Ubiquitin-specific proteases

Abstract

The disclosure relates to a generic class of ubiquitin-specific proteases which specifically cleave at the C-terminus of the ubiquitin moiety in a ubiquitin fusion protein irrespective of the size of the ubiquitin fusion protein. More specifically, the disclosure relates to ubiquitin-specific proteases of this class which have been isolated from a cell. The disclosure also relates to isolated DNA sequences encoding the proteases of this class.

Description

BACKGROUND OF THE INVENTION

Ubiquitin (Ub), a highly conserved 76-residue protein, is present in eukaryotic cells either free or covalently joined to a great variety of proteins. The post-translational coupling of ubiquitin to other proteins is catalyzed by a family of Ub-conjugating (E2) enzymes and involves formation of an isopeptide bond between the C-terminal Gly residue of ubiquitin and the .epsilon.-amino group of a Lys residue in an acceptor protein. One function of ubiquitin is to mark proteins destined for selective degradation. Ubiquitin was also shown to have a chaperone function, in that its transient (cotranslational) covalent association with specific ribosomal proteins promotes the assembly of ribosomal subunits.

Unlike branched Ub-protein conjugates, which are formed posttranslationally, linear Ub-protein adducts are formed as the translational products of natural or engineered gene fusions. Thus, in the yeast Saccharomyces cerevisiae for example, ubiquitin is generated exclusively by proteolytic processing of precursors in which ubiquitin is joined either to itself, as in the linear polyubiquitin protein Ubi4, or to unrelated amino acid sequences, as in the hybrid proteins Ubi1-Ubi3. In growing yeast cells, ubiquitin is generated largely from the Ubi1-Ubi3 precursors whose "tails" are specific ribosomal proteins. The polyubiquitin (UB14) gene is dispensable in growing cells but becomes essential (as the main supplier of ubiquitin) during stress. The lack of genes encoding mature ubiquitin, and the fusion structure of ubiquitin precursors in yeast are characteristic of other eukaryotes as well.

Ub-specific, ATP-independent proteases capable of cleaving ubiquitin from its linear or branched conjugates have been detected in all eukaryotes examined but not in bacteria such as Escherichia coli, which lack ubiquitin and Ub-specific enzymes. Miller et al. (Biotechnology 1: 698-704 (1989)) have cloned a S. cerevisiae gene, named YUH1, encoding a Ub-specific protease that cleaves ubiquitin from its relatively short C-terminal extensions but is virtually inactive with larger fusions such as Ub-.beta.-galactosidase (Ub-.beta.gal). Wilkinson et al. (Science 246:670-673 (1989)) have also cloned a eDNA encoding a mammalian homolog of the yeast Yuh1 protease. Tobias and Varshavsky (J. Biol. Chem. 266:12021-12028 (1991)) reported the cloning and functional analysis of another yeast gene, named UBP1, which encodes a Ub-specific processing protease whose amino acid sequence is dissimilar to those of the Yuh1 protease and other known proteins. Unlike YUH1 and its known homologues in other species, Ubp1 deubiquitinates ubiquitin fusion proteins irrespective of their size or the presence of an N-terminal ubiquitin extension.

SUMMARY OF THE INVENTION

The subject invention relates to a generic class of ubiquitin-specific proteases which specifically cleave at the C-terminus of the ubiquitin moiety in a ubiquitin fusion protein irrespective of the size of the ubiquitin fusion protein. More specifically, the invention relates to ubiquitin-specific proteases of this class which have been isolated from a cell. The invention also relates to isolated DNA sequences encoding the proteases of this class.

One useful property of ubiquitin-specific proteases is that they cleave ubiquitin from its C-terminal extensions irrespective of the identity of the extension's residue abutting the cleavage site. This property of the Ubp proteases make possible the in vivo or in vitro generation of proteins or peptides bearing predetermined N-terminal residues, a method with applications in both basic research and biotechnology.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 is a diagram representing the plasmid pJT60.

FIG. 2 is a diagram representing the plasmid pJTUP.

FIG. 3 is a diagram representing a restriction map of UBP2.

FIG. 4 is a diagram representing a restriction map of UBP3.

DETAILED DESCRIPTION OF THE INVENTION

A ubiquitin fusion protein, as used herein, is defined as a fusion protein comprising ubiquitin or its functional homolog having its C-terminal amino acid residue fused to the N-terminal amino acid residue of a non-ubiquitin protein or peptide. As discussed in the Examples which follow, the ubiquitin fusion protein can be a naturally occurring fusion protein, or a fusion protein produced by recombinant DNA technology. The specific cleavage takes place either in vivo or in vitro, between the C-terminal residue of ubiquitin and the N-terminal residue of the protein or peptide.

In contrast to the class of ubiquitin-specific proteases disclosed herein, the previously isolated YUH1 enzyme cleaves ubiquitin off a ubiquitin fusion protein only if the non-ubiquitin portion of the fusion is relatively short (shorter than about 60 residues). Since, for instance, many of the pharmaceutically important proteins are much longer than 60 residues, the YUH1 protease cannot be used to deubiquitinate fusions of these proteins with ubiquitin. The proteases of the class disclosed herein, however, can be used for this purpose, thereby allowing the generation of desired residues at the N-termini of either large or small proteins, polypeptides or peptides (the terms protein, polypeptide and peptide are often used interchangeably in the art).

Disclosed in the Examples which follow are DNA sequences which encode three of the proteases which are members of the class of ubiquitin-specific proteases to which this invention pertains. These proteases have been designated UBP1, UBP2 and UBP3. The DNA sequences which encode these proteases, and their deduced amino acid sequences, are set forth in Sequence I.D. Numbers 3-4, Sequence I.D. Numbers 5-6 and Sequence I.D. Numbers 7-8, respectively. The DNA sequences which encode the proteases disclosed herein can be isolated by the methods described below, or by using the polymerase chain reaction amplification method. Primer sequences to be used in such an amplification method can be determined by reference to the DNA Sequence Listing below.

The proteases UBP1 and UBP2 demonstrate activity both in vivo and in vitro, whereas the UBP3 protease demonstrates activity only in vivo. Each of these proteases has been shown to specifically cleave a ubiquitin fusion protein having a molecular weight of about 120 kilodaltons (ubiquitin-methionine-.beta.-galactosidase). By contrast, the YUH1 ubiquitin-specific protease is virtually inactive with this ubiquitin fusion either in vitro or in vivo. The DNA sequence encoding this 120 kilodalton fusion protein is represented in Sequence I.D. Number 1. The amino acid sequence is represented in Sequence I.D. Numbers 1-2.

The scope of the invention encompasses an isolated DNA sequence encoding a ubiquitin-specific protease, or a biologically active portion thereof, which is characterized by the ability to hybridize specifically with the DNA sequence represented in Sequence I.D. Number 3, Sequence I.D. Number 5 or Sequence I.D. Number 7, under stringent hybridization conditions. DNA sequences which hybridize to the listed sequences under stringent hybridization conditions are either perfectly complementary, or highly homologous to the listed sequence. Homologous, as used herein, refers to DNA sequences which differ from the listed sequence, but the difference has no substantial effect on the biological activity (i.e., cleavage properties) of the encoded protease. One of the possible sets of stringent hybridization conditions is 50% formamide, 5.times.SSPE (1.times.SSPE is 0.15 mNaCl, 1 mM Na-EDTA, 10 mM Na-phosphate, pH 7.0), 5.times.Denhardt's solution (0.1% polyvinylpyrrolidone, 0.1% Ficoll) at 45.degree. C.

The isolated DNA sequences which fall within the scope of this invention can be used to express the encoded protease in large quantities in either prokaryotic or eukaryotic host cells. For this purpose, the DNA is inserted into a prokaryotic or eukaryotic expression vector, with the appropriate regulatory signals, and used to transform cells. A variety of appropriate vectors and regulatory signals have been previously developed for this purpose and are well known to those skilled in the art.

As discussed in the Examples below, the proteases of this invention have been overexpressed in E. coli to the extent that they represent a substantial proportion of the total cellular protein. The purification of a protein which is expressed at such substantial levels, and for which a simple assay system is established, is a straightforward matter to one skilled in the art.

Isolated UBP1 or UBP2, or a cellular extract containing UBP1 or UBP2 produced from a recombinant DNA expression vector can be used to cleave ubiquitin off ubiquitin fusions in vitro. A cellular extract can be prepared from a culture of host cells expressing a recombinant DNA expression vector by simply concentrating and lysing the cell culture. The lysis can be followed, optionally, by various degrees of purification as described above. The range of conditions appropriate for in vitro cleavage can be determined empirically by one skilled in the art, using no more than routine experimentation, from the information provided in the Examples which follow.

In addition, the UBP1, UBP2 and UBP3 proteases can be used to deubiquitinate fusion proteins in vivo. For example, prokaryotic cells harboring an expression vector encoding the protease can be transformed with an expression vector encoding a ubiquitin fusion protein. Such cells will produce a deubiquitinated product having a predetermined N-terminal amino acid residue. There are many well known advantages to producing recombinant proteins in prokaryotic organisms such as E. coli.

In some fusions of ubiquitin to a non-ubiquitin protein or peptide, the presence of the ubiquitin moiety may inhibit or modify the functional activity of the non-ubiquitin protein or peptide. In this case, ubiquitin can be used as a temporary inhibitor (or modifier) of the functional activity of the non-ubiquitin protein or peptide, with the ability to restore the original functional activity at any desired time, either in vitro or in vivo, by contacting the corresponding ubiquitin fusion with the ubiquitin-specific protease to remove the ubiquitin moiety.

The invention is further illustrated by the following Examples.

EXAMPLES

Example I: Cloning and Analysis of UBP1

Preparation of Yeast Genomic DNA Library and Lysate for Screening

Escherichia coli (strain HB101) transformed with a Saccharomyces cerevisiae genomic library was used for a sib selection strategy. The library, RB237, was produced by partially digesting yeast genomic DNA with SauIIIA and ligating the fragments into the BamH1 site in the Tet.RTM. ene of the yeast/E. coil shuttle vector YCp50. Upon initial analysis, the library contained inserts with an average size of .about.19 Kb.

E. coli, transformed with the above library, were plated on agar containing Luria Broth (LB) and ampicillin (amp) (100 .mu.g/ml) at a density of about 40 viable cells per plate. The plates were incubated at 36.degree. C. for 16 hours. The colonies were then replicated onto LB/amp plates. The original plates were stored at 4.degree. C., and their replicas were grown for 24 hours at 36.degree. C. Each replicate was eluted with 1 ml of LB/amp (50 .mu.g/ml) by repeated washing over the surface of the plate until all of the colonies were loosened into the liquid. The entire eluate was then added to 4 ml of LB/amp, and incubated on a roller drum at 36.degree. C. overnight.

The E. coli cells in these overnight (stationary-phase) cultures were then lysed. 1.7 ml of each culture was placed in a microcentrifuge tube on ice, and then centrifuged at 12,000.times. g for 1 min at 4.degree. C. The cell pellet was resuspended, by vortexing at high speed, in 50 .mu.l of 25% sucrose (w/v), 250 mM Tris-HCl (pH 8.0). 10 .mu.l of freshly made lysozyme solution (10 mg/ml chicken egg-white lysozyme (Sigma) in 0.25 M Tris-HCl (pH 8.0)) was then added, and mixed by light vortexing. The suspension was incubated on ice for 5 minutes, 150 .mu.l of 75. mM EDTA, 0.33 M Tris-HCl (pH 8.0) was then added, mixed by light vortexing, and the tube was incubated on ice for 5 minutes with occasional stirring. 1 .mu.l of 10%. Triton X-100 (Pierce) was then added to each tube, and mixed by pipetting. The cell lysate was centrifuged at 12,000.times. g for 15 minutes at 4.degree. C. The supernatant was retained on ice, and the pellet was discarded.

Preparation of Labeled Substrate

Cell lysates were assayed for the Ub-specific protease activity using a .sup.35 S-labeled substrate. .sup.35 S-labeled ubiquitin-methionine-dihydrofolate reductase (Ub-Met-DHFR) was prepared as follows: Luria Broth (50 ml) supplemented with 50 .mu.g/ml ampicillin was inoculated with 1 ml of a saturated overnight culture of E. coli strain JM101 containing a plasmid expressing the Ub-Met-DHFR fusion protein from an IPTG-inducible, highly active derivative of the lac promoter. The cells were grown with shaking at 37.degree. C. until they reached an A.sub.600 of .about.0.9. The culture was chilled on ice for 15 minutes, then centrifuged at 3000.times. g for 5 minutes and washed 2 times with M9 salts at 0.degree. C. The cells were resuspended after the final wash in 25 ml of M9 salts supplemented with 0.2% glucose, 1.8 .mu.g/ml thiamine, 40 .mu.g/ml ampicillin, 1 mM IPTG, 0.0625% (w/v) methionine assay medium (Difco). The suspension was then shaken for 1 hour at 37.degree. C. and the cells were labeled by the addition of 1 mCi of .sup.35 S-Translabel (ICN), followed by a 5-min incubation, with shaking. Unlabeled L-methionine was then added to a final concentration of 0.0032 % (w/v), and the cells were shaken for an additional 10 min. The cells were then harvested (3000.times. g for 5 minutes) and washed once in cold M9 salts. After the M9 wash, the cell pellet was resuspended in 0.5 ml 25% Sucrose, 50 mM Tris-HCl (pH 8.0), and incubated on ice for 5 minutes. During this time, chicken egg-white lysozyme (Sigma) was dissolved freshly in 250 mM Tris-HCl (pH 8.0) to a concentration of 10 mg/ml. 10 .mu.l of the lysozyme solution was added to the cell suspension, mixed, and incubated for 5 minutes at 0.degree. C. 5 .mu.l of 0.5 M EDTA (pH 8.0) was then added, and the suspension left at 0.degree. C. for 5 minutes, with intermittent mixing. The cell suspension was then added to a centrifuge tube containing 0.975 ml of 65 mM EDTA (pH 8.0), 50 mM-Tris-HCl (pH 8.0) and protease inhibitors antipain, chymostatin, leupeptin, aprotinin and pepstatin, each at 25 .mu.g/ml. 10 .mu.l 10% Triton X-100 (Pierce) was then added, and dispersed by pipetting. The lysate was centrifuged at 39,000.times. g for 30 minutes. The supernatant was retained, quickly frozen in liquid nitrogen, and stored at -85.degree. C.

To affinity-purify the .sup.35 S-labeled Ub-Met-DHFR, a methotrexate (MTX)-agarose affinity matrix was prepared according to the method of Kaufman (Meth. Enzymol. 34:272-281 (1974)). A 0.5 ml bed volume column was filled with the MTX-agarose, and washed with 10 ml of MTX column buffer (20 mM Hepes (pH 7.5), 1 mM EDTA 200 mM NaCl, 0.2 mM dithiothreitol). The .sup.35 S-labeled supernatant of the preceding step was thawed and applied to the MTX-agarose column. The column was washed with 50 ml of MTX column buffer, 50 ml of MTX column buffer containing 2M urea, and again with 50 ml of MTX column buffer. The labeled Ub-Met-DHFR was eluted from the column with folic acid elution buffer (0.2M potassium borate (pH 9.0), 1 M KCl, 1 mM DTT, 1 mM EDTA, 10 mM folic acid). The elution buffer was applied to the column in 1 ml aliquots, and 1 ml fractions were collected. The fractions were assayed for .sup.35 S radioactivity and those fractions that contained the major radioactive peak were pooled. The pooled fractions were dialyzed for .about.20 hours against two changes of a storage buffer containing 40 mM Tris-HCl (pH 7.5), 1 mM MgCl.sub.2, 0.1 mM EDTA, 50% glycerol. The purified .sup.35 S-labeled Ub-Met-DHFR was assayed by SDS-PAGE, followed by fluorography and found to be greater than 95% pure.

Deubiquitination Assay

The cell lysates were assayed for the Ub-specific protease activity, by combining 9 .mu.l of the cell lysate supernatant with 1 .mu.l of the affinity purified .sup.35 S-labeled Ub-Met-DHFR fusion in a 0:5 ml microcentrifuge tube, and incubated at 36.degree. C. for 3 hr. 5 .mu.l of a 3-fold concentrated electrophoretic sample buffer (30% glycerol, 3 % SDS (w/v), 15 mM EDTA, 0.2M 2-mercaptoethanol, 0.3 .mu.g/ml bromophenol blue, 375 mM Tris-HCl (pH 6.8) was then added, and each tube was placed in a boiling water bath for 3 min. The samples were loaded onto a 12% polyacrylamide-SDS gel, and electrophoresed at 50 V until the bromophenol dye reached the bottom of the gel. Positions of the radioactively labeled proteins in the gel were visualized by fluorography. The gel was washed in 10% acetic acid, 25% methanol for 15 minutes, rinsed in H.sub.2 O for 15 minutes and incubated with Autofluor (National Diagnostics) for 1 hour. The gel was then dried at 80.degree. C. under vacuum, placed in a light-proof cassette against Kodak XAR-5 film and stored at -85.degree. C. overnight.

The above deubiquitination assay was repeated with lysates from different pools of E. coli transformants until the gel analysis revealed a lysate that displayed protcolytic activity acting at the ubiquitin-DHFR junction. This assay indicated that at least one of the .about.40 E. coli colonies on the original LB/amp plate (from which the pooled lysate had been derived) contained a YCp50-based plasmid having a yeast DNA insert conferring Ub-specific proteolytic activity.

The next step of this sib selection approach to cloning the UBP1 gene was to carry out a similar Ub-Met-DHFR cleavage assay to determine which of the .about.40 colonies in a "positive" pool contained the desired plasmid. To do so, a sample of each individual colony on the plate of interest was inoculated into LB/amp and grown overnight. The Ub-Met-DHFR cleavage assay was then repeated exactly as above, but this time each lysate sample was representative of a single clonal E. coli transformat rather than a mixture of .about.40 such transformants. This analysis revealed a single colony that contained a plasmid which conferred the ability to specifically cleave at the Ub-DHFR junction.

Cloning and DNA Sequence Analysis of UBP1

Analysis of the initially isolated plasmid (pJT55) revealed a .about.15 kb insert of yeast genomic DNA in the YCp50 vector. SphI digestion of this plasmid yielded a .about.14 kb fragment, which, upon subcloning into the vector pUC19, conferred the same protcolytic activity. This plasmid was called pJT57. The .about.14 kb fragment was subcloned further by cutting with SphI and XhoI, isolating the .about.5.5 kb of the insert DNA and subcloning it into the pUC19 vector pre-cut with SphI and SalI. This resulted in .about.8.1 kb plasmid pIT60 containing the .about.5.5 kb yeast DNA insert that conferred the same Ub-specific protcolytic activity as the original plasmid.

A map showing restriction endonuclease recognition sites in plasmid pTT60 is shown in FIG. 1. In the map, base pair positions are indicated by a number in parentheses following a restriction site. The yeast DNA insert in pJT60 contained a KpnI site near its center that divided the insert into two smaller fragments A and B (bases 423 and 5830). In this fragment, the open arrow indicates the Open reading frame (ORF) representing UBP1. The entire ORF, and the thin lines bracketing it, represent the extent of the sequenced DNA shown in Sequence I.D. Number 3. Both fragments were subcloned into pUC19, yielding pJT60A and pJT60B. Fragment A was isolated from pJT57 after cutting with KpnI and SphI. This fragment was subcloned into pUC19 that had been cut with the same restriction endonucleases. Fragment B was isolated from pJT57 that had been cut by KpnI and XhoI; it was subcloned into pUC19 that had been cut by KpnI and SalI. Neither pJT60A nor pJT60B was able to confer Ub-specific proteolytic activity. This result suggested that the gene of interest straddled the KpnI site of the .about.5.5 kb insert of pJT60.

To sequence the cloned gene, the inserts of pJT60A and pJT60B were subcloned into the M13mp19 phage vector. Nucleotide sequence was determined (using the chain termination method) in both directions from the internal KpnI site in pJT60. The KpnI site was found to be ensconced within an open reading frame extending from this site in both directions. Unidirectional deletions were then made in the sequencing templates by the methods of Dale et al., (Plasmid 13:31-40 (1989)) and the entire open reading frame (ORF) was determined. The 5' end of the ORF was in fragment B and the termination codon was in fragment A. The ORF was 2427 nucleotides long, and encoded an 809-residue protein, with a molecular mass of 93 kD. The sequenced ORF was then isolated on a 2.8 kb fragment by cutting pJT60 with AccI, filling in the 5' overhangs with Klenow PolI, and ligating SalI linkers to the blunt ends. This construct was digested with SalI and BamHI, the 2.8 kb fragment was electrophoretically purified and ligated into pUC19 that had been digested with BamHI and SalI. The resulting plasmid was called pJT70. This plasmid, when transformed into E. coli, was able to confer the Ub-specific proteolytic activity to the same extent as either the original .about.15 kb insert in YCp50 or the .about.5.5 kb insert of the pJT60 plasmid that includes the .about.2.8 kb fragment of pJT70. The plasmid pJT60 has been deposited with the American Type Culture Collection (Rockville, Md.), and has been assigned ATCC designation 68211. The 2.8 kb fragment contained no other ORFs of significant size, indicating that the sequenced ORF shown in Sequence I.D. Number 3 encoded the Ub-specific protease. This new gene has been named UBP1, for Ubiquitin-specific protease.

Substrate Specificity of UBP1

The in vitro substrate specificity of the UBP1 encoded product was examined by testing for cleavage using a variety of substrates. These experiments demonstrated the ability of Ubp1 to deubiquitinate �.sup.35 S!Ub-Met-DHFR and �.sup.35 S!ubiquitin-methionine-.beta.-galactosidase (Ub-Met-.beta.gal). The construction of the �.sup.35 S!Ub-Met-.beta.gal fusion protein has been described previously (Bachmair et al., Science 234:179-186 (1986)). The labeled substrates were employed in a deubiquitination assay as described above. Both fusion proteins were specifically deubiquitinated. Fluorograms of electrophoretic patterns from these deubiquitination experiments revealed deubiquitination reaction products of the expected molecular mass.

The Ubp1 protease was alto shown to deubiquitinate natural ubiquitin fusions to yeast ribosomal proteins (Ubi2 and Ubi3) in vitro. An expression construct encoding Ubi2, a natural ubiquitin-ribosomal protein fusion of S. cerevisiae, was used to transform E. coli. A cellular extract from a culture of the transformed cells was treated with an E. coli extract from cells expressing Ubp1, followed by electrophoresis in a polyacrylamide-SDS-gel, blotting onto polyvinylidene difluoride membrane, and detection using a rabbit anti-ubiquitin antibody, with subsequent application of a secondary goat anti-rabbit antibody linked to alkaline phosphatase, and colorgenic substrates of alkaline phosphatase. These experiments demonstrated that an extract from E. coli expressing the Ubp1 gene product effectively deubiquitinated the natural ubiquitin fusion proteins Ubi2 and Ubi3.

To determine whether a sandwich-type ubiquitin fusion protein in which the ubiquitin moiety had an N-terminal extension was a substrate for Ubp1, a plasmid was constructed that encoded a triple fusion protein consisting of an N-terminal dihydrofolate reductase (DHFR) moiety, a flexible linker region of three glycine residues and a serine, followed by ubiquitin and Met-.beta.gal moieties. The mouse DHFR gene was isolated on a BamHI/HindlII fragment from a plasmid encoding Ub-Met-DHFR (Bachmair and Varshavsky, Cell 56:1019-1032 (1989)). This fragment was treated with Klenow PolI to fill in the ends, and KpnI linkers were ligated. The fragment was then cut with KpnI to yield a 678 bp fragment which was cloned into the KpnI site in a modified Ub-Met-.beta.gal expression vector in which the second codon of the ubiquitin moiety was altered to encode a KpnI site (Gonda et al., J. Biol. Chem. 264:16700-16712 (1989)). This procedure yielded a plasmid that encoded DHFR, ubiquitin (without the initial Met codon) and Met-.beta.gal, with the open reading frames for each moiety not yet aligned into a single open reading frame. To effect the alignment of the open reading frames and to position the initiator codon of DHFR correctly with respect to the GAL promoter in the vector, site-directed mutagenesis was performed at two locations in the plasmid.

The plasmid was cut with BamHI and HindIII, and the .about.2.76 kb fragment encoding DHFR, ubiquitin and the first few residues of Met-.beta.gal was cloned into M13mp19 that had been cut with the same enzymes. Oligonucleotide-mediated, site-directed mutagenesis was performed using the single-stranded M13 derivative and standard protocols. The first oligodeoxynucleotide was designed to produce a 20 bp deletion that would bring the initiator codon of DHFR to a proper position relative to the GAL5 promoter of the vector. The second oligodeoxynucleotide was designed to bring together the reading frames of DHFR and ubiquitin, and to introduce the 4-residue spacer (-Gly-Gly-Gly-Ser-) SEQ ID NO:9 between the DHFR and ubiquitin moieties. After mutagenesis, DNA clones were tested for incorporation of both changes by direct nucleotide sequencing using the chain termination method.

Double stranded, replicative form (RF) of the desired M13 clone was isolated and digested with BamHI and XhoI. The resulting .about.1.2 kb fragment was cloned into the .about.9.87 kb fragment of a Ub-Met-.beta.gal expression vector digested with the same enzymes, replacing the Ub-Met-coding fragment with the DHFR-Ub-Met-coding fragment produced by the site-directed mutagenesis. This last step yielded an expression vector that encoded the triple fusion DHFR-Ub-Met-.beta.gal. The vector was named pTJUP (FIG. 2).

pJTUP was used to test whether a ubiquitin fusion in which the ubiquitin moiety is located between two non-ubiquitin moieties would be a substrate for cleavage by Ubp1. In E. coli metabolicaIly labelled with �.sup.35 S!methionine, the fate of expressed DHFR-Ub-Met-.beta.gal was determined in the presence or absence of Ubp1 using immunoprecipitation with a monoclonal antibody to .beta.-galactosidase, followed by polyacrylarnide-SDS gel electrophoresis and fluorography. These experiments demonstrated that UBP1 efficiently cleaves the triple fusion protein.

The ability to cleave such a sandwich construct is particularly useful in situations wherein the first non-ubiquitin moiety confers some desirable property on the sandwich ubiquitin fusion. For example, the first non-ubiquitin moiety may facilitate affinity purification of the ubiquitin fusion protein. In such a case, the fusion protein can be expressed in a cell (e.g., E. coli) that lacks ubiquitin-specific proteases, and a cellular lysate can be passed over an affinity column specific for the first non-ubiquitin moiety. One example of a protein which is useful for affinity purification is streptavidin. Following affinity purification of the fusion protein, the latter is contacted with the ubiquitin-specific protease. The second non-ubiquitin moiety is thereby liberated from the sandwich ubiquitin fusion construct.

Example 2: Cloning and Analysis of UBP2 and UBP3

Cloning Strategy

The strategy employed to clone the genes encoding Ub-specific proteases of S. cerevisiae other than Ubp1 and Yuh 1 took advantage of the fact that bacteria such as E. coli lack ubiquitin and Ub-specific enzymes, and was also based on the recent demonstration that the N-end rule, a relation between the in vivo half-life of a protein and the identity of its N-terminal residue, operates not only in eukaryotes but in E. coli as well. In eukaryotes, ubiquitin fusions to test proteins such as .beta.-galactosidase are deubiquitinated by Ub-specific processing proteases irrespective of the identity of a residue at the Ub-.beta.gal junction, making it possible to expose in vivo different residues at the N-termini of otherwise identical test proteins. This technique, required for detection and analysis of the N-end rule in eukaryotes, has been made applicable in bacteria through the isolation of the yeast UBP1 gene (see Example 1), inasmuch as E. coli transformed with UBP1 acquires the ability to deubiquitinate ubiquitin fusions. The finding that an X-.beta.gal test protein such as Arg-.beta.gal is short-lived in E. coli, whereas Ub-Arg-.beta.gal is long-lived, made possible a new E. coli-based in vivo screen for Ub-specific proteases. E. coli expressing the (long-lived) Ub-Arg-.beta.gal fusion protein form blue colonies on plates containing X-Gat, a chromogenie substrate of .beta.gal. However, if a deubiquitinating activity is present in the cells as well, Ub-Arg-.beta.gal is converted into a short-lived Arg-.beta.gal, whose low steady-state level results in white E. coli colonies on X-Gal plates.

To be clonable by this strategy using a conventional yeast genomic DNA library, a yeast gene must have a promoter that functions in E. coli (a minority of yeast promoters can do so), must lack introns in its coding region (most yeast genes lack introns), and must encode a Ub-specific processing protease that functions as a monomer or a homooligomer. One advantage of this in vivo screen over the previously used in vitro screen that yielded UBP1 is that the former requires a relevant protease to be active in vivo but not necessarily in vitro (in E. coli extracts).

Plasmids Expressing Ubiquitin-Containing Test Proteins

The plasmid pACUb-R-.beta.gal, expressing Ub-Arg-.beta.gal, was constructed by subcloning the .about.5 kb ScaI fragment of pUB23-R (Bachmalt et al., Science 234:179-186 (1986)) that contains the Ub-Arg-.beta.gal coding region downstream from the GAL10 promoter, into HincII-digested pACYC 184, whose P 15A origin of replication makes this plasmid compatible with pMB1(ColE1)-based E. coli vectors such as pUC19 and pBR322. pACUb-R-.beta.gal expressed Ub-Arg-.beta.gal in E. coli from the galactose-inducible yeast GAL10 promoter, which functions as a weak constitutive promoter in E. coil. The plasmid pACUb-M-.beta.gal, expressing Ub-Met-.beta.al, was constructed identically to pACUb-R-.beta.gal except that pUB23-M was used instead of pUB23-R. Plasmids pKKUBI2, pKKUBI3 and pUB17 expressed in E. coli the natural yeast ubiquitin fusions (ubiquitin precursors) Ubi2, Ubi3 and Ubi4 (polyubiquitin), respectively (Ozkaynak et al., EMBO J. 6:1429-1439 (1987)), using an isopropylthiogalactoside (IPTG)-inducible promoter in the vector pKK223-3 (Ausubel et al., Current Protocols in Molecular Biology, J. Wiley & Sons, N.Y. (1989)). The plasmids pKKHUb2 and pKKHUb3 that expressed, respectively, the human diubiquitin and triubiquitin (both of which contain the naturally occurring 1-residue C-terminal extension, cysteine), were constructed as follows. A 1.77 kb BamHI fragment containing the human UbB (triubiquitin) gene from the plasmid pB8.3 was ligated into BamHI-digested pUC19 in the orientation that placed the 3' end of UbB adjacent to the SmaI site of the polylinker in pUC19, yielding pUbB. A 1.04 kb DraI/SmaI fragment of pUbB containing the Ub13 coding and 3' flanking regions (the DraI site is located 10 bp upstream of the UbB start codon) was subcloned into the SmaI/HincII-digested pUC19, placing the UbB start codon adjacent to the EcoRI site in the polylinker, and yielding pHUb3. This plasmid was partially digested with SalI, which cleaves once within each Ub-coding repeat (the polylinker's SaII site was removed during the construction of pHUb3); the vector-containing fragment that retained two Ub-coding repeats was isolated and self-ligated, yielding pHUb2. The inserts of pHUb2 and pHUb3 were excised with EcoRI and PstI, and subcloned into the EcoRI/PstI-cut pKK223-3, yielding, respectively, pKKHUb2 and pKKHUb3. The start codon of the Ub-coding region in these plasmids is 36 bp downstream of the Shine-Dalgarno sequence in pKK223-3.

Screening Results

E. coli carrying a plasmid expressing Ub-Arg-.beta.gal were transformed with the S. cerevisiae genomic DNA library RB237 carried in the plasmid YCp50, plated on X-Gal plates containing antibiotics that selected for the presence of both .plasmids, and incubated overnight at 37.degree. C. Of .about.800 colonies thus screened, six (named pRBW1-pRBW6) were white or pale blue, whereas the other colonies were dark blue (comparable to control colonies of E. coli transformed with the YCp50 vector alone). Three of the six candidate colonies were found to be false positives, two contained plasmids (termed pRBW1 and pRBW6) with overlapping inserts of yeast DNA, while the remaining colony contained a plasmid (termed pRBW2) with a distinct yeast DNA insert. Plasmids pRBW1 and pRBW2 were isolated and retransformed into E. coli expressing either Ub-Arg-.beta.gal or Ub-Met-.beta.gal. Transformants expressing Ub-Arg-.beta.gal formed white colonies on X-Gal plates, confirming the original results, whereas transformants expressing Ub-Met-.beta.gal formed blue colonies on these plates, indicating that the metabolic destabilization of Ub-Arg-.beta.gal by inserts in pRBW1 and pRBW2 was N-end rule-specific. (Arg and Met are, respectively, destabilizing and stabilizing residues in the E. coli N-end rule).

Surprisingly, extracts of E. coli carrying pRBW1 or pRBW2 were inactive in an in vitro deubiquitinating assay with Ub-Met-DHFR, suggesting that Ub-specific proteases encoded by pRBW1 and pRBW2 were either inactivated in cell extracts or, alternatively, could deubiquitinate ubiquitin fusions cotranslationally but not posttranslationally. The Ub-specific protease activities conferred by pRBW1 and pRBW2 on E. coli were therefore assayed in vivo by pulse-chase analyses with Ub-Met-.beta.gal, using a monoclonal antibody to .beta.gal. The results confirmed that pRBW1 and pRBW2 (but not the YCp50 vector alone) did confer deubiquitinating activity on E. coli. Subsequent overexpression of Ub-specific proteases encoded by pRBW1 and pRBW2 made possible their detection in E. coli extracts as well.

The ORF encoding deubiquitinating activity of pRBW2 was identified by subcloning experiments and nucleotide sequencing, and was named the UBP2 gene (FIG. 3 and Sequence I.D. Number 5). The position of the start (ATG) codon in the UBP2 was inferred so as to yield the longest (3715 bp) ORF encoding an acidic (calculated pI of 4.95), 1264-residue (145 kDa) protein.

The ORF encoding deubiquitinating protease of pRBW1 was identified by subcloning experiments and nucleotide sequencing, and was named the UBP3 gene (FIGS. 4 and Sequence I.D. Number 7). The position of the start (ATG) codon was inferred so as to yield the longest (2736 bp) ORF, which encodes a slightly basic (calculated pI of 7.92), 912-residue (102 kDa) protein. A plasmid (pRB143) containing this ORF downstream of an E. coli promoter conferred deubiquitinating activity on E. coli.

Expression of UBP1, UBP2 and UBP3 in E. coli

The previously constructed plasmids pJT70 (pUC19-based) and pJT184 (pACYC184-based) expressed the yeast UBP1 in E. coli from the yeast UBP1 promoter, which is weakly active in E. coli. Although a 1.9 kb HindlII subclone of pRBW2 conferred deubiquitinating activity on E. coli, it contained only the 3' half of the UBP20RF. Pilot experiments indicated that the truncated Ubp2 protein yielded variable levels of deubiquitinating activity in E. coli extracts. To construct a plasmid that expressed the full-length Ubp2 in E. coli, a 5' portion of UBP2, isolated as the 1.56 kb HindlII/XbaI fragment of pRB6 (see FIG. 3), was subcloned into pRS316 (Sikorski and Hieter, Genetics 122: 19-27 (1989)), which contains a polylinker, placing an EcoRI site close to the HindlII site in UBP2. The resulting insert was then excised as the 1.57 kb EcoRI/XbaI fragment. A 3' portion of UBP2 was isolated as the .about.3.4 kb XbaI/BamHI fragment from pRB11 (see FIG. 3), and subcloned into pRS316, placing a PstI site close to the BamHI site in UBP2. The resulting insert was then excised as a .about.3.4 kb XbaI/PstI fragment. This fragment and the above 1.57 kb EcoRI/XbaI fragment were ligated into the EcoRI/XbaI-cut pKK223-3, yielding (among other products) the plasmid pRB105, which contained UBP2 in the correct orientation, 50 bp downstream from the Shine-Dalgamo sequence of pKK223-3. For experiments requiting the simultaneous presence of two distinct plasmids in E. coli, the UBP2/rrnB terminator region of pRB105 was excised as the .about.6.4 kb SphI/ScaI fragment, and subcloned into the SphI/EcoRV-cut pACYC184, yielding pRB173.

Since in the initial experiments, the Ub-specific protease activity of Ubp3 could be detected in vivo but not in E. coli extracts, a UBP3-overexpressing plasmid was constructed. The .about.2.9 kb KpnI/DraI fragment of pRB27 that contained the entire UBP3 gene was subcloned into the KpnI/HincII-cut pUC19, placing the EcoRI and the PstI site of the plasmid near, respectively, the KpnI site and the DraI site of the introduced insert. The insert was then excised with EcoRI/PstI and subcloned into the EcoPJ/PstI-cut pKK223-3, yielding pRB143, which contained UBP3 in the correct orientation, 50 bp downstream form the Shine-Dalgarno sequence of pKK223-3. For experiments requiring the simultaneous presence of two distinct plasmids in E. coli, the UBP3/rrnB terminator region of pRB143 was excised as the .about.4.2 kb SphI/ScaI fragment and subcloned into the SphI/EcoRV-cut pACYC184, yielding pRB 175.

In more recent experiments, UBP1, UBP2 and UBP3 were overexpressed in E. coli from a pKK-based expression vector (Ausubel et al., Current Protocols in Molecular Biology, J. Wiley & Sons, N.Y. (1989)). Each of the UBP proteins was expressed to a level where it comprises a substantial proportion (1-5%) of the total cellular protein.

Sequence Comparisons of Ub-specific Proteases

Sequence alignment of the 809-residue Ubp1, 1264-residue Ubp2 and 912-residue Ubp3 demonstrated the lack of overall sequence similarity between these proteins, as well as the presence of two short regions of statistically significant similarity that are spaced a few hundred residues apart in each of the Ubp proteases. The two regions of similarity are centered around a Cys and two His residues. As has been seen with Ubp1, neither Ubp2 nor Ubp3 have significant sequence similarities to the fourth Ub-specific protease of yeast, Yuh1 or its mammalian homologs. The region in Yuh1 and its mammalian homologs that contains a putative active-site Cys residue is not similar to the conserved "Cys" region of Ubp1-Ubp3: apart from the Cys residue, only one other residue position is occupied by an identical residue (Asn) in all six proteins. No such identities are seen in an analogous alignment of the two conserved His residues in Yuh1-like proteases with either of the conserved His residues in Ubp1-Ubp3.

In Vitro Properties of Ub-specific Proteases

The previously characterized Ubp1 protease can efficiently deubiquitinate in vitro a variety of linear ubiquitin fusion proteins, including the natural ubiquitin precursors Ubi1-Ubi3 and engineered fusions such as Ub-X-.beta.gal and Ub-X-DHFR. Similar assays, in which an extract of E. coli carrying an overexpression vector-based plasmid expressing either Ubp2 (pRB105), Ubp3 (pRB143), or Yuh1 (pKKYUH1) is incubated with Ub-containing test proteins, were used to analyze in vitro the substrate specificity of these proteases. Extracts of E. coli carrying the UBP1-expressing plasmid pJT70 or vector alone, were also used in these assays. The cleavage products were fractionated by SDS-PAGE and visualized by immunoblotting, using anti-Ub antibodies or, with purified, .sup.35 S-labeled test proteins, directly by fluorography.

In these in vitro assays, the Ubp2 protease efficiently deubiquitinated Ub-Met-.beta.gal and Ub-Met-DHFR, as well as Ubi2 and Ubi3, the natural precursors of ubiquitin, in which it is fused to specific ribosomal proteins. Both Ubp1 and Ubp2 released the Cys residue from Ub-Ub-Cys (diubiquitin bearing a one-residue C-terminal extension) but were unable to cleave at the Ub-Ub junction in Ub-Ub-Cys. Ubp1 and Ubp2 were also unable to cleave at the Ub-Ub junctions in the yeast polyubiquitin, a natural ubiquitin precursor containing five head-to-tail ubiquitin repeats as was previously reported for Ubp1. Thus, Ubp1 and Ubp2 efficiently cleaved in vitro after the last (Gly.sup.76) residue of ubiquitin in all of the tested ubiquitin fusions, the Ub-Ub linkage in polyubiquitins being the single exception. However, as shown below, these proteases are able to cleave polyubiquitin when coexpressed with it E. coli.

Although the expression of Ubp3 in E. coli from the pKK overexpression vector-based plasmid pRB143 resulted in a substantial overproduction of a protein with the expected molecular mass, extracts of Ubp3-expressing E. coli lacked deubiquitinating activity. Since Ubp3 is certainly active in E. coli in vivo, it is either inactivated in cell extracts or is able to cleave ubiquitin fusions exclusively during or shortly after their ribosome-mediated synthesis.

In agreement with previously reported findings, extracts of E. coli expressing Yuh1 efficiently deubiquitinated short ubiquitin fusions such as Ubi2 and Ubi3. However, Yuh1 was much less active against the larger fusion Ub-Met-DHFR (a 229-residue C-terminal extension of ubiquitin), deubiquitinating at most .about.50% of the fusion even after a prolonged incubation, and was virtually inactive against Ub-Met-.beta.gal (Sequence I.D. Numbers 1-2).

In Vivo Properties of Ub-specific Proteases

As expected from their activities in E. coli extracts, both Ubp1, Ubp2 and Yuh1 were active in vivo against the natural ubiquitin fusions Ubi2 and Ubi3. Ubp3, which was inactive in E. coli extracts, efficiently deubiquitinated Ubi2 and Ubi3 when coexpressed with them in E. coli While Ubp1 and Ubp2 were unable to cleave at the Ub-Ub junction in polyubiquitins in vitro, both of them were active against yeast polyubiquitin when coexpressed with it in E. coli. In contrast, the Ubp3 protease, while active in vivo against ubiquitin fusions such as Ubi2 and Ubi3, was inactive, under the same conditions, against polyubiquitin. These distinctions among Ub-specific processing proteases indicate subtle differences in their requirements for the conformation of protein domains in the vicinities of Ub-X peptide bonds.

The in vivo deubiquitination of ubiquitin fusions such as Ub-Met-.beta.gal by Ubp2 and Ubp3 was also followed by pulse-chase analysis, in part to confirm the findings of the original X-Gal screen. As expected, both proteases deubiquitinated Ub-Met-.beta.gal in vivo, except that the cleavage by Ubp3 was incomplete, and a significant proportion of pulse-labeled Ub-Met-.beta.gal remained intact 15 min after the pulse. These results are consistent with the pattern of deubiquitination by Ubp3 that is more strictly cotranslational than that by Ubp2. In a similar pulse-chase assay, Yuh1 was unable to deubiquitinate Ub-Met-.beta.gal in vivo, indicating that an apparently greater susceptibility of the Ub-Met peptide bond in a nascent (as distinguished from mature) Ub-Met-.beta.gal is insufficient to allow its deubiquitination by Yuh1. By contrast, this difference is sufficient to allow a cotranslational (but apparently not posttranslational) deubiquitination of Ub-Met-.beta.gal by Ubp3.

Equivalents

Those skilled in the art will recognize or be able to ascertain, using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the claims which follow the Sequence Listing.

__________________________________________________________________________SEQUENCE LISTING(1) GENERAL INFORMATION:(iii) NUMBER OF SEQUENCES: 9(2) INFORMATION FOR SEQ ID NO:1:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 3365 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: linear(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: 1..3363(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:ATGCAGATTTTCGTCAAGACTTTGACCGGTAAAACCATAACATTGGAA48MetGlnIlePheValLysThrLeuThrGlyLysThrIleThrLeuGlu151015GTTGAATCTTCCGATACCATCGACAACGTTAAGTCGAAAATTCAAGAC96ValGluSerSerAspThrIleAspAsnValLysSerLysIleGlnAsp202530AAGGAAGGTATCCCTCCAGATCAACAAAGATTGATCTTTGCCGGTAAG144LysGluGlyIleProProAspGlnGlnArgLeuIlePheAlaGlyLys354045CAGCTAGAAGACGGTAGAACGCTGTCTGATTACAACATTCAGAAGGAG192GlnLeuGluAspGlyArgThrLeuSerAspTyrAsnIleGlnLysGlu505560TCCACCTTACATCTTGTGCTAAGGCTAAGAGGTGGTATGCACGGATCC240SerThrLeuHisLeuValLeuArgLeuArgGlyGlyMetHisGlySer65707580GGAGCTTGGCTGTTGCCCGTCTCACTGGTGAAAAGAAAAACCACCCTG288GlyAlaTrpLeuLeuProValSerLeuValLysArgLysThrThrLeu859095GCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTA336AlaProAsnThrGlnThrAlaSerProArgAlaLeuAlaAspSerLeu100105110ATGCAGCTGGCACGACAGGTTTCCCGACTTAATCGCCTTGCAGCACAT384MetGlnLeuAlaArgGlnValSerArgLeuAsnArgLeuAlaAlaHis115120125CCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGC432ProProPheAlaSerTrpArgAsnSerGluGluAlaArgThrAspArg130135140CCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGCGCTTTGCCTGG480ProSerGlnGlnLeuArgSerLeuAsnGlyGluTrpArgPheAlaTrp145150155160TTTCCGGCACCAGAAGCGGTGCCGGAAAGCTGGCTGGAGTGCGATCTT528PheProAlaProGluAlaValProGluSerTrpLeuGluCysAspLeu165170175CCTGAGGCCGATACTGTCGTCGTCCCCTCAAACTGGCAGATGCACGGT576ProGluAlaAspThrValValValProSerAsnTrpGlnMetHisGly180185190TACGATGCGCCCATCTACACCAACGTAACCTATCCCATTACGGTCAAT624TyrAspAlaProIleTyrThrAsnValThrTyrProIleThrValAsn195200205CCGCCGTTTGTTCCCACGGAGAATCCGACGGGTTGTTACTCGCTCACA672ProProPheValProThrGluAsnProThrGlyCysTyrSerLeuThr210215220TTTAATGTTGATGAAAGCTGGCTACAGGAAGGCCAGACGCGAATTATT720PheAsnValAspGluSerTrpLeuGlnGluGlyGlnThrArgIleIle225230235240TTTGATGGCGTTAACTCGGCGTTTCATCTGTGGTGCAACGGGCGCTGG768PheAspGlyValAsnSerAlaPheHisLeuTrpCysAsnGlyArgTrp245250255GTCGGTTACGGCCAGGACAGTCGTTTGCCGTCTGAATTTGACCTGAGC816ValGlyTyrGlyGlnAspSerArgLeuProSerGluPheAspLeuSer260265270GCATTTTTACGCGCCGGAGAAAACCGCCTCGCGGTGATGGTGCTGCGT864AlaPheLeuArgAlaGlyGluAsnArgLeuAlaValMetValLeuArg275280285TGGAGTGACGGCAGTTATCTGGAAGATCAGGATATGTGGCGGATGAGC912TrpSerAspGlySerTyrLeuGluAspGlnAspMetTrpArgMetSer290295300GGCATTTTCCGTGACGTCTCGTTGCTGCATAAACCGACTACACAAATC960GlyIlePheArgAspValSerLeuLeuHisLysProThrThrGlnIle305310315320AGCGATTTCCATGTTGCCACTCGCTTTAATGATGATTTCAGCCGCGCT1008SerAspPheHisValAlaThrArgPheAsnAspAspPheSerArgAla325330335GTACTGGAGGCTGAAGTTCAGATGTGCGGCGAGTTGCGTGACTACCTA1056ValLeuGluAlaGluValGlnMetCysGlyGluLeuArgAspTyrLeu340345350CGGGTAACAGTTTCTTTATGGCAGGGTGAAACGCAGGTCGCCAGCGGC1104ArgValThrValSerLeuTrpGlnGlyGluThrGlnValAlaSerGly355360365ACCGCGCCTTTCGGCGGTGAAATTATCGATGAGCGTGGTGGTTATGCC1152ThrAlaProPheGlyGlyGluIleIleAspGluArgGlyGlyTyrAla370375380GATCGCGTCACACTACGTCTGAACGTCGAAAACCCGAAACTGTGGAGC1200AspArgValThrLeuArgLeuAsnValGluAsnProLysLeuTrpSer385390395400GCCGAAATCCCGAATCTCTATCGTGCGGTGGTTGAACTGCACACCGCC1248AlaGluIleProAsnLeuTyrArgAlaValValGluLeuHisThrAla405410415GACGGCACGCTGATTGAAGCAGAAGCCTGCGATGTCGGTTTCCGCGAG1296AspGlyThrLeuIleGluAlaGluAlaCysAspValGlyPheArgGlu420425430GTGCGGATTGAAAATGGTCTGCTGCTGCTGAACGGCAAGCCGTTGCTG1344ValArgIleGluAsnGlyLeuLeuLeuLeuAsnGlyLysProLeuLeu435440445ATTCGAGGCGTTAACCGTCACGAGCATCATCCTCTGCATGGTCAGGTC1392IleArgGlyValAsnArgHisGluHisHisProLeuHisGlyGlnVal450455460ATGGATGAGCAGACGATGGTGCAGGATATCCTGCTGATGAAGCAGAAC1440MetAspGluGlnThrMetValGlnAspIleLeuLeuMetLysGlnAsn465470475480AACTTTAACGCCGTGCGCTGTTCGCATTATCCGAACCATCCGCTGTGG1488AsnPheAsnAlaValArgCysSerHisTyrProAsnHisProLeuTrp485490495TACACGCTGTGCGACCGCTACGGCCTGTATGTGGTGGATGAAGCCAAT1536TyrThrLeuCysAspArgTyrGlyLeuTyrValValAspGluAlaAsn500505510ATTGAAACCCACGGCATGGTGCCAATGAATCGTCTGACCGATGATCCG1584IleGluThrHisGlyMetValProMetAsnArgLeuThrAspAspPro515520525CGCTGGCTACCGGCGATGAGCGAACGCGTAACGCGAATGGTGCAGCGC1632ArgTrpLeuProAlaMetSerGluArgValThrArgMetValGlnArg530535540GATCGTAATCACCCGAGTGTGATCATCTGGTCGCTGGGGAATGAATCA1680AspArgAsnHisProSerValIleIleTrpSerLeuGlyAsnGluSer545550555560GGCCACGGCGCTAATCACGACGCGCTGTATCGCTGGATCAAATCTGTC1728GlyHisGlyAlaAsnHisAspAlaLeuTyrArgTrpIleLysSerVal565570575GATCCTTCCCGCCCGGTGCAGTATGAAGGCGGCGGAGCCGACACCACG1776AspProSerArgProValGlnTyrGluGlyGlyGlyAlaAspThrThr580585590GCCACCGATATTATTTGCCCGATGTACGCGCGCGTGGATGAAGACCAG1824AlaThrAspIleIleCysProMetTyrAlaArgValAspGluAspGln595600605CCCTTCCCGGCTGTGCCGAAATGGTCCATCAAAAAATGGCTTTCGCTA1872ProPheProAlaValProLysTrpSerIleLysLysTrpLeuSerLeu610615620CCTGGAGAGACGCGCCCGCTGATCCTTTGCGAATACGCCCACGCGATG1920ProGlyGluThrArgProLeuIleLeuCysGluTyrAlaHisAlaMet625630635640GGTAACAGTCTTGGCGGTTTCGCTAAATACTGGCAGGCGTTTCGTCAG1968GlyAsnSerLeuGlyGlyPheAlaLysTyrTrpGlnAlaPheArgGln645650655TATCCCCGTTTACAGGGCGGCTTCGTCTGGGACTGGGTGGATCAGTCG2016TyrProArgLeuGlnGlyGlyPheValTrpAspTrpValAspGlnSer660665670CTGATTAAATATGATGAAAACGGCAACCCGTGGTCGGCTTACGGCGGT2064LeuIleLysTyrAspGluAsnGlyAsnProTrpSerAlaTyrGlyGly675680685GATTTTGGCGATACGCCGAACGATCGCCAGTTCTGTATGAACGGTCTG2112AspPheGlyAspThrProAsnAspArgGlnPheCysMetAsnGlyLeu690695700GTCTTTGCCGACCGCACGCCGCATCCAGCGCTGACGGAAGCAAAACAC2160ValPheAlaAspArgThrProHisProAlaLeuThrGluAlaLysHis705710715720CAGCAGCAGTTTTTCCAGTTCCGTTTATCCGGGCAAACCATCGAAGTG2208GlnGlnGlnPhePheGlnPheArgLeuSerGlyGlnThrIleGluVal725730735ACCAGCGAATACCTGTTCCGTCATAGCGATAACGAGCTCCTGCACTGG2256ThrSerGluTyrLeuPheArgHisSerAspAsnGluLeuLeuHisTrp740745750ATGGTGGCGCTGGATGGTAAGCCGCTGGCAAGCGGTGAAGTGCCTCTG2304MetValAlaLeuAspGlyLysProLeuAlaSerGlyGluValProLeu755760765GATGTCGCTCCACAAGGTAAACAGTTGATTGAACTGCCTGAACTACCG2352AspValAlaProGlnGlyLysGlnLeuIleGluLeuProGluLeuPro770775780CAGCCGGAGAGCGCCGGGCAACTCTGGCTCACAGTACGCGTAGTGCAA2400GlnProGluSerAlaGlyGlnLeuTrpLeuThrValArgValValGln785790795800CCGAACGCGACCGCATGGTCAGAAGCCGGGCACATCAGCGCCTGGCAG2448ProAsnAlaThrAlaTrpSerGluAlaGlyHisIleSerAlaTrpGln805810815CAGTGGCGTCTGGCGGAAAACCTCAGTGTGACGCTCCCCGCCGCGTCC2496GlnTrpArgLeuAlaGluAsnLeuSerValThrLeuProAlaAlaSer820825830CACGCCATCCCGCATCTGACCACCAGCGAAATGGATTTTTGCATCGAG2544HisAlaIleProHisLeuThrThrSerGluMetAspPheCysIleGlu835840845CTGGGTAATAAGCGTTGGCAATTTAACCGCCAGTCAGGCTTTCTTTCA2592LeuGlyAsnLysArgTrpGlnPheAsnArgGlnSerGlyPheLeuSer850855860CAGATGTGGATTGGCGATAAAAAACAACTGCTGACGCCGCTGCGCGAT2640GlnMetTrpIleGlyAspLysLysGlnLeuLeuThrProLeuArgAsp865870875880CAGTTCACCCGTGCACCGCTGGATAACGACATTGGCGTAAGTGAAGCG2688GlnPheThrArgAlaProLeuAspAsnAspIleGlyValSerGluAla885890895ACCCGCATTGACCCTAACGCCTGGGTCGAACGCTGGAAGGCGGCGGGC2736ThrArgIleAspProAsnAlaTrpValGluArgTrpLysAlaAlaGly900905910CATTACCAGGCCGAAGCAGCGTTGTTGCAGTGCACGGCAGATACACTT2784HisTyrGlnAlaGluAlaAlaLeuLeuGlnCysThrAlaAspThrLeu915920925GCTGATGCGGTGCTGATTACGACCGCTCACGCGTGGCAGCATCAGGGG2832AlaAspAlaValLeuIleThrThrAlaHisAlaTrpGlnHisGlnGly930935940AAAACCTTATTTATCAGCCGGAAAACCTACCGGATTGATGGTAGTGGT2880LysThrLeuPheIleSerArgLysThrTyrArgIleAspGlySerGly945950955960CAAATGGCGATTACCGTTGATGTTGAAGTGGCGAGCGATACACCGCAT2928GlnMetAlaIleThrValAspValGluValAlaSerAspThrProHis965970975CCGGCGCGGATTGGCCTGAACTGCCAGCTGGCGCAGGTAGCAGAGCGG2976ProAlaArgIleGlyLeuAsnCysGlnLeuAlaGlnValAlaGluArg980985990GTAAACTGGCTCGGATTAGGGCCGCAAGAAAACTATCCCGACCGCCTT3024ValAsnTrpLeuGlyLeuGlyProGlnGluAsnTyrProAspArgLeu99510001005ACTGCCGCCTGTTTTGACCGCTGGGATCTGCCATTGTCAGACATGTAT3072ThrAlaAlaCysPheAspArgTrpAspLeuProLeuSerAspMetTyr101010151020ACCCCGTACGTCTTCCCGAGCGAAAACGGTCTGCGCTGCGGGACGCGC3120ThrProTyrValPheProSerGluAsnGlyLeuArgCysGlyThrArg1025103010351040GAATTGAATTATGGCCCACACCAGTGGCGCGGCGACTTCCAGTTCAAC3168GluLeuAsnTyrGlyProHisGlnTrpArgGlyAspPheGlnPheAsn104510501055ATCAGCCGCTACAGTCAACAGCAACTGATGGAAACCAGCCATCGCCAT3216IleSerArgTyrSerGlnGlnGlnLeuMetGluThrSerHisArgHis106010651070CTGCTGCACGCGGAAGAAGGCACATGGCTGAATATCGACGGTTTCCAT3264LeuLeuHisAlaGluGluGlyThrTrpLeuAsnIleAspGlyPheHis107510801085ATGGGGATTGGTGGCGACGACTCCTGGAGCCCGTCAGTATCGGCGGAA3312MetGlyIleGlyGlyAspAspSerTrpSerProSerValSerAlaGlu109010951100TTCCAGCTGAGCGCCGGTCGCTACCATTACCAGTTGGTCTGGTGTCAA3360PheGlnLeuSerAlaGlyArgTyrHisTyrGlnLeuValTrpCysGln1105111011151120AAATA3365Lys(2) INFORMATION FOR SEQ ID NO:2:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 1121 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:MetGlnIlePheValLysThrLeuThrGlyLysThrIleThrLeuGlu151015ValGluSerSerAspThrIleAspAsnValLysSerLysIleGlnAsp202530LysGluGlyIleProProAspGlnGlnArgLeuIlePheAlaGlyLys354045GlnLeuGluAspGlyArgThrLeuSerAspTyrAsnIleGlnLysGlu505560SerThrLeuHisLeuValLeuArgLeuArgGlyGlyMetHisGlySer65707580GlyAlaTrpLeuLeuProValSerLeuValLysArgLysThrThrLeu859095AlaProAsnThrGlnThrAlaSerProArgAlaLeuAlaAspSerLeu100105110MetGlnLeuAlaArgGlnValSerArgLeuAsnArgLeuAlaAlaHis115120125ProProPheAlaSerTrpArgAsnSerGluGluAlaArgThrAspArg130135140ProSerGlnGlnLeuArgSerLeuAsnGlyGluTrpArgPheAlaTrp145150155160PheProAlaProGluAlaValProGluSerTrpLeuGluCysAspLeu165170175ProGluAlaAspThrValValValProSerAsnTrpGlnMetHisGly180185190TyrAspAlaProIleTyrThrAsnValThrTyrProIleThrValAsn195200205ProProPheValProThrGluAsnProThrGlyCysTyrSerLeuThr210215220PheAsnValAspGluSerTrpLeuGlnGluGlyGlnThrArgIleIle225230235240PheAspGlyValAsnSerAlaPheHisLeuTrpCysAsnGlyArgTrp245250255ValGlyTyrGlyGlnAspSerArgLeuProSerGluPheAspLeuSer260265270AlaPheLeuArgAlaGlyGluAsnArgLeuAlaValMetValLeuArg275280285TrpSerAspGlySerTyrLeuGluAspGlnAspMetTrpArgMetSer290295300GlyIlePheArgAspValSerLeuLeuHisLysProThrThrGlnIle305310315320SerAspPheHisValAlaThrArgPheAsnAspAspPheSerArgAla325330335ValLeuGluAlaGluValGlnMetCysGlyGluLeuArgAspTyrLeu340345350ArgValThrValSerLeuTrpGlnGlyGluThrGlnValAlaSerGly355360365ThrAlaProPheGlyGlyGluIleIleAspGluArgGlyGlyTyrAla370375380AspArgValThrLeuArgLeuAsnValGluAsnProLysLeuTrpSer385390395400AlaGluIleProAsnLeuTyrArgAlaValValGluLeuHisThrAla405410415AspGlyThrLeuIleGluAlaGluAlaCysAspValGlyPheArgGlu420425430ValArgIleGluAsnGlyLeuLeuLeuLeuAsnGlyLysProLeuLeu435440445IleArgGlyValAsnArgHisGluHisHisProLeuHisGlyGlnVal450455460MetAspGluGlnThrMetValGlnAspIleLeuLeuMetLysGlnAsn465470475480AsnPheAsnAlaValArgCysSerHisTyrProAsnHisProLeuTrp485490495TyrThrLeuCysAspArgTyrGlyLeuTyrValValAspGluAlaAsn500505510IleGluThrHisGlyMetValProMetAsnArgLeuThrAspAspPro515520525ArgTrpLeuProAlaMetSerGluArgValThrArgMetValGlnArg530535540AspArgAsnHisProSerValIleIleTrpSerLeuGlyAsnGluSer545550555560GlyHisGlyAlaAsnHisAspAlaLeuTyrArgTrpIleLysSerVal565570575AspProSerArgProValGlnTyrGluGlyGlyGlyAlaAspThrThr580585590AlaThrAspIleIleCysProMetTyrAlaArgValAspGluAspGln595600605ProPheProAlaValProLysTrpSerIleLysLysTrpLeuSerLeu610615620ProGlyGluThrArgProLeuIleLeuCysGluTyrAlaHisAlaMet625630635640GlyAsnSerLeuGlyGlyPheAlaLysTyrTrpGlnAlaPheArgGln645650655TyrProArgLeuGlnGlyGlyPheValTrpAspTrpValAspGlnSer660665670LeuIleLysTyrAspGluAsnGlyAsnProTrpSerAlaTyrGlyGly675680685AspPheGlyAspThrProAsnAspArgGlnPheCysMetAsnGlyLeu690695700ValPheAlaAspArgThrProHisProAlaLeuThrGluAlaLysHis705710715720GlnGlnGlnPhePheGlnPheArgLeuSerGlyGlnThrIleGluVal725730735ThrSerGluTyrLeuPheArgHisSerAspAsnGluLeuLeuHisTrp740745750MetValAlaLeuAspGlyLysProLeuAlaSerGlyGluValProLeu755760765AspValAlaProGlnGlyLysGlnLeuIleGluLeuProGluLeuPro770775780GlnProGluSerAlaGlyGlnLeuTrpLeuThrValArgValValGln785790795800ProAsnAlaThrAlaTrpSerGluAlaGlyHisIleSerAlaTrpGln805810815GlnTrpArgLeuAlaGluAsnLeuSerValThrLeuProAlaAlaSer820825830HisAlaIleProHisLeuThrThrSerGluMetAspPheCysIleGlu835840845LeuGlyAsnLysArgTrpGlnPheAsnArgGlnSerGlyPheLeuSer850855860GlnMetTrpIleGlyAspLysLysGlnLeuLeuThrProLeuArgAsp865870875880GlnPheThrArgAlaProLeuAspAsnAspIleGlyValSerGluAla885890895ThrArgIleAspProAsnAlaTrpValGluArgTrpLysAlaAlaGly900905910HisTyrGlnAlaGluAlaAlaLeuLeuGlnCysThrAlaAspThrLeu915920925AlaAspAlaValLeuIleThrThrAlaHisAlaTrpGlnHisGlnGly930935940LysThrLeuPheIleSerArgLysThrTyrArgIleAspGlySerGly945950955960GlnMetAlaIleThrValAspValGluValAlaSerAspThrProHis965970975ProAlaArgIleGlyLeuAsnCysGlnLeuAlaGlnValAlaGluArg980985990ValAsnTrpLeuGlyLeuGlyProGlnGluAsnTyrProAspArgLeu99510001005ThrAlaAlaCysPheAspArgTrpAspLeuProLeuSerAspMetTyr101010151020ThrProTyrValPheProSerGluAsnGlyLeuArgCysGlyThrArg1025103010351040GluLeuAsnTyrGlyProHisGlnTrpArgGlyAspPheGlnPheAsn104510501055IleSerArgTyrSerGlnGlnGlnLeuMetGluThrSerHisArgHis106010651070LeuLeuHisAlaGluGluGlyThrTrpLeuAsnIleAspGlyPheHis107510801085MetGlyIleGlyGlyAspAspSerTrpSerProSerValSerAlaGlu109010951100PheGlnLeuSerAlaGlyArgTyrHisTyrGlnLeuValTrpCysGln1105111011151120Lys(2) INFORMATION FOR SEQ ID NO:3:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 2845 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: linear(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: 193..2619(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:TGTGATCTGCGTCCTTTTTTTCTCAGGAAAAAAAAATTTTATAGACATTCAAAGAATAGA60AGCGATTGTCAAAATTCGCTTCTCCTTTCTTTTCCATTATAACGTCTGATCATTTTACGT120CTTCAGTGCCCTCCCTTGTTCGAAACTAGATACTTTCGAACACTTCTCCCCTTTTAATCT180ACAAAATTTTGTATGGATTTGTTTATTGAAAGCAAGATAAACAGTTTA228MetAspLeuPheIleGluSerLysIleAsnSerLeu1510TTACAATTTTTATTTGGTTCCCGACAGGATTTTTTGAGAAATTTTAAA276LeuGlnPheLeuPheGlySerArgGlnAspPheLeuArgAsnPheLys152025ACTTGGAGTAACAACAATAACAATCTATCGATTTATTTATTAATTTTT324ThrTrpSerAsnAsnAsnAsnAsnLeuSerIleTyrLeuLeuIlePhe303540GGCATAGTAGTATTTTTTTATAAAAAACCAGACCATCTAAACTACATT372GlyIleValValPhePheTyrLysLysProAspHisLeuAsnTyrIle45505560GTTGAGAGCGTTAGTGAAATGACAACAAACTTCAGAAATAATAATAGC420ValGluSerValSerGluMetThrThrAsnPheArgAsnAsnAsnSer657075CTTAGCCGTTGGTTGCCCAGAAGTAAGTTTACCCACTTAGACGAAGAG468LeuSerArgTrpLeuProArgSerLysPheThrHisLeuAspGluGlu808590ATCTTGAAAAGAGGTGGTTTCATTGCTGGTTTAGTTAATGATGGTAAC516IleLeuLysArgGlyGlyPheIleAlaGlyLeuValAsnAspGlyAsn95100105ACTTGTTTTATGAACTCTGTTTTGCAATCATTGGCATCATCCAGAGAA564ThrCysPheMetAsnSerValLeuGlnSerLeuAlaSerSerArgGlu110115120TTAATGGAGTTCTTGGACAATAATGTCATAAGGACCTATGAGGAGATA612LeuMetGluPheLeuAspAsnAsnValIleArgThrTyrGluGluIle125130135140GAACAAAATGAACACAATGAAGAAGGAAACGGGCAAGAATCTGCTCAA660GluGlnAsnGluHisAsnGluGluGlyAsnGlyGlnGluSerAlaGln145150155GATGAAGCCACTCATAAGAAAAACACTCGTAAGGGTGGCAAAGTTTAT708AspGluAlaThrHisLysLysAsnThrArgLysGlyGlyLysValTyr160165170GGTAAGCATAAGAAGAAATTGAATAGGAAGTCAAGTTCGAAAGAAGAC756GlyLysHisLysLysLysLeuAsnArgLysSerSerSerLysGluAsp175180185GAAGAAAAGAGCCAGGAGCCAGATATCACTTTCAGTGTCGCCTTAAGG804GluGluLysSerGlnGluProAspIleThrPheSerValAlaLeuArg190195200GATCTACTTTCTGCCTTAAATGCGAAGTATTATCGGGATAAACCCTAT852AspLeuLeuSerAlaLeuAsnAlaLysTyrTyrArgAspLysProTyr205210215220TTCAAAACCAATAGTTTATTGAAAGCAATGTCCAAATCTCCAAGAAAA900PheLysThrAsnSerLeuLeuLysAlaMetSerLysSerProArgLys225230235AATATTCTTCTTGGCTACGACCAAGAGGACGCGCAAGAATTCTTCCAG948AsnIleLeuLeuGlyTyrAspGlnGluAspAlaGlnGluPhePheGln240245250AACATACTAGCCGAGTTGGAAAGTAACGTTAAATCATTGAATACTGAA996AsnIleLeuAlaGluLeuGluSerAsnValLysSerLeuAsnThrGlu255260265AAACTAGATACCACTCCAGTTGCGAAATCAGAATTACCCGATGATGCT1044LysLeuAspThrThrProValAlaLysSerGluLeuProAspAspAla270275280TTAGTAGGTCAACTTAACCTTGGTGAAGTTGGCACTGTTTACATTCCA1092LeuValGlyGlnLeuAsnLeuGlyGluValGlyThrValTyrIlePro285290295300ACTGAACAGATTGATCCTAACTCTATACTACATGACAAGTCCATTCAA1140ThrGluGlnIleAspProAsnSerIleLeuHisAspLysSerIleGln305310315AATTTCACACCTTTCAAACTAATGACTCCTTTAGATGGTATCACGGCA1188AsnPheThrProPheLysLeuMetThrProLeuAspGlyIleThrAla320325330GAAAGAATTGGTTGTTTACAGTGTGGTGAGAACGGTGGCATAAGATAT1236GluArgIleGlyCysLeuGlnCysGlyGluAsnGlyGlyIleArgTyr335340345TCCGTATTTTCGGGATTAAGCTTAAATTTACCGAACGAGAATATTGGT1284SerValPheSerGlyLeuSerLeuAsnLeuProAsnGluAsnIleGly350355360TCCACTTTAAAATTATCTCAGTTATTAAGCGACTGGAGTAAACCTGAA1332SerThrLeuLysLeuSerGlnLeuLeuSerAspTrpSerLysProGlu365370375380ATCATCGAAGGCGTAGAATGTAACCGTTGTGCCCTCACAGCAGCGCAC1380IleIleGluGlyValGluCysAsnArgCysAlaLeuThrAlaAlaHis385390395TCTCATTTATTTGGTCAGTTGAAAGAATTTGAAAAAAAACCTGAGGGT1428SerHisLeuPheGlyGlnLeuLysGluPheGluLysLysProGluGly400405410TCGATCCCAGAAAAGCCAATTAACGCTGTAAAAGATAGGGTCCATCAA1476SerIleProGluLysProIleAsnAlaValLysAspArgValHisGln415420425ATCGAAGAAGTTCTTGCCAAACCAGTTATTGACGATGAAGATTATAAG1524IleGluGluValLeuAlaLysProValIleAspAspGluAspTyrLys430435440AAGTTGCATACAGCAAATATGGTACGTAAATGCTCTAAATCTAAGCAG1572LysLeuHisThrAlaAsnMetValArgLysCysSerLysSerLysGln445450455460ATTTTAATATCAAGACCTCCACCATTATTATCCATTCATATCAACAGA1620IleLeuIleSerArgProProProLeuLeuSerIleHisIleAsnArg465470475TCCGTATTTGATCCAAGAACGTACATGATTAGAAAAAATAACTCGAAA1668SerValPheAspProArgThrTyrMetIleArgLysAsnAsnSerLys480485490GTATTGTTTAAGTCAAGGTTGAATCTTGCCCCATGGTGTTGTGATATT1716ValLeuPheLysSerArgLeuAsnLeuAlaProTrpCysCysAspIle495500505AATGAAATCAATTTGGATGCTCGTTTGCCAATGTCAAAAAAGGAAAAA1764AsnGluIleAsnLeuAspAlaArgLeuProMetSerLysLysGluLys510515520GCTGCGCAACAAGATTCAAGTGAAGATGAAAACATTGGCGGTGAATAC1812AlaAlaGlnGlnAspSerSerGluAspGluAsnIleGlyGlyGluTyr525530535540TATACGAAATTACATGAACGCTTCGAGCAGGAATTTGAAGACAGCGAG1860TyrThrLysLeuHisGluArgPheGluGlnGluPheGluAspSerGlu545550555GAAGAAAAAGAATACGATGACGCAGAGGGGAACTATGCGTCTCATTAC1908GluGluLysGluTyrAspAspAlaGluGlyAsnTyrAlaSerHisTyr560565570AATCATACCAAGGATATCAGTAACTATGATCCCCTAAACGGTGAAGTC1956AsnHisThrLysAspIleSerAsnTyrAspProLeuAsnGlyGluVal575580585GATGGCGTGACATCCGATGATGAAGATGAGTACATTGAAGAAACCGAT2004AspGlyValThrSerAspAspGluAspGluTyrIleGluGluThrAsp590595600GCTTTAGGGAATACAATCAAAAAAAGGATCATAGAACATTCTGATGTT2052AlaLeuGlyAsnThrIleLysLysArgIleIleGluHisSerAspVal605610615620GAAAACGAGAATGTAAAAGATAATGAAGAACTGCAAGAAATCGACAAT2100GluAsnGluAsnValLysAspAsnGluGluLeuGlnGluIleAspAsn625630635GTGAGCCTTGACGAACCAAAGATCAATGTTGAAGATCAACTAGAAACA2148ValSerLeuAspGluProLysIleAsnValGluAspGlnLeuGluThr640645650TCATCTGATGAGGAAGATGTTATACCAGCTCCACCTATCAATTATGCT2196SerSerAspGluGluAspValIleProAlaProProIleAsnTyrAla655660665AGGTCATTTTCCACAGTTCCAGCCACTCCATTGACATATTCATTGCGC2244ArgSerPheSerThrValProAlaThrProLeuThrTyrSerLeuArg670675680TCTGTCATTGTTCACTACGGTACCCATAATTATGGTCATTACATTGCA2292SerValIleValHisTyrGlyThrHisAsnTyrGlyHisTyrIleAla685690695700TTTAGAAAATACAGGGGTTGTTGGTGGAGAATATCTGATGAGACTGTG2340PheArgLysTyrArgGlyCysTrpTrpArgIleSerAspGluThrVal705710715TACGTTGTGGACGAAGCTGAAGTCCTTTCAACACCCGGTGTATTTATG2388TyrValValAspGluAlaGluValLeuSerThrProGlyValPheMet720725730TTATTTTACGAATATGACTTTGATGAAGAAACTGGGAAGATGAAGGAT2436LeuPheTyrGluTyrAspPheAspGluGluThrGlyLysMetLysAsp735740745GATTTGGAAGCTATTCAGAGTAATAATGAAGAAGATGATGAAAAAGAG2484AspLeuGluAlaIleGlnSerAsnAsnGluGluAspAspGluLysGlu750755760CAGGAGCAAAAAGGAGTCCAGGAGCCAAAGGAAAGCCAAGAGCAAGGA2532GlnGluGlnLysGlyValGlnGluProLysGluSerGlnGluGlnGly765770775780GAAGGTGAAGAGCAAGAGGAAGGTCAAGAGCAGATGAAGTTCGAGAGA2580GluGlyGluGluGlnGluGluGlyGlnGluGlnMetLysPheGluArg785790795ACAGAAGACCATAGAGATATTTCTGGTAAAGATGTAAACTAAGTTATAA2629ThrGluAspHisArgAspIleSerGlyLysAspValAsn800805ATACGATATCCGTAATTGTGTAAATAACAATAACTATAATTAAATTGAATAATTAAAAGT2689CTACGTTATTCGTTAAATCAATTGTTTAGCTAGTTACGAATGTCTAAAGTTTTTGTAGGA2749CAATTGCAAAAATCACTTCCATTATTATACAAATCCTTCTAAGCTTCATTTTTCTTACCA2809TTGTACTTCTTCAACTTTTTCTCTTCTCTTCTCTCC2845(2) INFORMATION FOR SEQ ID NO:4:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 809 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:MetAspLeuPheIleGluSerLysIleAsnSerLeuLeuGlnPheLeu151015PheGlySerArgGlnAspPheLeuArgAsnPheLysThrTrpSerAsn202530AsnAsnAsnAsnLeuSerIleTyrLeuLeuIlePheGlyIleValVal354045PhePheTyrLysLysProAspHisLeuAsnTyrIleValGluSerVal505560SerGluMetThrThrAsnPheArgAsnAsnAsnSerLeuSerArgTrp65707580LeuProArgSerLysPheThrHisLeuAspGluGluIleLeuLysArg859095GlyGlyPheIleAlaGlyLeuValAsnAspGlyAsnThrCysPheMet100105110AsnSerValLeuGlnSerLeuAlaSerSerArgGluLeuMetGluPhe115120125LeuAspAsnAsnValIleArgThrTyrGluGluIleGluGlnAsnGlu130135140HisAsnGluGluGlyAsnGlyGlnGluSerAlaGlnAspGluAlaThr145150155160HisLysLysAsnThrArgLysGlyGlyLysValTyrGlyLysHisLys165170175LysLysLeuAsnArgLysSerSerSerLysGluAspGluGluLysSer180185190GlnGluProAspIleThrPheSerValAlaLeuArgAspLeuLeuSer195200205AlaLeuAsnAlaLysTyrTyrArgAspLysProTyrPheLysThrAsn210215220SerLeuLeuLysAlaMetSerLysSerProArgLysAsnIleLeuLeu225230235240GlyTyrAspGlnGluAspAlaGlnGluPhePheGlnAsnIleLeuAla245250255GluLeuGluSerAsnValLysSerLeuAsnThrGluLysLeuAspThr260265270ThrProValAlaLysSerGluLeuProAspAspAlaLeuValGlyGln275280285LeuAsnLeuGlyGluValGlyThrValTyrIleProThrGluGlnIle290295300AspProAsnSerIleLeuHisAspLysSerIleGlnAsnPheThrPro305310315320PheLysLeuMetThrProLeuAspGlyIleThrAlaGluArgIleGly325330335CysLeuGlnCysGlyGluAsnGlyGlyIleArgTyrSerValPheSer340345350GlyLeuSerLeuAsnLeuProAsnGluAsnIleGlySerThrLeuLys355360365LeuSerGlnLeuLeuSerAspTrpSerLysProGluIleIleGluGly370375380ValGluCysAsnArgCysAlaLeuThrAlaAlaHisSerHisLeuPhe385390395400GlyGlnLeuLysGluPheGluLysLysProGluGlySerIleProGlu405410415LysProIleAsnAlaValLysAspArgValHisGlnIleGluGluVal420425430LeuAlaLysProValIleAspAspGluAspTyrLysLysLeuHisThr435440445AlaAsnMetValArgLysCysSerLysSerLysGlnIleLeuIleSer450455460ArgProProProLeuLeuSerIleHisIleAsnArgSerValPheAsp465470475480ProArgThrTyrMetIleArgLysAsnAsnSerLysValLeuPheLys485490495SerArgLeuAsnLeuAlaProTrpCysCysAspIleAsnGluIleAsn500505510LeuAspAlaArgLeuProMetSerLysLysGluLysAlaAlaGlnGln515520525AspSerSerGluAspGluAsnIleGlyGlyGluTyrTyrThrLysLeu530535540HisGluArgPheGluGlnGluPheGluAspSerGluGluGluLysGlu545550555560TyrAspAspAlaGluGlyAsnTyrAlaSerHisTyrAsnHisThrLys565570575AspIleSerAsnTyrAspProLeuAsnGlyGluValAspGlyValThr580585590SerAspAspGluAspGluTyrIleGluGluThrAspAlaLeuGlyAsn595600605ThrIleLysLysArgIleIleGluHisSerAspValGluAsnGluAsn610615620ValLysAspAsnGluGluLeuGlnGluIleAspAsnValSerLeuAsp625630635640GluProLysIleAsnValGluAspGlnLeuGluThrSerSerAspGlu645650655GluAspValIleProAlaProProIleAsnTyrAlaArgSerPheSer660665670ThrValProAlaThrProLeuThrTyrSerLeuArgSerValIleVal675680685HisTyrGlyThrHisAsnTyrGlyHisTyrIleAlaPheArgLysTyr690695700ArgGlyCysTrpTrpArgIleSerAspGluThrValTyrValValAsp705710715720GluAlaGluValLeuSerThrProGlyValPheMetLeuPheTyrGlu725730735TyrAspPheAspGluGluThrGlyLysMetLysAspAspLeuGluAla740745750IleGlnSerAsnAsnGluGluAspAspGluLysGluGlnGluGlnLys755760765GlyValGlnGluProLysGluSerGlnGluGlnGlyGluGlyGluGlu770775780GlnGluGluGlyGlnGluGlnMetLysPheGluArgThrGluAspHis785790795800ArgAspIleSerGlyLysAspValAsn805(2) INFORMATION FOR SEQ ID NO:5:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 6008 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: linear(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: 983..4774(xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:GCATGCTCCCAAGTGTCAGAATTTATCAGATGCTCAGGCTGCATTTTTGGACCGTGTTAT60TCGTGTAGATCAAGCTGGCGAATTAGGTGCAGACTACATCTACGCTGGCCAGTACTTCGT120GTTGGCTCATAGGTACCCTCACTTGAAACCTGTGCTAAAGCACATATGGGACCAGGAGAT180ACATCATCATAATACTTTTAACAATTTGCAATTGAAAAGGAGAGTCAGGCCTTCCTTATT240AACGCCTTTGTGGAAGGCAGGAGCCTTTGCAATGGGGGCTGGTACCGCATTGATTTCTCC300AGAAGCAGCTATGGCTTGTACTGAAGCTGTCGAGACAGTAATCGGAGGGCACTACAATGG360CCAATTGCGAAACTTGGCCAATCAATTCAATTTAGAAAGAACAGATGGAACAAAGGGTCC420AAGTGAGGAAATCAAATCCTTAACTTCTACTATCCAACAGTTCAGGGATGACGAGCTAGA480GCATCTAGACACCGCTATCAAGCATGATTCGTATATGGCAGTTCCATATACAGTTATCAC540TGAAGGTATTAAAACGATTTGCAGAGTAGCTATATGGAGTGCCGAAAGAATTTAACCACC600AGAAAGTGGCATACATCAGTCGCGTTATGCCAGAAAAGGAGAATTGAAAGGAAAACGGTT660TGATAAATGTCCTAATTAAACTATCATGTATAAAATTATGTATCATCCTTACGCATTTTA720ACGCTATATGACCAATATGACAGGAATAGATACACTGTCTATAATTATGTAAATGGGGTA780TGGGTTCATAGTCTAAGGGTGAGTACAAACTGGATCTTTAACAAGAGTAACAGTTAATTA840GAGCAAAACTATAGTACATATAGCTTGAAAAAAACAAGCGGCTTGCCATTGGAAGAACAT900TGCATAAAAACGGGGCCACTGCTAATAATAAAGTGGTAATTAAAAAGAAAGCTTTTGTTC960AAGGTTAAGAAGGTATAAGGAAATGCCGAACGAAGATAATGAACTTCAAAAA1012MetProAsnGluAspAsnGluLeuGlnLys1510GCAATTGAGAACCATCATAATCAACTACTAAACCAGGATAAAGAAAAT1060AlaIleGluAsnHisHisAsnGlnLeuLeuAsnGlnAspLysGluAsn152025GCTGACAGAAATGGGTCTGTTATAGAAGACCTCCCATTATACGGGACA1108AlaAspArgAsnGlySerValIleGluAspLeuProLeuTyrGlyThr303540AGTATAAACCAGCAGTCTACCCCTGGAGATGTTGACGATGGAAAACAC1156SerIleAsnGlnGlnSerThrProGlyAspValAspAspGlyLysHis455055TTACTGTATCCAGATATTGCCACCAACCTACCACTGAAGACTTCTGAC1204LeuLeuTyrProAspIleAlaThrAsnLeuProLeuLysThrSerAsp606570AGACTTTTGGACGATATACTTTGCGATACTATTTTTCTCAATTCTACA1252ArgLeuLeuAspAspIleLeuCysAspThrIlePheLeuAsnSerThr75808590GACCCGAAGGTCATGCAAAAGGGCCTGCAATCGAGGGGTATTTTAAAA1300AspProLysValMetGlnLysGlyLeuGlnSerArgGlyIleLeuLys95100105GAGTCTATGCTTTCTTACTCAACTTTCAGAAGTAGTATTCGCCCTAAC1348GluSerMetLeuSerTyrSerThrPheArgSerSerIleArgProAsn110115120TGCTTGGGTTCATTAACTGATCAAGTGGTTTTTCAAACAAAATCCGAG1396CysLeuGlySerLeuThrAspGlnValValPheGlnThrLysSerGlu125130135TATGATTCCATTTCATGCCCAAAATATAATAAAATACATGTATTTCAG1444TyrAspSerIleSerCysProLysTyrAsnLysIleHisValPheGln140145150GCGGTCATCTTTAATCCATCACTGGCAGAACAGCAAATTTCAACTTTT1492AlaValIlePheAsnProSerLeuAlaGluGlnGlnIleSerThrPhe155160165170GATGATATTGTTAAAATTCCTATTTATCATCTTAAGGTTAGCGTAAAA1540AspAspIleValLysIleProIleTyrHisLeuLysValSerValLys175180185GTCCGCCAAGAACTGGAGCGGTTGAAGAAGCATGTCGGTGTTACTCAA1588ValArgGlnGluLeuGluArgLeuLysLysHisValGlyValThrGln190195200TTCCACTCACTAGATCATTTGCACGAATACGATCGAGTAGACCTTTCG1636PheHisSerLeuAspHisLeuHisGluTyrAspArgValAspLeuSer205210215ACTTTTGATTCTTCCGATCCTAATTTGTTGGATTACGGTATTTACGTT1684ThrPheAspSerSerAspProAsnLeuLeuAspTyrGlyIleTyrVal220225230TCTGATGATACTAACAAACTGATCTTGATTGAAATTTTTAAACCCGAG1732SerAspAspThrAsnLysLeuIleLeuIleGluIlePheLysProGlu235240245250TTTAATTCACCTGAAGAGCATGAGAGTTTTACTGCCGACGCAATTAAG1780PheAsnSerProGluGluHisGluSerPheThrAlaAspAlaIleLys255260265AAGAGATACAATGCTATGTGTGTAAAAAATGAATCACTAGATAAAAGC1828LysArgTyrAsnAlaMetCysValLysAsnGluSerLeuAspLysSer270275280GAGACGCCATCTCAAGTTGACTGTTTTTACACACTTTTTAAAATTTTT1876GluThrProSerGlnValAspCysPheTyrThrLeuPheLysIlePhe285290295AAAGGGCCTTTGACGAGGAAAAGTAAAGCGGAACCTACAAAGACAATT1924LysGlyProLeuThrArgLysSerLysAlaGluProThrLysThrIle300305310GATTCTGGAAATTTGGCCCTTAACACTCACCTGAATCCTGAATGGTTA1972AspSerGlyAsnLeuAlaLeuAsnThrHisLeuAsnProGluTrpLeu315320325330ACGTCCAAGTATGGATTTCAAGCAAGCTCAGAAATCGATGAGGAAACT2020ThrSerLysTyrGlyPheGlnAlaSerSerGluIleAspGluGluThr335340345AATGAGATATTTACTGAATACGTCCCTCCAGATATGGTGGACTATGTA2068AsnGluIlePheThrGluTyrValProProAspMetValAspTyrVal350355360AACGATTTGGAGACAAGAAAAATTCGAGAATCGTTTGTGAGGAAGTGT2116AsnAspLeuGluThrArgLysIleArgGluSerPheValArgLysCys365370375TTACAACTGATATTTTGGGGTCAACTATCTACCTCATTACTGGCACCT2164LeuGlnLeuIlePheTrpGlyGlnLeuSerThrSerLeuLeuAlaPro380385390AATTCTCCCTTGAAAAATACGAAAAGCGTAAAGGGAATGTCTTCATTA2212AsnSerProLeuLysAsnThrLysSerValLysGlyMetSerSerLeu395400405410CAAACTTCTTTCTCAACACTACCTTGGTTCCATTTATTGGGAGAATCC2260GlnThrSerPheSerThrLeuProTrpPheHisLeuLeuGlyGluSer415420425AGAGCAAGGATTCTATTAAATTCCAATGAGCAAACTCATTCTCCTTTG2308ArgAlaArgIleLeuLeuAsnSerAsnGluGlnThrHisSerProLeu430435440GACGCAGAACCTCATTTTATTAATCTTTCCGTTTCGCATTATTATACC2356AspAlaGluProHisPheIleAsnLeuSerValSerHisTyrTyrThr445450455GATAGAGATATAATCAGAAACTACGAATCTTTGTCTTCTTTGGATCCT2404AspArgAspIleIleArgAsnTyrGluSerLeuSerSerLeuAspPro460465470GAAAATATTGGGCTGTATTTTGACGCACTGACATACATTGCAAATAGG2452GluAsnIleGlyLeuTyrPheAspAlaLeuThrTyrIleAlaAsnArg475480485490AAGGGGGCATATCAATTGATTGCTTACTGTGGAAAACAGGACATTATA2500LysGlyAlaTyrGlnLeuIleAlaTyrCysGlyLysGlnAspIleIle495500505GGCCAAGAAGCTCTAGAAAATGCTTTGTTAATGTTTAAAATTAACCCT2548GlyGlnGluAlaLeuGluAsnAlaLeuLeuMetPheLysIleAsnPro510515520AAAGAGTGTAACATCTCCGAATTAAATGAGGCGACTTTGCTATCTATT2596LysGluCysAsnIleSerGluLeuAsnGluAlaThrLeuLeuSerIle525530535TACAAATATGAAACATCAAATAAGAGCCAAGTAACCTCTAATCACCTA2644TyrLysTyrGluThrSerAsnLysSerGlnValThrSerAsnHisLeu540545550ACAAATTTGAAAAATGCTCTAAGATTGTTGGCCAAATATACCAAATCT2692ThrAsnLeuLysAsnAlaLeuArgLeuLeuAlaLysTyrThrLysSer555560565570GACAAACTAAAATTTTACGTCGATCATGAGCCCTACAGAGCTTTATCC2740AspLysLeuLysPheTyrValAspHisGluProTyrArgAlaLeuSer575580585CAGGCATACGACACACTTTCAATTGACGAGTCTGTTGATGAAGACATT2788GlnAlaTyrAspThrLeuSerIleAspGluSerValAspGluAspIle590595600ATAAAAACTGCATATTCGGTCAAGATTAACGACTCTCCCGGATTAAAG2836IleLysThrAlaTyrSerValLysIleAsnAspSerProGlyLeuLys605610615TTGGATTGTGATAGAGCACTTTACACCATTGCTATCAGTAAAAGAAGC2884LeuAspCysAspArgAlaLeuTyrThrIleAlaIleSerLysArgSer620625630CTTGATTTGTTCAATTTTTTAACAGAGGAATGCCCACAGTTTTCCAAC2932LeuAspLeuPheAsnPheLeuThrGluGluCysProGlnPheSerAsn635640645650TATTATGGTCCAGAGAAGCTTCTTCAAGTGAATGAAAATGCCTCTGAC2980TyrTyrGlyProGluLysLeuLeuGlnValAsnGluAsnAlaSerAsp655660665GAAACCATTTTGAAAATCTTTAAACAAAAGTGGTTTGATGAAAACGTT3028GluThrIleLeuLysIlePheLysGlnLysTrpPheAspGluAsnVal670675680TATGAGCCTGACCAATTTCTTATTTTGAGGGCAGCATTGACCAAAATC3076TyrGluProAspGlnPheLeuIleLeuArgAlaAlaLeuThrLysIle685690695AGTATAGAAAGAAATTCAACTTTAATCACCAACTTCTTACTAACTGGT3124SerIleGluArgAsnSerThrLeuIleThrAsnPheLeuLeuThrGly700705710ACGATAGATCCAAATTCCTTGCCGCCAGAAAATTGGCCAACTGGCATT3172ThrIleAspProAsnSerLeuProProGluAsnTrpProThrGlyIle715720725730AATAATATCGGGAACACCTGTTACCTAAATTCTTTATTACAATATTAC3220AsnAsnIleGlyAsnThrCysTyrLeuAsnSerLeuLeuGlnTyrTyr735740745TTTTCCATTGCGCCACTAAGAAGATATGTATTGGAATATCAAAAAACG3268PheSerIleAlaProLeuArgArgTyrValLeuGluTyrGlnLysThr750755760GTAGAAAATTTCAATGACCACCTCTCTAATAGTGGGCATATTAGAAGA3316ValGluAsnPheAsnAspHisLeuSerAsnSerGlyHisIleArgArg765770775ATTGGTGGAAGAGAAATTAGTAGAGGCGAAGTGGAAAGATCTATTCAA3364IleGlyGlyArgGluIleSerArgGlyGluValGluArgSerIleGln780785790TTCATATACCAACTTCGCAACCTTTTCTATGCGATGGTTCATACAAGA3412PheIleTyrGlnLeuArgAsnLeuPheTyrAlaMetValHisThrArg795800805810GAAAGATGTGTAACACCCTCAAAAGAGCTAGCATATTTGGCATTTGCT3460GluArgCysValThrProSerLysGluLeuAlaTyrLeuAlaPheAla815820825CCAAGTAATGTTGAAGTAGAATTTGAAGTGGAAGGCAATAAAGTAGTT3508ProSerAsnValGluValGluPheGluValGluGlyAsnLysValVal830835840GATCAAACAGGAGTTCTTTCGGATTCAAAGAAGGAAACAACGGATGAC3556AspGlnThrGlyValLeuSerAspSerLysLysGluThrThrAspAsp845850855GCATTTACTACAAAAATAAAGGATACAAGCCTGATTGATTTAGAAATG3604AlaPheThrThrLysIleLysAspThrSerLeuIleAspLeuGluMet860865870GAAGATGGCCTTAATGGCGATGTTGGTACAGATGCGAACAGAAAAAAA3652GluAspGlyLeuAsnGlyAspValGlyThrAspAlaAsnArgLysLys875880885890AATGAATCGAATGATGCTGAAGTAAGTGAGAACGAAGATACAACAGGA3700AsnGluSerAsnAspAlaGluValSerGluAsnGluAspThrThrGly895900905TTAACTTCACCTACGCGTGTGGCAAAAATCAGTTCTGATCAATTAGAA3748LeuThrSerProThrArgValAlaLysIleSerSerAspGlnLeuGlu910915920AATGCTTTGGAAATGGGTAGGCAACAAGATGTTACTGAATGCATAGGA3796AsnAlaLeuGluMetGlyArgGlnGlnAspValThrGluCysIleGly925930935AACGTGTTATTTCAGATAGAAAGCGGTTCAGAGCCTATCCGATATGAT3844AsnValLeuPheGlnIleGluSerGlySerGluProIleArgTyrAsp940945950GAAGACAACGAGCAATATGACTTGGTTAAGCAACTATTTTATGGTACT3892GluAspAsnGluGlnTyrAspLeuValLysGlnLeuPheTyrGlyThr955960965970ACTAAACAAAGTATTGTTCCTTTGTCCGCAACAAATAAAGTCCGTACG3940ThrLysGlnSerIleValProLeuSerAlaThrAsnLysValArgThr975980985AAAGTTGAAAGATTCCTATCGTTACTGATAAATATTGGCGATCATCCT3988LysValGluArgPheLeuSerLeuLeuIleAsnIleGlyAspHisPro9909951000AAAGATATTTATGATGCGTTTGATTCTTATTTTAAAGACGAATATCTG4036LysAspIleTyrAspAlaPheAspSerTyrPheLysAspGluTyrLeu100510101015ACAATGGAAGAGTATGGTGATGTTATACGTACCGTTGCTGTTACAACT4084ThrMetGluGluTyrGlyAspValIleArgThrValAlaValThrThr102010251030TTTCCTACTATTTTGCAGGTACAAATCCAAAGAGTTTATTACGATCGT4132PheProThrIleLeuGlnValGlnIleGlnArgValTyrTyrAspArg1035104010451050GAAAGATTAATGCCGTTTAAATCCATTGAGCCCTTACCATTCAAAGAA4180GluArgLeuMetProPheLysSerIleGluProLeuProPheLysGlu105510601065GTTATTTACATGGACAGATACGCGGATACAGAGAACCCTTTATTGTTG4228ValIleTyrMetAspArgTyrAlaAspThrGluAsnProLeuLeuLeu107010751080GCAAAAAAGAAAGAAACAGAAGAAATGAAGCAAAAGTTGAAGGTAATG4276AlaLysLysLysGluThrGluGluMetLysGlnLysLeuLysValMet108510901095AAAAATAGACAAAGAGAGCTTTTGAGTCGTGATGATTCAGGGCTTACA4324LysAsnArgGlnArgGluLeuLeuSerArgAspAspSerGlyLeuThr110011051110AGGAAGGATGCATTTTTGGAGAGTATCAAGCTATTGGAATCGGATACC4372ArgLysAspAlaPheLeuGluSerIleLysLeuLeuGluSerAspThr1115112011251130ATAAAGAAAACTCCTTTAAAAATTGAGGCTGCTAATGATGTGATAAAG4420IleLysLysThrProLeuLysIleGluAlaAlaAsnAspValIleLys113511401145ACGCTGAGAAACAACGTTCAAAATATCGATAATGAATTGATGAAATTA4468ThrLeuArgAsnAsnValGlnAsnIleAspAsnGluLeuMetLysLeu115011551160TACAATGATATCAACAGTTTGGAAGAGAAAATAAGCCATCAATTTGAC4516TyrAsnAspIleAsnSerLeuGluGluLysIleSerHisGlnPheAsp116511701175GATTTCAAGGAATATGGTTACTCACTGTTTTCGGTTTTTATTCATCGC4564AspPheLysGluTyrGlyTyrSerLeuPheSerValPheIleHisArg118011851190GGCGAGGCCAGTTATGGTCACTATTGGATATATATCAAGGACAGAAAT4612GlyGluAlaSerTyrGlyHisTyrTrpIleTyrIleLysAspArgAsn1195120012051210CGCAATGGAATTTGGAGGAAGTACAATGATGAAACCATCAGCGAGGTC4660ArgAsnGlyIleTrpArgLysTyrAsnAspGluThrIleSerGluVal121512201225CAGGAAGAGGAGGTCTTCAATTTCAATGAGGGTAACACTGCAACTCCA4708GlnGluGluGluValPheAsnPheAsnGluGlyAsnThrAlaThrPro123012351240TATTTCCTAGTATATGTCAAACAAGGACAAGAAGGTGATATTGAGCCA4756TyrPheLeuValTyrValLysGlnGlyGlnGluGlyAspIleGluPro124512501255TTGAAAAGAATTCTAAAGTAGTCTTAGTCAATGAAGAGTTTATGTAAA4804LeuLysArgIleLeuLys1260ATGTCACTATTGCCATAAGTACCATTATTATGTAAAAAGCTTTGCCATATTCAATGTTAC4864GGGTGACTATCTGCTACGTAAAGAAAAACGAAAAAACAAAAAAAAAAAGAACAAGCTCAT4924AGAAGTGAATACGAAAGCTGAAGAAAGTCGTTAAGTAGATAGGTTGCGTAAACTAGGTGC4984GTCCAATCAAAGTAATCCAATTAGATATACTGGACTATAATTAAGATGTCATCTGAAAGC5044CCACAGGATCAACCACAGAAGGAGCAAATCAGCAATAACGTCGGCGTTACCACCAATAGT5104ACAAGCAATGAGGAAACAAGCCGCTCTCAAGATGATAATGTCAAGGAAGTCAATGGAAAT5164GATGATACTAAAGAAGAGGAACAAGAAGAAGACGCAGAACTAGATGATTTATTTGGAGAT5224GACAATGATGACGATGATGATGATGATGTTAAAAAATCGGAGACTGAAAAAAGTGATAGT5284GATAGTGATGAAGACGACGAGGGAGAGAATATCAACCATAGAAGTCGTCATAGAGAAAGT5344CTCGGGTTAGATGATGATGAAGCAGAGGAGCAAGCCATGTACACCCGAAAATTTTATGGT5404GAGGATGCTAATAACTTTTCTGATCTTGATGAGACTACTCACACTTTTAAAGAGGAAAAT5464GTAGAGCTTGTCAGACATATTATTCCAAGTAAAGCTAATGTGAATGAAACGGCGTCTCAC5524AACGAAATTTTCTATGCTAGAATTCCCAACTTTTTAACTATCGATCCAATTCCTTTCGAC5584CCTCCAAGTTTTGAGGCCAAAGTAAACGAAAGGGCAAGCAATTCAGCTTCTAGGGAGGAT5644CAACTGGACGACCGCCTGATTGATGAAAACACTGTTAGATGGAGATACTCTCGTGACAAA5704GACCAACATGTCTTTAAAGAATCAAATACACAAATAGTGCAGTGGTCAGACGGTACATAT5764TCGCTAAAAGTTGGTGAAGAGTGTACAGATATATTGGTCAACGATACGAGCAACACTTTT5824TTGACAGTATCGCATGACCAACAAGAGTTGATCCAGTGTTACGAAGGGGGTGAAATAAAA5884AAGACGTTGATGTTTATTCCAACTTCGACGAATTCAAAAATACATCAAAAACTAAGTAAA5944GCTGTTATAAGAAGGAACCAAAGACAAAGCAAGGGTCCTGGAAATACATTGTAAGTATGG6004ATCC6008(2) INFORMATION FOR SEQ ID NO:6:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 1264 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:MetProAsnGluAspAsnGluLeuGlnLysAlaIleGluAsnHisHis151015AsnGlnLeuLeuAsnGlnAspLysGluAsnAlaAspArgAsnGlySer202530ValIleGluAspLeuProLeuTyrGlyThrSerIleAsnGlnGlnSer354045ThrProGlyAspValAspAspGlyLysHisLeuLeuTyrProAspIle505560AlaThrAsnLeuProLeuLysThrSerAspArgLeuLeuAspAspIle65707580LeuCysAspThrIlePheLeuAsnSerThrAspProLysValMetGln859095LysGlyLeuGlnSerArgGlyIleLeuLysGluSerMetLeuSerTyr100105110SerThrPheArgSerSerIleArgProAsnCysLeuGlySerLeuThr115120125AspGlnValValPheGlnThrLysSerGluTyrAspSerIleSerCys130135140ProLysTyrAsnLysIleHisValPheGlnAlaValIlePheAsnPro145150155160SerLeuAlaGluGlnGlnIleSerThrPheAspAspIleValLysIle165170175ProIleTyrHisLeuLysValSerValLysValArgGlnGluLeuGlu180185190ArgLeuLysLysHisValGlyValThrGlnPheHisSerLeuAspHis195200205LeuHisGluTyrAspArgValAspLeuSerThrPheAspSerSerAsp210215220ProAsnLeuLeuAspTyrGlyIleTyrValSerAspAspThrAsnLys225230235240LeuIleLeuIleGluIlePheLysProGluPheAsnSerProGluGlu245250255HisGluSerPheThrAlaAspAlaIleLysLysArgTyrAsnAlaMet260265270CysValLysAsnGluSerLeuAspLysSerGluThrProSerGlnVal275280285AspCysPheTyrThrLeuPheLysIlePheLysGlyProLeuThrArg290295300LysSerLysAlaGluProThrLysThrIleAspSerGlyAsnLeuAla305310315320LeuAsnThrHisLeuAsnProGluTrpLeuThrSerLysTyrGlyPhe325330335GlnAlaSerSerGluIleAspGluGluThrAsnGluIlePheThrGlu340345350TyrValProProAspMetValAspTyrValAsnAspLeuGluThrArg355360365LysIleArgGluSerPheValArgLysCysLeuGlnLeuIlePheTrp370375380GlyGlnLeuSerThrSerLeuLeuAlaProAsnSerProLeuLysAsn385390395400ThrLysSerValLysGlyMetSerSerLeuGlnThrSerPheSerThr405410415LeuProTrpPheHisLeuLeuGlyGluSerArgAlaArgIleLeuLeu420425430AsnSerAsnGluGlnThrHisSerProLeuAspAlaGluProHisPhe435440445IleAsnLeuSerValSerHisTyrTyrThrAspArgAspIleIleArg450455460AsnTyrGluSerLeuSerSerLeuAspProGluAsnIleGlyLeuTyr465470475480PheAspAlaLeuThrTyrIleAlaAsnArgLysGlyAlaTyrGlnLeu485490495IleAlaTyrCysGlyLysGlnAspIleIleGlyGlnGluAlaLeuGlu500505510AsnAlaLeuLeuMetPheLysIleAsnProLysGluCysAsnIleSer515520525GluLeuAsnGluAlaThrLeuLeuSerIleTyrLysTyrGluThrSer530535540AsnLysSerGlnValThrSerAsnHisLeuThrAsnLeuLysAsnAla545550555560LeuArgLeuLeuAlaLysTyrThrLysSerAspLysLeuLysPheTyr565570575ValAspHisGluProTyrArgAlaLeuSerGlnAlaTyrAspThrLeu580585590SerIleAspGluSerValAspGluAspIleIleLysThrAlaTyrSer595600605ValLysIleAsnAspSerProGlyLeuLysLeuAspCysAspArgAla610615620LeuTyrThrIleAlaIleSerLysArgSerLeuAspLeuPheAsnPhe625630635640LeuThrGluGluCysProGlnPheSerAsnTyrTyrGlyProGluLys645650655LeuLeuGlnValAsnGluAsnAlaSerAspGluThrIleLeuLysIle660665670PheLysGlnLysTrpPheAspGluAsnValTyrGluProAspGlnPhe675680685LeuIleLeuArgAlaAlaLeuThrLysIleSerIleGluArgAsnSer690695700ThrLeuIleThrAsnPheLeuLeuThrGlyThrIleAspProAsnSer705710715720LeuProProGluAsnTrpProThrGlyIleAsnAsnIleGlyAsnThr725730735CysTyrLeuAsnSerLeuLeuGlnTyrTyrPheSerIleAlaProLeu740745750ArgArgTyrValLeuGluTyrGlnLysThrValGluAsnPheAsnAsp755760765HisLeuSerAsnSerGlyHisIleArgArgIleGlyGlyArgGluIle770775780SerArgGlyGluValGluArgSerIleGlnPheIleTyrGlnLeuArg785790795800AsnLeuPheTyrAlaMetValHisThrArgGluArgCysValThrPro805810815SerLysGluLeuAlaTyrLeuAlaPheAlaProSerAsnValGluVal820825830GluPheGluValGluGlyAsnLysValValAspGlnThrGlyValLeu835840845SerAspSerLysLysGluThrThrAspAspAlaPheThrThrLysIle850855860LysAspThrSerLeuIleAspLeuGluMetGluAspGlyLeuAsnGly865870875880AspValGlyThrAspAlaAsnArgLysLysAsnGluSerAsnAspAla885890895GluValSerGluAsnGluAspThrThrGlyLeuThrSerProThrArg900905910ValAlaLysIleSerSerAspGlnLeuGluAsnAlaLeuGluMetGly915920925ArgGlnGlnAspValThrGluCysIleGlyAsnValLeuPheGlnIle930935940GluSerGlySerGluProIleArgTyrAspGluAspAsnGluGlnTyr945950955960AspLeuValLysGlnLeuPheTyrGlyThrThrLysGlnSerIleVal965970975ProLeuSerAlaThrAsnLysValArgThrLysValGluArgPheLeu980985990SerLeuLeuIleAsnIleGlyAspHisProLysAspIleTyrAspAla99510001005PheAspSerTyrPheLysAspGluTyrLeuThrMetGluGluTyrGly101010151020AspValIleArgThrValAlaValThrThrPheProThrIleLeuGln1025103010351040ValGlnIleGlnArgValTyrTyrAspArgGluArgLeuMetProPhe104510501055LysSerIleGluProLeuProPheLysGluValIleTyrMetAspArg106010651070TyrAlaAspThrGluAsnProLeuLeuLeuAlaLysLysLysGluThr107510801085GluGluMetLysGlnLysLeuLysValMetLysAsnArgGlnArgGlu109010951100LeuLeuSerArgAspAspSerGlyLeuThrArgLysAspAlaPheLeu1105111011151120GluSerIleLysLeuLeuGluSerAspThrIleLysLysThrProLeu112511301135LysIleGluAlaAlaAsnAspValIleLysThrLeuArgAsnAsnVal114011451150GlnAsnIleAspAsnGluLeuMetLysLeuTyrAsnAspIleAsnSer115511601165LeuGluGluLysIleSerHisGlnPheAspAspPheLysGluTyrGly117011751180TyrSerLeuPheSerValPheIleHisArgGlyGluAlaSerTyrGly1185119011951200HisTyrTrpIleTyrIleLysAspArgAsnArgAsnGlyIleTrpArg120512101215LysTyrAsnAspGluThrIleSerGluValGlnGluGluGluValPhe122012251230AsnPheAsnGluGlyAsnThrAlaThrProTyrPheLeuValTyrVal123512401245LysGlnGlyGlnGluGlyAspIleGluProLeuLysArgIleLeuLys125012551260(2) INFORMATION FOR SEQ ID NO:7:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 4887 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: linear(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: 1278..4013(xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:GCATGCTGAACATCCTTCTGCAAACAACCTTGCCACATAACGGGTATACCAGGCAGGCGT60TCATCATCACGCCAACATATTTCTTGATCAACAATTGCTTCACAGATGCGGGATTCAAGG120GGAAAATGACCGCCATCAACGAGCAGGGCCACGACTCGATTGATTTCGAGTCGTTGATTT180CTGCCCTTGAGCAGCACGAGGCGGAGCCGCAGCCCCATAGTACCACAGAGATGATTCAGG240GGCCAAAGTTGACCAAGAAGGTCTACAGGTACGTTATGTACTGCATCCCGACGTTTGCAA300ACCCATCGGGAAACACATACTCGCTTGAGACCAGACGCAGACTTATCGACATCGCTCGGA360AGTACGACATGCTGATAATCACTGATGACGTGTACGATATTCTAGATTACACGACGCCCT420CAGATGAGCTGCCCTCTCCGCCCCTAAGGATGGTGCACATAGACAGAAGTACAGCGCCCT480CCGGTGAGGACTCGTTCGGGAATACAGTGTCCAACGCAACTTTCTCCAAGCTGATCGCCC540CTGGGCTCAGATTTGGATACCATGAGTCAATCAACGCGAATCTCGCCAGACAGCTATCTA600AAGGTGGTGCAAACGTCTCTGGCGGAACTCCCTCACAACTGAACTCCATGATCGTGGGTG660AGATGCTGCGTAGTGGTGCCGCCCAGAGATGCATTGCACATCTGAGATCCGTATACTCCG720AGAGGGCCACTGTCTTGACCTCGGCGCTTAAGAAATACATGCCCCATGGAACCGAGATTA780TGCCATTGAAGGGCGGCTATTTTACTTGGATCACTCTCCCACCAGCGTACAATGCCATGG840AGATATCCACTATTCTTGCCAAGAAATTTAATGTCATCCTTGCCGACGGCTCCAATTTCG900AGGTCATCGGCGATGAGAAAAACTGGGGTCAGTCATGCTTTAGGCTTTCTATTAGTTTCT960TAGAAGTTGATGATATCGACAGGGGCATTGAGCTGTTTGGAGCTGTTTGCAAATCTCATG1020CGATCACCAATAACATAACTATGTAGAAGGAATACGTATATAGGTGAACGGTAATAAGAG1080GGTAATTTTTCTACGGGCAAAGGCAAGGAAGAAAAAGAAAAAGAAGGAAAAAAATATAAT1140GTGATAAAACAAACAAGCAGCGAAAAAGCGAAAGGGAAGAGAAGTGTTCTAGAGAAGAAA1200GTCATTTTAATAGTAAGTCAGACTCGTCTGCTACCATCATCCAGGTACCGCTTTCCTTTC1260CATCATCATTAAAAAAAATGAACATGCAAGACGCTAACAAAGAAGAGTCG1310MetAsnMetGlnAspAlaAsnLysGluGluSer1510TACTCGATGTACCCGAAAACCTCTTCTCCACCACCACCTACGCCAACC1358TyrSerMetTyrProLysThrSerSerProProProProThrProThr152025AATATGCAGATTCCTATTTATCAAGCGCCTTTGCAGATGTACGGCTAC1406AsnMetGlnIleProIleTyrGlnAlaProLeuGlnMetTyrGlyTyr303540ACTCAGGCCCCATATCTATACCCCACACAAATACCTGCCTATTCGTTT1454ThrGlnAlaProTyrLeuTyrProThrGlnIleProAlaTyrSerPhe455055AATATGGTCAACCAAAACCAGCCAATCTACCATCAAAGTGGCAGCCCA1502AsnMetValAsnGlnAsnGlnProIleTyrHisGlnSerGlySerPro60657075CATCACTTGCCTCCGCAAAACAATATTAACGGCGGAAGCACTACCAAT1550HisHisLeuProProGlnAsnAsnIleAsnGlyGlySerThrThrAsn808590AACAACAACATTAACAAGAAGAAGTGGCACTCTAATGGCATTACCAAT1598AsnAsnAsnIleAsnLysLysLysTrpHisSerAsnGlyIleThrAsn95100105AACAATGGAAGCAGCGGTAATCAAGGCGCCAACTCTAGCGGTAGCGGC1646AsnAsnGlySerSerGlyAsnGlnGlyAlaAsnSerSerGlySerGly110115120ATGAGCTACAACAAATCCCACACCTACCATCACAATTACTCTAACAAT1694MetSerTyrAsnLysSerHisThrTyrHisHisAsnTyrSerAsnAsn125130135CATATCCCCATGATGGCCTCTCCAAACAGTGGCAGCAATGCGGGCATG1742HisIleProMetMetAlaSerProAsnSerGlySerAsnAlaGlyMet140145150155AAAAAACAGACCAACTCTTCCAACGGCAACGGTTCTTCGGCTACTTCA1790LysLysGlnThrAsnSerSerAsnGlyAsnGlySerSerAlaThrSer160165170CCATCGTACTCTTCCTACAACTCTTCTTCACAGTATGATTTATACAAG1838ProSerTyrSerSerTyrAsnSerSerSerGlnTyrAspLeuTyrLys175180185TTTGATGTCACTAAATTAAAGAATCTCAAGGAAAATTCATCAAACTTG1886PheAspValThrLysLeuLysAsnLeuLysGluAsnSerSerAsnLeu190195200ATTCAATTGCCACTGTTCATAAACACTACGGAAGCAGAATTTGCTGCG1934IleGlnLeuProLeuPheIleAsnThrThrGluAlaGluPheAlaAla205210215GCAAGTGTCCAAAGGTACGAATTAAACATGAAGGCTTTGAACCTAAAC1982AlaSerValGlnArgTyrGluLeuAsnMetLysAlaLeuAsnLeuAsn220225230235TCTGAAAGCTTAGAGAACTCATCTGTAGAAAAGAGCTCTGCCCATCAT2030SerGluSerLeuGluAsnSerSerValGluLysSerSerAlaHisHis240245250CACACAAAAAGCCATAGTATACCAAAGCATAATGAGGAAGTAAAGACA2078HisThrLysSerHisSerIleProLysHisAsnGluGluValLysThr255260265GAAACACATGGGGAAGAAGAAGATGCTCATGATAAAAAACCACATGCG2126GluThrHisGlyGluGluGluAspAlaHisAspLysLysProHisAla270275280AGCAAAGATGCGCACGAGCTTAAAAAGAAAACTGAAGTAAAGAAAGAG2174SerLysAspAlaHisGluLeuLysLysLysThrGluValLysLysGlu285290295GATGCTAAGCAAGACCGTAACGAAAAAGTTATACAGGAACCTCAAGCT2222AspAlaLysGlnAspArgAsnGluLysValIleGlnGluProGlnAla300305310315ACTGTTTTACCTGTAGTGGATAAGAAGGAACCAGAGGAATCTGTTGAA2270ThrValLeuProValValAspLysLysGluProGluGluSerValGlu320325330GAAAATACTTCCAAGACATCTTCACCTTCACCATCTCCTCCAGCAGCA2318GluAsnThrSerLysThrSerSerProSerProSerProProAlaAla335340345AAATCCTGGTCCGCCATAGCATCAGATGCGATTAAAAGTAGACAAGCT2366LysSerTrpSerAlaIleAlaSerAspAlaIleLysSerArgGlnAla350355360AGTAACAAAACAGTCTCCGGATCGATGGTCACTAAAACACCAATTTCT2414SerAsnLysThrValSerGlySerMetValThrLysThrProIleSer365370375GGTACGACCGCAGGCGTTTCATCAACAAACATGGCTGCGGCGACTATA2462GlyThrThrAlaGlyValSerSerThrAsnMetAlaAlaAlaThrIle380385390395GGTAAATCCAGCTCTCCCCTGTTGTCCAAGCAGCCTCAGAAAAAGGAT2510GlyLysSerSerSerProLeuLeuSerLysGlnProGlnLysLysAsp400405410AAAAAATACGTTCCACCTTCTACAAAGGGTATTGAGCCACTGGGTTCG2558LysLysTyrValProProSerThrLysGlyIleGluProLeuGlySer415420425ATTGCGTTAAGAATGTGTTTTGATCCCGATTTCATTAGTTACGTTTTA2606IleAlaLeuArgMetCysPheAspProAspPheIleSerTyrValLeu430435440CGGAATAAAGATGTTGAAAACAAAATACCAGTCCATTCCATTATTCCA2654ArgAsnLysAspValGluAsnLysIleProValHisSerIleIlePro445450455AGAGGCATAATTAACAGAGCCAACATTTGTTTTATGAGTTCTGTGTTA2702ArgGlyIleIleAsnArgAlaAsnIleCysPheMetSerSerValLeu460465470475CAAGTGTTACTCTACTGTAAGCCATTTATTGATGTAATTAACGTTCTC2750GlnValLeuLeuTyrCysLysProPheIleAspValIleAsnValLeu480485490AGTACACGGAATACCAATTCAAGAGTCGGCACATCATCCTGTAAATTA2798SerThrArgAsnThrAsnSerArgValGlyThrSerSerCysLysLeu495500505TTAGATGCTTGTTTGACTATGTATAAGCAATTCGATAAGGAAACCTAT2846LeuAspAlaCysLeuThrMetTyrLysGlnPheAspLysGluThrTyr510515520GAGAAAAAATTCCTAGAGAATGCTGATGATGCTGAAAAAACCACGGAA2894GluLysLysPheLeuGluAsnAlaAspAspAlaGluLysThrThrGlu525530535AGTGATGCAAAAAAATCATCAAAATCCAAGAGTTTCCAACACTGCGCC2942SerAspAlaLysLysSerSerLysSerLysSerPheGlnHisCysAla540545550555ACTGCCGATGCTGTCAAACCTGACGAATTTTACAAAACTTTGTCTACT2990ThrAlaAspAlaValLysProAspGluPheTyrLysThrLeuSerThr560565570ATACCGAAGTTCAAAGACTTGCAATGGGGCCATCAGGAAGACGCAGAA3038IleProLysPheLysAspLeuGlnTrpGlyHisGlnGluAspAlaGlu575580585GAATTTTTGACCCACTTATTGGACCAATTACACGAGGAATTAATTTCT3086GluPheLeuThrHisLeuLeuAspGlnLeuHisGluGluLeuIleSer590595600GCAATTGATGGCTTAACCGATAATGAAATTCAAAATATGCTGCAAAGT3134AlaIleAspGlyLeuThrAspAsnGluIleGlnAsnMetLeuGlnSer605610615ATTAATGATGAACAATTGAAAGTTTTCTTTATTAGAAATTTGTCACGT3182IleAsnAspGluGlnLeuLysValPhePheIleArgAsnLeuSerArg620625630635TATGGAAAAGCAGAGTTTATCAAAAATGCTAGTCCTAGACTGAAGGAG3230TyrGlyLysAlaGluPheIleLysAsnAlaSerProArgLeuLysGlu640645650TTGATAGAAAAATATGGCGTGATCAATGATGACTCTACCGAAGAAAAT3278LeuIleGluLysTyrGlyValIleAsnAspAspSerThrGluGluAsn655640665GGTTGGCATGAAGTGAGCGGATCTAGCAAAAGAGGCAAGAAAACTAAG3326GlyTrpHisGluValSerGlySerSerLysArgGlyLysLysThrLys670675680ACCGCTGCCAAGAGGACTGTCGAGATTGTTCCATCACCAATCTCCAAA3374ThrAlaAlaLysArgThrValGluIleValProSerProIleSerLys685690695CTTTTCGGTGGCCAGTTCAGATCTGTGTTAGATATACCGAACAATAAG3422LeuPheGlyGlyGlnPheArgSerValLeuAspIleProAsnAsnLys700705710715GAATCTCAATCGATTACACTCGATCCGTTCCAAACAATTCAATTGGAC3470GluSerGlnSerIleThrLeuAspProPheGlnThrIleGlnLeuAsp720725730ATTTCAGATGCTGGTGTGAATGATCTAGAAACTGCATTCAAAAAATTT3518IleSerAspAlaGlyValAsnAspLeuGluThrAlaPheLysLysPhe735740745AGTGAATACGAATTGCTACCCTTTAAGTCCTCGTCAGGGAATGATGTC3566SerGluTyrGluLeuLeuProPheLysSerSerSerGlyAsnAspVal750755760GAGGCCAAGAAGCAGACTTTTATTGATAAATTGCCGCAAGTTCTTTTA3614GluAlaLysLysGlnThrPheIleAspLysLeuProGlnValLeuLeu765770775ATCCAATTCAAAAGATTCTCATTCATAAATAATGTGAACAAAGACAAC3662IleGlnPheLysArgPheSerPheIleAsnAsnValAsnLysAspAsn780785790795GCAATGACGAACTATAACGCGTACAATGGACGTATTGAGAAGATCAGG3710AlaMetThrAsnTyrAsnAlaTyrAsnGlyArgIleGluLysIleArg800805810AAAAAAATTAAATATGGTCACGAGTTAATCATACCTGAAGAATCAATG3758LysLysIleLysTyrGlyHisGluLeuIleIleProGluGluSerMet815820825TCTTCCATAACATTGAAAAACAACACCTCAGGGATTGATGATAGAAGA3806SerSerIleThrLeuLysAsnAsnThrSerGlyIleAspAspArgArg830835840TATAAGCTAACCGGAGTTATATACCATCATGGGGTAAGTTCCGATGGC3854TyrLysLeuThrGlyValIleTyrHisHisGlyValSerSerAspGly845850855GGTCATTACACAGCGGATGTTTATCATAGCGAGCACAACAAATGGTAT3902GlyHisTyrThrAlaAspValTyrHisSerGluHisAsnLysTrpTyr860865870875AGAATAGATGATGTAAATATTACCGAACTAGAGGACGATGACGTTTTG3950ArgIleAspAspValAsnIleThrGluLeuGluAspAspAspValLeu880885890AAAGGTGGCGAAGAAGCTTCTGATTCGAGGACTGCCTATATTTTAATG3998LysGlyGlyGluGluAlaSerAspSerArgThrAlaTyrIleLeuMet895900905TATCAAAAGAGAAATTAAGACGGGGGGTGGTATTATAGACAAAATACATAAAAAA4053TyrGlnLysArgAsn910TAATATAGCAATAATACAATACAATACAATACAATACGATAGTGAGCACGATTTTAAAAA4113AGAAATAGAGACAGACAGAGAAACAGAGTTACACTTTATGCTTGGCATATTTAAAAAATG4173ATTTCGCCCAGGATCGAACTGGGGACGTTCTGCGTGTTAAGCAGATGCCATAACCGACTA4233GACCACGAAACCAATTATTTCTTGGAGATGAACATTTAAGAAACAAATACCTTGTAGAAG4293GAATGTGAATTTCAAAATATTATGGCCTTTGGCAACAATGGAATCACAACAATTATCACA4353AAACTCATACATCTCTTAAGATTCATTTCTTACTTTAAGTAATCATCCAAATTTAGCCAA4413AGTTTGATTTTACCTAAAAAAAGCAGAGGATTCCCGATTTCAATCATATGTGCACAGACG4473ATGAGTCCAACACGTTATCGTTAACATAGTGCTCAATATTGCCACTGCGCTTCGCAGGAG4533CATATTTCGTATACGCCAAGCCCAAGGAGGGTTTTGTCATTAAGCAGCTTACGCCAATTA4593AGTGCTAACCTCGAAGCACCATACTTTATCTCAGGATTTACAAACTCCCTATTGCACAAC4653GGCAAACAACATAATCATGACCAAATGGGTAAAAAAGATGAGCTGTGAAAAAGCCAAAAA4713AAAAAAGGAAGAACTAGAATTACATTTATTATTCTACACACAAAAAGAAAAAATAGTTTC4773TTTATTTAAATGATTTGAAGAAAAAGAACTATAACGACTACATCGAAGAATACAATATTA4833GTAAAAAACACATGTCCTGTTTAAAATAAGTCTCTAGTTAAAGACTATTCGATC4887(2) INFORMATION FOR SEQ ID NO:8:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 912 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:MetAsnMetGlnAspAlaAsnLysGluGluSerTyrSerMetTyrPro151015LysThrSerSerProProProProThrProThrAsnMetGlnIlePro202530IleTyrGlnAlaProLeuGlnMetTyrGlyTyrThrGlnAlaProTyr354045LeuTyrProThrGlnIleProAlaTyrSerPheAsnMetValAsnGln505560AsnGlnProIleTyrHisGlnSerGlySerProHisHisLeuProPro65707580GlnAsnAsnIleAsnGlyGlySerThrThrAsnAsnAsnAsnIleAsn859095LysLysLysTrpHisSerAsnGlyIleThrAsnAsnAsnGlySerSer100105110GlyAsnGlnGlyAlaAsnSerSerGlySerGlyMetSerTyrAsnLys115120125SerHisThrTyrHisHisAsnTyrSerAsnAsnHisIleProMetMet130135140AlaSerProAsnSerGlySerAsnAlaGlyMetLysLysGlnThrAsn145150155160SerSerAsnGlyAsnGlySerSerAlaThrSerProSerTyrSerSer165170175TyrAsnSerSerSerGlnTyrAspLeuTyrLysPheAspValThrLys180185190LeuLysAsnLeuLysGluAsnSerSerAsnLeuIleGlnLeuProLeu195200205PheIleAsnThrThrGluAlaGluPheAlaAlaAlaSerValGlnArg210215220TyrGluLeuAsnMetLysAlaLeuAsnLeuAsnSerGluSerLeuGlu225230235240AsnSerSerValGluLysSerSerAlaHisHisHisThrLysSerHis245250255SerIleProLysHisAsnGluGluValLysThrGluThrHisGlyGlu260265270GluGluAspAlaHisAspLysLysProHisAlaSerLysAspAlaHis275280285GluLeuLysLysLysThrGluValLysLysGluAspAlaLysGlnAsp290295300ArgAsnGluLysValIleGlnGluProGlnAlaThrValLeuProVal305310315320ValAspLysLysGluProGluGluSerValGluGluAsnThrSerLys325330335ThrSerSerProSerProSerProProAlaAlaLysSerTrpSerAla340345350IleAlaSerAspAlaIleLysSerArgGlnAlaSerAsnLysThrVal355360365SerGlySerMetValThrLysThrProIleSerGlyThrThrAlaGly370375380ValSerSerThrAsnMetAlaAlaAlaThrIleGlyLysSerSerSer385390395400ProLeuLeuSerLysGlnProGlnLysLysAspLysLysTyrValPro405410415ProSerThrLysGlyIleGluProLeuGlySerIleAlaLeuArgMet420425430CysPheAspProAspPheIleSerTyrValLeuArgAsnLysAspVal435440445GluAsnLysIleProValHisSerIleIleProArgGlyIleIleAsn450455460ArgAlaAsnIleCysPheMetSerSerValLeuGlnValLeuLeuTyr465470475480CysLysProPheIleAspValIleAsnValLeuSerThrArgAsnThr485490495AsnSerArgValGlyThrSerSerCysLysLeuLeuAspAlaCysLeu500505510ThrMetTyrLysGlnPheAspLysGluThrTyrGluLysLysPheLeu515520525GluAsnAlaAspAspAlaGluLysThrThrGluSerAspAlaLysLys530535540SerSerLysSerLysSerPheGlnHisCysAlaThrAlaAspAlaVal545550555560LysProAspGluPheTyrLysThrLeuSerThrIleProLysPheLys565570575AspLeuGlnTrpGlyHisGlnGluAspAlaGluGluPheLeuThrHis580585590LeuLeuAspGlnLeuHisGluGluLeuIleSerAlaIleAspGlyLeu595600605ThrAspAsnGluIleGlnAsnMetLeuGlnSerIleAsnAspGluGln610615620LeuLysValPhePheIleArgAsnLeuSerArgTyrGlyLysAlaGlu625630635640PheIleLysAsnAlaSerProArgLeuLysGluLeuIleGluLysTyr645650655GlyValIleAsnAspAspSerThrGluGluAsnGlyTrpHisGluVal660665670SerGlySerSerLysArgGlyLysLysThrLysThrAlaAlaLysArg675680685ThrValGluIleValProSerProIleSerLysLeuPheGlyGlyGln690695700PheArgSerValLeuAspIleProAsnAsnLysGluSerGlnSerIle705710715720ThrLeuAspProPheGlnThrIleGlnLeuAspIleSerAspAlaGly725730735ValAsnAspLeuGluThrAlaPheLysLysPheSerGluTyrGluLeu740745750LeuProPheLysSerSerSerGlyAsnAspValGluAlaLysLysGln755760765ThrPheIleAspLysLeuProGlnValLeuLeuIleGlnPheLysArg770775780PheSerPheIleAsnAsnValAsnLysAspAsnAlaMetThrAsnTyr785790795800AsnAlaTyrAsnGlyArgIleGluLysIleArgLysLysIleLysTyr805810815GlyHisGluLeuIleIleProGluGluSerMetSerSerIleThrLeu820825830LysAsnAsnThrSerGlyIleAspAspArgArgTyrLysLeuThrGly835840845ValIleTyrHisHisGlyValSerSerAspGlyGlyHisTyrThrAla850855860AspValTyrHisSerGluHisAsnLysTrpTyrArgIleAspAspVal865870875880AsnIleThrGluLeuGluAspAspAspValLeuLysGlyGlyGluGlu885890895AlaSerAspSerArgThrAlaTyrIleLeuMetTyrGlnLysArgAsn900905910(2) INFORMATION FOR SEQ ID NO:9:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 4 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:GlyGlyGlySer__________________________________________________________________________

Claims

1. An isolated DNA encoding a ubiquitin-specific protease which specifically cleaves a ubiquitin fusion protein having a molecular weight of about 120 kilodaltons, the specific cleavage taking place in vitro between the C-terminal residue of ubiquitin and the N-terminal residue of the protein or peptide, the fusion protein being encoded by the DNA represented in Sequence ID Number 1.

2. An isolated DNA of claim 1 which is characterized by the ability to hybridize specifically with the DNA represented in Sequence I.D. Number 3 under stringent hybridization conditions.

3. An isolated DNA of claim 1 which is characterized by the ability to hybridize specifically with the DNA represented in Sequence I.D. Number 5 under stringent hybridization conditions.

4. An isolated DNA encoding a ubiquitin-specific protease which specifically cleaves a ubiquitin fusion protein having a molecular weight of about 120 kilodaltons, the specific cleavage taking place in a prokaryotic cell between the C-terminal residue of ubiquitin and the N-terminal residue of the protein or peptide, the fusion protein being encoded by the DNA represented in Sequence I.D. Number 1.

5. An isolated DNA of claim 4 which is characterized by the ability to hybridize specifically with the DNA represented in Sequence I.D. Number 3 under stringent hybridization conditions.

6. An isolated DNA of claim 4 which is characterized by the ability to hybridize specifically with the DNA represented in Sequence I.D. Number 5 under stringent hybridization conditions.

7. An isolated DNA of claim 4 which is characterized by the ability to hybridize specifically with the DNA represented in Sequence I.D. Number 7 under stringent hybridization conditions.

8. A cell transformed with:

a) a first DNA expression construct encoding a biologically active ubiquitin-specific protease comprising a DNA sequence selected from the group consisting of Sequence I.D. Number 3, Sequence I.D. Number 5 and Sequence I.D. Number 7, or a portion of these sequences, said portion encoding said protease, in expressible form; and

b) a second DNA expression construct encoding ubiquitin joined to a DNA sequence encoding a protein or polypeptide of interest having a predetermined amino acid residue at its amino terminus, the ubiquitin being proteolytically cleavable by a ubiquitin-specific endoprotease at the junction with the amino-terminus of the protein or polypeptide of interest such that cleavage results in the exposure of the predetermined amino-terminal residue of the protein or polypeptide of interest.

9. A cell of claim 8 which is a prokaryotic cell.

10. A cell of claim 8 which is E. coli.