Claims
- 1. A compound, RX-0194, having a sequence comprising Seq. Id. No. 2 5′ ccagcccccaccagtccact 3′, targeted to a nucleic acid molecule encoding human Akt-1, wherein said oligonucleotide compound inhibits the expression of human Akt-1.
- 2. The compound of claim 1, wherein the compound is an antisense oligonucleotide.
- 3. The antisense oligonucleotide of claim 2 having at least one modified internucleoside linkage that is a phosphorothioate linkage.
- 4. A method of inhibiting the expression Akt-1 in human cells or tissues comprising contacting said cells or tissues with the compound of claim 1.
- 5. A method of inducing cytotoxicity in a cancer cell comprising the step of introducing into the cell an oligonucleotide that hybridizes to a human Akt-1 sequence, comprising, RX-0194, Seq. Id. No. 2, 5′ ccagcccccaccagtccact 3′.
- 6. A compound, RX-0201, 5′ gctgcatgatctccttggcg 3′, Seq. Id. No. 4, targeted to a nucleic acid molecule encoding Akt-1, wherein said compound inhibits the expression of human Akt-1.
- 7. The compound of claim 6, wherein the compound is an antisense oligonucleotide.
- 8. The antisense oligonucleotide of claim 7 having at least one modified internucleoside linkage that is a phosphorothioate linkage.
- 9. A method of inhibiting the expression of Akt-1 in human cells or tissues comprising contacting said cells or tissues with the compound of claim 6.
- 10. A method of inducing cytotoxicity in a cancer cell comprising the step of introducing into the cell an oligonucleotide that hybridizes to a human Akt-1 sequence, comprising Seq. Id. No. 4 RX-0201, 5′ gctgcatgatctccttggcg 3′.
- 11. A compound, RX-0616, having a sequence comprising Seq. Id. No. 13 5′ agatagctggtgacagacag 3′, targeted to a nucleic acid molecule encoding human Akt-1, wherein said oligonucleotide compound inhibits the expression of human Akt-1.
- 12. The compound of claim 11, wherein the compound is an antisense oligonucleotide.
- 13. The antisense oligonucleotide of claim 12 having at least one modified internucleoside linkage that is a phosphorothioate linkage.
- 14. A method of inhibiting the expression Akt-1 in human cells or tissues comprising contacting said cells or tissues with the compound of claim 11.
- 15. A method of inducing cytotoxicity in a cancer cell comprising the step of introducing into the cell an oligonucleotide that hybridizes to a human Akt-1 sequence, comprising, RX-0616, Seq. Id. No. 13, 5′ agatagctggtgacagacag 3′.
- 16. A compound, RX-0627, having a sequence comprising Seq. Id. No. 14 5′ cgtggagagatcatctgagg 3′, targeted to a nucleic acid molecule encoding human Akt-1, wherein said oligonucleotide compound inhibits the expression of human Akt-1.
- 17. The compound of claim 16, wherein the compound is an antisense oligonucleotide.
- 18. The antisense oligonucleotide of claim 17 having at least one modified internucleoside linkage that is a phosphorothioate linkage.
- 19. A method of inhibiting the expression Akt-1 in human cells or tissues comprising contacting said cells or tissues with the compound of claim 16.
- 20. A method of inducing cytotoxicity in a cancer cell comprising the step of introducing into the cell an oligonucleotide that hybridizes to a human Akt-1 sequence, comprising, RX-0627, Seq. Id. No. 14, 5′ cgtggagagatcatctgagg 3′.
- 21. A compound, RX-0628, having a sequence comprising Seq. Id. No. 15 5′ tcgaaaaggtcaagtgctac 3′, targeted to a nucleic acid molecule encoding human Akt-1, wherein said oligonucleotide compound inhibits the expression of human Akt-1.
- 22. The compound of claim 21, wherein the compound is an antisense oligonucleotide.
- 23. The antisense oligonucleotide of claim 22 having at least one modified internucleoside linkage that is a phosphorothioate linkage.
- 24. A method of inhibiting the expression Akt-1 in human cells or tissues comprising contacting said cells or tissues with the compound of claim 21.
- 25. A method of inducing cytotoxicity in a cancer cell comprising the step of introducing into the cell an oligonucleotide that hybridizes to a human Akt-1 sequence, comprising, RX-0628, Seq. Id. No. 15, 5′ tcgaaaaggtcaagtgctac 3′.
- 26. A compound, RX-0632, having a sequence comprising Seq. Id. No. 16 5′ tggtgcagcggcagcggcag 3′, targeted to a nucleic acid molecule encoding human Akt-1, wherein said oligonucleotide compound inhibits the expression of human Akt-1.
- 27. The compound of claim 26, wherein the compound is an antisense oligonucleotide.
- 28. The antisense oligonucleotide of claim 27 having at least one modified internucleoside linkage that is a phosphorothioate linkage.
- 29. A method of inhibiting the expression Akt-1 in human cells or tissues comprising contacting said cells or tissues with the compound of claim 26.
- 30. A method of inducing cytotoxicity in a cancer cell comprising the step of introducing into the cell an oligonucleotide that hybridizes to a human Akt-1 sequence, comprising, RX-0632, Seq. Id. No. 16, 5′ tggtgcagcggcagcggcag 3′.
- 31. A compound, RX-0638, having a sequence comprising Seq. Id. No. 17 5′ ggcgcgagcgcgggcctagc 3′, targeted to a nucleic acid molecule encoding human Akt-1, wherein said oligonucleotide compound inhibits the expression of human Akt-1.
- 32. The compound of claim 31, wherein the compound is an antisense oligonucleotide.
- 33. The antisense oligonucleotide of claim 32 having at least one modified internucleoside linkage that is a phosphorothioate linkage.
- 34. A method of inhibiting the expression Akt-1 in human cells or tissues comprising contacting said cells or tissues with the compound of claim 31.
- 35. A method of inducing cytotoxicity in a cancer cell comprising the step of introducing into the cell an oligonucleotide that hybridizes to a human Akt-1 sequence, comprising, RX-0638, Seq. Id. No. 17, 5′ ggcgcgagcgcgggcctagc 3′.
RELATED APPLICATION
[0001] This application is a continuation-in-part of U.S. Ser. No. 60/404,010 filed Aug. 16, 2002. A corresponding PCT Application, Atty. Docket No. REX-7032 PCT, is filed concurrently herewith. Both applications are incorporated herein as if set forth in full.
Provisional Applications (1)
|
Number |
Date |
Country |
|
60404010 |
Aug 2002 |
US |