAACT GCTCTATAAT GATCGATGAA ATTATACATC ACTTAAAGAG AC - #CACCTGCA 60- CCTTTGCTGG ACCCGAACAA CCTCAATGAC GAAGACGTCG ATATCCTGAT GG - #AACGAAAC 120- CTTCGACTTC CAAACCTGGA GAGCTTCGTA AGGGCTGTCA AGAACTTAGA AA - #ATGCATCA 180- GGTATTGAGG CAATTCTTCG TAATCTCCAA CCATGTCTGC CCTCTGCCAC GG - #CCGCACCC 240- TCTCGACATC CAATCATCAT CAAGGCAGGT GACTGGCAAG AATTCCGGGA AA - #AACTGACG 300# 339 TTGA GCAAGCGCAG GAACAACAG- (2) INFORMATION FOR SEQ ID NO:368:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 339 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:368:- ATGGCTAACT GCTCTATAAT GATCGATGAA GCAATACATC ACTTAAAGAG AC - #CACCTGCA 60- CCTTCCCTGG ACCCGAACAA CCTCAATGAC GAAGACATGT CTATCCTGAT GG - #AACGAAAC 120- CTTCGACTTC CAAACCTGGA GAGCTTCGTA AGGGCTGTCA AGAACTTAGA AA - #ATGCATCA 180- GGTATTGAGG CAATTCTTCG TAATCTCCAA CCATGTCTGC CCTCTGCCAC GG - #CCGCACCC 240- TCTCGACATC CAATCATCAT CAAGGCAGGT GACTGGCAAG AATTCCGGGA AA - #AACTGACG 300# 339 TTGA GCAAGCGCAG GAACAACAG- (2) INFORMATION FOR SEQ ID NO:369:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 339 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:369:- ATGGCTAACT GCTCTATAAT GATCGATGAA ATTATACATC ACTTAAAGAG AC - #CACCTGCA 60- CCTTTGCTGG ACCCGAACAA CCTCAATGAC GAAGACATGT CTATCCTGAT GG - #AACGAAAC 120- CTTCGACTTC CAAACCTGGA GAGCTTCGTA AGGGCTGTCA AGAACTTAGA AA - #ATGCATCA 180- GGTATTGAGG CAATTCTTCG TAATCTCCAA CCATGTCTGC CCTCTGCCAC GG - #CCGCACCC 240- TCTCGACATC CAATCATCAT CAAGGCAGGT GACTGGCAAG AATTCCGGGA AA - #AACTGACG 300# 339 TTGA GCAAGCGCAG GAACAACAG- (2) INFORMATION FOR SEQ ID NO:370:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 339 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:370:- ATGGCTAACT GCTCTATAAT GATCGATGAA GCAATACATC ACTTAAAGGT AC - #CACCTCGC 60- CCTTCCCTGG ACCCGAACAA CCTCAATGAC GAAGACGTCT CTATCCTGAT GG - #AACGAAAC 120- CTTCGACTTC CAAACCTGGA GAGCTTCGTA AGGGCTGTCA AGAACTTAGA AA - #ATGCATCA 180- GGTATTGAGG CAATTCTTCG TAATCTCCAA CCATGTCTGC CCTCTGCCAC GG - #CCGCACCC 240- TCTCGACATC CAATCATCAT CAAGGCAGGT GACTGGCAAG AATTCCGGGA AA - #AACTGACG 300# 339 TTGA GCAAGCGCAG GAACAACAG- (2) INFORMATION FOR SEQ ID NO:371:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 339 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:371:- ATGGCTAACT GCTCTATAAT GATCGATGAA ATTATACATC ACTTAAAGAG AC - #CACCTGCA 60- CCTTTGCTGG ACCCGAACAA CCTCAATGCT GAAGACGTCG ATATCCTGAT GG - #AACGAAAC 120- CTTCGACTTC CAAACCTGGA GAGCTTCGTA AGGGCTGTCA AGAACTTAGA AA - #ATGCATCA 180- GGTATTGAGG CAATTCTTCG TAATCTCCAA CCATGTCTGC CCTCTGCCAC GG - #CCGCACCC 240- TCTCGACATC CAATCATCAT CCGTATGGGT GACTGGCAAG AATTCCGGGA AA - #AACTGACG 300# 339 TTGA GCAAGCGCAG GAACAACAG- (2) INFORMATION FOR SEQ ID NO:372:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 339 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:372:- ATGGCTAACT GCTCTATAAT GATCGATGAA ATTATACATC ACTTAAAGAG AC - #CACCTGCA 60- CCTTTGCTGG ACCCGAACAA CCTCAATGCT GAAGACGTCG ATATCCTGAT GG - #AACGAAAC 120- CTTCGACTTC CAAACCTGGA GAGCTTCGTA AGGGCTGTCA AGAACTTAGA AA - #ATGCATCA 180- GGTATTGAGG CAATTCTTCG TAATCTCTGG CCATGTCTGC CCTCTGCCAC GG - #CCGCACCC 240- TCTCGACATC CAATCATCAT CCGTATGGGT GACTGGCAAG AATTCCGGGA AA - #AACTGACG 300# 339 TTGA GCAAGCGCAG GAACAACAG- (2) INFORMATION FOR SEQ ID NO:373:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 339 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:373:- ATGGCTAACT GCTCTATAAT GATCGATGAA ATTATACATC ACTTAAAGAG AC - #CACCTGCA 60- CCTTTGCTGG ACCCGAACAA CCTCAATGAC GAAGACGTCT CTATCCTGAT GG - #AACGAAAC 120- CTTCGACTTC CAAACCTGGA GAGCTTCGTA AGGGCTGTCA AGAACTTAGA AA - #ATGCATCA 180- GGTATTGAGG CAATTCTTCG TAATCTCCAA CCATGTCTGC CCTCTGCCAC GG - #CCGCACCC 240- TCTCGACATC CAATCATCAT CAAGGCAGGT GACTGGCAAG AATTCCGGGA AA - #AACTGACG 300# 339 TTGA GCAAGCGCAG GAACAACAG- (2) INFORMATION FOR SEQ ID NO:374:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 339 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:374:- ATGGCTAACT GCTCTATAAT GATCGATGAA GCAATACATC ACTTAAAGGT AC - #CACCTCGC 60- CCTTCCCTGG ACCCGAACAA CCTCAATGAC GAAGACGTCT CTATCCTGAT GG - #AACGAAAC 120- CTTCGACTTC CAAACCTGGA GAGCTTCGTA AGGGCTGTCA AGAACTTAGA AA - #ATGCATCA 180- GGTATTGAGG CAATTCTTCG TAATCTCCAA CCATGTCTGC CCTCTGCCAC GG - #CCGCACCC 240- TCTCGACATC CAATCATCAT CAAGGCAGGT GACTGGCAAG AATTCCGGGA AA - #AACTGACG 300# 339 TTGA GCAAGCGCAG GAACAACAG- (2) INFORMATION FOR SEQ ID NO:375:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 321 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:375:- ATGGCTAACT GCTCTATAAT GATCGATGAA ATTATACATC ACTTAAAGAG AC - #CACCTGCA 60- CCTTTGCTGG ACCCGAACAA CCTCAATGCT GAAGACGTCG ATATCCTGAT GG - #AACGAAAC 120- CTTCGACTTC CAAACCTGGA GAGCTTCGTA AGGGCTGTCA AGAACTTAGA AA - #ATGCATCA 180- GGTATTGAGG CAATTCTTCG TAATCTCCAA CCATGTCTGC CCTCTGCCAC GG - #CCGCACCC 240- TCTCGACATC CAATCATCAT CAAGGCAGGT GACTGGCAAG AATTCCGGGA AA - #AACTGCAA 300# 321GA G- (2) INFORMATION FOR SEQ ID NO:376:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 339 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:376:- ATGGCTAACT GCTCTATAAT GATCGATGAA ATTATACATC ACTTAAAGAG AC - #CACCTGCA 60- CCTTTGCTGG ACCCGAACAA CCTCAATGCT GAAGACGTCG ATATCCTGAT GG - #ACCGAAAC 120- CTTCGACTTC CAAACCTGGA GAGCTTCGTA AGGGCTGTCA AGAACTTAGA AA - #ATGCATCA 180- GGTATTGAGG CAATTCTTCG TAATCTCCAA CCATGTCTGC CCTCTGCCAC GG - #CCGCACCC 240- TCTCGACATC CAATCATCAT CAAGGCAGGT GACTGGCAAG AATTCCGGGA AA - #AACTGACG 300# 339 TTGA GCAAGCGCAG GAACAACAG- (2) INFORMATION FOR SEQ ID NO:377:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 339 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:377:- ATGGCTAACT GCTCTATAAT GATCGATGAA ATTATACATC ACTTAAAGAG AC - #CACCTGCA 60- CCTTTGCTGG ACCCGAACAA CCTCAATGAC GAAGACGTCG ATTCTCTGAT GG - #AACGAAAC 120- CTTCGACTTC CAAACCTGGA GAGCTTCGTA AGGGCTGTCA AGAACTTAGA AA - #ATGCATCA 180- GGTATTGAGG CAATTCTTCG TAATCTCCAA CCATGTCTGC CCTCTGCCAC GG - #CCGCACCC 240- TCTCGACATC CAATCATCAT CAAGGCAGGT GACTGGCAAG AATTCCGGGA AA - #AACTGACG 300# 339 TTGA GCAAGCGCAG GAACAACAG- (2) INFORMATION FOR SEQ ID NO:378:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 339 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:378:- ATGGCTAACT GCTCTATAAT GATCGATGAA ATTATACATC ACTTAAAGAG AC - #CACCTGCA 60- CCTTTGCTGG ACCCGAACAA CCTCAATGAC GAAGACGTCA TGTCTCTGAT GG - #AACGAAAC 120- CTTCGACTTC CAAACCTGGA GAGCTTCGTA AGGGCTGTCA AGAACTTAGA AA - #ATGCATCA 180- GGTATTGAGG CAATTCTTCG TAATCTCCAA CCATGTCTGC CCTCTGCCAC GG - #CCGCACCC 240- TCTCGACATC CAATCATCAT CAAGGCAGGT GACTGGCAAG AATTCCGGGA AA - #AACTGACG 300# 339 TTGA GCAAGCGCAG GAACAACAG- (2) INFORMATION FOR SEQ ID NO:379:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 339 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:379:- ATGGCTAACT GCTCTATAAT GATCGATGAA GCAATACATC ACTTAAAGAG AC - #CACCTGAC 60- CTTTCCCTGG ACCCGAACAA CCTCAATGAC GAAGACGTCT CTATCCTGAT GG - #ACCGAAAC 120- CTTCGACTTA GCAACCTGGA GAGCTTCGTA AGGGCTGTCA AGAACTTAGA AA - #ATGCATCA 180- GGTATTGAGG CAATTCTTCG TAATCTCCAA CCATGTCTGC CCTCTGCCAC GG - #CCGCACCC 240- TCTCGACATC CAATCATCAT CAAGGCAGGT GACTGGCAAG AATTCCGGGA AA - #AACTGACG 300# 339 TTGA GCAAGCGCAG GAACAACAG- (2) INFORMATION FOR SEQ ID NO:380:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 339 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:380:- ATGGCTAACT GCTCTATAAT GATCGATGAA GCAATACATC ACTTAAAGAG AC - #CACCTGCA 60- CCTTCCCTGG ACCCGAACAA CCTCAATGAC GAAGACATGT CTATCCTGAT GG - #ACCGAAAC 120- CTTCGACTTA GCAACCTGGA GAGCTTCGTA AGGGCTGTCA AGAACTTAGA AA - #ATGCATCA 180- GGTATTGAGG CAATTCTTCG TAATCTCCAA CCATGTCTGC CCTCTGCCAC GG - #CCGCACCC 240- TCTCGACATC CAATCATCAT CAAGGCAGGT GACTGGCAAG AATTCCGGGA AA - #AACTGACG 300# 339 TTGA GCAAGCGCAG GAACAACAG- (2) INFORMATION FOR SEQ ID NO:381:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 339 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:381:- ATGGCTAACT GCTCTATAAT GATCGATGAA GCAATACATC ACTTAAAGAG AC - #CACCTGCA 60- CCTTCCCTGG ACCCGAACAA CCTCAATGAC GAAGACATGT CTATCCTGAT GG - #ACCGAAAC 120- CTTCGACTTC CAAACCTGGA GAGCTTCGTA AGGGCTGTCA AGAACTTAGA AA - #ATGCATCA 180- GGTATTGAGG CAATTCTTCG TAATCTCCAA CCATGTCTGC CCTCTGCCAC GG - #CCGCACCC 240- TCTCGACATC CAATCATCAT CAAGGCAGGT GACTGGCAAG AATTCCGGGA AA - #AACTGACG 300# 339 TTGA GCAAGCGCAG GAACAACAG- (2) INFORMATION FOR SEQ ID NO:382:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 339 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:382:- ATGGCTAACT GCTCTATAAT GATCGATGAA ATTATACATC ACTTAAAGAG AC - #CACCTGCA 60- CCTTTGCTGG ACCCGAACAA CCTCAATGCT GAAGACGTCG ATATCCTGAT GG - #AACGAAAC 120- CTTCGACTTC CAAACCTGGA GAGCTTCGTA AGGGCTGTCA AGAACTTAGA AA - #ATGCATCA 180- GGTATTGAGG CAATTCTTCG TAATCTCCAA CCATGTCTGC CCTCTGCCAC GG - #CCGCACCC 240- TCTCGACATC CAATCATCAT CAAGGCAGGT GACTGGCAAG AATTCCGGGA AA - #AACTGCAA 300# 339 TTGA GCAAGCGCAG GAACAACAG- (2) INFORMATION FOR SEQ ID NO:383:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 339 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:383:- ATGGATAACT GCTCTATTAT GATCGATGAA GCAATACATC ACTTAAAGAG AC - #CACCTGCA 60- CCTTTGCTGG ACCCGAACAA CCTCAATGCT GAAGACGTCG ATATCCTGAT GG - #AACGAAAC 120- CTTCGACTTC CAAACCTGGA GAGCTTCGTA AGGGCTGTCA AGAACTTAGA AA - #ATGCATCA 180- GGTATTGAGG CAATTCTTCG TAATCTCCAA CCATGTCTGC CCTCTGCCAC GG - #CCGCACCC 240- TCTCGACATC CAATCATCAT CAAGGCAGGT GACTGGCAAG AATTCCGGGA AA - #AACTGACG 300# 339 TTGA GCAAGCGCAG GAACAACAG- (2) INFORMATION FOR SEQ ID NO:384:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 339 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:384:- ATGGCTAACT GCTCTATAAT GCCAGATGAA GCAATACATC ACTTAAAGAT AC - #CACCTAAC 60- CCTAGCCTGG ACAGTGCTAA CCTCAATTCC GAAGACGTCT CTATCCTGAT GG - #AACGAAAC 120- CTTCGAACTC CAAACCTGCT CGCATTCGTA AGGGCTGTCA AGCACTTAGA AA - #ATGCATCA 180- GGTATTGAGG CAATTCTTCG TAATCTCCAA CCATGTCTGC CCTCTGCCAC GG - #CCGCACCC 240- TCTCGACATC CAATCATCAT CAAGGCAGGT GACTGGCAAG AATTCCGGGA AA - #AACTGACG 300# 339 TTGA GCAAGCGCAG GAACAACAG- (2) INFORMATION FOR SEQ ID NO:385:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 339 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:385:- ATGGCTAACT GCTCTATAAT GATCGATGAA ATTATACATC ACTTAAAGAT AC - #CACCTAAC 60- CCTAGCCTGG ACAGTGCTAA CCTCAATTCC GAAGACGTCT CTATCCTGAT GG - #AACGAAAC 120- CTTCGAACTC CAAACCTGCT CGCATTCGTA AGGGCTGTCA AGCACTTAGA AA - #ATGCATCA 180- GGTATTGAGG CAATTCTTCG TAATCTCCAA CCATGTCTGC CCTCTGCCAC GG - #CCGCACCC 240- TCTCGACATC CAATCATCAT CAAGGCAGGT GACTGGCAAG AATTCCGGGA AA - #AACTGACG 300# 339 TTGA GCAAGCGCAG GAACAACAG- (2) INFORMATION FOR SEQ ID NO:386:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 339 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:386:- ATGGCTAACT GCTCTATTAT GATCGATGAA GCAATACATC ACTTAAAGAT AC - #CACCTAAC 60- CCTAGCCTGG ACAGTGCTAA CCTCAATTCC GAAGACGTCT CTATCCTGAT GG - #AACGAAAC 120- CTTCGAACTC CAAACCTGCT CGCATTCGTA AGGGCTGTCA AGCACTTAGA AA - #ATGCATCA 180- GGTATTGAGG CAATTCTTCG TAATCTCCAA CCATGTCTGC CCTCTGCCAC GG - #CCGCACCC 240- TCTCGACATC CAATCATCAT CAAGGCAGGT GACTGGCAAG AATTCCGGGA AA - #AACTGACG 300# 339 TTGA GCAAGCGCAG GAACAACAG- (2) INFORMATION FOR SEQ ID NO:387:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 339 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:387:- ATGGCTAACT GCTCTATAAT ACTCGATGAA GCAATACATC ACTTAAAGAT AC - #CACCTAAC 60- CCTAGCCTGG ACAGTGCTAA CCTCAATTCC GAAGACGTCT CTATCCTGAT GG - #AACGAAAC 120- CTTCGAACTC CAAACCTGCT CGCATTCGTA AGGGCTGTCA AGCACTTAGA AA - #ATGCATCA 180- GGTATTGAGG CAATTCTTCG TAATCTCCAA CCATGTCTGC CCTCTGCCAC GG - #CCGCACCC 240- TCTCGACATC CAATCATCAT CAAGGCAGGT GACTGGCAAG AATTCCGGGA AA - #AACTGACG 300# 339 TTGA GCAAGCGCAG GAACAACAG- (2) INFORMATION FOR SEQ ID NO:388:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 339 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:388:- ATGGCTAACT GCTCTATAAT GATCGATGAA ATTATACATC ACTTAAAGAG AC - #CACCTAAC 60- CCTTTGCTGG ACCCGAACAA CCTCAATTCC GAAGACATGG ATATCCTGAT GG - #ACTCCAAC 120- CTTCGAACTC CAAACCTGCT CGCATTCCCA CATGCTGTCA AGCAATTAGA AA - #ATGCATCA 180- GGTATTGAGG CAATTCTTCG TAATCTCCAA CCATGTCTGC CCTCTGCCAC GG - #CCGCACCC 240- TCTCGACATC CAATCATCAT CAAGGCAGGT GACTGGCAAG AATTCCGGGA AA - #AACTGACG 300# 339 TTGA GCAAGCGCAG GAACAACAG- (2) INFORMATION FOR SEQ ID NO:389:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 339 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:389:- ATGGCTAACT GCTCTATAAT GATCGATGAA ATTATACATC ACTTAAAGAG AC - #CACCTAAC 60- CCTTTGCTGG ACCCGAACAA CCTCAATTCC GAAGACATGG ATATCCTGAT GG - #ACTCCAAC 120- CTTCGAACTC CAAACCTGCT CGCATTCCCA CATGCTTCTA AGCAATTAGA AA - #ATGCATCA 180- GGTATTGAGG CAATTCTTCG TAATCTCCAA CCATGTCTGC CCTCTGCCAC GG - #CCGCACCC 240- TCTCGACATC CAATCATCAT CAAGGCAGGT GACTGGCAAG AATTCCGGGA AA - #AACTGACG 300# 339 TTGA GCAAGCGCAG GAACAACAG- (2) INFORMATION FOR SEQ ID NO:390:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 339 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:390:- ATGGCTAACT GCTCTATAAT GATCGATGAA ATTATACATC ACTTAAAGAG AC - #CACCTAAC 60- CCTTTGCTGG ACCCGAACAA CCTCAATTCC GAAGACATGG ATATCCTGAT GG - #AACGAAAC 120- CTTCGAACTC CAAACCTGCT CGCATTCGTA AGGGCTGTCA AGCACTTAGA AA - #ATGCATCA 180- GGTATTGAGG CAATTCTTCG TAATCTCCAA CCATGTCTGC CCTCTGCCAC GG - #CCGCACCC 240- TCTCGACATC CAATCATCAT CAAGGCAGGT GACTGGCAAG AATTCCGGCT TA - #AACTGCAA 300# 339 TTGA GCAAGCGCAG GAACAACAG- (2) INFORMATION FOR SEQ ID NO:391:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 318 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:391:- ATGGCTAACT GCTCTATAAT GATCGATGAA ATTATACATC ACTTAAAGAG AC - #CACCTAAC 60- CCTTTGCTGG ACCCGAACAA CCTCAATTCC GAAGACATGG ATATCCTGAT GG - #AACGAAAC 120- CTTCGAACTC CAAACCTGCT CGCATTCGTA AGGGCTGTCA AGCACTTAGA AA - #ATGCATCA 180- GGTATTGAGG CAATTCTTCG TAATCTCCAA CCATGTCTGC CCTCTGCCAC GG - #CCGCACCC 240- TCTCGACATC CAATCATCAT CAAGGCAGGT GACTGGCAAG AATTCCGGCT TA - #AACTGCAA 300# 318 TT- (2) INFORMATION FOR SEQ ID NO:392:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 339 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:392:- ATGGCTAACT GCTCTATAAT GATCGATGAA ATTATACATC ACTTAAAGAG AC - #CACCTAAC 60- CCTTTGCTGG ACCCGAACAA CCTCAATTCC GAAGACATGG ATATCCTGAT GG - #AACGAAAC 120- CTTCGAACTC CAAACCTGCT CGCATTCGTA AGGGCTGTCA AGCACTTAGA AA - #ATGCATCA 180- GGTATTGAGG CAATTCTTCG TAATCTCCAA CCATGTCTGC CCTCTGCCAC GG - #CCGCACCC 240- TCTCGACATC CAATCATCAT CAAGGCAGGT GACTGGCAAG AATTCCGGCT TA - #AACTGCAA 300# 339 TTGA GCAAGCGCAG GAACAACAG- (2) INFORMATION FOR SEQ ID NO:393:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 339 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:393:- ATGGCTAACT GCTCTATAAT GATCGATGAA ATTATACATC ACTTAAAGAG AC - #CACCTAAC 60- CCTTTGCTGG ACCCGAACAA CCTCAATTCC GAAGACATGG ATATCCTGAT GG - #AACGAAAC 120- CTTCGAACTC CAAACCTGCT CGCATTCGTA AGGGCTGTCA AGCACTTAGA AA - #ATGCATCA 180- GGTATTGAGC CAATTCTTTC TAATCTCCAA CCATGTGTTC CCTATTGGAC GG - #CCCCTCCC 240- TCTCGAACAC CAATCACGAT CAAGGCAGGT GACTGGCAAG AATTCCGGGA AA - #AACTGACG 300# 339 TTGA GCAAGCGCAG GAACAACAG- (2) INFORMATION FOR SEQ ID NO:394:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 339 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:394:- ATGGCTAACT GCTCTATAAT GATCGATGAA ATTATACATC ACTTAAAGAG AC - #CACCTAAC 60- CCTTTGCTGG ACCCGAACAA CCTCAATTCC GAAGACATGG ATATCCTGAT GG - #AACGAAAC 120- CTTCGAACTC CAAACCTGCT CGCATTCGTA AGGGCTGTCA AGCACTTAGA AA - #ATGCATCA 180- GGTATTGAGC CAATTCTTTC TAATCTCCAA CCATGTGTTC CCTATTGGAC GG - #CCCCTCCC 240- TCTCGAACAC CAATCACGAT CAAGGCAGGT GACTGGCAAG AATTCCGGCT TA - #AACTGCAA 300# 339 TTGA GCAAGCGCAG GAACAACAG- (2) INFORMATION FOR SEQ ID NO:395:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 339 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:395:- ATGGCTAACT GCTCTATAAT GATCGATGAA ATTATACATC ACTTAAAGAT AC - #CACCTAAC 60- CCTAGCCTGG ACAGTGCTAA CCTCAATTCC GAAGACGTCT CTATCCTGAT GG - #AACGAAAC 120- CTTCGAACTC CAAACCTGCT CGCATTCGTA AGGGCTGTCA AGCACTTAGA AA - #ATGCATCA 180- GGTATTGAGC CAATTCTTTC TAATCTCCAA CCATGTGTTC CCTATTGGAC GG - #CCCCTCCC 240- TCTCGAACAC CAATCACGAT CAAGGCAGGT GACTGGCAAG AATTCCGGCT TA - #AACTGCAA 300# 339 TTGA GCAAGCGCAG GAACAACAG- (2) INFORMATION FOR SEQ ID NO:396:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 339 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:396:- ATGGCTAACT GCTCTATAAT GATCGATGAA ATTATACATC ACTTAAAGAT AC - #CACCTAAC 60- CCTAGCCTGG ACAGTGCTAA CCTCAATTCC GAAGACGTCT CTATCCTGAT GG - #AACGAAAC 120- CTTCGAACTC CAAACCTGCT CGCATTCGTA AGGGCTGTCA AGCACTTAGA AA - #ATGCATCA 180- GGTATTGAGG CAATTCTTCG TAATCTCCAA CCATGTCTGC CCTCTGCCAC GG - #CCGCACCC 240- TCTCGACATC CAATCATCAT CAAGGCAGGT GACTGGCAAG AATTCCGGCT TA - #AACTGCAA 300# 339 TTGA GCAAGCGCAG GAACAACAG- (2) INFORMATION FOR SEQ ID NO:397:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 339 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:397:- ATGGCTAACT GCTCTATAAT GATCGATGAA ATTATACATC ACTTAAAGAT AC - #CACCTAAC 60- CCTAGCCTGG ACAGTGCTAA CCTCAATTCC GAAGACGTCT CTATCCTGAT GG - #AACGAAAC 120- CTTCGAACTC CAAACCTGCT CGCATTCGTA AGGGCTGTCA AGCACTTAGA AA - #ATGCATCA 180- GGTATTGAGC CAATTCTTTC TAATCTCCAA CCATGTGTTC CCTATTGGAC GG - #CCCCTCCC 240- TCTCGAACAC CAATCACGAT CAAGGCAGGT GACTGGCAAG AATTCCGGGA AA - #AACTGACG 300# 339 TTGA GCAAGCGCAG GAACAACAG- (2) INFORMATION FOR SEQ ID NO:398:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 339 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:398:- ATGGCTAACT GCTCTAACAT GATCGATGAA ATCATCACCC ACCTGAAGCA GC - #CACCGCTG 60- CCGCTGCTGG ACTTCAACAA CCTCAATGAC GAAGACATGT CTATCCTGAT GG - #ACAATAAC 120- CTTCGTCGTC CAAACCTCGA GGCATTCAAC CGTGCTGTCA AGTCTCTGCA GA - #ATGCATCA 180- GCAATTGAGA GCATTCTTAA AAATCTCCTG CCATGTCTGC CCCTGGCCAC GG - #CCGCACCC 240- ACGCGACATC CAATCCATAT CAAGGACGGT GACTGGAATG AATTCCGTCG TA - #AACTGACC 300# 339 TGGA GAACGCGCAG GCTCAACAG- (2) INFORMATION FOR SEQ ID NO:399:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 339 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:399:- ATGGCTAACT GCTCTAACAT GATCGATGAA ATCATCACCC ACCTGAAGCA GC - #CACCGCTG 60- CCGCTGCTGG ACTTCAACAA CCTCAATGAC GAAGACATGT CTATCCTGAT GG - #AAAATAAC 120- CTTCGTCGTC CAAACCTCGA GGCATTCAAC CGTGCTGTCA AGTCTCTGCA GA - #ATGCATCA 180- GCAATTGAGA GCATTCTTAA AAATCTCCTG CCATGTCTGC CCCTGGCCAC GG - #CCGCACCC 240- ACGCGACATC CAATCCATAT CAAGGACGGT GACTGGAATG AATTCCGTCG TA - #AACTGACC 300# 339 TGGA GAACGCGCAG GCTCAACAG- (2) INFORMATION FOR SEQ ID NO:400:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 29 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:400:# 29 GAAC TGCTCTAAC- (2) INFORMATION FOR SEQ ID NO:401:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 5 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:401:- Met Asn Cys Ser Asn1 5- (2) INFORMATION FOR SEQ ID NO:402:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 120 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:402:- Met Asn Cys Ser Asn Met Ile Asp Glu Ile Il - #e Thr His Leu Lys Gln# 15- Pro Pro Leu Pro Leu Leu Asp Phe Asn Asn Le - #u Asn Gly Glu Asp Gln# 30- Asp Ile Leu Met Glu Asn Asn Leu Arg Arg Pr - #o Asn Leu Glu Ala Phe# 45- Asn Arg Ala Val Lys Ser Leu Gln Asn Ala Se - #r Ala Ile Glu Ser Ile# 60- Leu Lys Asn Leu Leu Pro Cys Leu Pro Leu Al - #a Thr Ala Ala Pro Thr#80- Arg His Pro Ile His Ile Lys Asp Gly Asp Tr - #p Asn Glu Phe Arg Arg# 95- Lys Leu Thr Phe Tyr Leu Lys Thr Leu Glu As - #n Ala Gln Ala Gln Gln# 110- Thr Thr Leu Arg Leu Ala Ile Phe# 120- (2) INFORMATION FOR SEQ ID NO:403:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 14 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:403:- Met Ala Tyr Pro Glu Thr Asp Tyr Lys Asp As - #p Asp Asp Lys# 10- (2) INFORMATION FOR SEQ ID NO:404:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 378 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:404:- ATGGCATATC CAGAAACTGA TTACAAGGAC GACGATGACA AGGCTAACTG CT - #CTATAATG 60- ATCGATGAAA TTATACATCA CTTAAAGAGA CCACCTGCAC CTTTGCTGGA CC - #CGAACAAC 120- CTCAATGCTG AAGACGTCGA TATCCTGATG GAACGAAACC TTCGACTTCC AA - #ACCTGGAG 180- AGCTTCGTAA GGGCTGTCAA GAACTTAGAA AATGCATCAG GTATTGAGGC AA - #TTCTTCGT 240- AATCTCCAAC CATGTCTGCC CTCTGCCACG GCCGCACCCT CTCGACATCC AA - #TCATCATC 300- AAGGCAGGTG ACTGGCAAGA ATTCCGGGAA AAACTGACGT TCTATCTGGT TA - #CCCTTGAG 360# 378 AG- (2) INFORMATION FOR SEQ ID NO:405:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 378 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:405:- ATGGCATATC CAGAAACTGA TTACAAGGAC GACGATGACA AGGCTAACTG CT - #CTATAATG 60- ATCGATGAAA TTATACATCA CTTAAAGAGA CCACCTAACC CTTTGCTGGA CC - #CGAACAAC 120- CTCAATTCCG AAGACATGGA TATCCTGATG GAACGAAACC TTCGAACTCC AA - #ACCTGCTC 180- GCATTCGTAA GGGCTGTCAA GCACTTAGAA AATGCATCAG GTATTGAGGC AA - #TTCTTCGT 240- AATCTCCAAC CATGTCTGCC CTCTGCCACG GCCGCACCCT CTCGACATCC AA - #TCATCATC 300- AAGGCAGGTG ACTGGCAAGA ATTCCGGGAA AAACTGACGT TCTATCTGGT TA - #CCCTTGAG 360# 378 AG- (2) INFORMATION FOR SEQ ID NO:406:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 113 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:406:- Met Ala Asn Cys Ser Asn Met Ile Asp Glu Il - #e Ile Thr His Leu Lys# 15- Gln Pro Pro Leu Pro Leu Leu Asp Phe Asn As - #n Leu Asn Asp Glu Asp# 30- Met Ser Ile Leu Met Glu Asn Asn Leu Arg Ar - #g Pro Asn Leu Glu Ala# 45- Phe Asn Arg Ala Val Lys Ser Leu Gln Asn Al - #a Ser Ala Ile Glu Ser# 60- Ile Leu Lys Asn Leu Leu Pro Cys Leu Pro Le - #u Ala Thr Ala Ala Pro#80- Thr Arg His Pro Ile Ile Ile Arg Asp Gly As - #p Trp Asn Glu Phe Arg# 95- Arg Lys Leu Thr Phe Tyr Leu Trp Thr Leu Gl - #u Asn Ala Gln Ala Gln# 110- Gln- (2) INFORMATION FOR SEQ ID NO:407:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 111 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:407:- Asn Cys Ser Asn Met Ile Asp Glu Ile Ile Th - #r His Leu Lys Gln Pro# 15- Pro Leu Pro Leu Leu Asp Phe Asn Asn Leu As - #n Gly Glu Asp Gln Asp# 30- Ile Leu Met Asp Asn Asn Leu Arg Arg Pro As - #n Leu Glu Ala Phe Asn# 45- Arg Ala Val Lys Ser Leu Gln Asn Ala Ser Al - #a Ile Glu Ser Ile Leu# 60- Lys Asn Leu Leu Pro Cys Leu Pro Leu Ala Th - #r Ala Ala Pro Thr Arg#80- His Pro Ile His Ile Lys Asp Gly Asp Trp As - #n Glu Phe Arg Arg Lys# 95- Leu Thr Phe Tyr Leu Lys Thr Leu Glu Asn Al - #a Gln Ala Gln Gln# 110- (2) INFORMATION FOR SEQ ID NO:408:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 340 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:408:- ATGGCTAACT GCTCTAACAT GATCGATGAA ATCATCACCC ACCTGAAGCA GC - #CACCGCTG 60- CCGCTGCTGG ACTTCAACAA CCTCAATGGT GAAGACCAAG ATATCCTGAT GG - #AACAATAA 120- CCTTCGTCGT CCAAACCTCG AGGCATTCAA CCGTGCTGTC AACTCTCTGC AG - #AATGCATC 180- AGCAATTGAG AGCATTCTTA AAAATCTCCT GCCATGTCTG CCCCTGGCCA CG - #GCCGCACC 240- CACGCGACAT CCAATCCATA TCAAGGACGG TGACTGGAAT GAATTCCGTC GT - #AAACTGAC 300# 340 TTGG AGAACGCGCA GGCTCAACAG- (2) INFORMATION FOR SEQ ID NO:409:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 45 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:409:#45 ATTT CATCGATCAT TATAGAGCAG TTAGC- (2) INFORMATION FOR SEQ ID NO:410:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 36 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:410:# 36 CTGC ACCTTTGCTG GACCCG- (2) INFORMATION FOR SEQ ID NO:411:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 36 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:411:# 36 AGCA AAGGTGCAGG TGGTCT- (2) INFORMATION FOR SEQ ID NO:412:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 36 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:412:# 36 CTAA CCCTTTGCTG GACCCG- (2) INFORMATION FOR SEQ ID NO:413:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 36 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:413:# 36 AGCA AAGGGTTAGG TGGTCT- (2) INFORMATION FOR SEQ ID NO:414:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 36 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:414:# 36 CTGC ACCTTTGCTG GACAGT- (2) INFORMATION FOR SEQ ID NO:415:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 36 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (synthetic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:415:# 36 AGCA AAGGTGCAGG TGGAAC__________________________________________________________________________

Claims

1. A method of treating a patient having an immunodeficiency or hematopoietic deficiency comprising administering to said patient, a therapeutically effective amount of a mutant human interleukin-3 (hIL-3) polypeptide comprising a modified hIL-3 amino acid sequence selected from the group consisting of:
(a) a sequence of (SEQ ID NO:15)
wherein;
Xaa at position 17 is Ser, Lys, Gly, Asp, Met, Gln, or Arg;
Xaa at position 18 is Asn, His, Leu, Ile, Phe, Arg, or Gln;
Xaa at position 19 is Met, Phe, Ile, Arg, Gly, Ala, or Cys;
Xaa at position 20 is Ile, Cys, Gln, Glu, Arg, Pro, or Ala;
Xaa at position 21 is Asp, Phe, Lys, Arg, Ala, Gly, Glu, Gln, Asn, Thr, Ser or Val;
Xaa at position 22 is Glu, Trp, Pro, Ser, Ala, His, Asp, Asn, Gln, Leu, Val or Gly;
Xaa at position 23 is Ile, Val, Ala, Leu, Gly, Trp, Lys, Phe, Ser, or Arg;
Xaa at position 24 is Ile, Gly, Val, Arg, Ser, Phe, or Leu;
Xaa at position 25 is Thr, His, Gly, Gln, Arg, Pro, or Ala;
Xaa at position 26 is His, Thr, Phe, Gly, Arg, Ala, or Trp;
Xaa at position 27 is Leu, Gly, Arg, Thr, Ser, or Ala;
Xaa at position 28 is Lys, Arg, Leu, Gln, Gly, Pro, Val or Trp;
Xaa at position 29 is Gln, Asn, Leu, Pro, Arg, or Val;
Xaa at position 30 is Pro, His, Thr, Gly, Asp, Gln, Ser, Leu, or Lys;
Xaa at position 31 is Pro, Asp, Gly, Ala, Arg, Leu, or Gln;
Xaa at position 32 is Leu, Val, Arg, Gln, Asn, Gly, Ala, or Glu;
Xaa at position 33 is Pro, Leu, Gln, Ala, Thr, or Glu;
Xaa at position 34 is Leu, Val, Gly, Ser, Lys, Glu, Gln, Thr, Arg, Ala, Phe, Ile or Met;
Xaa at position 35 is Leu, Ala, Gly, Asn, Pro, Gln, or Val;
Xaa at position 36 is Asp, Leu, or Val;
Xaa at position 37 is Phe, Ser, Pro, Trp, or Ile;
Xaa at position 38 is Asn, or Ala;
Xaa at position 40 is Leu, Trp, or Arg;
Xaa at position 41 is Asn, Cys, Arg, Leu, His, Met, or Pro;
Xaa at position 42 is Gly, Asp, Ser, Cys, Asn, Lys, Thr, Leu, Val, Glu, Phe, Tyr, Ile, Met or Ala;
Xaa at position 43 is Glu, Asn, Tyr, Leu, Phe, Asp, Ala, Cys, Gln, Arg, Thr, Gly or Ser;
Xaa at position 44 is Asp, Ser, Leu, Arg, Lys, Thr, Met, Trp, Glu, Asn, Gln, Ala or Pro;
Xaa at position 45 is Gln, Pro, Phe, Val, Met, Leu, Thr, Lys, Trp, Asp, Asn, Arg, Ser, Ala, Ile, Glu or His;
Xaa at position 46 is Asp, Phe, Ser, Thr, Cys, Glu, Asn, Gln, Lys, His, Ala, Tyr, Ile, Val or Gly;
Xaa at position 47 is Ile, Gly, Val, Ser, Arg, Pro, or His;
Xaa at position 48 is Leu, Ser, Cys, Arg, Ile, His, Phe, Glu, Lys, Thr, Ala, Met, Val or Asn;
Xaa at position 49 is Met, Arg, Ala, Gly, Pro, Asn, His, or Asp;
Xaa at position 50 is Glu, Leu, Thr, Asp, Tyr, Lys, Asn, Ser, Ala, Ile, Val, His, Phe, Met or Gln;
Xaa at position 51 is Asn, Arg, Met, Pro, Ser, Thr, or His;
Xaa at position 52 is Asn, His, Arg, Leu, Gly, Ser, or Thr;
Xaa at position 53 is Leu, Thr, Ala, Gly, Glu, Pro, Lys, Ser, or Met;
Xaa at position 54 is Arg, Asp, Ile, Ser, Val, Thr, Gln, Asn, Lys, His, Ala or Leu;
Xaa at position 55 is Arg, Thr, Val, Ser, Leu, or Gly;
Xaa at position 56 is Pro, Gly, Cys, Ser, Gln, Glu, Arg, His, Thr, Ala, Tyr, Phe, Leu, Val or Lys;
Xaa at position 57 is Asn or Gly;
Xaa at position 58 is Leu, Ser, Asp, Arg, Gln, Val, or Cys;
Xaa at position 59 is Glu, Tyr, His, Leu, Pro, or Arg;
Xaa at position 60 is Ala, Ser, Pro, Tyr, Asn, or Thr;
Xaa at position 61 is Phe, Asn, Glu, Pro, Lys, Arg, or Ser;
Xaa at position 62 is Asn, His, Val, Arg, Pro, Thr, Asp, or Ile;
Xaa at position 63 is Arg, Tyr, Trp, Ser, His, Pro, or Val;
Xaa at position 64 is Ala, Asn, Pro, Ser, or Lys;
Xaa at position 65 is Val, Thr, Pro, His, Leu, Phe, or Ser;
Xaa at position 66 is Lys, Ile, Arg, Val, Asn, Glu, or Ser;
Xaa at position 67 is Ser, Ala, Phe, Val, Gly, Asn, Ile, Pro, or His;
Xaa at position 68 is Leu, Val, Trp, Ser, Ile, Phe, Thr, or His;
Xaa at position 69 is Gln, Ala, Pro, Thr, Glu, Arg, Trp, Gly, or Leu;
Xaa at position 70 is Asn, Leu, Val, Trp, Pro, or Ala;
Xaa at position 71 is Ala, Met, Leu, Pro, Arg, Glu, Thr, Gln, Trp, or Asn;
Xaa at position 72 is Ser, Glu, Met, Ala, His, Asn, Arg, or Asp;
Xaa at position 73 is Ala, Glu, Asp, Leu, Ser, Gly, Thr, or Arg;
Xaa at position 74 is Ile, Met, Thr, Pro, Arg, Gly, Ala;
Xaa at position 75 is Glu, Lys, Gly, Asp, Pro, Trp, Arg, Ser, Gln, or Leu;
Xaa at position 76 is Ser, Val, Ala, Asn, Trp, Glu, Pro, Gly, or Asp;
Xaa at position 77 is Ile, Ser, Arg, Thr, or Leu;
Xaa at position 78 is Leu, Ala, Ser, Glu, Phe, Gly, or Arg;
Xaa at position 79 is Lys, Thr, Asn, Met, Arg, Ile, Gly, or Asp;
Xaa at position 80 is Asn, Trp, Val, Gly, Thr, Leu, Glu, or Arg;
Xaa at position 81 is Leu, Gln, Gly, Ala, Trp, Arg, Val, or Lys;
Xaa at position 82 is Leu, Gln, Lys, Trp, Arg, Asp, Glu, Asn, His, Thr, Ser, Ala, Tyr, Phe, Ile, Met or Val;
Xaa at position 83 is Pro, Ala, Thr, Trp, Arg, or Met;
Xaa at position 84 is Cys, Glu, Gly, Arg, Met, or Val;
Xaa at position 85 is Leu, Asn, Val, or Gln;
Xaa at position 86 is Pro, Cys, Arg, Ala, or Lys;
Xaa at position 87 is Leu, Ser, Trp, or Gly;
Xaa at position 88 is Ala, Lys, Arg, Val, or Trp;
Xaa at position 89 is Thr, Asp, Cys, Leu, Val, Glu, His, Asn, or Ser;
Xaa at position 90 is Ala, Pro, Ser, Thr, Gly, Asp, Ile, or Met;
Xaa at position 91 is Ala, Pro, Ser, Thr, Phe, Leu, Asp, or His;
Xaa at position 92 is Pro, Phe, Arg, Ser, Lys, His, Ala, Gly, Ile or Leu;
Xaa at position 93 is Thr, Asp, Ser, Asn, Pro, Ala, Leu, or Arg;
Xaa at position 94 is Arg, Ile, Ser, Glu, Leu, Val, Gln, Lys, His, Ala, or Pro;
Xaa at position 95 is His, Gln, Pro, Arg, Val, Leu, Gly, Thr, Asn, Lys, Ser, Ala, Trp, Phe, Ile, or Tyr;
Xaa at position 96 is Pro, Lys, Tyr, Gly, Ile, or Thr;
Xaa at position 97 is Ile, Val, Lys, Ala, or Asn;
Xaa at position 98 is His, Ile, Asn, Leu, Asp, Ala, Thr, Glu, Gln, Ser, Phe, Met, Val, Lys, Tyr or Pro;
Xaa at position 99 is Ile, Leu, Arg, Asp, Val, Pro, Gln, Gly, Ser, Phe, or His;
Xaa at position 100 is Lys, Tyr, Leu, His, Arg, Ile, Ser, Gln, or Pro;
Xaa at position 101 is Asp;
Xaa at position 102 is Gly, Leu, Glu, Lys, Ser, Tyr, or Pro;
Xaa at position 103 is Asp, or Ser;
Xaa at position 104 is Trp, Val, Cys, Tyr, Thr, Met, Pro, Leu, Gln, Lys, Ala, Phe, or Gly;
Xaa at position 105 is Asn, Pro, Ala, Phe, Ser, Trp, Gln, Tyr, Leu, Lys, Ile, Asp, or His;
Xaa at position 106 is Glu, Ser, Ala, Lys, Thr, Ile, Gly, or Pro;
Xaa at position 108 is Arg, Lys, Asp, Leu, Thr, Ile, Gln, His, Ser, Ala or Pro;
Xaa at position 109 is Arg, Thr, Pro, Glu, Tyr, Leu, Ser, or Gly;
Xaa at position 110 is Lys, Ala, Asn, Thr, Leu, Arg, Gln, His, Glu, Ser, Ala, or Trp;
Xaa at position 111 is Leu, Ile, Arg, Asp, or Met;
Xaa at position 112 is Thr, Val, Gln, Tyr, Glu, His, Ser, or Phe;
Xaa at position 113 is Phe, Ser, Cys, His, Gly, Trp, Tyr, Asp, Lys, Leu, Ile, Val or Asn;
Xaa at position 114 is Tyr, Cys, His, Ser, Trp, Arg, or Leu;
Xaa at position 115 is Leu, Asn, Val, Pro, Arg, Ala, His, Thr, Trp, or Met;
Xaa at position 116 is Lys;
Xaa at position 117 is Thr, Ser, Asn, Ile, Trp, Lys, or Pro;
Xaa at position 118 is Leu, Ser, Pro, Ala, Glu, Cys, Asp, or Tyr;
Xaa at position 119 is Glu, Ser, Lys, Pro, Leu, Thr, Tyr, or Arg;
Xaa at position 120 is Asn, Ala, Pro, Leu, His, Val, or Gln;
Xaa at position 121 is Ala, Ser, Ile, Asn, Pro, Lys, Asp, or Gly;
Xaa at position 122 is Gln, Ser, Met, Trp, Arg, Phe, Pro, His, Ile, Tyr, or Cys;
Xaa at position 123 is Ala, Met, Glu, His, Ser, Pro, Tyr, or Leu;
wherein from 4 to about 44 of the amino acids designated by Xaa are different from the corresponding amino acids of native (1-133) human interleukin-3 with the proviso that no more than one of the amino acids at positions 63, 82, 87, 98, 112, and 121 are different from the corresponding amino acids in native human interleukin-3; and wherein from 1 to 14 amino acids are optionally deleted from the N-terminus and/or from 1 to 15 amino acids are optionally deleted from the C-terminus; and said mutant human interleukin-3 polypeptide has increased cell proliferative activity compared to native human interleukin-3 in at least one assay selected from the group consisting of: AML cell proliferation, TF-1 cell proliferation and Methylcellulose assay; and
(b) a polypeptide comprising an N-terminal methionine residue, alanine residue or methionine-alanine di-peptide immediately preceding said sequence according to (a).
2. The method according to claim 1, wherein said mutant human interleukin-3 polypeptide has at least three times greater cell proliferative activity compared to native human interleukin-3.
3. The method according to claim 1, wherein said mutant human interleukin-3 polypeptide has at least ten times greater cell proliferative activity compared to native human interleukin-3.
4. A method of treating a patient having an immunodeficiency or hematopoietic deficiency comprising administering to said patient, a therapeutically effective amount of a mutant human interleukin-3 (hIL-3) polypeptide comprising a modified hIL-3 amino acid sequence selected from the group consisting of:
(a) a sequence of (SEQ ID NO:17)
wherein;
Xaa at position 17 is Ser, Gly, Asp, Met, or Gln;
Xaa at position 18 is Asn, His, or Ile;
Xaa at position 19 is Met or Ile;
Xaa at position 21 is Asp or Glu;
Xaa at position 23 is Ile, Ala, Leu, or Gly;
Xaa at position 24 is Ile, Val, or Leu;
Xaa at position 25 is Thr, His, Gln, or Ala;
Xaa at position 26 is His or Ala;
Xaa at position 29 is Gln, Asn, or Val;
Xaa at position 30 is Pro, Gly, or Gln;
Xaa at position 31 is Pro, Asp, Gly, or Gln;
Xaa at position 32 is Leu, Arg, Gln, Asn, Gly, Ala, or Glu;
Xaa at position 33 is Pro or Glu;
Xaa at position 34 is Leu, Val, Gly, Ser, Lys, Ala, Arg, Gln, Glu, Ile, Phe, Thr or Met;
Xaa at position 35 is Leu, Ala, Asn, Pro, Gln, or Val;
Xaa at position 37 is Phe, Ser, Pro, or Trp;
Xaa at position 38 is Asn or Ala;
Xaa at position 42 is Gly, Asp, Ser, Cys, Ala, Asn, Ile, Leu, Met, Tyr or Arg;
Xaa at position 44 is Asp or Glu;
Xaa at position 45 is Gln, Val, Met, Leu, Thr, Ala, Asn, Glu, Ser or Lys;
Xaa at position 46 is Asp, Phe, Ser, Thr, Ala, Asn, Gln, Glu, His, Ile, Lys, Tyr, Val or Cys;
Xaa at position 50 is Glu, Ala, Asn, Ser or Asp;
Xaa at position 51 is Asn, Arg, Met, Pro, Ser, Thr, or His;
Xaa at position 54 is Arg or Ala;
Xaa at position 55 is Arg, Thr, Val, Leu, or Gly;
Xaa at position 56 is Pro, Gly, Ser, Gln, Ala, Arg, Asn, Glu, Leu, Thr, Val or Lys;
Xaa at position 60 is Ala or Ser;
Xaa at position 62 is Asn, Pro, Thr, or Ile;
Xaa at position 63 is Arg;
Xaa at position 64 is Ala or Asn;
Xaa at position 65 is Val or Thr;
Xaa at position 66 is Lys or Arg;
Xaa at position 67 is Ser, Phe, or His;
Xaa at position 68 is Leu, Ile, Phe, or His;
Xaa at position 69 is Gln, Ala, Pro, Thr, Glu, Arg, or Gly;
Xaa at position 71 is Ala, Pro, or Arg;
Xaa at position 72 is Ser, Glu, Arg, or Asp;
Xaa at position 73 is Ala or Leu;
Xaa at position 76 is Ser, Val, Ala, Asn, Glu, Pro, or Gly;
Xaa at position 77 is Ile or Leu;
Xaa at position 79 is Lys, Thr, Gly, Asn, Met, Arg, Ile, or Asp;
Xaa at position 80 is Asn, Gly, Glu, or Arg;
Xaa at position 82 is Leu, Gln, Trp, Arg, Asp, Ala, Asn, Glu, His, Ile, Met, Phe, Ser, Thr, Tyr or Val;
Xaa at position 83 is Pro or Thr;
Xaa at position 85 is Leu or Val;
Xaa at position 87 is Leu or Ser;
Xaa at position 88 is Ala or Trp;
Xaa at position 91 is Ala or Pro;
Xaa at position 93 is Thr, Asp, Ser, Pro, Ala, Leu, or Arg;
Xaa at position 95 is His, Pro, Arg, Val, Leu, Gly, Asn, Phe, Ser or Thr;
Xaa at position 96 is Pro or Tyr;
Xaa at position 97 is Ile or Val;
Xaa at position 98 is His, Ile, Asn, Leu, Ala, Thr, Gln, Lys, Met, Ser, Tyr, Val or Pro;
Xaa at position 99 is Ile, Leu, or Val;
Xaa at position 100 is Lys, Arg, Ile, Gln, Pro, or Ser;
Xaa at position 101 is Asp;
Xaa at position 104 is Trp or Leu;
Xaa at position 105 is Asn, Pro, Ala, Ser, Trp, Gln, Tyr, Leu, Lys, Ile, Asp, or His;
Xaa at position 106 is Glu or Gly;
Xaa at position 108 is Arg, Ala, or Ser;
Xaa at position 109 is Arg, Thr, Glu, Leu, or Ser;
Xaa at position 112 is Thr, Val, or Gln;
Xaa at position 114 is Tyr or Trp;
Xaa at position 115 is Leu or Ala;
Xaa at position 116 is Lys;
Xaa at position 117 is Thr or Ser;
Xaa at position 120 is Asn, Pro, Leu, His, Val, or Gln;
Xaa at position 121 is Ala, Ser, Ile, Asn, Pro, Asp, or Gly;
Xaa at position 122 is Gln, Ser, Met, Trp, Arg, Phe, Pro, His, Ile, Tyr, or Cys;
Xaa at position 123 is Ala, Met, Glu, His, Ser, Pro, Tyr, or Leu;
wherein from 4 to about 44 of the amino acids designated by Xaa are different from the corresponding amino acids of native (1-133) human interleukin-3 with the proviso that no more than one of the amino acids at positions 63, 82, 87, 98, 112, and 121 are different from the corresponding amino acids in native human interleukin-3; and wherein from 1 to 14 amino acids are optionally deleted from the N-terminus and/or from 1 to 15 amino acids are optionally deleted from the C-terminus; and said mutant human interleukin-3 polypeptide has increased cell proliferative activity compared to native human interleukin-3 in at least one assay selected from the group consisting of: AML cell proliferation, TF-1 cell proliferation and Methylcellulose assay; and
(b) a polypeptide comprising an N-terminal methionine residue, alanine residue or methionine-alanine di-peptide immediately preceding said sequence according to (a).
5. The method according to claim 4, wherein said mutant human interleukin-3 polypeptide has at least three times greater cell proliferative activity compared to native human interleukin-3.
6. The method according to claim 4, wherein said mutant human interleukin-3 polypeptide has at least ten times greater cell proliferative activity compared to native human interleukin-3.
7. The method according to claim 4, wherein in said mutant human interleukin-3 (hIL-3) sequence the amino acids which differ from the corresponding residue in native human interleukin-3 are selected from the group consisting of:
position 42 wherein Xaa is Gly, Asp, Ser, Ile, Leu, Met, Tyr, or Ala;
position 45 wherein Xaa is Gln, Val, Met or Asn;
position 46 wherein Xaa is Asp, Ser, Gln, His or Val;
position 50 wherein Xaa is Glu or Asp;
position 51 wherein Xaa is Asn, Pro or Thr;
position 62 wherein Xaa is Asn or Pro;
position 76 wherein Xaa is Ser, or Pro;
position 82 wherein Xaa is Leu, Trp, Asp, Asn Glu, His, Phe, Ser or Tyr;
position 95 wherein Xaa is His, Arg, Thr, Asn or Ser;
position 98 wherein Xaa is His, Ile, Leu, Ala, Gln, Lys, Met, Ser, Tyr or Val;
position 100 wherein Xaa is Lys or Arg;
position 101 wherein Xaa is Asp;
position 105 wherein Xaa is Asn, or Pro;
position 108 wherein Xaa is Arg, Ala, or Ser;
position 116 wherein Xaa is Lys;
position 121 wherein Xaa is Ala, or Ile;
position 122 wherein Xaa is Gln, or Ile;
position 123 wherein Xaa is Ala, Met or Glu.
8. The method according to claim 7, wherein said mutant human interleukin-3 polypeptide has at least three times greater cell proliferative activity compared to native human interleukin-3.
9. The method according to claim 7, wherein said mutant human interleukin-3 polypeptide has at least ten times greater cell proliferative activity compared to native human interleukin-3.
10. A method of treating a patient having an immunodeficiency or hematopoietic deficiency comprising administering to said patient, a therapeutically effective amount of a mutant human interleukin-3 (hIL-3) polypeptide comprising a modified hIL-3 amino acid sequence selected from the group consisting of:
(a) a sequence of (SEQ ID NO:19)
wherein;
Xaa at position 3 is Ser, Lys, Gly, Asp, Met, Gln, or Arg;
Xaa at position 4 is Asn, His, Leu, Ile, Phe, Arg, or Gln;
Xaa at position 5 is Met, Phe, Ile, Arg, Gly, Ala, or Cys;
Xaa at position 6 is Ile, Cys, Gln, Glu, Arg, Pro, or Ala;
Xaa at position 7 is Asp, Phe, Lys, Arg, Ala, Gly, Glu, Gln, Asn, Thr, Ser or Val;
Xaa at position 8 is Glu, Trp, Pro, Ser, Ala, His, Asp, Asn, Gln, Leu, Val, or Gly;
Xaa at position 9 is Ile, Val, Ala, Leu, Gly, Trp, Lys, Phe, Ser, or Arg;
Xaa at position 10 is Ile, Gly, Val, Arg, Ser, Phe, or Leu;
Xaa at position 11 is Thr, His, Gly, Gln, Arg, Pro, or Ala;
Xaa at position 12 is His, Thr, Phe, Gly, Arg, Ala, or Trp;
Xaa at position 13 is Leu, Gly, Arg, Thr, Ser, or Ala;
Xaa at position 14 is Lys, Arg, Leu, Gln, Gly, Pro, Val or Trp;
Xaa at position 15 is Gln, Asn, Leu, Pro, Arg, or Val;
Xaa at position 16 is Pro, His, Thr, Gly, Asp, Gln, Ser, Leu, or Lys;
Xaa at position 17 is Pro, Asp, Gly, Ala, Arg, Leu, or Gln;
Xaa at position 18 is Leu, Val, Arg, Gln, Asn, Gly, Ala, or Glu;
Xaa at position 19 is Pro, Leu, Gln, Ala, Thr, or Glu;
Xaa at position 20 is Leu, Val, Gly, Ser, Lys, Glu, Gln, Thr, Arg, Ala, Phe, Ile or Met;
Xaa at position 21 is Leu, Ala, Gly, Asn, Pro, Gln, or Val;
Xaa at position 22 is Asp, Leu, or Val;
Xaa at position 23 is Phe, Ser, Pro, Trp, or Ile;
Xaa at position 24 is Asn, or Ala;
Xaa at position 26 is Leu, Trp, or Arg;
Xaa at position 27 is Asn, Cys, Arg, Leu, His, Met, Pro;
Xaa at position 28 is Gly, Asp, Ser, Cys, Ala, Lys, Asn, Thr, Leu, Val, Glu, Phe, Tyr, Ile or Met;
Xaa at position 29 is Glu, Asn, Tyr, Leu, Phe, Asp, Ala, Cys, Gln, Arg, Thr, Gly or Ser;
Xaa at position 30 is Asp, Ser, Leu, Arg, Lys, Thr, Met, Trp, Glu, Asn, Gln, Ala or Pro;
Xaa at position 31 is Gln, Pro, Phe, Val, Met, Leu, Thr, Lys, Asp, Asn, Arg, Ser, Ala, Ile, Glu, His or Trp;
Xaa at position 32 is Asp, Phe, Ser, Thr, Cys, Glu, Asn, Gln, Lys, His, Ala, Tyr, Ile, Val or Gly;
Xaa at position 33 is Ile, Gly, Val, Ser, Arg, Pro, or His;
Xaa at position 34 is Leu, Ser, Cys, Arg, Ile, His, Phe, Glu, Lys, Thr, Ala, Met, Val or Asn;
Xaa at position 35 is Met, Arg, Ala, Gly, Pro, Asn, His, or Asp;
Xaa at position 36 is Glu, Leu, Thr, Asp, Tyr, Lys, Asn, Ser, Ala, Ile, Val, His, Phe, Met or Gln;
Xaa at position 37 is Asn, Arg, Met, Pro, Ser, Thr, or His;
Xaa at position 38 is Asn, His, Arg, Leu, Gly, Ser, or Thr;
Xaa at position 39 is Leu, Thr, Ala, Gly, Glu, Pro, Lys, Ser, or Met;
Xaa at position 40 is Arg, Asp, Ile, Ser, Val, Thr, Gln, Asn, Lys, His, Ala or Leu;
Xaa at position 41 is Arg, Thr, Val, Ser, Leu, or Gly;
Xaa at position 42 is Pro, Gly, Cys, Ser, Gln, Glu, Arg, His, Thr, Ala, Tyr, Phe, Leu, Val or Lys;
Xaa at position 43 is Asn or Gly;
Xaa at position 44 is Leu, Ser, Asp, Arg, Gln, Val, or Cys;
Xaa at position 45 is Glu, Tyr, His, Leu, Pro, or Arg;
Xaa at position 46 is Ala, Ser, Pro, Tyr, Asn, or Thr;
Xaa at position 47 is Phe, Asn, Glu, Pro, Lys, Arg, or Ser;
Xaa at position 48 is Asn, His, Val, Arg, Pro, Thr, Asp, or Ile;
Xaa at position 49 is Arg, Tyr, Trp, Ser, His, Pro, or Val;
Xaa at position 50 is Ala, Asn, Pro, Ser, or Lys;
Xaa at position 51 is Val, Thr, Pro, His, Leu, Phe, or Ser;
Xaa at position 52 is Lys, Ile, Arg, Val, Asn, Glu, or Ser;
Xaa at position 53 is Ser, Ala, Phe, Val, Gly, Asn, Ile, Pro, or His;
Xaa at position 54 is Leu, Val, Trp, Ser, Ile, Phe, Thr, or His;
Xaa at position 55 is Gln, Ala, Pro, Thr, Glu, Arg, Trp, Gly, or Leu;
Xaa at position 56 is Asn, Leu, Val, Trp, Pro, or Ala;
Xaa at position 57 is Ala, Met, Leu, Pro, Arg, Glu, Thr, Gln, Trp, or Asn;
Xaa at position 58 is Ser, Glu, Met, Ala, His, Asn, Arg, or Asp;
Xaa at position 59 is Ala, Glu, Asp, Leu, Ser, Gly, Thr, or Arg;
Xaa at position 60 is Ile, Met, Thr, Pro, Arg, Gly, Ala;
Xaa at position 61 is Glu, Lys, Gly, Asp, Pro, Trp, Arg, Ser, Gln, or Leu;
Xaa at position 62 is Ser, Val, Ala, Asn, Trp, Glu, Pro, Gly, or Asp;
Xaa at position 63 is Ile, Ser, Arg, Thr, or Leu;
Xaa at position 64 is Leu, Ala, Ser, Glu, Phe, Gly, or Arg;
Xaa at position 65 is Lys, Thr, Gly, Asn, Met, Arg, Ile, or Asp;
Xaa at position 66 is Asn, Trp, Val, Gly, Thr, Leu, Glu, or Arg;
Xaa at position 67 is Leu, Gln, Gly, Ala, Trp, Arg, Val, or Lys;
Xaa at position 68 is Leu, Gln, Lys, Trp, Arg, Asp, Glu, Asn, His, Thr, Ser, Ala, Tyr, Phe, Ile, Met or Val;
Xaa at position 69 is Pro, Ala, Thr, Trp, Arg, or Met;
Xaa at position 70 is Cys, Glu, Gly, Arg, Met, or Val;
Xaa at position 71 is Leu, Asn, Val, or Gln;
Xaa at position 72 is Pro, Cys, Arg, Ala, or Lys;
Xaa at position 73 is Leu, Ser, Trp, or Gly;
Xaa at position 74 is Ala, Lys, Arg, Val, or Trp;
Xaa at position 75 is Thr, Asp, Cys, Leu, Val, Glu, His, Asn, or Ser;
Xaa at position 76 is Ala, Pro, Ser, Thr, Gly, Asp, Ile, or Met;
Xaa at position 77 is Ala, Pro, Ser, Thr, Phe, Leu, Asp, or His;
Xaa at position 78 is Pro, Phe, Arg, Ser, Lys, His, Ala, Gly, Ile or Leu;
Xaa at position 79 is Thr, Asp, Ser, Asn, Pro, Ala, Leu, or Arg;
Xaa at position 80 is Arg, Ile, Ser, Glu, Leu, Val, Gln, Lys, His, Ala or Pro;
Xaa at position 81 is His, Gln, Pro, Arg, Val, Leu, Gly, Thr, Asn, Lys, Ser, Ala, Trp, Phe, Ile or Tyr;
Xaa at position 82 is Pro, Lys, Tyr, Gly, Ile, or Thr;
Xaa at position 83 is Ile, Val, Lys, Ala, or Asn;
Xaa at position 84 is His, Ile, Asn, Leu, Asp, Ala, Thr, Glu, Gln, Ser, Phe, Met, Val, Lys, Tyr or Pro;
Xaa at position 85 is Ile, Leu, Arg, Asp, Val, Pro, Gln, Gly, Ser, Phe, or His;
Xaa at position 86 is Lys, Tyr, Leu, His, Arg, Ile, Ser, Gln, or Pro;
Xaa at position 87 is Asp;
Xaa at position 88 is Gly, Leu, Glu, Lys, Ser, Tyr, or Pro;
Xaa at position 89 is Asp, or Ser;
Xaa at position 90 is Trp, Val, Cys, Tyr, Thr, Met, Pro, Leu, Gln, Lys, Ala, Phe, or Gly;
Xaa at position 91 is Asn, Pro, Ala, Phe, Ser, Trp, Gln, Tyr, Leu, Lys, Ile, Asp, or His;
Xaa at position 92 is Glu, Ser, Ala, Lys, Thr, Ile, Gly, or Pro;
Xaa at position 94 is Arg, Lys, Asp, Leu, Thr, Ile, Gln, His, Ser, Ala, or Pro;
Xaa at position 95 is Arg, Thr, Pro, Glu, Tyr, Leu, Ser, or Gly;
Xaa at position 96 is Lys, Asn, Thr, Leu, Gln, Arg, His, Glu, Ser, Ala or Trp;
Xaa at position 97 is Leu, Ile, Arg, Asp, or Met;
Xaa at position 98 is Thr, Val, Gln, Tyr, Glu, His, Ser, or Phe;
Xaa at position 99 is Phe, Ser, Cys, His, Gly, Trp, Tyr, Asp, Lys, Leu, Ile, Val or Asn;
Xaa at position 100 is Tyr, Cys, His, Ser, Trp, Arg, or Leu;
Xaa at position 101 is Leu, Asn, Val, Pro, Arg, Ala, His, Thr, Trp, or Met;
Xaa at position 102 is Lys;
Xaa at position 103 is Thr, Ser, Asn, Ile, Trp, Lys, or Pro;
Xaa at position 104 is Leu, Ser, Pro, Ala, Glu, Cys, Asp, or Tyr;
Xaa at position 105 is Glu, Ser, Lys, Pro, Leu, Thr, Tyr, or Arg;
Xaa at position 106 is Asn, Ala, Pro, Leu, His, Val, or Gln;
Xaa at position 107 is Ala, Ser, Ile, Asn, Pro, Lys, Asp, or Gly;
Xaa at position 108 is Gln, Ser, Met, Trp, Arg, Phe, Pro, His, lie, Tyr, or Cys;
Xaa at position 109 is Ala, Met, Glu, His, Ser, Pro, Tyr, or Leu;
wherein from 4 to about 44 of the amino acids designated by Xaa are different from the corresponding native amino acids of (1-133) human interleukin-3 with the proviso that no more than one of the amino acids at positions 49, 68, 73, 84, 98, and 107 are different from the corresponding amino acids in native human interleukin-3; and said mutant human interleukin-3 polypeptide has increased cell proliferative activity compared to native human interleukin-3 in at least one assay selected from the group consisting of: AML cell proliferation, TF-1 cell proliferation and Methylcellulose assay; and
(b) a polypeptide comprising an N-terminal methionine residue, alanine residue or methionine-alanine di-peptide immediately preceding said sequence according to (a).
11. The method according to claim 10, wherein said mutant human interleukin-3 polypeptide has at least three times greater cell proliferative activity compared to native human interleukin-3.
12. The method according to claim 10, wherein said mutant human interleukin-3 polypeptide has at least ten times greater cell proliferative activity compared to native human interleukin-3.
13. A method of treating a patient having an immunodeficiency or hematopoietic deficiency comprising administering to said patient, a therapeutically effective amount of a mutant human interleukin-3 (hIL-3) polypeptide comprising a modified hIL-3 amino acid sequence selected from the group consisting of:
(a) a sequence of (SEQ ID NO:21)
wherein;
Xaa at position 3 is Ser, Gly, Asp, Met, or Gln;
Xaa at position 4 is Asn, His, or Ile;
Xaa at position 5 is Met or Ile;
Xaa at position 7 is Asp or Glu;
Xaa at position 9 is Ile, Ala, Leu, or Gly;
Xaa at position 10 is Ile, Val, or Leu;
Xaa at position 11 is Thr, His, Gln, or Ala;
Xaa at position 12 is His or Ala;
Xaa at position 15 is Gln, Asn, or Val;
Xaa at position 16 is Pro, Gly, or Gln;
Xaa at position 17 is Pro, Asp, Gly, or Gln;
Xaa at position 18 is Leu, Arg, Gln, Asn, Gly, Ala, or Glu;
Xaa at position 19 is Pro or Glu;
Xaa at position 20 is Leu, Val, Gly, Ser, Lys, Ala, Arg, Gln, Glu, Ile, Phe, Thr or Met;
Xaa at position 21 is Leu, Ala, Asn, Pro, Gln, or Val;
Xaa at position 23 is Phe, Ser, Pro, or Trp;
Xaa at position 24 is Asn or Ala;
Xaa at position 28 is Gly, Asp, Ser, Cys, Ala, Asn, Ile, Leu, Met Tyr or Arg;
Xaa at position 30 is Asp or Glu;
Xaa at position 31 is Gln, Val, Met, Leu, Thr, Ala, Asn, Glu, Ser or Lys;
Xaa at position 32 is Asp, Phe, Ser, Thr, Ala, Asn, Gln, Glu, His, Ile, Lys, Tyr, Val or Cys;
Xaa at position 36 is Glu, Ala, Asn, Ser or Asp;
Xaa at position 37 is Asn, Arg, Met, Pro, Ser, Thr, or His;
Xaa at position 40 is Arg or Ala;
Xaa at position 41 is Arg, Thr, Val, Leu, or Gly;
Xaa at position 42 is Pro, Gly, Ser, Gln, Ala, Arg, Asn, Glu, Leu, Thr, Val or Lys;
Xaa at position 46 is Ala or Ser;
Xaa at position 48 is Asn, Pro, Thr, or Ile;
Xaa at position 49 is Arg;
Xaa at position 50 is Ala or Asn;
Xaa at position 51 is Val or Thr;
Xaa at position 52 is Lys or Arg;
Xaa at position 53 is Ser, Phe, or His;
Xaa at position 54 is Leu, Ile, Phe, or His;
Xaa at position 55 is Gln, Ala, Pro, Thr, Glu, Arg, or Gly;
Xaa at position 57 is Ala, Pro, or Arg;
Xaa at position 58 is Ser, Glu, Arg, or Asp;
Xaa at position 59 is Ala or Leu;
Xaa at position 62 is Ser, Val, Ala, Asn, Glu, Pro, or Gly;
Xaa at position 63 is Ile or Leu;
Xaa at position 65 is Lys, Thr, Gly, Asn, Met, Arg, Ile, or Asp;
Xaa at position 66 is Asn, Gly, Glu, or Arg;
Xaa at position 68 is Leu, Gln, Trp, Arg, Asp, Ala, Asn, Glu, His, Ile, Met, Phe, Ser, Thr, Tyr or Val;
Xaa at position 69 is Pro or Thr;
Xaa at position 71 is Leu or Val;
Xaa at position 73 is Leu or Ser;
Xaa at position 74 is Ala or Trp;
Xaa at position 77 is Ala or Pro;
Xaa at position 79 is Thr, Asp, Ser, Pro, Ala, Leu, or Arg;
Xaa at position 81 is His, Pro, Arg, Val, Leu, Gly, Asn, Phe, Ser or Thr;
Xaa at position 82 is Pro or Tyr;
Xaa at position 83 is Ile or Val;
Xaa at position 84 is His, Ile, Asn, Leu, Ala, Thr, Gln, Lys, Met, Ser, Tyr, Val or Pro;
Xaa at position 85 is Ile, Leu, or Val;
Xaa at position 86 is Lys, Arg, Ile, Gln, Pro, or Ser;
Xaa at position 87 is Asp;
Xaa at position 90 is Trp or Leu;
Xaa at position 91 is Asn, Pro, Ala, Ser, Trp, Gln, Tyr, Leu, Lys, Ile, Asp, or His;
Xaa at position 92 is Glu, or Gly;
Xaa at position 94 is Arg, Ala, or Ser;
Xaa at position 95 is Arg, Thr, Glu, Leu, or Ser;
Xaa at position 98 is Thr, Val, or Gln;
Xaa at position 100 is Tyr or Trp;
Xaa at position 101 is Leu or Ala;
Xaa at position 102 is Lys;
Xaa at position 103 is Thr or Ser;
Xaa at position 106 is Asn, Pro, Leu, His, Val, or Gln;
Xaa at position 107 is Ala, Ser, Ile, Asn, Pro, Asp, or Gly;
Xaa at position 108 is Gln, Ser, Met, Trp, Arg, Phe, Pro, His, Ile, Tyr, or Cys;
Xaa at position 109 is Ala, Met, Glu, His, Ser, Pro, Tyr, or Leu;
wherein from 4 to about 44 of the amino acids designated by Xaa are different from the corresponding amino acids of native (1-133) human interleukin-3 with the proviso that no more than one of the amino acids at positions 49, 68, 73, 84, 98, and 107 are different from the corresponding amino acids in native human interleukin-3; and said mutant human interleukin-3 polypeptide has increased cell proliferative activity compared to native human interleukin-3 in at least one assay selected from the group consisting of: AML cell proliferation, TF-l cell proliferation and Methylcellulose assay; and
(b) a polypeptide comprising an N-terminal methionine residue, alanine residue or methionine-alanine di-peptide immediately preceding said sequence according to (a).
14. The method according to claim 13, wherein said mutant human interleukin-3 polypeptide has at least three times greater cell proliferative activity compared to native human interleukin-3.
15. The method according to claim 13, wherein said mutant human interleukin-3 polypeptide has at least ten times greater cell proliferative activity compared to native human interleukin-3.
16. The method according to claim 13, wherein in said mutant human interleukin-3 (hIL-3) sequence the amino acids which differ from the corresponding residue in native human interleukin-3 are selected from the group consisting of:
position 28 wherein Xaa is Gly, Asp, Ser, Ile, Leu, Met, Tyr, or Ala;
position 31 wherein Xaa is Gln, Val, Met or Asn;
position 32 wherein Xaa is Asp, Ser, Ala, Gln, His or Val;
position 36 wherein Xaa is Glu or Asp;
position 37 wherein Xaa is Asn, Pro or Thr;
position 48 wherein Xaa is Asn or Pro;
position 62 wherein Xaa is Ser, or Pro;
position 68 wherein Xaa is Leu, Trp, Asp, Asn, Glu, His, Phe, Ser or Tyr;
position 81 wherein Xaa is His, Arg, Thr, Asn or Ser;
position 84 wherein Xaa is His, Ile, Leu, Ala, Arg, Gln, Lys, Met, Ser, Tyr or Val;
position 86 wherein Xaa is Lys or Arg;
position 87 wherein Xaa is Asp;
position 91 wherein Xaa is Asn, or Pro;
position 94 wherein Xaa is Arg, Ala, or Ser;
position 102 wherein Xaa is Lys;
position 107 wherein Xaa is Ala, or Ile;
position 108 wherein Xaa is Gln, or Ile;
position 109 wherein Xaa is Ala, Met or Glu.
17. The method according to claim 16, wherein said mutant human interleukin-3 polypeptide has at least three times greater cell proliferative activity compared to native human interleukin-3.
18. The method according to claim 16, wherein said mutant human interleukin-3 polypeptide has at least ten times greater cell proliferative activity compared to native human interleukin-3.
19. A method of treating a patient having an immunodeficiency or hematopoietic deficiency comprising administering to said patient, a therapeutically effective amount of a mutant human interleukin-3 (hIL-3) polypeptide comprising a modified hIL-3 amino acid sequence selected from the group consisting of:
(a) a polypeptide having an amino acid sequence of
(18I, 25H, 29R, 32A, 37P, 42A and 45V)-(15-125)human interleukin-3 (SEQ ID NO:66);
(18I, 25H, 29R, 32N, 37P, 42S and 45M)-(15-125)human interleukin-3 (SEQ ID NO:67);
(18I, 25H, 29V, 32A, 37S, 42S and 45M)-(15-125)human interleukin-3 (SEQ ID NO:68);
(51R, 55L, 59L, 62V, 67N and 69E)-(15-125)human interleukin-3 (SEQ ID NO:69);
(51R, 55L, 60S, 62V, 67N and 69E)-(15-125)human interleukin-3 (SEQ ID NO:70);
(51R, 55T, 59L, 62V, 67H and 69E)-(15-125)human interleukin-3 (SEQ ID NO:71);
(73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A and 105Q)-(15-125)human interleukin-3 (SEQ ID NO:72);
(73G, 76A, 79R, 82V, 87S, 93S, 98T, 101A and 105Q)-(15-125)human interleukin-3 (SEQ ID NO:73);
(73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and 123E)-(15-125)human interleukin-3 (SEQ. ID. NO:76)
(73G, 76A, 79R, 82V, 87S, 93S, 98T, 101A, 105Q, 109E, 116V, 120Q and 123E)-(15-125)human interleukin-3 (SEQ ID NO:77);
(73G, 76A, 79R, 82V, 87S, 93S, 98T, 101A, 105Q, 109E, 116V, 117S, 120H and 123E)-(15-125)human interleukin-3 (SEQ ID NO:78);
(18I, 25H, 29R, 32A, 37P, 42A, 45V, 51R, 55L, 60S, 62V, 67N and 69E)-(15-125)human interleukin-3 (SEQ ID NO:79);
(18I, 25H, 29R, 32N, 37P, 42S, 45M, 51R, 55T, 59L, 62V, 67H and 69E)-(15-125)human interleukin-3 (SEQ ID NO:80);
(18I, 25H, 29V, 32A, 37S, 42S, 45M, 51R, 55L, 59L, 62V, 67N and 69E)-(15-125)human interleukin-3 (SEQ ID NO:81);
(42D, 45M, 46S, 50D, 95R, 98I, 100R, 116W)-(15-125)human interleukin-3 (residues 3-113 of SEQ ID NO:263);
(42D, 45M, 46S, 98I, 10R, 116W)-(15-125)human interleukin-3 (SEQ ID NO:406);
(18I, 19A, 25H, 29R, 32N, 37P, 42S, 45V, 49D, 51R, 55T, 59L, 62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and 123E)-(15-125)human interleukin-3 (residues 3-113 of SEQ ID NO:276);
(18I, 19I, 25H, 29R, 32N, 37P, 42S, 45V, 49D, 51R, 55T, 59L, 62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and 123E)-(15-125)human interleukin-3 (residues 3-113 of SEQ ID NO:277);
(18I, 23A, 25H, 29V, 32A, 37S, 42S, 45M, 51R, 55L, 59L, 62V, 67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and 123E)-(15-125)human interleukin-3 (residues 3-113 of SEQ ID NO:278);
(18I, 23A, 25H, 29V, 32A, 37S, 42S, 45M, 51R, 55L, 59L, 62V, 67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 112Q, 116V, 120Q and 123E)-(15-125)human interleukin-3 (SEQ ID NO:279);
(18I, 25H, 29R, 32A, 37P, 42A, 45V, 51R, 55L, 60S, 62V, 67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V,)-(15-119)human interleukin-3 (residues 3-113 of SEQ ID NO:287);
(18I, 23A, 25H, 29R, 32A, 37P, 42D, 45V, 46S, 50D, 51R, 55L, 60S, 62V, 67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 112Q, 116V)-(15-119)human interleukin-3 (residues 3-113 of SEQ ID NO:289);
(18I, 25H, 29R, 32A, 37P, 42A, 45V, 51R, 55L, 60S, 62V, 67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 112Q, 116V)-(15-119)human interleukin-3 (residues 3-113 of SEQ ID NO:307);
(18I, 20P, 23A, 25H, 29I, 32N, 34S, 37S, 38A, 42S, 45V, 46S, 51R, 55T, 59L, 62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and 123E)-(15-125)human interleukin-3 (residues 3-113 of SEQ ID NO:317);
(18I, 23L, 25H, 29I, 32N, 34S, 37S, 38A, 42S, 45V, 46S, 51R, 55T, 59L, 62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and 123E)-(15-125)human interleukin-3 (residues 3-113 of SEQ ID NO:318);
(18I, 23A, 25H, 29I, 32N, 34S, 37S, 38A, 42S, 45V, 46S, 51R, 55T, 59L, 62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and 123E)-(15-125)human interleukin-3 (residues 3-113 of SEQ ID NO:319);
(18I, 19I, 20L, 23A, 25H, 29I, 32N, 34S, 37S, 38A, 42S, 45V, 46S, 51R, 55T, 59L, 62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and 123E)-(15-125)human interleukin-3 (residues 3-113 of SEQ ID NO:320);
(18I, 25H, 29R, 32N, 37P, 42S, 45M, 50D, 51S, 55T, 59L, 62P, 63H, 67Q, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and 123E)-(15-125)human interleukin-3 (residues 3-113 of SEQ ID NO:321);
(18I, 25H, 29R, 32N, 37P, 42S, 45M, 51R, 55T, 59L, 62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109L, 112Q, 116S, 120Q and 123E)-(15-125)human interleukin-3 (residues 3-113 of SEQ ID NO:322); and
(18I, 25H, 29R, 32N, 37P, 42S, 45M, 51R, 55T, 59L, 62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109L, 112Q, 116S)-(15-118)human interleukin-3 (residues 3-113 of SEQ ID NO:323); and
said mutant human interleukin-3 polypeptide has increased cell proliferative activity compared to native human interleukin-3 in at least one assay selected from the group consisting of: AML cell proliferation, TF-1 cell proliferation and Methylcellulose assay;
(b) a polypeptide comprising an N-terminal methionine residue, alanine residue or methionine-alanine di-peptide immediately preceding said sequence according to (a).
20. The method according to claim 19, wherein said mutant human interleukin-3 polypeptide has at least three times greater cell proliferative activity compared to native human interleukin-3.
21. The method according to claim 19, wherein said mutant human interleukin-3 polypeptide has at least ten times greater cell proliferative activity compared to native human interleukin-3.
22. A method of treating a patient comprising the steps of:
(i) administering to said patient, an amount of a mutant human interleukin-3 (IL-3) polypeptide, effective to promote the proliferation and/or differentiation of hematopoietic cells in said patient, wherein said mutant human interleukin-3 (hIL-3) polypeptide comprises a modified hIL-3 amino acid sequence selected from the group consisting of:
(a) a sequence of (SEQ ID NO:15)
wherein;
Xaa at position 17 is Ser, Lys, Gly, Asp, Met, Gln, or Arg;
Xaa at position 18 is Asn, His, Leu, Ile, Phe, Arg, or Gln;
Xaa at position 19 is Met, Phe, Ile, Arg, Gly, Ala, or Cys;
Xaa at position 20 is Ile, Cys, Gln, Glu, Arg, Pro, or Ala;
Xaa at position 21 is Asp, Phe, Lys, Arg, Ala, Gly, Glu, Gln, Asn, Thr, Ser or Val;
Xaa at position 22 is Glu, Trp, Pro, Ser, Ala, His, Asp, Asn, Gln, Leu, Val or Gly;
Xaa at position 23 is Ile, Val, Ala, Leu, Gly, Trp, Lys, Phe, Ser, or Arg;
Xaa at position 24 is Ile, Gly, Val, Arg, Ser, Phe, or Leu;
Xaa at position 25 is Thr, His, Gly, Gln, Arg, Pro, or Ala;
Xaa at position 26 is His, Thr, Phe, Gly, Arg, Ala, or Trp;
Xaa at position 27 is Leu, Gly, Arg, Thr, Ser, or Ala;
Xaa at position 28 is Lys, Arg, Leu, Gln, Gly, Pro, Val or Trp;
Xaa at position 29 is Gln, Asn, Leu, Pro, Arg, or Val;
Xaa at position 30 is Pro, His, Thr, Gly, Asp, Gln, Ser, Leu, or Lys;
Xaa at position 31 is Pro, Asp, Gly, Ala, Arg, Leu, or Gln;
Xaa at position 32 is Leu, Val, Arg, Gln, Asn, Gly, Ala, or Glu;
Xaa at position 33 is Pro, Leu, Gln, Ala, Thr, or Glu;
Xaa at position 34 is Leu, Val, Gly, Ser, Lys, Glu, Gln, Thr, Arg, Ala, Phe, Ile or Met;
Xaa at position 35 is Leu, Ala, Gly, Asn, Pro, Gln, or Val;
Xaa at position 36 is Asp, Leu, or Val;
Xaa at position 37 is Phe, Ser, Pro, Trp, or Ile;
Xaa at position 38 is Asn, or Ala;
Xaa at position 40 is Leu, Trp, or Arg;
Xaa at position 41 is Asn, Cys, Arg, Leu, His, Met, or Pro;
Xaa at position 42 is Gly, Asp, Ser, Cys, Asn, Lys, Thr, Leu, Val, Glu, Phe, Tyr, Ile, Met or Ala;
Xaa at position 43 is Glu, Asn, Tyr, Leu, Phe, Asp, Ala, Cys, Gln, Arg, Thr, Gly or Ser;
Xaa at position 44 is Asp, Ser, Leu, Arg, Lys, Thr, Met, Trp, Glu, Asn, Gln, Ala or Pro;
Xaa at position 45 is Gln, Pro, Phe, Val, Met, Leu, Thr, Lys, Trp, Asp, Asn, Arg, Ser, Ala, Ile, Glu or His;
Xaa at position 46 is Asp, Phe, Ser, Thr, Cys, Glu, Asn, Gln, Lys, His, Ala, Tyr, Ile, Val or Gly;
Xaa at position 47 is Ile, Gly, Val, Ser, Arg, Pro, or His;
Xaa at position 48 is Leu, Ser, Cys, Arg, Ile, His, Phe, Glu, Lys, Thr, Ala, Met, Val or Asn;
Xaa at position 49 is Met, Arg, Ala, Gly, Pro, Asn, His, or Asp;
Xaa at position 50 is Glu, Leu, Thr, Asp, Tyr, Lys, Asn, Ser, Ala, Ile, Val, His, Phe, Met or Gln;
Xaa at position 51 is Asn, Arg, Met, Pro, Ser, Thr, or His;
Xaa at position 52 is Asn, His, Arg, Leu, Gly, Ser, or Thr;
Xaa at position 53 is Leu, Thr, Ala, Gly, Glu, Pro, Lys, Ser, or Met;
Xaa at position 54 is Arg, Asp, Ile, Ser, Val, Thr, Gln, Asn, Lys, His, Ala or Leu;
Xaa at position 55 is Arg, Thr, Val, Ser, Leu, or Gly;
Xaa at position 56 is Pro, Gly, Cys, Ser, Gln, Glu, Arg, His, Thr, Ala, Tyr, Phe, Leu, Val or Lys;
Xaa at position 57 is Asn or Gly;
Xaa at position 58 is Leu, Ser, Asp, Arg, Gln, Val, or Cys;
Xaa at position 59 is Glu, Tyr, His, Leu, Pro, or Arg;
Xaa at position 60 is Ala, Ser, Pro, Tyr, Asn, or Thr;
Xaa at position 61 is Phe, Asn, Glu, Pro, Lys, Arg, or Ser;
Xaa at position 62 is Asn, His, Val, Arg, Pro, Thr, Asp, or Ile;
Xaa at position 63 is Arg, Tyr, Trp, Ser, His, Pro, or Val;
Xaa at position 64 is Ala, Asn, Pro, Ser, or Lys;
Xaa at position 65 is Val, Thr, Pro, His, Leu, Phe, or Ser;
Xaa at position 66 is Lys, Ile, Arg, Val, Asn, Glu, or Ser;
Xaa at position 67 is Ser, Ala, Phe, Val, Gly, Asn, Ile, Pro, or His;
Xaa at position 68 is Leu, Val, Trp, Ser, Ile, Phe, Thr, or His;
Xaa at position 69 is Gln, Ala, Pro, Thr, Glu, Arg, Trp, Gly, or Leu;
Xaa at position 70 is Asn, Leu, Val, Trp, Pro, or Ala;
Xaa at position 71 is Ala, Met, Leu, Pro, Arg, Glu, Thr, Gln, Trp, or Asn;
Xaa at position 72 is Ser, Glu, Met, Ala, His, Asn, Arg, or Asp;
Xaa at position 73 is Ala, Glu, Asp, Leu, Ser, Gly, Thr, or Arg;
Xaa at position 74 is Ile, Met, Thr, Pro, Arg, Gly, Ala;
Xaa at position 75 is Glu, Lys, Gly, Asp, Pro, Trp, Arg, Ser, Gln, or Leu;
Xaa at position 76 is Ser, Val, Ala, Asn, Trp, Glu, Pro, Gly, or Asp;
Xaa at position 77 is Ile, Ser, Arg, Thr, or Leu;
Xaa at position 78 is Leu, Ala, Ser, Glu, Phe, Gly, or Arg;
Xaa at position 79 is Lys, Thr, Asn, Met, Arg, Ile, Gly, or Asp;
Xaa at position 80 is Asn, Trp, Val, Gly, Thr, Leu, Glu, or Arg;
Xaa at position 81 is Leu, Gln, Gly, Ala, Trp, Arg, Val, or Lys;
Xaa at position 82 is Leu, Gln, Lys, Trp, Arg, Asp, Glu, Asn, His, Thr, Ser, Ala, Tyr, Phe, Ile, Met or Val;
Xaa at position 83 is Pro, Ala, Thr, Trp, Arg, or Met;
Xaa at position 84 is Cys, Glu, Gly, Arg, Met, or Val;
Xaa at position 85 is Leu, Asn, Val, or Gln;
Xaa at position 86 is Pro, Cys, Arg, Ala, or Lys;
Xaa at position 87 is Leu, Ser, Trp, or Gly;
Xaa at position 88 is Ala, Lys, Arg, Val, or Trp;
Xaa at position 89 is Thr, Asp, Cys, Leu, Val, Glu, His, Asn, or Ser;
Xaa at position 90 is Ala, Pro, Ser, Thr, Gly, Asp, Ile, or Met;
Xaa at position 91 is Ala, Pro, Ser, Thr, Phe, Leu, Asp, or His;
Xaa at position 92 is Pro, Phe, Arg, Ser, Lys, His, Ala, Gly, Ile or Leu;
Xaa at position 93 is Thr, Asp, Ser, Asn, Pro, Ala, Leu, or Arg;
Xaa at position 94 is Arg, Ile, Ser, Glu, Leu, Val, Gln, Lys, His, Ala, or Pro;
Xaa at position 95 is His, Gln, Pro, Arg, Val, Leu, Gly, Thr, Asn, Lys, Ser, Ala, Trp, Phe, Ile, or Tyr;
Xaa at position 96 is Pro, Lys, Tyr, Gly, Ile, or Thr;
Xaa at position 97 is Ile, Val, Lys, Ala, or Asn;
Xaa at position 98 is His, Ile, Asn, Leu, Asp, Ala, Thr, Glu, Gln, Ser, Phe, Met, Val, Lys, Tyr or Pro;
Xaa at position 99 is Ile, Leu, Arg, Asp, Val, Pro, Gln, Gly, Ser, Phe, or His;
Xaa at position 100 is Lys, Tyr, Leu, His, Arg, Ile, Ser, Gln, or Pro;
Xaa at position 101 is Asp;
Xaa at position 102 is Gly, Leu, Glu, Lys, Ser, Tyr, or Pro;
Xaa at position 103 is Asp, or Ser;
Xaa at position 104 is Trp, Val, Cys, Tyr, Thr, Met, Pro, Leu, Gln, Lys, Ala, Phe, or Gly;
Xaa at position 105 is Asn, Pro, Ala, Phe, Ser, Trp, Gln, Tyr, Leu, Lys, Ile, Asp, or His;
Xaa at position 106 is Glu, Ser, Ala, Lys, Thr, Ile, Gly, or Pro;
Xaa at position 108 is Arg, Lys, Asp, Leu, Thr, Ile, Gln, His, Ser, Ala or Pro;
Xaa at position 109 is Arg, Thr, Pro, Glu, Tyr, Leu, Ser, or Gly;
Xaa at position 110 is Lys, Ala, Asn, Thr, Leu, Arg, Gln, His, Glu, Ser, Ala, or Trp;
Xaa at position 111 is Leu, Ile, Arg, Asp, or Met;
Xaa at position 112 is Thr, Val, Gln, Tyr, Glu, His, Ser, or Phe;
Xaa at position 113 is Phe, Ser, Cys, His, Gly, Trp, Tyr, Asp, Lys, Leu, Ile, Val or Asn;
Xaa at position 114 is Tyr, Cys, His, Ser, Trp, Arg, or Leu;
Xaa at position 115 is Leu, Asn, Val, Pro, Arg, Ala, His, Thr, Trp, or Met;
Xaa at position 116 is Lys;
Xaa at position 117 is Thr, Ser, Asn, Ile, Trp, Lys, or Pro;
Xaa at position 118 is Leu, Ser, Pro, Ala, Glu, Cys, Asp, or Tyr;
Xaa at position 119 is Glu, Ser, Lys, Pro, Leu, Thr, Tyr, or Arg;
Xaa at position 120 is Asn, Ala, Pro, Leu, His, Val, or Gln;
Xaa at position 121 is Ala, Ser, Ile, Asn, Pro, Lys, Asp, or Gly;
Xaa at position 122 is Gln, Ser, Met, Trp, Arg, Phe, Pro, His, Ile, Tyr, or Cys;
Xaa at position 123 is Ala, Met, Glu, His, Ser, Pro, Tyr, or Leu;
wherein from 4 to about 44 of the amino acids designated by Xaa are different from the corresponding amino acids of native (1-133) human interleukin-3 with the proviso that no more than one of the amino acids at positions 63, 82, 87, 98, 112, and 121 are different from the corresponding amino acids in native human interleukin-3; and wherein from 1 to 14 amino acids are optionally deleted from the N-terminus and/or from 1 to 15 amino acids are optionally deleted from the C-terminus; and said mutant human interleukin-3 polypeptide has increased cell proliferative activity compared to native human interleukin-3 in at least one assay selected from the group consisting of: AML cell proliferation, TF-1 cell proliferation and Methylcellulose assay; and
(b) a polypeptide comprising an N-terminal methionine residue, alanine residue or methionine-alanine di-peptide immediately preceding said sequence according to (a);
(ii) removing hematopoietic cells from said patient;
(iii) administering to said patient cancer radiation therapy or chemotherapy; and
(iv) returning said hematopoietic cells to said patient.
23. The method according to claim 22, wherein said mutant human interleukin-3 polypeptide has at least three times greater cell proliferative activity compared to native human interleukin-3.
24. The method according to claim 22, wherein said mutant human interleukin-3 polypeptide has at least ten times greater cell proliferative activity compared to native human interleukin-3.
25. A method of treating a patient comprising the steps of:
(i) administering to said patient, an amount of a mutant human interleukin-3 (IL-3) polypeptide, effective to promote the proliferation and/or differentiation of hematopoietic cells in said patient, wherein said mutant human interleukin-3 (hIL-3) polypeptide comprises a modified hIL-3 amino acid sequence selected from the group consisting of:
(a) a sequence of(SEQ ID NO:17)
wherein;
Xaa at position 17 is Ser, Gly, Asp, Met, or Gln;
Xaa at position 18 is Asn, His, or Ile;
Xaa at position 19 is Met or Ile;
Xaa at position 21 is Asp or Glu;
Xaa at position 23 is Ile, Ala, Leu, or Gly;
Xaa at position 24 is Ile, Val, or Leu;
Xaa at position 25 is Thr, His, Gln, or Ala;
Xaa at position 26 is His or Ala;
Xaa at position 29 is Gln, Asn, or Val;
Xaa at position 30 is Pro, Gly, or Gln;
Xaa at position 31 is Pro, Asp, Gly, or Gln;
Xaa at position 32 is Leu, Arg, Gln, Asn, Gly, Ala, or Glu;
Xaa at position 33 is Pro or Glu;
Xaa at position 34 is Leu, Val, Gly, Ser, Lys, Ala, Arg, Gln, Glu, Ile, Phe, Thr or Met;
Xaa at position 35 is Leu, Ala, Asn, Pro, Gln, or Val;
Xaa at position 37 is Phe, Ser, Pro, or Trp;
Xaa at position 38 is Asn or Ala;
Xaa at position 42 is Gly, Asp, Ser, Cys, Ala, Asn, Ile, Leu, Met, Tyr or Arg;
Xaa at position 44 is Asp or Glu;
Xaa at position 45 is Gln, Val, Met, Leu, Thr, Ala, Asn, Glu, Ser or Lys;
Xaa at position 46 is Asp, Phe, Ser, Thr, Ala, Asn, Gln, Glu, His, Ile, Lys, Tyr, Val or Cys;
Xaa at position 50 is Glu, Ala, Asn, Ser or Asp;
Xaa at position 51 is Asn, Arg, Met, Pro, Ser, Thr, or His;
Xaa at position 54 is Arg or Ala;
Xaa at position 55 is Arg, Thr, Val, Leu, or Gly;
Xaa at position 56 is Pro, Gly, Ser, Gln, Ala, Arg, Asn, Glu, Leu, Thr, Val or Lys;
Xaa at position 60 is Ala or Ser;
Xaa at position 62 is Asn, Pro, Thr, or Ile;
Xaa at position 63 is Arg;
Xaa at position 64 is Ala or Asn;
Xaa at position 65 is Val or Thr;
Xaa at position 66 is Lys or Arg;
Xaa at position 67 is Ser, Phe, or His;
Xaa at position 68 is Leu, Ile, Phe, or His;
Xaa at position 69 is Gln, Ala, Pro, Thr, Glu, Arg, or Gly;
Xaa at position 71 is Ala, Pro, or Arg;
Xaa at position 72 is Ser, Glu, Arg, or Asp;
Xaa at position 73 is Ala or Leu;
Xaa at position 76 is Ser, Val, Ala, Asn, Glu, Pro, or Gly;
Xaa at position 77 is Ile or Leu;
Xaa at position 79 is Lys, Thr, Gly, Asn, Met, Arg, Ile, or Asp;
Xaa at position 80 is Asn, Gly, Glu, or Arg;
Xaa at position 82 is Leu, Gln, Trp, Arg, Asp, Ala, Asn, Glu, His, Ile, Met, Phe, Ser, Thr, Tyr or Val;
Xaa at position 83 is Pro or Thr;
Xaa at position 85 is Leu or Val;
Xaa at position 87 is Leu or Ser;
Xaa at position 88 is Ala or Trp;
Xaa at position 91 is Ala or Pro;
Xaa at position 93 is Thr, Asp, Ser, Pro, Ala, Leu, or Arg;
Xaa at position 95 is His, Pro, Arg, Val, Leu, Gly, Asn, Phe, Ser or Thr;
Xaa at position 96 is Pro or Tyr;
Xaa at position 97 is Ile or Val;
Xaa at position 98 is His, Ile, Asn, Leu, Ala, Thr, Gln, Lys, Met, Ser, Tyr, Val or Pro;
Xaa at position 99 is Ile, Leu, or Val;
Xaa at position 100 is Lys, Arg, Ile, Gln, Pro, or Ser;
Xaa at position 101 is Asp;
Xaa at position 104 is Trp or Leu;
Xaa at position 105 is Asn, Pro, Ala, Ser, Trp, Gln, Tyr, Leu, Lys, Ile, Asp, or His;
Xaa at position 106 is Glu or Gly;
Xaa at position 108 is Arg, Ala, or Ser;
Xaa at position 109 is Arg, Thr, Glu, Leu, or Ser;
Xaa at position 112 is Thr, Val, or Gln;
Xaa at position 114 is Tyr or Trp;
Xaa at position 115 is Leu or Ala;
Xaa at position 116 is Lys;
Xaa at position 117 is Thr or Ser;
Xaa at position 120 is Asn, Pro, Leu, His, Val, or Gln;
Xaa at position 121 is Ala, Ser, Ile, Asn, Pro, Asp, or Gly;
Xaa at position 122 is Gln, Ser, Met, Trp, Arg, Phe, Pro, His, Ile, Tyr, or Cys;
Xaa at position 123 is Ala, Met, Glu, His, Ser, Pro, Tyr, or Leu;
wherein from 4 to about 44 of the amino acids designated by Xaa are different from the corresponding amino acids of native (1-133) human interleukin-3 with the proviso that no more than one of the amino acids at positions 63, 82, 87, 98, 112, and 121 are different from the corresponding amino acids in native human interleukin-3; and wherein from 1 to 14 amino acids are optionally deleted from the N-terminus and/or from 1 to 15 amino acids are optionally deleted from the C-terminus; and said mutant human interleukin-3 polypeptide has increased cell proliferative activity compared to native human interleukin-3 in at least one assay selected from the group consisting of: AML cell proliferation, TF-1 cell proliferation and Methylcellulose assay; and
(b) a polypeptide comprising an N-terminal methionine residue, alanine residue or methionine-alanine di-peptide immediately preceding said sequence according to (a);
(ii) removing hematopoietic cells from said patient;
(iii) administering to said patient cancer radiation therapy or chemotherapy; and
(iv) returning said hematopoietic cells to said patient.
26. The method according to claim 25, wherein said mutant human interleukin-3 polypeptide has at least three times greater cell proliferative activity compared to native human interleukin-3.
27. The method according to claim 25, wherein said mutant human interleukin-3 polypeptide has at least ten times greater cell proliferative activity compared to native human interleukin-3.
28. The method according to claim 25 wherein in said mutant human interleukin-3 (hIL-3) sequence the amino acids which differ from the corresponding residue in native human interleukin-3 are selected from the group consisting of:
position 42 wherein Xaa is Gly, Asp, Ser, Ile, Leu, Met, Tyr, or Ala;
position 45 wherein Xaa is Gln, Val, Met or Asn;
position 46 wherein Xaa is Asp, Ser, Gln, His or Val;
position 50 wherein Xaa is Glu or Asp;
position 51 wherein Xaa is Asn, Pro or Thr;
position 62 wherein Xaa is Asn or Pro;
position 76 wherein Xaa is Ser, or Pro;
position 82 wherein Xaa is Leu, Trp, Asp, Asn Glu, His, Phe, Ser or Tyr;
position 95 wherein Xaa is His, Arg, Thr, Asn or Ser;
position 98 wherein Xaa is His, Ile, Leu, Ala, Gln, Lys, Met, Ser, Tyr or Val;
position 100 wherein Xaa is Lys or Arg;
position 101 wherein Xaa is Asp;
position 105 wherein Xaa is Asn, or Pro;
position 108 wherein Xaa is Arg, Ala, or Ser;
position 116 wherein Xaa is Lys;
position 121 wherein Xaa is Ala, or Ile;
position 122 wherein Xaa is Gln, or Ile;
position 123 wherein Xaa is Ala, Met or Glu.
29. The method according to claim 28 wherein said mutant human interleukin-3 polypeptide has at least three times greater cell proliferative activity compared to native human interleukin-3.
30. The method according to claim 28, wherein said mutant human interleukin-3 polypeptide has at least ten times greater cell proliferative activity compared to native human interleukin-3.
31. A method of treating a patient comprising the steps of:
(i) administering to said patient, an amount of a mutant human interleukin-3 (IL-3) polypeptide, effective to promote the proliferation and/or differentiation of hematopoietic cells in said patient, wherein said mutant human interleukin-3 (hIL-3) polypeptide comprises a modified hIL-3 amino acid sequence selected from the group consisting of:
(a) a sequence of(SEQ ID NO:19)
wherein;
Xaa at position 3 is Ser, Lys, Gly, Asp, Met, Gln, or Arg;
Xaa at position 4 is Asn, His, Leu, Ile, Phe, Arg, or Gln;
Xaa at position 5 is Met, Phe, Ile, Arg, Gly, Ala, or Cys;
Xaa at position 6 is Ile, Cys, Gln, Glu, Arg, Pro, or Ala;
Xaa at position 7 is Asp, Phe, Lys, Arg, Ala, Gly, Glu, Gln, Asn, Thr, Ser or Val;
Xaa at position 8 is Glu, Trp, Pro, Ser, Ala, His, Asp, Asn, Gln, Leu, Val, or Gly;
Xaa at position 9 is Ile, Val, Ala, Leu, Gly, Trp, Lys, Phe, Ser, or Arg;
Xaa at position 10 is Ile, Gly, Val, Arg, Ser, Phe, or Leu;
Xaa at position 11 is Thr, His, Gly, Gln, Arg, Pro, or Ala;
Xaa at position 12 is His, Thr, Phe, Gly, Arg, Ala, or Trp;
Xaa at position 13 is Leu, Gly, Arg, Thr, Ser, or Ala;
Xaa at position 14 is Lys, Arg, Leu, Gln, Gly, Pro, Val or Trp;
Xaa at position 15 is Gln, Asn, Leu, Pro, Arg, or Val;
Xaa at position 16 is Pro, His, Thr, Gly, Asp, Gln, Ser, Leu, or Lys;
Xaa at position 17 is Pro, Asp, Gly, Ala, Arg, Leu, or Gln;
Xaa at position 18 is Leu, Val, Arg, Gln, Asn, Gly, Ala, or Glu;
Xaa at position 19 is Pro, Leu, Gln, Ala, Thr, or Glu;
Xaa at position 20 is Leu, Val, Gly, Ser, Lys, Glu, Gln, Thr, Arg, Ala, Phe, Ile or Met;
Xaa at position 21 is Leu, Ala, Gly, Asn, Pro, Gln, or Val;
Xaa at position 22 is Asp, Leu, or Val;
Xaa at position 23 is Phe, Ser, Pro, Trp, or Ile;
Xaa at position 24 is Asn, or Ala;
Xaa at position 26 is Leu, Trp, or Arg;
Xaa at position 27 is Asn, Cys, Arg, Leu, His, Met, Pro;
Xaa at position 28 is Gly, Asp, Ser, Cys, Ala, Lys, Asn, Thr, Leu, Val, Glu, Phe, Tyr, Ile or Met;
Xaa at position 29 is Glu, Asn, Tyr, Leu, Phe, Asp, Ala, Cys, Gln, Arg, Thr, Gly or Ser;
Xaa at position 30 is Asp, Ser, Leu, Arg, Lys, Thr, Met, Trp, Glu, Asn, Gln, Ala or Pro;
Xaa at position 31 is Gln, Pro, Phe, Val, Met, Leu, Thr, Lys, Asp, Asn, Arg, Ser, Ala, Ile, Glu, His or Trp;
Xaa at position 32 is Asp, Phe, Ser, Thr, Cys, Glu, Asn, Gln, Lys, His, Ala, Tyr, Ile, Val or Gly;
Xaa at position 33 is Ile, Gly, Val, Ser, Arg, Pro, or His;
Xaa at position 34 is Leu, Ser, Cys, Arg, Ile, His, Phe, Glu, Lys, Thr, Ala, Met, Val or Asn;
Xaa at position 35 is Met, Arg, Ala, Gly, Pro, Asn, His, or Asp;
Xaa at position 36 is Glu, Leu, Thr, Asp, Tyr, Lys, Asn, Ser, Ala, Ile, Val, His, Phe, Met or Gln;
Xaa at position 37 is Asn, Arg, Met, Pro, Ser, Thr, or His;
Xaa at position 38 is Asn, His, Arg, Leu, Gly, Ser, or Thr;
Xaa at position 39 is Leu, Thr, Ala, Gly, Glu, Pro, Lys, Ser, or Met;
Xaa at position 40 is Arg, Asp, Ile, Ser, Val, Thr, Gln, Asn, Lys, His, Ala or Leu;
Xaa at position 41 is Arg, Thr, Val, Ser, Leu, or Gly;
Xaa at position 42 is Pro, Gly, Cys, Ser, Gln, Glu, Arg, His, Thr, Ala, Tyr, Phe, Leu, Val or Lys;
Xaa at position 43 is Asn or Gly;
Xaa at position 44 is Leu, Ser, Asp, Arg, Gln, Val, or Cys;
Xaa at position 45 is Glu, Tyr, His, Leu, Pro, or Arg;
Xaa at position 46 is Ala, Ser, Pro, Tyr, Asn, or Thr;
Xaa at position 47 is Phe, Asn, Glu, Pro, Lys, Arg, or Ser;
Xaa at position 48 is Asn, His, Val, Arg, Pro, Thr, Asp, or Ile;
Xaa at position 49 is Arg, Tyr, Trp, Ser, His, Pro, or Val;
Xaa at position 50 is Ala, Asn, Pro, Ser, or Lys;
Xaa at position 51 is Val, Thr, Pro, His, Leu, Phe, or Ser;
Xaa at position 52 is Lys, Ile, Arg, Val, Asn, Glu, or Ser;
Xaa at position 53 is Ser, Ala, Phe, Val, Gly, Asn, Ile, Pro, or His;
Xaa at position 54 is Leu, Val, Trp, Ser, Ile, Phe, Thr, or His;
Xaa at position 55 is Gln, Ala, Pro, Thr, Glu, Arg, Trp, Gly, or Leu;
Xaa at position 56 is Asn, Leu, Val, Trp, Pro, or Ala;
Xaa at position 57 is Ala, Met, Leu, Pro, Arg, Glu, Thr, Gln, Trp, or Asn;
Xaa at position 58 is Ser, Glu, Met, Ala, His, Asn, Arg, or Asp;
Xaa at position 59 is Ala, Glu, Asp, Leu, Ser, Gly, Thr, or Arg;
Xaa at position 60 is Ile, Met, Thr, Pro, Arg, Gly, Ala;
Xaa at position 61 is Glu, Lys, Gly, Asp, Pro, Trp, Arg, Ser, Gln, or Leu;
Xaa at position 62 is Ser, Val, Ala, Asn, Trp, Glu, Pro, Gly, or Asp;
Xaa at position 63 is Ile, Ser, Arg, Thr, or Leu;
Xaa at position 64 is Leu, Ala, Ser, Glu, Phe, Gly, or Arg;
Xaa at position 65 is Lys, Thr, Gly, Asn, Met, Arg, Ile, or Asp;
Xaa at position 66 is Asn, Trp, Val, Gly, Thr, Leu, Glu, or Arg;
Xaa at position 67 is Leu, Gln, Gly, Ala, Trp, Arg, Val, or Lys;
Xaa at position 68 is Leu, Gln, Lys, Trp, Arg, Asp, Glu, Asn, His, Thr, Ser, Ala, Tyr, Phe, Ile, Met or Val;
Xaa at position 69 is Pro, Ala, Thr, Trp, Arg, or Met;
Xaa at position 70 is Cys, Glu, Gly, Arg, Met, or Val;
Xaa at position 71 is Leu, Asn, Val, or Gln;
Xaa at position 72 is Pro, Cys, Arg, Ala, or Lys;
Xaa at position 73 is Leu, Ser, Trp, or Gly;
Xaa at position 74 is Ala, Lys, Arg, Val, or Trp;
Xaa at position 75 is Thr, Asp, Cys, Leu, Val, Glu, His, Asn, or Ser;
Xaa at position 76 is Ala, Pro, Ser, Thr, Gly, Asp, Ile, or Met;
Xaa at position 77 is Ala, Pro, Ser, Thr, Phe, Leu, Asp, or His;
Xaa at position 78 is Pro, Phe, Arg, Ser, Lys, His, Ala, Gly, Ile or Leu;
Xaa at position 79 is Thr, Asp, Ser, Asn, Pro, Ala, Leu, or Arg;
Xaa at position 80 is Arg, Ile, Ser, Glu, Leu, Val, Gln, Lys, His, Ala or Pro;
Xaa at position 81 is His, Gln, Pro, Arg, Val, Leu, Gly, Thr, Asn, Lys, Ser, Ala, Trp, Phe, Ile or Tyr;
Xaa at position 82 is Pro, Lys, Tyr, Gly, Ile, or Thr;
Xaa at position 83 is Ile, Val, Lys, Ala, or Asn;
Xaa at position 84 is His, Ile, Asn, Leu, Asp, Ala, Thr, Glu, Gln, Ser, Phe, Met, Val, Lys, Tyr or Pro;
Xaa at position 85 is Ile, Leu, Arg, Asp, Val, Pro, Gln, Gly, Ser, Phe, or His;
Xaa at position 86 is Lys, Tyr, Leu, His, Arg, Ile, Ser, Gln, or Pro;
Xaa at position 87 is Asp;
Xaa at position 88 is Gly, Leu, Glu, Lys, Ser, Tyr, or Pro;
Xaa at position 89 is Asp, or Ser;
Xaa at position 90 is Trp, Val, Cys, Tyr, Thr, Met, Pro, Leu, Gln, Lys, Ala, Phe, or Gly;
Xaa at position 91 is Asn, Pro, Ala, Phe, Ser, Trp, Gln, Tyr, Leu, Lys, Ile, Asp, or His;
Xaa at position 92 is Glu, Ser, Ala, Lys, Thr, Ile, Gly, or Pro;
Xaa at position 94 is Arg, Lys, Asp, Leu, Thr, Ile, Gln, His, Ser, Ala, or Pro;
Xaa at position 95 is Arg, Thr, Pro, Glu, Tyr, Leu, Ser, or Gly;
Xaa at position 96 is Lys, Asn, Thr, Leu, Gln, Arg, His, Glu, Ser, Ala or Trp;
Xaa at position 97 is Leu, Ile, Arg, Asp, or Met;
Xaa at position 98 is Thr, Val, Gln, Tyr, Glu, His, Ser, or Phe;
Xaa at position 99 is Phe, Ser, Cys, His, Gly, Trp, Tyr, Asp, Lys, Leu, Ile, Val or Asn;
Xaa at position 100 is Tyr, Cys, His, Ser, Trp, Arg, or Leu;
Xaa at position 101 is Leu, Asn, Val, Pro, Arg, Ala, His, Thr, Trp, or Met;
Xaa at position 102 is Lys;
Xaa at position 103 is Thr, Ser, Asn, Ile, Trp, Lys, or Pro;
Xaa at position 104 is Leu, Ser, Pro, Ala, Glu, Cys, Asp, or Tyr;
Xaa at position 105 is Glu, Ser, Lys, Pro, Leu, Thr, Tyr, or Arg;
Xaa at position 106 is Asn, Ala, Pro, Leu, His, Val, or Gln;
Xaa at position 107 is Ala, Ser, Ile, Asn, Pro, Lys, Asp, or Gly;
Xaa at position 108 is Gln, Ser, Met, Trp, Arg, Phe, Pro, His, Ile, Tyr, or Cys;
Xaa at position 109 is Ala, Met, Glu, His, Ser, Pro, Tyr, or Leu;
wherein from 4 to about 44 of the amino acids designated by Xaa are different from the corresponding native amino acids of (1-133) human interleukin-3 with the proviso that no more than one of the amino acids at positions 49, 68, 73, 84, 98, and 107 are different from the corresponding amino acids in native human interleukin-3; and said mutant human interleukin-3 polypeptide has increased cell proliferative activity compared to native human interleukin-3 in at least one assay selected from the group consisting of: AML cell proliferation, TF-1 cell proliferation and Methylcellulose assay; and
(b) a polypeptide comprising an N-terminal methionine residue, alanine residue or methionine-alanine di-peptide immediately preceding said sequence according to (a);
(ii) removing hematopoietic cells from said patient;
(iii)administering to said patient cancer radiation therapy or chemotherapy; and
(iv) returning said hematopoietic cells to said patient.
32. The method according to claim 31, wherein said mutant human interleukin-3 polypeptide has at least three times greater cell proliferative activity compared to native human interleukin-3.
33. The method according to claim 31, wherein said mutant human interleukin-3 polypeptide has at least ten times greater cell proliferative activity compared to native human interleukin-3.
34. A method of treating a patient comprising the steps of:
(i) administering to said patient, an amount of a mutant human interleukin-3 (IL-3) polypeptide, effective to promote the proliferation and/or differentiation of hematopoietic cells in said patient, wherein said mutant human interleukin-3 (hIL-3) polypeptide comprises a modified hIL-3 amino acid sequence selected from the group consisting of:
(a) a sequence of (SEQ ID NO:21)
wherein;
Xaa at position 3 is Ser, Gly, Asp, Met, or Gln;
Xaa at position 4 is Asn, His, or Ile;
Xaa at position 5 is Met or Ile;
Xaa at position 7 is Asp or Glu;
Xaa at position 9 is Ile, Ala, Leu, or Gly;
Xaa at position 10 is Ile, Val, or Leu;
Xaa at position 11 is Thr, His, Gln, or Ala;
Xaa at position 12 is His or Ala;
Xaa at position 15 is Gln, Asn, or Val;
Xaa at position 16 is Pro, Gly, or Gln;
Xaa at position 17 is Pro, Asp, Gly, or Gln;
Xaa at position 18 is Leu, Arg, Gln, Asn, Gly, Ala, or Glu;
Xaa at position 19 is Pro or Glu;
Xaa at position 20 is Leu, Val, Gly, Ser, Lys, Ala, Arg, Gin, Glu, Ile, Phe, Thr or Met;
Xaa at position 21 is Leu, Ala, Asn, Pro, Gln, or Val;
Xaa at position 23 is Phe, Ser, Pro, or Trp;
Xaa at position 24 is Asn or Ala;
Xaa at position 28 is Gly, Asp, Ser, Cys, Ala, Asn, Ile, Leu, Met Tyr or Arg;
Xaa at position 30 is Asp or Glu;
Xaa at position 31 is Gln, Val, Met, Leu, Thr, Ala, Asn, Glu, Ser or Lys;
Xaa at position 32 is Asp, Phe, Ser, Thr, Ala, Asn, Gln, Glu, His, Ile, Lys, Tyr, Val or Cys;
Xaa at position 36 is Glu, Ala, Asn, Ser or Asp;
Xaa at position 37 is Asn, Arg, Met, Pro, Ser, Thr, or His;
Xaa at position 40 is Arg or Ala;
Xaa at position 41 is Arg, Thr, Val, Leu, or Gly;
Xaa at position 42 is Pro, Gly, Ser, Gln, Ala, Arg, Asn, Glu, Leu, Thr, Val or Lys;
Xaa at position 46 is Ala or Ser;
Xaa at position 48 is Asn, Pro, Thr, or Ile;
Xaa at position 49 is Arg;
Xaa at position 50 is Ala or Asn;
Xaa at position 51 is Val or Thr;
Xaa at position 52 is Lys or Arg;
Xaa at position 53 is Ser, Phe, or His;
Xaa at position 54 is Leu, Ile, Phe, or His;
Xaa at position 55 is Gln, Ala, Pro, Thr, Glu, Arg, or Gly;
Xaa at position 57 is Ala, Pro, or Arg;
Xaa at position 58 is Ser, Glu, Arg, or Asp;
Xaa at position 59 is Ala or Leu;
Xaa at position 62 is Ser, Val, Ala, Asn, Glu, Pro, or Gly;
Xaa at position 63 is Ile or Leu;
Xaa at position 65 is Lys, Thr, Gly, Asn, Met, Arg, Ile, or Asp;
Xaa at position 66 is Asn, Gly, Glu, or Arg;
Xaa at position 68 is Leu, Gln, Trp, Arg, Asp, Ala, Asn, Glu, His, Ile, Met, Phe, Ser, Thr, Tyr or Val;
Xaa at position 69 is Pro or Thr;
Xaa at position 71 is Leu or Val;
Xaa at position 73 is Leu or Ser;
Xaa at position 74 is Ala or Trp;
Xaa at position 77 is Ala or Pro;
Xaa at position 79 is Thr, Asp, Ser, Pro, Ala, Leu, or Arg;
Xaa at position 81 is His, Pro, Arg, Val, Leu, Gly, Asn, Phe, Ser or Thr;
Xaa at position 82 is Pro or Tyr;
Xaa at position 83 is Ile or Val;
Xaa at position 84 is His, Ile, Asn, Leu, Ala, Thr, Gln, Lys, Met, Ser, Tyr, Val or Pro;
Xaa at position 85 is Ile, Leu, or Val;
Xaa at position 86 is Lys, Arg, Ile, Gln, Pro, or Ser;
Xaa at position 87 is Asp;
Xaa at position 90 is Trp or Leu;
Xaa at position 91 is Asn, Pro, Ala, Ser, Trp, Gln, Tyr, Leu, Lys, Ile, Asp, or His;
Xaa at position 92 is Glu, or Gly;
Xaa at position 94 is Arg, Ala, or Ser;
Xaa at position 95 is Arg, Thr, Glu, Leu, or Ser;
Xaa at position 98 is Thr, Val, or Gln;
Xaa at position 100 is Tyr or Trp;
Xaa at position 101 is Leu or Ala;
Xaa at position 102 is Lys;
Xaa at position 103 is Thr or Ser;
Xaa at position 106 is Asn, Pro, Leu, His, Val, or Gln;
Xaa at position 107 is Ala, Ser, Ile, Asn, Pro, Asp, or Gly;
Xaa at position 108 is Gln, Ser, Met, Trp, Arg, Phe, Pro, His, Ile, Tyr, or Cys;
Xaa at position 109 is Ala, Met, Glu, His, Ser, Pro, Tyr, or Leu;
wherein from 4 to about 44 of the amino acids designated by Xaa are different from the corresponding amino acids of native (1-133) human interleukin-3 with the proviso that no more than one of the amino acids at positions 49, 68, 73, 84, 98, and 107 are different from the corresponding amino acids in native human interleukin-3; and said mutant human interleukin-3 polypeptide has increased cell proliferative activity compared to native human interleukin-3 in at least one assay selected from the group consisting of: AML cell proliferation, TF-1 cell proliferation and Methylcellulose assay; and
(b) a polypeptide comprising an N-terminal methionine residue, alanine residue or methionine-alanine di-peptide immediately preceding said sequence according to (a);
(ii) removing hematopoietic cells from said patient;
(iii)administering to said patient cancer radiation therapy or chemotherapy; and
(iv) returning said hematopoietic cells to said patient.
35. The method according to claim 34, wherein said mutant human interleukin-3 polypeptide has at least three times greater cell proliferative activity compared to native human interleukin-3.
36. The method according to claim 34, wherein said mutant human interleukin-3 polypeptide has at least ten times greater cell proliferative activity compared to native human interleukin-3.
37. The method according to claim 34, wherein in said mutant human interleukin-3 (hIL-3) sequence the amino acids which differ from the corresponding residue in native human interleukin-3 are selected from the group consisting of:
position 28 wherein Xaa is Gly, Asp, Ser, Ile, Leu, Met, Tyr, or Ala;
position 31 wherein Xaa is Gln, Val, Met or Asn;
position 32 wherein Xaa is Asp, Ser, Ala, Gln, His or Val;
position 36 wherein Xaa is Glu or Asp;
position 37 wherein Xaa is Asn, Pro or Thr;
position 48 wherein Xaa is Asn or Pro;
position 62 wherein Xaa is Ser. or Pro;
position 68 wherein Xaa is Leu, Trp, Asp, Asn, Glu, His, Phe, Ser or Tyr;
position 81 wherein Xaa is His, Arg, Thr, Asn or Ser;
position 84 wherein Xaa is His, Ile, Leu, Ala, Arg, Gln, Lys, Met, Ser, Tyr or Val;
position 86 wherein Xaa is Lys or Arg;
position 87 wherein Xaa is Asp;
position 91 wherein Xaa is Asn, or Pro;
position 94 wherein Xaa is Arg, Ala, or Ser;
position 102 wherein Xaa is Lys;
position 107 wherein Xaa is Ala, or Ile;
position 108 wherein Xaa is Gln, or Ile;
position 109 wherein Xaa is Ala, Met or Glu.
38. The method according to claim 37, wherein said mutant human interleukin-3 polypeptide has at least three times greater cell proliferative activity compared to native human interleukin-3.
39. The method according to claim 37, wherein said mutant human interleukin-3 polypeptide has at least ten times greater cell proliferative activity compared to native human interleukin-3.
40. A method of treating a patient comprising the steps of:
(i) administering to said patient, an amount of a mutant human interleukin-3 (IL-3) polypeptide, effective to promote the proliferation and/or differentiation of hematopoietic cells in said patient, wherein said mutant human interleukin-3 (hIL-3) polypeptide comprises a modified hIL-3 amino acid sequence selected from the group consisting of:
(a) a polypeptide having an amino acid sequence of
(18I, 25H, 29R, 32A, 37P, 42A and 45V)-(15-125)human interleukin-3 (SEQ ID NO:66);
(18I, 25H, 29R, 32N, 37P, 42S and 45M)-(15-125)human interleukin-3 (SEQ ID NO:67);
(18I, 25H, 29V, 32A, 37S, 42S and 45M)-(15-125)human interleukin-3 (SEQ ID NO:68);
(51R, 55L, 59L, 62V, 67N and 69E)-(15-125)human interleukin-3 (SEQ ID NO:69);
(51R, 55L, 60S, 62V, 67N and 69E)-(15-125)human interleukin-3 (SEQ ID NO:70);
(51R, 55T, 59L, 62V, 67H and 69E)-(15-125)human interleukin-3 (SEQ ID NO:71);
(73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A and 105Q)-(15-125)human interleukin-3 (SEQ ID NO:72);
(73C, 76A, 79R, 82V, 87S, 93S, 98T, 101A and 105Q)-(15-125)human interleukin-3 (SEQ ID NO:73);
(73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and 123E)-(15-125)human interleukin-3 (SEQ. ID. NO:76);
(73G, 76A, 79R, 82V, 87S, 93S, 98T, 101A, 105Q, 109E, 116V, 120Q and 123E)-(15-125)human interleukin-3 (SEQ ID NO:77);
(73G, 76A, 79R, 82V, 87S, 93S, 98T, 101A, 105Q, 109E, 116V, 117S, 120H and 123E)-(15-125)human interleukin-3 (SEQ ID NO:78);
(18I, 25H, 29R, 32A, 37P, 42A, 45V, 51R, 55L, 60S, 62V, 67N and 69E)-(15-125)human interleukin-3 (SEQ ID NO:79);
(18I, 25H, 29R, 32N, 37P, 42S, 45M, 51R, 55T, 59L, 62V, 67H and 69E)-(15-125)human interleukin-3 (SEQ ID NO:80);
(18I, 25H, 29V, 32A, 37S, 42S, 45M, 51R, 55L, 59L, 62V, 67N and 69E)-(15-125)human interleukin-3 (SEQ ID NO:81);
(42D, 45M, 46S, 50D, 95R, 98I, 100R, 116W)-(15-125)human interleukin-3 (residues 3-113 of SEQ ID NO:263);
(42D, 45M, 46S, 98I, lOOR, 116W)-(15-125)human interleukin-3 (SEQ ID NO:406);
(18I, 19A, 25H, 29R, 32N, 37P, 42S, 45V, 49D, 51R, 55T, 59L, 62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and 123E)-(15-125)human interleukin-3 (residues 3-113 of SEQ ID NO:276);
(18I, 19I, 25H, 29R, 32N, 37P, 42S, 45V, 49D, 51R, 55T, 59L, 62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and 123E)-(15-125)human interleukin-3 (residues 3-113 of SEQ ID NO:277);
(18I, 23A, 25H, 29V, 32A, 37S, 42S, 45M, 51R, 55L, 59L, 62V, 67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and 123E)-(15-125)human interleukin-3 (residues 3-113 of SEQ ID NO:278);
(18I, 23A, 25H, 29V, 32A, 37S, 42S, 45M, 51R, 55L, 59L, 62V, 67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 112Q, 116V, 120Q and 123E)-(15-125)human interleukin-3 (SEQ ID NO:279);
(18I, 25H, 29R, 32A, 37P, 42A, 45V, 51R, 55L, 60S, 62V, 67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V,)-(15-119)human interleukin-3 (residues 3-113 of SEQ ID NO:287);
(18I, 23A, 25H, 29R, 32A, 37P, 42D, 45V, 46S, 50D, 51R, 55L, 60S, 62V, 67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 112Q, 116V)-(15-119)human interleukin-3 (residues 3-113 of SEQ ID NO:289);
(18I, 25H, 29R, 32A, 37P, 42A, 45V, 51R, 55L, 60S, 62V, 67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 112Q, 116V)-(15-119)human interleukin-3 (residues 3-113 of SEQ ID NO:307);
(18I, 20P, 23A, 25H, 29I, 32N, 34S, 37S, 38A, 42S, 45V, 46S, 51R, 55T, 59L, 62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and 123E)-(15-125)human interleukin-3 (residues 3-113 of SEQ ID NO:317);
(18I, 23L, 25H, 29I, 32N, 34S, 37S, 38A, 42S, 45V, 46S, 51R, 55T, 59L, 62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and 123E)-(15-125)human interleukin-3 (residues 3-113 of SEQ ID NO:318);
(18I, 23A, 25H, 29I, 32N, 34S, 37S, 38A, 42S, 45V, 46S, 51R, 55T, 59L, 62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and 123E)-(15-125)human interleukin-3 (residues 3-113 of SEQ ID NO:319);
(18I, 19I, 20L, 23A, 25H, 29I, 32N, 34S, 37S, 38A, 42S, 45V, 46S, 51R, 55T, 59L, 62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and 123E)-(15-125)human interleukin-3 (residues 3-113 of SEQ ID NO:320);
(18I, 25H, 29R, 32N, 37P, 42S, 45M, 50D, 51S, 55T, 59L, 62P, 63H, 67Q, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and 123E)-(15-125)human interleukin-3 (residues 3-113 of SEQ ID NO:321);
(18I, 25H, 29R, 32N, 37P, 42S, 45M, 51R, 55T, 59L, 62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109L, 112Q, 116S, 120Q and 123E)-(15-125)human interleukin-3 (residues 3-113 of SEQ ID NO:322); and
(18I, 25H, 29R, 32N, 37P, 42S, 45M, 51R, 55T, 59L, 62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98T, 101A, 105Q, 109L, 112Q, 116S)-(15-118)human interleukin-3 (residues 3-113 of SEQ ID NO:323); and
said mutant human interleukin-3 polypeptide has increased cell proliferative activity compared to native human interleukin-3 in at least one assay selected from the group consisting of: AML cell proliferation, TF-1 cell proliferation and Methylcellulose assay; and
(b) a polypeptide comprising an N-terminal methionine residue, alanine residue or methionine-alanine di-peptide immediately preceding said sequence according to (a);
(ii) removing hematopoietic cells from said patient;
(iii) administering to said patient cancer radiation therapy or chemotherapy; and
(iv) returning said hematopoietic cells to said patient.
41. The method according to claim 40, wherein said mutant human interleukin-3 polypeptide has at least three times greater cell proliferative activity compared to native human interleukin-3.
42. The method according to claim 40, wherein said mutant human interleukin-3 polypeptide has at least ten times greater cell proliferative activity compared to native human interleukin-3.
43. A method of treating a side effect of cancer chemotherapy or radiation therapy in a patient comprising administering to said patient, a therapeutically effective amount of a mutant human interleukin-3 (hIL-3) polypeptide comprising a modified hIL-3 amino acid sequence selected from the group consisting of:
(a) a sequence of (SEQ ID NO:15)
wherein;
Xaa at position 17 is Ser, Lys, Gly, Asp, Met, Gln, or Arg;
Xaa at position 18 is Asn, His, Leu, Ile, Phe, Arg, or Gln;
Xaa at position 19 is Met, Phe, Ile, Arg, Gly, Ala, or Cys;
Xaa at position 20 is Ile, Cys, Gln, Glu, Arg, Pro, or Ala;
Xaa at position 21 is,Asp, Phe, Lys, Arg, Ala, Gly, Glu, Gln, Asn, Thr, Ser or Val;
Xaa at position 22 is Glu, Trp, Pro, Ser, Ala, His, Asp, Asn, Gln, Leu, Val or Gly;
Xaa at position 23 is Ile, Val, Ala, Leu, Gly, Trp, Lys, Phe, Ser, or Arg;
Xaa at position 24 is Ile, Gly, Val, Arg, Ser, Phe, or Leu;
Xaa at position 25 is Thr, His, Gly, Gln, Arg, Pro, or Ala;
Xaa at position 26 is His, Thr, Phe, Gly, Arg, Ala, or Trp;
Xaa at position 27 is Leu, Gly, Arg, Thr, Ser, or Ala;
Xaa at position 28 is Lys, Arg, Leu, Gln, Gly, Pro, Val or Trp;
Xaa at position 29 is Gln, Asn, Leu, Pro, Arg, or Val;
Xaa at position 30 is Pro, His, Thr, Gly, Asp, Gln, Ser, Leu, or Lys;
Xaa at position 31 is Pro, Asp, Gly, Ala, Arg, Leu, or Gln;
Xaa at position 32 is Leu, Val, Arg, Gln, Asn, Gly, Ala, or Glu;
Xaa at position 33 is Pro, Leu, Gln, Ala, Thr, or Glu;
Xaa at position 34 is Leu, Val, Gly, Ser, Lys, Glu, Gln, Thr, Arg, Ala, Phe, Ile or Met;
Xaa at position 35 is Leu, Ala, Gly, Asn, Pro, Gln, or Val;
Xaa at position 36 is Asp, Leu, or Val;
Xaa at position 37 is Phe, Ser, Pro, Trp, or Ile;
Xaa at position 38 is Asn, or Ala;
Xaa at position 40 is Leu, Trp, or Arg;
Xaa at position 41 is Asn, Cys, Arg, Leu, His, Met, or Pro;
Xaa at position 42 is Gly, Asp, Ser, Cys, Asn, Lys, Thr, Leu, Val, Glu, Phe, Tyr, Ile, Met or Ala;
Xaa at position 43 is Glu, Asn, Tyr, Leu, Phe, Asp, Ala, Cys, Gln, Arg, Thr, Gly or Ser;
Xaa at position 44 is Asp, Ser, Leu, Arg, Lys, Thr, Met, Trp, Glu, Asn, Gln, Ala or Pro;
Xaa at position 45 is Gln, Pro, Phe, Val, Met, Leu, Thr, Lys, Trp, Asp, Asn, Arg, Ser, Ala, Ile, Glu or His;
Xaa at position 46 is Asp, Phe, Ser, Thr, Cys, Glu, Asn, Gln, Lys, His, Ala, Tyr, Ile, Val or Gly;
Xaa at position 47 is Ile, Gly, Val, Ser, Arg, Pro, or His;
Xaa at position 48 is Leu, Ser, Cys, Arg, Ile, His, Phe, Glu, Lys, Thr, Ala, Met, Val or Asn;
Xaa at position 49 is Met, Arg, Ala, Gly, Pro, Asn, His, or Asp;
Xaa at position 50 is Glu, Leu, Thr, Asp, Tyr, Lys, Asn, Ser, Ala, Ile, Val, His, Phe, Met or Gln;
Xaa at position 51 is Asn, Arg, Met, Pro, Ser, Thr, or His;
Xaa at position 52 is Asn, His, Arg, Leu, Gly, Ser, or Thr;
Xaa at position 53 is Leu, Thr, Ala, Gly, Glu, Pro, Lys, Ser, or Met;
Xaa at position 54 is Arg, Asp, Ile, Ser, Val, Thr, Gln, Asn, Lys, His, Ala or Leu;
Xaa at position 55 is Arg, Thr, Val, Ser, Leu, or Gly;
Xaa at position 56 is Pro, Gly, Cys, Ser, Gln, Glu, Arg, His, Thr, Ala, Tyr, Phe, Leu, Val or Lys;
Xaa at position 57 is Asn or Gly;
Xaa at position 58 is Leu, Ser, Asp, Arg, Gln, Val, or Cys;
Xaa at position 59 is Glu, Tyr, His, Leu, Pro, or Arg;
Xaa at position 60 is Ala, Ser, Pro, Tyr, Asn, or Thr;
Xaa at position 61 is Phe, Asn, Glu, Pro, Lys, Arg, or Ser;
Xaa at position 62 is Asn, His, Val, Arg, Pro, Thr, Asp, or Ile;
Xaa at position 63 is Arg, Tyr, Trp, Ser, His, Pro, or Val;
Xaa at position 64 is Ala, Asn, Pro, Ser, or Lys;
Xaa at position 65 is Val, Thr, Pro, His, Leu, Phe, or Ser;
Xaa at position 66 is Lys, Ile, Arg, Val, Asn, Glu, or Ser;
Xaa at position 67 is Ser, Ala, Phe, Val, Gly, Asn, Ile, Pro, or His;
Xaa at position 68 is Leu, Val, Trp, Ser, Ile, Phe, Thr, or His;
Xaa at position 69 is Gln, Ala, Pro, Thr, Glu, Arg, Trp, Gly, or Leu;
Xaa at position 70 is Asn, Leu, Val, Trp, Pro, or Ala;
Xaa at position 71 is Ala, Met, Leu, Pro, Arg, Glu, Thr, Gln, Trp, or Asn;
Xaa at position 72 is Ser, Glu, Met, Ala, His, Asn, Arg, or Asp;
Xaa at position 73 is Ala, Glu, Asp, Leu, Ser, Gly, Thr, or Arg;
Xaa at position 74 is Ile, Met, Thr, Pro, Arg, Gly, Ala;
Xaa at position 75 is Glu, Lys, Gly, Asp, Pro, Trp, Arg, Ser, Gln, or Leu;
Xaa at position 76 is Ser, Val, Ala, Asn, Trp, Glu, Pro, Gly, or Asp;
Xaa at position 77 is Ile, Ser, Arg, Thr, or Leu;
Xaa at position 78 is Leu, Ala, Ser, Glu, Phe, Gly, or Arg;
Xaa at position 79 is Lys, Thr, Asn, Met, Arg, Ile, Gly, or Asp;
Xaa at position 80 is Asn, Trp, Val, Gly, Thr, Leu, Glu, or Arg;
Xaa at position 81 is Leu, Gln, Gly, Ala, Trp, Arg, Val, or Lys;
Xaa at position 82 is Leu, Gln, Lys, Trp, Arg, Asp, Glu, Asn, His, Thr, Ser, Ala, Tyr, Phe, Ile, Met or Val;
Xaa at position 83 is Pro, Ala, Thr, Trp, Arg, or Met;
Xaa at position 84 is Cys, Glu, Gly, Arg, Met, or Val;
Xaa at position 85 is Leu, Asn, Val, or Gln;
Xaa at position 86 is Pro, Cys, Arg, Ala, or Lys;
Xaa at position 87 is Leu, Ser, Trp, or Gly;
Xaa at position 88 is Ala, Lys, Arg, Val, or Trp;
Xaa at position 89 is Thr, Asp, Cys, Leu, Val, Glu, His, Asn, or Ser;
Xaa at position 90 is Ala, Pro, Ser, Thr, Gly, Asp, Ile, or Met;
Xaa at position 91 is Ala, Pro, Ser, Thr, Phe, Leu, Asp, or His;
Xaa at position 92 is Pro, Phe, Arg, Ser, Lys, His, Ala, Gly, Ile or Leu;
Xaa at position 93 is Thr, Asp, Ser, Asn, Pro, Ala, Leu, or Arg;
Xaa at position 94 is Arg, Ile, Ser, Glu, Leu, Val, Gln, Lys, His,Ala, or Pro;
Xaa at position 95 is His, Gln, Pro, Arg, Val, Leu, Gly, Thr, Asn,Lys, Ser, Ala, Trp, Phe, Ile, or Tyr;
Xaa at position 96 is Pro, Lys, Tyr, Gly, Ile, or Thr;
Xaa at position 97 is Ile, Val, Lys, Ala, or Asn;
Xaa at position 98 is His, Ile, Asn, Leu, Asp, Ala, Thr, Glu, Gln, Ser, Phe, Met, Val, Lys, Tyr or Pro;
Xaa at position 99 is Ile, Leu, Arg, Asp, Val, Pro, Gln, Gly, Ser, Phe, or His;
Xaa at position 100 is Lys, Tyr, Leu, His, Arg, Ile, Ser, Gln, or Pro;
Xaa at position 101 is Asp;
Xaa at position 102 is Gly, Leu, Glu, Lys, Ser, Tyr, or Pro;
Xaa at position 103 is Asp, or Ser;
Xaa at position 104 is Trp, Val, Cys, Tyr, Thr, Met, Pro, Leu, Gln, Lys, Ala, Phe, or Gly;
Xaa at position 105 is Asn, Pro, Ala, Phe, Ser, Trp, Gln, Tyr, Leu, Lys, Ile, Asp, or His;
Xaa at position 106 is Glu, Ser, Ala, Lys, Thr, Ile, Gly, or Pro;
Xaa at position 108 is Arg, Lys, Asp, Leu, Thr, Ile, Gln, His, Ser, Ala or Pro;
Xaa at position 109 is Arg, Thr, Pro, Glu, Tyr, Leu, Ser, or Gly;
Xaa at position 110 is Lys, Ala, Asn, Thr, Leu, Arg, Gln, His, Glu, Ser, Ala, or Trp;
Xaa at position 111 is Leu, Ile, Arg, Asp, or Met;
Xaa at position 112 is Thr, Val, Gln, Tyr, Glu, His, Ser, or Phe;
Xaa at position 113 is Phe, Ser, Cys, His, Gly, Trp, Tyr, Asp, Lys, Leu, Ile, Val or Asn;
Xaa at position 114 is Tyr, Cys, His, Ser, Trp, Arg, or Leu;
Xaa at position 115 is Leu, Asn, Val, Pro, Arg, Ala, His, Thr, Trp, or Met;
Xaa at position 116 is Lys;
Xaa at position 117 is Thr, Ser, Asn, Ile, Trp, Lys, or Pro;
Xaa at position 118 is Leu, Ser, Pro, Ala, Glu, Cys, Asp, or Tyr;
Xaa at position 119 is Glu, Ser, Lys, Pro, Leu, Thr, Tyr, or Arg;
Xaa at position 120 is Asn, Ala, Pro, Leu, His, Val, or Gln;
Xaa at position 121 is Ala, Ser, Ile, Asn, Pro, Lys, Asp, or Gly;
Xaa at position 122 is Gln, Ser, Met, Trp, Arg, Phe, Pro, His, Ile, Tyr, or Cys;
Xaa at position 123 is Ala, Met, Glu, His, Ser, Pro, Tyr, or Leu;
wherein from 4 to about 44 of the amino acids designated by Xaa are different from the corresponding amino acids of native (1-133) human interleukin-3 with the proviso that no more than one of the amino acids at positions 63, 82, 87, 98, 112, and 121 are different from the corresponding amino acids in native human interleukin-3; and wherein from 1 to 14 amino acids are optionally deleted from the N-terminus and/or from 1 to 15 amino acids are optionally deleted from the C-terminus; and said mutant human interleukin-3 polypeptide has increased cell proliferative activity compared to native human interleukin-3 in at least one assay selected from the group consisting of: AML cell proliferation, TF-1 cell proliferation and Methylcellulose assay; and
(b) a polypeptide comprising an N-terminal methionine residue, alanine residue or methionine-alanine di-peptide immediately preceding said sequence according to (a).
44. The method according to claim 43, wherein said mutant human interleukin-3 polypeptide has at least three times greater cell proliferative activity compared to native human interleukin-3.
45. The method according to claim 43, wherein said mutant human interleukin-3 polypeptide has at least ten times greater cell proliferative activity compared to native human interleukin-3.
46. A method of treating a side effect of cancer chemotherapy or radiation therapy in a patient comprising administering to said patient, a therapeutically effective amount of a mutant human interleukin-3 (hIL-3) polypeptide comprising a modified hIL-3 amino acid sequence selected from the group consisting of:
(a) a sequence of (SEQ ID NO:17)
wherein;
Xaa at position 17 is Ser, Gly, Asp, Met, or Gln;
Xaa at position 18 is Asn, His, or Ile;
Xaa at position 19 is Met or Ile;
Xaa at position 21 is Asp or Glu;
Xaa at position 23 is Ile, Ala, Leu, or Gly;
Xaa at position 24 is Ile, Val, or Leu;
Xaa at position 25 is Thr, His, Gln, or Ala;
Xaa at position 26 is His or Ala;
Xaa at position 29 is Gln, Asn, or Val;
Xaa at position 30 is Pro, Gly, or Gln;
Xaa at position 31 is Pro, Asp, Gly, or Gln;
Xaa at position 32 is Leu, Arg, Gln, Asn, Gly, Ala, or Glu;
Xaa at position 33 is Pro or Glu;
Xaa at position 34 is Leu, Val, Gly, Ser, Lys, Ala, Arg, Gln, Glu, Ile, Phe, Thr or Met;
Xaa at position 35 is Leu, Ala, Asn, Pro, Gln, or Val;
Xaa at position 37 is Phe, Ser, Pro, or Trp;
Xaa at position 38 is Asn or Ala;
Xaa at position 42 is Gly, Asp, Ser, Cys, Ala, Asn, Ile, Leu, Met, Tyr or Arg;
Xaa at position 44 is Asp or Glu;
Xaa at position 45 is Gln, Val, Met, Leu, Thr, Ala, Asn, Glu, Ser or Lys;
Xaa at position 46 is Asp, Phe, Ser, Thr, Ala, Asn, Gln, Glu, His, Ile, Lys, Tyr, Val or Cys;
Xaa at position 50 is Glu, Ala, Asn, Ser or Asp;
Xaa at position 51 is Asn, Arg, Met, Pro, Ser, Thr, or His;
Xaa at position 54 is Arg or Ala;
Xaa at position 55 is Arg, Thr, Val, Leu, or Gly;
Xaa at position 56 is Pro, Gly, Ser, Gln, Ala, Arg, Asn, Glu, Leu, Thr, Val or Lys;
Xaa at position 60 is Ala or Ser;
Xaa at position 62 is Asn, Pro, Thr, or Ile;
Xaa at position 63 is Arg;
Xaa at position 64 is Ala or Asn;
Xaa at position 65 is Val or Thr;
Xaa at position 66 is Lys or Arg;
Xaa at position 67 is Ser, Phe, or His;
Xaa at position 68 is Leu, Ile, Phe, or His;
Xaa at position 69 is Gln, Ala, Pro, Thr, Glu, Arg, or Gly;
Xaa at position 71 is Ala, Pro, or Arg;
Xaa at position 72 is Ser, GA u, Arg, or Asp;
Xaa at position 73 is Ala or Leu;
Xaa at position 76 is Ser, Val, Ala, Asn, Glu, Pro, or Gly;
Xaa at position 77 is Ile or Leu;
Xaa at position 79 is Lys, Thr, Gly, Asn, Met, Arg, le, or Asp;
Xaa at position 80 is Asn, Gly, Glu, or Arg;
Xaa a t position 82 is Leu, Gln, Trp, Arg, Asp, Ala, Asn, Glu, His, Ile, Met, Phe, Ser, Thr, Tyr or Val;
Xaa at position 83 is Pro or Thr;
Xaa at position 85 is Leu or Val;
Xaa at position 87 is Leu or Ser;
Xaa at position 88 is Ala or Trp;
Xaa at position 91 is Ala or Pro;
Xaa at position 93 is Thr, Asp, Ser, Pro, Ala, Leu, or Arg;
Xaa at position 95 is His, Pro, Arg, Val, Leu, Gly, Asn, Phe, Ser or Thr;
Xaa at position 96 is Pro or Tyr;
Xaa at position 97 is i Ile or Val;
Xaa at position 98 is His, Ile, Asn, Leu, Ala, Thr, Gln, Lys, Met, Ser, Tyr, Val or Pro;
Xaa at position 99 is Ile, Leu, or Val;
Xaa at position 100 is Lys, Arg, le, Gln, Pro, or Ser;
Xaa at position 101 is Asp;
Xaa at position 104 is Trp or Leu;
Xaa at position 105 is Asn, Pro, Ala, Ser, Trp, Gln, Tyr, Leu, Lys, Ile, Asp, or His;
Xaa at position 106 is G Au or Gly;
Xaa at position 108 is Arg, Ala , or Ser;
Xaa at position 109 is Arg, Thr, Glu, Leu, or Ser;
Xaa at position 112 is Thr, Val, or Gln;
Xaa at position 114 is Tyr or Trp;
Xaa at position 115 is Leu or Ala;
Xaa at position 116 is Lys;
Xaa at position 117 is Thr or Ser;
Xaa at position 120 is Asn, Pro, Leu, His, Val, or Gln;
Xaa at position 121 is Ala, Ser, Ile, Asn, Pro, Asp, or Gly;
Xaa at position 122 is Gln, Ser, Met, Trp, Arg, Phe, Pro, His, Ile, Tyr, or Cys;
Xaa at position 123 is Ala, Met, Glu, His, Ser, Pro, Tyr, or Leu;
wherein from 4 to about 44 of the amino acids designated by Xaa are different from the corresponding amino acids of native (1-133) human interleukin-3 with the proviso that no more than one of the amino acids at positions 63, 82, 87, 98, 112, and 121 are different from the corresponding amino acids in native human interleukin-3; and wherein from 1 to 14 amino acids are optionally deleted from the N-terminus and/or from 1 to 15 amino acids are optionally deleted from the C-terminus; and said mutant human interleukin-3 polypeptide has increased cell proliferative activity compared to native human interleukin-3 in at least one assay selected from the group consisting of: AML cell proliferation, TF-1 cell proliferation and Methylcellulose assay; and
(b) a polypeptide comprising an N-terminal methionine residue, alanine residue or methionine-alanine di-peptide immediately preceding said sequence according to (a).
47. The method according to claim 46, wherein said mutant human interleukin-3 polypeptide has at least three times greater cell proliferative activity compared to native human interleukin-3.
48. The method according to claim 46, wherein said mutant human interleukin-3 polypeptide has at least ten times greater cell proliferative activity compared to native human interleukin-3.
49. The method according to claim 46 wherein in said mutant human interleukin-3 (hIL-3sequence the amino acids which differ from the corresponding residue in native human interleukin-3 are selected from the group consisting of:
position 42 wherein Xaa is Gly, Asp, Ser, Ile, Leu, Met, Tyr, or Ala;
position 45 wherein Xaa is Gln, Val, Met or Asn;
position 46 wherein Xaa is Asp, Ser, Gln, His or Val;
position 50 wherein Xaa is Glu or Asp;
position 51 wherein Xaa is Asn, Pro or Thr;
position 62 wherein Xaa is Asn or Pro;
position 76 wherein Xaa is Ser, or Pro;
position 82 wherein Xaa is Leu, Trp, Asp, Asn Glu, His, Phe, Ser or Tyr;
position 95 wherein Xaa is His, Arg, Thr, Asn or Ser;
position 98 wherein Xaa is His, Ile, Leu, Ala, Gln, Lys, Met, Ser, Tyr or Val;
position 100 wherein Xaa is Lys or Arg;
position 101 wherein Xaa is Asp;
position 105 wherein Xaa is Asn, or Pro;
position 108 wherein Xaa is Arg, Ala, or Ser;
position 116 wherein Xaa is Lys;
position 121 wherein Xaa is Ala, or Ile;
position 122 wherein Xaa is Gln, or Ile;
position 123 wherein Xaa is Ala, Met or Glu.
50. The method according to claim 49, wherein said mutant human interleukin-3 polypeptide has at least three times greater cell proliferative activity compared to native human interleukin-3.
51. The method according to claim 49, wherein said mutant human interleukin-3 polypeptide has at least ten times greater cell proliferative activity compared to native human interleukin-3.
52. A method of treating a side effect of cancer chemotherapy or radiation therapy in a patient comprising administering to said patient, a therapeutically effective amount of a mutant human interleukin-3 (hIL-3) polypeptide comprising a modified hIL-3 amino acid sequence selected from the group consisting of:
(a) a sequence of (SEQ ID NO:19)
wherein;
Xaa at position 3 is Ser, Lys, Gly, Asp, Met, Gln, or Arg;
Xaa at position 4 is Asn, His, Leu, Ile, Phe, Arg, or Gln;
Xaa at position 5 is Met, Phe, Ile, Arg, Gly, Ala, or Cys;
Xaa at position 6 is Ile, Cys, Gln, Glu, Arg, Pro, or Ala;
Xaa at position 7 is Asp, Phe, Lys, Arg, Ala, Gly, Glu, Gln, Asn, Thr, Ser or Val;
Xaa at position 8 is Glu, Trp, Pro, Ser, Ala, His, Asp, Asn, Gln, Leu, Val, or Gly;
Xaa at position 9 is Ile, Val, Ala, Leu, Gly, Trp, Lys, Phe, Ser, or Arg;
Xaa at position 10 is Ile, Gly, Val, Arg, Ser, Phe, or Leu;
Xaa at position 11 is Thr, His, Gly, Gln, Arg, Pro, or Ala;
Xaa at position 12 is His, Thr, Phe, Gly, Arg, Ala, or Trp;
Xaa at position 13 is Leu, Gly, Arg, Thr, Ser, or Ala;
Xaa at position 14 is Lys, Arg, Leu, Gln, Gly, Pro, Val or Trp;
Xaa at position 15 is Gln, Asn, Leu, Pro, Arg, or Val;
Xaa at position 16 is Pro, His, Thr, Gly, Asp, Gln, Ser, Leu, or Lys;
Xaa at position 17 is Pro, Asp, Gly, Ala, Arg, Leu, or Gln;
Xaa at position 18 is Leu, Val, Arg, Gln, Asn, Gly, Ala, or Glu;
Xaa at position 19 is Pro, Leu, Gln, Ala, Thr, or Glu;
Xaa at position 20 is Leu, Val, Gly, Ser, Lys, Glu, Gln, Thr, Arg, Ala, Phe, Ile or Met;
Xaa at position 21 is Leu, Ala, Gly, Asn, Pro, Gln, or Val;
Xaa at position 22 is Asp, Leu, or Val;
Xaa at position 23 is Phe, Ser, Pro, Trp, or Ile;
Xaa at position 24 is Asn, or Ala;
Xaa at position 26 is Leu, Trp, or Arg;
Xaa at position 27 is Asn, Cys, Arg, Leu, His, Met, Pro;
Xaa at position 28 is Gly, Asp, Ser, Cys, Ala, Lys, Asn, Thr, Leu, Val, Glu, Phe, Tyr, Ile or Met;
Xaa at position 29 is Glu, Asn, Tyr, Leu, Phe, Asp, Ala, Cys, Gln, Arg, Thr, Gly or Ser;
Xaa at position 30 is Asp, Ser, Leu, Arg, Lys, Thr, Met, Trp, Glu, Asn, Gln, Ala or Pro;
Xaa at position 31 is Gln, Pro, Phe, Val, Met, Leu, Thr, Lys, Asp, Asn, Arg, Ser, Ala, Ile, Glu, His or Trp;
Xaa at position 32 is Asp, Phe, Ser, Thr, Cys, Glu, Asn, Gln, Lys, His, Ala, Tyr, Ile, Val or Gly;
Xaa at position 33 is Ile, Gly, Val, Ser, Arg, Pro, or His;
Xaa at position 34 is Leu, Ser, Cys, Arg, Ile, His, Phe, Glu, Lys, Thr, Ala, Met, Val or Asn;
Xaa at position 35 is Met, Arg, Ala, Gly, Pro, Asn, His, or Asp;
Xaa at position 36 is Glu, Leu, Thr, Asp, Tyr, Lys, Asn, Ser, Ala, Ile, Val, His, Phe, Met or Gln;
Xaa at position 37 is Asn, Arg, Met, Pro, Ser, Thr, or His;
Xaa at position 38 is Asn, His, Arg, Leu, Gly, Ser, or Thr;
Xaa at position 39 is Leu, Thr, Ala, Gly, Glu, Pro, Lys, Ser, or Met;
Xaa at position 40 is Arg, Asp, Ile, Ser, Val, Thr, Gln, Asn, Lys, His, Ala or Leu;
Xaa at position 41 is Arg, Thr, Val, Ser, Leu, or Gly;
Xaa at position 42 is Pro, Gly, Cys, Ser, Gln, Glu, Arg, His, Thr, Ala, Tyr, Phe, Leu, Val or Lys;
Xaa at position 43 is Asn or Gly;
Xaa at position 44 is Leu, Ser, Asp, Arg, Gln, Val, or Cys;
Xaa at position 45 is Glu, Tyr, His, Leu, Pro, or Arg;
Xaa at position 46 is Ala, Ser, Pro, Tyr, Asn, or Thr;
Xaa at position 47 is Phe, Asn, Glu, Pro, Lys, Arg, or Ser;
Xaa at position 48 is Asn, His, Val, Arg, Pro, Thr, Asp, or Ile;
Xaa at position 49 is Arg, Tyr, Trp, Ser, His, Pro, or Val;
Xaa at position 50 is Ala, Asn, Pro, Ser, or Lys;
Xaa at position 51 is Val, Thr, Pro, His, Leu, Phe, or Ser;
Xaa at position 52 is Lys, Ile, Arg, Val, Asn, Glu, or Ser;
Xaa at position 53 is Ser, Ala, Phe, Val, Gly, Asn, Ile, Pro, or His;
Xaa at position 54 is Leu, Val, Trp, Ser, Ile, Phe, Thr, or His;
Xaa at position 55 is Gln, Ala, Pro, Thr, Glu, Arg, Trp, Gly, or Leu;
Xaa at position 56 is Asn, Leu, Val, Trp, Pro, or Ala;
Xaa at position 57 is Ala, Met, Leu, Pro, Arg, Glu, Thr, Gln, Trp, or Asn;
Xaa at position 58 is Ser, Glu, Met, Ala, His, Asn, Arg, or Asp;
Xaa at position 59 is Ala, Glu, Asp, Leu, Ser, Gly, Thr, or Arg;
Xaa at position 60 is Ile, Met, Thr, Pro, Arg, Gly, Ala;
Xaa at position 61 is Glu, Lys, Gly, Asp, Pro, Trp, Arg, Ser, Gln, or Leu;
Xaa at position 62 is Ser, Val, Ala, Asn, Trp, Glu, Pro, Gly, or Asp;
Xaa at position 63 is Ile, Ser, Arg, Thr, or Leu;
Xaa at position 64 is Leu, Ala, Ser, Glu, Phe, Gly, or Arg;
Xaa at position 65 is Lys, Thr, Gly, Asn, Met, Arg, Ile, or Asp;
Xaa at position 66 is Asn, Trp, Val, Gly, Thr, Leu, Glu, or Arg;
Xaa at position 67 is Leu, Gln, Gly, Ala, Trp, Arg, Val, or Lys;
Xaa at position 68 is Leu, Gln, Lys, Trp, Arg, Asp, Glu, Asn, His, Thr, Ser, Ala, Tyr, Phe, Ile, Met or Val;
Xaa at position 69 is Pro, Ala, Thr, Trp, Arg, or Met;
Xaa at position 70 is Cys, Glu, Gly, Arg, Met, or Val;
Xaa at position 71 is Leu, Asn, Val, or Gln;
Xaa at position 72 is Pro, Cys, Arg, Ala, or Lys;
Xaa at position 73 is Leu, Ser, Trp, or Gly;
Xaa at position 74 is Ala, Lys, Arg, Val, or Trp;
Xaa at position 75 is Thr, Asp, Cys, Leu, Val, Glu, His, Asn, or Ser;
Xaa at position 76 is Ala, Pro, Ser, Thr, Gly, Asp, Ile, or Met;
Xaa at position 77 is Ala, Pro, Ser, Thr, Phe, Leu, Asp, or His;
Xaa at position 78 is Pro, Phe, Arg, Ser, Lys, His, Ala, Gly, Ile or Leu;
Xaa at position 79 is Thr, Asp, Ser, Asn, Pro, Ala, Leu, or Arg;
Xaa at position 80 is Arg, Ile, Ser, Glu, Leu, Val, Gln, Lys, His, Ala or Pro;
Xaa at position 81 is His, Gln, Pro, Arg, Val, Leu, Gly, Thr, Asn, Lys, Ser, Ala, Trp, Phe, Ile or Tyr;
Xaa at position 82 is Pro, Lys, Tyr, Gly, Ile, or Thr;
Xaa at position 83 is Ile, Val, Lys, Ala, or Asn;
Xaa at position 84 is His, Ile, Asn, Leu, Asp, Ala, Thr, Glu, Gln, Ser, Phe, Met, Val, Lys, Tyr or Pro;
Xaa at position 85 is Ile, Leu, Arg, Asp, Val, Pro, Gln, Gly, Ser, Phe, or His;
Xaa at position 86 is Lys, Tyr, Leu, His, Arg, Ile, Ser, Gln, or Pro;
Xaa at position 87 is Asp;
Xaa at position 88 is Gly, Leu, Glu, Lys, Ser, Tyr, or Pro;
Xaa at position 89 is Asp, or Ser;
Xaa at position 90 is Trp, Val, Cys, Tyr, Thr, Met, Pro, Leu, Gln, Lys, Ala, Phe, or Gly;
Xaa at position 91 is Asn, Pro, Ala, Phe, Ser, Trp, Gln, Tyr, Leu, Lys, Ile, Asp, or His;
Xaa at position 92 is Glu, Ser, Ala, Lys, Thr, Ile, Gly, or Pro;
Xaa at position 94 is Arg, Lys, Asp, Leu, Thr, Ile, Gln, His, Ser, Ala, or Pro;
Xaa at position 95 is Arg, Thr, Pro, Glu, Tyr, Leu, Ser, or Gly;
Xaa at position 96 is Lys, Asn, Thr, Leu, Gln, Arg, His, Glu, Ser, Ala or Trp;
Xaa at position 97 is Leu, Ile, Arg, Asp, or Met;
Xaa at position 98 is Thr, Val, Gln, Tyr, Glu, His, Ser, or Phe;
Xaa at position 99 is Phe, Ser, Cys, His, Gly, Trp, Tyr, Asp, Lys, Leu, Ile, Val or Asn;
Xaa at position 100 is Tyr, Cys, His, Ser, Trp, Arg, or Leu;
Xaa at position 101 is Leu, Asn, Val, Pro, Arg, Ala, His, Thr, Trp, or Met;
Xaa at position 102 is Lys;
Xaa at position 103 is Thr, Ser, Asn, Ile, Trp, Lys, or Pro;
Xaa at position 104 is Leu, Ser, Pro, Ala, Glu, Cys, Asp, or Tyr;
Xaa at position 105 is Glu, Ser, Lys, Pro, Leu, Thr, Tyr, or Arg;
Xaa at position 106 is Asn, Ala, Pro, Leu, His, Val, or Gln;
Xaa at position 107 is Ala, Ser, Ile, Asn, Pro, Lys, Asp, or Gly;
Xaa at position 108 is Gln, Ser, Met, Trp, Arg, Phe, Pro, His, Ile, Tyr, or Cys;
Xaa at position 109 is Ala, Met, Glu, His, Ser, Pro, Tyr, or Leu;
wherein from 4 to about 44 of the amino acids designated by Xaa are different from the corresponding native amino acids of (1-133) human interleukin-3 with the proviso that no more than one of the amino acids at positions 49, 68, 73, 84, 98, and 107 are different from the corresponding amino acids in native human interleukin-3; and said mutant human interleukin-3 polypeptide has increased cell proliferative activity compared to native human interleukin-3 in at least one assay selected from the group consisting of: AML cell proliferation, TF-1 cell proliferation and Methylcellulose assay; and
(b) a polypeptide comprising an N-terminal methionine residue, alanine residue or methionine-alanine di-peptide immediately preceding said sequence according to (a).
53. The method according to claim 52, wherein said mutant human interleukin-3 polypeptide has at least three times greater cell proliferative activity compared to native human interleukin-3.
54. The method according to claim 52, wherein said mutant human interleukin-3 polypeptide has at least ten times greater cell proliferative activity compared to native human interleukin-3.
55. A method of treating a side effect of cancer chemotherapy or radiation therapy in a patient comprising administering to said patient, a therapeutically effective amount of a mutant human interleukin-3 (hIL-3) polypeptide comprising a modified hIL-3 amino acid sequence selected from the group consisting of:
(a) a sequence of (SEQ ID NO:21)
wherein;
Xaa at position 3 is Ser, Gly, Asp, Met, or Gln;
Xaa at position 4 is Asn, His, or Ile;
Xaa at position 5 is Met or Ile;
Xaa at position 7 is Asp or Glu;
Xaa at position 9 is Ile, Ala, Leu, or Gly;
Xaa at position 10 is Ile, Val, or Leu;
Xaa at position 11 is Thr, His, Gln, or Ala;
Xaa at position 12 is His or Ala;
Xaa at position 15 is Gln, Asn, or Val;
Xaa at position 16 is Pro, Gly, or Gln;
Xaa at position 17 is Pro, Asp, Gly, or Gln;
Xaa at position 18 is Leu, Arg, Gln, Asn, Gly, Ala, or Glu;
Xaa at position 19 is Pro or Glu;
Xaa at position 20 is Leu, Val, Gly, Ser, Lys, Ala, Arg, Gln, Glu, Ile, Phe, Thr or Met;
Xaa at position 21 is Leu, Ala, Asn, Pro, Gln, or Val;
Xaa at position 23 is Phe, Ser, Pro, or Trp;
Xaa at position 24 is Asn or Ala;
Xaa at position 28 is Gly, Asp, Ser, Cys, Ala, Asn, Ile, Leu, Met Tyr or Arg;
Xaa at position 30 is Asp or Glu;
Xaa at position 31 is Gln, Val, Met, Leu, Thr, Ala, Asn, Glu, Ser or Lys;
Xaa at position 32 is Asp, Phe, Ser, Thr, Ala, Asn, Gln, Glu, His, Ile, Lys, Tyr, Val or Cys;
Xaa at position 36 is Glu, Ala, Asn, Ser or Asp;
Xaa at position 37 is Asn, Arg, Met, Pro, Ser, Thr, or His;
Xaa at position 40 is Arg or Ala;
Xaa at position 41 is Arg, Thr, Val, Leu, or Gly;
Xaa at position 42 is Pro, Gly, Ser, Gln, Ala, Arg, Asn, Glu, Leu, Thr, Val or Lys;
Xaa at position 46 is Ala or Ser;
Xaa at position 48 is Asn, Pro, Thr, or Ile;
Xaa at position 49 is Arg;
Xaa at position 50 is Ala or Asn;
Xaa at position 51 is Val or Thr;
Xaa at position 52 is Lys or Arg;
Xaa at position 53 is Ser, Phe, or His;
Xaa at position 54 is Leu, Ile, Phe, or His;
Xaa at position 55 is Gln, Ala, Pro, Thr, Glu, Arg, or Gly;
Xaa at position 57 is Ala, Pro, or Arg;
Xaa at position 58 is Ser, Glu, Arg, or Asp;
Xaa at position 59 is Ala or Leu;
Xaa at position 62 is Ser, Val, Ala, Asn, Glu, Pro, or Gly;
Xaa at position 63 is Ile or Leu;
Xaa at position 65 is Lys, Thr, Gly, Asn, Met, Arg, Ile, or Asp;
Xaa at position 66 is Asn, Gly, Glu, or Arg;
Xaa at position 68 is Leu, Gln, Trp, Arg, Asp, Ala, Asn, Glu, His, Ile, Met, Phe, Ser, Thr, Tyr or Val;
Xaa at position 69 is Pro or Thr;
Xaa at position 71 is Leu or Val;
Xaa at position 73 is Leu or Ser;
Xaa at position 74 is Ala or Trp;
Xaa at position 77 is Ala or Pro;
Xaa at position 79 is Thr, Asp, Ser, Pro, Ala, Leu, or Arg;
Xaa at position 81 is His, Pro, Arg, Val, Leu, Gly, Asn, Phe, Ser or Thr;
Xaa at position 82 is Pro or Tyr;
Xaa at position 83 is Ile or Val;
Xaa at position 84 is His, Ile, Asn, Leu, Ala, Thr, Gln, Lys, Met, Ser, Tyr, Val or Pro;
Xaa at position 85 is Ile, Leu, or Val;
Xaa at position 86 is Lys, Arg, Ile, Gln, Pro, or Ser;
Xaa at position 87 is Asp;
Xaa at position 90 is Trp or Leu;
Xaa at position 91 is Asn, Pro, Ala, Ser, Trp, Gln, Tyr, Leu, Lys, Ile, Asp, or His;
Xaa at position 92 is Glu, or Gly;
Xaa at position 94 is Arg, Ala, or Ser;
Xaa at position 95 is Arg, Thr, Glu, Leu, or Ser;
Xaa at position 98 is Thr, Val, or Gln;
Xaa at position 100 is Tyr or Trp;
Xaa at position 101 is Leu or Ala;
Xaa at position 102 is Lys;
Xaa at position 103 is Thr or Ser;
Xaa at position 106 is Asn, Pro, Leu, His, Val, or Gln;
Xaa at position 107 is Ala, Ser, Ile, Asn, Pro, Asp, or Gly;
Xaa at position 108 is Gln, Ser, Met, Trp, Arg, Phe, Pro, His, Ile, Tyr, or Cys;
Xaa at position 109 is Ala, Met, Glu, His, Ser, Pro, Tyr, or Leu;
wherein from 4 to about 44 of the amino acids designated by Xaa are different from the corresponding amino acids of native (1-133) human interleukin-3 with the proviso that no more than one of the amino acids at positions 49, 68, 73, 84, 98, and 107 are different from the corresponding amino acids in native human interleukin-3; and said mutant human interleukin-3 polypeptide has increased cell proliferative activity compared to native human interleukin-3 in at least one assay selected from the group consisting of: AML cell proliferation, TF-1 cell proliferation and Methylcellulose assay; and
(b) a polypeptide comprising an N-terminal methionine residue, alanine residue or methionine-alanine di-peptide immediately preceding said sequence according to (a).
56. The method according to claim 55, wherein said mutant human interleukin-3 polypeptide has at least three times greater cell proliferative activity compared to native human interleukin-3.
57. The method according to claim 55, wherein said mutant human interleukin-3 polypeptide has at least ten times greater cell proliferative activity compared to native human interleukin-3.
58. The method according to claim 55, wherein in said mutant human interleukin-3 (hIL-3) sequence the amino acids which differ from the corresponding residue in native human interleukin-3 are selected from the group consisting of:
position 28 wherein Xaa is Gly, Asp, Ser, Ile, Leu, Met, Tyr, or Ala;
position 31 wherein Xaa is Gln, Val, Met or Asn;
position 32 wherein Xaa is Asp, Ser, Ala, Gln, His or Val;
position 36 wherein Xaa is Glu or Asp;
position 37 wherein Xaa is Asn, Pro or Thr;
position 48 wherein Xaa is Asn or Pro;
position 62 wherein Xaa is Ser, or Pro;
position 68 wherein Xaa is Leu, Trp, Asp, Asn, Glu, His, Phe, Ser or Tyr;
position 81 wherein Xaa is His, Arg, Thr, Asn or Ser;
position 84 wherein Xaa is His, Ile, Leu, Ala, Arg, Gln, Lys, Met, Ser, Tyr or Val;
position 86 wherein Xaa is Lys or Arg;
position 87 wherein Xaa is Asp;
position 91 wherein Xaa is Asn, or Pro;
position 94 wherein Xaa is Arg, Ala, or Ser;
position 102 wherein Xaa is Lys;
position 107 wherein Xaa is Ala, or Ile;
position 108 wherein Xaa is Gln, or Ile;
position 109 wherein Xaa is Ala, Met or Glu.
59. The method according to claim 58, wherein said mutant human interleukin-3 polypeptide has at least three times greater cell proliferative activity compared to native human interleukin-3.
60. The method according to claim 58, wherein said mutant human interleukin-3 polypeptide has at least ten times greater cell proliferative activity compared to native human interleukin-3.
61. A method of treating a side effect of cancer chemotherapy or radiation therapy in a patient comprising administering to said patient, a therapeutically effective amount of a mutant human interleukin-3 (hIL-3) polypeptide comprising a modified hIL-3 amino acid sequence selected from the group consisting of:
(a) a polypeptide having an amino acid sequence of
(18I, 25H, 29R, 32A, 37P, 42A and 45V)-(15-125)human interleukin-3 (SEQ ID NO:66);
(18I, 25H, 29R, 32N, 37P, 42S and 45M)-(15-125)human interleukin-3 (SEQ ID NO:67);
(18I, 25H, 29V, 32A, 37S, 42S and 45M)-(15-125)human interleukin-3 (SEQ ID NO:68);
(51R, 55L, 59L, 62V, 67N and 69E)-(15-125)human interleukin-3 (SEQ ID NO:69);
(51R, 55L, 60S, 62V, 67N and 69E)-(15-125)human interleukin-3 (SEQ ID NO:70);
(51R, 55T, 59L, 62V, 67H and 69E)-(15-125)human interleukin-3 (SEQ ID NO:71);
(73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A and 105Q)-(15-125)human interleukin-3 (SEQ ID NO:72);
(73G, 76A, 79R, 82V, 87S, 93S, 98T, 101A and 105Q)-(15-125)human interleukin-3 (SEQ ID NO:73);
(73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and 123E)-(15-125)human interleukin-3 (SEQ. ID. NO:76);
(73G, 76A, 79R, 82V, 87S, 93S, 98T, 101A, 105Q, 109E, 116V, 120Q and 123E)-(15-125)human interleukin-3 (SEQ ID NO:77);
(73G, 76A, 79R, 82V, 87S, 93S, 98T, 101A, 105Q, 109E, 116V, 117S, 120H and 123E)-(15-125)human interleukin-3 (SEQ ID NO:78);
(18I, 25H, 29R, 32A, 37P, 42A, 45V, 51R, 55L, 60S, 62V, 67N and 69E)-(15-125)human interleukin-3 (SEQ ID NO:79);
(18I, 25H, 29R, 32N, 37P, 42S, 45M, 51R, 55T, 59L, 62V, 67H and 69E)-(15-125)human interleukin-3 (SEQ ID NO:80);
(18I, 25H, 29V, 32A, 37S, 42S, 45M, 51R, 55L, 59L, 62V, 67N and 69E)-(15-125)human interleukin-3 (SEQ ID NO:81);
(42D, 45M, 46S, 50D, 95R, 98I, 100R, 116W)-(15-125)human interleukin-3 (residues 3-113 of SEQ ID NO:263);
(42D, 45M, 46S, 98I, 100R, 116W)-(15-125)human interleukin-3 (SEQ ID NO:406);
(18I, 19A, 25H, 29R, 32N, 37P, 42S, 45V, 49D, 51R, 55T, 59L, 62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and 123E)-(15-125)human interleukin-3 (residues 3-113 of SEQ ID NO:276);
(18I, 19I, 25H, 29R, 32N, 37P, 42S, 45V, 49D, 51R, 55T, 59L, 62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and 123E)-(15-125)human interleukin-3 (residues 3-113 of SEQ ID NO:277);
(18I, 23A, 25H, 29V, 32A, 37S, 42S, 45M, 51R, 55L, 59L, 62V, 67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and 123E)-(15-125)human interleukin-3 (residues 3-113 of SEQ ID NO:278);
(18I, 23A, 25H, 29V, 32A, 37S, 42S, 45M, 51R, 55L, 59L, 62V, 67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 112Q, 116V, 120Q and 123E)-(15-125)human interleukin-3 (SEQ ID NO:279);
(181, 25H, 29R, 32A, 37P, 42A, 45V, 51R, 55L, 60S, 62V, 67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V,)-(15-119)human interleukin-3 (residues 3-113 of SEQ ID NO:287);
(18I, 23A, 25H, 29R, 32A, 37P, 42D, 45V, 46S, 50D, 51R, 55L, 60S, 62V, 67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 112Q, 116V)-(15-119)human interleukin-3 (residues 3-113 of SEQ ID NO:289);
(18I, 25H, 29R, 32A, 37P, 42A, 45V, 51R, 55L, 60S, 62V, 67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 112Q, 116V)-(15-119)human interleukin-3 (residues 3-113 of SEQ ID NO:307);
(18I, 20P, 23A, 25H, 29I, 32N, 34S, 37S, 38A, 42S, 45V, 46S, 51R, 55T, 59L, 62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and 123E)-(15-125)human interleukin-3 (residues 3-113 of SEQ ID NO:317);
(18I, 23L, 25H, 29I, 32N, 34S, 37S, 38A, 42S, 45V, 46S, 51R, 55T, 59L, 62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and 123E)-(15-125)human interleukin-3 (residues 3-113 of SEQ ID NO:318);
(18I, 23A, 25H, 29I, 32N, 34S, 37S, 38A, 42S, 45V, 46S, 51R, 55T, 59L, 62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and 123E)-(15-125)human interleukin-3 (residues 3-113 of SEQ ID NO:319);
(18I, 19I, 20L, 23A, 25H, 29I, 32N, 34S, 37S, 38A, 42S, 45V, 46S, 51R, 55T, 59L, 62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and 123E)-(15-125)human interleukin-3 (residues 3-113 of SEQ ID NO:320);
(18I, 25H, 29R, 32N, 37P, 42S, 45M, 50D, 51S, 55T, 59L, 62P, 63H, 67Q, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and 123E)-(15-125)human interleukin-3 (residues 3-113 of SEQ ID NO:321);
(18I, 25H, 29R, 32N, 37P, 42S, 45M, 51R, 55T, 59L, 62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109L, 112Q, 116S, 120Q and 123E)-(15-125)human interleukin-3 (residues 3-113 of SEQ ID NO:322); and
(18I, 25H, 29R, 32N, 37P, 42S, 45M, 51R, 55T, 59L, 62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109L, 112Q, 116S)-(15-118)human interleukin-3 (residues 3-113 of SEQ ID NO:323);
and said mutant human interleukin-3 polypeptide has increased cell proliferative activity compared to native human interleukin-3 in at least one assay selected from the group consisting of: AML cell proliferation, TF-1 cell proliferation and Methylcellulose assay; and
(b) a polypeptide comprising an N-terminal methionine residue, alanine residue or methionine-alanine di-peptide immediately preceding said sequence according to (a).
62. The method according to claim 61, wherein said mutant human interleukin-3 polypeptide has at least three times greater cell proliferative activity compared to native human interleukin-3.
63. The method according to claim 61, wherein said mutant human interleukin-3 polypeptide has at least ten times greater cell proliferative activity compared to native human interleukin-3.
64. A method of treating a patient having an immunodeficiency or hematopoietic deficiency consisting of administering to said patient, a therapeutically effective amount of a mutant human interleukin-3 (hIL-3) polypeptide consisting of a modified hIL-3 amino acid sequence selected from the group consisting of:
(a) a sequence of (SEQ ID NO:15)
wherein;
Xaa at position 17 is Ser, Lys, Gly, Asp, Met, Gln, or Arg;
Xaa at position 18 is Asn, His, Leu, Ile, Phe, Arg, or Gln;
Xaa at position 19 is Met, Phe, Ile, Arg, Gly, Ala, or Cys;
Xaa at position 20 is Ile, Cys, Gln, Glu, Arg, Pro, or Ala;
Xaa at position 21 is Asp, Phe, Lys, Arg, Ala, Gly, Glu, Gln, Asn, Thr, Ser or Val;
Xaa at position 22 is Glu, Trp, Pro, Ser, Ala, His, Asp, Asn, Gln, Leu, Val or Gly;
Xaa at position 23 is Ile, Val, Ala, Leu, Gly, Trp, Lys, Phe, Ser, or Arg;
Xaa at position 24 is Ile, Gly, Val, Arg, Ser, Phe, or Leu;
Xaa at position 25 is Thr, His, Gly, Gln, Arg, Pro, or Ala;
Xaa at position 26 is His, Thr, Phe, Gly, Arg, Ala, or Trp;
Xaa at position 27 is Leu, Gly, Arg, Thr, Ser, or Ala;
Xaa at position 28 is Lys, Arg, Leu, Gln, Gly, Pro, Val or Trp;
Xaa at position 29 is Gln, Asn, Leu, Pro, Arg, or Val;
Xaa at position 30 is Pro, His, Thr, Gly, Asp, Gln, Ser, Leu, or Lys;
Xaa at position 31 is Pro, Asp, Gly, Ala, Arg, Leu, or Gln;
Xaa at position 32 is Leu, Val, Arg, Gln, Asn, Gly, Ala, or Glu;
Xaa at position 33 is Pro, Leu, Gln, Ala, Thr, or Glu;
Xaa at position 34 is Leu, Val, Gly, Ser, Lys, Glu, Gln, Thr, Arg, Ala, Phe, Ile or Met;
Xaa at position 35 is Leu, Ala, Gly, Asn, Pro, Gln, or Val;
Xaa at position 36 is Asp, Leu, or Val;
Xaa at position 37 is Phe, Ser, Pro, Trp, or Ile;
Xaa at position 38 is Asn, or Ala;
Xaa at position 40 is Leu, Trp, or Arg;
Xaa at position 41 is Asn, Cys, Arg, Leu, His, Met, or Pro;
Xaa at position 42 is Gly, Asp, Ser, Cys, Asn, Lys, Thr, Leu, Val, Glu, Phe, Tyr, Ile, Met or Ala;
Xaa at position 43 is Glu, Asn, Tyr, Leu, Phe, Asp, Ala, Cys, Gln, Arg, Thr, Gly or Ser;
Xaa at position 44 is Asp, Ser, Leu, Arg, Lys, Thr, Met, Trp, Glu, Asn, Gln, Ala or Pro;
Xaa at position 45 is Gln, Pro, Phe, Val, Met, Leu, Thr, Lys, Trp, Asp, Asn, Arg, Ser, Ala, Ile, Glu or His;
Xaa at position 46 is Asp, Phe, Ser, Thr, Cys, Glu, Asn, Gln, Lys, His, Ala, Tyr, Ile, Val or Gly;
Xaa at position 47 is Ile, Gly, Val, Ser, Arg, Pro, or His;
Xaa at position 48 is Leu, Ser, Cys, Arg, Ile, His, Phe, Glu, Lys, Thr, Ala, Met, Val or Asn;
Xaa at position 49 is Met, Arg, Ala, Gly, Pro, Asn, His, or Asp;
Xaa at position 50 is Glu, Leu, Thr, Asp, Tyr, Lys, Asn, Ser, Ala, Ile, Val, His, Phe, Met or Gln;
Xaa at position 51 is Asn, Arg, Met, Pro, Ser, Thr, or His;
Xaa at position 52 is Asn, His, Arg, Leu, Gly, Ser, or Thr;
Xaa at position 53 is Leu, Thr, Ala, Gly, Glu, Pro, Lys, Ser, or Met;
Xaa at position 54 is Arg, Asp, Ile, Ser, Val, Thr, Gln, Asn, Lys, His, Ala or Leu;
Xaa at position 55 is Arg, Thr, Val, Ser, Leu, or Gly;
Xaa at position 56 is Pro, Gly, Cys, Ser, Gln, Glu, Arg, His, Thr, Ala, Tyr, Phe, Leu, Val or Lys;
Xaa at position 57 is Asn or Gly;
Xaa at position 58 is Leu, Ser, Asp, Arg, Gln, Val, or Cys;
Xaa at position 59 is Glu, Tyr, His, Leu, Pro, or Arg;
Xaa at position 60 is Ala, Ser, Pro, Tyr, Asn, or Thr;
Xaa at position 61 is Phe, Asn, Glu, Pro, Lys, Arg, or Ser;
Xaa at position 62 is Asn, His, Val, Arg, Pro, Thr, Asp, or Ile;
Xaa at position 63 is Arg, Tyr, Trp, Ser, His, Pro, or Val;
Xaa at position 64 is Ala, Asn, Pro, Ser, or Lys;
Xaa at position 65 is Val, Thr, Pro, His, Leu, Phe, or Ser;
Xaa at position 66 is Lys, Ile, Arg, Val, Asn, Glu, or Ser;
Xaa at position 67 is Ser, Ala, Phe, Val, Gly, Asn, Ile, Pro, or His;
Xaa at position 68 is Leu, Val, Trp, Ser, Ile, Phe, Thr, or His;
Xaa at position 69 is Gln, Ala, Pro, Thr, Glu, Arg, Trp, Gly, or Leu;
Xaa at position 70 is Asn, Leu, Val, Trp, Pro, or Ala;
Xaa at position 71 is Ala, Met, Leu, Pro, Arg, Glu, Thr, Gln, Trp, or Asn;
Xaa at position 72 is Ser, Glu, Met, Ala, His, Asn, Arg, or Asp;
Xaa at position 73 is Ala, Glu, Asp, Leu, Ser, Gly, Thr, or Arg;
Xaa at position 74 is Ile, Met, Thr, Pro, Arg, Gly, Ala;
Xaa at position 75 is Glu, Lys, Gly, Asp, Pro, Trp, Arg, Ser, Gln, or Leu;
Xaa at position 76 is Ser, Val, Ala, Asn, Trp, Glu, Pro, Gly, or Asp;
Xaa at position 77 is Ile, Ser, Arg, Thr, or Leu;
Xaa at position 78 is Leu, Ala, Ser, Glu, Phe, Gly, or Arg;
Xaa at position 79 is Lys, Thr, Asn, Met, Arg, Ile, Gly, or Asp;
Xaa at position 80 is Asn, Trp, Val, Gly, Thr, Leu, Glu, or Arg;
Xaa at position 81 is Leu, Gln, Gly, Ala, Trp, Arg, Val, or Lys;
Xaa at position 82 is Leu, Gln, Lys, Trp, Arg, Asp, Glu, Asn, His, Thr, Ser, Ala, Tyr, Phe, Ile, Met or Val;
Xaa at position 83 is Pro, Ala, Thr, Trp, Arg, or Met;
Xaa at position 84 is Cys, Glu, Gly, Arg, Met, or Val;
Xaa at position 85 is Leu, Asn, Val, or Gln;
Xaa at position 86 is Pro, Cys, Arg, Ala, or Lys;
Xaa at position 87 is Leu, Ser, Trp, or Gly;
Xaa at position 88 is Ala, Lys, Arg, Val, or Trp;
Xaa at position 89 is Thr, Asp, Cys, Leu, Val, Glu, His, Asn, or Ser;
Xaa at position 90 is Ala, Pro, Ser, Thr, Gly, Asp, Ile, or Met;
Xaa at position 91 is Ala, Pro, Ser, Thr, Phe, Leu, Asp, or His;
Xaa at position 92 is Pro, Phe, Arg, Ser, Lys, His, Ala, Gly, Ile or Leu;
Xaa at position 93 is Thr, Asp, Ser, Asn, Pro, Ala, Leu, or Arg;
Xaa at position 94 is Arg, Ile, Ser, Glu, Leu, Val, Gln, Lys, His, Ala, or Pro;
Xaa at position 95 is His, Gln, Pro, Arg, Val, Leu, Gly, Thr, Asn, Lys, Ser, Ala, Trp, Phe, Ile, or Tyr;
Xaa at position 96 is Pro, Lys, Tyr, Gly, Ile, or Thr;
Xaa at position 97 is Ile, Val, Lys, Ala, or Asn;
Xaa at position 98 is His, Ile, Asn, Leu, Asp, Ala, Thr, Glu, Gln, Ser, Phe, Met, Val, Lys, Tyr or Pro;
Xaa at position 99 is Ile, Leu, Arg, Asp, Val, Pro, Gln, Gly, Ser, Phe, or His;
Xaa at position 100 is Lys, Tyr, Leu, His, Arg, Ile, Ser, Gln, or Pro;
Xaa at position 101 is Asp;
Xaa at position 102 is Gly, Leu, Glu, Lys, Ser, Tyr, or Pro;
Xaa at position 103 is Asp, or Ser;
Xaa at position 104 is Trp, Val, Cys, Tyr, Thr, Met, Pro, Leu, Gln, Lys, Ala, Phe, or Gly;
Xaa at position 105 is Asn, Pro, Ala, Phe, Ser, Trp, Gln, Tyr, Leu, Lys, Ile, Asp, or His;
Xaa at position 106 is Glu, Ser, Ala, Lys, Thr, Ile, Gly, or Pro;
Xaa at position 108 is Arg, Lys, Asp, Leu, Thr, Ile, Gln, His, Ser, Ala or Pro;
Xaa at position 109 is Arg, Thr, Pro, Glu, Tyr, Leu, Ser, or Gly;
Xaa at position 110 is Lys, Ala, Asn, Thr, Leu, Arg, Gln, His, Glu, Ser, Ala, or Trp;
Xaa at position 111 is Leu, Ile, Arg, Asp, or Met;
Xaa at position 112 is Thr, Val, Gln, Tyr, Glu, His, Ser, or Phe;
Xaa at position 113 is Phe, Ser, Cys, His, Gly, Trp, Tyr, Asp, Lys, Leu, Ile, Val or Asn;
Xaa at position 114 is Tyr, Cys, His, Ser, Trp, Arg, or Leu;
Xaa at position 115 is Leu, Asn, Val, Pro, Arg, Ala, His, Thr, Trp, or Met;
Xaa at position 116 is Lys;
Xaa at position 117 is Thr, Ser, Asn, Ile, Trp, Lys, or Pro;
Xaa at position 118 is Leu, Ser, Pro, Ala, Glu, Cys, Asp, or Tyr;
Xaa at position 119 is Glu, Ser, Lys, Pro, Leu, Thr, Tyr, or Arg;
Xaa at position 120 is Asn, Ala, Pro, Leu, His, Val, or Gln;
Xaa at position 121 is Ala, Ser, Ile, Asn, Pro, Lys, Asp, or Gly;
Xaa at position 122 is Gln, Ser, Met, Trp, Arg, Phe, Pro, His, Ile, Tyr, or Cys;
Xaa at position 123 is Ala, Met, Glu, His, Ser, Pro, Tyr, or Leu;
wherein from 4 to about 44 of the amino acids designated by Xaa are different from the corresponding amino acids of native (1-133) human interleukin-3 with the proviso that no more than one of the amino acids at positions 63, 82, 87, 98, 112, and 121 are different from the corresponding amino acids in native human interleukin-3; and wherein from 1 to 14 amino acids are optionally deleted from the N-terminus and/or from 1 to 15 amino acids are optionally deleted from the C-terminus; and said mutant human interleukin-3 polypeptide has increased cell proliferative activity compared to native human interleukin-3 in at least one assay selected from the group consisting of: AML cell proliferation, TF-1 cell proliferation and Methylcellulose assay; and
(b) a polypeptide consisting of an N-terminal methionine residue, alanine residue or methionine-alanine di-peptide immediately preceding said sequence according to (a).
65. The method according to claim 64, wherein said mutant human interleukin-3 polypeptide has at least three times greater cell proliferative activity compared to native human interleukin-3.
66. The method according to claim 64, wherein said mutant human interleukin-3 polypeptide has at least ten times greater cell proliferative activity compared to native human interleukin-3.
67. A method of treating a patient having an immunodeficiency or hematopoietic deficiency consisting of administering to said patient, a therapeutically effective amount of a mutant human interleukin-3 (hIL-3) polypeptide consisting of a modified hIL-3 amino acid sequence selected from the group consisting of:
(a) a sequence of (SEQ ID NO:17)
wherein;
Xaa at position 17 is Ser, Gly, Asp, Met, or Gln;
Xaa at position 18 is Asn, His, or Ile;
Xaa at position 19 is Met or Ile;
Xaa at position 21 is Asp or Glu;
Xaa at position 23 is Ile, Ala, Leu, or Gly;
Xaa at position 24 is Ile, Val, or Leu;
Xaa at position 25 is Thr, His, Gln, or Ala;
Xaa at position 26 is His or Ala;
Xaa at position 29 is Gln, Asn, or Val;
Xaa at position 30 is Pro, Gly, or Gln;
Xaa at position 31 is Pro, Asp, Gly, or Gln;
Xaa at position 32 is Leu, Arg, Gln, Asn, Gly, Ala, or Glu;
Xaa at position 33 is Pro or Glu;
Xaa at position 34 is Leu, Val, Gly, Ser, Lys, Ala, Arg, Gln, Glu, Ile, Phe, Thr or Met;
Xaa at position 35 is Leu, Ala, Asn, Pro, Gln, or Val;
Xaa at position 37 is Phe, Ser, Pro, or Trp;
Xaa at position 38 is Asn or Ala;
Xaa at position 42 is Gly, Asp, Ser, Cys, Ala, Asn, Ile, Leu, Met, Tyr or Arg;
Xaa at position 44 is Asp or Glu;
Xaa at position 45 is Gln, Val, Met, Leu, Thr, Ala, Asn, Glu, Ser or Lys;
Xaa at position 46 is Asp, Phe, Ser, Thr, Ala, Asn, Gln, Glu, His, Ile, Lys, Tyr, Val or Cys;
Xaa at position 50 is Glu, Ala, Asn, Ser or Asp;
Xaa at position 51 is Asn, Arg, Met, Pro, Ser, Thr, or His;
Xaa at position 54 is Arg or Ala;
Xaa at position 55 is Arg, Thr, Val, Leu, or Gly;
Xaa at position 56 is Pro, Gly, Ser, Gln, Ala, Arg, Asn, Glu, Leu, Thr, Val or Lys;
Xaa at position 60 is Ala or Ser;
Xaa at position 62 is Asn, Pro, Thr, or Ile;
Xaa at position 63 is Arg;
Xaa at position 64 is Ala or Asn;
Xaa at position 65 is Val or Thr;
Xaa at position 66 is Lys or Arg;
Xaa at position 67 is Ser, Phe, or His;
Xaa at position 68 is Leu, Ile, Phe, or His;
Xaa at position 69 is Gln, Ala, Pro, Thr, Glu, Arg, or Gly;
Xaa at position 71 is Ala, Pro, or Arg;
Xaa at position 72 is Ser, Glu, Arg, or Asp;
Xaa at position 73 is Ala or Leu;
Xaa at position 76 is Ser, Val, Ala, Asn, Glu, Pro, or Gly;
Xaa at position 77 is Ile or Leu;
Xaa at position 79 is Lys, Thr, Gly, Asn, Met, Arg, Ile, or Asp;
Xaa at position 80 is Asn, Gly, Glu, or Arg;
Xaa at position 82 is Leu, Gln, Trp, Arg, Asp, Ala, Asn, Glu, His, Ile, Met, Phe, Ser, Thr, Tyr or Val;
Xaa at position 83 is Pro or Thr;
Xaa at position 85 is Leu or Val;
Xaa at position 87 is Leu or Ser;
Xaa at position 88 is Ala or Trp;
Xaa at position 91 is Ala or Pro;
Xaa at position 93 is Thr, Asp, Ser, Pro, Ala, Leu, or Arg;
Xaa at position 95 is His, Pro, Arg, Val, Leu, Gly, Asn, Phe, Ser or Thr;
Xaa at position 96 is Pro or Tyr;
Xaa at position 97 is Ile or Val;
Xaa at position 98 is His, Ile, Asn, Leu, Ala, Thr, Gln, Lys, Met, Ser, Tyr, Val or Pro;
Xaa at position 99 is Ile, Leu, or Val;
Xaa at position 100 is Lys, Arg, Ile, Gln, Pro, or Ser;
Xaa at position 101 is Asp;
Xaa at position 104 is Trp or Leu;
Xaa at position 105 is Asn, Pro, Ala, Ser, Trp, Gln, Tyr, Leu, Lys, Ile, Asp, or His;
Xaa at position 106 is Glu or Gly;
Xaa at position 108 is Arg, Ala, or Ser;
Xaa at position 109 is Arg, Thr, Glu, Leu, or Ser;
Xaa at position 112 is Thr, Val, or Gln;
Xaa at position 114 is Tyr or Trp;
Xaa at position 115 is Leu or Ala;
Xaa at position 116 is Lys;
Xaa at position 117 is Thr or Ser;
Xaa at position 120 is Asn, Pro, Leu, His, Val, or Gln;
Xaa at position 121 is Ala, Ser, Ile, Asn, Pro, Asp, or Gly;
Xaa at position 122 is Gln, Ser, Met, Trp, Arg, Phe, Pro, His, Ile, Tyr, or Cys;
Xaa at position 123 is Ala, Met, Glu, His, Ser, Pro, Tyr, or Leu;
wherein from 4 to about 44 of the amino acids designated by Xaa are different from the corresponding amino acids of native (1-133) human interleukin-3 with the proviso that no more than one of the amino acids at positions 63, 82, 87, 98, 112, and 121 are different from the corresponding amino acids in native human interleukin-3; and wherein from 1 to 14 amino acids are optionally deleted from the N-terminus and/or from 1 to 15 amino acids are optionally deleted from the C-terminus; and said mutant human interleukin-3 polypeptide has increased cell proliferative activity compared to native human interleukin-3 in at least one assay selected from the group consisting of: AML cell proliferation, TF-1 cell proliferation and Methylcellulose assay; and
(b) a polypeptide consisting of an N-terminal methionine residue, alanine residue or methionine-alanine di-peptide immediately preceding said sequence according to (a).
68. The method according to claim 67, wherein said mutant human interleukin-3 polypeptide has at least three times greater cell proliferative activity compared to native human interleukin-3.
69. The method according to claim 67, wherein said mutant human interleukin-3 polypeptide has at least ten times greater cell proliferative activity compared to native human interleukin-3.
70. The method according to claim 67 wherein in said mutant human interleukin-3 (hIL-3) sequence the amino acids which differ from the corresponding residue in native human interleukin-3 are selected from the group consisting of:
position 42 wherein Xaa is Gly, Asp, Ser, Ile, Leu, Met, Tyr, or Ala;
position 45 wherein Xaa is Gln, Val, Met or Asn;
position 46 wherein Xaa is Asp, Ser, Gln, His or Val;
position 50 wherein Xaa is Glu or Asp;
position 51 wherein Xaa is Asn, Pro or Thr;
position 62 wherein Xaa is Asn or Pro;
position 76 wherein Xaa is Ser, or Pro;
position 82 wherein Xaa is Leu, Trp, Asp, Asn Glu, His, Phe, Ser or Tyr;
position 95 wherein Xaa is His, Arg, Thr, Asn or Ser;
position 98 wherein Xaa is His, Ile, Leu, Ala, Gln, Lys, Met, Ser, Tyr or Val;
position 100 wherein Xaa is Lys or Arg;
position 101 wherein Xaa is Asp;
position 105 wherein Xaa is Asn, or Pro;
position 108 wherein Xaa is Arg, Ala, or Ser;
position 116 wherein Xaa is Lys;
position 121 wherein Xaa is Ala, or Ile;
position 122 wherein Xaa is Gln, or Ile;
position 123 wherein Xaa is Ala, Met or Glu.
71. The method according to claim 70, wherein said mutant human interleukin-3 polypeptide has at least three times greater cell proliferative activity compared to native human interleukin-3.
72. The method according to claim 70, wherein said mutant human interleukin-3 polypeptide has at least ten times greater cell proliferative activity compared to native human interleukin-3.
73. A method of treating a patient having an immunodeficiency or hematopoietic deficiency consisting of administering to said patient, a therapeutically effective amount of a mutant human interleukin-3 (hIL-3) polypeptide consisting of a modified hIL-3 amino acid sequence selected from the group consisting of:
(a) a sequence of (SEQ ID NO:19)
wherein;
Xaa at position 3 is Ser, Lys, Gly, Asp, Met, Gln, or Arg;
Xaa at position 4 is Asn, His, Leu, Ile, Phe, Arg, or Gln;
Xaa at position 5 is Met, Phe, Ile, Arg, Gly, Ala, or Cys;
Xaa at position 6 is Ile, Cys, Gln, Glu, Arg, Pro, or Ala;
Xaa at position 7 is Asp, Phe, Lys, Arg, Ala, Gly, Glu, Gln, Asn, Thr, Ser or Val;
Xaa at position 8 is Glu, Trp, Pro, Ser, Ala, His, Asp, Asn, Gln, Leu, Val, or Gly;
Xaa at position 9 is Ile, Val, Ala, Leu, Gly, Trp, Lys, Phe, Ser, or Arg;
Xaa at position 10 is Ile, Gly, Val, Arg, Ser, Phe, or Leu;
Xaa at position 11 is Thr, His, Gly, Gln, Arg, Pro, or Ala;
Xaa at position 12 is His, Thr, Phe, Gly, Arg, Ala, or Trp;
Xaa at position 13 is Leu, Gly, Arg, Thr, Ser, or Ala;
Xaa at position 14 is Lys, Arg, Leu, Gln, Gly, Pro, Val or Trp;
Xaa at position 15 is Gln, Asn, Leu, Pro, Arg, or Val;
Xaa at position 16 is Pro, His, Thr, Gly, Asp, Gln, Ser, Leu, or Lys;
Xaa at position 17 is Pro, Asp, Gly, Ala, Arg, Leu, or Gln;
Xaa at position 18 is Leu, Val, Arg, Gln, Asn, Gly, Ala, or Glu;
Xaa at position 19 is Pro, Leu, Gln, Ala, Thr, or Glu;
Xaa at position 20 is Leu, Val, Gly, Ser, Lys, Glu, Gln, Thr, Arg, Ala, Phe, Ile or Met;
Xaa at position 21 is Leu, Ala, Gly, Asn, Pro, Gln, or Val;
Xaa at position 22 is Asp, Leu, or Val;
Xaa at position 23 is Phe, Ser, Pro, Trp, or Ile;
Xaa at position 24 is Asn, or Ala;
Xaa at position 26 is Leu, Trp, or Arg;
Xaa at position 27 is Asn, Cys, Arg, Leu, His, Met, Pro;
Xaa at position 28 is Gly, Asp, Ser, Cys, Ala, Lys, Asn, Thr, Leu, Val, Glu, Phe, Tyr, Ile or Met;
Xaa at position 29 is Glu, Asn, Tyr, Leu, Phe, Asp, Ala, Cys, Gln, Arg, Thr, Gly or Ser;
Xaa at position 30 is Asp, Ser, Leu, Arg, Lys, Thr, Met, Trp, Glu, Asn, Gln, Ala or Pro;
Xaa at position 31 is Gln, Pro, Phe, Val, Met, Leu, Thr, Lys, Asp, Asn, Arg, Ser, Ala, Ile, Glu, His or Trp;
Xaa at position 32 is Asp, Phe, Ser, Thr, Cys, Glu, Asn, Gln, Lys, His, Ala, Tyr, Ile, Val or Gly;
Xaa at position 33 is Ile, Gly, Val, Ser, Arg, Pro, or His;
Xaa at position 34 is Leu, Ser, Cys, Arg, Ile, His, Phe, Glu, Lys, Thr, Ala, Met, Val or Asn;
Xaa at position 35 is Met, Arg, Ala, Gly, Pro, Asn, His, or Asp;
Xaa at position 36 is Glu, Leu, Thr, Asp, Tyr, Lys, Asn, Ser, Ala, Ile, Val, His, Phe, Met or Gln;
Xaa at position 37 is Asn, Arg, Met, Pro, Ser, Thr, or His;
Xaa at position 38 is Asn, His, Arg, Leu, Gly, Ser, or Thr;
Xaa at position 39 is Leu, Thr, Ala, Gly, Glu, Pro, Lys, Ser, or Met;
Xaa at position 40 is Arg, Asp, Ile, Ser, Val, Thr, Gln, Asn, Lys, His, Ala or Leu;
Xaa at position 41 is Arg, Thr, Val, Ser, Leu, or Gly;
Xaa at position 42 is Pro, Gly, Cys, Ser, Gln, Glu, Arg, His, Thr, Ala, Tyr, Phe, Leu, Val or Lys;
Xaa at position 43 is Asn or Gly;
Xaa at position 44 is Leu, Ser, Asp, Arg, Gln, Val, or Cys;
Xaa at position 45 is Glu, Tyr, His, Leu, Pro, or Arg;
Xaa at position 46 is Ala, Ser, Pro, Tyr, Asn, or Thr;
Xaa at position 47 is Phe, Asn, Glu, Pro, Lys, Arg, or Ser;
Xaa at position 48 is Asn, His, Val, Arg, Pro, Thr, Asp, or Ile;
Xaa at position 49 is Arg, Tyr, Trp, Ser, His, Pro, or Val;
Xaa at position 50 is Ala, Asn, Pro, Ser, or Lys;
Xaa at position 51 is Val, Thr, Pro, His, Leu, Phe, or Ser;
Xaa at position 52 is Lys, Ile, Arg, Val, Asn, Glu, or Ser;
Xaa at position 53 is Ser, Ala, Phe, Val, Gly, Asn, Ile, Pro, or His;
Xaa at position 54 is Leu, Val, Trp, Ser, Ile, Phe, Thr, or His;
Xaa at position 55 is Gln, Ala, Pro, Thr, Glu, Arg, Trp, Gly, or Leu;
Xaa at position 56 is Asn, Leu, Val, Trp, Pro, or Ala;
Xaa at position 57 is Ala, Met, Leu, Pro, Arg, Glu, Thr, Gln, Trp, or Asn;
Xaa at position 58 is Ser, Glu, Met, Ala, His, Asn, Arg, or Asp;
Xaa at position 59 is Ala, Glu, Asp, Leu, Ser, Gly, Thr, or Arg;
Xaa at position 60 is Ile, Met, Thr, Pro, Arg, Gly, Ala;
Xaa at position 61 is Glu, Lys, Gly, Asp, Pro, Trp, Arg, Ser, Gln, or Leu;
Xaa at position 62 is Ser, Val, Ala, Asn, Trp, Glu, Pro, Gly, or Asp;
Xaa at position 63 is Ile, Ser, Arg, Thr, or Leu;
Xaa at position 64 is Leu, Ala, Ser, Glu, Phe, Gly, or Arg;
Xaa at position 65 is Lys, Thr, Gly, Asn, Met, Arg, Ile, or Asp;
Xaa at position 66 is Asn, Trp, Val, Gly, Thr, Leu, Glu, or Arg;
Xaa at position 67 is Leu, Gln, Gly, Ala, Trp, Arg, Val, or Lys;
Xaa at position 68 is Leu, Gln, Lys, Trp, Arg, Asp, Glu, Asn, His, Thr, Ser, Ala, Tyr, Phe, Ile, Met or Val;
Xaa at position 69 is Pro, Ala, Thr, Trp, Arg, or Met;
Xaa at position 70 is Cys, Glu, Gly, Arg, Met, or Val;
Xaa at position 71 is Leu, Asn, Val, or Gln;
Xaa at position 72 is Pro, Cys, Arg, Ala, or Lys;
Xaa at position 73 is Leu, Ser, Trp, or Gly;
Xaa at position 74 is Ala, Lys, Arg, Val, or Trp;
Xaa at position 75 is Thr, Asp, Cys, Leu, Val, Glu, His, Asn, or Ser;
Xaa at position 76 is Ala, Pro, Ser, Thr, Gly, Asp, Ile, or Met;
Xaa at position 77 is Ala, Pro, Ser, Thr, Phe, Leu, Asp, or His;
Xaa at position 78 is Pro, Phe, Arg, Ser, Lys, His, Ala, Gly, Ile or Leu;
Xaa at position 79 is Thr, Asp, Ser, Asn, Pro, Ala, Leu, or Arg;
Xaa at position 80 is Arg, Ile, Ser, Glu, Leu, Val, Gln, Lys, His, Ala or Pro;
Xaa at position 81 is His, Gln, Pro, Arg, Val, Leu, Gly, Thr, Asn, Lys, Ser, Ala, Trp, Phe, Ile or Tyr;
Xaa at position 82 is Pro, Lys, Tyr, Gly, Ile, or Thr;
Xaa at position 83 is Ile, Val, Lys, Ala, or Asn;
Xaa at position 84 is His, Ile, Asn, Leu, Asp, Ala, Thr, Glu, Gln, Ser, Phe, Met, Val, Lys, Tyr or Pro;
Xaa at position 85 is Ile, Leu, Arg, Asp, Val, Pro, Gln, Gly, Ser, Phe, or His;
Xaa at position 86 is Lys, Tyr, Leu, His, .Arg, Ile, Ser, Gln, or Pro;
Xaa at position 87 is Asp;
Xaa at position 88 is Gly, Leu, Glu, Lys, Ser, Tyr, or Pro;
Xaa at position 89 is Asp, or Ser;
Xaa at position 90 is Trp, Val, Cys, Tyr, Thr, Met, Pro, Leu, Gin, Lys, Ala, Phe, or Gly;
Xaa at position 91 is Asn, Pro, Ala, Phe, Ser, Trp, Gln, Tyr, Leu, Lys, Ile, Asp, or His;
Xaa at position 92 is Glu, Ser, Ala, Lys, Thr, Ile, Gly, or Pro;
Xaa at position 94 is Arg, Lys, Asp, Leu, Thr, Ile, Gln, His, Ser, Ala, or Pro;
Xaa at position 95 is Arg, Thr, Pro, Glu, Tyr, Leu, Ser, or Gly;
Xaa at position 96 is Lys, Asn, Thr, Leu, Gln, Arg, His, Glu, Ser, Ala or Trp;
Xaa at position 97 is Leu, Ile, Arg, Asp, or Met;
Xaa at position 98 is Thr, Val, Gln, Tyr, Glu, His, Ser, or Phe;
Xaa at position 99 is Phe, Ser, Cys, His, Gly, Trp, Tyr, Asp, Lys, Leu, Ile, Val or Asn;
Xaa at position 100 is Tyr, Cys, His, Ser, Trp, Arg, or Leu;
Xaa at position 101 is Leu, Asn, Val, Pro, Arg, Ala, His, Thr, Trp, or Met;
Xaa at position 102 is Lys;
Xaa at position 103 is Thr, Ser, Asn, Ile, Trp, Lys, or Pro;
Xaa at position 104 is Leu, Ser, Pro, Ala, Glu, Cys, Asp, or Tyr;
Xaa at position 105 is Glu, Ser, Lys, Pro, Leu, Thr, Tyr, or Arg;
Xaa at position 106 is Asn, Ala, Pro, Leu, His, Val, or Gln;
Xaa at position 107 is Ala, Ser, Ile, Asn, Pro, Lys, Asp, or Gly;
Xaa at position 108 is Gln, Ser, Met, Trp, Arg, Phe, Pro, His, Ile, Tyr, or Cys;
Xaa at position 109 is Ala, Met, Glu, His, Ser, Pro, Tyr, or Leu;
wherein from 4 to about 44 of the amino acids designated by Xaa are different from the corresponding native amino acids of (1-133) human interleukin-3 with the proviso that no more than one of the amino acids at positions 49, 68, 73, 84, 98, and 107 are different from the corresponding amino acids in native human interleukin-3; and said mutant human interleukin-3 polypeptide has increased cell proliferative activity compared to native human interleukin-3 in at least one assay selected from the group consisting of: AML cell proliferation, TF-1 cell proliferation and Methylcellulose assay; and
(b) a polypeptide consisting of an N-terminal methionine residue, alanine residue or methionine-alanine di-peptide immediately preceding said sequence according to (a).
74. The method according to claim 73, wherein said mutant human interleukin-3 polypeptide has at least three times greater cell proliferative activity compared to native human interleukin-3.
75. The method according to claim 73, wherein said mutant human interleukin-3 polypeptide has at least ten times greater cell proliferative activity compared to native human interleukin-3.
76. A method of treating a patient having an immunodeficiency or hematopoietic deficiency consisting of administering to said patient, a therapeutically effective amount of a mutant human interleukin-3 (hIL-3) polypeptide consisting of a modified hIL-3 amino acid sequence selected from the group consisting of:
(a) a sequence of (SEQ ID NO:21)
wherein;
Xaa at position 3 is Ser, Gly, Asp, Met, or Gln;
Xaa at position 4 is Asn, His, or Ile;
Xaa at position 5 is Met or Ile;
Xaa at position 7 is Asp or Glu;
Xaa at position 9 is Ile, Ala, Leu, or Gly;
Xaa at position 10 is Ile, Val, or Leu;
Xaa at position 11 is Thr, His, Gln, or Ala;
Xaa at position 12 is His or Ala;
Xaa at position 15 is Gln, Asn, or Val;
Xaa at position 16 is Pro, Gly, or Gln;
Xaa at position 17 is Pro, Asp, Gly, or Gln;
Xaa at position 18 is Leu, Arg, Gln, Asn, Gly, Ala, or Glu;
Xaa at position 19 is Pro or Glu;
Xaa at position 20 is Leu, Val, Gly, Ser. Lys, Ala, Arg, Gln, Glu, Ile, Phe, Thr or Met;
Xaa at position 21 is Leu, Ala, Asn, Pro, Gln, or Val;
Xaa at position 23 is Phe, Ser, Pro, or Trp;
Xaa at position 24 is Asn or Ala;
Xaa at position 28 is Gly, Asp, Ser. Cys, Ala, Asn, Ile, Leu, Met Tyr or Arg;
Xaa at position 30 is Asp or Glu;
Xaa at position 31 is Gln, Val, Met, Leu, Thr, Ala, Asn, Glu, Ser or Lys;
Xaa at position 32 is Asp, Phe, Ser, Thr, Ala, Asn, Gln, Glu, His, Ile, Lys, Tyr, Val or Cys;
Xaa at position 36 is Glu, Ala, Asn, Ser or Asp;
Xaa at position 37 is Asn, Arg, Met, Pro, Ser, Thr, or His;
Xaa at position 40 is Arg or Ala;
Xaa at position 41 is Arg, Thr, Val, Leu, or Gly;
Xaa at position 42 is Pro, Gly, Ser, Gln, Ala, Arg, Asn, Glu, Leu, Thr, Val or Lys;
Xaa at position 46 is Ala or Ser;
Xaa at position 48 is Asn, Pro, Thr, or Ile;
Xaa at position 49 is Arg;
Xaa at position 50 is Ala or Asn;
Xaa at position 51 is Val or Thr;
Xaa at position 52 is Lys or Arg;
Xaa at position 53 is Ser, Phe, or His;
Xaa at position 54 is Leu, Ile, Phe, or His;
Xaa at position 55 is Gln, Ala, Pro, Thr, Glu, Arg, or Gly;
Xaa at position 57 is Ala, Pro, or Arg;
Xaa at position 58 is Ser, Glu, Arg, or Asp;
Xaa at position 59 is Ala or Leu;
Xaa at position 62 is Ser, Val, Ala, Asn, Glu, Pro, or Gly;
Xaa at position 63 is Ile or Leu;
Xaa at position 65 is Lys, Thr, Gly, Asn, Met, Arg, Ile, or Asp;
Xaa at position 66 is Asn, Gly, Glu, or Arg;
Xaa at position 68 is Leu, Gln, Trp, Arg, Asp, Ala, Asn, Glu, His, Ile, Met, Phe, Ser, Thr, Tyr or Val;
Xaa at position 69 is Pro or Thr;
Xaa at position 71 is Leu or Val;
Xaa at position 73 is Leu or Ser;
Xaa at position 74 is Ala or Trp;
Xaa at position 77 is Ala or Pro;
Xaa at position 79 is Thr, Asp, Ser, Pro, Ala, Leu, or Arg;
Xaa at position 81 is His, Pro, Arg, Val, Leu, Gly, Asn, Phe, Ser or Thr;
Xaa at position 82 is Pro or Tyr;
Xaa at position 83 is Ile or Val;
Xaa at position 84 is His, Ile, Asn, Leu, Ala, Thr, Gln, Lys, Met, Ser, Tyr, Val or Pro;
Xaa at position 85 is Ile, Leu, or Val;
Xaa at position 86 is Lys, Arg, Ile, Gln, Pro, or Ser;
Xaa at position 87 is Asp;
Xaa at position 90 is Trp or Leu;
Xaa at position 91 is Asn, Pro, Ala, Ser, Trp, Gln, Tyr, Leu, Lys, Ile, Asp, or His;
Xaa at position 92 is Glu, or Gly;
Xaa at position 94 is Arg, Ala, or Ser;
Xaa at position 95 is Arg, Thr, Glu, Leu, or Ser;
Xaa at position 98 is Thr, Val, or Gln;
Xaa at position 100 is Tyr or Trp;
Xaa at position 101 is Leu or Ala;
Xaa at position 102 is Lys;
Xaa at position 103 is Thr or Ser;
Xaa at position 106 is Asn, Pro, Leu, His, Val, or Gln;
Xaa at position 107 is Ala, Ser, Ile, Asn, Pro, Asp, or Gly;
Xaa at position 108 is Gln, Ser, Met, Trp, Arg, Phe, Pro, His, Ile, Tyr, or Cys;
Xaa at position 109 is Ala, Met, Glu, His, Ser, Pro, Tyr, or Leu;
wherein from 4 to about 44 of the amino acids designated by Xaa are different from the corresponding amino acids of native (1-133) human interleukin-3 with the proviso that no more than one of the amino acids at positions 49, 68, 73, 84, 98, and 107 are different from the corresponding amino acids in native human interleukin-3; and said mutant human interleukin-3 polypeptide has increased cell proliferative activity compared to native human interleukin-3 in at least one assay selected from the group consisting of: AML cell proliferation, TF-1 cell proliferation and Methylcellulose assay; and
(b) a polypeptide consisting of an N-terminal methionine residue, alanine residue or methionine-alanine di-peptide immediately preceding said sequence according to (a).
77. The method according to claim 76, wherein said mutant human interleukin-3 polypeptide has at least three times greater cell proliferative activity compared to native human interleukin-3.
78. The method according to claim 76, wherein said mutant human interleukin-3 polypeptide has at least ten times greater cell proliferative activity compared to native human interleukin-3.
79. The method according to claim 76, wherein in said mutant human interleukin-3 (hIL-3) sequence the amino acids which differ from the corresponding residue in native human interleukin-3 are selected from the group consisting of:
position 28 wherein Xaa is Gly, Asp, Ser, Ile, Leu, Met, Tyr, or Ala;
position 31 wherein Xaa is Gln, Val, Met or Asn;
position 32 wherein Xaa is Asp, Ser, Ala, Gln, His or Val;
position 36 wherein Xaa is Glu or Asp;
position 37 wherein Xaa is Asn, Pro or Thr;
position 48 wherein Xaa is Asn or Pro;
position 62 wherein Xaa is Ser, or Pro;
position 68 wherein Xaa is Leu, Trp, Asp, Asn, Glu, His, Phe, Ser or Tyr;
position 81 wherein Xaa is His, Arg, Thr, Asn or Ser;
position 84 wherein Xaa is His, Ile, Leu, Ala, Arg, Gln, Lys, Met, Ser, Tyr or Val;
position 86 wherein Xaa is Lys or Arg;
position 87 wherein Xaa is Asp;
position 91 wherein Xaa is Asn, or Pro;
position 94 wherein Xaa is Arg, Ala, or Ser;
position 102 wherein Xaa is Lys;
position 107 wherein Xaa is Ala, or Ile;
position 108 wherein Xaa is Gln, or Ile;
position 109 wherein Xaa is Ala, Met or Glu.
80. The method according to claim 79, wherein said mutant human interleukin-3 polypeptide has at least three times greater cell proliferative activity compared to native human interleukin-3.
81. The method according to claim 79, wherein said mutant human interleukin-3 polypeptide has at least ten times greater cell proliferative activity compared to native human interleukin-3.
82. A method of treating a patient having an immunodeficiency or hematopoietic deficiency consisting of administering to said patient, a therapeutically effective amount of a mutant human interleukin-3 (hIL-3) polypeptide consisting of a modified hIL-3 amino acid sequence selected from the group consisting of:
(a) a polypeptide having an amino acid sequence of
(18I, 25H, 29R, 32A, 37P, 42A and 45V)-(15-125)human interleukin-3 (SEQ ID NO:66);
(18I, 25H, 29R, 32N, 37P, 42S and 45M)-(15-125)human interleukin-3 (SEQ ID NO:67);
(18I, 25H, 29V, 32A, 37S, 42S and 45M)-(15-125)human interleukin-3 (SEQ ID NO:68);
(51R, 55L, 59L, 62V, 67N and 69E)-(15-125)human interleukin-3 (SEQ ID NO:69);
(51R, 55L, 60S, 62V, 67N and 69E)-(15-125)human interleukin-3 (SEQ ID NO:70);
(51R, 55T, 59L, 62V, 67H and 69E)-(15-125)human interleukin-3 (SEQ ID NO:71);
(73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A and 105Q)-(15-125)human interleukin-3 (SEQ ID NO:72);
(73G, 76A, 79R, 82V, 87S, 93S, 98T, 101A and 105Q)-(15-125)human interleukin-3 (SEQ ID NO:73);
(73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and 123E)-(15-125)human interleukin-3 (SEQ. ID. NO:76);
(73G, 76A, 79R, 82V, 87S, 93S, 98T, 101A, 105Q, 109E, 116V, 120Q and 123E)-(15-125)human interleukin-3 (SEQ ID NO:77);
(73G, 76A, 79R, 82V, 87S, 93S, 98T, 101A, 105Q, 109E, 116V, 117S, 120H and 123E)-(15-125)human interleukin-3 (SEQ ID NO:78);
(18I, 25H, 29R, 32A, 37P, 42A, 45V, 51R, 55L, 60S, 62V, 67N and 69E)-(15-125)human interleukin-3 (SEQ ID NO:79);
(18I, 25H, 29R, 32N, 37P, 42S, 45M, 51R, 55T, 59L, 62V, 67H and 69E)-(15-125)human interleukin-3 (SEQ ID NO:80);
(18I, 25H, 29V, 32A, 37S, 42S, 45M, 51R, 55L, 59L, 62V, 67N and 69E)-(15-125)human interleukin-3 (SEQ ID NO:81);
(42D, 45M, 46S, 50D, 95R, 98I, 100R, 116W)-(15-125)human interleukin-3 (residues 3-113 of SEQ ID NO:263);
(42D, 45M, 46S, 98I, 100R, 116W)-(15-125)human interleukin-3 (SEQ ID NO:406);
(18I, 19A, 25H, 29R, 32N, 37P, 42S, 45V, 49D, 51R, 55T, 59L, 62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and 123E)-(15-125)human interleukin-3 (residues 3-113 of SEQ ID NO:276);
(18I, 19I, 25H, 29R, 32N, 37P, 42S, 45V, 49D, 51R, 55T, 59L, 62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and 123E)-(15-125)human interleukin-3 (residues 3-113 of SEQ ID NO:277);
(18I, 23A, 25H, 29V, 32A, 37S, 42S, 45M, 51R, 55L, 59L, 62V, 67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and 123E)-(15-125)human interleukin-3 (residues 3-113 of SEQ ID NO:278);
(18I, 23A, 25H, 29V, 32A, 37S, 42S, 45M, 51R, 55L, 59L, 62V, 67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 112Q, 116V, 120Q and 123E)-(15-125)human interleukin-3 (SEQ ID NO:279);
(18I, 25H, 29R, 32A, 37P, 42A, 45V, 51R, 55L, 60S, 62V, 67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V,)-(15-119)human interleukin-3 (residues 3-113 of SEQ ID NO:287);
(18I, 23A, 25H, 29R, 32A, 37P, 42D, 45V, 46S, 50D, 51R, 55L, 60S, 62V, 67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 112Q, 116V)-(15-119)human interleukin-3 (residues 3-113 of SEQ ID NO:289);
(18I, 25H, 29R, 32A, 37P, 42A, 45V, 51R, 55L, 60S, 62V, 67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 112Q, 116V)-(15-119)human interleukin-3 (residues 3-113 of SEQ ID NO:307);
(18I, 20P, 23A, 25H, 29I, 32N, 34S, 37S, 38A, 42S, 45V, 46S, 51R, 55T, 59L, 62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and 123E)-(15-125)human interleukin-3 (residues 3-113 of SEQ ID NO:317);
(18I, 23L, 25H, 29I, 32N, 34S, 37S, 38A, 42S, 45V, 46S, 51R, 55T, 59L, 62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and 123E)-(15-125)human interleukin-3 (residues 3-113 of SEQ ID NO:318);
(18I, 23A, 25H, 29I, 32N, 34S, 37S, 38A, 42S, 45V, 46S, 51R, 55T, 59L, 62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and 123E)-(15-125)human interleukin-3 (residues 3-113 of SEQ ID NO:319);
(18I, 19I, 20L, 23A, 25H, 29I, 32N, 34S, 37S, 38A, 42S, 45V, 46S, 51R, 55T, 59L, 62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and 123E)-(15-125)human interleukin-3 (residues 3-113 of SEQ ID NO:320);
(18I, 25H, 29R, 32N, 37P, 42S, 45M, 50D, 51S, 55T, 59L, 62P, 63H, 67Q, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and 123E)-(15-125)human interleukin-3 (residues 3-113 of SEQ ID NO:321);
(18I, 25H, 29R, 32N, 37P, 42S, 45M, 51R, 55T, 59L, 62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109L, 112Q, 116S, 120Q and 123E)-(15-125)human interleukin-3 (residues 3-113 of SEQ ID NO:322); and
(18I, 25H, 29R, 32N, 37P, 42S, 45M, 51R, 55T, 59L, 62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109L, 112Q, 116S)-(15-118)human interleukin-3 (residues 3-113 of SEQ ID NO:323);
and said mutant human interleukin-3 polypeptide has increased cell proliferative activity compared to native human interleukin-3 in at least one assay selected from the group consisting of: AML cell proliferation, TF-1 cell proliferation and Methylcellulose assay; and
(b) a polypeptide comprising an N-terminal methionine residue, alanine residue or methionine-alanine di-peptide immediately preceding said sequence according to (a).
83. The method according to claim 82, wherein said mutant human interleukin-3 polypeptide has at least three times greater cell proliferative activity compared to native human interleukin-3.
84. The method according to claim 82, wherein said mutant human interleukin-3 polypeptide has at least ten times greater cell proliferative activity compared to native human interleukin-3.
85. A method of treating a patient consisting of the steps of:
(i) administering to said patient, an amount of a mutant human interleukin-3 (IL-3) polypeptide, effective to promote the proliferation and/or differentiation of hematopoietic cells in said patient, wherein said mutant human interleukin-3 (hIL-3) polypeptide consists of a modified hIL-3 amino acid sequence selected from the group consisting of:
(a) a sequence of (SEQ ID NO:15)
wherein;
Xaa at position 17 is Ser, Lys, Gly, Asp, Met, Gln, or Arg;
Xaa at position 18 is Asn, His, Leu, Ile, Phe, Arg, or Gln;
Xaa at position 19 is Met, Phe, Ile, Arg, Gly, Ala, or Cys;
Xaa at position 20 is Ile, Cys, Gln, Glu, Arg, Pro, or Ala;
Xaa at position 21 is Asp, Phe, Lys, Arg, Ala, Gly, Glu, Gln, Asn, Thr, Ser or Val;
Xaa at position 22 is Glu, Trp, Pro, Ser, Ala, His, Asp, Asn, Gln, Leu, Val or Gly;
Xaa at position 23 is Ile, Val, Ala, Leu, Gly, Trp, Lys, Phe, Ser, or Arg;
Xaa at position 24 is Ile, Gly, Val, Arg, Ser, Phe, or Leu;
Xaa at position 25 is Thr, His, Gly, Gln, Arg, Pro, or Ala;
Xaa at position 26 is His, Thr, Phe, Gly, Arg, Ala, or Trp;
Xaa at position 27 is Leu, Gly, Arg, Thr, Ser, or Ala;
Xaa at position 28 is Lys, Arg, Leu, Gln, Gly, Pro, Val or Trp;
Xaa at position 29 is Gln, Asn, Leu, Pro, Arg, or Val;
Xaa at position 30 is Pro, His, Thr, Gly, Asp, Gln, Ser, Leu, or Lys;
Xaa at position 31 is Pro, Asp, Gly, Ala, Arg, Leu, or Gln;
Xaa at position 32 is Leu, Val, Arg, Gln, Asn, Gly, Ala, or Glu;
Xaa at position 33 is Pro, Leu, Gln, Ala, Thr, or Glu;
Xaa at position 34 is Leu, Val, Gly, Ser, Lys, Glu, Gln, Thr, Arg, Ala, Phe, Ile or Met;
Xaa at position 35 is Leu, Ala, Gly, Asn, Pro, Gln, or Val;
Xaa at position 36 is Asp, Leu, or Val;
Xaa at position 37 is Phe, Ser, Pro, Trp, or Ile;
Xaa at position 38 is Asn, or Ala;
Xaa at position 40 is Leu, Trp, or Arg;
Xaa at position 41 is Asn, Cys, Arg, Leu, His, Met, or Pro;
Xaa at position 42 is Gly, Asp, Ser, Cys, Asn, Lys, Thr, Leu, Val, Glu, Phe, Tyr, Ile, Met or Ala;
Xaa at position 43 is Glu, Asn, Tyr, Leu, Phe, Asp, Ala, Cys, Gln, Arg, Thr, Gly or Ser;
Xaa at position 44 is Asp, Ser, Leu, Arg, Lys, Thr, Met, Trp, Glu, Asn, Gln, Ala or Pro;
Xaa at position 45 is Gln, Pro, Phe, Val, Met, Leu, Thr, Lys, Trp, Asp, Asn, Arg, Ser, Ala, Ile, Glu or His;
Xaa at position 46 is Asp, Phe, Ser, Thr, Cys, Glu, Asn, Gln, Lys, His, Ala, Tyr, Ile, Val or Gly;
Xaa at position 47 is Ile, Gly, Val, Ser, Arg, Pro, or His;
Xaa at position 48 is Leu, Ser, Cys, Arg, Ile, His, Phe, Glu, Lys, Thr, Ala, Met, Val or Asn;
Xaa at position 49 is Met, Arg, Ala, Gly, Pro, Asn, His, or Asp;
Xaa at position 50 is Glu, Leu, Thr, Asp, Tyr, Lys, Asn, Ser, Ala, Ile, Val, His, Phe, Met or Gln;
Xaa at position 51 is Asn, Arg, Met, Pro, Ser, Thr, or His;
Xaa at position 52 is Asn, His, Arg, Leu, Gly, Ser, or Thr;
Xaa at position 53 is Leu, Thr, Ala, Gly, Glu, Pro, Lys, Ser, or Met;
Xaa at position 54 is Arg, Asp, Ile, Ser, Val, Thr, Gln, Asn, Lys, His, Ala or Leu;
Xaa at position 55 is Arg, Thr, Val, Ser, Leu, or Gly;
Xaa at position 56 is Pro, Gly, Cys, Ser, Gln, Glu, Arg, His, Thr, Ala, Tyr, Phe, Leu, Val or Lys;
Xaa at position 57 is Asn or Gly;
Xaa at position 58 is Leu, Ser, Asp, Arg, Gln, Val, or Cys;
Xaa at position 59 is Glu, Tyr, His, Leu, Pro, or Arg;
Xaa at position 60 is Ala, Ser, Pro, Tyr, Asn, or Thr;
Xaa at position 61 is Phe, Asn, Glu, Pro, Lys, Arg, or Ser;
Xaa at position 62 is Asn, His, Val, Arg, Pro, Thr, Asp, or Ile;
Xaa at position 63 is Arg, Tyr, Trp, Ser, His, Pro, or Val;
Xaa at position 64 is Ala, Asn, Pro, Ser, or Lys;
Xaa at position 65 is Val, Thr, Pro, His, Leu, Phe, or Ser;
Xaa at position 66 is Lys, Ile, Arg, Val, Asn, Glu, or Ser;
Xaa at position 67 is Ser, Ala, Phe, Val, Gly, Asn, Ile, Pro, or His;
Xaa at position 68 is Leu, Val, Trp, Ser, Ile, Phe, Thr, or His;
Xaa at position 69 is Gln, Ala, Pro, Thr, Glu, Arg, Trp, Gly, or Leu;
Xaa at position 70 is Asn, Leu, Val, Trp, Pro, or Ala;
Xaa at position 71 is Ala, Met, Leu, Pro, Arg, Glu, Thr, Gln, Trp, or Asn;
Xaa at position 72 is Ser, Glu, Met, Ala, His, Asn, Arg, or Asp;
Xaa at position 73 is Ala, Glu, Asp, Leu, Ser, Gly, Thr, or Arg;
Xaa at position 74 is Ile, Met, Thr, Pro, Arg, Gly, Ala;
Xaa at position 75 is Glu, Lys, Gly, Asp, Pro, Trp, Arg, Ser, Gln, or Leu;
Xaa at position 76 is Ser, Val, Ala, Asn, Trp, Glu, Pro, Gly, or Asp;
Xaa at position 77 is Ile, Ser, Arg, Thr, or Leu;
Xaa at position 78 is Leu, Ala, Ser, Glu, Phe, Gly, or Arg;
Xaa at position 79 is Lys, Thr, Asn, Met, Arg, Ile, Gly, or Asp;
Xaa at position 80 is Asn, Trp, Val, Gly, Thr, Leu, Glu, or Arg;
Xaa at position 81 is Leu, Gln, Gly, Ala, Trp, Arg, Val, or Lys;
Xaa at position 82 is Leu, Gln, Lys, Trp, Arg, Asp, Glu, Asn, His, Thr, Ser, Ala, Tyr, Phe, Ile, Met or Val;
Xaa at position 83 is Pro, Ala, Thr, Trp, Arg, or Met;
Xaa at position 84 is Cys, Glu, Gly, Arg, Met, or Val;
Xaa at position 85 is Leu, Asn, Val, or Gln;
Xaa at position 86 is Pro, Cys, Arg, Ala, or Lys;
Xaa at position 87 is Leu, Ser, Trp, or Gly;
Xaa at position 88 is Ala, Lys, Arg, Val, or Trp;
Xaa at position 89 is Thr, Asp, Cys, Leu, Val, Glu, His, Asn, or Ser;
Xaa at position 90 is Ala, Pro, Ser, Thr, Gly, Asp, Ile, or Met;
Xaa at position 91 is Ala, Pro, Ser, Thr, Phe, Leu, Asp, or His;
Xaa at position 92 is Pro, Phe, Arg, Ser, Lys, His, Ala, Gly, Ile or Leu;
Xaa at position 93 is Thr, Asp, Ser, Asn, Pro, Ala, Leu, or Arg;
Xaa at position 94 is Arg, Ile, Ser, Glu, Leu, Val, Gln, Lys, His, Ala, or Pro;
Xaa at position 95 is His, Gln, Pro, Arg, Val, Leu, Gly, Thr, Asn, Lys, Ser, Ala, Trp, Phe, Ile, or Tyr;
Xaa at position 96 is Pro, Lys, Tyr, Gly, Ile, or Thr;
Xaa at position 97 is Ile, Val, Lys, Ala, or Asn;
Xaa at position 98 is His, Ile, Asn, Leu, Asp, Ala, Thr, Glu, Gln, Ser, Phe, Met, Val, Lys, Tyr or Pro;
Xaa at position 99 is Ile, Leu, Arg, Asp, Val, Pro, Gln, Gly, Ser, Phe, or His;
Xaa at position 100 is Lys, Tyr, Leu, His, Arg, Ile, Ser, Gln, or Pro;
Xaa at position 101 is Asp;
Xaa at position 102 is Gly, Leu, Glu, Lys, Ser, Tyr, or Pro;
Xaa at position 103 is Asp, or Ser;
Xaa at position 104 is Trp, Val, Cys, Tyr, Thr, Met, Pro, Leu, Gln, Lys, Ala, Phe, or Gly;
Xaa at position 105 is Asn, Pro, Ala, Phe, Ser, Trp, Gln, Tyr, Leu, Lys, Ile, Asp, or His;
Xaa at position 106 is Glu, Ser, Ala, Lys, Thr, Ile, Gly, or Pro;
Xaa at position 108 is Arg, Lys, Asp, Leu, Thr, Ile, Gln, His, Ser, Ala or Pro;
Xaa at position 109 is Arg, Thr, Pro, Glu, Tyr, Leu, Ser, or Gly;
Xaa at position 110 is Lys, Ala, Asn, Thr, Leu, Arg, Gln, His, Glu, Ser, Ala, or Trp;
Xaa at position 111 is Leu, Ile, Arg, Asp, or Met;
Xaa at position 112 is Thr, Val, Gln, Tyr, Glu, His, Ser, or Phe;
Xaa at position 113 is Phe, Ser, Cys, His, Gly, Trp, Tyr, Asp, Lys, Leu, Ile, Val or Asn;
Xaa at position 114 is Tyr, Cys, His, Ser, Trp, Arg, or Leu;
Xaa at position 115 is Leu, Asn, Val, Pro, Arg, Ala, His, Thr, Trp, or Met;
Xaa at position 116 is Lys;
Xaa at position 117 is Thr, Ser, Asn, Ile, Trp, Lys, or Pro;
Xaa at position 118 is Leu, Ser, Pro, Ala, Glu, Cys, Asp, or Tyr;
Xaa at position 119 is Glu, Ser, Lys, Pro, Leu, Thr, Tyr, or Arg;
Xaa at position 120 is Asn, Ala, Pro, Leu, His, Val, or Gln;
Xaa at position 121 is Ala, Ser, Ile, Asn, Pro, Lys, Asp, or Gly;
Xaa at position 122 is Gln, Ser, Met, Trp, Arg, Phe, Pro, His, Ile, Tyr, or Cys;
Xaa at position 123 is Ala, Met, Glu, His, Ser, Pro, Tyr, or Leu;
wherein from 4 to about 44 of the amino acids designated by Xaa are different from the corresponding amino acids of native (1-133) human interleukin-3 with the proviso that no more than one of the amino acids at positions 63, 82, 87, 98, 112, and 121 are different from the corresponding amino acids in native human interleukin-3; and wherein from 1 to 14 amino acids are optionally deleted from the N-terminus and/or from 1 to 15 amino acids are optionally deleted from the C-terminus; and said mutant human interleukin-3 polypeptide has increased cell proliferative activity compared to native human interleukin-3 in at least one assay selected from the group consisting of: AML cell proliferation, TF-1 cell proliferation and Methylcellulose assay; and
(b) a polypeptide consisting of an N-terminal methionine residue, alanine residue or methionine-alanine di-peptide immediately preceding said sequence according to (a);
(ii) removing hematopoietic cells from said patient;
(iii)administering to said patient cancer radiation therapy or chemotherapy; and
(iv) returning said hematopoietic cells to said patient.
86. The method according to claim 85 , wherein said mutant human interleukin-3 polypeptide has at least three times greater cell proliferative activity compared to native human interleukin-3.
87. The method according to claim 85, wherein said mutant human interleukin-3 polypeptide has at least ten times greater cell proliferative activity compared to native human interleukin-3.
88. A method of treating a patient consisting of the steps of:
(i) administering to said patient, an amount of a mutant human interleukin-3 (IL-3) polypeptide, effective to promote the proliferation and/or differentiation of hematopoietic cells in said patient, wherein said mutant human interleukin-3 (hIL-3) polypeptide consists of a modified hIL-3 amino acid sequence selected from the group consisting of:
(a) a sequence of(SEQ ID NO:17)
wherein;
Xaa at position 17 is Ser, Gly, Asp, Met, or Gln;
Xaa at position 18 is Asn, His, or Ile;
Xaa at position 19 is Met or Ile;
Xaa at position 21 is Asp or Glu;
Xaa at position 23 is Ile, Ala, Leu, or Gly;
Xaa at position 24 is Ile, Val, or Leu;
Xaa at position 25 is Thr, His, Gln, or Ala;
Xaa at position 26 is His or Ala;
Xaa at position 29 is Gln, Asn, or Val;
Xaa at position 30 is Pro, Gly, or Gln;
Xaa at position 31 is Pro, Asp, Gly, or Gln;
Xaa at position 32 is Leu, Arg, Gln, Asn, Gly, Ala, or Glu;
Xaa at position 33 is Pro or Glu;
Xaa at position 34 is Leu, Val, Gly, Ser, Lys, Ala, Arg, Gln, Glu, Ile, Phe, Thr or Met;
Xaa at position 35 is Leu, Ala, Asn, Pro, Gln, or Val;
Xaa at position 37 is Phe, Ser, Pro, or Trp;
Xaa at position 38 is Asn or Ala;
Xaa at position 42 is Gly, Asp, Ser, Cys, Ala, Asn, Ile, Leu, Met, Tyr or Arg;
Xaa at position 44 is Asp or Glu;
Xaa at position 45 is Gln, Val, Met, Leu, Thr, Ala, Asn, Glu, Ser or Lys;
Xaa at position 46 is Asp, Phe, Ser, Thr, Ala, Asn, Gln, Glu, His, Ile, Lys, Tyr, Val or Cys;
Xaa at position 50 is Glu, Ala, Asn, Ser or Asp;
Xaa at position 51 is Asn, Arg, Met, Pro, Ser, Thr, or His;
Xaa at position 54 is Arg or Ala;
Xaa at position 55 is Arg, Thr, Val, Leu, or Gly;
Xaa at position 56 is Pro, Gly, Ser, Gln, Ala, Arg, Asn, Glu, Leu, Thr, Val or Lys;
Xaa at position 60 is Ala or Ser;
Xaa at position 62 is Asn, Pro, Thr, or Ile;
Xaa at position 63 is Arg;
Xaa at position 64 is Ala or Asn;
Xaa at position 65 is Val or Thr;
Xaa at position 66 is Lys or Arg;
Xaa at position 67 is Ser, Phe, or His;
Xaa at position 68 is Leu, Ile, Phe, or His;
Xaa at position 69 is Gln, Ala, Pro, Thr, Glu, Arg, or Gly;
Xaa at position 71 is Ala, Pro, or Arg;
Xaa at position 72 is Ser, Glu, Arg, or Asp;
Xaa at position 73 is Ala or Leu;
Xaa at position 76 is Ser, Val, Ala, Asn, Glu, Pro, or Gly;
Xaa at position 77 is Ile or Leu;
Xaa at position 79 is Lys, Thr, Gly, Asn, Met, Arg, Ile, or Asp;
Xaa at position 80 is Asn, Gly, Glu, or Arg;
Xaa at position 82 is Leu, Gln, Trp, Arg, Asp, Ala, Asn, Glu, His, Ile, Met, Phe, Ser, Thr, Tyr or Val;
Xaa at position 83 is Pro or Thr;
Xaa at position 85 is Leu or Val;
Xaa at position 87 is Leu or Ser;
Xaa at position 88 is Ala or Trp;
Xaa at position 91 is Ala or Pro;
Xaa at position 93 is Thr, Asp, Ser, Pro, Ala, Leu, or Arg;
Xaa at position 95 is His, Pro, Arg, Val, Leu, Gly, Asn, Phe, Ser or Thr;
Xaa at position 96 is Pro or Tyr;
Xaa at position 97 is Ile or Val;
Xaa at position 98 is His, Ile, Asn, Leu, Ala, Thr, Gln, Lys, Met, Ser, Tyr, Val or Pro;
Xaa at position 99 is Ile, Leu, or Val;
Xaa at position 100 is Lys, Arg, Ile, Gln, Pro, or Ser;
Xaa at position 101 is Asp;
Xaa at position 104 is Trp or Leu;
Xaa at position 105 is Asn, Pro, Ala, Ser, Trp, Gln, Tyr, Leu, Lys, Ile, Asp, or His;
Xaa at position 106 is Glu or Gly;
Xaa at position 108 is Arg, Ala, or Ser;
Xaa at position 109 is Arg, Thr, Glu, Leu, or Ser;
Xaa at position 112 is Thr, Val, or Gln;
Xaa at position 114 is Tyr or Trp;
Xaa at position 115 is Leu or Ala;
Xaa at position 116 is Lys;
Xaa at position 117 is Thr or Ser;
Xaa at position 120 is Asn, Pro, Leu, His, Val, or Gln;
Xaa at position 121 is Ala, Ser, Ile, Asn, Pro, Asp, or Gly;
Xaa at position 122 is Gln, Ser, Met, Trp, Arg, Phe, Pro, His, Ile, Tyr, or Cys;
Xaa at position 123 is Ala, Met, Glu, His, Ser, Pro, Tyr, or Leu;
wherein from 4 to about 44 of the amino acids designated by Xaa are different from the corresponding amino acids of native (1-133) human interleukin-3; and wherein from 1 to 14 amino acids are optionally deleted from the N-terminus and/or from 1 to 15 amino acids are optionally deleted from the C-terminus; and said mutant human interleukin-3 polypeptide has increased cell proliferative activity compared to native human interleukin-3 in at least one assay selected from the group consisting of: AML cell proliferation, TF-1 cell proliferation and Methylcellulose assay; and
(b) a polypeptide consisting of an N-terminal methionine residue, alanine residue or methionine-alanine di-peptide immediately preceding said sequence according to (a);
(ii) removing hematopoietic cells from said patient;
(iii)administering to said patient cancer radiation therapy or chemotherapy; and
(iv) returning said hematoposetic cells to said patient.
89. The method according to claim 88, wherein said mutant human interleukin-3 polypeptide has at least three times greater cell proliferative activity compared to native human interleukin-3.
90. The method according to claim 88, wherein said mutant human interleukin-3 polypeptide has at least ten times greater cell proliferative activity compared to native human interleukin-3.
91. The method according to claim 88 wherein in said mutant human interleukin-3 (hIL-3) sequence the amino acids which differ from the corresponding residue in native human interleukin-3 are selected from the group consisting of:
position 42 wherein Xaa is Gly, Asp, Ser, Ile, Leu, Met, Tyr, or Ala;
position 45 wherein Xaa is Gln, Val, Met or Asn;
position 46 wherein Xaa is Asp, Ser, Gln, His or Val;
position 50 wherein Xaa is Glu or Asp;
position 51 wherein Xaa is Asn, Pro or Thr;
position 62 wherein Xaa is Asn or Pro;
position 76 wherein Xaa is Ser, or Pro;
position 82 wherein Xaa is Leu, Trp, Asp, Asn Glu, His, Phe, Ser or Tyr;
position 95 wherein Xaa is His, Arg, Thr, Asn or Ser;
position 98 wherein Xaa is His, Ile, Leu, Ala, Gln, Lys, Met, Ser, Tyr or Val;
position 100 wherein Xaa is Lys or Arg;
position 101 wherein Xaa is Asp;
position 105 wherein Xaa is Asn, or Pro;
position 108 wherein Xaa is Arg, Ala, or Ser;
position 116 wherein Xaa is Lys;
position 121 wherein Xaa is Ala, or Ile;
position 122 wherein Xaa is Gln, or Ile;
position 123 wherein Xaa is Ala, Met or Glu.
92. The method according to claim 91, wherein said mutant human interleukin-3 polypeptide has at least three times greater cell proliferative activity compared to native human interleukin-3.
93. The method according to claim 91, wherein said mutant human interleukin-3 polypeptide has at least ten times greater cell proliferative activity compared to native human interleukin-3.
94. A method of treating a patient consisting of the steps of:
(i) administering to said patient, an amount of a mutant human interleukin-3 (IL-3) polypeptide, effective to promote the proliferation and/or differentiation of hematopoietic cells in said patient, wherein said mutant human interleukin-3 (hIL-3) polypeptide consists of a modified hIL-3 amino acid sequence selected from the group consisting of:
(a) a sequence of(SEQ ID NO:19)
wherein;
Xaa at position 3 is Ser, Lys, Gly, Asp, Met, Gln, or Arg;
Xaa at position 4 is Asn, His, Leu, le, Phe, Arg, or Gln;
Xaa at position 5 is Met , Phe, Ile , Arg, Gly, Ala, or Cys;
Xaa at position 6 is Ile, Cys, Gln, Glu, Arg, Pro, or Ala;
Xaa at position 7 is Asp, Phe, Lys, Arg, Ala, Gly, Glu, Gln, Asn, Thr, Ser or Val;
Xaa at position 8 is Glu, Trp, Pro, Ser, Ala, His, Asp, Asn, Gln, Leu, Val, or Gly;
Xaa at position 9 is Ile, Val, Ala, Leu, Gly, Trp, Lys, Phe, Ser, or Arg;
Xaa at position 10 is Ile, Gly, Val, Arg, Ser, Phe, or Leu;
Xaa at position 11 is Thr, His, Gly, Gln, Arg, Pro, or Ala;
Xaa at position 12 is His, Thr, Phe, Gly, Arg, Ala, or Trp;
Xaa at position 13 is Leu, Gly, Arg, Thr, Ser, or Ala;
Xaa at position 14 is Lys, Arg, Leu, Gln, Gly, Pro, Val or Trp;
Xaa at position 15 is Gln, Asn, Leu, Pro, Arg, or Val;
Xaa at position 16 is Pro, His, Thr, Gly, Asp, Gln, Ser, Leu, or Lys;
Xaa at position 17 is Pro, Asp, Gly, Ala, Arg, Leu, or Gln;
Xaa at position 18 is Leu, Val, Arg, Gln, Asn, Gly, Ala, or Glu;
Xaa at position 19 is Pro, Leu, Gln, Ala, Thr, or Glu;
Xaa at position 20 is Leu, Val, Gly, Ser, Lys, Glu, Gln, Thr, Arg, Ala, Phe, Ile or Met;
Xaa at position 21 is Leu, Ala, Gly, Asn, Pro, Gln, or Val;
Xaa at position 22 is Asp, Leu, or Val;
Xaa at position 23 is Phe, Ser, Pro, Trp, or Ile;
Xaa at position 24 is Asn, or Ala;
Xaa at position 26 is Leu, Trp, or Arg;
Xaa at position 27 is Asn, Cys, Arg, Leu, His, Met, Pro;
Xaa at position 28 is Gly, Asp, Ser, Cys, Ala, Lys, Asn, Thr, Leu, Val, Glu, Phe, Tyr, Ile or Met;
Xaa at position 29 is Glu, Asn, Tyr, Leu, Phe, Asp, Ala, Cys, Gln, Arg, Thr, Gly or Ser;
Xaa at position 30 is Asp, Ser, Leu, Arg, Lys, Thr, Met, Trp, Glu, Asn, Gln, Ala or Pro;
Xaa at position 31 is Gln, Pro, Phe, Val, Met, Leu, Thr, Lys, Asp, Asn, Arg, Ser, Ala, Ile, Glu, His or Trp;
Xaa at position 32 is Asp, Phe, Ser, Thr, Cys, Glu, Asn, Gln, Lys, His, Ala, Tyr, Ile, Val or Gly;
Xaa at position 33 is Ile, Gly, Val, Ser, Arg, Pro, or His;
Xaa at position 34 is Leu, Ser, Cys, Arg, Ile, His, Phe, Glu, Lys, Thr, Ala, Met, Val or Asn;
Xaa at position 35 is Met, Arg, Ala, Gly, Pro, Asn, His, or Asp;
Xaa at position 36 is Glu, Leu, Thr, Asp, Tyr, Lys, Asn, Ser, Ala, Ile, Val, His, Phe, Met or Gln;
Xaa at position 37 is Asn, Arg, Met, Pro, Ser, Thr, or His;
Xaa at position 38 is Asn, His, Arg, Leu, Gly, Ser, or Thr;
Xaa at position 39 is Leu, Thr, Ala, Gly, Glu, Pro, Lys, Ser, or Met;
Xaa at position 40 is Arg, Asp, Ile, Ser, Val, Thr, Gln, Asn, Lys, His, Ala or Leu;
Xaa at position 41 is Arg, Thr, Val, Ser, Leu, or Gly;
Xaa at position 42 is Pro, Gly, Cys, Ser, Gln, Glu, Arg, His, Thr, Ala, Tyr, Phe, Leu, Val or Lys;
Xaa at position 43 is Asn or Gly;
Xaa at position 44 is Leu, Ser, Asp, Arg, Gln, Val, or Cys;
Xaa at position 45 is Glu, Tyr, His, Leu, Pro, or Arg;
Xaa at position 46 is Ala, Ser, Pro, Tyr, Asn, or Thr;
Xaa at position 47 is Phe, Asn, Glu, Pro, Lys, Arg, or Ser;
Xaa at position 48 is Asn, His, Val, Arg, Pro, Thr, Asp, or Ile;
Xaa at position 49 is Arg, Tyr, Trp, Ser, His, Pro, or Val;
Xaa at position 50 is Ala, Asn, Pro, Ser, or Lys;
Xaa at position 51 is Val, Thr, Pro, His, Leu, Phe, or Ser;
Xaa at position 52 is Lys, Ile, Arg, Val, Asn, Glu, or Ser;
Xaa at position 53 is Ser, Ala, Phe, Val, Gly, Asn, Ile, Pro, or His;
Xaa at position 54 is Leu, Val, Trp, Ser, Ile, Phe, Thr, or His;
Xaa at position 55 is Gln, Ala, Pro, Thr, Glu, Arg, Trp, Gly, or Leu;
Xaa at position 56 is Asn, Leu, Val, Trp, Pro, or Ala;
Xaa at position 57 is Ala, Met, Leu, Pro, Arg, Glu, Thr, Gln, Trp, or Asn;
Xaa at position 58 is Ser, Glu, Met, Ala, His, Asn, Arg, or Asp;
Xaa at position 59 is Ala, Glu, Asp, Leu, Ser, Gly, Thr, or Arg;
Xaa at position 60 is Ile, Met, Thr, Pro, Arg, Gly, Ala;
Xaa at position 61 is Glu, Lys, Gly, Asp, Pro, Trp, Arg, Ser, Gln, or Leu;
Xaa at position 62 is Ser, Val, Ala, Asn, Trp, Glu, Pro, Gly, or Asp;
Xaa at position 63 is Ile, Ser, Arg, Thr, or Leu;
Xaa at position 64 is Leu, Ala, Ser, Glu, Phe, Gly, or Arg;
Xaa at position 65 is Lys, Thr, Gly, Asn, Met, Arg, Ile, or Asp;
Xaa at position 66 is Asn, Trp, Val, Gly, Thr, Leu, Glu, or Arg;
Xaa at position 67 is Leu, Gln, Gly, Ala, Trp, Arg, Val, or Lys;
Xaa at position 68 is Leu, Gln, Lys, Trp, Arg, Asp, Glu, Asn, His, Thr, Ser, Ala, Tyr, Phe, Ile, Met or Val;
Xaa at position 69 is Pro, Ala, Thr, Trp, Arg, or Met;
Xaa at position 70 is Cys, Glu, Gly, Arg, Met, or Val;
Xaa at position 71 is Leu, Asn, Val, or Gln;
Xaa at position 72 is Pro, Cys, Arg, Ala, or Lys;
Xaa at position 73 is Leu, Ser, Trp, or Gly;
Xaa at position 74 is Ala, Lys, Arg, Val, or Trp;
Xaa at position 75 is Thr, Asp, Cys, Leu, Val, Glu, His, Asn, or Ser;
Xaa at position 76 is Ala, Pro, Ser, Thr, Gly, Asp, Ile, or Met;
Xaa at position 77 is Ala, Pro, Ser, Thr, Phe, Leu, Asp, or His;
Xaa at position 78 is Pro, Phe, Arg, Ser, Lys, His, Ala, Gly, Ile or Leu;
Xaa at position 79 is Thr, Asp, Ser, Asn, Pro, Ala, Leu, or Arg;
Xaa at position 80 is Arg, Ile, Ser, Glu, Leu, Val, Gln, Lys, His, Ala or Pro;
Xaa at position 81 is His, Gln, Pro, Arg, Val, Leu, Gly, Thr, Asn, Lys, Ser, Ala, Trp, Phe, Ile or Tyr;
Xaa at position 82 is Pro, Lys, Tyr, Gly, Ile, or Thr;
Xaa at position 83 is Ile, Val, Lys, Ala, or Asn;
Xaa at position 84 is His, Ile, Asn, Leu, Asp, Ala, Thr, Glu, Gln, Ser, Phe, Met, Val, Lys, Tyr or Pro;
Xaa at position 85 is Ile, Leu, Arg, Asp, Val, Pro, Gln, Gly, Ser, Phe, or His;
Xaa at position 86 is Lys, Tyr, Leu, His, Arg, Ile, Ser, Gln, or Pro;
Xaa at position 87 is Asp;
Xaa at position 88 is Gly, Leu, Glu, Lys, Ser, Tyr, or Pro;
Xaa at position 89 is Asp, or Ser;
Xaa at position 90 is Trp, Val, Cys, Tyr, Thr, Met, Pro, Leu, Gln, Lys, Ala, Phe, or Gly;
Xaa at position 91 is Asn, Pro, Ala, Phe, Ser, Trp, Gln, Tyr, Leu, Lys, Ile, Asp, or His;
Xaa at position 92 is Glu, Ser, Ala, Lys, Thr, Ile, Gly, or Pro;
Xaa at position 94 is Arg, Lys, Asp, Leu, Thr, Ile, Gln, His, Ser, Ala, or Pro;
Xaa at position 95 is Arg, Thr, Pro, Glu, Tyr, Leu, Ser, or Gly;
Xaa at position 96 is Lys, Asn, Thr, Leu, Gln, Arg, His, Glu, Ser, Ala or Trp;
Xaa at position 97 is Leu, Ile, Arg, Asp, or Met;
Xaa at position 98 is Thr, Val, Gln, Tyr, Glu, His, Ser, or Phe;
Xaa at position 99 is Phe, Ser, Cys, His, Gly, Trp, Tyr, Asp, Lys, Leu, Ile, Val or Asn;
Xaa at position 100 is Tyr, Cys, His, Ser, Trp, Arg, or Leu;
Xaa at position 101 is Leu, Asn, Val, Pro, Arg, Ala, His, Thr, Trp, or Met;
Xaa at position 102 is Lys;
Xaa at position 103 is Thr, Ser, Asn, Ile, Trp, Lys, or Pro;
Xaa at position 104 is Leu, Ser, Pro, Ala, Glu, Cys, Asp, or Tyr;
Xaa at position 105 is Glu, Ser, Lys, Pro, Leu, Thr, Tyr, or Arg;
Xaa at position 106 is Asn, Ala, Pro, Leu, His, Val, or Gln;
Xaa at position 107 is Ala, Ser, Ile, Asn, Pro, Lys, Asp, or Gly;
Xaa at position 108 is Gln, Ser, Met, Trp, Arg, Phe, Pro, His, Ile, Tyr, or Cys;
Xaa at position 109 is Ala, Met, Glu, His, Ser, Pro, Tyr, or Leu;
wherein from 4 to about 44 of the amino acids designated by Xaa are different from the corresponding native amino acids of (1-133) human interleukin-3 with the proviso that no more than one of the amino acids at positions 49, 68, 73, 84, 98, and 107 are different from the corresponding amino acids in native human interleukin-3; and said mutant human interleukin-3 polypeptide has increased cell proliferative activity compared to native human interleukin-3 in at least one assay selected from the group consisting of: AML cell proliferation, TF-1 cell proliferation and Methylcellulose assay; and
(b) a polypeptide consisting of an N-terminal methionine residue, alanine residue or methionine-alanine di-peptide immediately preceding said sequence according to (a);
(ii) removing hematopoietic cells from said patient;
(iii)administering to said patient cancer radiation therapy or chemotherapy; and
(iv) returning said hematopoietic cells to said patient.
95. The method according to claim 94, wherein said mutant human interleukin-3 polypeptide has at least three times greater cell proliferative activity compared to native human interleukin-3.
96. The method according to claim 94, wherein said mutant human interleukin-3 polypeptide has at least ten times greater cell proliferative activity compared to native human interleukin-3.
97. A method of treating a patient consisting of the steps of:
(i) administering to said patient, an amount of a mutant human interleukin-3 (IL-3) polypeptide, effective to promote the proliferation and/or differentiation of hematopoietic cells in said patient, wherein said mutant human interleukin-3 (hIL-3) polypeptide consists of a modified hIL-3 amino acid sequence selected from the group consisting of:
(a) a sequence of (SEQ ID NO:21)
wherein;
Xaa at position 3 is Ser, Gly, Asp, Met, or Gln;
Xaa at position 4 is Asn, His, or Ile;
Xaa at position 5 is Met or Ile;
Xaa at position 7 is Asp or Glu;
Xaa at position 9 is Ile, Ala, Leu, or Gly;
Xaa at position 10 is Ile, Val, or Leu;
Xaa at position 11 is Thr, His, Gln, or Ala;
Xaa at position 12 is His or Ala;
Xaa at position 15 is Gln, Asn, or Val;
Xaa at position 16 is Pro, Gly, or Gln;
Xaa at position 17 is Pro, Asp, Gly, or Gln;
Xaa at position 18 is Leu, Arg, Gln, Asn, Gly, Ala, or Glu;
Xaa at position 19 is Pro or Glu;
Xaa at position 20 is Leu, Val, Gly, Ser, Lys, Ala, Arg, Gln, Glu, Ile, Phe, Thr or Met;
Xaa at position 21 is Leu, Ala, Asn, Pro, Gln, or Val;
Xaa at position 23 is Phe, Ser, Pro, or Trp;
Xaa at position 24 is Asn or Ala;
Xaa at position 28 is Gly, Asp, Ser, Cys, Ala, Asn, Ile, Leu, Met Tyr or Arg;
Xaa at position 30 is Asp or Glu;
Xaa at position 31 is Gln, Val, Met, Leu, Thr, Ala, Asn, Glu, Ser or Lys;
Xaa at position 32 is Asp, Phe, Ser, Thr, Ala, Asn, Gln, Glu, His, Ile, Lys, Tyr, Val or Cys;
Xaa at position 36 is Glu, Ala, Asn, Ser or Asp;
Xaa at position 37 is Asn, Arg, Met, Pro, Ser, Thr, or His;
Xaa at position 40 is Arg or Ala;
Xaa at position 41 is Arg, Thr, Val, Leu, or Gly;
Xaa at position 42 is Pro, Gly, Ser, Gln, Ala, Arg, Asn, Glu, Leu, Thr, Val or Lys;
Xaa at position 46 is Ala or Ser;
Xaa at position 48 is Asn, Pro, Thr, or Ile;
Xaa at position 49 is Arg;
Xaa at position 50 is Ala or Asn;
Xaa at position 51 is Val or Thr;
Xaa at position 52 is Lys or Arg;
Xaa at position 53 is Ser, Phe, or His;
Xaa at position 54 is Leu, Ile, Phe, or His;
Xaa at position 55 is Gln, Ala, Pro, Thr, Glu, Arg, or Gly;
Xaa at position 57 is Ala, Pro, or Arg;
Xaa at position 58 is Ser, Glu, Arg, or Asp;
Xaa at position 59 is Ala or Leu;
Xaa at position 62 is Ser, Val, Ala, Asn, Glu, Pro, or Gly;
Xaa at position 63 is Ile or Leu;
Xaa at position 65 is Lys, Thr, Gly, Asn, Met, Arg, Ile, or Asp;
Xaa at position 66 is Asn, Gly, Glu, or Arg;
Xaa at position 68 is Leu, Gln, Trp, Arg, Asp, Ala, Asn, Glu, His, Ile, Met, Phe, Ser, Thr, Tyr or Val;
Xaa at position 69 is Pro or Thr;
Xaa at position 71 is Leu or Val;
Xaa at position 73 is Leu or Ser;
Xaa at position 74 is Ala or Trp;
Xaa at position 77 is Ala or Pro;
Xaa at position 79 is Thr, Asp, Ser, Pro, Ala, Leu, or Arg;
Xaa at position 81 is His, Pro, Arg, Val, Leu, Gly, Asn, Phe, Ser or Thr;
Xaa at position 82 is Pro or Tyr;
Xaa at position 83 is Ile or Val;
Xaa at position 84 is His, Ile, Asn, Leu, Ala, Thr, Gln, Lys, Met, Ser, Tyr, Val or Pro;
Xaa at position 85 is Ile, Leu, or Val;
Xaa at position 86 is Lys, Arg, Ile, Gln, Pro, or Ser;
Xaa at position 87 is Asp;
Xaa at position 90 is Trp or Leu;
Xaa at position 91 is Asn, Pro, Ala, Ser, Trp, Gln, Tyr, Leu, Lys, Ile, Asp, or His;
Xaa at position 92 is Glu, or Gly;
Xaa at position 94 is Arg, Ala, or Ser;
Xaa at position 95 is Arg, Thr, Glu, Leu, or Ser;
Xaa at position 98 is Thr, Val, or Gln;
Xaa at position 100 is Tyr or Trp;
Xaa at position 101 is Leu or Ala;
Xaa at position 102 is Lys;
Xaa at position 103 is Thr or Ser;
Xaa at position 106 is Asn, Pro, Leu, His, Val, or Gln;
Xaa at position 107 is Ala, Ser, Ile, Asn, Pro, Asp, or Gly;
Xaa at position 108 is Gln, Ser, Met, Trp, Arg, Phe, Pro, His, Ile, Tyr, or Cys;
Xaa at position 109 is Ala, Met, Glu, His, Ser, Pro, Tyr, or Leu;
wherein from 4 to about 44 of the amino acids designated by Xaa are different from the corresponding amino acids of native (1-133) human interleukin-3 with the proviso that no more than one of the amino acids at positions 49, 68, 73, 84, 98, and 107 are different from the corresponding amino acids in native human interleukin-3; and said mutant human interleukin-3 polypeptide has increased cell proliferative activity compared to native human interleukin-3 in at least one assay selected from the group consisting of: AML cell proliferation, TF-1 cell proliferation and Methylcellulose assay; and
(b) a polypeptide consisting of an N-terminal methionine residue, alanine residue or methionine-alanine di-peptide immediately preceding said sequence according to (a);
(ii) removing hematopoietic cells from said patient;
(iii)administering to said patient cancer radiation therapy or chemotherapy; and
(iv) returning said hematopoietic cells to said patient.
98. The method according to claim 97, wherein said mutant human interleukin-3 polypeptide has at least three times greater cell proliferative activity compared to native human interleukin-3.
99. The method according to claim 97, wherein said mutant human interleukin-3 polypeptide has at least ten times greater cell proliferative activity compared to native human interleukin-3.
100. The method according to claim 97, wherein in said mutant human interleukin-3 (hIL-3) sequence the amino acids which differ from the corresponding residue in native human interleukin-3 are selected from the group consisting of:
position 28 wherein Xaa is Gly, Asp, Ser, Ile, Leu, Met, Tyr, or Ala;
position 31 wherein Xaa is Gln, Val, Met or Asn;
position 32 wherein Xaa is Asp, Ser, Ala, Gln, His or Val;
position 36 wherein Xaa is Glu or Asp;
position 37 wherein Xaa is Asn, Pro or Thr;
position 48 wherein Xaa is Asn or Pro;
position 62 wherein Xaa is Ser, or Pro;
position 68 wherein Xaa is Leu, Trp, Asp, Asn, Glu, His, Phe, Ser or Tyr;
position 81 wherein Xaa is His, Arg, Thr, Asn or Ser;
position 84 wherein Xaa is His, Ile, Leu, Ala, Arg, Gln, Lys, Met, Ser, Tyr or Val;
position 86 wherein Xaa is Lys or Arg;
position 87 wherein Xaa is Asp;
position 91 wherein Xaa is Asn, or Pro;
position 94 wherein Xaa is Arg, Ala, or Ser;
position 102 wherein Xaa is Lys;
position 107 wherein Xaa is Ala, or Ile;
position 108 wherein Xaa is Gln, or Ile;
position 109 wherein Xaa is Ala, Met or Glu.
101. The method according to claim 100, wherein said mutant human interleukin-3 polypeptide has at least three times greater cell proliferative activity compared to native human interleukin-3.
102. The method according to claim 100, wherein said mutant human interleukin-3 polypeptide has at least ten times greater cell proliferative activity compared to native human interleukin-3.
103. A method of treating a patient consisting of the steps of:
(i) administering to said patient, an amount of a mutant human interleukin-3 (IL-3) polypeptide, effective to promote the proliferation and/or differentiation of hematopoietic cells in said patient, wherein said mutant human interleukin-3 (hIL-3) polypeptide consists of a modified hIL-3 amino acid sequence selected from the group consisting of:
(a) a polypeptide having an amino acid sequence of
(18I, 25H, 29R, 32A, 37P, 42A and 45V)-(15-125)human interleukin-3 (SEQ ID NO:66);
(18I, 25H, 29R, 32N, 37P, 42S and 45M)-(15-125)human interleukin-3 (SEQ ID NO:67);
(18I, 25H, 29V, 32A, 37S, 42S and 45M)-(15-125)human interleukin-3 (SEQ ID NO:68);
(51R, 55L, 59L, 62V, 67N and 69E)-(15-125)human interleukin-3 (SEQ ID NO:69);
(51R, 55L, 60S, 62V, 67N and 69E)-(15-125)human interleukin-3 (SEQ ID NO:70);
(51R, 55T, 59L, 62V, 67H and 69E)-(15-125)human interleukin-3 (SEQ ID NO:71);
(73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A and 105Q)-(15-125)human interleukin-3 (SEQ ID NO:72);
(73G, 76A, 79R, 82V, 87S, 93S, 98T, 101A and 105Q)-(15-125)human interleukin-3 (SEQ ID NO:73);
(73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and 123E)-(15-125)human interleukin-3 (SEQ. ID. NO:76);
(73G, 76A, 79R, 82V, 87S, 93S, 98T, 101A, 105Q, 109E, 116V, 120Q and 123E)-(15-125)human interleukin-3 (SEQ ID NO:77);
(73G, 76A, 79R, 82V, 87S, 93S, 98T, 101A, 105Q, 109E, 116V, 117S, 120H and 123E)-(15-125)human interleukin-3 (SEQ ID NO:78);
(181, 25H, 29R, 32A, 37P, 42A, 45V, 51R, 55L, 60S, 62V, 67N and 69E)-(15-125)human interleukin-3 (SEQ ID NO:79);
(18I, 25H, 29R, 32N, 37P, 42S, 45M, 51R, 55T, 59L, 62V, 67H and 69E)-(15-125)human interleukin-3 (SEQ ID NO:80);
(18I, 25H, 29V, 32A, 37S, 42S, 45M, 51R, 55L, 59L, 62v, 67N and 69E)-(15-125)human interleukin-3 (SEQ ID NO:81);
(42D, 45M, 46S, 50D, 95R, 98I, 100R, 116W)-(15-125)human interleukin-3 (residues 3-113 of SEQ ID NO:263);
(42D, 45M, 46S, 98I, 100R, 116W)-(15-125)human interleukin-3 (SEQ ID NO:406);
(18I, 19A, 25H, 29R, 32N, 37P, 42S, 45V, 49D, 51R, 55T, 59L, 62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and 123E)-(15-125)human interleukin-3 (residues 3-113 of SEQ ID NO:276);
(18I, 19I, 25H, 29R, 32N, 37P, 42S, 45V, 49D, 51R, 55T, 59L, 62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and 123E)-(15-125)human interleukin-3 (residues 3-113 of SEQ ID NO:277);
(18I, 23A, 25H, 29V, 32A, 37S, 42S, 45M, 51R, 55L, 59L, 62V, 67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and 123E)-(15-125)human interleukin-3 (residues 3-113 of SEQ ID NO:278);
(18I, 23A, 25H, 29V, 32A, 37S, 42S, 45M, 51R, 55L, 59L, 62V, 67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 112Q, 116V, 120Q and 123E)-(15-125)human interleukin-3 (SEQ ID NO:279);
(18I, 25H, 29R, 32A, 37P, 42A, 45V, 51R, 55L, 60S, 62V, 67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V,)-(15-119)human interleukin-3 (residues 3-113 of SEQ ID NO:287);
(18I, 23A, 25H, 29R, 32A, 37P, 42D, 45V, 46S, 50D, 51R, 55L, 60S, 62V, 67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 112Q, 116V)-(15-119)human interleukin-3 (residues 3-113 of SEQ ID NO:289);
(18I, 25H, 29R, 32A, 37P, 42A, 45V, 51R, 55L, 60S, 62V, 67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 112Q, 116V)-(15-119)human interleukin-3 (residues 3-113 of SEQ ID NO:307);
(18I, 20P, 23A, 25H, 29I, 32N, 34S, 37S, 38A, 42S, 45V, 46S, 51R, 55T, 59L, 62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and 123E)-(15-125)human interleukin-3 (residues 3-113 of SEQ ID NO:317);
(18I, 23L, 25H, 29I, 32N, 34S, 37S, 38A, 42S, 45V, 46S, 51R, 55T, 59L, 62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and 123E)-(15-125)human interleukin-3 (residues 3-113 of SEQ ID NO:318);
(18I, 23A, 25H, 29I, 32N, 34S, 37S, 38A, 42S, 45V, 46S, 51R, 55T, 59L, 62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and 123E)-(15-125)human interleukin-3 (residues 3-113 of SEQ ID NO:319);
(18I, 19I, 20L, 23A, 25H, 29I, 32N, 34S, 37S, 38A, 42S, 45V, 46S, 51R, 55T, 59L, 62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and 123E)-(15-125)human interleukin-3 (residues 3-113 of SEQ ID NO:320);
(18I, 25H, 29R, 32N, 37P, 42S, 45M, 50D, 51S, 55T, 59L, 62P, 63H, 67Q, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and 123E)-(15-125)human interleukin-3 (residues 3-113 of SEQ ID NO:321);
(18I, 25H, 29R, 32N, 37P, 42S, 45M, 51R, 55T, 59L, 62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109L, 112Q, 116S, 120Q and 123E)-(15-125)human interleukin-3 (residues 3-113 of SEQ ID NO:322);
(18I, 25H, 29R, 32N, 37P, 42S, 45M, 51R, 55T, 59L, 62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109L, 112Q, 116S)-(15-118)human interleukin-3 (residues 3-113 of SEQ ID NO:323); and
said mutant human interleukin-3 polypeptide has increased cell proliferative activity compared to native human interleukin-3 in at least one assay selected from the group consisting of: AML cell proliferation, TF-1 cell proliferation and Methylcellulose assay;
(b) a polypeptide comprising an N-terminal methionine residue, alanine residue or methionine-alanine di-peptide immediately preceding said sequence according to (a);
(ii) removing hematopoietic cells from said patient;
(iii) administering to said patient cancer radiation therapy or chemotherapy; and
(iv) returning said hematopoietic cells to said patient.
104. The method according to claim 103, wherein said mutant human interleukin-3 polypeptide has at least three times greater cell proliferative activity compared to native human interleukin-3.
105. The method according to claim 103, wherein said mutant human interleukin-3 polypeptide has at least ten times greater cell proliferative activity compared to native human interleukin-3.
106. A method of treating a side effect of cancer chemotherapy or radiation therapy in a patient consisting of administering to said patient, a therapeutically effective amount of a mutant human interleukin-3 (hIL-3) polypeptide consisting of a modified hIL-3 amino acid sequence selected from the group consisting of:
(a) a sequence of (SEQ ID NO:15)
wherein;
Xaa at position 17 is Ser, Lys, Gly, Asp, Met, Gln, or Arg;
Xaa at position 18 is Asn, His, Leu, Ile, Phe, Arg, or Gln;
Xaa at position 19 is Met, Phe, Ile, Arg, Gly, Ala, or Cys;
Xaa at position 20 is Ile, Cys, Gln, Glu, Arg, Pro, or Ala;
Xaa at position 21 is Asp, Phe, Lys, Arg, Ala, Gly, Glu, Gln, Asn, Thr, Ser or Val;
Xaa at position 22 is Glu, Trp, Pro, Ser, Ala, His, Asp, Asn, Gln, Leu, Val or Gly;
Xaa at position 23 is Ile, Val, Ala, Leu, Gly, Trp, Lys, Phe, Ser, or Arg;
Xaa at position 24 is Ile, Gly, Val, Arg, Ser, Phe, or Leu;
Xaa at position 25 is Thr, His, Gly, Gln, Arg, Pro, or Ala;
Xaa at position 26 is His, Thr, Phe, Gly, Arg, Ala, or Trp;
Xaa at position 27 is Leu, Gly, Arg, Thr, Ser, or Ala;
Xaa at position 28 is Lys, Arg, Leu, Gln, Gly, Pro, Val or Trp;
Xaa at position 29 is Gln, Asn, Leu, Pro, Arg, or Val;
Xaa at position 30 is Pro, His, Thr, Gly, Asp, Gln, Ser, Leu, or Lys;
Xaa at position 31 is Pro, Asp, Gly, Ala, Arg, Leu, or Gln;
Xaa at position 32 is Leu, Val, Arg, Gln, Asn, Gly, Ala, or Glu;
Xaa at position 33 is Pro, Leu, Gln, Ala, Thr, or Glu;
Xaa at position 34 is Leu, Val, Gly, Ser, Lys, Glu, Gln, Thr, Arg, Ala, Phe, Ile or Met;
Xaa at position 35 is Leu, Ala, Gly, Asn, Pro, Gln, or Val;
Xaa at position 36 is Asp, Leu, or Val;
Xaa at position 37 is Phe, Ser, Pro, Trp, or Ile;
Xaa at position 38 is Asn, or Ala;
Xaa at position 40 is Leu, Trp, or Arg;
Xaa at position 41 is Asn, Cys, Arg, Leu, His, Met, or Pro;
Xaa at position 42 is Gly, Asp, Ser, Cys, Asn, Lys, Thr, Leu, Val, Glu, Phe, Tyr, Ile, Met or Ala;
Xaa at position 43 is Glu, Asn, Tyr, Leu, Phe, Asp, Ala, Cys, Gln, Arg, Thr, Gly or Ser;
Xaa at position 44 is Asp, Ser, Leu, Arg, Lys, Thr, Met, Trp, Glu, Asn, Gln, Ala or Pro;
Xaa at position 45 is Gln, Pro, Phe, Val, Met, Leu, Thr, Lys, Trp, Asp, Asn, Arg, Ser, Ala, Ile, Glu or His;
Xaa at position 46 is Asp, Phe, Ser, Thr, Cys, Glu, Asn, Gln, Lys, His, Ala, Tyr, Ile, Val or Gly;
Xaa at position 47 is Ile, Gly, Val, Ser, Arg, Pro, or His;
Xaa at position 48 is Leu, Ser, Cys, Arg, Ile, His, Phe, Glu, Lys, Thr, Ala, Met, Val or Asn;
Xaa at position 49 is Met, Arg, Ala, Gly, Pro, Asn, His, or Asp;
Xaa at position 50 is Glu, Leu, Thr, Asp, Tyr, Lys, Asn, Ser, Ala, Ile, Val, His, Phe, Met or Gln;
Xaa at position 51 is Asn, Arg, Met, Pro, Ser, Thr, or His;
Xaa at position 52 is Asn, His, Arg, Leu, Gly, Ser, or Thr;
Xaa at position 53 is Leu, Thr, Ala, Gly, Glu, Pro, Lys, Ser, or Met;
Xaa at position 54 is Arg, Asp, Ile, Ser, Val, Thr, Gln, Asn, Lys, His, Ala or Leu;
Xaa at position 55 is Arg, Thr, Val, Ser, Leu, or Gly;
Xaa at position 56 is Pro, Gly, Cys, Ser, Gln, Glu, Arg, His, Thr, Ala, Tyr, Phe, Leu, Val or Lys;
Xaa at position 57 is Asn or Gly;
Xaa at position 58 is Leu, Ser, Asp, Arg, Gln, Val, or Cys;
Xaa at position 59 is Glu, Tyr, His, Leu, Pro, or Arg;
Xaa at position 60 is Ala, Ser, Pro, Tyr, Asn, or Thr;
Xaa at position 61 is Phe, Asn, Glu, Pro, Lys, Arg, or Ser;
Xaa at position 62 is Asn, His, Val, Arg, Pro, Thr, Asp, or Ile;
Xaa at position 63 is Arg, Tyr, Trp, Ser, His, Pro, or Val;
Xaa at position 64 is Ala, Asn, Pro, Ser, or Lys;
Xaa at position 65 is Val, Thr, Pro, His, Leu, Phe, or Ser;
Xaa at position 66 is Lys, Ile, Arg, Val, Asn, Glu, or Ser;
Xaa at position 67 is Ser, Ala, Phe, Val, Gly, Asn, Ile, Pro, or His;
Xaa at position 68 is Leu, Val, Trp, Ser, Ile, Phe, Thr, or His;
Xaa at position 69 is Gln, Ala, Pro, Thr, Glu, Arg, Trp, Gly, or Leu;
Xaa at position 70 is Asn, Leu, Val, Trp, Pro, or Ala;
Xaa at position 71 is Ala, Met, Leu, Pro, Arg, Glu, Thr, Gln, Trp, or Asn;
Xaa at position 72 is Ser, Glu, Met, Ala, His, Asn, Arg, or Asp;
Xaa at position 73 is Ala, Glu, Asp, Leu, Ser, Gly, Thr, or Arg;
Xaa at position 74 is Ile, Met, Thr, Pro, Arg, Gly, Ala;
Xaa at position 75 is Glu, Lys, Gly, Asp, Pro, Trp, Arg, Ser, Gln, or Leu;
Xaa at position 76 is Ser, Val, Ala, Asn, Trp, Glu, Pro, Gly, or Asp;
Xaa at position 77 is Ile, Ser, Arg, Thr, or Leu;
Xaa at position 78 is Leu, Ala, Ser, Glu, Phe, Gly, or Arg;
Xaa at position 79 is Lys, Thr, Asn, Met, Arg, Ile, Gly, or Asp;
Xaa at position 80 is Asn, Trp, Val, Gly, Thr, Leu, Glu, or Arg;
Xaa at position 81 is Leu, Gln, Gly, Ala, Trp, Arg, Val, or Lys;
Xaa at position 82 is Leu, Gln, Lys, Trp, Arg, Asp, Glu, Asn, His, Thr, Ser, Ala, Tyr, Phe, Ile, Met or Val;
Xaa at position 83 is Pro, Ala, Thr, Trp, Arg, or Met;
Xaa at position 84 is Cys, Glu, Gly, Arg, Met, or Val;
Xaa at position 85 is Leu, Asn, Val, or Gln;
Xaa at position 86 is Pro, Cys, Arg, Ala, or Lys;
Xaa at position 87 is Leu, Ser, Trp, or Gly;
Xaa at position 88 is Ala, Lys, Arg, Val, or Trp;
Xaa at position 89 is Thr, Asp, Cys, Leu, Val, Glu, His, Asn, or Ser;
Xaa at position 90 is Ala, Pro, Ser, Thr, Gly, Asp, Ile, or Met;
Xaa at position 91 is Ala, Pro, Ser, Thr, Phe, Leu, Asp, or His;
Xaa at position 92 is Pro, Phe, Arg, Ser, Lys, His, Ala, Gly, Ile or Leu;
Xaa at position 93 is Thr, Asp, Ser, Asn, Pro, Ala, Leu, or Arg;
Xaa at position 94 is Arg, Ile, Ser, Glu, Leu, Val, Gln, Lys, His, Ala, or Pro;
Xaa at position 95 is His, Gln, Pro, Arg, Val, Leu, Gly, Thr, Asn, Lys, Ser, Ala, Trp, Phe, Ile, or Tyr;
Xaa at position 96 is Pro, Lys, Tyr, Gly, Ile, or Thr;
Xaa at position 97 is Ile, Val, Lys, Ala, or Asn;
Xaa at position 98 is His, Ile, Asn, Leu, Asp, Ala, Thr, Glu, Gln, Ser, Phe, Met, Val, Lys, Tyr or Pro;
Xaa at position 99 is Ile, Leu, Arg, Asp, Val, Pro, Gln, Gly, Ser, Phe, or His;
Xaa at position 100 is Lys, Tyr, Leu, His, Arg, Ile, Ser, Gln, or Pro;
Xaa at position 101 is Asp;
Xaa at position 102 is Gly, Leu, Glu, Lys, Ser, Tyr, or Pro;
Xaa at position 103 is Asp, or Ser;
Xaa at position 104 is Trp, Val, Cys, Tyr, Thr, Met, Pro, Leu, Gln, Lys, Ala, Phe, or Gly;
Xaa at position 105 is Asn, Pro, Ala, Phe, Ser, Trp, Gln, Tyr, Leu, Lys, Ile, Asp, or His;
Xaa at position 106 is Glu, Ser, Ala, Lys, Thr, Ile, Gly, or Pro;
Xaa at position 108 is Arg, Lys, Asp, Leu, Thr, Ile, Gln, His, Ser, Ala or Pro;
Xaa at position 109 is Arg, Thr, Pro, Glu, Tyr, Leu, Ser, or Gly;
Xaa at position 110 is Lys, Ala, Asn, Thr, Leu, Arg, Gln, His, Glu, Ser, Ala, or Trp;
Xaa at position Ill is Leu, Ile, Arg, Asp, or Met;
Xaa at position 112 is Thr, Val, Gln, Tyr, Glu, His, Ser, or Phe;
Xaa at position 113 is Phe, Ser, Cys, His, Gly, Trp, Tyr, Asp, Lys, Leu, Ile, Val or Asn;
Xaa at position 114 is Tyr, Cys, His, Ser, Trp, Arg, or Leu;
Xaa at position 115 is Leu, Asn, Val, Pro, Arg, Ala, His, Thr, Trp, or Met;
Xaa at position 116 is Lys;
Xaa at position 117 is Thr, Ser, Asn, Ile, Trp, Lys, or Pro;
Xaa at position 118 is Leu, Ser, Pro, Ala, Glu, Cys, Asp, or Tyr;
Xaa at position 119 is Glu, Ser, Lys, Pro, Leu, Thr, Tyr, or Arg;
Xaa at position 120 is Asn, Ala, Pro, Leu, His, Val, or Gln;
Xaa at position 121 is Ala, Ser, Ile, Asn, Pro, Lys, Asp, or Gly;
Xaa at position 122 is Gln, Ser, Met, Trp, Arg, Phe, Pro, His, Ile, Tyr, or Cys;
Xaa at position 123 is Ala, Met, Glu, His, Ser, Pro, Tyr, or Leu;
wherein from 4 to about 44 of the amino acids designated by Xaa are different from the corresponding amino acids of native (1-133) human interleukin-3 with the proviso that no more than one of the amino acids at positions 63, 82, 87, 98, 112, and 121 are different from the corresponding amino acids in native human interleukin-3; and wherein from 1 to 14 amino acids are optionally deleted from the N-terminus and/or from 1 to 15 amino acids are optionally deleted from the C-terminus; and said mutant human interleukin-3 polypeptide has increased cell proliferative activity compared to native human interleukin-3 in at least one assay selected from the group consisting of: AML cell proliferation, TF-1 cell proliferation and Methylcellulose assay; and
(b) a polypeptide consisting of an N-terminal methionine residue, alanine residue or methionine-alanine di-peptide immediately preceding said sequence according to (a).
107. The method according to claim 106, wherein said mutant human interleukin-3 polypeptide has at least three times greater cell proliferative activity compared to native human interleukin-3.
108. The method according to claim 106, wherein said mutant human interleukin-3 polypeptide has at least ten times greater cell proliferative activity compared to native human interleukin-3.
109. A method of treating a side effect of cancer chemotherapy or radiation therapy in a patient consisting of administering to said patient, a therapeutically effective amount of a mutant human interleukin-3 (hIL-3) polypeptide consisting of a modified hIL-3 amino acid sequence selected from the group consisting of:
(a) a sequence of (SEQ ID NO:17)
wherein;
Xaa at position 17 is Ser, Gly, Asp, Met, or Gln;
Xaa at position 18 is Asn, His, or Ile;
Xaa at position 19 is Met or Ile;
Xaa at position 21 is Asp or Glu;
Xaa at position 23 is Ile, Ala, Leu, or Gly;
Xaa at position 24 is Ile, Val, or Leu;
Xaa at position 25 is Thr, His, Gln, or Ala;
Xaa at position 26 is His or Ala;
Xaa at position 29 is Gln, Asn, or Val;
Xaa at position 30 is Pro, Gly, or Gln;
Xaa at position 31 is Pro, Asp, Gly, or Gln;
Xaa at position 32 is Leu, Arg, Gln, Asn, Gly, Ala, or Glu;
Xaa at position 33 is Pro or Glu;
Xaa at position 34 is Leu, Val, Gly, Ser, Lys, Ala, Arg, Gln, Glu, Ile, Phe, Thr or Met;
Xaa at position 35 is Leu, Ala, Asn, Pro, Gln, or Val;
Xaa at position 37 is Phe, Ser, Pro, or Trp;
Xaa at position 38 is Asn or Ala;
Xaa at position 42 is Gly, Asp, Ser, Cys, Ala, Asn, Ile, Leu, Met, Tyr or Arg;
Xaa at position 44 is Asp or Glu;
Xaa at position 45 is Gln, Val, Met, Leu, Thr, Ala, Asn, Glu, Ser or Lys;
Xaa at position 46 is Asp, Phe, Ser, Thr, Ala, Asn, Gln, Glu, His, Ile, Lys, Tyr, Val or Cys;
Xaa at position 50 is Glu, Ala, Asn, Ser or Asp;
Xaa at position 51 is Asn, Arg, Met, Pro, Ser, Thr, or His;
Xaa at position 54 is Arg or Ala;
Xaa at position 55 is Arg, Thr, Val, Leu, or Gly;
Xaa at position 56 is Pro, Gly, Ser, Gln, Ala, Arg, Asn, Glu, Leu, Thr, Val or Lys;
Xaa at position 60 is Ala or Ser;
Xaa at position 62 is Asn, Pro, Thr, or Ile;
Xaa at position 63 is Arg;
Xaa at position 64 is Ala or Asn;
Xaa at position 65 is Val or Thr;
Xaa at position 66 is Lys or Arg;
Xaa at position 67 is Ser, Phe, or His;
Xaa at position 68 is Leu, Ile, Phe, or His;
Xaa at position 69 is Gln, Ala, Pro, Thr, Glu, Arg, or Gly;
Xaa at position 71 is Ala, Pro, or Arg;
Xaa at position 72 is Ser, Glu, Arg, or Asp;
Xaa at position 73 is Ala or Leu;
Xaa at position 76 is Ser, Val, Ala, Asn, Glu, Pro, or Gly;
Xaa at position 77 is Ile or Leu;
Xaa at position 79 is Lys, Thr, Gly, Asn, Met, Arg, Ile, or Asp;
Xaa at position 80 is Asn, Gly, Glu, or Arg;
Xaa at position 82 is Leu, Gln, Trp, Arg, Asp, Ala, Asn, Glu, His, Ile, Met, Phe, Ser, Thr, Tyr or Val;
Xaa at position 83 is Pro or Thr;
Xaa at position 85 is Leu or Val;
Xaa at position 87 is Leu or Ser;
Xaa at position 88 is Ala or Trp;
Xaa at position 91 is Ala or Pro;
Xaa at position 93 is Thr, Asp, Ser, Pro, Ala, Leu, or Arg;
Xaa at position 95 is His, Pro, Arg, Val, Leu, Gly, Asn, Phe, Ser or Thr;
Xaa at position 96 is Pro or Tyr;
Xaa at position 97 is Ile or Val;
Xaa at position 98 is His, Ile, Asn, Leu, Ala, Thr, Gln, Lys, Met, Ser, Tyr, Val or Pro;
Xaa at position 99 is Ile, Leu, or Val;
Xaa at position 100 is Lys, Arg, Ile, Gln, Pro, or Ser;
Xaa at position 101 is Asp;
Xaa at position 104 is Trp or Leu;
Xaa at position 105 is Asn, Pro, Ala, Ser, Trp, Gln, Tyr, Leu, Lys, Ile, Asp, or His;
Xaa at position 106 is Glu or Gly;
Xaa at position 108 is Arg, Ala, or Ser;
Xaa at position 109 is Arg, Thr, Glu, Leu, or Ser;
Xaa at position 112 is Thr, Val, or Gln;
Xaa at position 114 is Tyr or Trp;
Xaa at position 115 is Leu or Ala;
Xaa at position 116 is Lys;
Xaa at position 117 is Thr or Ser;
Xaa at position 120 is Asn, Pro, Leu, His, Val, or Gln;
Xaa at position 121 is Ala, Ser, Ile, Asn, Pro, Asp, or Gly;
Xaa at position 122 is Gln, Ser, Met, Trp, Arg, Phe, Pro, His, Ile, Tyr, or Cys;
Xaa at position 123 is Ala, Met, Glu, His, Ser, Pro, Tyr, or Leu;
wherein from 4 to about 44 of the amino acids designated by Xaa are different from the corresponding amino acids of native (1-133) human interleukin-3 with the proviso that no more than one of the amino acids at positions 63, 82, 87, 98, 112, and 121 are different from the corresponding amino acids in native human interleukin-3; and wherein from 1 to 14 amino acids are optionally deleted from the N-terminus and/or from 1 to 15 amino acids are optionally deleted from the C-terminus; and said mutant human interleukin-3 polypeptide has increased cell proliferative activity compared to native human interleukin-3 in at least one assay selected from the group consisting of: AML cell proliferation, TF-1 cell proliferation and Methylcellulose assay; and
(b) a polypeptide consisting of an N-terminal methionine residue, alanine residue or methionine-alanine di-peptide immediately preceding said sequence according to (a).
110. The method according to claim 109, wherein said mutant human interleukin-3 polypeptide has at least three times greater cell proliferative activity compared to native human interleukin-3.
111. The method according to claim 109, wherein said mutant human interleukin-3 polypeptide has at least ten times greater cell proliferative activity compared to native human interleukin-3.
112. The method according to claim 109 wherein in said mutant human interleukin-3 (hIL-3) sequence the amino acids which differ from the corresponding residue in native human interleukin-3 are selected from the group consisting of:
position 42 wherein Xaa is Gly, Asp, Ser, Ile, Leu, Met, Tyr, or Ala;
position 45 wherein Xaa is Gln, Val, Met or Asn;
position 46 wherein Xaa is Asp, Ser, Gln, His or Val;
position 50 wherein Xaa is Glu or Asp;
position 51 wherein Xaa is Asn, Pro or Thr;
position 62 wherein Xaa is Asn or Pro;
position 76 wherein Xaa is Ser, or Pro;
position 82 wherein Xaa is Leu, Trp, Asp, Asn Glu, His, Phe, Ser or Tyr;
position 95 wherein Xaa is His, Arg, Thr, Asn or Ser;
position 98 wherein Xaa is His, Ile, Leu, Ala, Gln, Lys, Met, Ser, Tyr or Val;
position 100 wherein Xaa is Lys or Arg;
position 101 wherein Xaa is Asp;
position 105 wherein Xaa is Asn, or Pro;
position 108 wherein Xaa is Arg, Ala, or Ser;
position 116 wherein Xaa is Lys;
position 121 wherein Xaa is Ala, or Ile;
position 122 wherein Xaa is Gln, or Ile;
position 123 wherein Xaa is Ala, Met or Glu.
113. The method according to claim 112, wherein said mutant human interleukin-3 polypeptide has at least three times greater cell proliferative activity compared to native human interleukin-3.
114. The method according to claim 112, wherein said mutant human interleukin-3 polypeptide has at least ten times greater cell proliferative activity compared to native human interleukin-3.
115. A method of treating a side effect of cancer chemotherapy or radiation therapy in a patient consisting of administering to said patient, a therapeutically effective amount of a mutant human interleukin-3 (hIL-3) polypeptide consisting of a modified hIL-3 amino acid sequence selected from the group consisting of:
(a) a sequence of (SEQ ID NO:19)
wherein;
Xaa at position 3 is Ser, Lys, Gly, Asp, Met, Gln, or Arg;
Xaa at position 4 is Asn, His, Leu, Ile, Phe, Arg, or Gln;
Xaa at position 5 is Met, Phe, Ile, Arg, Gly, Ala, or Cys;
Xaa at position 6 is Ile, Cys, Gln, Glu, Arg, Pro, or Ala;
Xaa at position 7 is Asp, Phe, Lys, Arg, Ala, Gly, Glu, Gln, Asn, Thr, Ser or Val;
Xaa at position 8 is Glu, Trp, Pro, Ser, Ala, His, Asp, Asn, Gln, Leu, Val, or Gly;
Xaa at position 9 is Ile, Val, Ala, Leu, Gly, Trp, Lys, Phe, Ser, or Arg;
Xaa at position 10 is Ile, Gly, Val, Arg, Ser, Phe, or Leu;
Xaa at position 11 is Thr, His, Gly, Gln, Arg, Pro, or Ala;
Xaa at position 12 is His, Thr, Phe, Gly, Arg, Ala, or Trp;
Xaa at position 13 is Leu, Gly, Arg, Thr, Ser, or Ala;
Xaa at position 14 is Lys, Arg, Leu, Gln, Gly, Pro, Val or Trp;
Xaa at position 15 is Gln, Asn, Leu, Pro, Arg, or Val;
Xaa at position 16 is Pro, His, Thr, Gly, Asp, Gln, Ser, Leu, or Lys;
Xaa at position 17 is Pro, Asp, Gly, Ala, Arg, Leu, or Gln;
Xaa at position 18 is Leu, Val, Arg, Gln, Asn, Gly, Ala, or Glu;
Xaa at position 19 is Pro, Leu, Gln, Ala, Thr, or Glu;
Xaa at position 20 is Leu, Val, Gly, Ser, Lys, Glu, Gln, Thr, Arg, Ala, Phe, Ile or Met;
Xaa at position 21 is Leu, Ala, Gly, Asn, Pro, Gln, or Val;
Xaa at position 22 is Asp, Leu, or Val;
Xaa at position 23 is Phe, Ser, Pro, Trp, or Ile;
Xaa at position 24 is Asn, or Ala;
Xaa at position 26 is Leu, Trp, or Arg;
Xaa at position 27 is Asn, Cys, Arg, Leu, His, Met, Pro;
Xaa at position 28 is Gly, Asp, Ser, Cys, Ala, Lys, Asn, Thr, Leu, Val, Glu, Phe, Tyr, Ile or Met;
Xaa at position 29 is Glu, Asn, Tyr, Leu, Phe, Asp, Ala, Cys, Gln, Arg, Thr, Gly or Ser;
Xaa at position 30 is Asp, Ser, Leu, Arg, Lys, Thr, Met, Trp, Glu, Asn, Gln, Ala or Pro;
Xaa at position 31 is Gln, Pro, Phe, Val, Met, Leu, Thr, Lys, Asp, Asn, Arg, Ser, Ala, Ile, Glu, His or Trp;
Xaa at position 32 is Asp, Phe, Ser, Thr, Cys, Glu, Asn, Gln, Lys, His, Ala, Tyr, Ile, Val or Gly;
Xaa at position 33 is Ile, Gly, Val, Ser, Arg, Pro, or His;
Xaa at position 34 is Leu, Ser, Cys, Arg, Ile, His, Phe, Glu, Lys, Thr, Ala, Met, Val or Asn;
Xaa at position 35 is Met, Arg, Ala, Gly, Pro, Asn, His, or Asp;
Xaa at position 36 is Glu, Leu, Thr, Asp, Tyr, Lys, Asn, Ser, Ala, Ile, Val, His, Phe, Met or Gln;
Xaa at position 37 is Asn, Arg, Met, Pro, Ser, Thr, or His;
Xaa at position 38 is Asn, His, Arg, Leu, Gly, Ser, or Thr;
Xaa at position 39 is Leu, Thr, Ala, Gly, Glu, Pro, Lys, Ser, or Met;
Xaa at position 40 is Arg, Asp, Ile, Ser, Val, Thr, Gln, Asn, Lys, His, Ala or Leu;
Xaa at position 41 is Arg, Thr, Val, Ser, Leu, or Gly;
Xaa at position 42 is Pro, Gly, Cys, Ser, Gln, Glu, Arg, His, Thr, Ala, Tyr, Phe, Leu, Val or Lys;
Xaa at position 43 is Asn or Gly;
Xaa at position 44 is Leu, Ser, Asp, Arg, Gln, Val, or Cys;
Xaa at position 45 is Glu, Tyr, His, Leu, Pro, or Arg;
Xaa at position 46 is Ala, Ser, Pro, Tyr, Asn, or Thr;
Xaa at position 47 is Phe, Asn, Glu, Pro, Lys, Arg, or Ser;
Xaa at position 48 is Asn, His, Val, Arg, Pro, Thr, Asp, or Ile;
Xaa at position 49 is Arg, Tyr, Trp, Ser, His, Pro, or Val;
Xaa at position 50 is Ala, Asn, Pro, Ser, or Lys;
Xaa at position 51 is Val, Thr, Pro, His, Leu, Phe, or Ser;
Xaa at position 52 is Lys, Ile, Arg, Val, Asn, Glu, or Ser;
Xaa at position 53 is Ser, Ala, Phe, Val, Gly, Asn, Ile, Pro, or His;
Xaa at position 54 is Leu, Val, Trp, Ser, Ile, Phe, Thr, or His;
Xaa at position 55 is Gln, Ala, Pro, Thr, Glu, Arg, Trp, Gly, or Leu;
Xaa at position 56 is Asn, Leu, Val, Trp, Pro, or Ala;
Xaa at position 57 is Ala, Met, Leu, Pro, Arg, Glu, Thr, Gln, Trp, or Asn;
Xaa at position 58 is Ser, Glu, Met, Ala, His, Asn, Arg, or Asp;
Xaa at position 59 is Ala, Glu, Asp, Leu, Ser, Gly, Thr, or Arg;
Xaa at position 60 is Ile, Met, Thr, Pro, Arg, Gly, Ala;
Xaa at position 61 is Glu, Lys, Gly, Asp, Pro, Trp, Arg, Ser, Gln, or Leu;
Xaa at position 62 is Ser, Val, Ala, Asn, Trp, Glu, Pro, Gly, or Asp;
Xaa at position 63 is Ile, Ser, Arg, Thr, or Leu;
Xaa at position 64 is Leu, Ala, Ser, Glu, Phe, Gly, or Arg;
Xaa at position 65 is Lys, Thr, Gly, Asn, Met, Arg, Ile, or Asp;
Xaa at position 66 is Asn, Trp, Val, Gly, Thr, Leu, Glu, or Arg;
Xaa at position 67 is Leu, Gln, Gly, Ala, Trp, Arg, Val, or Lys;
Xaa at position 68 is Leu, Gln, Lys, Trp, Arg, Asp, Glu, Asn, His, Thr, Ser, Ala, Tyr, Phe, Ile, Met or Val;
Xaa at position 69 is Pro, Ala, Thr, Trp, Arg, or Met;
Xaa at position 70 is Cys, Glu, Gly, Arg, Met, or Val;
Xaa at position 71 is Leu, Asn, Val, or Gln;
Xaa at position 72 is Pro, Cys, Arg, Ala, or Lys;
Xaa at position 73 is Leu, Ser, Trp, or Gly;
Xaa at position 74 is Ala, Lys, Arg, Val, or Trp;
Xaa at position 75 is Thr, Asp, Cys, Leu, Val, Glu, His, Asn, or Ser;
Xaa at position 76 is Ala, Pro, Ser, Thr, Gly, Asp, Ile, or Met;
Xaa at position 77 is Ala, Pro, Ser, Thr, Phe, Leu, Asp, or His;
Xaa at position 78 is Pro, Phe, Arg, Ser, Lys, His, Ala, Gly, Ile or Leu;
Xaa at position 79 is Thr, Asp, Ser, Asn, Pro, Ala, Leu, or Arg;
Xaa at position 80 is Arg, Ile, Ser, Glu, Leu, Val, Gln, Lys, His, Ala or Pro;
Xaa at position 81 is His, Gln, Pro, Arg, Val, Leu, Gly, Thr, Asn, Lys, Ser, Ala, Trp, Phe, Ile or Tyr;
Xaa at position 82 is Pro, Lys, Tyr, Gly, Ile, or Thr;
Xaa at position 83 is Ile, Val, Lys, Ala, or Asn;
Xaa at position 84 is His, Ile, Asn, Leu, Asp, Ala, Thr, Glu, Gln, Ser, Phe, Met, Val, Lys, Tyr or Pro;
Xaa at position 85 is Ile, Leu, Arg, Asp, Val, Pro, Gln, Gly, Ser, Phe, or His;
Xaa at position 86 is Lys, Tyr, Leu, His, Arg, Ile, Ser, Gln, or Pro;
Xaa at position 87 is Asp;
Xaa at position 88 is Gly, Leu, Glu, Lys, Ser, Tyr, or Pro;
Xaa at position 89 is Asp, or Ser;
Xaa at position 90 is Trp, Val, Cys, Tyr, Thr, Met, Pro, Leu, Gln, Lys, Ala, Phe, or Gly;
Xaa at position 91 is Asn, Pro, Ala, Phe, Ser, Trp, Gln, Tyr, Leu, Lys, Ile, Asp, or His;
Xaa at position 92 is Glu, Ser, Ala, Lys, Thr, Ile, Gly, or Pro;
Xaa at position 94 is Arg, Lys, Asp, Leu, Thr, Ile, Gln, His, Ser, Ala, or Pro;
Xaa at position 95 is Arg, Thr, Pro, Glu, Tyr, Leu, Ser, or Gly;
Xaa at position 96 is Lys, Asn, Thr, Leu, Gln, Arg, His, Glu, Ser, Ala or Trp;
Xaa at position 97 is Leu, Ile, Arg, Asp, or Met;
Xaa at position 98 is Thr, Val, Gln, Tyr, Glu, His, Ser, or Phe;
Xaa at position 99 is Phe, Ser, Cys, His, Gly, Trp, Tyr, Asp, Lys, Leu, Ile, Val or Asn;
Xaa at position 100 is Tyr, Cys, His, Ser, Trp, Arg, or Leu;
Xaa at position 101 is Leu, Asn, Val, Pro, Arg, Ala, His, Thr, Trp, or Met;
Xaa at position 102 is Lys;
Xaa at position 103 is Thr, Ser, Asn, Ile, Trp, Lys, or Pro;
Xaa at position 104 is Leu, Ser, Pro, Ala, Glu, Cys, Asp, or Tyr;
Xaa at position 105 is Glu, Ser, Lys, Pro, Leu, Thr, Tyr, or Arg;
Xaa at position 106 is Asn, Ala, Pro, Leu, His, Val, or Gln;
Xaa at position 107 is Ala, Ser, Ile, Asn, Pro, Lys, Asp, or Gly;
Xaa at position 108 is Gln, Ser, Met, Trp, Arg, Phe, Pro, His, Ile, Tyr, or Cys;
Xaa at position 109 is Ala, Met, Glu, His, Ser, Pro, Tyr, or Leu;
wherein from 4 to about 44 of the amino acids designated by Xaa are different from the corresponding native amino acids of (1-133) human interleukin-3 with the proviso that no more than one of the amino acids at positions 49, 68, 73, 84, 98, and 107 are different from the corresponding amino acids in native human interleukin-3; and said mutant human interleukin-3 polypeptide has increased cell proliferative activity compared to native human interleukin-3 in at least one assay selected from the group consisting of: AML cell proliferation, TF-1 cell proliferation and Methylcellulose assay; and
(b) a polypeptide consisting of an N-terminal methionine residue, alanine residue or methionine-alanine di-peptide immediately preceding said sequence according to (a).
116. The method according to claim 115, wherein said mutant human interleukin-3 polypeptide has at least three times greater cell proliferative activity compared to native human interleukin-3.
117. The method according to claim 115, wherein said mutant human interleukin-3 polypeptide has at least ten times greater cell proliferative activity compared to native human interleukin-3.
118. A method of treating a side effect of cancer chemotherapy or radiation therapy in a patient consisting of administering to said patient, a therapeutically effective amount of a mutant human interleukin-3 (hIL-3) polypeptide consisting of a modified hIL-3 amino acid sequence selected from the group consisting of:
(a) a sequence of (SEQ ID NO:21)
wherein;
Xaa at position 3 is Ser, Gly, Asp, Met, or Gln;
Xaa at position 4 is Asn, His, or Ile;
Xaa at position 5 is Met or Ile;
Xaa at position 7 is Asp or Glu;
Xaa at position 9 is Ile, Ala, Leu, or Gly;
Xaa at position 10 is Ile, Val, or Leu;
Xaa at position 11 is Thr, His, Gln, or Ala;
Xaa at position 12 is His or Ala;
Xaa at position 15 is Gln, Asn, or Val;
Xaa at position 16 is Pro, Gly, or Gln;
Xaa at position 17 is Pro, Asp, Gly, or Gln;
Xaa at position 18 is Leu, Arg, Gln, Asn, Gly, Ala, or Glu;
Xaa at position 19 is Pro or Glu;
Xaa at position 20 is Leu, Val, Gly, Ser, Lys, Ala, Arg, Gln, Glu, Ile, Phe, Thr or Met;
Xaa at position 21 is Leu, Ala, Asn, Pro, Gln, or Val;
Xaa at position 23 is Phe, Ser, Pro, or Trp;
Xaa at position 24 is Asn or Ala;
Xaa at position 28 is Gly, Asp, Ser, Cys, Ala, Asn, Ile, Leu, Met Tyr or Arg;
Xaa at position 30 is Asp or Glu;
Xaa at position 31 is Gln, Val, Met, Leu, Thr, Ala, Asn, Glu, Ser or Lys;
Xaa at position 32 is Asp, Phe, Ser, Thr, Ala, Asn, Gln, Glu, His, Ile, Lys, Tyr, Val or Cys;
Xaa at position 36 is Glu, Ala, Asn, Ser or Asp;
Xaa at position 37 is Asn, Arg, Met, Pro, Ser, Thr, or His;
Xaa at position 40 is Arg or Ala;
Xaa at position 41 is Arg, Thr, Val, Leu, or Gly;
Xaa at position 42 is Pro, Gly, Ser, Gln, Ala, Arg, Asn, Glu, Leu, Thr, Val or Lys;
Xaa at position 46 is Ala or Ser;
Xaa at position 48 is Asn, Pro, Thr, or Ile;
Xaa at position 49 is Arg;
Xaa at position 50 is Ala or Asn;
Xaa at position 51 is Val or Thr;
Xaa at position 52 is Lys or Arg;
Xaa at position 53 is Ser, Phe, or His;
Xaa at position 54 is Leu, Ile, Phe, or His;
Xaa at position 55 is Gln, Ala, Pro, Thr, Glu, Arg, or Gly;
Xaa at position 57 is Ala, Pro, or Arg;
Xaa at position 58 is Ser, Glu, Arg, or Asp;
Xaa at position 59 is Ala or Leu;
Xaa at position 62 is Ser, Val, Ala, Asn, Glu, Pro, or Gly;
Xaa at position 63 is Ile or Leu;
Xaa at position 65 is Lys, Thr, Gly, Asn, Met, Arg, Ile, or Asp;
Xaa at position 66 is Asn, Gly, Glu, or Arg;
Xaa at position 68 is Leu, Gln, Trp, Arg, Asp, Ala, Asn, Glu, His, Ile, Met, Phe, Ser, Thr, Tyr or Val;
Xaa at position 69 is Pro or Thr;
Xaa at position 71 is Leu or Val;
Xaa at position 73 is Leu or Ser;
Xaa at position 74 is Ala or Trp;
Xaa at position 77 is Ala or Pro;
Xaa at position 79 is Thr, Asp, Ser, Pro, Ala, Leu, or Arg;
Xaa at position 81 is His, Pro, Arg, Val, Leu, Gly, Asn, Phe, Ser or Thr;
Xaa at position 82 is Pro or Tyr;
Xaa at position 83 is Ile or Val;
Xaa at position 84 is His, Ile, Asn, Leu, Ala, Thr, Gln, Lys, Met, Ser, Tyr, Val or Pro;
Xaa at position 85 is Ile, Leu, or Val;
Xaa at position 86 is Lys, Arg, Ile, Gln, Pro, or Ser;
Xaa at position 87 is Asp;
Xaa at position 90 is Trp or Leu;
Xaa at position 91 is Asn, Pro, Ala, Ser, Trp, Gln, Tyr, Leu, Lys, Ile, Asp, or His;
Xaa at position 92 is Glu, or Gly;
Xaa at position 94 is Arg, Ala, or Ser;
Xaa at position 95 is Arg, Thr, Glu, Leu, or Ser;
Xaa at position 98 is Thr, Val, or Gln;
Xaa at position 100 is Tyr or Trp;
Xaa at position 101 is Leu or Ala;
Xaa at position 102 is Lys;
Xaa at position 103 is Thr or Ser;
Xaa at position 106 is Asn, Pro, Leu, His, Val, or Gln;
Xaa at position 107 is Ala, Ser, Ile, Asn, Pro, Asp, or Gly;
Xaa at position 108 is Gln, Ser, Met, Trp, Arg, Phe, Pro, His, Ile, Tyr, or Cys;
Xaa at position 109 is Ala, Met, Glu, His, Ser, Pro, Tyr, or Leu;
wherein from 4 to about 44 of the amino acids designated by Xaa are different from the corresponding amino acids of native (1-133) human interleukin-3 with the proviso that no more than one of the amino acids at positions 49, 68, 73, 84, 98, and 107 are different from the corresponding amino acids in native human interleukin-3; and said mutant human interleukin-3 polypeptide has increased cell proliferative activity compared to native human interleukin-3 in at least one assay selected from the group consisting of: AML cell proliferation, TF-1 cell proliferation and Methylcellulose assay; and
(b) a polypeptide consisting of an N-terminal methionine residue, alanine residue or methionine-alanine di-peptide immediately preceding said sequence according to (a).
119. The method according to claim 118, wherein said mutant human interleukin-3 polypeptide has at least three times greater cell proliferative activity compared to native human interleukin-3.
120. The method according to claim 118, wherein said mutant human interleukin-3 polypeptide has at least ten times greater cell proliferative activity compared to native human interleukin-3.
121. The method according to claim 118, wherein in said mutant human interleukin-3 (hIL-3) sequence the amino acids which differ from the corresponding residue in native human interleukin-3 are selected from the group consisting of:
position 28 wherein Xaa is Gly, Asp, Ser, Ile, Leu, Met, Tyr, or Ala;
position 31 wherein Xaa is Gln, Val, Met or Asn;
position 32 wherein Xaa is Asp, Ser, Ala, Gln, His or Val;
position 36 wherein Xaa is Glu or Asp;
position 37 wherein Xaa is Asn, Pro or Thr;
position 48 wherein Xaa is Asn or Pro;
position 62 wherein Xaa is Ser, or Pro;
position 68 wherein Xaa is Leu, Trp, Asp, Asn, Glu, His, Phe, Ser or Tyr;
position 81 wherein Xaa is His, Arg, Thr, Asn or Ser;
position 84 wherein Xaa is His, Ile, Leu, Ala, Arg, Gln, Lys, Met, Ser, Tyr or Val;
position 86 wherein Xaa is Lys or Arg;
position 87 wherein Xaa is Asp;
position 91 wherein Xaa is Asn, or Pro;
position 94 wherein Xaa is Arg, Ala, or Ser;
position 102 wherein Xaa is Lys;
position 107 wherein Xaa is Ala, or Ile;
position 108 wherein Xaa is Gln, or Ile;
position 109 wherein Xaa is Ala, Met or Glu.
122. The method according to claim 121, wherein said mutant human interleukin-3 polypeptide has at least three times greater cell proliferative activity compared to native human interleukin-3.
123. The method according to claim 121, wherein said mutant human interleukin-3 polypeptide has at least ten times greater cell proliferative activity compared to native human interleukin-3.
124. A method of treating a side effect of cancer chemotherapy or radiation therapy in a patient consisting of administering to said patient, a therapeutically effective amount of a mutant human interleukin-3 (hIL-3) polypeptide consisting of a modified hIL-3 amino acid sequence selected from the group consisting of:
(a) a polypeptide selected from the group consisting of:
(18I, 25H, 29R, 32A, 37P, 42A and 45V)-(15-125)human interleukin-3 (SEQ ID NO:66);
(18I, 25H, 29R, 32N, 37P, 42S and 45M)-(15-125)human interleukin-3 (SEQ ID NO:67);
(18I, 25H, 29V, 32A, 37S, 42S and 45M)-(15-125)human interleukin-3 (SEQ ID NO:68);
(51R, 55L, 59L, 62V, 67N and 69E)-(15-125)human interleukin-3 (SEQ ID NO:69);
(51R, 55L, 60S, 62V, 67N and 69E)-(15-125)human interleukin-3 (SEQ ID NO:70);
(51R, 55T, 59L, 62V, 67H and 69E)-(15-125)human interleukin-3 (SEQ ID NO:71);
(73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A and 105Q)-(15-125)human interleukin-3 (SEQ ID NO:72);
(73G, 76A, 79R, 82V, 87S, 93S, 98T, 101A and 105Q)-(15-125)human interleukin-3 (SEQ ID NO:73);
(73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and 123E)-(15-125)human interleukin-3 (SEQ. ID. NO:76);
(73G, 76A, 79R, 82V, 87S, 93S, 98T, 101A, 105Q, 109E, 116V, 120Q and 123E)-(15-125)human interleukin-3 (SEQ ID NO:77);
(73G, 76A, 79R, 82V, 87S, 93S, 98T, 101A, 105Q, 1O9E, 116V, 117S, 120H and 123E)-(15-125)human interleukin-3 (SEQ ID NO:78);
(18I, 25H, 29R, 32A, 37P, 42A, 45V, 51R, 55L, 60S, 62V, 67N and 69E)-(15-125)human interleukin-3 (SEQ ID NO:79);
(18I, 25H, 29R, 32N, 37P, 42S, 45M, 51R, 55T, 59L, 62V, 67H and 69E)-(15-125)human interleukin-3 (SEQ ID NO:80);
(18I, 25H, 29V, 32A, 37S, 42S, 45M, 51R, 55L, 59L, 62V, 67N and 69E)-(15-125)human interleukin-3 (SEQ ID NO:81);
(42D, 45M, 46S, 50D, 95R, 98I, 100R, 116W)-(15-125)human interleukin-3 (residues 3-113 of SEQ ID NO:263);
(42D, 45M, 46S, 98I, 100R, 116W)-(15-125)human interleukin-3 (SEQ ID NO:406);
(18I, 19A, 25H, 29R, 32N, 37P, 42S, 45V, 49D, 51R, 55T, 59L, 62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and 123E)-(15-125)human interleukin-3 (residues 3-113 of SEQ ID NO:276);
(18I, 19I, 25H, 29R, 32N, 37P, 42S, 45V, 49D, 51R, 55T, 59L, 62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and 123E)-(15-125)human interleukin-3 (residues 3-113 of SEQ ID NO:277);
(18I, 23A, 25H, 29V, 32A, 37S, 42S, 45M, 51R, 55L, 59L, 62V, 67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 1O9E, 116V, 120Q and 123E)-(15-125)human interleukin-3 (residues 3-113 of SEQ ID NO:278);
(18I, 23A, 25H, 29V, 32A, 37S, 42S, 45M, 51R, 55L, 59L, 62V, 67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 112Q, 116V, 120Q and 123E)-(15-125)human interleukin-3 (SEQ ID NO:279);
(18I, 25H, 29R, 32A, 37P, 42A, 45V, 51R, 55L, 60S, 62V, 67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V,)-(15-119)human interleukin-3 (residues 3-113 of SEQ ID NO:287);
(18I, 23A, 25H, 29R, 32A, 37P, 42D, 45V, 46S, 50D, 51R, 55L, 60S, 62V, 67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 112Q, 116V)-(15-119)human interleukin-3 (residues 3-113 of SEQ ID NO:289);
(18I, 25H, 29R, 32A, 37P, 42A, 45V, 51R, 55L, 60S, 62V, 67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 112Q, 116V)-(15-119)human interleukin-3 (residues 3-113 of SEQ ID NO:307);
(18I, 20P, 23A, 25H, 29I, 32N, 34S, 37S, 38A, 42S, 45V, 46S, 51R, 55T, 59L, 62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and 123E)-(15-125)human interleukin-3 (residues 3-113 of SEQ ID NO:317);
(18I, 23L, 25H, 29I, 32N, 34S, 37S, 38A, 42S, 45V, 46S, 51R, 55T, 59L, 62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and 123E)-(15-125)human interleukin-3 (residues 3-113 of SEQ ID NO:318);
(18I, 23A, 25H, 29I, 32N, 34S, 37S, 38A, 42S, 45V, 46S, 51R, 55T, 59L, 62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and 123E)-(15-125)human interleukin-3 (residues 3-113 of SEQ ID NO:319);
(18I, 19I, 20L, 23A, 25H, 29I, 32N, 34S, 37S, 38A, 42S, 45V, 46S, 51R, 55T, 59L, 62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and 123E)-(15-125)human interleukin-3 (residues 3-113 of SEQ ID NO:320);
(18I, 25H, 29R, 32N, 37P, 42S, 45M, 50D, 51S, 55T, 59L, 62P, 63H, 67Q, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and 123E)-(15-125)human interleukin-3 (residues 3-113 of SEQ ID NO:321);
(18I, 25H, 29R, 32N, 37P, 42S, 45M, 51R, 55T, 59L, 62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109L, 112Q, 116S, 120Q and 123E)-(15-125)human interleukin-3 (residues 3-113 of SEQ ID NO:322);
(18I, 25H, 29R, 32N, 37P, 42S, 45M, 51R, 55T, 59L, 62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109L, 112Q, 116S)-(15-118)human interleukin-3 (residues 3-113 of SEQ ID NO:323); and
said mutant human interleukin-3 polypeptide has increased cell proliferative activity compared to native human interleukin-3 in at least one assay selected from the group consisting of: AML cell proliferation, TF-1 cell proliferation and Methylcellulose assay;
(b) a polypeptide comprising an N-terminal methionine residue, alanine residue or methionine-alanine di-peptide immediately preceding said sequence according to (a).
125. The method according to claim 124, wherein said mutant human interleukin-3 polypeptide has at least three times greater cell proliferative activity compared to native human interleukin-3.
126. The method according to claim 124, wherein said mutant human interleukin-3 polypeptide has at least ten times greater cell proliferative activity compared to native human interleukin-3.
127. A method of treating a patient having an immunodeficiency or hematopoietic deficiency comprising administering to said patient, a therapeutically effective amount of a mutant human interleukin-3 (hIL-3) polypeptide comprising a modified hIL-3 amino acid sequence selected from the group consisting of:
(a) a sequence of (SEQ ID NO:15)
wherein;
Xaa at position 17 is Ser, Lys, Gly, Asp, Met, Gln, or Arg;
Xaa at position 18 is Asn, His, Leu, Ile, Phe, Arg, or Gln;
Xaa at position 19 is Met, Phe, Ile, Arg, Gly, Ala, or Cys;
Xaa at position 20 is Ile, Cys, Gln, Glu, Arg, Pro, or Ala;
Xaa at position 21 is Asp, Phe, Lys, Arg, Ala, Gly, Glu, Gln, Asn, Thr, Ser or Val;
Xaa at position 22 is Glu, Trp, Pro, Ser, Ala, His, Asp, Asn, Gln, Leu, Val or Gly;
Xaa at position 23 is Ile, Val, Ala, Leu, Gly, Trp, Lys, Phe, Ser, or Arg;
Xaa at position 24 is Ile, Gly, Val, Arg, Ser, Phe, or Leu;
Xaa at position 25 is Thr, His, Gly, Gln, Arg, Pro, or Ala;
Xaa at position 26 is His, Thr, Phe, Gly, Arg, Ala, or Trp;
Xaa at position 27 is Leu, Gly, Arg, Thr, Ser, or Ala;
Xaa at position 28 is Lys, Arg, Leu, Gln, Gly, Pro, Val or Trp;
Xaa at position 29 is Gln, Asn, Leu, Pro, Arg, or Val;
Xaa at position 30 is Pro, His, Thr, Gly, Asp, Gln, Ser, Leu, or Lys;
Xaa at position 31 is Pro, Asp, Gly, Ala, Arg, Leu, or Gln;
Xaa at position 32 is Leu, Val, Arg, Gln, Asn, Gly, Ala, or Glu;
Xaa at position 33 is Pro, Leu, Gln, Ala, Thr, or Glu;
Xaa at position 34 is Leu, Val, Gly, Ser, Lys, Glu, Gln, Thr, Arg, Ala, Phe, Ile or Met;
Xaa at position 35 is Leu, Ala, Gly, Asn, Pro, Gln, or Val;
Xaa at position 36 is Asp, Leu, or Val;
Xaa at position 37 is Phe, Ser, Pro, Trp, or Ile;
Xaa at position 38 is Asn, or Ala;
Xaa at position 40 is Leu, Trp, or Arg;
Xaa at position 41 is Asn, Cys, Arg, Leu, His, Met, or Pro;
Xaa at position 42 is Gly, Asp, Ser, Cys, Asn, Lys, Thr, Leu, Val, Glu, Phe, Tyr, Ile, Met or Ala;
Xaa at position 43 is Glu, Asn, Tyr, Leu, Phe, Asp, Ala, Cys, Gln, Arg, Thr, Gly or Ser;
Xaa at position 44 is Asp, Ser, Leu, Arg, Lys, Thr, Met, Trp, Glu, Asn, Gln, Ala or Pro;
Xaa at position 45 is Gln, Pro, Phe, Val, Met, Leu, Thr, Lys, Trp, Asp, Asn, Arg, Ser, Ala, Ile, Glu or His;
Xaa at position 46 is Asp, Phe, Ser, Thr, Cys, Glu, Asn, Gln, Lys, His, Ala, Tyr, Ile, Val or Gly;
Xaa at position 47 is Ile, Gly, Val, Ser, Arg, Pro, or His;
Xaa at position 48 is Leu, Ser, Cys, Arg, Ile, His, Phe, Glu, Lys, Thr, Ala, Met, Val or Asn;
Xaa at position 49 is Met, Arg, Ala, Gly, Pro, Asn, His, or Asp;
Xaa at position 50 is Glu, Leu, Thr, Asp, Tyr, Lys, Asn, Ser, Ala, Ile, Val, His, Phe, Met or Gln;
Xaa at position 51 is Asn, Arg, Met, Pro, Ser, Thr, or His;
Xaa at position 52 is Asn, His, Arg, Leu, Gly, Ser, or Thr;
Xaa at position 53 is Leu, Thr, Ala, Gly, Glu, Pro, Lys, Ser, or Met;
Xaa at position 54 is Arg, Asp, Ile, Ser, Val, Thr, Gln, Asn, Lys, His, Ala or Leu;
Xaa at position 55 is Arg, Thr, Val, Ser, Leu, or Gly;
Xaa at position 56 is Pro, Gly, Cys, Ser, Gln, Glu, Arg, His, Thr, Ala, Tyr, Phe, Leu, Val or Lys;
Xaa at position 57 is Asn or Gly;
Xaa at position 58 is Leu, Ser, Asp, Arg, Gln, Val, or Cys;
Xaa at position 59 is Glu, Tyr, His, Leu, Pro, or Arg;
Xaa at position 60 is Ala, Ser, Pro, Tyr, Asn, or Thr;
Xaa at position 61 is Phe, Asn, Glu, Pro, Lys, Arg, or Ser;
Xaa at position 62 is Asn, His, Val, Arg, Pro, Thr, Asp, or Ile;
Xaa at position 63 is Arg, Tyr, Trp, Ser, His, Pro, or Val;
Xaa at position 64 is Ala, Asn, Pro, Ser, or Lys;
Xaa at position 65 is Val, Thr, Pro, His, Leu, Phe, or Ser;
Xaa at position 66 is Lys, Ile, Arg, Val, Asn, Glu, or Ser;
Xaa at position 67 is Ser, Ala, Phe, Val, Gly, Asn, Ile, Pro, or His;
Xaa at position 68 is Leu, Val, Trp, Ser, Ile, Phe, Thr, or His;
Xaa at position 69 is Gln, Ala, Pro, Thr, Glu, Arg, Trp, Gly, or Leu;
Xaa at position 70 is Asn, Leu, Val, Trp, Pro, or Ala;
Xaa at position 71 is Ala, Met, Leu, Pro, Arg, Glu, Thr, Gln, Trp, or Asn;
Xaa at position 72 is Ser, Glu, Met, Ala, His, Asn, Arg, or Asp;
Xaa at position 73 is Ala, Glu, Asp, Leu, Ser, Gly, Thr, or Arg;
Xaa at position 74 is Ile, Met, Thr, Pro, Arg, Gly, Ala;
Xaa at position 75 is Glu, Lys, Gly, Asp, Pro, Trp, Arg, Ser, Gin, or Leu;
Xaa at position 76 is Ser, Val, Ala, Asn, Trp, Glu, Pro, Gly, or Asp;
Xaa at position 77 is Ile, Ser, Arg, Thr, or Leu;
Xaa at position 78 is Leu, Ala, Ser, Glu, Phe, Gly, or Arg;
Xaa at position 79 is Lys, Thr, Asn, Met, Arg, Ile, Gly, or Asp;
Xaa at position 80 is Asn, Trp, Val, Gly, Thr, Leu, Glu, or Arg;
Xaa at position 81 is Leu, Gln, Gly, Ala, Trp, Arg, Val, or Lys;
Xaa at position 82 is Leu, Gln, Lys, Trp, Arg, Asp, Glu, Asn, His, Thr, Ser, Ala, Tyr, Phe, Ile, Met or Val;
Xaa at position 83 is Pro, Ala, Thr, Trp, Arg, or Met;
Xaa at position 84 is Cys, Glu, Gly, Arg, Met, or Val;
Xaa at position 85 is Leu, Asn, Val, or Gln;
Xaa at position 86 is Pro, Cys, Arg, Ala, or Lys;
Xaa at position 87 is Leu, Ser, Trp, or Gly;
Xaa at position 88 is Ala, Lys, Arg, Val, or Trp;
Xaa at position 89 is Thr, Asp, Cys, Leu, Val, Glu, His, Asn, or Ser;
Xaa at position 90 is Ala, Pro, Ser, Thr, Gly, Asp, Ile, or Met;
Xaa at position 91 is Ala, Pro, Ser, Thr, Phe, Leu, Asp, or His;
Xaa at position 92 is Pro, Phe, Arg, Ser, Lys, His, Ala, Gly, Ile or Leu;
Xaa at position 93 is Thr, Asp, Ser, Asn, Pro, Ala, Leu, or Arg;
Xaa at position 94 is Arg, Ile, Ser, Glu, Leu, Val, Gln, Lys, His, Ala, or Pro;
Xaa at position 95 is His, Gln, Pro, Arg, Val, Leu, Gly, Thr, Asn, Lys, Ser, Ala, Trp, Phe, Ile, or Tyr;
Xaa at position 96 is Pro, Lys, Tyr, Gly, Ile, or Thr;
Xaa at position 97 is Ile, Val, Lys, Ala, or Asn;
Xaa at position 98 is His, Ile, Asn, Leu, Asp, Ala, Thr, Glu, Gln, Ser, Phe, Met, Val, Lys, Tyr or Pro;
Xaa at position 99 is Ile, Leu, Arg, Asp, Val, Pro, Gln, Gly, Ser, Phe, or His;
Xaa at position 100 is Lys, Tyr, Leu, His, Arg, Ile, Ser, Gln, or Pro;
Xaa at position 101 is Asp;
Xaa at position 102 is Gly, Leu, Glu, Lys, Ser, Tyr, or Pro;
Xaa at position 103 is Asp, or Ser;
Xaa at position 104 is Trp, Val, Cys, Tyr, Thr, Met, Pro, Leu, Gln, Lys, Ala, Phe, or Gly;
Xaa at position 105 is Asn, Pro, Ala, Phe, Ser, Trp, Gln, Tyr, Leu, Lys, Ile, Asp, or His;
Xaa at position 106 is Glu, Ser, Ala, Lys, Thr, Ile, Gly, or Pro;
Xaa at position 108 is Arg, Lys, Asp, Leu, Thr, Ile, Gln, His, Ser, Ala or Pro;
Xaa at position 109 is Arg, Thr, Pro, Glu, Tyr, Leu, Ser, or Gly;
Xaa at position 110 is Lys, Ala, Asn, Thr, Leu, Arg, Gln, His, Glu, Ser, Ala, or Trp;
Xaa at position 111 is Leu, Ile, Arg, Asp, or Met;
Xaa at position 112 is Thr, Val, Gln, Tyr, Glu, His, Ser, or Phe;
Xaa at position 113 is Phe, Ser, Cys, His, Gly, Trp, Tyr, Asp, Lys, Leu, Ile, Val or Asn;
Xaa at position 114 is Tyr, Cys, His, Ser, Trp, Arg, or Leu;
Xaa at position 115 is Leu, Asn, Val, Pro, Arg, Ala, His, Thr, Trp, or Met;
Xaa at position 116 is Lys;
Xaa at position 117 is Thr, Ser, Asn, Ile, Trp, Lys, or Pro;
Xaa at position 118 is Leu, Ser, Pro, Ala, Glu, Cys, Asp, or Tyr;
Xaa at position 119 is Glu, Ser, Lys, Pro, Leu, Thr, Tyr, or Arg;
Xaa at position 120 is Asn, Ala, Pro, Leu, His, Val, or Gln;
Xaa at position 121 is Ala, Ser, Ile, Asn, Pro, Lys, Asp, or Gly;
Xaa at position 122 is Gln, Ser, Met, Trp, Arg, Phe, Pro, His, Ile, Tyr, or Cys;
Xaa at position 123 is Ala, Met, Glu, His, Ser, Pro, Tyr, or Leu;
wherein from 6 to about 44 of the amino acids designated by Xaa are different from the corresponding amino acids of native (1-133) human interleukin-3; and wherein from 1 to 14 amino acids are optionally deleted from the N-terminus and/or from 1 to 15 amino acids are optionally deleted from the C-terminus; and
(b) a polypeptide comprising an N-terminal methionine residue, alanine residue or methionine-alanine di-peptide immediately preceding said sequence according to (a).
128. A method of treating a patient having an immunodeficiency or hematopoietic deficiency comprising administering to said patient, a therapeutically effective amount of a mutant human interleukin-3 (hIL-3) polypeptide comprising a modified hIL-3 amino acid sequence selected from the group consisting of:
(a) a polypeptide having an amino acid sequence of
(18I, 25H, 29R, 32A, 37P, 42A and 45V)-(15-125)human interleukin-3 (SEQ ID NO:66);
(18I, 25H, 29R, 32N, 37P, 42S and 45M)-(15-125)human interleukin-3 (SEQ ID NO:67);
(18I, 25H, 29V, 32A, 37S, 42S and 45M)-(15-125)human interleukin-3 (SEQ ID NO:68);
(51R, 55L, 59L, 62V, 67N and 69E)-(15-125)human interleukin-3 (SEQ ID NO:69);
(51R, 55L, 60S, 62V, 67N and 69E)-(15-125)human interleukin-3 (SEQ ID NO:70)i
(51R, 55T, 59L, 62V, 67H and 69E)-(15-125)human interleukin-3 (SEQ ID NO:71);
(73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A and 105Q)-(15-125)human interleukin-3 (SEQ ID NO:72);
(73G, 76A, 79R, 82V, 87S, 93S, 98T, 101A and 105Q)-(15-125)human interleukin-3 (SEQ ID NO:73);
(73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and 123E)-(15-125)human interleukin-3 (SEQ. ID. NO:76);
(73G, 76A, 79R, 82V, 87S, 93S, 98T, 101A, 105Q, 109E, 116V, 120Q and 123E)-(15-125)human interleukin-3 (SEQ ID NO:77);
(73G, 76A, 79R, 82V, 87S, 93S, 98T, 101A, 105Q, 109E, 116V, 117S, 120H and 123E)-(15-125)human interleukin-3 (SEQ ID NO:78);
(18I, 25H, 29R, 32A, 37P, 42A, 45V, 51R, 55L, 60S, 62V, 67N and 69E)-(15-125)human interleukin-3 (SEQ ID NO:79);
(18I, 25H, 29R, 32N, 37P, 42S, 45M, 51R, 55T, 59L, 62V, 67H and 69E)-(15-125)human interleukin-3 (SEQ ID NO:80);
(18I, 25H, 29V, 32A, 37S, 42S, 45M, 51R, 55L, 59L, 62V, 67N and 69E)-(15-125)human interleukin-3 (SEQ ID NO:81);
(42D, 45M, 46S, 50D, 95R, 98I, 100R, 116W)-(15-125)human interleukin-3 (residues 3-113 of SEQ ID NO:263);
(42D, 45M, 46S, 98I, 100R, 116W)-(15-125)human interleukin-3 (SEQ ID NO:406);
(18I, 19A, 25H, 29R, 32N, 37P, 42S, 45V, 49D, 51R, 55T, 59L, 62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and 123E)-(15-125)human interleukin-3 (residues 3-113 of SEQ ID NO:276);
(18I, 19I, 25H, 29R, 32N, 37P, 42S, 45V, 49D, 51R, 55T, 59L, 62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and 123E)-(15-125)human interleukin-3 (residues 3-113 of SEQ ID NO:277);
(18I, 23A, 25H, 29V, 32A, 37S, 42S, 45M, 51R, 55L, 59L, 62V, 67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and 123E)-(15-125)human interleukin-3 (residues 3-113 of SEQ ID NO:278);
(18I, 23A, 25H, 29V, 32A, 37S, 42S, 45M, 51R, 55L, 59L, 62V, 67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 112Q, 116V, 120Q and 123E)-(15-125)human interleukin-3 (SEQ ID NO:279);
(18I, 25H, 29R, 32A, 37P, 42A, 45V, 51R, 55L, 60S, 62V, 67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V,)-(15-119)human interleukin-3 (residues 3-113 of SEQ ID NO:287);
(18I, 23A, 25H, 29R, 32A, 37P, 42D, 45V, 46S, 50D, 51R, 55L, 60S, 62V, 67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 112Q, 116V)-(15-119)human interleukin-3 (residues 3-113 of SEQ ID NO:289);
(18I, 25H, 29R, 32A, 37P, 42A, 45V, 51R, 55L, 60S, 62V, 67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 112Q, 116V)-(15-119)human interleukin-3 (residues 3-113 of SEQ ID NO:307);
(18I, 20P, 23A, 25H, 29I, 32N, 34S, 37S, 38A, 42S, 45V, 46S, 51R, 55T, 59L, 62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and 123E)-(15-125)human interleukin-3 (residues 3-113 of SEQ ID NO:317);
(18I, 23L, 25H, 29I, 32N, 34S, 37S, 38A, 42S, 45V, 46S, 51R, 55T, 59L, 62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116v, 120Q and 123E)-(15-125)human interleukin-3 (residues 3-113 of SEQ ID NO:318);
(18I, 23A, 25H, 29I, 32N, 34S, 37S, 38A, 42S, 45V, 46S, 51R, 55T, 59L, 62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and 123E)-(15-125)human interleukin-3 (residues 3-113 of SEQ ID NO:319);
(18I, 19I, 20L, 23A, 25H, 29I, 32N, 34S, 37S, 38A, 42S, 45V, 46S, 51R, 55T, 59L, 62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and 123E)-(15-125)human interleukin-3 (residues 3-113 of SEQ ID NO:320);
(18I, 25H, 29R, 32N, 37P, 42S, 45M, 50D, 51S, 55T, 59L, 62P, 63H, 67Q, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and 123E)-(15-125)human interleukin-3 (residues 3-113 of SEQ ID NO:321);
(18I, 25H, 29R, 32N, 37P, 42S, 45M, 51R, 55T, 59L, 62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109L, 112Q, 116S, 120Q and 123E)-(15-125)human interleukin-3 (residues 3-113 of SEQ ID NO:322); and
(18I, 25H, 29R, 32N, 37P, 42S, 45M, 51R, 55T, 59L, 62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109L, 112Q, 116S)-(15-118)human interleukin-3 (residues 3-113 of SEQ ID NO:323);
(b) a polypeptide comprising an N-terminal methionine residue, alanine residue or methionine-alanine di-peptide immediately preceding said sequence according to (a).
129. A method of treating a patient comprising the steps of:
(i) administering to said patient, an amount of a mutant human interleukin-3 (IL-3) polypeptide, effective to promote the proliferation and/or differentiation of hematopoietic cells in said patient, wherein said mutant human interleukin-3 (hIL-3) polypeptide comprises a modified hIL-3 amino acid sequence selected from the group consisting of:
(a) a sequence of (SEQ ID NO:15)
wherein;
Xaa at position 17 is Ser, Lys, Gly, Asp, Met, Gln, or Arg;
Xaa at position 18 is Asn, His, Leu, Ile, Phe, Arg, or Gln;
Xaa at position 19 is Met, Phe, Ile, Arg, Gly, Ala, or Cys;
Xaa at position 20 is Ile, Cys, Gln, Glu, Arg, Pro, or Ala;
Xaa at position 21 is Asp, Phe, Lys, Arg, Ala, Gly, Glu, Gln, Asn, Thr, Ser or Val;
Xaa at position 22 is Glu, Trp, Pro, Ser, Ala, His, Asp, Asn, Gln, Leu, Val or Gly;
Xaa at position 23 is Ile, Val, Ala, Leu, Gly, Trp, Lys, Phe, Ser, or Arg;
Xaa at position 24 is Ile, Gly, Val, Arg, Ser, Phe, or Leu;
Xaa at position 25 is Thr, His, Gly, Gln, Arg, Pro, or Ala;
Xaa at position 26 is His, Thr, Phe, Gly, Arg, Ala, or Trp;
Xaa at position 27 is Leu, Gly, Arg, Thr, Ser, or Ala;
Xaa at position 28 is Lys, Arg, Leu, Gln, Gly, Pro, Val or Trp;
Xaa at position 29 is Gln, Asn, Leu, Pro, Arg, or Val;
Xaa at position 30 is Pro, His, Thr, Gly, Asp, Gln, Ser, Leu, or Lys;
Xaa at position 31 is Pro, Asp, Gly, Ala, Arg, Leu, or Gln;
Xaa at position 32 is Leu, Val, Arg, Gln, Asn, Gly, Ala, or Glu;
Xaa at position 33 is Pro, Leu, Gln, Ala, Thr, or Glu;
Xaa at position 34 is Leu, Val, Gly, Ser, Lys, Glu, Gln, Thr, Arg, Ala, Phe, Ile or Met;
Xaa at position 35 is Leu, Ala, Gly, Asn, Pro, Gln, or Val;
Xaa at position 36 is Asp, Leu, or Val;
Xaa at position 37 is Phe, Ser, Pro, Trp, or Ile;
Xaa at position 38 is Asn, or Ala;
Xaa at position 40 is Leu, Trp, or Arg;
Xaa at position 41 is Asn, Cys, Arg, Leu, His, Met, or Pro;
Xaa at position 42 is Gly, Asp, Ser, Cys, Asn, Lys, Thr, Leu, Val, Glu, Phe, Tyr, Ile, Met or Ala;
Xaa at position 43 is Glu, Asn, Tyr, Leu, Phe, Asp, Ala, Cys, Gln, Arg, Thr, Gly or Ser;
Xaa at position 44 is Asp, Ser, Leu, Arg, Lys, Thr, Met, Trp, Glu, Asn, Gln, Ala or Pro;
Xaa at position 45 is Gln, Pro, Phe, Val, Met, Leu, Thr, Lys, Trp, Asp, Asn, Arg, Ser, Ala, Ile, Glu or His;
Xaa at position 46 is Asp, Phe, Ser, Thr, Cys, Glu, Asn, Gln, Lys, His, Ala, Tyr, Ile, Val or Gly;
Xaa at position 47 is Ile, Gly, Val, Ser, Arg, Pro, or His;
Xaa at position 48 is Leu, Ser, Cys, Arg, Ile, His, Phe, Glu, Lys, Thr, Ala, Met, Val or Asn;
Xaa at position 49 is Met, Arg, Ala, Gly, Pro, Asn, His, or Asp;
Xaa at position 50 is Glu, Leu, Thr, Asp, Tyr, Lys, Asn, Ser, Ala, Ile, Val, His, Phe, Met or Gln;
Xaa at position 51 is Asn, Arg, Met, Pro, Ser, Thr, or His;
Xaa at position 52 is Asn, His, Arg, Leu, Gly, Ser, or Thr;
Xaa at position 53 is Leu, Thr, Ala, Gly, Glu, Pro, Lys, Ser, or Met;
Xaa at position 54 is Arg, Asp, Ile, Ser, Val, Thr, Gln, Asn, Lys, His, Ala or Leu;
Xaa at position 55 is Arg, Thr, Val, Ser, Leu, or Gly;
Xaa at position 56 is Pro, Gly, Cys, Ser, Gln, Glu, Arg, His, Thr, Ala, Tyr, Phe, Leu, Val or Lys;
Xaa at position 57 is Asn or Gly;
Xaa at position 58 is Leu, Ser, Asp, Arg, Gln, Val, or Cys;
Xaa at position 59 is Glu, Tyr, His, Leu, Pro, or Arg;
Xaa at position 60 is Ala, Ser, Pro, Tyr, Asn, or Thr;
Xaa at position 61 is Phe, Asn, Glu, Pro, Lys, Arg, or Ser;
Xaa at position 62 is Asn, His, Val, Arg, Pro, Thr, Asp, or Ile;
Xaa at position 63 is Arg, Tyr, Trp, Ser, His, Pro, or Val;
Xaa at position 64 is Ala, Asn, Pro, Ser, or Lys;
Xaa at position 65 is Val, Thr, Pro, His, Leu, Phe, or Ser;
Xaa at position 66 is Lys, Ile, Arg, Val, Asn, Glu, or Ser;
Xaa at position 67 is Ser, Ala, Phe, Val, Gly, Asn, Ile, Pro, or His;
Xaa at position 68 is Leu, Val, Trp, Ser, Ile, Phe, Thr, or His;
Xaa at position 69 is Gln, Ala, Pro, Thr, Glu, Arg, Trp, Gly, or Leu;
Xaa at position 70 is Asn, Leu, Val, Trp, Pro, or Ala;
Xaa at position 71 is Ala, Met, Leu, Pro, Arg, Glu, Thr, Gln, Trp, or Asn;
Xaa at position 72 is Ser, Glu, Met, Ala, His, Asn, Arg, or Asp;
Xaa at position 73 is Ala, Glu, Asp, Leu, Ser, Gly, Thr, or Arg;
Xaa at position 74 is Ile, Met, Thr, Pro, Arg, Gly, Ala;
Xaa at position 75 is Glu, Lys, Gly, Asp, Pro, Trp, Arg, Ser, Gln, or Leu;
Xaa at position 76 is Ser, Val, Ala, Asn, Trp, Glu, Pro, Gly, or Asp;
Xaa at position 77 is Ile, Ser, Arg, Thr, or Leu;
Xaa at position 78 is Leu, Ala, Ser, Glu, Phe, Gly, or Arg;
Xaa at position 79 is Lys, Thr, Asn, Met, Arg, Ile, Gly, or Asp;
Xaa at position 80 is Asn, Trp, Val, Gly, Thr, Leu, Glu, or Arg;
Xaa at position 81 is Leu, Gln, Gly, Ala, Trp, Arg, Val, or Lys;
Xaa at position 82 is Leu, Gln, Lys, Trp, Arg, Asp, Glu, Asn, His, Thr, Ser, Ala, Tyr, Phe, Ile, Met or Val;
Xaa at position 83 is Pro, Ala, Thr, Trp, Arg, or Met;
Xaa at position 84 is Cys, Glu, Gly, Arg, Met, or Val;
Xaa at position 85 is Leu, Asn, Val, or Gln;
Xaa at position 86 is Pro, Cys, Arg, Ala, or Lys;
Xaa at position 87 is Leu, Ser, Trp, or Gly;
Xaa at position 88 is Ala, Lys, Arg, Val, or Trp;
Xaa at position 89 is Thr, Asp, Cys, Leu, Val, Glu, His, Asn, or Ser;
Xaa at position 90 is Ala, Pro, Ser, Thr, Gly, Asp, Ile, or Met;
Xaa at position 91 is Ala, Pro, Ser, Thr, Phe, Leu, Asp, or His;
Xaa at position 92 is Pro, Phe, Arg, Ser, Lys, His, Ala, Gly, Ile or Leu;
Xaa at position 93 is Thr, Asp, Ser, Asn, Pro, Ala, Leu, or Arg;
Xaa at position 94 is Arg, Ile, Ser, Glu, Leu, Val, Gln, Lys, His, Ala, or Pro;
Xaa at position 95 is His, Gln, Pro, Arg, Val, Leu, Gly, Thr, Asn, Lys, Ser, Ala, Trp, Phe, Ile, or Tyr;
Xaa at position 96 is Pro, Lys, Tyr, Gly, Ile, or Thr;
Xaa at position 97 is Ile, Val, Lys, Ala, or Asn;
Xaa at position 98 is His, Ile, Asn, Leu, Asp, Ala, Thr, Glu, Gln, Ser, Phe, Met, Val, Lys, Tyr or Pro;
Xaa at position 99 is Ile, Leu, Arg, Asp, Val, Pro, Gln, Gly, Ser, Phe, or His;
Xaa at position 100 is Lys, Tyr, Leu, His, Arg, Ile, Ser, Gln, or Pro;
Xaa at position 101 is Asp;
Xaa at position 102 is Gly, Leu, Glu, Lys, Ser, Tyr, or Pro;
Xaa at position 103 is Asp, or Ser;
Xaa at position 104 is Trp, Val, Cys, Tyr, Thr, Met, Pro, Leu, Gln, Lys, Ala, Phe, or Gly;
Xaa at position 105 is Asn, Pro, Ala, Phe, Ser, Trp, Gln, Tyr, Leu, Lys, Ile, Asp, or His;
Xaa at position 106 is Glu, Ser, Ala, Lys, Thr, Ile, Gly, or Pro;
Xaa at position 108 is Arg, Lys, Asp, Leu, Thr, Ile, Gln, His, Ser, Ala or Pro;
Xaa at position 109 is Arg, Thr, Pro, Glu, Tyr, Leu, Ser, or Gly;
Xaa at position 110 is Lys, Ala, Asn, Thr, Leu, Arg, Gln, His, Glu, Ser, Ala, or Trp;
Xaa at position 111 is Leu, Ile, Arg, Asp, or Met;
Xaa at position 112 is Thr, Val, Gln, Tyr, Glu, His, Ser, or Phe;
Xaa at position 113 is Phe, Ser, Cys, His, Gly, Trp, Tyr, Asp, Lys, Leu, Ile, Val or Asn;
Xaa at position 114 is Tyr, Cys, His, Ser, Trp, Arg, or Leu;
Xaa at position 115 is Leu, Asn, Val, Pro, Arg, Ala, His, Thr, Trp, or Met;
Xaa at position 116 is Lys;
Xaa at position 117 is Thr, Ser, Asn, Ile, Trp, Lys, or Pro;
Xaa at position 118 is Leu, Ser, Pro, Ala, Glu, Cys, Asp, or Tyr;
Xaa at position 119 is Glu, Ser, Lys, Pro, Leu, Thr, Tyr, or Arg;
Xaa at position 120 is Asn, Ala, Pro, Leu, His, Val, or Gln;
Xaa at position 121 is Ala, Ser, Ile, Asn, Pro, Lys, Asp, or Gly;
Xaa at position 122 is Gln, Ser, Met, Trp, Arg, Phe, Pro, His, Ile, Tyr, or Cys;
Xaa at position 123 is Ala, Met, Glu, His, Ser, Pro, Tyr, or Leu;
wherein from 6 to about 44 of the amino acids designated by Xaa are different from the corresponding amino acids of native (1-133) human interleukin-3; and wherein from 1 to 14 amino acids are optionally deleted from the N-terminus and/or from 1 to 15 amino acids are optionally deleted from the C-terminus; and
(b) a polypeptide comprising an N-terminal methionine residue, alanine residue or methionine-alanine di-peptide immediately preceding said sequence according to (a);
(ii) removing hematopoietic cells from said patient;
(iii) administering to said patient cancer radiation therapy or chemotherapy; and
(iv) returning said hematopoietic cells to said patient.
130. A method of treating a patient comprising the steps of:
(i) administering to said patient, an amount of a mutant human interleukin-3 (IL-3) polypeptide, effective to promote the proliferation and/or differentiation of hematopoietic cells in said patient, wherein said mutant human interleukin-3 (hIL-3) polypeptide comprises a modified hIL-3 amino acid sequence selected from the group consisting of:
(a) a polypeptide having an amino acid sequence of
(18I, 25H, 29R, 32A, 37P, 42A and 45V)-(15-125)human interleukin-3 (SEQ ID NO:66);
(18I, 25H, 29R, 32N, 37P, 42S and 45M)-(15-125)human interleukin-3 (SEQ ID NO:67);
(18I, 25H, 29V, 32A, 37S, 42S and 45M)-(15-125)human interleukin-3 (SEQ ID NO:68);
(51R, 55L, 59L, 62V, 67N and 69E)-(15-125)human interleukin-3 (SEQ ID NO:69)
(51R, 55L, 60S, 62V, 67N and 69E)-(15-125)human interleukin-3 (SEQ ID NO:70);
(51R, 55T, 59L, 62V, 67H and 69E)-(15-125)human interleukin-3 (SEQ ID NO:71);
(73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A and 105Q)-(15-125)human interleukin-3 (SEQ ID NO:72);
(73G, 76A, 79R, 82V, 87S, 93S, 98T, 101A and 105Q)-(15-125)human interleukin-3 (SEQ ID NO:73);
(73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 1O9E, 116V, 120Q and 123E)-(15-125)human interleukin-3 (SEQ. ID. NO:76);
(73G, 76A, 79R, 82V, 87S, 93S, 98T, 101A, 105Q, 109E, 116V, 120Q and 123E)-(15-125)human interleukin-3 (SEQ ID NO:77);
(73G, 76A, 79R, 82V, 87S, 93S, 98T, 101A, 105Q, lO9E, 116V, 117S, 120H and 123E)-(15-125)human interleukin-3 (SEQ ID NO:78);
(18I, 25H, 29R, 32A, 37P, 42A, 45V, 51R, 55L, 60S, 62V, 67N and 69E)-(15-125)human interleukin-3 (SEQ ID NO:79);
(18I, 25H, 295, 32N, 37P, 42S, 45M, 515, 55T, 59L, 62V, 67H and 69E)-(15-125)human interleukin-3 (SEQ ID NO:80);
(18I, 25H, 29V, 32A, 37S, 42S, 45M, 51R, 55L, 59L, 62V, 67N and 69E)-(15-125)human interleukin-3 (SEQ ID NO:81);
(42D, 45M, 46S, 50D, 95R, 98I, 100R, 116W)-(15-125)human interleukin-3 (residues 3-113 of SEQ ID NO:263);
(42D, 45M, 46S, 98I, 100R, 116W)-(15-125)human interleukin-3 (SEQ ID NO:406);
(18I, 19A, 25H, 29R, 32N, 37P, 42S, 45V, 49D, 51R, 55T, 59L, 62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and 123E)-(15-125)human interleukin-3 (residues 3-113 of SEQ ID NO:276);
(18I, 19I, 25H, 29R, 32N, 37P, 42S, 45V, 49D, 51R, 55T, 59L, 62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and 123E)-(15-125)human interleukin-3 (residues 3-113 of SEQ ID NO:277);
(18I, 23A, 25H, 29V, 32A, 37S, 42S, 45M, 51R, 55L, 59L, 62V, 67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and 123E)-(15-125)human interleukin-3 (residues 3-113 of SEQ ID NO:278);
(18I, 23A, 25H, 29V, 32A, 37S, 42S, 45M, 51R, 55L, 59L, 62V, 67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 112Q, 116V, 120Q and 123E)-(15-125)human interleukin-3 (SEQ ID NO:279);
(18I, 25H, 29R, 32A, 37P, 42A, 45V, 51R, 55L, 60S, 62V, 67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V,)-(15-119)human interleukin-3 (residues 3-113 of SEQ ID NO:287);
(18I, 23A, 25H, 29R, 32A, 37P, 42D, 45V, 46S, 50D, 51R, 55L, 60S, 62V, 67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 112Q, 116V)-(15-119)human interleukin-3 (residues 3-113 of SEQ ID NO:289);
(18I, 25H, 29R, 32A, 37P, 42A, 45V, 51R, 55L, 60S, 62V, 67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 112Q, 116V)-(15-119)human interleukin-3 (residues 3-113 of SEQ ID NO:307);
(18I, 20P, 23A, 25H, 29I, 32N, 34S, 37S, 38A, 42S, 45V, 46S, 51R, 55T, 59L, 62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and 123E)-(15-125)human interleukin-3 (residues 3-113 of SEQ ID NO:317);
(18I, 23L, 25H, 29I, 32N, 34S, 37S, 38A, 42S, 45V, 46S, 51R, 55T, 59L, 62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and 123E)-(15-125)human interleukin-3 (residues 3-113 of SEQ ID NO:318);
(18I, 23A, 25H, 29I, 32N, 34S, 37S, 38A, 42S, 45V, 46S, 51R, 55T, 59L, 62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and 123E)-(15-125)human interleukin-3 (residues 3-113 of SEQ ID NO:319);
(18I, 19I, 20L, 23A, 25H, 29I, 32N, 34S, 37S, 38A, 42S, 45V, 46S, 51R, 55T, 59L, 62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and 123E)-(15-125)human interleukin-3 (residues 3-113 of SEQ ID NO:320);
(18I, 25H, 29R, 32N, 37P, 42S, 45M, 50D, 51S, 55T, 59L, 62P, 63H, 67Q, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and 123E)-(15-125)human interleukin-3 (residues 3-113 of SEQ ID NO:321);
(18I, 25H, 29R, 32N, 37P, 42S, 45M, 51R, 55T, 59L, 62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109L, 112Q, 116S, 120Q and 123E)-(15-125)human interleukin-3 (residues 3-113 of SEQ ID NO:322); and
(18I, 25H, 29R, 32N, 37P, 42S, 45M, 51R, 55T, 59L, 62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109L, 112Q, 116S)-(15-118)human interleukin-3 (residues 3-113 of SEQ ID NO:323); and
(b) a polypeptide comprising an N-terminal methionine residue, alanine residue or methionine-alanine di-peptide immediately preceding said sequence according to (a);
(ii) removing hematopoietic cells from said patient;
(iii) administering to said patient cancer radiation therapy or chemotherapy; and
(iv) returning said hematopoietic cells to said patient.
131. A method of treating a side effect of cancer chemotherapy or radiation therapy in a patient comprising administering to said patient, a therapeutically effective amount of a mutant human interleukin-3 (hIL-3) polypeptide comprising a modified hIL-3 amino acid sequence selected from the group consisting of:
(a) a sequence of (SEQ ID NO:15)
wherein;
Xaa at position 17 is Ser, Lys, Gly, Asp, Met, Gln, or Arg;
Xaa at position 18 is Asn, His, Leu, Ile, Phe, Arg, or Gln;
Xaa at position 19 is Met, Phe, Ile, Arg, Gly, Ala, or Cys;
Xaa at position 20 is Ile, Cys, Gln, Glu, Arg, Pro, or Ala;
Xaa at position 21 is Asp, Phe, Lys, Arg, Ala, Gly, Glu, Gln, Asn, Thr, Ser or Val;
Xaa at position 22 is Glu, Trp, Pro, Ser, Ala, His, Asp, Asn, Gln, Leu, Val or Gly;
Xaa at position 23 is Ile, Val, Ala, Leu, Gly, Trp, Lys, Phe, Ser, or Arg;
Xaa at position 24 is Ile, Gly, Val, Arg, Ser, Phe, or Leu;
Xaa at position 25 is Thr, His, Gly, Gln, Arg, Pro, or Ala;
Xaa at position 26 is His, Thr, Phe, Gly, Arg, Ala, or Trp;
Xaa at position 27 is Leu, Gly, Arg, Thr, Ser, or Ala;
Xaa at position 28 is Lys, Arg, Leu, Gln, Gly, Pro, Val or Trp;
Xaa at position 29 is Gln, Asn, Leu, Pro, Arg, or Val;
Xaa at position 30 is Pro, His, Thr, Gly, Asp, Gln, Ser, Leu, or Lys;
Xaa at position 31 is Pro, Asp, Gly, Ala, Arg, Leu, or Gln;
Xaa at position 32 is Leu, Val, Arg, Gln, Asn, Gly, Ala, or Glu;
Xaa at position 33 is Pro, Leu, Gln, Ala, Thr, or Glu;
Xaa at position 34 is Leu, Val, Gly, Ser, Lys, Glu, Gln, Thr, Arg, Ala, Phe, Ile or Met;
Xaa at position 35 is Leu, Ala, Gly, Asn, Pro, Gln, or Val;
Xaa at position 36 is Asp, Leu, or Val;
Xaa at position 37 is Phe, Ser, Pro, Trp, or Ile;
Xaa at position 38 is Asn, or Ala;
Xaa at position 40 is Leu, Trp, or Arg;
Xaa at position 41 is Asn, Cys, Arg, Leu, His, Met, or Pro;
Xaa at position 42 is Gly, Asp, Ser, Cys, Asn, Lys, Thr, Leu, Val, Glu, Phe, Tyr, Ile, Met or Ala;
Xaa at position 43 is Glu, Asn, Tyr, Leu, Phe, Asp, Ala, Cys, Gln, Arg, Thr, Gly or Ser;
Xaa at position 44 is Asp, Ser, Leu, Arg, Lys, Thr, Met, Trp, Glu, Asn, Gln, Ala or Pro;
Xaa at position 45 is Gln, Pro, Phe, Val, Met, Leu, Thr, Lys, Trp, Asp, Asn, Arg, Ser, Ala, Ile, Glu or His;
Xaa at position 46 is Asp, Phe, Ser, Thr, Cys, Glu, Asn, Gln, Lys, His, Ala, Tyr, Ile, Val or Gly;
Xaa at position 47 is Ile, Gly, Val, Ser, Arg, Pro, or His;
Xaa at position 48 is Leu, Ser, Cys, Arg, Ile, His, Phe, Glu, Lys, Thr, Ala, Met, Val or Asn;
Xaa at position 49 is Met, Arg, Ala, Gly, Pro, Asn, His, or Asp;
Xaa at position 50 is Glu, Leu, Thr, Asp, Tyr, Lys, Asn, Ser, Ala, Ile, Val, His, Phe, Met or Gln;
Xaa at position 51 is Asn, Arg, Met, Pro, Ser, Thr, or His;
Xaa at position 52 is Asn, His, Arg, Leu, Gly, Ser, or Thr;
Xaa at position 53 is Leu, Thr, Ala, Gly, Glu, Pro, Lys, Ser, or Met;
Xaa at position 54 is Arg, Asp, Ile, Ser, Val, Thr, Gln, Asn, Lys, His, Ala or Leu;
Xaa at position 55 is Arg, Thr, Val, Ser, Leu, or Gly;
Xaa at position 56 is Pro, Gly, Cys, Ser, Gln, Glu, Arg, His, Thr, Ala, Tyr, Phe, Leu, Val or Lys;
Xaa at position 57 is Asn or Gly;
Xaa at position 58 is Leu, Ser, Asp, Arg, Gln, Val, or Cys;
Xaa at position 59 is Glu, Tyr, His, Leu, Pro, or Arg;
Xaa at position 60 is Ala, Ser, Pro, Tyr, Asn, or Thr;
Xaa at position 61 is Phe, Asn, Glu, Pro, Lys, Arg, or Ser;
Xaa at position 62 is Asn, His, Val, Arg, Pro, Thr, Asp, or Ile;
Xaa at position 63 is Arg, Tyr, Trp, Ser, His, Pro, or Val;
Xaa at position 64 is Ala, Asn, Pro, Ser, or Lys;
Xaa at position 65 is Val, Thr, Pro, His, Leu, Phe, or Ser;
Xaa at position 66 is Lys, Ile, Arg, Val, Asn, Glu, or Ser;
Xaa at position 67 is Ser, Ala, Phe, Val, Gly, Asn, Ile, Pro, or His;
Xaa at position 68 is Leu, Val, Trp, Ser, Ile, Phe, Thr, or His;
Xaa at position 69 is Gln, Ala, Pro, Thr, Glu, Arg, Trp, Gly, or Leu;
Xaa at position 70 is Asn, Leu, Val, Trp, Pro, or Ala;
Xaa at position 71 is Ala, Met, Leu, Pro, Arg, Glu, Thr, Gln, Trp, or Asn;
Xaa at position 72 is Ser, Glu, Met, Ala, His, Asn, Arg, or Asp;
Xaa at position 73 is Ala, Glu, Asp, Leu, Ser, Gly, Thr, or Arg;
Xaa at position 74 is Ile, Met, Thr, Pro, Arg, Gly, Ala;
Xaa at position 75 is Glu, Lys, Gly, Asp, Pro, Trp, Arg, Ser, Gln, or Leu;
Xaa at position 76 is Ser, Val, Ala, Asn, Trp, Glu, Pro, Gly, or Asp;
Xaa at position 77 is Ile, Ser, Arg, Thr, or Leu;
Xaa at position 78 is Leu, Ala, Ser, Glu, Phe, Gly, or Arg;
Xaa at position 79 is Lys, Thr, Asn, Met, Arg, Ile, Gly, or Asp;
Xaa at position 80 is Asn, Trp, Val, Gly, Thr, Leu, Glu, or Arg;
Xaa at position 81 is Leu, Gln, Gly, Ala, Trp, Arg, Val, or Lys;
Xaa at position 82 is Leu, Gln, Lys, Trp, Arg, Asp, Glu, Asn, His, Thr, Ser, Ala, Tyr, Phe, Ile, Met or Val;
Xaa at position 83 is Pro, Ala, Thr, Trp, Arg, or Met;
Xaa at position 84 is Cys, Glu, Gly, Arg, Met, or Val;
Xaa at position 85 is Leu, Asn, Val, or Gln;
Xaa at position 86 is Pro, Cys, Arg, Ala, or Lys;
Xaa at position 87 is Leu, Ser, Trp, or Gly;
Xaa at position 88 is Ala, Lys, Arg, Val, or Trp;
Xaa at position 89 is Thr, Asp, Cys, Leu, Val, Glu, His, Asn, or Ser;
Xaa at position 90 is Ala, Pro, Ser, Thr, Gly, Asp, Ile, or Met;
Xaa at position 91 is Ala, Pro, Ser, Thr, Phe, Leu, Asp, or His;
Xaa at position 92 is Pro, Phe, Arg, Ser, Lys, His, Ala, Gly, Ile or Leu;
Xaa at position 93 is Thr, Asp, Ser, Asn, Pro, Ala, Leu, or Arg;
Xaa at position 94 is Arg, Ile, Ser, Glu, Leu, Val, Gln, Lys, His, Ala, or Pro;
Xaa at position 95 is His, Gln, Pro, Arg, Val, Leu, Gly, Thr, Asn, Lys, Ser, Ala, Trp, Phe, Ile, or Tyr;
Xaa at position 96 is Pro, Lys, Tyr, Gly, Ile, or Thr;
Xaa at position 97 is Ile, Val, Lys, Ala, or Asn;
Xaa at position 98 is His, Ile, Asn, Leu, Asp, Ala, Thr, Glu, Gln, Ser, Phe, Met, Val, Lys, Tyr or Pro;
Xaa at position 99 is Ile, Leu, Arg, Asp, Val, Pro, Gln, Gly, Ser, Phe, or His;
Xaa at position 100 is Lys, Tyr, Leu, His, Arg, Ile, Ser, Gln, or Pro;
Xaa at position 101 is Asp;
Xaa at position 102 is Gly, Leu, Glu, Lys, Ser, Tyr, or Pro;
Xaa at position 103 is Asp, or Ser;
Xaa at position 104 is Trp, Val, Cys, Tyr, Thr, Met, Pro, Leu, Gln, Lys, Ala, Phe, or Gly;
Xaa at position 105 is Asn, Pro, Ala, Phe, Ser, Trp, Gln, Tyr, Leu, Lys, Ile, Asp, or His;
Xaa at position 106 is Glu, Ser, Ala, Lys, Thr, Ile, Gly, or Pro;
Xaa at position 108 is Arg, Lys, Asp, Leu, Thr, Ile, Gln, His, Ser, Ala or Pro;
Xaa at position 109 is Arg, Thr, Pro, Glu, Tyr, Leu, Ser, or Gly;
Xaa at position 110 is Lys, Ala, Asn, Thr, Leu, Arg, Gln, His, Glu, Ser, Ala, or Trp;
Xaa at position 111 is Leu, Ile, Arg, Asp, or Met;
Xaa at position 112 is Thr, Val, Gln, Tyr, Glu, His, Ser, or Phe;
Xaa at position 113 is Phe, Ser, Cys, His, Gly, Trp, Tyr, Asp, Lys, Leu, Ile, Val or Asn;
Xaa at position 114 is Tyr, Cys, His, Ser, Trp, Arg, or Leu;
Xaa at position 115 is Leu, Asn, Val, Pro, Arg, Ala, His, Thr, Trp, or Met;
Xaa at position 116 is Lys;
Xaa at position 117 is Thr, Ser, Asn, Ile, Trp, Lys, or Pro;
Xaa at position 118 is Leu, Ser, Pro, Ala, Glu, Cys, Asp, or Tyr;
Xaa at position 119 is Glu, Ser, Lys, Pro, Leu, Thr, Tyr, or Arg;
Xaa at position 120 is Asn, Ala, Pro, Leu, His, Val, or Gln;
Xaa at position 121 is Ala, Ser, Ile, Asn, Pro, Lys, Asp, or Gly;
Xaa at position 122 is Gln, Ser, Met, Trp, Arg, Phe, Pro, His, Ile, Tyr, or Cys;
Xaa at position 123 is Ala, Met, Glu, His, Ser, Pro, Tyr, or Leu;
wherein from 6 to about 44 of the amino acids designated by Xaa are different from the corresponding amino acids of native (1-133) human interleukin-3; and wherein from 1 to 14 amino acids are optionally deleted from the N-terminus and/or from 1 to 15 amino acids are optionally deleted from the C-terminus; and
(b) a polypeptide comprising an N-terminal methionine residue, alanine residue or methionine-alanine di-peptide immediately preceding said sequence according to (a).
132. A method of treating a side effect of cancer chemotherapy or radiation therapy in a patient comprising administering to said patient, a therapeutically effective amount of a mutant human interleukin-3 (hIL-3) polypeptide comprising a modified hIL-3 amino acid sequence selected from the group consisting of:
(a) a polypeptide having an amino acid sequence of
(18I, 25H, 29R, 32A, 37P, 42A and 45V)-(15-125)human interleukin-3 (SEQ ID NO:66);
(18I, 25H, 29R, 32N, 37P, 42S and 45M)-(15-125)human interleukin-3 (SEQ ID NO:67);
(18I, 25H, 29V, 32A, 37S, 42S and 45M)-(15-125)human interleukin-3 (SEQ ID NO:68);
(51R, 55L, 59L, 62V, 67N and 69E)-(15-125)human interleukin-3 (SEQ ID NO:69);
(51R, 55L, 60S, 62V, 67N and 69E)-(15-125)human interleukin-3 (SEQ ID NO:70);
(51R, 55T, 59L, 62V, 67H and 69E)-(15-125)human interleukin-3 (SEQ ID NO:71);
(73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A and 105Q)-(15-125)human interleukin-3 (SEQ ID NO:72);
(73G, 76A, 79R, 82V, 87S, 93S, 98T, 101A and 105Q)-(15-125)human interleukin-3 (SEQ ID NO:73);
(73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and 123E)-(15-125)human interleukin-3 (SEQ. ID. NO:76);
(73G, 76A, 79R, 82V, 87S, 93S, 98T, 101A, 105Q, 109E, 116V, 120Q and 123E)-(15-125)human interleukin-3 (SEQ ID NO:77);
(73G, 76A, 79R, 82V, 87S, 93S, 98T, 101A, 105Q, 109E, 116V, 117S, 120H and 123E)-(15-125)human interleukin-3 (SEQ ID NO:78);
(18I, 25H, 29R, 32A, 37P, 42A, 45V, 51R, 55L, 60S, 62V, 67N and 69E)-(15-125)human interleukin-3 (SEQ ID NO:79);
(18I, 25H, 29R, 32N, 37P, 42S, 45M, 51R, 55T, 59L, 62V, 67H and 69E)-(15-125)human interleukin-3 (SEQ ID NO:80);
(18I, 25H, 29V, 32A, 37S, 42S, 45M, 51R, 55L, 59L, 62V, 67N and 69E)-(15-125)human interleukin-3 (SEQ ID NO:81);
(42D, 45M, 46S, 50D, 95R, 98I, 10R, 116W)-(15-125)human interleukin-3 (residues 3-113 of SEQ ID NO:263);
(42D, 45M, 46S, 98I, 100R, 116W)-(15-125)human interleukin-3 (SEQ ID NO:406);
(18I, 19A, 25H, 29R, 32N, 37P, 42S, 45V, 49D, 51R, 55T, 59L, 62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and 123E)-(15-125)human interleukin-3 (residues 3-113 of SEQ ID NO:276);
(18I, 19I, 25H, 29R, 32N, 37P, 42S, 45V, 49D, 51R, 55T, 59L, 62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and 123E)-(15-125)human interleukin-3 (residues 3-113 of SEQ ID NO:277);
(18I, 23A, 25H, 29V, 32A, 37S, 42S, 45M, 51R, 55L, 59L, 62V, 67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and 123E)-(15-125)human interleukin-3 (residues 3-113 of SEQ ID NO:278);
(18I, 23A, 25H, 29V, 32A, 37S, 42S, 45M, 51R, 55L, 59L, 62V, 67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 112Q, 116V, 120Q and 123E)-(15-125)human interleukin-3 (SEQ ID NO:279);
(18I, 25H, 29R, 32A, 37P, 42A, 45V, 51R, 55L, 60S, 62V, 67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V,)-(15-119)human interleukin-3 (residues 3-113 of SEQ ID NO:287);
(18I, 23A, 25H, 29R, 32A, 37P, 42D, 45V, 46S, 50D, 51R, 55L, 60S, 62V, 67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 112Q, 116V)-(15-119)human interleukin-3 (residues 3-113 of SEQ ID NO:289);
(18I, 25H, 29R, 32A, 37P, 42A, 45V, 51R, 55L, 60S, 62V, 67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 112Q, 116V)-(15-119)human interleukin-3 (residues 3-113 of SEQ ID NO:307);
(18I, 20P, 23A, 25H, 29I, 32N, 34S, 37S, 38A, 42S, 45V, 46S, 51R, 55T, 59L, 62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and 123E)-(15-125)human interleukin-3 (residues 3-113 of SEQ ID NO:317);
(18I, 23L, 25H, 29I, 32N, 34S, 37S, 38A, 42S, 45V, 46S, 51R, 55T, 59L, 62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and 123E)-(15-125)human interleukin-3 (residues 3-113 of SEQ ID NO:318);
(18I, 23A, 25H, 29I, 32N, 34S, 37S, 38A, 42S, 45V, 46S, 51R, 55T, 59L, 62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and 123E)-(15-125)human interleukin-3 (residues 3-113 of SEQ ID NO:319);
(18I, 19I, 20L, 23A, 25H, 29I, 32N, 34S, 37S, 38A, 42S, 45V, 46S, 51R, 55T, 59L, 62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and 123E)-(15-125)human interleukin-3 (residues 3-113 of SEQ ID NO:320);
(18I, 25H, 29R, 32N, 37P, 42S, 45M, 50D, 51S, 55T, 59L, 62P, 63H, 67Q, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and 123E)-(15-125)human interleukin-3 (residues 3-113 of SEQ ID NO:321);
(18I, 25H, 29R, 32N, 37P, 42S, 45M, 51R, 55T, 59L, 62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109L, 112Q, 116S, 120Q and 123E)-(15-125)human interleukin-3 (residues 3-113 of SEQ ID NO:322); and
(18I, 25H, 29R, 32N, 37P, 42n, 45M, 51R, 55T, 59L, 62V, 67H, 69E, 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109L, 112Q, 116S)-(15-118) human interleukin-3 (residues 3-113 of SEQ ID NO: 323); and
said mutant human interleukin-3 polypeptide has increased cell proliferative activity compared to native human interleukin-3 in at least one assay selected from the group consisting of: AML cell proliferation, TF-1 cell proliferation and Methylcellulose assay;
a polypeptide comprising an N-terminal methionine residue, alanine residue or methionine-alanine di-peptide immediately preceding said sequence according to (a).

Parent Case Info

This a divisional of U.S. Ser. No. 08/411,795, now U.S. Pat. No. 5,604,116, which was filed as international application PCT/US93/11197 on Nov. 22, 1993, which entered the U.S. national stage under 35 U.S.C. .sctn. 371 on Apr. 6, 1995; and PCT/US93/11197 in turn is a Continuation in Part of U.S. Ser. No. 07/981,044; filed Nov. 24, 1992 which is now abandoned. The noted applications ate incorporated herein by reference.

US Referenced Citations (6)

Number	Name	Date
4877729	Clark et al.	Oct 1989
4959455	Clark et al.	Sep 1990
5032395	Clark et al.	Jul 1991
5166322	Shaw et al.	Nov 1992
5516512	Dorssers et al.	May 1996
5604116	Bauer et al.	Feb 1997

Foreign Referenced Citations (17)

Number	Date	Country
275598	Jul 1988	EPX
413383	Feb 1991	EPX
3236400	Oct 1991	JPX
463595	Feb 1992	JPX
2210883	Jun 1989	GBX
8800598	Jan 1988	WOX
8804691	Jun 1988	WOX
8805469	Jul 1988	WOX
8806161	Aug 1988	WOX
9001039	Feb 1990	WOX
9010705	Sep 1990	WOX
9012874	Nov 1990	WOX
9100350	Jan 1991	WOX
9102754	Mar 1991	WOX
9107988	Jun 1991	WOX
9206116	Apr 1992	WOX
9307171-A1	Apr 1993	WOX

Non-Patent Literature Citations (14)

Entry
Yang et al, in Cell 47:3 (1986).
Dorsers et al, Gene 55:115 (1987).
Phillips et al, Gene, 84, 501 (1989).
Clark-Lewis et al, Science 231:134 (1986).
Clark-Lewis et al, Proc.Nat.Acad.Sci.USA 85:7897 (1988).
Lokker et al, J.Biol.Chem., 266(16):10624 (1991).
Clark-Lewis et al, Immune Regulation by Characterized Polypeptides, Alan R. Liss, Inc. (1987) p. 323-334.
Ihle et al, J.Immunol. 126:2184 (1981).
Fung et al, Nature, 307, 233 (1984).
Yokota et al, Proc.Nat.Acad.Sci.USA 81:1070 (1984).
Dorssers et al, J.Biol.Chem 266(31):21310 (1991).
Koshansky et al, J.Clin.Invest, 90:1879 (1992).
Lopez et al, Proc.Natl.Acad.Sci.USA 89:11842-11846 (1992).
Lokker et al, The EMBO JOUR. 10:2125-2131 (1991).

Divisions (1)

	Number	Date	Country
Parent	411795

Therapeutic uses of interleukin-3 (IL-3) multiple mutation polypeptides

Information

Patent Number

Date Filed

Date Issued

Inventors

Original Assignees

Examiners

Agents

CPC

US Classifications

Field of Search

US

International Classifications