This application claims priority to Chinese Application No. 202010738200.2, filed Jul. 28, 2020, the contents of which are incorporated by reference herein in its entirety.
The present disclosure relates to the field of biotechnology, and in particular to use of a miRNA 148 cluster as a marker for diagnosing and/or treating cognitive impairment-associated diseases.
Neurocognitive disorder (NCD) is a group of syndromes with cognitive deficits as main clinical manifestations, including disorders of thought, reasoning, memory and problem solving. According to “Diagnostic and Statistical Manual of Mental Disorders, Fifth Edition (DSM-5)”, cognitive impairment is divided into mild cognitive impairment (MCI) and severe cognitive impairment (dementia). Cognitive impairment involves many brain and physical diseases, where Alzheimer's disease (AD) and vascular dementia (VaD) are the most common cognitive impairment-associated diseases. Cognitive impairment, which is more likely to affect the elderly, is not a part of a normal aging process, but a disease that occurs after the brain undergoes underlying pathological damage. Therefore, cognitive impairment also affects young people.
The prevalence of AD accounts for more than 50% of dementia, and the principal pathological features of AD are senile plaques formed due to extracellular amyloid deposition and neurofibrillary tangles formed due to intracellular Tau hyperphosphorylation. The incidence of VaD is second only to AD, accounting for about 15% to 20% of dementia. VaD is caused by ischemic stroke, hemorrhagic stroke, cerebral ischemia and hypoxia, or the like. The pathogenesis of these two diseases is relatively complex, and there is a lack of effective medicine and simple and non-invasive early diagnosis and screening methods. Therefore, seeking reliable diagnostic markers and effective drugs is a scientific problem to be solved urgently in the prevention and treatment of AD and VaD at present. However, there are no related gene reports on sporadic AD and VaD, which brings great difficulty to disease screening and prevention. Therefore, studying changes of related genes in the diseases is of great significance for the prevention and treatment of cognitive impairment-associated diseases and the discovery of clinical biomarkers.
In view of this, the present disclosure provides use of a miRNA 148 cluster as a marker for diagnosing and/or treating cognitive impairment-associated diseases.
To achieve the above objective, the present disclosure provides the following technical solutions.
The present disclosure provides use of a miRNA 148 cluster or an expression promoter thereof in the following (a), (b), (c), and/or (d):
(a) preparation of a substance that can inhibit phosphorylation of Tau;
(b) preparation of a substance that can alleviate neurodegeneration and has a neuroprotective effect;
(c) preparation of a substance for diagnosing and/or treating cognitive impairment-associated diseases; and
(d) preparation of a substance for reducing the expression of p35, p25, and cyclin-dependent kinase 5 (CDK5).
In an example of the present disclosure, the miRNA148 cluster is selected from hsa-miR-148a, with a nucleotide sequence shown in SEQ ID NO. 1; and the miRNA148 cluster is selected from hsa-miR-148a-3p, with a nucleotide sequence shown in SEQ ID NO. 2.
The present disclosure further provides a product with an active ingredient of a miRNA 148 cluster or an expression promoter thereof, and use of the product includes the following (a), (b), (c) and/or (d):
(a) inhibiting phosphorylation of Tau;
(b) alleviating neurodegeneration and providing a neuroprotective effect;
(c) diagnosing and/or treating cognitive impairment-associated diseases; and
(d) reducing the expression of p35, p25, and CDK5.
In an example of the present disclosure, the product for diagnosing cognitive impairment-associated diseases is a detection kit;
the detection kit includes primers of the miRNA 148 cluster; and the kit is used to diagnose cognitive impairment-associated diseases, predict the risk of developing cognitive impairment-associated diseases, or predict the outcome of cognitive impairment-associated diseases in patients suffering from or at risk of developing cognitive impairment-associated diseases.
In an example of the present disclosure, the primer is used to determine an expression level of the miRNA 148 cluster in a sample.
In an example of the present disclosure, the expression level of the miRNA 148 cluster is based on an expression level of the miRNA 148 cluster in a patient and a reference expression level of the miRNA 148 cluster in a healthy subject; and
if the expression level of the miRNA 148 cluster is significantly lower than the reference expression level of the miRNA 148 cluster in a healthy subject, it indicates that the patient has or is at risk of developing a cognitive impairment-associated disease.
In an example of the present disclosure, the expression level of the miRNA 148 cluster is determined by a sequencing-based method, an array-based method, or a PCR-based method.
In an example of the present disclosure, the expression promoter of the miRNA 148 cluster is at least a reagent, a medicament, a preparation, and a gene sequence that promote the expression or activation of Akt, a reagent, a medicament, a preparation, and a gene sequence that promote the expression or activation of cAMP-response element binding protein (CREB), and a reagent, a medicament, a preparation, and a gene sequence that inhibit the expression or activation of PTEN;
the Akt and CREB up-regulate the expression of the miRNA 148 cluster; and the PTEN downregulates the expression of the miRNA 148 cluster.
Use of an agonist for a miRNA 148 cluster in the preparation of a medicament for treating cognitive impairment-associated diseases also belongs to the protection scope of the present disclosure.
Use of a long non-coding RNA (lncRNA) interactive with a miRNA 148 cluster in the preparation of a medicament for treating cognitive impairment-associated diseases also belongs to the protection scope of the present disclosure.
In the present disclosure, the expression of a miRNA of the miRNA 148 cluster is reduced in AD and VaD, and miRNA 148 cluster reduces the phosphorylation level of Tau by targeting p35 in AD to play a role in improving cognitive dysfunction. The miRNA of the miRNA 148 cluster is:
(1) The miRNA 148 cluster is selected from the following: (a) classification of microRNA, where, the miRNA 148a is selected from hsa-miR-148a, with a sequence shown in SEQ ID NO. 1: gaggcaaagu ucugagacac uccgacucug aguaugauag aagucagugc acuacagaac uuugucuc, and a default mature body (hsa-miR-148a-3p) thereof has a sequence shown in SEQ ID NO. 2: ucagugcacuacagaacuuugu; and (b) modified derivatives of microRNAs; or microRNAs or modified miRNA derivatives with the same or substantially the same functions as microRNAs length of 18 nt to 26 nt.
The present disclosure further provides a preparation and a medicament, which are agonists for the microRNA in (1).
The present disclosure further provides a lncRNA, which is a lncRNA that specifically interacts with the microRNA in (1).
The present disclosure has the following advantages:
The present disclosure finds that the miRNA 148 cluster plays a role in the diagnosis and treatment of cognitive impairment-associated diseases. The expression level of the miRNA 148 cluster is detected using primers and/or probes for the microRNA through cognitive impairment-associated disease models, and it is found that the expression of the miRNA 148 cluster is significantly reduced during the progression of the cognitive impairment-associated disease. Therefore, the miRNA 148 cluster can be used as a novel marker for the auxiliary diagnosis of cognitive impairment-associated diseases.
The present disclosure finds that the miRNA 148 cluster participates in the pathological processes of AD and VaD, and exhibits a neuroprotective effect in AD and VaD cell models. In the pathological process of AD, the miRNA 148 cluster can directly bind to the 3′UTR of p35 mRNA to regulate the translation of p35, thereby secondarily regulating the expression of p25 and CDK5, reducing the phosphorylation level of Tau, and improving cognitive impairment in mice. CREB can directly bind to the promoter of miR-148a and upregulate the transcription of miR-148a. The PTEN/Akt signaling pathway can regulate the expression of miR-148a by regulating CREB, thereby affecting the phosphorylation level of Tau and improving the learning and memory capabilities of mice.
The present disclosure investigates functions of the miRNA 148 cluster deeply and systematically. Based on the above findings, the miRNA 148 cluster can be used as a novel therapeutic target for cognitive impairment-associated diseases, providing a new idea for targeted therapy using the miRNA 148 cluster as a biomarker for cognitive impairment-associated diseases.
In order to more clearly illustrate the implementations of the present disclosure or the technical solutions in the prior art, the following will briefly introduce the drawings that need to be used in the description of the implementations or the prior art. Obviously, the drawings in the following description are only exemplary. For those of ordinary skill in the art, other implementation drawings can be derived from the provided drawings without creative work.
The structure, scale, size, and the like shown in the drawings of this specification are only used to match the content disclosed in the specification and for those skilled in the art to understand and read, which are not used to limit the limitations for implementing the present disclosure and thus are not technically substantial. Any structural modification, scaling relation change, or size adjustment made without affecting the effects and objectives that can be achieved by the present disclosure shall fall within the scope that can be encompassed by the technical content disclosed in the present disclosure.
In order to more clearly illustrate the implementations of the present disclosure or the technical solutions in the prior art, the following will briefly introduce the drawings that need to be used in the description of the implementations or the prior art. Obviously, the drawings in the following description are only exemplary. For those of ordinary skill in the art, other implementation drawings can be derived from the provided drawings without creative work.
The implementation of the present disclosure will be illustrated below in conjunction with specific examples. Those skilled in the art can easily understand other advantages and effects of the present disclosure from the content disclosed in this specification. Obviously, the described examples are merely a part rather than all of the examples of the present disclosure. All other examples obtained by a person of ordinary skill in the art based on the examples of the present disclosure without creative efforts shall fall within the protection scope of the present disclosure.
In the present disclosure, the term “expression level” refers to a measured expression level compared with a reference nucleic acid (for example, from a control), or a calculated average expression value (for example, in RNA microarray analysis). A specified “expression level” can also be used as a result and determined by the comparison and measurement of a plurality of nucleic acids of interest disclosed below, and show the relative abundance of these transcripts with each other. The expression level can also be evaluated relative to the expression of different tissues, patients versus healthy controls, etc.
In the context of the present disclosure, a “sample” or “biological sample” is a sample that is derived from or has been in contact with a biological organism. Examples of biological samples include: cells, tissues, body fluids, biopsy samples, blood, urine, saliva, sputum, plasma, serum, cell culture supernatant, etc.
A “gene” is a nucleic acid segment that carries the information necessary to produce a functional RNA product in a controlled manner. A “gene product” is a biomolecule produced by gene transcription or expression, such as mRNA or translated protein.
“miRNA” is a short, naturally occurring RNA molecule, and should have the general meaning understood by those skilled in the art. A “miRNA-derived molecule” is a molecule obtained from a miRNA template chemically or enzymatically, such as cDNA.
“lncRNA” is a non-coding or slightly-coding RNA molecule with a length of more than 200 bases, and should have the general meaning understood by those skilled in the art. lncRNA can interact with miRNA as a competitive endogenous RNA (ceRNA), participate in the regulation of target genes, and play an important role in the occurrence and development of diseases.
In the present disclosure, the term “array” refers to an arrangement of addressable positions on a device (such as a chip device). The number of locations can vary from a few to at least hundreds or thousands. Each position represents an independent reaction site. Arrays include, but are not limited to, nucleic acid arrays, protein arrays, and antibody arrays. “Nucleic acid array” refers to an array including nucleic acid probes, such as oligonucleotides, polynucleotides, or large portions of genes. The nucleic acids on the array are preferably single-stranded.
“PCR-based method” refers to a method involving polymerase chain reaction (PCR). This is a method of exponentially amplifying nucleic acids “such as DNA or RNA” by using one, two or more primers to replicate enzymatically in vitro. For RNA amplification, reverse transcription can be used as the first step. PCR-based methods include kinetic or quantitative PCR (qPCR), which are particularly suitable for analyzing expression levels. When it achieves the determination of the expression level, for example, a PCR-based method can be used to detect the presence of a given mRNA, which reverse transcribes a complete mRNA library (the so-called transcriptome) into cDNA with the help of reverse transcriptase, and the presence of a given cDNA is detected with the help of corresponding primers. This method is commonly referred to as reverse transcriptase PCR (RT-PCR).
In the present disclosure, the term “PCR-based method” includes both end-point PCR applications and kinetic/real-time PCR techniques using special fluorophores or intercalating dyes, which emit fluorescent signals as functions of amplification targets and allow monitoring and quantification of the targets.
In the present disclosure, the term “marker” or “biomarker” refers to a biomolecule whose presence or concentration can be detected and associated with a known condition (such as a disease state) or clinical outcome (such as response to treatment), such as nucleic acids, peptides, proteins, and hormones.
In the present disclosure, miRNA has the advantages of being endogenous, small in size and easy to pass through the blood-brain barrier (BBB), which can not only regulate translation and expression by binding to target genes, but also interact with lncRNA. Moreover, a single miRNA may interact with multiple target genes and lncRNAs, and multiple miRNAs may also interact with the same target gene or lncRNA to form a complex regulatory network in the brain.
RNA was extracted from the brain tissues of 1-month-old, 3-month-old, 6-month-old, and 9-month-old APP/PS1 double-transgenic mice and WT control mice, and the miRNA was fluorescently labeled with the miRCURY™ Array Power Labeling kit. The miRNA 148 cluster of the present disclosure was hsa-miR-148a, with a sequence shown in SEQ ID NO. 1: gaggcaaagu ucugagacac uccgacucug aguaugauag aagucagugc acuacagaac uuugucuc. A default mature body (hsa-miR-148a-3p) thereof had a sequence shown in SEQ ID NO. 2: ucagugcacuacagaacuuugu. The mature body (hsa-miR-148a-3p) miRNA involved: reverse transcription primer: SEQ ID NO. 3: gtcgtatcca gtgcagggtc cgaggtattc gcactggata cgacacaaag; qPCR forward primer: SEQ ID NO. 4: gcgcgtcagt gcactacagaa; and reverse primer: SEQ ID NO. 5: agtgcagggt ccgaggtatt. Then the sample was hybridized on the miRCURY™ Array. A microarry was scanned with Axon GenePix 4000B microarray scanner, and the original data were analyzed with GenePix pro V6.0 software. As shown in the array results in
The Swedish mutant APP gene was stably transfected into SH-SYSY cells to construct a stable transgenic APPswe cell line. The present disclosure used 300 μM Cu2+ (CuSO4) to damage APPswe cells to establish an AD cell model, and cellular RNA was extracted to detect the expression level of miR-148a. As shown in
qPCR was used to detect the level of miR-148a expression in the brains of APP/PS1 double-transgenic mice and WT control mice thereof, and SAMP8 mice and control mice thereof (SAMR1). As shown in
To confirm the correlation between the miR-148a level and AD, miRNA was extracted from the serum of fourteen AD patients and five health age-matched volunteers (HAVs), and the expression of miR-148a was detected by qPCR. As shown in
Five mM sodium dithionite (Na2S2O4) was used to damage SH-SYSY cells to establish an oxygen-glucose deprivation (OGD) cell model to simulate the pathological state of VaD. After the Na2S2O4 injury, RNA was extracted, and the expression of miR-148a was detected by qPCR. As shown in
SD rats suffering from 2-vessel occlusion (2VO) were used to establish the VaD model, and the expression changes of miR-148a were detected in the cerebral cortex and hippocampus of rats with VaD. As shown in
In order to explore the neuroprotective effect of miR-148a in AD and VaD, two cell models were transfected with miR-148a mimics or inhibitor, and the CCK-8 was used to detect cell viability. As shown in
The apoptosis rate was detected by flow cytometry to further confirm the role of miR-148a in nerve cells. As shown in
In order to explore the role of miR-148a in the phosphorylation of Tau, APPswe cells were transfected with miR-148a mimics or inhibitor, and Western blot (WB) was used to detect the phosphorylation level of Tau at various sites. As shown in
In order to explore the inhibitory mechanism of miR-148a on Tau phosphorylation, bioinformatics software was used to explore its target, and it was found that miR-148a could specifically bind to the 3′UTR of p35 mRNA, and the binding site as shown in
As shown in
Furthermore, qPCR and WB were used to detect the regulation of miR-148a on the expression of p35 mRNA and protein. As shown in
CDK5 is a member of the cyclin-dependent kinase family, which does not regulate the cell cycle and is an important kinase for Tau in nerve cells. p35 is a specific activator for CDK5 in the brain. In order to study the effect of p35 on CDK5, a p35 plasmid was overexpressed in SH-SYSY cells, and the expression changes of CDK5 were detected by co-immunoprecipitation (CO-IP) and WB assay. As shown in
In order to further study the potential mechanism of miR-148a regulating Tau phosphorylation, the expression of miR-148a was upregulated in cells to detect the expression levels of p35, p25, and CDK5. As shown in
In order to verify the above inference, the cells were simultaneously transfected with miR-148a and p35. As shown in
APP/PS1 mice are commonly used AD animal models, which can well simulate the pathology of AD at advanced stage. 6-month-old APP/PS1 mice were selected for test. The brain of APP/PS1 mice was intracerebroventricularly injected with miR-148a adeno-associated virus (AAV) to upregulate the expression of miR-148a in the brain. The Morris water maze experiment was conducted to explore the effect of miR-148a on the cognition of mice. As shown in
Based on the discovery of the regulatory relationship between miR-148a and p35, p25 or CDK5 in vitro, the correlation between miR-148a and p35, p25 or CDK5 was further tested in vivo. As shown by results in
Since miR-148a was previously found to affect the pathological change of Tau hyperphosphorylation in AD model cells, the regulation of miR-148a on Tau phosphorylation was further observed in the hippocampus of AD mice. As shown in
RNA was extracted from brain tissues of 1-month-old, 3-month-old, 6-month-old, and 9-month-old APP/PS1 double-transgenic mice and WT control mice therefore, and the mRNA was fluorescently labeled using the Quick Amp Labeling Kit. PTEN gene qPCR primers involved in this example: forward primer: SEQ ID NO. 6: attggctgctgtcctgctgtt; and reverse primer: SEQ ID NO. 7: ggttaagtcattgctgctgtgtct. Then Agilent Microarray Scanner was used to scan the array, and Agilent Feature Extraction software was used for data acquisition and analysis. The array results in
In order to further confirm the expression changes of PTEN in the brain tissues of AD animals, the expression of PTEN protein in the brain of 3-month-old, 6-month-old, and 9-month-old APP/PS1 mice and SAMP8 mice was detected. As shown in
In order to explore the relationship between PTEN and Tau phosphorylation, the immunofluorescence technology was used to analyze the localization of PTEN and phosphorylated Tau in cells. As shown by results in
In order to further explore the effect of PTEN on the Tau phosphorylation, the PTEN was transfected into APPswe cells. As shown by results in
In order to explore the relationship between PTEN and miR-148a, the plasmid or siRNA was transfected into APPswe cells to overexpress or inhibit the expression of PTEN, and the expression changes of miR-148a were detected by the qPCR. As shown in
As an inhibitor of Akt signaling pathway, PTEN downregulates the downstream pathway of Akt. As shown in
In order to explore the effect of Akt signaling pathway on the expression of miR-148a, the cells were transfected with the Akt plasmid and Akt siRNA to change the expression of Akt. As shown in E of
The above experiments suggest that the PTEN/Akt signaling pathway may affect the expression of miR-148a by regulating the transcription process of miR-148a. Therefore, a miR-148a promoter region luciferase plasmid was constructed. The increased luminescence value indicates that the miR-148a transcription is promoted, and the decreased luminescence value indicates that the miR-148a transcription is inhibited. As shown in
Since the PTEN/Akt signaling pathway can regulate the transcription of miR-148a, the promoter region of miR-148a was analyzed. Promoter Scan software found that the promoter region of miR-148a may bind to CREB.
In order to further verify whether CREB can regulate the transcription of miR-148a, a dual-luciferase reporter gene was designed according to the binding site. As shown in
Since CREB can directly bind to the promoter region of miR-148a, it can regulate the transcription of miR-148a. Combining the above experimental results, the regulatory effect of PTEN/Akt signaling pathway on CREB was further studied. The cells were transfected with a PTEN expression plasmid and PTEN siRNA, and the WB was used to detect changes in the activity of CREB. As shown in
The expression of Akt in cells was changed to detect expression changes of CREB. As shown in
In order to further study the role of PTEN in AD, the brains of APP/PS1 mice were intracerebroventricularly injected with PTEN siRNA AAV and control AAV, separately. Thirty days after the injection, the Morris water maze experiment was conducted to determine the effect of PTEN on the learning and memory capacity of AD mice. As shown in
The qPCR was used to detect the expression level of miR-148a in the brain of mice. As shown in
The WB method was used to detect the phosphorylation levels of Tau in the hippocampus of mice in the above three groups. As shown
Similarly, the WB method was used to detect expression changes of the Akt/CREB signaling pathway in the hippocampus of mice. As shown in
The test results of Examples 1 to 29 of the present disclosure show that the expression of the miRNA 148 cluster is significantly reduced during pathological processes of cognitive impairment-associated diseases AD and VaD, and exogenously increasing the expression of miRNA 148a can result in a neuroprotective effect.
In particular, in a pathological process of AD, upregulating the PTEN expression can inhibit the phosphorylation of Akt, which in turn suppresses the phosphorylation of CREB, reduces the transcription and expression of miR-148a, increases the expression of p35, p25, and CDK5, and promotes the phosphorylation of Tau, thus causing cognitive impairment; and inhibiting the expression of PTEN can activate the phosphorylation of Akt/CREB, promote the transcription of miR-148a, and suppress the expression of p35, p25 and CDK5, thereby inhibiting the phosphorylation of Tau and improving cognitive dysfunction. Therefore, the miRNA 148 cluster is expected to become a novel target for the diagnosis and treatment of cognitive impairment-associated diseases.
Although the present disclosure has been described in detail above with general descriptions and specific examples, it will be apparent to those skilled in the art that some modifications or improvements can be made on the basis of the present disclosure. Therefore, all these modifications or improvements made without departing from the spirit of the present disclosure fall within the scope of the present disclosure.
Number | Date | Country | Kind |
---|---|---|---|
202010738200.2 | Jul 2020 | CN | national |