Vaccine for clostridium botulinum neurotoxin

FIELD OF THE INVENTION
The present invention relates to the isolation of polypeptides derived from the Clostridium botulinum neurotoxin and the use thereof as immunogens for the production of vaccines and antitoxins.
The genus Clostridium is comprised of gram-positive, anaerobic, spore-forming bacilli. The natural habitat of these organisms is the environment and the intestinal tracts of humans and other animals. Indeed, clostridia are ubiquitous; they are commonly found in soil, dust, sewage, marine sediments, decaying vegetation, and mud. �See e.g., P. H. A. Sneath et al., "Clostridium," Bergey's Manual.RTM. of Systematic Bacteriology, Vol. 2, pp. 1141-1200, Williams & Wilkins (1986).! Despite the identification of approximately 100 species of Clostridium, only a small number have been recognized as etiologic agents of medical and veterinary importance. Nonetheless, these species are associated with very serious diseases, including botulism, tetanus, anaerobic cellulitis, gas gangrene, bacteremia, pseudomembranous colitis, and clostridial gastroenteritis. Table 1 lists some of the species of medical and veterinary importance and the diseases with which they are associated. As virtually all of these species have been isolated from fecal samples of apparently healthy persons, some of these isolates may be transient, rather than permanent residents of the colonic flora.
TABLE 1______________________________________Clostridium Species of Medical and Veterinary Importance*Species Disease______________________________________C. aminovalericum Bacteriuria (pregnant women)C. argentinense Infected wounds; Bacteremia; Botulism; Infections of amniotic fluidC. baratii Infected war wounds; Peritonitis; Infectious processes of the eye, ear and prostateC. beijerinckikii Infected woundsC. bifermentans Infected wounds; Abscesses; Gas Gangrene; BacteremiaC. botulinum Food poisoning; Botulism (wound, food, infant)C. butyricum Urinary tract, lower respiratory tract, pleural cavity, and abdominal infections; Infected wounds; Abscesses BacteremiaC. cadaveris Abscesses; Infected woundsC. carnis Soft tissue infections; BacteremiaC. chauvoei BlacklegC. clostridioforme Abdominal, cervical; scrotal, pleural, and other infections; Septicemia; Peritonitis; AppendicitisC. cochlearium Isolated from human disease processes, but role in disease unknown.C. difficile Antimicrobial-associated diarrhea; Pseudomembranous enterocolitis; Bacteremia; Pyogenic infectionsC. fallax Soft tissue infectionsC. ghnoii Soft tissue infectionsC. glycolicum Wound infections; Abscesses; PeritonitisC. hastiforme Infected war wounds; Bacteremia; AbscessesC. histolyticum Infected war wounds; Gas gangrene; Gingival plaque isolateC. indolis Gastrointestinal tract infectionsC. innocuum Gastrointestinal tract infections; EmpyemaC. irregulare Penile lesionsC. leptum Isolated from human disease processes, but role in disease unknown.C. limosum Bacteremia; Peritonitis; Pulmonary infectionsC. malenominatum Various infectious processesC. novyi Infected wounds; Gas gangrene; Blackleg, Big head (ovine); Redwater disease (bovine)C. oroticum Urinary tract infections; Rectal abscessesC. paraputrificum Bacteremia; Peritonitis; Infected wounds; AppendicitisC. perfringens Gas gangrene; Anaerobic cellulitis; Intra-abdominal abscesses; Soft tissue infections; Food poisoning; Necrotizing pneumonia; Empyema; Meningitis; Bacteremia; Uterine Infections; Enteritis necrotans; Lamb dysentery; Struck; Ovine Enterotoxemia;C. putrefaciens Bacteriuria (Pregnant women with bacteremia)C. putrificum Abscesses; Infected wounds; BacteremiaC. ramosum Infections of the abdominal cavity, genital tract, lung, and biliary tract; BacteremiaC. sartagoforme Isolated from human disease processes, but role in disease unknown.C. septicum Gas gangrene; Bacteremia; Suppurative infections; Necrotizing enterocolitis; BraxyC. sordellii Gas gangrene; Wound infections; Penile lesions; Bacteremia;. Abscesses; Abdominal and vaginal infectionsC. sphenoides Appendicitis; Bacteremia; Bone and soft tissue infections; Intraperitoneal infections; Infected war wounds; Visceral gas gangrene; Renal abscessesC. sporogenes Gas gangrene; Bacteremia; Endocarditis; central nervous system and pleuropulmonary infections; Penile lesions; Infected war wounds; Other pyogenic infectionsC. subterminale Bacteremia; Empyema; Biliary tract, soft tissue and bone infectionsC. symbiosum Liver abscesses; Bacteremia; Infections resulting due to bowel floraC. tertium Gas gangrene; Appendicitis; Brain abscesses; Intestinal tract and soft tissue infections; Infected war wounds; Periodontitis; BacteremiaC. tetani Tetanus; Infected gums and teeth; Corneal ulcerations; Mastoid and middle ear infections; Intraperitoneal infections; Tetanus neonatorum; Postpartum uterine infections; Soft tissue infections, especially related to trauma (including abrasions and lacerations); Infections related to use of contaminated needlesC. thermosaccharolyticum Isolated from human disease processes, but role in disease unknown.______________________________________ *Compiled from P. G. Engelkirk et al. "Classification", Principles and Practice of Clinical Anaerobic Bacteriology, pp. 2223, Star Publishing Co., Belmont, CA (1992); J. Stephen and R. A. Petrowski, "Toxins Which Traverse Membranes and Deregulate Cells," in Bacterial Toxins, 2d ed., pp 66-67, American Society for Microbiology (1986); R. Berkow and A. J. Fletcher (eds.), "Bacterial Diseases," #Merck Manual of Diagnosis and Therapy, 16th ed., pp. 116-126, Merck Research Laboratories, Rahway, N.J. (1992); and O. H. Sigmund and C. M. Fraser (eds.), "Clostridial Infections," Merck Veterinary Manual, 5th ed., pp. 396-409, Merck & Co., Rahway, N.J. (1979).
In most cases, the pathogenicity of these organisms is related to the release of powerful exotoxins or highly destructive enzymes. Indeed, several species of the genus Closiridium produce toxins and other enzymes of great medical and veterinary significance. �C. L. Hatheway, Clin. Microbiol. Rev. 3:66-98 (1990).!
Perhaps because of their significance for human and veterinary medicine, much research has been conducted on these toxins, in particular those of C. botulinum and C. difficile.
C. botulinum
Several strains of Clostridium botulinum produce toxins of significance to human and animal health. �C. L. Hatheway, Clin. Microbiol. Rev. 3:66-98 (1990).! The effects of these toxins range from diarrheal diseases that can cause destruction of the colon, to paralytic effects that can cause death. Particularly at risk for developing clostridial diseases are neonates and humans and animals in poor health (e.g., those suffering from diseases associated with old age or immunodeficiency diseases).
Clostridium botulinum produces the most poisonous biological toxin known. The lethal human dose is a mere 10.sup.-9 mg/kg bodyweight for toxin in the bloodstream. Botulinal toxin blocks nerve transmission to the muscles, resulting in flaccid paralysis. When the toxin reaches airway and respiratory muscles, it results in respiratory failure that can cause death. �S. Arnon, J. Infect. Dis. 154:201-206 (1986).!
C. botulinum spores are carried by dust and are found on vegetables taken from the soil, on fresh fruits, and on agricultural products such as honey. Under conditions favorable to the organism, the spores germinate to vegetative cells which produces toxin. �S. Arnon, Ann. Rev. Med. 31:541 (1980).!
Botulism disease may be grouped into four types, based on the method of introduction of toxin into the bloodstream. Food-borne botulism results from ingesting improperly preserved and inadequately heated food that contains botulinal toxin. There were 355 cases of food-borne botulism in the United States between 1976 and 1984. �K. L. MacDonald et al., Am. J. Epidemiol. 124:794 (1986).! The death rate due to botulinal toxin is 12% and can be higher in particular risk groups. �C. O. Tacket et al., Am. J. Med. 76:794 (1984).! Wound-induced botulism results from C. botulinum penetrating traumatized tissue and producing toxin that is absorbed into the bloodstream. Since 1950, thirty cases of wound botulism have been reported. �M. N. Swartz, "Anaerobic Spore-Forming Bacilli: The Clostridia," pp. 633-646, in B. D. Davis et al.,(eds.), Microbiology, 4th edition, J. B. Lippincott Co. (1990).! Inhalation botulism results when the toxin is inhaled. Inhalation botulism has been reported as the result of accidental exposure in the laboratory �E. Holzer, Med. Klin. 41:1735 (1962)! and could arise if the toxin is used as an agent of biological warfare �D. R. Franz et al., in Botulinum and Tetanus Neurotoxins, B. R. DasGupta, ed., Plenum Press, New York (1993), pp. 473-476!. Infectious infant botulism results from C. botulinum colonization of the infant intestine with production of toxin and its absorption into the bloodstream. It is likely that the bacterium gains entry when spores are ingested and subsequently germinate. �S. Arnon, J. Infect. Dis. 154:201 (1986).! There have been 500 cases reported since it was first recognized in 1976. �M. N. Swartz, supra.!
Infant botulism strikes infants who are three weeks to eleven months old (greater than 90% of the cases are infants less than six months). �S. Arnon, J. Infect. Dis. 154:201 (1986).! It is believed that infants are susceptible, due, in large part, to the absence of the full adult complement of intestinal microflora. The benign microflora present in the adult intestine provide an acidic environment that is not favorable to colonization by C. botulinum. Infants begin life with a sterile intestine which is gradually colonized by microflora. Because of the limited microflora present in early infancy, the intestinal environment is not as acidic, allowing for C. botulinum spore germination, growth, and toxin production. In this regard, some adults who have undergone antibiotic therapy which alters intestinal microflora become more susceptible to botulism.
An additional factor accounting for infant susceptibility to infectious botulism is the immaturity of the infant immune system. The mature immune system is sensitized to bacterial antigens and produces protective antibodies. Secretory IgA produced in the adult intestine has the ability to agglutinate vegetative cells of C botulinum. �S. Arnon, J. Infect. Dis. 154:201 (1986).! Secretory IgA may also act by preventing intestinal bacteria and their products from crossing the cells of the intestine. �S. Arnon, Epidemiol. Rev. 3:45 (1981).! The infant immune system is not primed to do this.
Clinical symptoms of infant botulism range from mild paralysis, to moderate and severe paralysis requiring hospitalization, to fulminant paralysis, leading to sudden death. �S. Arnon, Epidemiol. Rev. 3:45 (1981).!
The chief therapy for severe infant botulism is ventilatory assistance using a mechanical respirator and concurrent elimination of toxin and bacteria using cathartics, enemas, and gastric lavage. There were 68 hospitalizations in California for infant botulism in a single year with a total cost of over $4 million for treatment. �T. L. Frankovich and S. Arnon, West. J. Med. 154:103 (1991).!
Different strains of Clostridium botulinum each produce antigenically distinct toxin designated by the letters A-G. Serotype A toxin has been implicated in 26% of the cases of food botulism; types B, E and F have also been implicated in a smaller percentage of the food botulism cases �H. Sugiyama, Microbiol. Rev. 44:419 (1980)!. Wound botulism has been reportedly caused by only types A or B toxins �H. Sugiyama, supra!. Nearly all cases of infant botulism have been caused by bacteria producing either type A or type B toxin. (Exceptionally, one New Mexico case was caused by Clostridium botulinum producing type F toxin and another by Clostridium botulinum producing a type B-type F hybrid.) �S. Arnon, Epidemiol. Rev. 3:45 (1981).! Type C toxin affects waterfowl, cattle, horses and mink. Type D toxin affects cattle, and type E toxin affects both humans and birds.
A trivalent antitoxin derived from horse plasma is commercially available from Connaught Industries Ltd. as a therapy for toxin types A, B, and E. However, the antitoxin has several disadvantages. First, extremely large dosages must be injected intravenously and/or intramuscularly. Second, the antitoxin has serious side effects such as acute anaphylaxis which can lead to death, and serum sickness. Finally, the efficacy of the antitoxin is uncertain and the treatment is costly. �C. O. Tacket et al., Am. J. Med. 76:794 (1984).!
A heptavalent equine botulinal antitoxin which uses only the F(ab')2 portion of the antibody molecule has been tested by the United States Military. �M. Balady, USAMRDC Newsletter, p. 6 (1991).! This was raised against impure toxoids in those large animals and is not a high titer preparation.
A pentavalent human antitoxin has been collected from immunized human subjects for use as a treatment for infant botulism. The supply of this antitoxin is limited and cannot be expected to meet the needs of all individuals stricken with botulism disease. In addition, collection of human sera must involve screening out HIV and other potentially serious human pathogens. �P. J. Schwarz and S. S. Arnon, Western J. Med. 156:197 (1992).!
Infant botulism has been implicated as the cause of mortality in some cases of Sudden Infant Death Syndrome (SIDS, also known as crib death). SIDS is officially recognized as infant death that is sudden and unexpected and that remained unexplained despite complete post-mortem examination. The link of SIDS to infant botulism came when fecal or blood specimens taken at autopsy from SIDS infants were found to contain C. botulinum organisms and/or toxin in 3-4% of cases analyzed. �D. R. Peterson et al., Rev. Infect. Dis. 1:630 (1979).! In contrast, only 1 of 160 healthy infants (0.6%) had C. botulinum organisms in the feces and no botulinal toxin. (S. Arnon et al., Lancet, pp. 1273-76, Jun. 17, 1978.)
In developed countries, SIDS is the number one cause of death in children between one month and one year old. (S. Arnon et al., Lancet, pp. 1273-77, Jun. 17, 1978.) More children die from SIDS in the first year than from any other single cause of death in the first fourteen years of life. In the United States, there are 8,000-10,000 SIDS victims annually. Id.
What is needed is an effective therapy against infant botulism that is free of dangerous side effects, is available in large supply at a reasonable price, and can be safely and gently delivered so that prophylactic application to infants is feasible.
Immunization of subjects with toxin preparations has been done in an attempt to induce immunity against botulinal toxins. A C botulinum vaccine comprising chemically inactivated (i.e., formaldehyde-treated) type A, B,C, D and E toxin is commercially available for human usage. However, this vaccine preparation has several disadvantages. First, the efficacy of this vaccine is variable (in particular, only 78% of recipients produce protective levels of anti-type B antibodies following administration of the primary series). Second, immunization is painful (deep subcutaneous inoculation is required for administration), with adverse reactions being common (moderate to severe local reactions occur in approximately 6% of recipients upon initial injection; this number rises to approximately 11% of individuals who receive booster injections) �Informational Brochure for the Pentavalent (ABCDE) Botulinum Toxoid, Centers for Disease Control!. Third, preparation of the vaccine is dangerous as active toxin must be handled by laboratory workers.
What is needed are safe and effective vaccine preparations for administration to those at risk of exposure to C. botulinum toxins.
C. difficile
C. difficile, an organism which gained its name due to difficulties encountered in its isolation, has recently been proven to be an etiologic agent of diarrheal disease. (Sneath et al., p. 1165.). C. difficile is present in the gastrointestinal tract of approximately 3% of healthy adults, and 10-30% of neonates without adverse effect (Swartz, at p. 644); by other estimates, C difficile is a part of the normal gastrointestinal flora of 2-10% of humans. �G. F. Brooks et al., (eds.) "Infections Caused by Anaerobic Bacteria," Jawetz, Melnick; & Adelberg's Medical Microbiology, 19th ed., pp. 257-262, Appleton & Lange, San Mateo, Calif. (1991).! As these organisms are relatively resistant to most commonly used antimicrobials, when a patient is treated with antibiotics, the other members of the normal gastrointestinal flora are suppressed and C. difficile flourishes, producing cytopathic toxins and enterotoxins. It has been found in 25% of cases of moderate diarrhea resulting from treatment with antibiotics, especially the cephalosporins, clindamycin, and ampicillin. �M. N. Swartz at 644.!
Importantly, C. difficile is commonly associated with nosocomial infections. The organism is often present in the hospital and nursing home environments and may be carried on the hands and clothing of hospital personnel who care for debilitated and immunocompromised patients. As many of these patients are being treated with antimicrobials or other chemotherapeutic agents, such transmission of C. difficile represents a significant risk factor for disease. (Engelkirk et al., pp. 64-67.)
C. difficile is associated with a range of diarrhetic illness, ranging from diarrhea alone to marked diarrhea and necrosis of the gastrointestinal mucosa with the accumulation of inflammatory cells and fibrin, which forms a pseudomembrane in the affected area. (Brooks et al.) It has been found in over 95% of pseudomembranous enterocolitis cases. (Swartz, at p. 644.) This occasionally fatal disease is characterized by diarrhea, multiple small colonic plaques, and toxic megacolon. (Swartz, at p. 644.) Although stool cultures are sometimes used for diagnosis, diagnosis is best made by detection of the heat labile toxins present in fecal filtrates from patients with enterocolitis due to C. difficile. (Swartz, at p. 644-645; and Brooks et al., at p. 260.) C. difficile toxins are cytotoxic for tissue/cell cultures and cause enterocolitis when injected intracecally into hamsters. (Swartz, at p. 644.)
The enterotoxicity of C. difficile is primarily due to the action of two toxins, designated A and B, each of approximately 300,000 in molecular weight. Both are potent cytotoxins, with toxin A possessing direct enterocytotoxic activity. �Lyerly et al., Infect. Immun. 60:4633 (1992).! Unlike toxin A of C. perfringens, an organism rarely associated with antimicrobial-associated diarrhea, the toxin of C. difficile is not a spore coat constituent and is not produced during sporulation. (Swartz, at p. 644.) C. difficile toxin A causes hemorrhage, fluid accumulation and mucosal damage in rabbit ileal loops and appears to increase the uptake of toxin B by the intestinal mucosa. Toxin B does not cause intestinal fluid accumulation, but it is 1000 times more toxic than toxin A to tissue culture cells and causes membrane damage. Although both toxins induce similar cellular effects such as actin disaggregation, differences in cell specificity occurs.
Both toxins are important in disease. �Borriello et al., Rev. Infect. Dis., 12(suppl. 2):S185 (1990); Lyerly et al., Infect. Immun., 47:349 (1985); and Rolfe, Infect. Immun., 59:1223 (1990).! Toxin A is thought to act first by binding to brush border receptors, destroying the outer mucosal layer, then allowing toxin B to gain access to the underlying tissue. These steps in pathogenesis would indicate that the production of neutralizing antibodies against toxin A may be sufficient in the prophylactic therapy of CDAD. However, antibodies against toxin B may be a necessary additional component for an effective therapeutic against later stage colonic disease. Indeed, it has been reported that animals require antibodies to both toxin A and toxin B to be completely protected against the disease. �Kim and Rolfe, Abstr. Ann. Meet. Am. Soc. Microbiol., 69:62 (1987).!
C difficile has also been reported to produce other toxins such as an enterotoxin different from toxins A and B �Banno et al., Rev. Infect. Dis., 6(Suppl. 1:S11-S20 (1984)!, a low molecular weight toxin �Rihn et al., Biochem. Biophys. Res. Comm., 124:690-695 (1984)!, a motility altering factor �Justus et al., Gastroenterol., 83:836-843 (1982)!, and perhaps other toxins. Regardless, C. difficile gastrointestinal disease is of primary concern.
It is significant that due to its resistance to most commonly used antimicrobials, C. difficile is associated with antimicrobial therapy with virtually all antimicrobial agents (although most commonly ampicillin, clindamycin and cephalosporins). It is also associated with disease in patients undergoing chemotherapy with such compounds as methotrexate, 5-fluorouracil, cyclophosphamide, and doxorubicin. �S. M. Finegold et al., Clinical Guide to Anaerobic Infections, pp. 88-89, Star Publishing Co., Belmont, Calif. (1992).!
Treatment of C. difficile disease is problematic, given the high resistance of the organism. Oral metronidazole, bacitracin and vancomycin have been reported to be effective. (Finegold et al., p. 89.) However there are problems associated with treatment utilizing these compounds. Vancomycin is very expensive, some patients are unable to take oral medication, and the relapse rate is high (20-25%), although it may not occur for several weeks. Id.
C. difficile disease would be prevented or treated by neutralizing the effects of these toxins in the gastrointestinal tract. Thus, what is needed is an effective therapy against C. difficile toxin that is free of dangerous side effects, is available in large supply at a reasonable price, and can be safely delivered so that prophylactic application to patients at risk of developing pseudomembranous enterocolitis can be effectively treated.

DESCRIPTION OF THE DRAWINGS
FIG. 1 shows the reactivity of anti-C. botulinum IgY by Western blot.
FIG. 2 shows the IgY antibody titer to C. botulinum type A toxoid in eggs, measured by ELISA.
FIG. 3 shows the results of C. difficile toxin A neutralization assays.
FIG. 4 shows the results of C. difficile toxin B neutralization assays.
FIG. 5 shows the results of C. difficile toxin B neutralization assays.
FIG. 6 is a restriction map of C. difficile toxin A gene, showing sequences of primers 1-4 (SEQ ID NOS:1-4).
FIG. 7 is a Western blot of C. difficile toxin A reactive protein.
FIG. 8 shows C. difficile toxin A expression constructs.
FIG. 9 shows C. difficile toxin A expression constructs.
FIG. 10 shows the purification of recombinant C. difficile toxin A.
FIG. 11 shows the results of C. difficile toxin A neutralization assays with antibodies reactive to recombinant toxin A.
FIG. 12 shows the results for a C. difficile toxin A neutralization plate.
FIG. 13 shows the results for a C. difficile toxin A neutralization plate.
FIG. 14 shows the results of recombinant C. difficile toxin A neutralization assays.
FIG. 15 shows C. difficile toxin A expression constructs.
FIG. 16 shows a chromatograph plotting absorbance at 280 nm against retention time for a pMA1870-680 IgY PEG preparation.
FIG. 17 shows two recombinant C. difficile toxin B expression constructs.
FIG. 18 shows C. difficile toxin B expression constructs.
FIG. 19 shows C. difficile toxin B expression constructs.
FIG. 20 shows C. difficile toxin B expression constructs.
FIG. 21 is an SDS-PAGE gel showing the purification of recombinant C. difficile toxin B fusion protein.
FIG. 22 is an SDS-PAGE gel showing the purification of two histidine-tagged recombinant C. difficile toxin B proteins.
FIG. 23 shows C. difficile toxin B expression constructs.
FIG. 24 is a Western blot of C. difficile toxin B reactive protein.
FIG. 25 shows C. botulinum type A toxin expression constructs; constructs used to provide C. botulinum or C. difficile sequences are also shown.
FIG. 26 is an SDS-PAGE gel stained with Coomaisse blue showing the purification of recombinant C. botulinum type A toxin fusion proteins.
FIG. 27 shows C. botulinum type A toxin expression constructs; constructs used to provide C. botulinum sequences are also shown Polyshistidine tags are represented by "HHHHH" (SEQ ID NO:30).
FIG. 28 is an SDS-PAGE gel stained with Coomaisse blue showing the purification of pHisBot protein using the Ni-NTA resin.
FIG. 29 is an SDS-PAGE gel stained with Coomaisse blue showing the expression of pHisBot protein in BL21(DE3) and BL21(DE3)pLysS host cells.
FIG. 30 is an SDS-PAGE gel stained with Coomaisse blue showing the purification of pHisBot protein using a batch absorption procedure.

DEFINITIONS
To facilitate understanding of the invention, a number of terms are defined below.
As used herein, the term "neutralizing" is used in reference to antitoxins, particularly antitoxins comprising antibodies, which have the ability to prevent the pathological actions of the toxin against which the antitoxin is directed.
As used herein, the term "overproducing" is used in reference to the production of clostridial toxin polypeptides in a host cell and indicates that the host cell is producing more of the clostridial toxin by virtue of the introduction of nucleic acid sequences encoding said clostridial toxin polypeptide than would be expressed by said host cell absent the introduction of said nucleic acid sequences. To allow ease of purification of toxin polypeptides produced in a host cell it is preferred that the host cell express or overproduce said toxin polypeptide at a level greater than 1 mg/liter of host cell culture.
As used herein, the term "fusion protein" refers to a chimeric protein containing the protein of interest (i.e., C. difficile toxin A or B and fragments thereof) joined to an exogenous protein fragment (the fusion partner which consists of a non-toxin protein). The fusion partner may enhance solubility of the C. difficile protein as expressed in a host cell, may provide an affinity tag to allow purification of the recombinant fusion protein from the host cell or culture supernatant, or both. If desired, the fusion protein may be removed from the protein of interest (i.e., toxin protein or fragments thereof) prior to immunization by a variety of enzymatic or chemical means known to the art.
As used herein the term "non-toxin protein" or "non-toxin protein sequence" refers to that portion of a fusion protein which comprises a protein or protein sequence which is not derived from a bacterial toxin protein.
The term "protein of interest" as used herein refers to the protein whose expression is desired within the fusion protein. In a fusion protein the protein of interest will be joined or fused with another protein or protein domain, the fusion partner, to allow for enhanced stability of the protein of interest and/or ease of purification of the fusion protein.
As used herein, the term "maltose binding protein" refers to the maltose binding protein of E. coli. A portion of the maltose binding protein may be added to a protein of interest to generate a fusion protein; a portion of the maltose binding protein may merely enhance the solubility of the resulting fusion protein when expressed in a bacterial host. On the other hand, a portion of the maltose binding protein may allow affinity purification of the fusion protein on an amylose resin.
As used herein, the term "poly-histidine tract" when used in reference to a fusion protein refers to the presence of two to ten histidine residues at either the amino- or carboxy-terminus of a protein of interest. A poly-histidine tract of six to ten residues is preferred. The poly-histidine tract is also defined functionally as being a number of consecutive histidine residues added to the protein of interest which allows the affinity purification of the resulting fusion protein on a nickel-chelate column.
As used herein, the term "purified" or "to purify" refers to the removal of contaminants from a sample. For example, antitoxins are purified by removal of contaminating non-immunoglobulin proteins; they are also purified by the removal of immunoglobulin that does not bind toxin. The removal of non-immunoglobulin proteins and/or the removal of immunoglobulins that do not bind toxin results in an increase in the percent of toxin-reactive immunoglobulins in the sample. In another example, recombinant toxin polypeptides are expressed in bacterial host cells and the toxin polypeptides are purified by the removal of host cell proteins; the percent of recombinant toxin polypeptides is thereby increased in the sample. Additionally, the recombinant toxin polypeptides are purified by the removal of host cell components such as lipopolysaccharide (e.g., endotoxin).
The term "recombinant DNA molecule" as used herein refers to a DNA molecule which is comprised of segments of DNA joined together by means of molecular biological techniques.
The term "recombinant protein" or "recombinant polypeptide" as used herein refers to a protein molecule which is expressed from a recombinant DNA molecule.
The term "native protein" as used herein refers to a protein which is isolated from a natural source as opposed to the production of a protein by recombinant means.
As used herein the term "portion" when in reference to a protein (as in "a portion of a given protein") refers to fragments of that protein. The fragments may range in size from four amino acid residues to the entire amino acid sequence minus one amino acid.
As used herein "soluble" when in reference to a protein produced by recombinant DNA technology in a host cell is a protein which exists in solution in the cytoplasm of the host cell; if the protein contains a signal sequence the soluble protein is exported to the periplasmic space in bacteria hosts and is secreted into the culture medium in eucaryotic cells capable of secretion or by bacterial host possessing the appropriate genes (i.e., the kil gene). In contrast, an insoluble protein is one which exists in denatured form inside cytoplasmic granules (called an inclusion bodies) in the host cell. High level expression (i.e., greater than 10-20 mg recombinant protein/liter of bacterial culture) of recombinant proteins often results in the expressed protein being found in inclusion bodies in the bacterial host cells. A soluble protein is a protein which is not found in an inclusion body inside the host cell or is found both in the cytoplasm and in inclusion bodies and in this case the protein may be present at high or low levels in the cytoplasm.
A distinction is drawn between a soluble protein (i.e., a protein which when expressed in a host cell is produced in a soluble form) and a "solubilized" protein. An insoluble recombinant protein found inside an inclusion body may be solubilized (i.e., rendered into a soluble form) by treating purified inclusion bodies with denaturants such as guanidine hydrochloride, urea or sodium dodecyl sulfate (SDS). These denaturants must then be removed from the solubilized protein preparation to allow the recovered protein to renature (refold). Not all proteins will refold into an active conformation after solubilization in a denaturant and removal of the denaturant. Many proteins precipitate upon removal of the denaturant. SDS may be used to solubilize inclusion bodies and will maintain the proteins in solution at low concentration. However, dialysis will not always remove all of the SDS (SDS can form micelles which do not dialyze out); therefore, SDS-solubilized inclusion body protein is soluble but not refolded.
A distinction is drawn between proteins which are soluble (i.e., dissolved) in a solution devoid of significant amounts of ionic detergents (e.g., SDS) or denaturants (e.g., urea, guanidine hydrochloride) and proteins which exist as a suspension of insoluble protein molecules dispersed within the solution. A soluble protein will not be removed from a solution containing the protein by centrifugation using conditions sufficient to remove bacteria present in a liquid medium (i.e., centrifugation at 5,000.times.g for 4-5 minutes). For example, to test whether two proteins, protein A and protein B, are soluble in solution, the two proteins are placed into a solution selected from the group consisting of PBS-NaCl (PBS containing 0.5M NaCl), PBS-NaCl containing 0.2% Tween 20, PBS, PBS containing 0.2% Tween 20, PBS-C (PBS containing 2 mM CaCl.sub.2), PBS-C containing either 0.1 or 0.5% Tween 20, PBS-C containing either 0.1 or 0.5% NP-40, PBS-C containing either 0.1 or 0.5% Triton X-100, PBS-C containing 0.1% sodium deoxycholate. The mixture containing proteins A and B is then centrifuged at 5000.times.g for 5 minutes. The supernatant and pellet formed by centrifugation are then assayed for the presence of protein A and B. If protein A is found in the supernatant and not in the pellet �except for minor amounts (i.e., less than 10%) as a result of trapping!, protein is said to be soluble in the solution tested. If the majority of protein B is found in the pellet (i.e., greater than 90%), then protein B is said to exist as a suspension in the solution tested.
As used herein, the term "therapeutic amount" refers to that amount of antitoxin required to neutralize the pathologic effects of one or more clostridial toxins in a subject.
The term "pyrogen" as used herein refers to a fever-producing substance. Pyrogens may be endogenous to the host (e.g., prostaglandins) or may be exogenous compounds (e.g., bacterial endo- and exotoxins, nonbacterial compounds such as antigens and certain steroid compounds, etc.). The presence of pyrogen in a pharmaceutical solution may be detected using the U.S. Pharmacopeia (USP) rabbit fever test (United States Pharmacopeia, Vol. XXII (1990) United States Pharmacopeial Convention, Rockville, Md., p. 151).
The term "endotoxin" as used herein refers to the high molecular weight complexes associated with the outer membrane of gram-negative bacteria. Unpurified endotoxin contains lipids, proteins and carbohydrates. Highly purified endotoxin does not contain protein and is referred to as lipopolysaccharide (LPS). Because unpurified endotoxin is of concern in the production of pharmaceutical compounds (e.g., proteins produced in E. coli using recombinant DNA technology), the term endotoxin as used herein refers to unpurified endotoxin. Bacterial endotoxin is a well known pyrogen.
As used herein, the term "endotoxin-free" when used in reference to a composition to be administered parenterally (with the exception of intrathecal administration) to a host means that the dose to be delivered contains less than 5 EU/kg body weight �FDA Guidelines for Parenteral Drugs (December 1987)!. Assuming a weight of 70 kg for an adult human, the dose must contain less than 350 EU to meet FDA Guidelines for parenteral administration. Endotoxin levels are measured herein using the Limulus Amebocyte Lysate (LAL) test (Limulus Amebocyte Lysate Pyrochrome.TM., Associates of Cape Cod, Inc. Woods Hole, Mass.). To measure endotoxin levels in preparations of recombinant proteins, 0.5 ml of a solution comprising 0.5 mg of purified recombinant protein in 50 mM NaPO.sub.4, pH 7.0, 0.3M NaCl and 10% glycerol is used in the LAL assay according to the manufacturer's instructions for the endpoint chromogenic without diazo-coupling method. Compositions containing greater than or equal less than 60 endotoxin units (EU)/mg of purified recombinant protein are herein defined as "substantially endotoxin-free." Typically, administration of bacterial toxins or toxoids to adult humans for the purpose of vaccination involves doses of about 10-500 .mu.g protein/dose. Therefore, administration of 10-500 .mu.g of a purified recombinant protein to a 70 kg human, wherein said purified recombinant protein preparation contains 60 EU/mg protein, results in the introduction of only 0.6 to 30 EU (i.e., 0.2 to 8.6% of the maximum allowable endotoxin burden per parenteral dose).
The LAL test is accepted by the U.S. FDA as a means of detecting bacterial endotoxins (21 C.F.R. .sctn..sctn. 660.100-105). Studies have shown that the LAL test is equivalent or superior to the USP rabbit pyrogen test for the detection of endotoxin and thus the LAL test can be used as a surrogate for pyrogenicity studies in animals �F. C. Perason, Pyrogens: endotoxins, LAL testing and depyrogenation, Marcel Dekker, New York (1985), pp.150-155!. The FDA Bureau of Biologics accepts the LAL assay in place of the USP rabbit pyrogen test so long as the LAL assay utilized is shown to be as sensitive as, or more sensitive as the rabbit test �Fed. Reg., 38, 26130 (1980)!.
The term "monovalent" when used in reference to a clostridial vaccine refers to a vaccine which is capable of provoking an immune response in a host animal directed against a single type of clostridial toxin. For example, if immunization of a host with C. botulinum type A toxin vaccine induces antibodies in the immunized host which protect against a challenge with type A toxin but not against challenge with type B, C, D, E, or F toxins, then the type A vaccine is said to be monovalent. In contrast, a "multivalent" vaccine provokes an immune response in a host animal directed against several (i.e., more than one) clostridial toxins. For example, if immunization of a host with a vaccine comprising C. botulinum type A and B toxins induces the production of antibodies which protect the host against a challenge with both type A and B toxin, the vaccine is said to be multivalent (in particular, this hypothetical vaccine is bivalent).
As used herein the term "immunogenically-effective amount" refers to that amount of an immunogen required to invoke the production of protective levels of antibodies in a host upon vaccination.
The term "protective level", when used in reference to the level of antibodies induced upon immunization of the host with an immunogen which comprises a bacterial toxin, means a level of circulating antibodies sufficient to protect the host from challenge with a lethal dose of the toxin.
As used herein the terms "protein" and "polypeptide" refer to compounds comprising amino acids joined via peptide bonds and are used interchangeably.
The terms "toxin" and "neurotoxin" when used in reference to toxins produced by members (i.e., species and strains) of the genus Clostridium are used interchangeably and refer to the proteins which are poisonous to nerve tissue.
SUMMARY OF THE INVENTION
The present invention relates to the production of polypeptides derived from toxins. In one embodiment, the invention contemplates a fusion protein comprising a poly-histidine tract and a portion of a toxin. The invention is not intended to be limited by the type or nature of the toxin. By way of example, portions of toxins produced by members of the genus Clostridium are expressed as fusion proteins comprising a poly-histidine tract.
In a preferred embodiment, the toxin polypeptides comprise Clostridium botulinum neurotoxin. The invention contemplates the use of polypeptides derived from C. botulinum toxin as immunogens for the production of vaccines and antitoxins. The C. botulinum vaccines and antitoxins find use in humans and other animals. In one embodiment, the present invention contemplates a fusion protein comprising a non-toxin protein sequence and a portion of the Clostridium botulinum type A toxin. In a preferred embodiment, the C. botulinum type A toxin sequences comprise a portion of the sequence of SEQ ID NO:28. In yet another preferred embodiment, the C. botulinum type A toxin sequences comprise a portion of the sequence of SEQ ID NO:23. It is not intended that the present invention be limited by the nature of the fusion protein. For example, the fusion protein may comprise the Clostridium botulinum type A toxin sequence as set forth in SEQ ID NO:23 along with a poly-histidine tract.
The invention also contemplates a host cell containing a recombinant expression vector, wherein the vector encodes a fusion protein comprising a non-toxin protein sequence and a portion of the Clostridium botulinum type A toxin sequence of SEQ ID NO:28. In this embodiment, the host cell is capable of expressing the encoded Clostridium botulinum type A toxin protein as a soluble protein at a level greater than or equal to 0.25% to 10% of the total cellular protein and preferably at a level greater than or equal to 0.75% of the total cellular protein. It is not intended that the present invention be limited by the nature of the fusion protein expressed by the recombinant vector in the host cell. For example, the fusion protein may comprise the Clostridium botulinum type A toxin sequence as set forth in SEQ ID NO:23, along with a poly-histidine tract.
The present invention also contemplates a host cell containing a recombinant expression vector, wherein the vector encodes a protein derived from the Clostridium botulinum type A toxin sequence of SEQ ID NO:28. In this embodiment, the host cell is capable of expressing the encoded Clostridium botulinum type A toxin protein at a level greater than or equal to 10% to 40% of the total cellular protein and preferably at a level greater than or equal to 20% of the total cellular protein. It is not intended that the present invention be limited by the nature of the fusion protein expressed by the recombinant vector in the host cell. For example, the fusion protein may comprise the Clostridium botulinum type A toxin sequence as set forth in SEQ ID NO:23, along with a poly-histidine tract.
In one embodiment, the present invention contemplates a method of generating neutralizing antitoxin directed against Clostridium botulinum type A toxin comprising (in any order), a purified soluble fusion protein comprising a non-toxin protein sequence and a portion of the Clostridium botulinum type A toxin sequence of SEQ ID NO:28, as well as host is immunized with the purified fusion protein so as to generate antibodies capable of neutralizing native Clostridium botulinum type A toxin. By way of illustration only, the fusion protein may comprise a portion of the Clostridium botulinum type A toxin sequence as set forth in SEQ ID NO:23, and a poly-histidine tract. The method may further comprise the additional step of collecting antibodies from the host. It is also contemplated that the collected antibodies be purified. The present invention contemplates the antibody, as a composition of matter, raised according to the above-described methods.
The present invention further contemplates a method of purifying a recombinant fusion protein derived from a Clostridium botulinum type A toxin. In this embodiment, the recombinant fusion protein comprises a poly-histidine tract, comprising (in any order) a solution comprising a fusion protein comprising a poly-histidine tract and a portion of the Clostridium botulinum type A toxin sequence of SEQ ID NO:28, and a chromatography resin comprising a divalent cation covalently linked to a solid support. In this embodiment, the solution is added to the chromatography resin to allow binding of the fusion protein to the chromatography resin. It is also contemplated that this embodiment further comprises the step of washing the chromatography resin containing said bound fusion protein to remove non-fusion protein from the chromatography resin, and eluting the bound fusion protein from the washed chromatography resin.
In a preferred embodiment, the chromatography resin comprises nickel ions immobilized on a solid support. Examples of commercially available nickel ion columns include the His.multidot.Bind.RTM. Resin (Novagen) and the Ni-NTA Agarose resin (Qiagen). Because the Ni-NTA Agarose resin has a very high affinity for binding proteins containing a poly-histidine tract, it is a preferred chromatography resin.
The invention is not intended to be limited by the nature of the solution comprising a fusion protein comprising a poly-histidine tract and a portion of the Clostridium botulinum type A toxin sequence of SEQ ID NO:28. In one embodiment, this solution comprises a soluble extract derived from a cell pellet comprising host cells containing a recombinant fission protein. In yet another embodiment, the soluble extract is generated from the cell pellet by suspension of the cell pellet in a binding buffer and disrupting the suspension to cause the disruption of the membranes of the host cell to generate a mixture comprising soluble proteins and insoluble cellular debris. In another embodiment, the method of purifying a recombinant fusion protein derived from a Clostridium botulinum type A toxin, wherein the recombinant fusion protein comprises a poly-histidine tract, further includes the additional step of removing the insoluble cellular debris from the disrupted cell suspension to generate a clarified soluble lysate. In yet a further embodiment, the method of purifying the recombinant fusion protein employs the addition of a non-ionic detergent to the clarified soluble lysate. A preferred non-ionic detergent is Nonidet P-40. In still another preferred embodiment of the method of purifying the recombinant fusion protein comprises, the additional step of incubating the clarified soluble lysate containing said non-ionic detergent with the chromatography resin for greater than one hour at four degrees Centigrade to allow the fusion protein to bind to the chromatography resin. Incubation steps of about 3 hours are particularly preferred.
DESCRIPTION OF THE INVENTION
The present invention contemplates vaccinating humans and other animals polypeptides derived from C. botulinum neurotoxin which are substantially endotoxin-free. These botulinal peptides are also useful for the production of antitoxin. Anti-botulinal toxin antitoxin is useful for the treatment of patients effected by or at risk of symptoms due to the action of C. botulinum toxins. The organisms, toxins and individual steps of the present invention are described separately below.
I. Clostridium Species, Clostridial Diseases And Associated Toxins
A preferred embodiment of the method of the present invention is directed toward obtaining antibodies against Clostridium species, their toxins, enzymes or other metabolic by-products, cell wall components, or synthetic or recombinant versions of any of these compounds. It is contemplated that these antibodies will be produced by immunization of humans or other animals. It is not intended that the present invention be limited to any particular toxin or any species of organism. In one embodiment,
TABLE 2______________________________________Clostridial ToxinsOrganism Toxins and Disease-Associated Antigens______________________________________C. botulinum A, B, C.sub.1, C.sub.2, D, E, F, GC. butyricum NeuraminidaseC. difficile A, B, Enterotoxin (not A nor B), Motility Altering Factor, Low Molecular Weight Toxin, OthersC. perfringens .alpha., .beta., .epsilon., .iota., .gamma., .delta., .nu., .theta., .kappa., .lambda., .mu., .upsilon.C. sordelli/ HT, LT, .alpha., .beta., .gamma.C. bifermentansC. novyi .alpha., .beta., .gamma., .delta., .epsilon., .zeta., .nu., .theta.C. septicum .alpha., .beta., .gamma., .delta.C. histolyticum .alpha., .beta., .gamma., .delta., .epsilon. plus additional enzymesC. chauvoei .alpha., .beta., .gamma., .delta.______________________________________
toxins from all Clostridium species are contemplated as immunogens. Examples of these toxins include the neuraminidase toxin of C butyricum, C. sordellii toxins HT and LT, toxins A, B, C, D, E, F, and G of C. botulinum and the numerous C. perfringens toxins. In one preferred embodiment, toxins A and B of C. difficile are contemplated as immunogens. Table 2 above lists various Clostridium species, their toxins and some antigens associated with disease.
It is not intended that antibodies produced against one toxin will only be used against that toxin. It is contemplated that antibodies directed against one toxin (e.g., C. perfringens type A enterotoxin) may be used as an effective therapeutic against one or more toxin(s) produced by other members of the genus Clostridium or other toxin producing organisms (e.g., Bacillus cereus, Staphylococcus aureus, Streptococcus mutans, Acinetobacter calcoaceticus, Pseudomonas aeruginosa, other Pseudomonas species, etc.). It is further contemplated that antibodies directed against the portion of the toxin which binds to mammalian membranes (e.g., C. perfringens enterotoxin A) can also be used against other organisms. It is contemplated that these membrane binding domains are produced synthetically and used as immunogens.
II. Obtaining Antibodies In Non-Mammals
A preferred embodiment of the method of the present invention for obtaining antibodies involves immunization. However, it is also contemplated that antibodies could be obtained from non-mammals without immunization. In the case where no immunization is contemplated, the present invention may use non-mammals with preexisting antibodies to toxins as well as non-mammals that have antibodies to whole organisms by virtue of reactions with the administered antigen. An example of the latter involves immunization with synthetic peptides or recombinant proteins sharing epitopes with whole organism components.
In a preferred embodiment, the method of the present invention contemplates immunizing non-mammals with bacterial toxin(s). It is not intended that the present invention be limited to any particular toxin. In one embodiment, toxin from all clostridial bacteria sources (see Table 2) are contemplated as immunogens. Examples of these toxins are C. butyricum neuraminidase toxin, toxins A, B, C, D, E, F, and G from C. botulinum, C. perfringens toxins .alpha., .beta., .epsilon., and .iota., and C. sordellii toxins HT and LT. In a preferred embodiment, C. difficile toxins A and B are contemplated as immunogens.
A particularly preferred embodiment involves the use of bacterial toxin protein or fragments of toxin proteins produced by molecular biological means (i.e., recombinant toxin proteins). In a preferred embodiment, the immunogen comprises interval 6 of C. difficile toxin A produced by recombinant DNA technology. In yet another preferred embodiment, the immunogen comprises interval 3 of C. difficile toxin B produced by recombinant DNA technology.
When immunization is used, the preferred non-mammal is from the class Aves. All birds are contemplated (e.g., duck, ostrich, emu, turkey, etc.). A preferred bird is a chicken. Importantly, chicken antibody does not fix mammalian complement. �See H. N. Benson et al., J. Immunol. 87:616 (1961).! Thus, chicken antibody will normally not cause a complement-dependent reaction. �A. A. Benedict and K. Yamaga, "Immunoglobulins and Antibody Production in Avian Species," in Comparative Immunology (J. J. Marchaloni, ed.), pp. 335-375, Blackwell, Oxford (1966).! Thus, the preferred antitoxins of the present invention will not exhibit complement-related side effects observed with antitoxins known presently.
When birds are used, it is contemplated that the antibody will be obtained from either the bird serum or the egg. A preferred embodiment involves collection of the antibody from the egg. Laying hens transport immunoglobulin to the egg yolk ("EgY") in concentrations equal to or exceeding that found in serum. �See R. Patterson et al., J. Immunol. 89:272 (1962); and S. B. Carroll and B. D. Stollar, J. Biol. Chem. 258:24 (1983).! In addition, the large volume of egg yolk produced vastly exceeds the volume of serum that can be safely obtained from the bird over any given time period. Finally, the antibody from eggs is purer and more homogeneous; there is far less non-immunoglobulin protein (as compared to serum) and only one class of immunoglobulin is transported to the yolk.
When considering immunization with toxins, one may consider modification of the toxins to reduce the toxicity. In this regard, it is not intended that the present invention be limited by immunization with modified toxin. Unmodified ("native") toxin is also contemplated as an immunogen.
It is also not intended that the present invention be limited by the type of modification--if modification is used. The present invention contemplates all types of toxin modification, including chemical and heat treatment of the toxin. The preferred modification, however, is formaldehyde treatment.
It is not intended that the present invention be limited to a particular mode of immunization; the present invention contemplates all modes of immunization, including subcutaneous, intramuscular, intraperitoneal, and intravenous or intravascular injection, as well as per os administration of immunogen.
The present invention further contemplates immunization with or without adjuvant. (Adjuvant is defined as a substance known to increase the immune response to other antigens when administered with other antigens.) If adjuvant is used, it is not intended that the present invention be limited to any particular type of adjuvant--or that the same adjuvant, once used, be used all the time. While the present invention contemplates all types of adjuvant, whether used separately or in combinations, the preferred use of adjuvant is the use of Complete Freund's Adjuvant followed sometime later with Incomplete Freund's Adjuvant. Another preferred use of adjuvant is the use of Gerbu Adjuvant. The invention also contemplates the use of RIBI fowl adjuvant and Quil A adjuvant.
When immunization is used, the present invention contemplates a wide variety of immunization schedules. In one embodiment, a chicken is administered toxin(s) on day zero and subsequently receives toxin(s) in intervals thereafter. It is not intended that the present invention be limited by the particular intervals or doses. Similarly, it is not intended that the present invention be limited to any particular schedule for collecting antibody. The preferred collection time is sometime after day 100.
Where birds are used and collection of antibody is performed by collecting eggs, the eggs may be stored prior to processing for antibody. It is preferred that eggs be stored at 4.degree. C. for less than one year.
It is contemplated that chicken antibody produced in this manner can be buffer-extracted and used analytically. While unpurified, this preparation can serve as a reference for activity of the antibody prior to further manipulations (e.g., immunoaffinity purification).
III. Increasing The Effectiveness Of Antibodies
When purification is used, the present invention contemplates purifying to increase the effectiveness of both non-mammalian antitoxins and mammalian antitoxins. Specifically, the present invention contemplates increasing the percent of toxin-reactive immunoglobulin. The preferred purification approach for avian antibody is polyethylene glycol (PEG) separation.
The present invention contemplates that avian antibody be initially purified using simple, inexpensive procedures. In one embodiment, chicken antibody from eggs is purified by extraction and precipitation with PEG. PEG purification exploits the differential solubility of lipids (which are abundant in egg yolks) and yolk proteins in high concentrations of PEG 8000. �Polson et al., Immunol. Comm. 9:495 (1980).! The technique is rapid, simple, and relatively inexpensive and yields an immunoglobulin fraction that is significantly purer in terms of contaminating non-immunoglobulin proteins than the comparable ammonium sulfate fractions of mammalian sera and horse antibodies. The majority of the PEG is removed from the precipitated chicken immunoglobulin by treatment with ethanol. Indeed, PEG-purified antibody is sufficiently pure that the present invention contemplates the use of PEG-purified antitoxins in the passive immunization of intoxicated humans and animals.
IV. Treatment
The present invention contemplates antitoxin therapy for humans and other animals intoxicated by bacterial toxins. A preferred method of treatment is by oral administration of antitoxin.
A. Dosage Of Antitoxin
It was noted by way of background that a balance must be struck when administering currently available antitoxin which is usually produced in large animals such as horses; sufficient antitoxin must be administered to neutralize the toxin, but not so much antitoxin as to increase the risk of untoward side effects. These side effects are caused by: i) patient sensitivity to foreign (e.g, horse) proteins; ii) anaphylactic or immunogenic properties of non-immunoglobulin proteins; iii) the complement fixing properties of mammalian antibodies; and/or iv) the overall burden of foreign protein administered. It is extremely difficult to strike this balance when, as noted above, the degree of intoxication (and hence the level of antitoxin therapy needed) can only be approximated.
The present invention contemplates significantly reducing side effects so that this balance is more easily achieved. Treatment according to the present invention contemplates reducing side effects by using PEG-purified antitoxin from birds.
In one embodiment, the treatment of the present invention contemplates the use of PEG-purified antitoxin from birds. The use of yolk-derived, PEG-purified antibody as antitoxin allows for the administration of: 1) non(mammalian)-complement-fixing, avian antibody; 2) a less heterogeneous mixture of non-immunoglobulin proteins; and 3) less total protein to deliver the equivalent weight of active antibody present in currently available antitoxins. The non-mammalian source of the antitoxin makes it useful for treating patients who are sensitive to horse or other mammalian sera.
B. Delivery Of Antitoxin
Although it is not intended to limit the route of delivery, the present invention contemplates a method for antitoxin treatment of bacterial intoxication in which delivery of antitoxin is oral. In one embodiment, antitoxin is delivered in a solid form (e.g., tablets). In an alternative embodiment antitoxin is delivered in an aqueous solution. When an aqueous solution is used, the solution has sufficient ionic strength to solubilize antibody protein, yet is made palatable for oral administration. The delivery solution may also be buffered (e.g., carbonate buffer pH 9.5) which can neutralize stomach acids and stabilize the antibodies when the antibodies are administered orally. In one embodiment the delivery solution is an aqueous solution. In another embodiment the delivery solution is a nutritional formula. Preferably, the delivery solution is infant formula. Yet another embodiment contemplates the delivery of lyophilized antibody encapsulated or microencapsulated inside acid-resistant compounds.
Methods of applying enteric coatings to pharmaceutical compounds are well known to the art �companies specializing in the coating of pharmaceutical compounds are available; for example, The Coating Place (Verona, Wis.) and AAI (Wilmington, N.C.)!. Enteric coatings which are resistant to gastric fluid and whose release (i.e., dissolution of the coating to release the pharmaceutical compound) is pH dependent are commercially available �for example, the polymethacrylates Eudragit.RTM. L and Eudragitg.RTM. S (Rohm GmbH)!. Eudragitg.RTM. S is soluble in intestinal fluid from pH 7.0; this coating can be used to microencapsulate lyophilized antitoxin antibodies and the particles are suspended in a solution having a pH above or below pH 7.0 for oral administration. The microparticles will remain intact and undissolved until they reached the intestines where the intestinal pH would cause them to dissolve thereby releasing the antitoxin.
The invention contemplates a method of treatment which can be administered for treatment of acute intoxication. In one embodiment, antitoxin is administered orally in either a delivery solution or in tablet form, in therapeutic dosage, to a subject intoxicated by the bacterial toxin which served as immunogen for the antitoxin.
The invention also contemplates a method of treatment which can be administered prophylactically. In one embodiment, antitoxin is administered orally, in a delivery solution, in therapeutic dosage, to a subject, to prevent intoxication of the subject by the bacterial toxin which served as immunogen for the production of antitoxin. In another embodiment, antitoxin is administered orally in solid for such as tablets or as microencapsulated particles. Microencapsulation of lyophilized antibody using compounds such as Eudragit.RTM. (Rohm GmbH) or polyethylene glycol, which dissolve at a wide range of pH units, allows the oral administration of solid antitoxin in a liquid form (i.e., a suspension) to recipients unable to tolerate administration of tablets (e.g., children or patients on feeding tubes). In one preferred embodiment the subject is an child. In another embodiment, antibody raised against whole bacterial organism is administered orally to a subject, in a delivery solution, in therapeutic dosage.
V. Vaccines Against Clostridial Species
The invention contemplates the generation of mono- and multivalent vaccines for the protection of an animal (particularly humans) against several clostridial species. Of particular interest are vaccines which stimulate the production of a humoral immune response to C. botulinum, C. tetani and C. difficile in humans. The antigens comprising the vaccine preparation may be native or recombinantly produced toxin proteins from the clostridial species listed above. When toxin proteins are used as immunogens they are generally modified to reduce the toxicity. This modification may be by chemical or genetic (i.e., recombinant DNA technology) means. In general genetic detoxification (i.e., the expression of nontoxic fragments in a host cell) is preferred as the expression of nontoxic fragments in a host cell precludes the presence of intact, active toxin in the final preparation. However, when chemical modification is desired, the preferred toxin modification is formaldehyde treatment.
The invention contemplates that recombinant C. botulinum toxin proteins be used as antigens in mono- and multivalent vaccine preparations. Soluble, substantially endotoxin-free recombinant C. botulinum type A toxin proteins may be used alone or in conjunction with either recombinant or native toxins or toxoids from C. botulinum, C. difficile and C. tetani as antigens for the preparation of these mono- and multivalent vaccines. It is contemplated that, due to the structural similarity of C. botulinum and C. tetani toxin proteins, a vaccine comprising C. difficile and botulinum toxin proteins (native or recombinant or a mixture thereof) be used to stimulate an immune response against C. botulinum, C. tetani and C. difficile.
The adverse consequences of exposure to botulinal toxin would be avoided by immunization of subjects at risk of exposure to the toxin with nontoxic preparations which confer immunity such as chemically or genetically detoxified toxin.
Vaccines which confer immunity against one or more of the toxin types A, B, E and F would be useful as a means of protecting humans from the deleterious effects of those C. botulinum toxins known to affect man. Vaccines which confer immunity against one or more of the toxin types C, D and E would be useful for veterinary applications.
The botulinal neurotoxin is synthesized as a single polypeptide chain which is processed into a heavy (H) and a light (L) chain; these two chains are held together via disulfide bonds in the active toxin �B. R. DasGupta and H. Sugiyama, Biochem. Biophys. Res. Commun. 48:108 (1972); reviewed in B. R. DasGupta, J. Physiol. 84:220 (1990) and H. Sugiyama, Microbiol. Rev. 44:419 (1980)!. Antisera raised against purified preparations of isolated H and L chains have been shown to protect mice against the lethal effects of the toxin; however, the effectiveness of the two antisera differ with the anti-H sera being more potent (H. Sugiyama, supra).
While the different botulinal toxins show structural similarity to one another, the different serotypes are reported to be immunologically distinct (i.e., sera raised against one toxin type does not cross-react to a significant degree with Other types). Thus, the generation of multivalent vaccines may require the use of more than one type of toxin. Purification methods have been reported for native toxin types A, B, C, D, E, and F �reviewed in G. Sakaguchi, Pharmac. Ther. 19:165 (1983)!. As the different botulinal toxins are structurally related, the invention contemplates the expression of any of the botulinal toxins (e.g., types A-F) as soluble recombinant fusion proteins.
In particular, methods for purification of the type A botulinum neurotoxin have been developed �L. J. Moberg and H. Sugiyarna, Appl. Environ. Microbiol. 35:878 (1978)!. Immunization of hens with detoxified purified protein results in the generation of neutralizing antibodies �B. S. Thalley et al., in Botulinum and Tetanus Neurotoxins, B. R. DasGupta, ed., Plenum Press, New York (1993), p. 467!.
The currently available C. botulinum vaccine comprising chemically inactivated (i.e., formaldehyde treated) type A, B, C, D and E toxins is not adequate. The efficacy is variable (in particular, only 78% of recipients produce protective levels of anti-type B antibodies following administration of the primary series) and immunization is painful (deep subcutaneous inoculation is required for administration), with adverse reactions being common (moderate to severe local reactions occur in approximately 6% of recipients upon initial injection; this number rises to approximately 11% of individuals who receive booster injections) �Informational Brochure for the Pentavalent (ABCDE) Botulinum Toxoid, Centers for Disease Control!. Preparation of this vaccine is dangerous as active toxin must be handled by laboratory workers.
In general, chemical detoxification of bacterial toxins using agents such as formaldehyde, glutaraldehyde or hydrogen peroxide is not optimal for the generation of vaccines or antitoxins. A delicate balance must be struck between too much and too little chemical modification. If the treatment is insufficient, the vaccine may retain residual toxicity. If the treatment is too excessive, the vaccine may lose potency due to destruction of native immunogenic determinants. Another major limitation of using botulinal toxoids for the generation of antitoxins or vaccines is the high production expense. For the above reasons, the development of methods for the production of nontoxic but immunogenic C. botulinum toxin proteins is desirable.
The C. botulinum and C. tetanus toxin proteins have similar structures �reviewed in E. J. Schantz and E. A. Johnson, Microbiol. Rev. 56:80 (1992)!. The carboxy-terminal 50 kD fragment of the tetanus toxin heavy chain (fragment C) is released by papain cleavage and has been shown to be non-toxic and immunogenic. Recombinant tetanus toxin fragment C has been developed as a candidate vaccine antigen �A. J. Makoff et al., Bio/Technology 7:1043 (1989)!. Mice immunized with recombinant tetanus toxin fragment C were protected from challenge with lethal doses of tetanus toxin. No studies have demonstrated that the recombinant tetanus fragment C protein confers immunity against other botulinal toxins such as the C. botulinum toxins.
Recombinant tetanus fragment C has been expressed in E. coli (A. J. Makoff et al., Bio/Technology, supra and Nucleic Acids Res. 17:10191 (1989); J. L. Halpern et al., Infect. Immun. 58:1004 (1990)!, yeast �M. A. Romanos et al., Nucleic Acids Res. 19:1461 (1991)! and baculovirus �I. G. Charles et al., Infect. Immun. 59:1627 (1991)!. Synthetic tetanus toxin genes had to be constructed to facilitate expression in yeast (M. A. Romanos et al., supra) and E. coli �A. J. Makoff et al., Nucleic Acids Res., supra!, due to the high A-T content of the tetanus toxin gene sequences. High A-T content is a common feature of clostridial genes (M. R. Popoff et al., Infect. Immun. 59:3673 (1991); H. F. LaPenotiere et al., in Botulinum and Tetanus Neurotoxins, B. R. DasGupta, ed., Plenurn Press, New York (1993), p. 463! which creates expression difficulties in E. coli and yeast due primarily to altered codon usage frequency and fortuitous polyadenylation sites, respectively.
The C fragment of the C. botulinum type A neurotoxin heavy chain has been evaluated as a vaccine candidate. The C. botulinum type A neurotoxin gene has been cloned and sequenced �D. E. Thompson et al., Eur. J. Biochem. 189:73 (1990)!. The C fragment of the type A toxin was expressed as either a fusion protein comprising the botulinal C fragment fused with the maltose binding protein (MBP) or as a native protein �H. F. LaPenotiere et al., supra!. The plasmid construct encoding the native protein was reported to be unstable, while the fusion protein was expressed in inclusion bodies as insoluble protein. Immunization of mice with crudely purified MBP fusion protein resulted in protection against IP challenge with 3 LD.sub.50 doses of toxin �LaPenotiere et al., supra!. However, this recombinant C. botulinum type A toxin C fragment/MBP fusion protein is not a suitable immunogen for the production of vaccines as it is expressed as an insoluble protein in E. coli. Furthermore, this recombinant C. botulinum type A toxin C fragment/MBP fusion protein was not shown to be substantially free of endotoxin contamination. Experience with recombinant C. botulinum type A toxin C fragment/MBP fusion proteins shows that the presence of the MBP on the fusion protein greatly complicates the removal of endotoxin from preparations of the recombinant fusion protein.
Inclusion body protein must be solubilized prior to purification and/or administration to a host. The harsh treatment of inclusion body protein needed to accomplish this solubilization may reduce the immunogenicity of the purified protein. Ideally, recombinant proteins to be used as vaccines are expressed as soluble proteins at high levels (i.e., greater than or equal to about 0.75% of total cellular protein) in E. coli or other host cells. This facilitates the production and isolation of sufficient quantities of the immunogen in a highly purified form (i.e., substantially free of endotoxin or other pyrogen contamination). The ability to express recombinant toxin proteins as soluble proteins in E. coli is advantageous due to the low cost of growth compared to insect or mammalian tissue culture cells.
The subject invention provides methods which allow the production of soluble C botulinum toxin proteins in economical host cells (e.g., E. coli). Further, methods for the isolation of purified soluble C. botulinum toxin proteins which are suitable for immunization of humans and other animals are provided. These soluble, purified preparations of C. botulinum toxin proteins provide the basis for improved vaccine preparations and facilitate the production of antitoxin.
When recombinant clostridial toxin proteins produced in gram-negative bacteria (e.g., E. coli) are used as vaccines, they are purified to remove endotoxin prior to administration to a host animal. In order to vaccinate a host, an immunogenlically-effective amount of purified substantially endotoxin-free recombinant clostridial toxin protein is administered in any of a number of physiologically acceptable carriers known to the art. When administered for the purpose of vaccination, the purified substantially endotoxin-free recombinant clostridial toxin protein may be used alone or in conjunction with known adjutants, including potassium alum, aluminum phosphate, aluminum hydroxide, Gerbu adjuvant (GmDP; C.C. Biotech Corp.), FIBI adjuvant (MPL; RIBI Immunochemical research, Inc.), QS21 (Cambridge Biotech). The alum and aluminum-based adjutants are particularly preferred when vaccines are to be administered to humans. The route of immunization may be nasal, oral, intramuscular, intraperitoneal or subcutaneous.
The invention contemplates the use of soluble, substantially endotoxin-free preparations of fusion proteins comprising the C fragment of the C. botulinum type A toxin as vaccines. In one embodiment, the vaccine comprises the C fragment of the C. botuintim type A toxin and a poly-histidine tract (also called a histidine tag). In a particularly preferred embodiment, a fusion protein comprising the histidine tagged C fragment is expressed using the pET series of expression vectors (Novagen). The pET expression system utilizes a vector containing the T7 promoter which encodes the fusion protein and a host cell which can be induced to express the T7 DNA polymerase (i.e., a DE3 host strain). The production of C fragment fusion proteins containing a histidine tract is not limited to the use of a particular expression vector and host strain. Several commercially available expression vectors and host strains can be used to express the C fragment protein sequences as a fusion protein containing a histidine tract (For example, the pQE series (pQE-8, 12, 16, 17, 18, 30, 31, 32, 40, 41, 42, 50, 51, 52, 60 and 70) of expression vectors (Qiagen) which are used with the host strains M15�pREP4! (Qiagen) and SG13009�pREP4! (Qiagen) can be used to express fusion proteins containing six histidine residues at the amino-terminus of the fusion protein).
VI. Detection Of Toxin
The invention contemplates detecting bacterial toxin in a sample. The term "sample" in the present specification and claims is used in its broadest sense. On the one hand it is meant to include a specimen or culture. On the other hand, it is meant to include both biological and environmental samples.
Biological samples may be animal, including human, fluid, solid (e.g., stool) or tissue; liquid and solid food products and ingredients such as dairy items, vegetables, meat and meat by-products, and waste. Environmental samples include environmental material such as surface matter, soil, water and industrial samples, as well as samples obtained from food and dairy processing instruments, apparatus, equipment, disposable and non-disposable items. These examples are not to be construed as limiting the sample types applicable to the present invention.
The invention contemplates detecting bacterial toxin by a competitive immunoassay method that utilizes recombinant toxin A and toxin B proteins, antibodies raised against recombinant bacterial toxin proteins. A fixed amount of the recombinant toxin proteins are immobilized to a solid support (e.g., a microtiter plate) followed by the addition of a biological sample suspected of containing a bacterial toxin. The biological sample is first mixed with affinity-purified or PEG fractionated antibodies directed against the recombinant toxin protein. A reporter reagent is then added which is capable of detecting the presence of antibody bound to the immobilized toxin protein. The reporter substance may comprise an antibody with binding specificity for the antitoxin attached to a molecule which is used to identify the presence of the reporter substance. If toxin is present in the sample, this toxin will compete with the immobilized recombinant toxin protein for binding to the anti-recombinant antibody thereby reducing the signal obtained following the addition of the reporter reagent. A control is employed where the antibody is not mixed with the sample. This gives the highest (or reference) signal.
The invention also contemplates detecting bacterial toxin by a "sandwich" immunoassay method that utilizes antibodies directed against recombinant bacterial toxin proteins. Affinity-purified antibodies directed against recombinant bacterial toxin proteins are immobilized to a solid support (e.g., microtiter plates). Biological samples suspected of containing bacterial toxins are then added followed by a washing step to remove substantially all unbound antitoxin. The biological sample is next exposed to the reporter substance, which binds to antitoxin and is then washed free of substantially all unbound reporter substance. The reporter substance may comprise an antibody with binding specificity for the antitoxin attached to a molecule which is used to identify the presence of the reporter substance. Identification of the reporter substance in the biological tissue indicates the presence of the bacterial toxin.
It is also contemplated that bacterial toxin be detected by pouring liquids (e.g., soups and other fluid foods and feeds including nutritional supplements for humans and other animals) over immobilized antibody which is directed against the bacterial toxin. It is contemplated that the immobilized antibody will be present in or on such supports as cartridges, columns, beads, or any other solid support medium. In one embodiment, following the exposure of the liquid to the immobilized antibody, unbound toxin is substantially removed by washing. The exposure of the liquid is then exposed to a reporter substance which detects the presence of bound toxin. In a preferred embodiment the reporter substance is an enzyme, fluorescent dye, or radioactive compound attached to an antibody which is directed against the toxin (i.e., in a "sandwich" immunoassay). It is also contemplated that the detection system will be developed as necessary (e.g., the addition of enzyme substrate in enzyme systems; observation using fluorescent light for fluorescent dye systems; and quantitation of radioactivity for radioactive systems).
EXPERIMENTAL
The following examples serve to illustrate certain preferred embodiments and aspects of the present invention and are not to be construed as limiting the scope thereof.
In the disclosure which follows, the following abbreviations apply: .degree. C. (degrees Centigrade); rpm (revolutions per minute); BBS-Tween (borate buffered saline containing Tween); BSA (bovine serum albumin); ELISA (enzyme-linked immunosorbent assay); CFA (complete Freund's adjuvant); IFA (incomplete Freund's adjuvant); IgG (immunoglobulin G); IgY (immunoglobulin Y); IM (intramuscular); IP (intraperitoneal); IV (intravenous or intravascular); SC (subcutaneous); H.sub.2 O (water); HCl (hydrochloric acid); LD.sub.100 (lethal dose for 100% of experimental animals); aa (amino acid); HPLC (high performance liquid chromatography); kD (kilodaltons); gm (grams); .mu.g (micrograms); mg (milligrams); ng (nanograms); .mu.l (microliters); ml (milliliters); mm (millimeters); nm (nanometers); .mu.m (micrometer); M (molar); mM (millimolar); MW (molecular weight); sec (seconds); min(s) (minute/minutes); hr(s) (hour/hours); MgCl.sub.2 (magnesium chloride); NaCl (sodium chloride); Na.sub.2 CO.sub.3 (sodium carbonate); OD.sub.280 (optical density at 280 nm); OD.sub.600 (optical density at 600 nm); PAGE (polyacrylamide gel electrophoresis); PBS �phosphate buffered saline (150 mM NaCl, 10 mM sodium phosphate buffer, pH 7.2)!; PEG (polyethylene glycol); PMSF (phenylmethylsulfonyl fluoride); SDS (sodium dodecyl sulfate); Tris (tris(hydroxymethyl)aminomethane); Ensure.RTM. (Ensure.RTM., Ross Laboratories, Columbus Ohio); Enfamil.RTM. (Enfamil.RTM., Mead Johnson); w/v (weight to volume); v/v (volume to volume); Amicon (Amicon, Inc., Beverly, Mass.); Amresco (Amresco, Inc., Solon, Ohio); ATCC (American Type Culture Collection, Rockville, Md.); BBL (Baltimore Biologics Laboratory, (a division of Becton Dickinson), Cockeysville, Md.); Becton Dickinson (Becton Dickinson Labware, Lincoln Park, N.J.); BioRad (BioRad, Richmond, Calif.); Biotech (C-C Biotech Corp., Poway, Calif.); Charles River (Charles River Laboratories, Wilmington, Mass.); Cocalico (Cocalico Biologicals Inc., Reamstown, Pa.); CytRx (CytRx Corp., Norcross, Ga.); Falcon (e.g. Baxter Healthcare Corp., McGaw Park, Ill. and Becton Dickinson); FDA (Federal Food and Drug Administration); Fisher Biotech (Fisher Biotech, Springfield, N.J.); GIBCO (Grand Island Biologic Company/BRL, Grand Island, N.Y.); Gibco-BRL (Life Technologies, Inc., Gaithersburg, Md.); Harlan Sprague Dawley (Harlan Sprague Dawley, Inc., Madison, Wis.); Mallinckrodt (a division of Baxter Healthcare Corp., McGaw Park, Ill.); Millipore (Millipore Corp., Marlborough, Mass.); New England Biolabs (New England Biolabs, Inc., Beverly, Mass.); Novagen (Novagen, Inc., Madison, Wis.); Pharmacia (Pharmacia, Inc., Piscataway, N.J.); Qiagen (Qiagen, Chatsworth, Calif.); Sasco (Sasco, Omaha, Nebr.); Showdex (Showa Denko America, Inc., New York, N.Y.); Sigma (Sigma Chemical Co., St. Louis, Mo.); Sterogene (Sterogene, Inc., Arcadia, Calif.); Tech Lab (Tech Lab, Inc., Blacksburg, Va.); and Vaxcell (Vaxcell, Inc., a subsidiary of CytRX Corp., Norcross, Ga.).
When a recombinant protein is described in the specification it is referred to in a short-hand manner by the amino acids in the toxin sequence present in the recombinant protein rounded to the nearest 10. For example, the recombinant protein pMB1850-2360 contains amino acids 1852 through 2362 of the C. difficile toxin B protein. The specification gives detailed construction details for all recombinant proteins such that one skilled in the art will know precisely which amino acids are present in a given recombinant protein.
EXAMPLE 1
Production Of High-Titer Antibodies To Clostridium difficile Organisms In A Hen
Antibodies to certain pathogenic organisms have been shown to be effective in treating diseases caused by those organisms. It has not been shown whether antibodies can be raised, against Clostridium difficile, which would be effective in treating infection by this organism. Accordingly, C. difficile was tested as immunogen for production of hen antibodies.
To determine the best course for raising high-titer egg antibodies against whole C. difficile organisms, different immunizing strains and different immunizing concentrations were examined. The example involved (a) preparation of the bacterial immunogen, (b) immunization, (c) purification of anti-bacterial chicken antibodies, and (d) detection of anti-bacterial antibodies in the purified IgY preparations.
a) Preparation Of Bacterial Immunogen
C. difficile strains 43594 (serogroup A) and 43596 (serogroup C) were originally obtained from the ATCC. These two strains were selected because they represent two of the most commonly-occurring serogroups isolated from patients with antibiotic-associated pseudomembranous colitis. �Delmee et al., J. Clin. Microbiol., 28(10):2210 (1990).! Additionally, both of these strains have been previously characterized with respect to their virulence in the Syrian hamster model for C. difficile infection. �Delmee et al., J. Med Microbiol., 33:85 (1990).!
The bacterial strains were separately cultured on brain heart infusion agar for 48 hours at 37.degree. C. in a Gas Pack 100 Jar (BBL, Cockeysville, Md.) equipped with a Gas Pack Plus anaerobic envelope (BBL). Forty-eight hour cultures were used because they produce better growth and the organisms have been found to be more cross-reactive with respect to their surface antigen presentation. The greater the degree of cross-reactivity of our IgY preparations, the better the probability of a broad range of activity against different strains/serogroups. �Toma et al., J. Clin. Microbiol., 26(3):426 (1988).!
The resulting organisms were removed from the agar surface using a sterile dacron-tip swab, and were suspended in a solution containing 0.4% formaldehyde in PBS, pH 7.2. This concentration of formaldehyde has been reported as producing good results for the purpose of preparing whole-organism immunogen suspensions for the generation of polyclonal anti-C. difficile antisera in rabbits. �Delmee et al., J. Clin. Microbiol., 21:323 (1985); Davies et al., Microbial Path., 9:141 (1990).! In this manner, two separate bacterial suspensions were prepared, one for each strain. The two suspensions were then incubated at 4.degree. C. for 1 hour. Following this period of formalin-treatment, the suspensions were centrifuged at 4,200.times.g for 20 min., and the resulting pellets were washed twice in normal saline. The washed pellets, which contained formalin-treated whole organisms, were resuspended in fresh normal saline such that the visual turbidity of each suspension corresponded to a #7 McFarland standard. �M. A. C. Edelstein, "Processing Clinical Specimens for Anaerobic Bacteria: Isolation and Identification Procedures," in S. M. Finegold et al (eds.)., Bailey and Scott's Diagnostic Microbiology, pp. 477-507, C. V. Mosby Co., (1990). The preparation of McFarland nephelometer standards and the corresponding approximate number of organisms for each tube are described in detail at pp. 172-173 of this volume.! Each of the two #7 suspensions was then split into two separate volumes. One volume of each suspension was volumetrically adjusted, by the addition of saline, to correspond to the visual turbidity of a #1 McFarland standard. �Id.! The #1 suspensions contained approximately 3.times.10.sup.8 organisms/ml, and the #7 suspensions contained approximately 2.times.10.sup.9 organisms/ml. �Id.! The four resulting concentration-adjusted suspensions of formalin-treated C. difficile organisms were considered to be "bacterial immunuogen suspensions." These suspensions were used immediately after preparation for the initial immunization. �See section (b).!
The formalin-treatment procedure did not result in 100% non-viable bacteria in the immunogen suspensions. In order to increase the level of killing, the formalin concentration and length of treatment were both increased for subsequent irnmunogen preparations, as described below in Table 3. (Although viability was decreased with the stronger formalin treatment, 100% inviability of the bacterial immunogen suspensions was not reached.) Also, in subsequent immunogen preparations, the formalin solutions were prepared in normal saline instead of PBS. At day 49, the day of the fifth immunization, the excess volumes of the four previous bacterial immunogen suspensions were stored frozen at -70.degree. C. for use during all subsequent immunizations.
b) Immunization
For the initial immunization, 1.0 ml volumes of each of the four bacterial immunogen suspensions described above were separately emulsified in 1.2 ml volumes of CFA (GIBCO). For each of the four emulsified immunogen suspensions, two four-month old White Leghorn hens (pre-laying) were immunized. (It is not necessary to use pre-laying hens; actively-laying hens can also be utilized.) Each hen received a total volume of approximately 1.0 ml of a single emulsified immunogen suspension via four injections (two subcutaneous and two intramuscular) of approximately 250 .mu.l per site. In this manner, a total of four different immunization combinations, using two hens per combination, were initiated for the purpose of evaluating both the effect of immunizing concentration on egg yolk antibody (IgY) production, and interstrain cross-reactivity of IgY raised against heterologous strains. The four immunization groups are summarized in Table 3.
The time point for the first series of immunizations was designated as "day zero." All subsequent immunizations were performed as described above except that the bacterial immunogen suspensions were emulsified using IFA (GIBCO) instead of
TABLE 3______________________________________Immunization GroupsGROUP IMMUNIZING APPROXIMATEDESIGNATION STRAIN IMMUNIZING DOSE______________________________________CD 43594, #1 C. difficile 1.5 .times. 10.sup.8 organisms/hen strain 43594CD 43594, #7 C. difficile 1.0 .times. 10.sup.9 organisms/hen strain 43594CD 43596, #1 C. difficile 1.5 .times. 10.sup.8 organisms/hen strain 43596CD 43596, #7 C. difficile 1.0 .times. 10.sup.9 organisms/hen strain 43596______________________________________
CFA, and for the later time point immunization, the stored frozen suspensions were used instead of freshly-prepared suspensions. The immunization schedule used is listed in Table 4.
c) Purificaton Of Anti-Bacterial Chicken Antibodies
Groups of four eggs were collected per immunization group between days 80 and 84 post-initial immunization, and chicken immunoglobulin (IgY) was extracted according to a modification of the procedure of A. Polson et al., Immunol. Comm., 9:495 (1980). A gentle stream of distilled water from a squirt bottle was used to separate the yolks from the whites, and the yolks were broken by dropping them through a funnel into a graduated cylinder. The four individual yolks were pooled for each group. The pooled, broken yolks were blended with 4 volumes of egg extraction buffer to improve antibody yield (egg extraction buffer is 0.01M sodium phosphate, 0.1M NaCl, pH 7.5, containing 0.005% thimerosal), and PEG 8000 (Amresco) was
TABLE 4______________________________________Immunization ScheduleDAY OF FORMALIN- IMMUNOGENIMMUNIZATION TREATMENT PREPARATION USED______________________________________0 1%, 1 hr. freshly-prepared14 1%, overnight "21 1%, overnight "35 1%, 48 hrs. "49 1%, 72 hrs. "70 " stored frozen85 " "105 " "______________________________________
added to a concentration of 3.5%. When all the PEG dissolved, the protein precipitates that formed were pelleted by centrifugation at 13,000.times.g for 10 minutes. The supernatants were decanted and filtered through cheesecloth to remove the lipid layer, and the PEG was added to the supernatants to a final concentration of 12% (the supernatants were assumed to contain 3.5% PEG). After a second centrifugation, the supernatants were discarded and the pellets were centrifuiged a final time to extrude the remaining PEG. These crude IgY pellets were then dissolved in the original yolk volume of egg extraction buffer and stored at 4.degree. C. As an additional control, a preimmune IgY solution was prepared as described above, using eggs collected from unimmunized hens.
d) Detection Of Anti-Bacterial Antibodies In The Purified IgY Preparations
In order to evaluate the relative levels of specific anti-C. difficile activity in the IgY preparations described above, a modified version of the whole-organism ELISA procedure of N. V. Padhye et al., J. Clin. Microbiol. 29:99-103 (1990) was used. Frozen organisms of both C. dificile strains described above were thawed and diluted to a concentration of approximately 1.times.10.sup.7 organisms/ml using PBS, pH 7.2. In this way, two separate coating suspensions were prepared, one for each immunizing strain. Into the wells of 96-well microtiter plates (Falcon, Pro-Bind Assay Plates) were placed 100 .mu.l volumes of the coating suspensions. In this manner, each plate well received a total of approximately 1.times.10.sup.6 organisms of one strain or the other. The plates were then incubated at 4.degree. C. overnight. The next morning, the coating suspensions were decanted, and all wells were washed three times using PBS. In order to block non-specific binding sites, 100 .mu.l of 0.5% BSA (Sigma) in PBS was then added to each well, and the plates were incubated for 2 hours at room temperature. The blocking solution was decanted, and 100 .mu.l volumes of the IgY preparations described above were initially diluted 1:500 with a solution of 0.1% BSA in PBS, and then serially diluted in 1:5 steps. The following dilutions were placed in the wells: 1:500, 1:2,500, 1:62,5000, 1:312,500, and 1:1,562,500. The plates were again incubated for 2 hours at room temperature. Following this incubation, the IgY-containing solutions were decanted, and the wells were washed three times using BBS-Tween (0.1M boric acid, 0.025M sodium borate, 1.0M NaCl, 0.1% Tween-20), followed by two washes using PBS-Tween (0.1% Tween-20), and finally, two washes using PBS only. To each well, 100 .mu.l of a 1:750 dilution of rabbit anti-chicken IgG (whole-molecule)-alkaline phosphatase conjugate (Sigma) (diluted in 0.1% BSA in PBS) was added. The plates were again incubated for 2 hours at room temperature. The conjugate solutions were decanted and the plates were washed as described above, substituting 50 mM Na.sub.2 CO.sub.3, pH 9.5 for the PBS in the final wash. The plates were developed by the addition of 100 .mu.l of a solution containing 1 mg/ml para-nitrophenyl phosphate (Sigma) dissolved in 50 mM Na.sub.2 CO.sub.3, 10 mM MgCl.sub.2, pH 9.5 to each well, and incubating the plates at
TABLE 5______________________________________Results Of The Anti-C. difficile Whole-Organism ELISAIgY DILUTION OF 43594-COATED 43596-COATEDPREPARATION IgY PREP WELLS WELLS______________________________________CD 43594, #1 1:500 1.746 1.801 1:2,500 1.092 1.670 1:12,500 0.202 0.812 1:62,500 0.136 0.179 1:312,500 0.012 0.080 1:1,562,500 0.002 0.020CD 43594, #7 1:500 1.780 1.771 1:2,500 1.025 1.078 1:12,500 0.188 0.382 1:62,500 0.052 0.132 1:312,500 0.022 0.043 1:1,562,500 0.005 0.024CD 43596, #1 1:500 1.526 1.790 1:2,500 0.832 1.447 1:12,500 0.247 0.452 1:62,500 0.050 0.242 1:312,500 0.010 0.067 1:1,562,500 0.000 0.036CD 43596, #7 1:500 1.702 1.505 1:2,500 0.706 0.866 1:12,500 0.250 0.282 1:62,500 0.039 0.078 1:312,500 0.002 0.017 1:1,562,500 0.000 0.010Preimmune IgY 1:500 0.142 0.309 1:2,500 0.032 0.077 1:12,500 0.006 0.024 1:62,500 0.002 0.012 1:312,500 0.004 0.010 1:1,562,500 0.002 0.014______________________________________
room temperature in the dark for 45 minutes. The absorbance of each well was measured at 410 nm using a Dynatech MR 700 plate reader. In this manner, each of the four IgY preparations described above was tested for reactivity against both of the immunizing C. difficile strains; strain-specific, as well as cross-reactive activity was determined.
Table 5 shows the results of the whole-organism ELISA. All four IgY preparations demonstrated significant levels of activity, to a dilution of 1:62,500 or greater against both of the immunizing organism strains. Therefore, antibodies raised against one strain were highly cross-reactive with the other strain, and vice versa. The immunizing concentration of organisms did not have a significant effect on organism-specific IgY production, as both concentrations produced approximately equivalent responses. Therefore, the lower immunizing concentration of approximately 1.5.times.10.sup.8 organisms/hen is the preferred immunizing concentration of the two tested. The preimmune IgY preparation appeared to possess relatively low levels of C. difficile-reactive activity to a dilution of 1:500, probably due to prior exposure of the animals to environmental clostridia.
An initial whole-organism ELISA was performed using IgY preparations made from single CD 43594, #1 and CD 43596, #1 eggs collected around day 50 (data not shown). Specific titers were found to be 5 to 10-fold lower than those reported in Table 5. These results demonstrate that it is possible to begin immunizing hens prior to the time that they begin to lay eggs, and to obtain high titer specific IgY from the first eggs that are laid. In other words, it is not necessary to wait for the hens to begin laying before the immunization schedule is started.
EXAMPLE 2
Treatment Of C. difficile Infection With Anti-C. difficile Antibody
In order to determine whether the immune IgY antibodies raised against whole C. dificile organisms were capable of inhibiting the infection of hamsters by C. difficile, hamsters infected by these bacteria were utilized. �Lyerly et al., Infect. Immun., 59:2215-2218 (1991).! This example involved: (a) determination of the lethal dose of C. difficile organisms; and (b) treatment of infected animals with immune antibody or control antibody in nutritional solution.
a) Determination Of The Lethal Dose Of C. difficile Organisms
Determination of the lethal dose of C. difficile organisms was carried out according to the model described by D. M. Lyerly et al., Infect. Immun., 59:2215-2218 (1991). C. difficile strain ATCC 43596 (serogroup C, ATCC) was plated on BHI agar and grown anaerobically (BBL Gas Pak 100 system) at 37.degree. C. for 42 hours. Organisms were removed from the agar surface using a sterile dacron-tip swab and suspended in sterile 0.9% NaCl solution to a density of 10.sup.8 organisms/ml.
In order to determine the lethal dose of C. difficile in the presence of control antibody and nutritional formula, non-immune eggs were obtained from unimmunized hens and a 12% PEG preparation made as described in Example 1(c). This preparation was redissolved in one fourth the original yolk volume of vanilla flavor Ensure.RTM..
Starting on day one, groups of female Golden Syrian hamsters (Harlan Sprague Dawley), 8-9 weeks old and weighing approximately 100 gm, were orally administered 1 ml of the preimmune/Ensure.RTM. formula at time zero, 2 hours, 6 hours, and 10 hours. At 1 hour, animals were orally administered 3.0 mg clindamycin HCl (Sigma) in 1 ml of water. This drug predisposes hamsters to C. difficile infection by altering the normal intestinal flora. On day two, the animals were given 1 ml of the preimmune IgY/Ensure.RTM. formula at time zero, 2 hours, 6 hours, and 10 hours. At 1 hour on day two, different groups of animals were inoculated orally with saline (control), or 10.sup.2, 10.sup.4, 10.sup.6, or 10.sup.8 C. difficile organisms in 1 ml of saline. From days 3-12, animals were given 1 ml of the preimmune IgY/Ensure.RTM. formula three times daily and observed for the onset of diarrhea and death. Each animal was housed in an individual cage and was offered food and water ad libitum.
Administration of 10.sup.6 -10.sup.8 organisms resulted in death in 3-4 days while the lower doses of 10.sup.2 -10.sup.4 organisms caused death in 5 days. Cecal swabs taken from dead animals indicated the presence of C. difficile. Given the effectiveness of the 10.sup.2 dose, this number of organisms was chosen for the following experiment to see if hyperimmune anti-C. difficile antibody could block infection.
b) Treatment Of Infected Animal With Immune Antibody Or Control Antibody In Nutritional Formula
The experiment in (a) was repeated using three groups of seven hamsters each. Group A received no clindamycin or C. difficile and was the survival control. Group B received clindamycin, 10.sup.2 C. difficile organisms and preimmune IgY on the same schedule as the animals in (a) above. Group C received clindamycin, 10.sup.2 C. difficile organisms, and hyperimmune anti-C. difficile IgY on the same schedule as Group B. The anti-C. difficile IgY was prepared as described in Example 1 except that the 12% PEG preparation was dissolved in one fourth the original yolk volume of Ensure.RTM.).
All animals were observed for the onset of diarrhea or other disease symptoms and death. Each animal was housed in an individual cage and was offered food and water ad libitum. The results are shown in Table 6.
Hamsters in the control group A did not develop diarrhea and remained healthy during the experimental period. Hamsters in groups B and C developed diarrheal disease. Anti-C. difficile IgY did not protect the animals from diarrhea or death, all animals succumbed in the same time interval as the animals treated with preimmune
TABLE 6______________________________________The Effect Of Oral Feeding Of Hyperimmune IgYAntibody on C. difficile Infection TIME TO TIME TOANIMAL GROUP DIARRHEA.sup.a DEATH.sup.a______________________________________A pre-immune IgY only no diarrhea no deathsB Clindamycin, C. difficile, 30 hrs. 49 hrs. preimmune IgYC Clindamycin, C. difficile, 33 hrs. 56 hrs. immune IgY______________________________________
IgY. Thus, while immunization with whole organisms apparently can improve sub-lethal symptoms with particular bacteria (see U.S. Pat. No. 5,080,895 to H. Tokoro), such an approach does not prove to be productive to protect against the lethal effects of C. difficile.
EXAMPLE 3
Production of C. botulinum Type A Antitoxin in Hens
In order to determine whether antibodies could be raised against the toxin produced by clostridial pathogens, which would be effective in treating clostridial diseases, antitoxin to C. botulinum type A toxin was produced. This example involves: (a) toxin modification; (b) immunization; (c) antitoxin collection; (d) antigenicity assessment; and (e) assay of antitoxin titer.
a) Toxin Modification
C. botulinum type A toxoid was obtained from B. R. DasGupta. From this, the active type A neurotoxin (M.W. approximately 150 kD) was purified to greater than 99% purity, according to published methods. �B. R. DasGupta & V. Sathyamoorthy, Toxicon, 22:415 (1984).! The neurotoxin was detoxified with formaldehyde according to published methods. �B. R. Singh & B. R. DasGupta, Toxicon, 27:403 (1989).!
b) Immunization
C. botulinum toxoid for immunization was dissolved in PBS (1 mg/ml) and was emulsified with an approximately equal volume of CFA (GIBCO) for initial immunization or IFA for booster immunization. On day zero, two white leghorn hens, obtained from local breeders, were each injected at multiple sites (intramuscular and subcutaneous) with 1 ml inactivated toxoid emulsified in 1 ml CFA. Subsequent booster immunizations were made according to the following schedule for day of injection and toxoid amount: days 14 and 21-0.5 mg; day 171-0.75 mg; days 394, 401, 409-0.25 mg. One hen received an additional booster of 0.150 mg on day 544.
c) Antitoxin Collection
Total yolk immunoglobulin (IgY) was extracted as described in Example 1(c) and the IgY pellet was dissolved in the original yolk volume of PBS with thimerosal.
d) Antigenticity Assessment
Eggs were collected from day 409 through day 423 to assess whether the toxoid was sufficiently immunogenic to raise antibody. Eggs from the two hens were pooled and antibody was collected as described in the standard PEG protocol. �Example 1(c).! Antigenicity of the botulinal toxin was assessed on Western blots. The 150 kD detoxified type A neurotoxin and unmodified, toxic, 300 kD botulinal type A complex (toxin used for intragastric route administration for animal gut neutralization experiments; see Example 6) were separated on a SDS-polyacrylamide reducing gel. The Western blot technique was performed according to the method of Towbin. �H. Towbin et al., Proc. Natl. Acad. Sci. USA, 76:4350 (1979).! Ten .mu.g samples of C. botulinum complex and toxoid were dissolved in SDS reducing sample buffer (1% SDS, 0.5% 2-mercaptoethanol, 50 mM Tris, pH 6.8, 10% glycerol, 0.025% w/v bromphenol blue, 10% .beta.-mercaptoethanol), heated at 95.degree. C. for 10 min and separated on a 1 mm thick 5% SDS-polyacrylamide gel. �K. Weber and M. Osborn, "Proteins and Sodium Dodecyl Sulfate: Molecular Weight Determination on Polyacrylamide Gels and Related Procedures," in The Proteins, 3d Edition (H. Neurath & R. L. Hill, eds), pp. 179-223, (Academic Press, NY, 1975).! Part of the gel was cut off and the proteins were stained with Coomassie Blue. The proteins in the remainder of the gel were transferred to nitrocellulose using the Milliblot-SDE electro-blotting system (Millipore) according to manufacturer's directions. The nitrocellulose was temporarily stained with 10% Ponceau S �S. B. Carroll and A. Laughon, "Production and Purification of Polyclonal Antibodies to the Foreign Segment of .beta.-galactosidase Fusion Proteins," in DNA Cloning: A Practical Approach, Vol. III, (D. Glover, ed.), pp. 89-111, IRL Press, Oxford, (1987)! to visualize the lanes, then destained by running a gentle stream of distilled water over the blot for several minutes. The nitrocellulose was immersed in PBS containing 3% BSA overnight at 4.degree. C. to block any remaining protein binding sites.
The blot was cut into strips and each strip was incubated with the appropriate primary antibody. The avian anti-C. botulinum antibodies �described in (c)! and pre-immune chicken antibody (as control) were diluted 1:125 in PBS containing 1 mg/ml BSA for 2 hours at room temperature. The blots were washed with two changes each of large volumes of PBS, BBS-Tween and PBS, successively (10 min/wash). Goat anti-chicken IgG alkaline phosphatase conjugated secondary antibody (Fisher Biotech) was diluted 1:500 in PBS containing 1 mg/ml BSA and incubated with the blot for 2 hours at room temperature. The blots were washed with two changes each of large volumes of PBS and BBS-Tween, followed by one change of PBS and 0.1M Tris-HCl, pH 9.5. Blots were developed in freshly prepared alkaline phosphatase substrate buffer (100 .mu.g/ml nitroblue tetrazolium (Sigma), 50 .mu.g/ml 5-bromo-4-chloro-3-indolyl phosphate (Sigma), 5 mM MgCl.sub.2 in 50 mM Na.sub.2 CO.sub.3, pH 9.5).
The Western blots are shown in FIG. 1. The anti-C. botulinum IgY reacted to the toxoid to give a broad immunoreactive band at about 145-150 kD on the reducing gel. This toxoid is refractive to disulfide cleavage by reducing agents due to formalin crosslinking. The immune IgY reacted with the active toxin complex, a 97 kD C. botulinum type A heavy chain and a 53 kD light chain. The preimmune IgY was unreactive to the C. botulinum complex or toxoid in the Western blot.
e) Aintitoxin Anitibody Titer
The IgY antibody titer to C. botulinum type A toxoid of eggs harvested between day 409 and 423 was evaluated by ELISA, prepared as follows. Ninety-six-well Falcon Pro-bind plates were coated overnight at 4.degree. C. with 100 .mu.l/well toxoid �B. R. Singh & B. R. Das Gupta, Toxicon 27:403 (1989)! at 2.5 .mu.g/ml in PBS, pH 7.5 containing 0.005% thimerosal. The following day the wells were blocked with PBS containing 1% BSA for 1 hour at 37.degree. C. The IgY from immune or preimmune eggs was diluted in PBS containing 1% BSA and 0.05% Tween 20 and the plates were incubated for 1 hour at 37.degree. C. The plates were washed three times with PBS containing 0.05% Tween 20 and three times with PBS alone. Alkaline phosphatase-conjugated goat-anti-chicken IgG (Fisher Biotech) was diluted 1:750 in PBS containing 1% BSA and 0.05% Tween 20, added to the plates, and incubated 1 hour at 37.degree. C. The plates were washed as before, and p-nitrophenyl phosphate (Sigma) at 1 mg/ml in 0.05M Na.sub.2 CO.sub.3, pH 9.5, 10 mM MgCl.sub.2 was added.
The results are shown in FIG. 2. Chickens immunized with the toxoid generated high titers of antibody to the immunogen. Importantly, eggs from both immunized hens had significant anti-immunogen antibody titers as compared to preimmune control eggs. The anti-C. botulinum IgY possessed significant activity, to a dilution of 1:93,750 or greater.
EXAMPLE 4
Preparation Of Avian Egg Yolk Immunoglobulin In An Orally Administrable Form
In order to administer avian IgY antibodies orally to experimental mice, an effective delivery formula for the IgY had to be determined. The concern was that if the crude IgY was dissolved in PBS, the saline in PBS would dehydrate the mice, which might prove harmful over the duration of the study. Therefore, alternative methods of oral administration of IgY were tested. The example involved: (a) isolation of immune IgY; (b) solubilization of IgY in water or PBS, including subsequent dialysis of the IgY-PBS solution with water to eliminate or reduce the salts (salt and phosphate) in the buffer; and (c) comparison of the quantity and activity of recovered IgY by absorbance at 280 nm and PAGE, and enzyme-linked immunoassay (ELISA).
a) Isolation Of Immune IgY
In order to investigate the most effective delivery formula for IgY, we used IgY which was raised against Crotalus durissus terrificus venom. Three eggs were collected from hens immunized with the C. durissus terrificus venom and IgY was extracted from the yolks using the modified Polson procedure described by Thalley and Carroll �Bio/Technology, 8:934-938 (1990)! as described in Example 1(c).
The egg yolks were separated from the whites, pooled, and blended with four volumes of PBS. Powdered PEG 8000 was added to a concentration of 3.5%. The mixture was centrifuged at 10,000 rpm for 10 minutes to pellet the precipitated protein, and the supernatant was filtered through cheesecloth to remove the lipid layer. Powdered PEG 8000 was added to the supernatant to bring the final PEG concentration to 12% (assuming a PEG concentration of 3.5% in the supernatant). The 12% PEG/IgY mixture was divided into two equal volumes and centrifuged to pellet the IgY.
h) Solubilization Of The IgY In Water Or PBS
One pellet was resuspended in 1/2 the original yolk volume of PBS, and the other pellet was resuspended in 1/2 the original yolk volume of water. The pellets were then centrifuged to remove any particles or insoluble material. The IgY in PBS solution dissolved readily but the fraction resuspended in water remained cloudy.
In order to satisfy anticipated sterility requirements for orally administered antibodies, the antibody solution needs to be filter-sterilized (as an alternative to heat sterilization which would destroy the antibodies). The preparation of IgY resuspended in water was too cloudy to pass through either a 0.2 or 0.45 .mu.m membrane filter, so 10 ml of the PBS resuspended fraction was dialyzed overnight at room temperature against 250 ml of water. The following morning the dialysis chamber was emptied and refilled with 250 ml of fresh H.sub.2 O for a second dialysis. Thereafter, the yields of soluble antibody were determined at OD.sub.280 and are compared in Table 7.
TABLE 7______________________________________Dependence Of IgY Yield On Solvents ABSORBANCE OF 1:10 PERCENTFRACTION DILUTION AT 280 nm RECOVERY______________________________________PBS dissolved 1.149 100%H.sub.2 O dissolved 0.706 61%PBS dissolved/H.sub.2 O dialyzed 0.885 77%______________________________________
Resuspending the pellets in PBS followed by dialysis against water recovered more antibody than directly resuspending the pellets in water (77% versus 61%). Equivalent volumes of the IgY preparation in PBS or water were compared by PAGE, and these results were in accordance with the absorbance values (data not shown).
c) Activity Of IgY Prepared With Different Solvents
An ELISA was performed to compare the binding activity of the IgY extracted by each procedure described above. C. durissus terrificus (C.d.t.) venom at 2.5 .mu.g/ml in PBS was used to coat each well of a 96-well microtiter plate. The remaining protein binding sites were blocked with PBS containing 5 mg/ml BSA. Primary antibody dilutions (in PBS containing 1 mg/ml BSA) were added in duplicate. After 2 hours of incubation at room temperature, the unbound primary antibodies were removed by washing the wells with PBS, BBS-Tween, and PBS. The species specific secondary antibody (goat anti-chicken immunoglobulin alkaline-phosphatase conjugate (Sigma) was diluted 1:750 in PBS containing 1 mg/ml BSA and added to each well of the microtiter plate. After 2 hours of incubation at room temperature, the unbound secondary antibody was removed by washing the plate as before, and freshly prepared alkaline phosphatase substrate (Sigma) at 1 mg/ml in 50 mM Na.sub.2 CO.sub.3, 10 mM MgCl.sub.2, pH 9.5 was added to each well. The color development was measured on a Dynatech MR 700 microplate reader using a 412 nm filter. The results are shown in Table 8.
The binding assay results parallel the recovery values in Table 7, with PBS-dissolved IgY showing slightly more activity than the PBS-dissolved/H.sub.2 O dialyzed antibody. The water-dissolved antibody had considerably less binding activity than the other preparations.
EXAMPLE 5
Survival Of Antibody Activity After Passage Through The Gastrointestinal Tract
In order to determine the feasibility of oral administration of antibody, it was of interest to determine whether orally administered IgY survived passage through the gastrointestinal tract. The example involved: (a) oral administration of specific immune antibody mixed with a nutritional formula; and (b) assay of antibody activity extracted from feces.
TABLE 8______________________________________Antigen-Binding Activity of IgY Prepared with Different Solvents PBS H.sub.2 O PBS/DILUTION PREIMMUNE DISSOLVED DISSOLVED H.sub.2 O______________________________________1:500 0.005 1.748 1.577 1.7421:2,500 0.004 0.644 0.349 0.6061:12,500 0.001 0.144 0.054 0.0901:62,500 0.001 0.025 0.007 0.0161:312,500 0.010 0.000 0.000 0.002______________________________________
a) Oral Administration Of Antibody
The IgY preparations used in this example are the same PBS-dissolved/H.sub.2 O dialyzed antivenom materials obtained in Example 4 above, mixed with an equal volume of Enfamnil.RTM.. Two mice were used in this experiment, each receiving a different diet as follows:
1) water and food as usual;
2) immune IgY preparation dialyzed against water and mixed 1:1 with Enfamil.RTM.. (The mice were given the corresponding mixture as their only source of food and water).
b) Antibody Activity After Ingestion
After both mice had ingested their respective fluids, each tube was refilled with approximately 10 ml of the appropriate fluid first thing in the morning. By mid-morning there was about 4 to 5 ml of liquid left in each tube. At this point stool samples were collected from each mouse, weighed, and dissolved in approximately 500 .mu.l PBS per 100 mg stool sample. One hundred and sixty mg of control stools (no antibody) and 99 mg of experimental stools (specific antibody) in 1.5 ml microfuge tubes were dissolved in 800 and 500 .mu.l PBS, respectively. The samples were heated at 37.degree. C. for 10 minutes and vortexed vigorously. The experimental stools were also broken up with a narrow spatula. Each sample was centrifuged for 5 minutes in a microfuge and the supernatants, presumably containing the antibody extracts, were collected. The pellets were saved at 2-8.degree. C. in case future extracts were needed. Because the supernatants were tinted, they were diluted five-fold in PBS containing 1 mg/ml BSA for the initial dilution in the enzyme immunoassay (ELISA). The primary extracts were then diluted five-fold serially from this initial dilution. The volume of primary extract added to each well was 190 .mu.l. The ELISA was performed exactly as described in Example 4.
TABLE 9______________________________________Specific Antibody Activity After PassageThrough the Gastrointestinal Tract CONTROL FECAL EXP. FECALDILUTION PREIMMUNE IgY EXTRACT EXTRACT______________________________________1:5 <0 0.000 0.0321:25 0.016 <0 0.0161:125 <0 <0 0.0091:625 <0 0.003 0.0011:3125 <0 <0 0.000______________________________________
There was some active antibody in the fecal extract from the mouse given the specific antibody in Enfamil.RTM. formula, but it was present at a very low level. Since the samples were assayed at an initial 1:5 dilution, the binding observed could have been higher with less dilute samples. Consequently, the mice were allowed to continue ingesting either regular food and water or the specific IgY in Enfamil.RTM. formula, as appropriate, so the assay could be repeated. Another ELISA plate was coated overnight with 5 .mu.g/ml of C.d.t. venom in PBS.
The following morning the ELISA plate was blocked with 5 mg/ml BSA, and the fecal samples were extracted as before, except that instead of heating the extracts at 37.degree. C., the samples were kept on ice to limit proteolysis. The samples were assayed undiluted initially, and in 5.times. serial dilutions thereafter. Otherwise the assay was carried out as before.
TABLE 10______________________________________Specific Antibody Survives Passage Through The Gastrointestinal Tract CONTROLDILUTION PREIMMUNE IgY EXTRACT EXP. EXTRACT______________________________________undiluted 0.003 <0 0.3791:5 <0 <0 0.0711:25 0.000 <0 0.0271:125 0.003 <0 0.0171:625 0.000 <0 0.0081:3125 0.002 <0 0.002______________________________________
The experiment confirmed the previous results, with the antibody activity markedly higher. The control fecal extract showed no anti-C.d.t. activity, even undiluted, while the fecal extract from the anti-C.d.t. IgY/Enfamil.RTM.-fed mouse showed considerable anti-C.d.t. activity. This experiment (and the previous experiment) clearly demonstrate that active IgY antibody survives passage through the mouse digestive tract, a finding with favorable implications for the success of IgY antibodies administered orally as a therapeutic or prophylactic.
EXAMPLE 6
In Vivo Neutralization Of Type C. botulinum Type A Neurotoxin By Avian Antitoxin Antibody
This example demonstrated the ability of PEG-purified antitoxin, collected as described in Example 3, to neutralize the lethal effect of C. botulinum neurotoxin type A in mice. To determine the oral lethal dose (LD.sub.100) of toxin A, groups of BALB/c mice were given different doses of toxin per unit body weight (average body weight of 24 grams). For oral administration, toxin A complex, which contains the neurotoxin associated with other non-toxin proteins was used. This complex is markedly more toxic than purified neurotoxin when given by the oral route. �I. Ohishi et al., Infect. Immun., 16:106 (1977).! C. botulinum toxin type A complex, obtained from Eric Johnson (University Of Wisconsin, Madison) was 250 .mu.g/ml in 50 mM sodium citrate, pH 5.5, specific toxicity 3.times.10.sup.7 mouse LD.sub.50 /mg with parenteral administration. Approximately 40-50 ng/gm body weight was usually fatal within 48 hours in mice maintained on conventional food and water. When mice were given a diet ad libitum of only Enfamil.RTM. the concentration needed to produce lethality was approximately 2.5 times higher (125 ng/gm body weight). Botulinal toxin concentrations of approximately 200 ng/gm body weight were fatal in mice fed Enfamil.RTM. containing preimmune IgY (resuspended in Enfamil.RTM. at the original yolk volume).
The oral LD.sub.100 of C. botulinum toxin was also determined in mice that received known amounts of a mixture of preimmune IgY-Ensure.RTM. delivered orally through feeding needles. Using a 22 gauge feeding needle, mice were given 250 .mu.l each of a preimmune IgY-Ensure.RTM. mixture (preimmune IgY dissolved in 1/4 original yolk volume) 1 hour before and 1/2 hour and 5 hours after administering botulinal toxin. Toxin concentrations given orally ranged from approximately 12 to 312 ng/gm body weight (0.3 to 7.5 .mu.g per mouse). Botulinal toxin complex concentration of approximately 40 ng/gm body weight (1 .mu.g per mouse) was lethal in all mice in less than 36 hours.
Two groups of BALB/c mice, 10 per group, were each given orally a single dose of 1 .mu.g each of botulinal toxin complex in 100 .mu.l of 50 mM sodium citrate pH 5.5. The mice received 250 .mu.l treatments of a mixture of either preimmune or immune IgY in Ensure.RTM. (1/4 original yolk volume) 1 hour before and 1/2 hour, 4 hours, and 8 hours after botulinal toxin administration. The mice received three treatments per day for two more days. The mice were observed for 96 hours. The survival and mortality are shown in Table 11.
TABLE 11______________________________________Neutralization Of Botulinal Toxin A In VivoTOXIN DOSE NUMBER OF NUMBER OFng/gm ANTIBODY TYPE MICE ALIVE MICE DEAD______________________________________41.6 non-immune 0 1041.6 anti-botulinal toxin 10 0______________________________________
All mice treated with the preimmune IgY-Ensure.RTM. mixture died within 46 hours post-toxin administration. The average time of death in the mice was 32 hours post toxin administration. Treatments of preimmune IgY-Ensure.RTM. mixture did not continue beyond 24 hours due to extensive paralysis of the mouth in mice of this group. In contrast, all ten mice treated with the immune anti-botulinal toxin IgY-Ensure.RTM. mixture survived past 96 hours. Only 4 mice in this group exhibited symptoms of botulism toxicity (two mice about 2 days after and two mice 4 days after toxin administration). These mice eventually died 5 and 6 days later. Six of the mice in this immune group displayed no adverse effects to the toxin and remained alive and healthy long term. Thus, the avian anti-botulinal toxin antibody demonstrated very good protection from the lethal effects of the toxin in the experimental mice.
EXAMPLE 7
Production Of An Avian Antitoxin Against Clostridium difficile Toxin A
Toxin A is a potent cytotoxin secreted by pathogenic strains of C. difficile, that plays a direct role in damaging gastrointestinal tissues. In more severe cases of C. dfficile intoxication, pseudomembranous colitis can develop which may be fatal. This would be prevented by neutralizing the effects of this toxin in the gastrointestinal tract. As a first step, antibodies were produced against a portion of the toxin. The example involved: (a) conjugation of a synthetic peptide of toxin A to bovine serum albumin; (b) immunization of hens with the peptide-BSA conjugate; and (c) detection of antitoxin peptide antibodies by ELISA.
a) Conjugation Of A Synthetic Peptide Of Toxin A To Bovine Serum Albumin
The synthetic peptide CQTIDGKKYYFN-NH.sub.2 (SEQ ID NO:29) was prepared commercially (Multiple Peptide Systems, San Diego, Calif.) and validated to be >80% pure by high-pressure liquid chromatography. The eleven amino acids following the cysteine residue represent a consensus sequence of a repeated amino acid sequence found in Toxin A. �Wren et al., Infect. Immun., 59:3151-3155 (1991).! The cysteine was added to facilitate conjugation to carrier protein.
In order to prepare the carrier for conjugation, BSA (Sigma) was dissolved in 0.01M NaPO.sub.4, pH 7.0 to a final concentration of 20 mg/ml and n-maleimidobenzoyl-N-hydroxysuccinimide ester (MBS; Pierce) was dissolved in N,N-dimethyl formamide to a concentration of 5 mg/ml. MBS solution, 0.51 ml, was added to 3.25 ml of the BSA solution and incubated for 30 minutes at room temperature with stirring every 5 minutes. The MBS-activated BSA was then purified by chromatography on a Bio-Gel P-10 column (Bio-Rad; 40 ml bed volume) equilibrated with 50 mM NaPO.sub.4, pH 7.0 buffer. Peak fractions were pooled (6.0 ml).
Lyophilized toxin A peptide (20 mg) was added to the activated BSA mixture, stirred until the peptide dissolved and incubated 3 hours at room temperature. Within 20 minutes, the reaction mixture became cloudy and precipitates formed. After 3 hours, the reaction mixture was centrifuged at 10,000.times.g for 10 min and the supernatant analyzed for protein content. No significant protein could be detected at 280 nm. The conjugate precipitate was washed three times with PBS and stored at 4.degree. C. A second conjugation was performed with 15 mg of activated BSA and 5 mg of peptide and the conjugates pooled and suspended at a peptide concentration of 10 mg/ml in 10 mM NaPO.sub.4, pH 7.2.
b) Immunization Of Hens With Peptide Conjugate
Two hens were each initially immunized on day zero by injection into two subcutaneous and two intramuscular sites with 1 mg of peptide conjugate that was emulsified in CFA (GIBCO). The hens were boosted on day 14 and day 21 with 1 mg of peptide conjugate emulsified in IFA (GIBCO).
C) Detection Of Antitoxin Peptide Antibodies By ELISA
IgY was purified from two eggs obtained before immunization (pre-immune) and two eggs obtained 31 and 32 days after the initial immunization using PEG fractionation as described in Example 1.
Wells of a 96-well microtiter plate (Falcon Pro-Bind Assay Plate) were coated overnight at 4.degree. C. with 100 .mu.g/ml solution of the toxin A synthetic peptide in PBS, pH 7.2 prepared by dissolving 1 mg of the peptide in 1.0 ml of H.sub.2 O and dilution of PBS. The pre-immune and immune IgY preparations were diluted in a five-fold series in a buffer containing 1% PEG 8000 and 0.1% Tween-20 (v/v) in PBS, pH 7.2. The wells were blocked for 2 hours at room temperature with 150 .mu.l of a solution containing 5% (v/v) Carnation.RTM. nonfat dry milk and 1% PEG 8000 in PBS, pH 7.2. After incubation for 2 hours at room temperature, the wells were washed, secondary rabbit anti-chicken IgG-alkaline phosphatase (1:750) added, the wells washed again and the color development obtained as described in Example 1. The results are shown in Table 12.
TABLE 12______________________________________Reactivity Of IgY With Toxin Peptide ABSORBANCE AT 410 nm IMMUNE ANTI-DILUTION OF PEG PREP PREIMMUNE PEPTIDE______________________________________1:100 0.013 0.2531:500 0.004 0.0391:2500 0.004 0.005______________________________________
Clearly, the immune antibodies contain titers against this repeated epitope of toxin A.
EXAMPLE 8
Production Of Avian Antitoxins Against Clostridium difficile Native Toxins A And B
To determine whether avian antibodies are effective for the neutralization of C. difficile toxins, hens were immunized using native C. difficile toxins A and B. The resulting egg yolk antibodies were then extracted and assessed for their ability to neutralize toxins A and B in vitro. The Example involved (a) preparation of the toxin immunogens, (b) immunization, (c) purification of the antitoxins, and (d) assay of toxin neutralization activity.
a) Preparation Of The Toxin Immunogens
Both C. difficile native toxins A and B, and C. difficile toxoids, prepared by the treatment of the native toxins with formaldehyde, were employed as immunogens. C. difficile toxoids A and B were prepared by a procedure which was modified from published methods (Ehrich et al., Infect. Immune. 28:1041 (1980). Separate solutions (in PBS) of native C. difficile toxin A and toxin B (Tech Lab) were each adjusted to a concentration of 0.20 mg/ml, and formaldehyde was added to a final concentration of 0.4%. The toxin/formaldehyde solutions were then incubated at 37.degree. C. for 40 hrs. Free formaldehyde was then removed from the resulting toxoid solutions by dialysis against PBS at 4.degree. C. In previously published reports, this dialysis step was not performed. Therefore, free formaldehyde must have been present in their toxoid preparations. The toxoid solutions were concentrated, using a Centriprep concentrator unit (Amicon), to a final toxoid concentration of 4.0 mg/ml. The two resulting preparations were designated as toxoid A and toxoid B.
C. difficile native toxins were prepared by concentrating stock solutions of toxin A and toxin B (Tech Lab, Inc), using Centriprep concentrator units (Amicon), to a final concentration of 4.0 mg/ml.
b) Immunization
The first two immunizations were performed using the toxoid A and toxoid B immunogens described above. A total of 3 different immunization combinations were employed. For the first immunization group, 0.2 ml of toxoid A was emulsified in an equal volume of Titer Max adjuvant (CytRx). Titer Max was used in order to conserve the amount of immunogen used, and to simplify the immunization procedure. This immunization group was designated "CTA." For the second immunization group, 0.1 ml of toxoid B was emulsified in an equal volume of Titer Max adjuvant. This group was designated "CTB." For the third immunization group, 0.2 ml of toxoid A was first mixed with 0.2 ml of toxoid B, and the resulting mixture was emulsified in 0.4 ml of Titer Max adjuvant. This group was designated "CTAB." In this way, three separate immunogen emulsions were prepared, with each emulsion containing a final concentration of 2.0 mg/ml of toxoid A (CTA) or toxoid B (CTB) or a mixture of 2.0 mg/ml toxoid A and 2.0 mg/ml toxoid B (CTAB).
On day 0, White Leghorn hens, obtained from a local breeder, were immunized as follows: Group CTA. Four hens were immunized, with each hen receiving 200 .mu.g of toxoid A, via two intramuscular (I.M.) injections of 50 .mu.l of CTA emulsion in the breast area. Group CTB. One hen was immunized with 200 .mu.g of toxoid B, via two I.M. injections of 50 .mu.l of CTB emulsion in the breast area. Group CTAB. Four hens were immunized, with each hen receiving a mixture containing 200 .mu.g of toxoid A and 200 .mu.g of toxoid B, via two I.M. injections of 100 .mu.l of CTAB emulsion in the breast area. The second immunization was performed 5 weeks later, on day 35, exactly as described for the first immunization above.
In order to determine whether hens previously immunized with C. difficile toxoids could tolerate subsequent booster immunizations using native toxins, a single hen from group CTAB was immunized for a third time, this time using a mixture of the native toxin A and native toxin B described in section (a) above (these toxins were not formaldehyde-treated, and were used in their active form). This was done in order to increase the amount (titer) and affinity of specific antitoxin antibody produced by the hen over that achieved by immunizing with toxoids only. On day 62, 0.1 ml of a toxin mixture was prepared which contained 200 .mu.g of native toxin A and 200 .mu.g of native toxin B. This toxin mixture was then emulsified in 0.1 ml of Titer Max adjuvant. A single CTAB hen was then immunized with the resulting immunogen emulsion, via two I.M. injections of 100 .mu.l each, into the breast area. This hen was marked with a wing band, and observed for adverse effects for a period of approximately 1 week, after which time the hen appeared to be in good health.
Because the CTAB hen described above tolerated the booster immunization with native toxins A and B with no adverse effects, it was decided to boost the remaining hens with native toxin as well. On day 70, booster immunizations were performed as follows: Group CTA. A 0.2 ml volume of the 4 mg/ml native toxin A solution was emulsified in an equal volume of Titer Max adjuvant. Each of the 4 hens was then immunized with 200 .mu.g of native toxin A, as described for the toxoid A immunizations above. Group CTB. A 50 .mu.l volume of the 4 mg/ml native toxin B solution was emulsified in an equal volume of Titer Max adjuvant. The hen was then immunized with 200 .mu.g of native toxin B, as described for the toxoid B immunizations above. Group CTAB. A 0.15 ml volume of the 4 mg/ml native toxin A solution was first mixed with a 0.15 ml volume the 4 mg/ml native toxin B solution. The resulting toxin mixture was then emulsified in 0.3 ml of Titer Max adjuvant. The 3 remaining hens (the hen with the wing band was not immunized this time) were then immunized with 200 .mu.g of native toxin A and 200 .mu.g of native toxin B as described for the toxoid A+toxoid B immunizations (CTAB) above. On day 85, all hens received a second booster immunization using native toxins, done exactly as described for the first boost with native toxins above.
All hens tolerated both booster immunizations with native toxins with no adverse effects. As previous literature references describe the use of formaldehyde-treated toxoids, this is apparently the first time that any immunizations have been performed using native C. difficile toxins.
c) Purification Of Antitoxins
Eggs were collected from the hen in group CTB 10-12 days following the second immunization with toxoid (day 35 immunization described in section (b) above), and from the hens in groups CTA and CTAB 20-21 days following the second immunization with toxoid. To be used as a pre-immune (negative) control, eggs were also collected from unimmunized hens from the same flock. Egg yolk immunoglobulin (IgY) was extracted from the 4 groups of eggs as described in Example 1(c), and the final IgY pellets were solubilized in the original yolk volume of PBS without thimerosal. Importantly, thimerosal was excluded because it would have been toxic to the CHO cells used in the toxin neutralization assays described in section (d) below.
d) Assay Of Toxin Neutralization Activity
The toxin neutralization activity of the IgY solutions prepared in section (c) above was determined using an assay system that was modified from published methods. �Ehrich et al., Infect. Immune. 28:1041-1043 (1992); and McGee et al. Microb. Path. 12:333-341 (1992).! As additional controls, affinity-purified goat anti-C. difficile toxin A (Tech Lab) and affinity-purified goat anti-C. difficile toxin B (Tech Lab) were also assayed for toxin neutralization activity.
The IgY solutions and goat antibodies were serially diluted using F12 medium (GIBCO) which was supplemented with 2% FCS (GIBCO)(this solution will be referred to as "medium" for the remainder of this Example). The resulting antibody solutions were then mixed with a standardized concentration of either native C. difficile toxin A (Tech Lab), or native C. difficile toxin B (Tech Lab), at the concentrations indicated below. Following incubation at 37.degree. C. for 60 min., 100 .mu.l volumes of the toxin+antibody mixtures were added to the wells of 96-well microtiter plates (Falcon Microtest III) which contained 2.5.times.10.sup.4 Chinese Hamster Ovary (CHO) cells per well (the CHO cells were plated on the previous day to allow them to adhere to the plate wells). The final concentration of toxin, or dilution of antibody indicated below refers to the final test concentration of each reagent present in the respective microtiter plate wells. Toxin reference wells were prepared which contained CHO cells and toxin A or toxin B at the same concentration used for the toxin plus antibody mixtures (these wells contained no antibody). Separate control wells were also prepared which contained CHO cells and medium only. The assay plates were then incubated for 18-24 hrs. in a 37.degree. C., humidified, 5% CO.sub.2 incubator. On the following day, the remaining adherent (viable) cells in the plate wells were stained using 0.2% crystal violet (Mallinckrodt) dissolved in 2% ethanol, for 10 min. Excess stain was then removed by rinsing with water, and the stained cells were solubilized by adding 100 .mu.l of 1% SDS (dissolved in water) to each well. The absorbance of each well was then measured at 570 nm, and the percent cytotoxicity of each test sample or mixture was calculated using the following formula: ##EQU1##
Unlike previous reports which quantitate results visually by counting cell rounding by microscopy, this Example utilized spectrophotometric methods to quantitate the C. difficile toxin bioassay. In order to determine the toxin A neutralizing activity of the CTA, CTAB, and pre-immune IgY preparations, as well as the affinity-purified goat antitoxin A control, dilutions of these antibodies were reacted against a 0.1 g/ml concentration of native toxin A (this is the approx. 50% cytotoxic dose of toxin A in this assay system). The results are shown in FIG. 3.
Complete neutralization of toxin A occurred with the CTA IgY (antitoxin A, above) at dilutions of 1:80 and lower, while significant neutralization occurred out to the 1:320 dilution. The CTAB IgY (antitoxin A+toxin B, above) demonstrated complete neutralization at the 1:320-1:160 and lower dilutions, and significant neutralization occurred out to the 1:1280 dilution. The commercially available affinity-purified goat antitoxin A did not completely neutralize toxin A at any of the dilutions tested, but demonstrated significant neutralization out to a dilution of 1:1,280. The preimmune IgY did not show any toxin A neutralizing activity at any of the concentrations tested. These results demonstrate that IgY purified from eggs laid by hens immunized with toxin A alone, or simultaneously with toxin A and toxin B, is an effective toxin A antitoxin.
The toxin B neutralizing activity of the CTAB and pre-immune IgY preparations, and also the affinity-purified goat antitoxin B control was determined by reacting dilutions of these antibodies against a concentration of native toxin B of 0.1 ng/ml (approximately the 50% cytotoxic dose of toxin B in the assay system). The results are shown in FIG. 4.
Complete neutralization of toxin B occurred with the CTAB IgY (antitoxin A+toxin B, above) at the 1:40 and lower dilutions, and significant neutralization occurred out to the 1:320 dilution. The affinity-purified goat antitoxin B demonstrated complete neutralization at dilutions of 1:640 and lower, and significant neutralization occurred out to a dilution of 1:2,560. The preimmune IgY did not show any toxin B neutralizing activity at any of the concentrations tested. These results demonstrate that IgY purified from eggs laid by hens immunized simultaneously with toxin A and toxin B is an effective toxin B antitoxin.
In a separate study, the toxin B neutralizing activity of CTB, CTAB, and pre-immune IgY preparations was determined by reacting dilutions of these antibodies against a native toxin B concentration of 0.1 .mu.g/ml (approximately 100% cytotoxic dose of toxin B in this assay system). The results are shown in FIG. 5.
Significant neutralization of toxin B occurred with the CTB IgY (antitoxin B, above) at dilutions of 1:80 and lower, while the CTAB IgY (antitoxin A+toxin B, above) was found to have significant neutralizing activity at dilutions of 1:40 and lower. The preimmune IgY did not show any toxin B neutralizing activity at any of the concentrations tested. These results demonstrate that IgY purified from eggs laid by hens immunized with toxin B alone, or simultaneously with toxin A and toxin B, is an effective toxin B antitoxin.
EXAMPLE 9
In vivo Protection Of Golden Syrian Hamsters From C. difficile Disease By Avian Antitoxins Against C. difficile Toxins A And B
The most extensively used animal model to study C. difficile disease is the hamster. �Lyerly et al., Infect. Immune. 47:349-352 (1992).! Several other animal models for antibiotic-induced diarrhea exist, but none mimic the human form of the disease as closely as the hamster model. �R. Fekety, "Animal Models of Antibiotic-Induced Colitis," in O. Zak and M. Sande (eds.), Experimental Models in Antimicrobial Chemotherapy, Vol. 2, pp.61-72, (1986).! In this model, the animals are first predisposed to the disease by the oral administration of an antibiotic, such as clindamycin, which alters the population of normally-occurring gastrointestinal flora (Fekety, at 61-72). Following the oral challenge of these animals with viable C. difficile organisms, the hamsters develop cecitis, and hemorrhage, ulceration, and inflammation are evident in the intestinal mucosa. �Lyerly et al., Infect. Immune. 47:349-352 (1985).! The animals become lethargic, develop severe diarrhea, and a high percentage of them die from the disease. �Lyerly et al., Infect. Immune. 47:349-352 (1985).! This model is therefore ideally suited for the evaluation of therapeutic agents designed for the treatment or prophylaxis of C. difficile disease.
The ability of the avian C. difficile antitoxins, described in Example 1 above, to protect hamsters from C. difficile disease was evaluated using the Golden Syrian hamster model of C. difficile infection. The Example involved (a) preparation of the avian C. difficile antitoxins, (b) in vivo protection of hamsters from C. difficile disease by treatment with avian antitoxins, and (c) long-term survival of treated hamsters.
a) Preparation Of The Avian C. difficile Antitoxins
Eggs were collected from hens in groups CTA and CTAB described in Example 1(b) above. To be used as a pre-immune (negative) control, eggs were also purchased from a local supermarket. Egg yolk immunoglobulin (IgY) was extracted from the 3 groups of eggs as described in Example 1(c), and the final IgY pellets were solubilized in one fourth the original yolk volume of Ensure.RTM. nutritional formula.
b) In vivo Protection Of Hamsters Against C. difficile Disease By Treatment With Avian Antitoxins
The avian C. difficile antitoxins prepared in section (a) above were evaluated for their ability to protect hamsters from C. difficile disease using an animal model system which was modified from published procedures. �Fekety, at 61-72; Borriello et al., J. Med. Microbiol., 24:53-64 (1987); Kim et al., Infect. Immune., 55:2984-2992 (1987); Borriello et al., J. Med. Microbiol., 25:191-196 (1988); Delmee and Avesani, J. Med. Microbiol., 33:85-90 (1990); and Lyerly et al., Infect. Immune., 59:2215-2218 (1991).! For the study, three separate experimental groups were used, with each group consisting of 7 female Golden Syrian hamsters (Charles River), approximately 10 weeks old and weighing approximately 100 gms. each. The three groups were designated "CTA," "CTAB" and "Pre-immune." These designations corresponded to the antitoxin preparations with which the animals in each group were treated. Each animal was housed in an individual cage, and was offered food and water ad libitum through the entire length of the study. On day 1, each animal was orally administered 1.0 ml of one of the three antitoxin preparations (prepared in section (a) above) at the following timepoints: 0 hrs., 4 hrs., and 8 hrs. On day 2, the day 1 treatment was repeated. On day 3, at the 0 hr. timepoint, each animal was again administered antitoxin, as described above. At 1 hr., each animal was orally administered 3.0 mg of clindamycin-HCl (Sigma) in 1 ml of water. This treatment predisposed the animals to infection with C. difficile. As a control for possible endogenous C. difficile colonization, an additional animal from the same shipment (untreated) was also administered 3.0 mg of clindamycin-HCl in the same manner. This clindamycin control animal was left untreated (and uninfected) for the remainder of the study. At the 4 hr. and 8 hr. timepoints, the animals were administered antitoxin as described above. On day 4, at the 0 hr. timepoint, each animal was again administered antitoxin as described above. At 1 hr., each animal was orally challenged with 1 ml of C. difficile inoculum, which contained approx. 100 C. difficile strain 43596 organisms in sterile saline. C. difficile strain 43596, which is a serogroup C strain, was chosen because it is representative of one of the most frequently-occurring serogroups isolated from patients with antibiotic-associated pseudomembranous colitis. �Delmee et al., J. Clin. Microbiol., 28:2210-2214 (1985).! In addition, this strain has been previously demonstrated to be virulent in the hamster model of infection. �Delmee and Avesani, J. Med. Microbiol., 33:85-90 (1990).! At the 4 hr. and 8 hr. timepoints, the animals were administered antitoxin as described above. On days 5 through 13, the animals were administered antitoxin 3.times. per day as described for day 1 above, and observed for the onset of diarrhea and death. On the morning of day 14, the final results of the study were tabulated. These results are shown in Table 13.
Representative animals from those that died in the Pre-Immune and CTA groups were necropsied. Viable C. difficile organisms were cultured from the ceca of these animals, and the gross pathology of the gastrointestinal tracts of these animals was consistent with that expected for C. difficile disease (inflamed, distended, hemorrhagic cecum, filled with watery diarrhea-like material). In addition, the
TABLE 13______________________________________Treatment Results No. AnimalsTreatment Group Surviving No. Animals Dead______________________________________Pre-Immune 1 6CTA (Antitoxin A only) 5 2CTAB (Antitoxin A + Antitoxin B) 7 0______________________________________
clindamycin control animal remained healthy throughout the entire study period, therefore indicating that the hamsters used in the study had not previously been colonized with endogenous C. difficile organisms prior to the start of the study. Following the final antitoxin treatment on day 13, a single surviving animal from the CTA group, and also from the CTAB group, was sacrificed and necropsied. No pathology was noted in either animal.
Treatment of hamsters with orally-administered toxin A and toxin B antitoxin (group CTAB) successfully protected 7 out of 7 (100%) of the animals from C. difficile disease. Treatment of hamsters with orally-administered toxin A antitoxin (group CTA) protected 5 out of 7 (71%) of these animals from C. difficile disease. Treatment using pre-immune IgY was not protective against C. difficile disease, as only 1 out of 7 (14%) of these animals survived. These results demonstrate that the avian toxin A antitoxin and the avian toxin A+toxin B antitoxin effectively protected the hamsters from C. difficile disease. These results also suggest that although the neutralization of toxin A alone confers some degree of protection against C. difficile disease, in order to achieve maximal protection, simultaneous antitoxin A and antitoxin B activity is necessary.
c) Long-Term Survival Of Treated Hamsters
It has been previously reported in the literature that hamsters treated with orally-administered bovine antitoxin IgG concentrate are protected from C. difficile disease as long as the treatment is continued, but when the treatment is stopped, the animals develop diarrhea and subsequently die within 72 hrs. �Lyerly et al., Infect. Immune., 59(6):2215-2218 (1991).!
In order to determine whether treatment of C. difficile disease using avian antitoxins promotes long-term survival following the discontinuation of treatment, the 4 surviving animals in group CTA, and the 6 surviving animals in group CTAB were observed for a period of 11 days (264 hrs.) following the discontinuation of antitoxin treatment described in section (b) above. All hamsters remained healthy through the entire post-treatment period. This result demonstrates that not only does treatment with avian antitoxin protect against the onset of C. difficile disease (i.e., it is effective as a prophylactic), it also promotes long-term survival beyond the treatment period, and thus provides a lasting cure.
EXAMPLE 10
In vivo Treatment Of Established C. difficile Infection In Golden Syrian Hamsters With Avian Antitoxins Against C. difficile Toxins A And B
The ability of the avian C. difficile antitoxins, described in Example 8 above, to treat an established C. difficile infection was evaluated using the Golden Syrian hamster model. The Example involved (a) preparation of the avian C. difficile antitoxins, (b) in vivo treatment of hamsters with established C. difficile infection, and (c) histologic evaluation of cecal tissue.
a) Preparations Of The Avian C. difficile Antitoxins
Eggs were collected from hens in group CTAB described in Example 8(b) above, which were immunized with C. difficile toxoids and native toxins A and B. Eggs purchased from a local supermarket were used as a pre-immune (negative) control. Egg yolk immunoglobulin (IgY) was extracted from the 2 groups of eggs as described in Example 1(c), and the final IgY pellets were solubilized in one-fourth the original yolk volume of Ensure.RTM. nutritional formula.
b) In vivo Treatment Of Hamsters With Establised C. difficile Infection
The avian C. difficile antitoxins prepared in section (a) above were evaluated for the ability to treat established C. difficile infection in hamsters using an animal model system which was modified from the procedure which was described for the hamster protection study in Example 8(b) above.
For the study, four separate experimental groups were used, with each group consisting of 7 female Golden Syrian hamsters (Charles River), approx. 10 weeks old, weighing approximately 100 gms. each. Each animal was housed separately, and was offered food and water ad libitum through the entire length of the study.
On day 1 of the study, the animals in all four groups were each predisposed to C. difficile infection by the oral administration of 3.0 mg of clindamycin-HCl (Sigma) in 1 ml of water.
On day 2, each animal in all four groups was orally challenged with 1 ml of C. difficile inoculum, which contained approximately 100 C. difficile strain 43596 organisms in sterile saline. C. difficile strain 43596 was chosen because it is representative of one of the most frequently-occurring serogroups isolated from patients with antibiotic-associated pseudomembranous colitis. �Delmee et al., J. Clin. Microbiol., 28:2210-2214 (1990).! In addition, as this was the same C. difficile strain used in all of the previous Examples above, it was again used in order to provide experimental continuity.
On day 3 of the study (24 hrs. post-infection), treatment was started for two of the four groups of animals. Each animal of one group was orally administered 1.0 ml of the CTAB IgY preparation (prepared in section (a) above) at the following timepoints: 0 hrs., 4 hrs., and 8 hrs. The animals in this group were designated "CTAB-24." The animals in the second group were each orally administered 1.0 ml of the pre-immune IgY preparation (also prepared in section (a) above) at the same timepoints as for the CTAB group. These animals were designated "Pre-24." Nothing was done to the remaining two groups of animals on day 3.
On day 4, 48 hrs. post-infection, the treatment described for day 3 above was repeated for the CTAB-24 and Pre-24 groups, and was initiated for the remaining two groups at the same timepoints. The final two groups of animals were designated "CTAB-48" and "Pre-48" respectively.
On days 5 through 9, the animals in all four groups were administered antitoxin or pre-immune IgY, 3.times. per day, as described for day 4 above. The four experimental groups are summarized in Table 14.
TABLE 14______________________________________Experimental Treatment GroupsGroup Designation Experimental Treatment______________________________________CTAB-24 Infected, treatment w/antitoxin IgY started @ 24 hrs. post-infection.Pre-24 Infected, treatment w/pre-immune IgY started @ 24 hrs. post-infection.CTAB-48 Infected, treatment w/antitoxin IgY started @ 48 hrs. post-infection.Pre-48 Infected, treatment w/pre-immune IgY started @ 48 hrs. post-infection.______________________________________
All animals were observed for the onset of diarrhea and death through the conclusion of the study on the morning of day 10. The results of this study are displayed in Table 15.
Eighty-six percent of the animals which began receiving treatment with antitoxin IgY at 24 hrs. post-infection (CTAB-24 above) survived, while 57% of the animals treated with antitoxin IgY starting 48 hrs. post-infection (CTAB-48 above) survived. In contrast, none of the animals receiving pre-immune IgY starting 24 hrs. post-infection (Pre-24 above) survived, and only 29% of the animals which began receiving treatment with pre-immune IgY at 48 hrs. post-infection (Pre-48 above) survived through the conclusion of the study. These results demonstrate that avian antitoxins raised against C. difficile toxins A and B are capable of successfully treating established C. difficile infections in vivo.
TABLE 15______________________________________Experimental Outcome--Day 10Treatment Group No. Animals Surviving No. Animals Dead______________________________________CTAB-24 6 1Pre-24 0 7CTAB-48 4 3Pre-48 2 5______________________________________
c) Histologic Evaluation Of Cecal Tissue
In order to further evaluate the ability of the IgY preparations tested in this study to treat established C. difficile infection, histologic evaluations were performed on cecal tissue specimens obtained from representative animals from the study described in section (b) above.
Immediately following death, cecal tissue specimens were removed from animals which died in the Pre-24 and Pre-48 groups. Following the completion of the study, a representative surviving animal was sacrificed and cecal tissue specimens were removed from the CTAB-24 and CTAB-48 groups. A single untreated animal from the same shipment as those used in the study was also sacrificed and a cecal tissue specimen was removed as a normal control. All tissue specimens were fixed overnight at 4.degree. C. in 10% buffered formalin. The fixed tissues were paraffin-embedded, sectioned, and mounted on glass microscope slides. The tissue sections were then stained using hematoxylin and eosin (H and E stain), and were examined by light microscopy.
Upon examination, the tissues obtained from the CTAB-24 and CTAB-48 animals showed no pathology, and were indistinguishable from the normal control. This observation provides further evidence for the ability of avian antitoxins raised against C. difficile toxins A and B to effectively treat established C. difficile infection, and to prevent the pathologic consequences which normally occur as a result of C. difficile disease.
In contrast, characteristic substantial mucosal damage and destruction was observed in the tissues of the animals from the Pre-24 and Pre-48 groups which died from C. difficile disease. Normal tissue architecture was obliterated in these two preparations, as most of the mucosal layer was observed to have sloughed away, and there were numerous large hemorrhagic areas containing massive numbers of erythrocytes.
EXAMPLE 11
Cloning And Expression Of C. difficile Toxin A Fragments
The toxin A gene has been cloned and sequenced, and shown to encode a protein of predicted MW of 308 kd. �Dove et al., Infect. Immune., 58:480-488 (1990).! Given the expense and difficulty of isolating native toxin A protein, it would be advantageous to use simple and inexpensive procaryotic expression systems to produce and purify high levels of recombinant toxin A protein for immunization purposes. Ideally, the isolated recombinant protein would be soluble in order to preserve native antigenicity, since solubilized inclusion body proteins often do not fold into native conformations. To allow ease of purification, the recombinant protein should be expressed to levels greater than 1 mg/liter of E. coli culture.
To determine whether high levels of recombinant toxin A protein can be produced in E. coli, fragments of the toxin A gene were cloned into various prokaryotic expression vectors, and assessed for the ability to express recombinant toxin A protein in E. coli. Three prokaryotic expression systems were utilized. These systems were chosen because they drive expression of either fusion (pMALc and pGEX2T) or native (pET23a-c) protein to high levels in E. coli, and allow affinity purification of the expressed protein on a ligand containing column. Fusion proteins expressed from pGEX vectors bind glutathione agarose beads, and are eluted with reduced glutathione. pMAL fusion proteins bind amylose resin, and are eluted with maltose. A poly-histidine tag is present at either the N-terminal (pET16b) or C-terminal (pET23a-c) end of pET fusion proteins. This sequence specifically binds Ni.sub.2.sup.+ chelate columns, and is eluted with imidazole salts. Extensive descriptions of these vectors are available (Williams et al. (1994) DNA Cloning: Expression Systems, in press), and will not be discussed in detail here. The Example involved (a) cloning of the toxin A gene, (b) expression of large fragments of toxin A in various prokaryotic expression systems, (c) identification of smaller toxin A gene fragments that express efficiently in E. coli, (d) purification of recombinant toxin A protein by affinity chromatography, and (e) demonstration of functional activity of a recombinant fragment of the toxin A gene.
a) Cloning Of The Toxin A Gene
A restriction map of the toxin A gene is shown in FIG. 6. The encoded protein contains a carboxy terminal ligand binding region, containing multiple repeats of a carbohydrate binding domain. �von Eichel-Streiber and Sauerbom, Gene 96:107-113 (1990).! The toxin A gene was cloned in three pieces, by using either the polymerase chain reaction (PCR) to amplify specific regions, (regions 1 and 2, FIG. 6) or by screening a constructed genomic library for a specific toxin A gene fragment (region 3, FIG. 6). The sequences of the utilized PCR primers are P1: 5' GGAAATT TAGCTGCAGCATCTGAC 3' (SEQ ID NO.: 1); P2: 5' TCTAGCAAATTCGCTTGT GTTGAA 3' (SEQ ID NO.:2); P3: 5' CTCGCATATAGCATTAGACC 3' (SEQ ID NO.:3); and P4: 5' CTATCTAGGCCTAAAGTAT 3' (SEQ ID NO.:4). These regions were cloned into prokaryotic expression vectors that express either fusion (pMALc and pGEX2T) or native (pET23a-c) protein to high levels in E. coli, and allow affinity purification of the expressed protein on a ligand containing column.
Clostridium difficile VPI strain 10463 was obtained from the ATCC (ATCC #43255) and grown under anaerobic conditions in brain-heart infusion medium (BBL). High molecular-weight C. difficile DNA was isolated essentially as described by Wren and Tabaqchali (1987) J. Clin. Microbiol., 25:2402, except proteinase K and sodium dodecyl sulfate (SDS) was used to disrupt the bacteria, and cetyltrimethylammonium bromide precipitation �as described in Ausubel et al., Current Protocols in Molecular Biology (1989)! was used to remove carbohydrates from the cleared lysate. The integrity and yield of genomic DNA was assessed by comparison with a serial dilution of uncut lambda DNA after electrophoresis on an agarose gel.
Fragments 1 and 2 were cloned by PCR, utilizing a proofreading thermostable DNA polymerase (native pfu polymerase; Stratagene). The high fidelity of this polymerase reduces the mutation problems associated with amplification by error prone polymerases (e.g., Taq polymerase). PCR amplification was performed using the indicated PCR primers (FIG. 6) in 50 .mu.l reactions containing 10 mM Tris-HCl(8.3), 50 mM KCl, 1.5 mM MgCl.sub.2, 200 .mu.M each dNTP, 0.2 .mu.M each primer, and 50 ng C. difficile genomic DNA. Reactions were overlaid with 100 .mu.l mineral oil, heated to 94.degree. C. for 4 min, 0.5 .mu.l native pfu polymerase (Stratagene) added, and the reaction cycled 30.times. at 94.degree. C. for 1 min, 50.degree. C. for 1 min, 72.degree. C. for 4 min, followed by 10 at 72.degree. C. Duplicate reactions were pooled, chloroform extracted, and ethanol precipitated. After washing in 70% ethanol, the pellets were resuspended in 50 .mu.l TE buffer �10 mM Tris-HCL, 1 mM EDTA pH 8.0!. Aliquots of 10 .mu.l each were restriction digested with either EcoRI/HincII (fragment 1) or EcoRI/PstI (fragment 2), and the appropriate restriction fragments were gel purified using the Prep-A-Gene kit (BioRad), and ligated to either EcoRI/SmaI-restricted pGEX2T (Pharmacia) vector (fragment 1), or the EcoRI/PstI pMAlc (New England Biolabs) vector (fragment 2). Both clones are predicted to produce in-frame fusions with either the glutathione-S-transferase protein (PGEX vector) or the maltose binding protein (pMAL vector). Recombinant clones were isolated, and confirmed by restriction digestion, using standard recombinant molecular biology techniques. �Sambrook et al., Molecular Cloning, A Laboratory Manual (1989), and designated pGA30-660 and pMA660-1100, respectively (see FIG. 6 for description of the clone designations).!
Fragment 3 was cloned from a genomic library of size selected PstI digested C. difficile genomic DNA, using standard molecular biology techniques (Sambrook et al.). Given that the fragment 3 internal PstI site is protected from cleavage in C. difficile genomic DNA �Price et al., Curr. Microbiol., 16:55-60 (1987)!, a 4.7 kb fragment from PstI restricted C. difficile genomic DNA was gel purified, and ligated to PstI restricted, phosphatase treated pUC9 DNA. The resulting genomic library was screened with a oligonucleotide primer specific to fragment 3, and multiple independent clones were isolated. The presence of fragment 3 in several of these clones was confirmed by restriction digestion, and a clone of the indicated orientation (FIG. 6) was restricted with BamHI/HindIII, the released fragment purified by gel electrophoresis, and ligated into similarly restricted pET23c expression vector DNA (Novagen). Recombinant clones were isolated, and confirmed by restriction digestion. This construct is predicted to create both a predicted in frame fusion with the pET protein leader sequence, as well as a predicted C-terminal poly-histidine affinity tag, and is designated pPA1100-2680 (see FIG. 6 for the clone designation).
b) Expression Of Large Fragments Of Toxin A In E. coli
Protein expression from the three expression constructs made in (a) was induced, and analyzed by Western blot analysis with an affinity purified, goat polyclonal antiserum directed against the toxin A toxoid (Tech Lab). The procedures utilized for protein induction, SDS-PAGE, and Western blot analysis are described in detail in Williams et al (1994), supra. In brief, 5 ml 2.times. YT (16 g tryptone, 10 g yeast extract, 5 g NaCl per liter, pH 7.5+100 .mu.g/ml ampicillin were added to cultures of bacteria (BL21 for pMAl and pGEX plasmids, and BL21(DE3)LysS for pET plasmids) containing the appropriate recombinant clone which were induced to express recombinant protein by addition of IPTG to 1 mM. Cultures were grown at 37.degree. C., and induced when the cell density reached 0.5 OD.sub.600. Induced protein was allowed to accumulate for two hrs after induction. Protein samples were prepared by pelleting 1 ml aliquots of bacteria by centrifugation (1 min in a microfuge), and resuspension of the pelleted bacteria in 150 .mu.l of 2.times. SDS-PAGE sample buffer �Williams et al. (1994), supra!. The samples were heated to 95.degree. C. for 5 min, the cooled and 5 or 10 .mu.l aliquots loaded on 7.5% SDS-PAGE gels. BioRad high molecular weight protein markers were also loaded, to allow estimation of the MW of identified fusion proteins. After electrophoresis, protein was detected either generally by staining gels with Coomassie blue, or specifically, by blotting to nitrocellulose for Western blot detection of specific immunoreactive protein. Western blots, (performed as described in Example 3) which detect toxin A reactive protein in cell lysates of induced protein from the three expression constructs are shown in FIG. 7. In this figure, lanes 1-3 contain cell lysates prepared from E. coli strains containing pPA1100-2860 in B121(DE3)lysE cells; lanes 4-6 contain cell lysates prepared from E. coli strains containing pPA1100-2860 in B121(DE3)lysS cells; lanes 7-9 contain cell lysates prepared from E. coli strains containing pMA30-660; lanes 10-12 contain cell lysates prepared from E. coli strains containing pMA660-1100. The lanes were probed with an affinity purified goat antitoxin A polyclonal antibody (Tech Lab). Control lysates from uninduced cells (lanes 1, 7, and 10) contain very little immunoreactive material compared to the induced samples in the remaining lanes. The highest molecular weight band observed for each clone is consistent with the predicted size of the full length fusion protein.
Each construct directs expression of high molecular weight (HMW) protein that is reactive with the toxin A antibody. The size of the largest immunoreactive bands from each sample is consistent with predictions of the estimated MW of the intact fusion proteins. This demonstrates that the three fusions are in-frame, and that none of the clones contain cloning artifacts that disrupt the integrity of the encoded fusion protein. However, the Western blot demonstrates that fusion protein from the two larger constructs (pGA30-660 and pPA1100-2680) are highly degraded. Also, expression levels of toxin A proteins from these two constructs are low, since induced protein bands are not visible by Coomassie staining (not shown). Several other expression constructs that fuse large sub-regions of the toxin A gene to either pMALc or pET23a-c expression vectors, were constructed and tested for protein induction. These constructs were made by mixing gel purified restriction fragments, derived from the expression constructs shown in FIG. 6, with appropriately cleaved expression vectors, ligating, and selecting recombinant clones in which the toxin A restriction fragments had ligated together and into the expression vector as predicted for in-frame fusions. The expressed toxin A interval within these constructs are shown in FIG. 8, as well as the internal restriction sites utilized to make these constructs.
As used herein, the term "interval" refers to any portion (i.e., any segment of the toxin which is less than the whole toxin molecule) of a clostridial toxin. In a preferred embodiment, "interval" refers to portions of C. difficile toxins such as toxin A or toxin B. It is also contemplated that these intervals will correspond to epitopes of immunologic importance, such as antigens or immunogens against which a neutralizing antibody response is effected. It is not intended that the present invention be limited to the particular intervals or sequences described in these Examples. It is also contemplated that sub-portions of intervals (e.g., an epitope contained within one interval or which bridges multiple intervals) be used as compositions and in the methods of the present invention.
In all cases, Western blot analysis of each of these constructs with goat antitoxin A antibody (Tech Lab) detected HMW fusion protein of the predicted size (not shown). This confirms that the reading frame of each of these clones is not prematurely terminated, and is fused in the correct frame with the fusion partner. However, the Western blot analysis revealed that in all cases, the induced protein is highly degraded, and, as assessed by the absence of identifiable induced protein bands by Coomassie Blue staining, are expressed only at low levels. These results suggest that expression of high levels of intact toxin A recombinant protein is not possible when large regions of the toxin A gene are expressed in E. coli using these expression vectors.
c) High Level Expresstion Of Small Toxin A Protein Fusions In E. coli
Experience indicates that expression difficulties are often encountered when large (greater than 100 kd) fragments are expressed in E. coli. A number of expression constructs containing smaller fragments of the toxin A gene were constructed, to determine if small regions of the gene can be expressed to high levels without extensive protein degradation. A summary of these expression constructs are shown in FIG. 9. All were constructed by in-frame fusions of convenient toxin A restriction fragments to either the pMALc or pET23a-c vectors. Protein preparations from induced cultures of each of these constructs were analyzed by both Coomassie Blue staining and Western analysis as in (b) above. In all cases, higher levels of intact, full length fusion proteins were observed than with the larger recombinants from section (b).
d) Purification Of Recombinant Toxin A Protien
Large scale (500 ml) cultures of each recombinant from (c) were grown, induced, and soluble and insoluble protein fractions were isolated. The soluble protein extracts were affinity chromatographed to isolate recombinant fusion protein, as described �Williams et al. (1994), supra!. In brief, extracts containing tagged pET fusions were chromatographed on a nickel chelate column, and eluted using imidazole salts as described by the distributor (Novagen). Extracts containing soluble pMAL fusion protein were prepared and chromatographed in column buffer (10 mM NaPO.sub.4, 0.5M NaCl, 10 mM .beta.-mercaptoethanol, pH 7.2) over an amylose resin column (New England Biolabs), and eluted with column buffer containing 10 mM maltose as described �Williams et al. (1994), supra!. When the expressed protein was found to be predominantly insoluble, insoluble protein extracts were prepared by the method described in Example 17, infra. The results are summarized in Table 16. FIG. 10 shows the sample purifications of recombinant toxin A protein. In this figure, lanes 1 and 2 contain MBP fusion protein purified by affinity purification of soluble protein.
TABLE 16______________________________________Purification Of Recombinant Toxin A Protein Yield Affinity % Intact Purified Soluble Yield Intact Protein Soluble Fusion InsolubleClone.sup.(a) Solubility Protein.sup.(b) Protein.sup.(c) Fusion Protein______________________________________pMA30-270 Soluble 4 mg/500 mls 10% NApMA30-300 Soluble 4 mg/500 mls 5-10% NApMA300-660 Insoluble -- NA 10 mg/500 mlpMA660-1100 Soluble 4.5 mg/500 50% NA mlspMA100- Soluble 18 mg/500 mls 10% NA1610pMA1610 Both 22 mg/500 mls 90% 20 mg/500 ml1870pMA1450- Insoluble -- NA 0.2 mg/500 ml1870pPA1100- Soluble 0.1 mg/500 90% NA1450 mlspPA1100- Soluble 0.02 mg/500 90% NA1870 mlspMA1870- Both 12 mg/500 mls 80% NA2680pPa1870-2680 Insoluble -- NA 10 mg/500 ml______________________________________ .sup.(a) pP = pET23 vector, pM = pMALc vector, A = toxin A. .sup.(b) Based on 1.5 OD.sub.280 = 1 mg/ml (extinction coefficient of MBP). .sup.(c) Estimated by Coomassie staining of SDSPAGE gels.
Lanes 3 and 4 contain MBP fusion protein purified by solubilization of insoluble inclusion bodies. The purified fusion protein samples are pMA1870-2680 (lane 1), pMA660-1100 (lane 2), pMA300-600 (lane 3) and pMA1450-1870 (lane 4).
Poor yields of affinity purified protein were obtained when poly-histidine tagged pET vectors were used to drive expression (pPA1100-1450, pP100-1870). However, significant protein yields were obtained from pMAL expression constructs spanning the entire toxin A gene, and yields of full-length soluble fusion protein ranged from an estimated 200-400 .mu.g/500 ml culture (pMA30-300) to greater than 20 mg/500 ml culture (pMA1610-1870). Only one interval was expressed to high levels as strictly insoluble protein (pMA300-660). Thus, although high level expression was not observed when using large expression constructs from the toxin A gene, usable levels of recombinant protein spanning the entire toxin A gene were obtainable by isolating induced protein from a series of smaller pMAL expression constructs that span the entire toxin A gene. This is the first demonstration of the feasibility of expressing recombinant toxin A protein to high levels in E. coli.
e) Hemagglutination Assay Using The Toxin A Rcombinant Proteins
The carboxy terminal end consisting of the repeating units contains the hemagglutination activity or binding domain of C. difficile toxin A. To determine whether the expressed toxin A recombinants retain functional activity, hemagglutination assays were performed. Two toxin A recombinant proteins, one containing the binding domain as either soluble affinity purified protein (pMA1870-2680) or SDS solubilized inclusion body protein (pPA1870-2680) and soluble protein from one region outside that domain (pMA1100-1610) were tested using a described procedure. �H. C. Krivan et. al., Infect. Immune., 53:573 (1986).! Citrated rabbit red blood cells (RRBC)(Cocalico) were washed several times with Tris-buffer (0.1M Tris and 50 mM NaCl) by centrifugation at 450.times.g for 10 minutes at 4.degree. C. A 1% RRBC suspension was made from the packed cells and resuspended in Tris-buffer. Dilutions of the recombinant proteins and native toxin A (Tech Labs) were made in the Tris-buffer and added in duplicate to a round-bottomed 96-well microtiter plate in a final volume of 100 .mu.l. To each well, 50 .mu.l of the 1% RRBC suspension was added, mixed by gentle tapping, and incubated at 4.degree. C. for 3-4 hours. Significant hemagglutination occurred only in the recombinant proteins containing the binding domain (pMA 1870-2680) and native toxin A. The recombinant protein outside the binding domain (pMA 1100-1610) displayed no hemagglutination activity. Using equivalent protein concentrations, the hemagglutination titer for toxin A was 1:256, while titers for the soluble and insoluble recombinant proteins of the binding domain were 1:256 and about 1:5000. Clearly, the recombinant proteins tested retained functional activity and were able to bind RRBC's.
EXAMPLE 12
Functional Activity Of IgY Reactive Against Toxin A Recombinants
The expression of recombinant toxin A protein as multiple fragments in E.coli has demonstrated the feasibility of generating toxin A antigen through use of recombinant methodologies (Example 11). The isolation of these recombinant proteins allows the immunoreactivity of each individual subregion of the toxin A protein to be determined (i.e., in a antibody pool directed against the native toxin A protein). This identifies the regions (if any) for which little or no antibody response is elicited when the whole protein is used as a immunogen. Antibodies directed against specific fragments of the toxin A protein can be purified by affinity chromatography against recombinant toxin A protein, and tested for neutralization ability. This identifies any toxin A subregions that are essential for producing neutralizing antibodies. Comparison with the levels of immune response directed against these intervals when native toxin is used as an immunogen predicts whether potentially higher titers of neutralizing antibodies can be produced by using recombinant protein directed against a individual region, rather than the entire protein. Finally, since it is unknown whether antibodies reactive to the recombinant toxin A proteins produced in Example 11 neutralize toxin A as effectively as antibodies raised against native toxin A (Examples 9 and 10), the protective ability of a pool of antibodies affinity purified against recombinant toxin A fragments was assessed for its ability to neutralize toxin A.
This Example involved (a) epitope mapping of the toxin A protein to determine the titre of specific antibodies directed against individual subregions of the toxin A protein when native toxin A protein is used as an immunogen, (b) affinity purification of IgY reactive against recombinant proteins spanning the toxin A gene, (c) toxin A neutralization assays with affinity purified IgY reactive to recombinant toxin A protein to identify subregions of the toxin A protein that induce the production of neutralizing antibodies, and determination of whether complete neutralization of toxin A can be elicited with a mixture of antibodies reactive to recombinant toxin A protein.
a) Epitope Mapping Of The Toxin A Gene
The affinity purification of recombinant toxin A protein specific to defined intervals of the toxin A protein allows epitope mapping of antibody pools directed against native toxin A. This has not previously been possible, since previous expression of toxin A recombinants has been assessed only by Western blot analysis, without knowledge of the expression levels of the protein �e.g., von Eichel-Streiber et al, J. Gen. Microbiol., 135:55-64 (1989)!. Thus, high or low reactivity of recombinant toxin A protein on Western blots may reflect protein expression level differences, not immunoreactivity differences. Given that the purified recombinant protein generated in Example 11 have been quantitated, the issue of relative immunoreactivity of individual regions of the toxin A protein was precisely addressed.
For the purposes of this Example, the toxin A protein was subdivided into 6 intervals (1-6), numbered from the amino (interval 1) to the carboxyl (interval 6) termini.
The recombinant proteins corresponding to these intervals were from expression clones (see Example 11(d) for clone designations) pMA30-300 (interval 1), pMA300-660 (interval 2), pMA660-1100 (interval 3), pPA1100-1450 (interval 4), pMA1450-1870 (interval 5) and pMA1870-2680 (interval 6). These 6 clones were selected because they span the entire protein from amino acids numbered 30 through 2680, and subdivide the protein into 6 small intervals. Also, the carbohydrate binding repeat interval is contained specifically in one interval (interval 6), allowing evaluation of the immune response specifically directed against this region. Western blots of 7.5% SDS-PAGE gels, loaded and electrophoresed with defined quantities of each recombinant protein, were probed with either goat antitoxin A polyclonal antibody (Tech Lab) or chicken antitoxin A polyclonal antibody �pCTA IgY, Example 8(c)!. The blots were prepared and developed with alkaline phosphatase as previously described �Williams et al. (1994), supra!. At least 90% of all reactivity, in either goat or chicken antibody pools, was found to be directed against the ligand binding domain (interval 6). The remaining immunoreactivity was directed against all five remaining intervals, and was similar in both antibody pools, except that the chicken antibody showed a much lower reactivity against interval 2 than the goat antibody.
This clearly demonstrates that when native toxin A is used as an immunogen in goats or chickens, the bulk of the immune response is directed against the ligand binding domain of the protein, with the remaining response distributed throughout the remaining 2/3 of the protein.
b) Affinity Purification Of IgY Reactive Against Recombialnt Toxin A Protein
Affinity columns, containing recombinant toxin A protein from the 6 defined intervals in (a) above, were made and used to (i) affinity purify antibodies reactive to each individual interval from the CTA IgY preparation �Example 8(c)!, and (ii) deplete interval specific antibodies from the CTA IgY preparation. Affinity columns were made by coupling 1 ml of PBS-washed Actigel resin (Sterogene) with region specific protein and 1/10 final volume of Ald-coupling solution (1M sodium cyanoborohydride). The total region specific protein added to each reaction mixture was 2.7 mg (interval 1), 3 mg (intervals 2 and 3), 0.1 mg (interval 4), 0.2 mg (interval 5) and 4 mg (interval 6). Protein for intervals 1, 3, and 6 was affinity purified pMA1 fusion protein in column buffer (see Example 11). Interval 4 was affinity purified poly-histidine containing pET fusion in PBS; intervals 2 and 5 were from inclusion body preparations of insoluble pMAL fusion protein, dialyzed extensively in PBS. Aliquots of the supernatants from the coupling reactions, before and after coupling, were assessed by Coomassie staining of 7.5% SDS-PAGE gels. Based on protein band intensities, in all cases greater than 50% coupling efficiencies were estimated. The resins were poured into 5 ml BioRad columns, washed extensively with PBS, and stored at 4.degree. C.
Aliquots of the CTA IgY polyclonal antibody preparation were depleted for each individual region as described below. A 20 ml sample of the CTA IgY preparation �Example 8(c)! was dialyzed extensively against 3 changes of PBS (1 liter for each dialysis), quantitated by absorbance at OD.sub.280, and stored at 4.degree. C. Six 1 ml aliquots of the dialyzed IgY preparation were removed, and depleted individually for each of the six intervals. Each 1 ml aliquot was passed over the appropriate affinity column, and the eluate twice reapplied to the column. The eluate was collected, and pooled with a 1 ml PBS wash. Bound antibody was eluted from the column by washing with 5 column volumes of 4M Guanidine-HCl (in 10 mM Tris-HCl, pH 8.0). The column was reequilibrated in PBS, and the depleted antibody stock reapplied as described above. The eluate was collected, pooled with a 1 ml PBS wash, quantitated by absorbance at OD.sub.280, and stored at 4.degree. C. In this manner, 6 aliquots of the CTA IgY preparation were individually depleted for each of the 6 toxin A intervals, by two rounds of affinity depletion. The specificity of each depleted stock was tested by Western blot analysis. Multiple 7.5% SDS-PAGE gels were loaded with protein samples corresponding to all 6 toxin A subregions. After electrophoresis, the gels were blotted, and protein transfer confirmed by Ponceau S staining �protocols described in Williams et al. (1994), supra!. After blocking the blots 1 hr at 20.degree. C. in PBS+0.1% Tween 20 (PBST) containing 5% milk (as a blocking buffer), 4 ml of either a 1/500 dilution of the dialyzed CTA IgY preparation in blocking buffer, or an equivalent amount of the six depleted antibody stocks (using OD.sub.280 to standardize antibody concentration) were added and the blots incubated a further 1 hr at room temperature. The blots were washed and developed with alkaline phosphatase (using a rabbit anti-chicken alkaline phosphate conjugate as a secondary antibody) as previously described �Williams et al. (1994), supra!. In all cases, only the target interval was depleted for antibody reactivity, and at least 90% of the reactivity to the target intervals was specifically depleted.
Region specific antibody pools were isolated by affinity chromatography as described below. Ten mls of the dialyzed CTA IgY preparation were applied sequentially to each affinity column, such that a single 10 ml aliquot was used to isolate region specific antibodies specific to each of the six subregions. The columns were sequentially washed with 10 volumes of PBS, 6 volumes of BBS-Tween, 10 volumes of TBS, and eluted with 4 ml Actisep elution media (Sterogene). The eluate was dialyzed extensively against several changes of PBS, and the affinity purified antibody collected and stored at 4.degree. C. The volumes of the eluate increased to greater than 10 mls during dialysis in each case, due to the high viscosity of the Actisep elution media. Aliquots of each sample were 20.times. concentrated using Centricon 30 microconcentrators (Amicon) and stored at 4.degree. C. The specificity of each region specific antibody pool was tested, relative to the dialyzed CTA IgY preparation, by Western blot analysis, exactly as described above, except that 4 ml samples of blocking buffer containing 100 .mu.l region specific antibody (unconcentrated) were used instead of the depleted CTA IgY preparations. Each affinity purified antibody preparation was specific to the defined interval, except that samples purified against intervals 1-5 also reacted with interval 6. This may be due to non-specific binding to the interval 6 protein, since this protein contains the repetitive ligand binding domain which has been shown to bind antibodies nonspecifically. �Lyerly et al., Curr. Microbiol., 19:303-306 (1989).!
The reactivity of each affinity purified antibody preparation to the corresponding proteins was approximately the same as the reactivity of the 1/500 diluted dialyzed CTA IgY preparation standard. Given that the specific antibody stocks were diluted 1/40, this would indicate that the unconcentrated affinity purified antibody stocks contain 1/10-1/20 the concentration of specific antibodies relative to the starting CTA IgY preparation.
c) Toxin A Neutralization Assay Using Antibodies Reactive Toward Recombinant Toxin A Protein
The CHO toxin neutralization assay �Example 8(d)! was used to assess the ability of the depleted or enriched samples generated in (b) above to neutralize the cytotoxicity of toxin A. The general ability of affinity purified antibodies to neutralize toxin A was assessed by mixing together aliquots of all 6 concentrated stocks of the 6 affinity purified samples generated in (b) above, and testing the ability of this mixture to neutralize a toxin A concentration of 0.1 .mu.g/ml. The results, shown in FIG. 11, demonstrate almost complete neutralization of toxin A using the affinity purified (AP) mix. Some epitopes within the recombinant proteins utilized for affinity purification were probably lost when the proteins were denatured before affinity purification �by Guanidine-HCl treatment in (b) above!. Thus, the neutralization ability of antibodies directed against recombinant protein is probably underestimated using these affinity purified antibody pools. This experiment demonstrates that antibodies reactive to recombinant toxin A can neutralize cytotoxicity, suggesting that neutralizing antibodies may be generated by using recombinant toxin A protein as immunogen.
In view of the observation that the recombinant expression clones of the toxin A gene divide the protein into 6 subregions, the neutralizing ability of antibodies directed against each individual region was assessed. The neutralizing ability of antibodies directed against the ligand binding domain of toxin A was determined first.
In the toxin neutralization experiment shown in FIG. 11, interval 6 specific antibodies (interval 6 contains the ligand binding domain) were depleted from the dialyzed PEG preparation, and the effect on toxin neutralization assayed. Interval 6 antibodies were depleted either by utilizing the interval 6 depleted CTA IgY preparation from (b) above ("-6 aff. depleted" in FIG. 11), or by addition of interval 6 protein to the CTA IgY preparation (estimated to be a 10 fold molar excess over anti-interval 6 immunoglobulin present in this preparation) to competitively compete for interval 6 protein ("-6 prot depleted" in FIG. 11). In both instances, removal of interval 6 specific antibodies reduces the neutralization efficiency relative to the starting CTA IgY preparation. This demonstrates that antibodies directed against interval 6 contribute to toxin neutralization. Since interval 6 corresponds to the ligand binding domain of the protein, these results demonstrate that antibodies directed against this region in the PEG preparation contribute to the neutralization of toxin A in this assay. However, it is significant that after removal of these antibodies, the PEG preparation retains significant ability to neutralize toxin A (FIG. 11). This neutralization is probably due to the action of antibodies specific to other regions of the toxin A protein, since at least 90% of the ligand binding region reactive antibodies were removed in the depleted sample prepared in (b) above. This conclusion was supported by comparison of the toxin neutralization of the affinity purified (AP) mix compared to affinity purified interval 6 antibody alone. Although some neutralization ability was observed with AP interval 6 antibodies alone, the neutralization was significantly less than that observed with the mixture of all 6 AP antibody stocks (not shown).
Given that the mix of all six affinity purified samples almost completely neutralized the cytotoxicity of toxin A (FIG. 11), the relative importance of antibodies directed against toxin A intervals 1-5 within the mixture was determined. This was assessed in two ways. First, samples containing affinity purified antibodies representing 5 of the 6 intervals were prepared, such that each individual region was depleted from one sample. FIG. 12 demonstrates a sample neutralization curve, comparing the neutralization ability of affinity purified antibody mixes without interval 4 (-4) or 5 (-5) specific antibodies, relative to the mix of all 6 affinity purified antibody stocks (positive control). While the removal of interval 5 specific antibodies had no effect on toxin neutralization (or intervals 1-3, not shown), the loss of interval 4 specific antibodies significantly reduced toxin neutralization (FIG. 12).
Similar results were seen in a second experiment, in which affinity purified antibodies, directed against a single region, were added to interval 6 specific antibodies, and the effects on toxin neutralization assessed. Only interval 4 specific antibodies significantly enhanced neutralization when added to interval 6 specific antibodies (FIG. 13). These results demonstrate that antibodies directed against interval 4 (corresponding to clone pPA1100-1450 in FIG. 9) are important for neutralization of cytotoxicity in this assay. Epitope mapping has shown that only low levels of antibodies reactive to this region are generated when native toxin A is used as an immunogen �Example 12(a)!. It is hypothesized that immunization with recombinant protein specific to this interval will elicit higher titers of neutralizing antibodies. In summary, this analysis has identified two critical regions of the toxin A protein against which neutralizing antibodies are produced, as assayed by the CHO neutralization assay.
EXAMPLE 13
Production And Evaluation Of Avian Antitoxin Against C. difficile Recombinant Toxin A Polypeptide
In Example 12, we demonstrated neutralization of toxin A mediated cytotoxicity by affinity purified antibodies reactive to recombinant toxin A protein. To determine whether antibodies raised against a recombinant polypeptide fragment of C. difficile toxin A may be effective in treating clostridial diseases, antibodies to recombinant toxin A protein representing the binding domain were generated. Two toxin A binding domain recombinant polypeptides, expressing the binding domain in either the pMALc (pMA1870-2680) or pET 23(pPA1870-2680) vector, were used as immunogens. The pMAL protein was affinity purified as a soluble product �Example 12(d)! and the pET protein was isolated as insoluble inclusion bodies �Example 12(d)! and solubilized to an immunologically active protein using a proprietary method described in a pending patent application (U.S. patent application Ser. No. 08/129,027). This Example involves (a) immunization, (b) antitoxin collection, (c) determination of antitoxin antibody titer, (d) anti-recombinant toxin A neutralization of toxin A hemagglutination activity in vitro, and (e) assay of in vitro toxin A neutralizing activity.
a) Immunization
The soluble and the inclusion body preparations each were used separately to immunize hens. Both purified toxin A polypeptides were diluted in PBS and emulsified with approximately equal volumes of CFA for the initial immunization or IFA for subsequent booster immunizations. On day zero, for each of the recombinant preparations, two egg laying white Leghorn hens (obtained from local breeder) were each injected at multiple sites (intramuscular and subcutaneous) with 1 ml of recombinant adjuvant mixture containing approximately 0.5 to 1.5 mgs of recombinant toxin A. Booster immunizations of 1.0 mg were given on days 14 and day 28.
b) Antitoxin Collection
Total yolk immune IgY was extracted as described in the standard PEG protocol (as in Example 1) and the final IgY pellet was dissolved in sterile PBS at the original yolk volume. This material is designated "immune recombinant IgY" or "immune IgY."
C) Antitoxin Antibody Titer
To determine if the recombinant toxin A protein was sufficiently immunogenic to raise antibodies in hens, the antibody titer of a recombinant toxin A polypeptide was determined by ELISA. Eggs from both hens were collected on day 32, the yolks pooled and the antibody was isolated using PEG as described. The immune recombinant IgY antibody titer was determined for the soluble recombinant protein containing the maltose binding protein fusion generated in p-Mal (pMA1870-2680). Ninety-six well Falcon Pro-bind plates were coated overnight at 4.degree. C. with 100 .mu.l/well of toxin A recombinant at 2.5 .mu.g /.mu.l in PBS containing 0.05% thimerosal. Another plate was also coated with maltose binding protein (MBP) at the same concentration, to permit comparison of antibody reactivity to the fusion partner. The next day, the wells were blocked with PBS containing 1% bovine serum albumin (BSA) for 1 hour at 37.degree. C. IgY isolated from immune or preimmune eggs was diluted in antibody diluent (PBS containing 1% BSA and 0.05% Tween-20), and added to the blocked wells and incubated for 1 hour at 37.degree. C. The plates were washed three times with PBS with 0.05% Tween-20, then three times with PBS. Alkaline phosphatase conjugated rabbit anti-chicken EgG (Sigma) diluted 1:1000 in antibody diluent was added to the plate, and incubated for 1 hour at 37.degree. C. The plates were washed as before and substrate was added, �p-nitrophenyl phosphate (Sigma)! at 1 mg/ml in 0.05M Na.sub.2 CO.sub.3, pH 9.5 and 10 mM MgCl.sub.2. The plates were evaluated quantitatively on a Dynatech MR 300Micro EPA plate reader at 410 nm about 10 minutes after the addition of substrate.
Based on these ELISA results, high antibody titers were raised in chickens immunized with the toxin A recombinant polypeptide. The recombinant appeared to be highly immunogenic, as it was able to generate high antibody titers relatively quickly with few immunizations. Immune IgY titer directed specifically to the toxin A portion of the recombinant was higher than the immune IgY titer to its fusion partner, the maltose binding protein, and significantly higher than the preimmune IgY. ELISA titers (reciprocal of the highest dilution of IgY generating a signal) in the preimmune IgY to the MBP or the recombinant was <1:30 while the immune IgY titers to MBP and the toxin A recombinant were 1:18750 and >1:93750 respectively. Importantly, the anti-recombinant antibody titers generated in the hens against the recombinant polypeptide is much higher, compared to antibodies to that region raised using native toxin A. The recombinant antibody titer to region 1870-2680 in the CTA antibody preparation is at least five-fold lower compared to the recombinant generated antibodies (1:18750 versus >1:93750). Thus, it appears a better immune response can be generated against a specific recombinant using that recombinant as the immunogen compared to the native toxin A.
This observation is significant, as it shows that because recombinant portions stimulate the production of antibodies, it is not necessary to use native toxin molecules to produce antitoxin preparations. Thus, the problems associated with the toxicity of the native toxin are avoided and large-scale antitoxin production is facilitated.
d) Anti-Recombinant Toxin A Neutralization Of Toxin A Hemagglutination Activity In Vitro
Toxin A has hemagglutinating activity besides cytotoxic and enterotoxin properties. Specifically, toxin A agglutinates rabbit erythrocytes by binding to a trisaccharide (gal 1-3B1-4GlcNAc) on the cell surface. �H. Krivan et al., Infect. Immune., 53:573-581 (1986).! We examined whether the anti-recombinant toxin A (immune IgY, antibodies raised against the insoluble product expressed in pET) can neutralize the hemagglutination activity of toxin A in vitro. The hemagglutination assay procedure used was described by H. C. Krivan et al. Polyethylene glycol-fractionated immune or preimmune IgY were pre-absorbed with citrated rabbit erythrocytes prior to performing the hemagglutination assay because we have found that IgY alone can agglutinate red blood cells. Citrated rabbit red blood cells (RRBC's)(Cocalico) were washed twice by centrifugation at 450.times.g with isotonic buffer (0.1M Tris-HCl, 0.05M NaCl, pH 7.2). RRBC-reactive antibodies in the IgY were removed by preparing a 10% RRBC suspension (made by adding packed cells to immune or preimmune IgY) and incubating the mixture for 1 hour at 37.degree. C. The RRBCs were then removed by centrifugation. Neutralization of the hemagglutination activity of toxin A by antibody was tested in round-bottomed 96-well microtiter plates. Twenty-five .mu.l of toxin A (36 .mu.g /ml) (Tech Lab) in isotonic buffer was mixed with an equal volume of different dilutions of immune or preimmune IgY in isotonic buffer, and incubated for 15 minutes at room temperature. Then, 50 .mu.l of a 1% RRBC suspension in isotonic buffer was added and the mixture was incubated for 3 hours at 4.degree. C. Positive control wells containing the final concentration of 9 .mu.g/ml of toxin A after dilution without IgY were also included. Hemagglutination activity was assessed visually, with a diffuse matrix of RRBC's coating the bottom of the well representing a positive hemagglutination reaction and a tight button of RRBC's at the bottom of the well representing a negative reaction. The anti-recombinant immune IgY neutralized toxin A hemagglutination activity, giving a neutralization titer of 1:8. However, preimmune IgY was unable to neutralize the hemagglutination ability of toxin A.
e) Assay Of In Vitro Toxin A Neutralizing Activity
The ability of the anti-recombinant toxin A IgY (immune IgY antibodies raised against pMA1870-2680, the soluble recombinant binding domain protein expressed in pMAL, designated as Anti-tox. A-2 in FIG. 14 , and referred to as recombinant region 6) and pre-immune IgY, prepared as described in Example 8(c) above, to neutralize the cytotoxic activity of toxin A was assessed in vitro using the CHO cell cytotoxicity assay, and toxin A (Tech Lab) at a concentration of 0.1 .mu.g/ml, as described in Example 8(d) above. As additional controls, the anti-native toxin A IgY (CTA) and pre-immune IgY preparations described in Example 8(c) above were also tested. The results are shown in FIG. 14.
The anti-recombinant toxin A IgY demonstrated only partial neutralization of the cytotoxic activity of toxin A, while the pre-immune IgY did not demonstrate any significant neutralizing activity.
EXAMPLE 14
In vivo Neutralization Of C. difficile Toxin A
The ability of avian antibodies (IgY) raised against recombinant toxin A binding domain to neutralize the enterotoxin activity of C. difficile toxin A was evaluated in vivo using Golden Syrian hamsters. The Example involved: (a) preparation of the avian anti-recombinant toxin A IgY for oral administration; (b) in vivo protection of hamsters from C. difficile toxin A enterotoxicity by treatment of toxin A with avian anti-recombinant toxin A IgY; and (c) histologic evaluation of hamster ceca.
a) Preparation Of The Avian Anti-Recombinant Toxin A IgY For Oral Administration
Eggs were collected from hens which had been immunized with the recombinant C. difficile toxin A fragment pMA1870-2680 (described in Example 13, above). A second group of eggs purchased at a local supermarket was used as a pre-immune (negative) control. Egg yolk immunoglobulin (IgY) was extracted by PEG from the two groups of eggs as described in Example 8(c), and the final IgY pellets were solubilized in one-fourth the original yolk volume using 0.1M carbonate buffer (mixture of NaHCO.sub.3 and Na.sub.2 CO.sub.3), pH 9.5. The basic carbonate buffer was used in order to protect the toxin A from the acidic pH of the stomach environment.
b) In vivo Protection Of Hamsters Against C. difficile Toxin A Enterotoycsty By Treatment Of Toxin A With Avian Anti-recombinant Toxin A IgY
In order to assess the ability of the avian anti-recombinant toxin A IgY, prepared in section (a) above to neutralize the in vivo enterotoxin activity of toxin A, an in vivo toxin neutralization model was developed using Golden Syrian hamsters. This model was based on published values for the minimum amount of toxin A required to elicit diarrhea (0.08 mg toxin A/Kg body wt.) and death (0.16 mg toxin A/Kg body wt.) in hamsters when administered orally (Lyerly et al. Infect. Immun., 47:349-352 (1985).
For the study, four separate experimental groups were used, with each group consisting of 7 female Golden Syrian hamsters (Charles River), approx. three and one-half weeks old, weighing approx. 50 gms each. The animals were housed as groups of 3 and 4, and were offered food and water ad libitum through the entire length of the study.
For each animal, a mixture containing either 10 .mu.g of toxin A (0.2 mg/Kg) or 30 .mu.g of toxin A (0.6 mg/Kg) (C. difficile toxin A was obtained from Tech Lab and 1 ml of either the anti-recombinant toxin A IgY or pre-immune IgY (from section (a) above) was prepared. These mixtures were incubated at 37.degree. C. for 60 min. and were then administered to the animals by the oral route. The animals were then observed for the onset of diarrhea and death for a period of 24 hrs. following the administration of the toxin A+IgY mixtures, at the end of which time, the following results were tabulated and shown in Table 17:
TABLE 17______________________________________Study Outcome At 24 Hours Study Outcome at 24 HoursExperimental Group Healthy.sup.1 Diarrhea.sup.2 Dead.sup.3______________________________________10 .mu.g Toxin A + Antitoxin Against 7 0 0Interval 630 .mu.g Toxin A + Antitoxin Against 7 0 0Interval 610 .mu.g Toxin A + Pre-Immune Serum 0 5 230 .mu.g Toxin A + Pre-Immune 0 5 2______________________________________ .sup.1 Animal shows no sign of illness. .sup.2 Animal developed diarrhea, but did not die. .sup.3 Animal developed diarrhea and subsequently died.
Pretreatment of toxin A at both doses tested, using the anti-recombinant toxin A IgY, prevented all overt symptoms of disease in hamsters. Therefore, pretreatment of C. difficile toxin A, using the anti-recombinant toxin A IgY, neutralized the in vivo enterotoxin activity of the toxin A. In contrast, all animals from the two groups which received toxin A which had been pretreated using pre-immune IgY developed disease symptoms which ranged from diarrhea to death. The diarrhea which developed in the 5 animals which did not die in each of the two pre-immune groups, spontaneously resolved by the end of the 24 hr. study period.
c) Histologic Evaluation Of Hamster Ceca
In order to further assess the ability of anti-recombinant toxin A IgY to protect hamsters from the enterotoxin activity of toxin A, histologic evaluations were performed on the ceca of hamsters from the study described in section (b) above.
Three groups of animals were sacrificed in order to prepare histological specimens. The first group consisted of a single representative animal taken from each of the 4 groups of surviving hamsters at the conclusion of the study described in section (b) above. These animals represented the 24 hr. timepoint of the study.
The second group consisted of two animals which were not part of the study described above, but were separately treated with the same toxin A+pre-immune IgY mixtures as described for the animals in section (b) above. Both of these hamsters developed diarrhea, and were sacrificed 8 hrs. after the time of administration of the toxin A+pre-immune IgY mixtures. At the time of sacrifice, both animals were presenting symptoms of diarrhea. These animals represented the acute phase of the study.
The final group consisted of a single untreated hamster from the same shipment of animals as those used for the two previous groups. This animal served as the normal control.
Samples of cecal tissue were removed from the 7 animals described above, and were fixed overnight at 4.degree. C. using 10% buffered formalin. The fixed tissues were paraffin-embedded, sectioned, and mounted on glass microscope slides. The tissue sections were then stained using hematoxylin and eosin (H and E stain), and were examined by light microscopy.
The tissues obtained from the two 24 hr. animals which received mixtures containing either 10 .mu.g or 30 .mu.g of toxin A and anti-recombinant toxin A IgY were indistinguishable from the normal control, both in terms of gross pathology, as well as at the microscopic level. These observations provide further evidence for the ability of anti-recombinant toxin A IgY to effectively neutralize the in vivo enterotoxin activity of C. difficile toxin A, and thus its ability to prevent acute or lasting toxin A-induced pathology.
In contrast, the tissues from the two 24 hr. animals which received the toxin A+pre-immune IgY mixtures demonstrated significant pathology. In both of these groups, the mucosal layer was observed to be less organized than in the normal control tissue. The cytoplasm of the epithelial cells had a vacuolated appearance, and gaps were present between the epithelium and the underlying cell layers. The lamina propria was largely absent. Intestinal villi and crypts were significantly diminished, and appeared to have been overgrown by a planar layer of epithelial cells and fibroblasts. Therefore, although these animals overtly appeared to recover from the acute symptoms of toxin A intoxication, lasting pathologic alterations to the cecal mucosa had occurred.
The tissues obtained from the two acute animals which received mixtures of toxin A and pre-immune IgY demonstrated the most significant pathology. At the gross pathological level, both animals were observed to have severely distended ceca which were filled with watery, diarrhea-like material. At the microscopic level, the animal that was given the mixture containing 10 .mu.g of toxin A and pre-immune IgY was found to have a mucosal layer which had a ragged, damaged appearance, and a disorganized, compacted quality. The crypts were largely absent, and numerous breaks in the epithelium had occurred. There was also an influx of erythrocytes into spaces between the epithelial layer and the underlying tissue. The animal which had received the mixture containing 30 .mu.g of toxin A and pre-immune IgY demonstrated the most severe pathology. The cecal tissue of this animal had an appearance very similar to that observed in animals which had died from C. difficile disease. Widespread destruction of the mucosa was noted, and the epithelial layer had sloughed. Hemorrhagic areas containing large numbers of erythrocytes were very prevalent. All semblance of normal tissue architecture was absent from this specimen. In terms of the presentation of pathologic events, this in vivo hamster model of toxin A-intoxication correlates very closely with the pathologic consequences of C. difficile disease in hamsters. The results presented in this Example demonstrate that while anti-recombinant toxin A (Interval 6) IgY is capable of only partially neutralizing the cytotoxic activity of C. difficile toxin A, the same antibody effectively neutralizes 100% of the in vivo enterotoxin activity of the toxin. While it is not intended that this invention be limited to this mechanism, this may be due to the cytotoxicity and enterotoxicity of C. difficile Toxin A as two separate and distinct biological functions.
EXAMPLE 15
In Vivo Neutralization Of C. Difficile Toxin A By Antibodies Against Recombinant Toxin A Polypeptides
The ability of avian antibodies directed against the recombinant C. difficile toxin A fragment 1870-2680 (as expressed by pMA1870-2680; see Example 13) to neutralize the enterotoxic activity of toxin A was demonstrated in Example 14. The ability of avian antibodies (IgYs) directed against other recombinant toxin A epitopes to neutralize native toxin A in vivo was next evaluated. This example involved: (a) the preparation of IgYs against recombinant toxin A polypeptides; (b) in vivo protection of hamsters against toxin A by treatment with anti-recombinant toxin A IgYs and (c) quantification of specific antibody concentration in CTA and Interval 6 IgY PEG preparations.
The nucleotide sequence of the coding region of the entire toxin A protein is listed in SEQ ID NO:5. The amino acid sequence of the entire toxin A protein is listed in SEQ ID NO:6. The amino acid sequence consisting of amino acid residues 1870 through 2680 of toxin A is listed in SEQ ID NO:7. The amino acid sequence consisting of amino acid residues 1870 through 1960 of toxin A is listed in SEQ ID NO:8.
a) Preparation Of IgY's Against Recombinant Toxin A Polypeptides
Eggs were collected from Leghorn hens which have been immunized with recombinant C. difficile toxin A polypeptide fragments encompassing the entire toxin A protein. The polypeptide fragments used as immunogens were: 1) pMA 1870-2680 (Interval 6), 2) pPA 1100-1450 (Interval 4), and 3) a mixture of fragments consisting of pMA 30-300 (Interval 1), pMA 300-660 (Interval 2), pMA 660-1100 (Interval 3) and pMA 1450-1870 (Interval 5). This mixture of immunogens is referred to as Interval 1235. The location of each interval within the toxin A molecule is shown in FIG. 15A. In FIG. 15A, the following abbreviations are used: pP refers to the pET23 vector (New England BioLabs); pM refers to the pMAL.TM.-c vector (New England BioLabs); A refers to toxin A; the numbers refer to the amino acid interval expressed in the clone. (For example, the designation pMA30-300 indicates that the recombinant clone encodes amino acids 30-300 of toxin A and the vector used was pMAL.TM.-c).
The recombinant proteins were generated as described in Example 11. The IgYs were extracted and solubilized in 0.1M carbonate buffer pH 9.5 for oral administration as described in Example 14(a). The IgY reactivities against each individual recombinant interval was evaluated by ELISA as described in Example 13(c).
b) In Vivo Protection Of Hamsters Against Toxin A By Treatment With Anti-Recombinant Toxin A Antibodies
The ability of antibodies raised against recombinant toxin A polypeptides to provide in vivo protection against the enterotoxic activity of toxin A was examined in the hamster model system. This assay was performed as described in Example 14(b). Briefly, for each 40-50 gram female Golden Syrian hamster (Charles River), 1 ml of IgY 4.times. (i.e., resuspended in 1/4 of the original yolk volume) PEG prep against Interval 6, Interval 4 or Interval 1235 was mixed with 30 .mu.g (LD.sub.100 oral dose) of C. difficile toxin A (Tech Lab). Preimmune IgY mixed with toxin A served as a negative control. Antibodies raised against C. difficile toxoid A (Example 8) mixed with toxin A (CTA) served as a positive control. The mixture was incubated for 1 hour at 37.degree. C. then orally administered to lightly etherized hamsters using an 18G feeding needle. The animals were then observed for the onset of diarrhea and death for a period of approximately 24 hours. The results are shown in Table 18.
TABLE 18______________________________________Study Outcome After 24 HoursTreatment group Healthy.sup.1 Diarrhea.sup.2 Dead.sup.3______________________________________Preimmune 0 0 7CTA 5 0 0Interval 6 6 1 0Interval 4 0 1 6Interval 1235 0 0 7______________________________________ .sup.1 Animal shows no sign of illness. .sup.2 Animal developed diarrhea, but did not die. .sup.3 Animal developed diarrhea and died.
Pre-treatment of toxin A with IgYs against Interval 6 prevented diarrhea in 6 of 7 hamsters and completely prevented death in all 7. In contrast, as with preimmune IgY, IgYs against Interval 4 and Interval 1235 had no effect on the onset of diarrhea and death in the hamsters.
c) Quantification Of Specific Antibody Concentration In CTA And Interval 6 IgY PEG Preparations
To determine the purity of IgY PEG preparations, an aliquot of a pMA1870-2680 (Interval 6) IgY PEG preparation was chromatographed using HPLC and a KW-803 sizing column (Shodex). The resulting profile of absorbance at 280 nm is shown in FIG. 16. The single large peak corresponds to the predicted MW of IgY. Integration of the area under the single large peak showed that greater than 95% of the protein eluted from the column was present in this single peak. This result demonstrated that the majority (>95%) of the material absorbing at 280 nm in the PEG preparation corresponds to IgY. Therefore, absorbance at 280 mn can be used to determine the total antibody concentration in PEG preparations.
To determine the concentration of Interval 6-specific antibodies (expressed as percent of total antibody) within the CTA and pMA1870-2680 (Interval 6) PEG preparations, defined quantities of these antibody preparations were affinity purified on a pPA1870-2680(H) (shown schematically in FIG. 15B) affinity column and the specific antibodies were quantified. In FIG. 15B the following abbreviations are used: pP refers to the pET23 vector (New England BioLabs); pM refers to the pMAL.TM.-c vector (New England BioLabs); pG refers to the pGEX vector (Pharmacia); pB refers to the Pinpoint.TM. Xa vector (Promega); A refers to toxin A; the numbers refer to the amino acid interval expressed in the clone. The solid black ovals represent the MBP; the hatched ovals represent glutathione S-transferase; the hatched circles represent the biotin tag; and HHH represents the poly-histidine tag.
An affinity column containing recombinant toxin A repeat protein was made as follows. Four ml of PBS-washed Actigel resin (Sterogene) was coupled with 5-10 mg of pPA1870-2680 inclusion body protein �prepared as described in Example (17) and dialyzed into PBS! in a 15 ml tube (Falcon) containing 1/10 final volume Ald-coupling solution (1M sodium cyanoborohydride). Aliquots of the supernatant from the coupling reactions, before and after coupling, were assessed by Coomassie staining of 7.5% SDS-PAGE gels. Based upon protein band intensities, greater than 6 mg of recombinant protein was coupled to the resin. The resin was poured into a 10 ml column (BioRad), washed extensively with PBS, pre-eluted with 4M guanidine-HCl (in 10 mM Tris-HCl, pH 8.0; 0.005% thimerosal) and re-equilibrated with PBS. The column was stored at 4.degree. C.
Aliquots of a pMA1870-2680 (Interval 6) or a CTA IgY polyclonal antibody preparation (PEG prep) were affinity purified on the above affinity column as follows. The column was attached to an UV monitor (ISCO) and washed with PBS. For pMA1870-2680 IgY purification, a 2.times. PEG prep (filter sterilized using a 0.45.mu. filter; approximately 500 mg total IgY) was applied. The column was washed with PBS until the baseline was re-established (the column flow-through was saved), washed with BBSTween to elute nonspecifically binding antibodies and re-equilibrated with PBS. Bound antibody was eluted from the column in 4M guanidine-HCl (in 10 mM Tris-HCl, pH 8.0; 0.005% thimerosal). The entire elution peak was collected in a 15 ml tube (Falcon). The column was re-equilibrated and the column eluate was re-chromatographed as described above. The antibody preparation was quantified by UV absorbance (the elution buffer was used to zero the spectrophotometer). Total purified antibody was approximately 9 mg and 1 mg from the first and second chromatography passes, respectively. The low yield from the second pass indicated that most specific antibodies were removed by the first round of chromatography. The estimated percentage of Interval 6 specific antibodies in the pMA1870-2680 PEG prep is approximately 2%.
The percentage of Interval 6 specific antibodies in the CTA PEG prep was determined (utilizing the same column and methodology described above) to be approximately 0.5% of total IgY.
A 4.times. PEG prep contains approximately 20 mg/ml IgY. Thus in b) above, approximately 400 .mu.g specific antibody in the Interval 6 PEG prep neutralized 30 .mu.g toxin A in vivo.
EXAMPLE 16
In Vivo Treatment Of C. difficile Disease In Hamsters By Recombinant Interval 6 Antibodies
The ability of antibodies directed against recombinant Interval 6 of toxin A to protect hamsters in vivo from C. difficile disease was examined. This example involved: (a) prophylactic treatment of C. difficile disease and (b) therapeutic treatment of C. difficile disease.
a) Prophylactic Treatment Of C. difficile Disease
This experiment was performed as described in Example 9(b). Three groups each consisting of 7 female 100 gram Syrian hamsters (Charles River) were prophylactically treated with either preimmune IgYs, IgYs against native toxin A and B �CTAB; see Example 8 (a) and (b)! or IgYs against Interval 6. IgYs were prepared as 4.times. PEG preparations as described in Example 9(a).
The animals were orally dosed 3 times daily, roughly at 4 hour intervals, for 12 days with 1 ml antibody preparations diluted in Ensure.RTM.. Using estimates of specific antibody concentration from Example 15(c), each dose of the Interval 6 antibody prep contained approximately 400 .mu.g of specific antibody. On day 2 each hamster was predisposed to C. difficile infection by the oral administration of 3.0 mg of Clindamycin-HCl (Sigma) in 1 ml of water. On day 3 the hamsters were orally challenged with 1 ml of C. difficile inoculum strain ATCC 43596 in sterile saline containing approximately 100 organisms. The animals were then observed for the onset of diarrhea and subsequent death during the treatment period. The results are shown in Table 19.
TABLE 19______________________________________Lethality 2 After 12 Days Of TreatmentTreatment Group Number Animals Alive Number Animals Dead______________________________________Preimmune 0 7CTAB 6 1Interval 6 7 0______________________________________
Treatment of hamsters with orally-administered IgYs against Interval 6 successfully protected 7 out of 7 (100%) of the animals from C. difficile disease. One of the hamsters in this group presented with diarrhea which subsequently resolved during the course of treatment. As shown previously in Example 9, antibodies to native toxin A and toxin B were highly protective. In this Example, 6 out of 7 animals survived in the CTAB treatment group. All of the hamsters treated with preimmune sera came down with diarrhea and died. The survivors in both the CTAB and Interval 6 groups remained healthy throughout a 12 day post-treatment period. In particular, 6 out of 7 Interval 6-treated hamsters survived at least 2 weeks after termination of treatment which suggests that these antibodies provide a long-lasting cure. These results represent the first demonstration that antibodies generated against a recombinant region of toxin A can prevent CDAD when administered passively to animals. These results also indicate that antibodies raised against Interval 6 alone may be sufficient to protect animals from C. difficile disease when administered prophylactically.
Previously others had raised antibodies against toxin A by actively immunizing hamsters against a recombinant polypeptide located within the Interval 6 region �Lyerly, D. M., et al. (1990) Curr. Microbiol. 21:29!. FIG. 17 shows schematically the location of the Lyerly, et al. intra-Interval 6 recombinant protein (cloned into the pUC vector) in comparison with the complete Interval 6 construct (pM1870-2680) used herein to generate neutralizing antibodies directed against toxin A. In FIG. 17, the solid black oval represents the MBP which is fused to the toxin A Interval 6 in pMA1870-2680.
The Lyerly, et al. antibodies (intra-Interval 6) were only able to partially protect hamsters against C. difficile infection in terms of survival (4 out of 8 animals survived) and furthermore, these antibodies did not prevent diarrhea in any of the animals. Additionally, animals treated with the intra-Interval 6 antibodies �Lyerly, et al. (1990), supra! died when treatment was removed.
In contrast, the experiment shown above demonstrates that passive administration of anti-Interval 6 antibodies prevented diarrhea in 6 out of 7 animals and completely prevented death due to CDAD. Furthermore, as discussed above, passive administration of the anti-Interval 6 antibodies provides a long lasting cure (i.e., treatment could be withdrawn without incident).
b) Therapeutic Treatment Of C. difficile Disease: In Vivo Treatment Of An Established C. difficile Infection In Hamster With Recombinant Interval 6 Antibodies
The ability of antibodies against recombinant interval 6 of toxin A to therapeutically treat C. difficile disease was examined. The experiment was performed essentially as described in Example 10(b). Three groups, each containing seven to eight female Golden Syrian hamsters (100 g each; Charles River) were treated with either preimmune IgY, IgYs against native toxin A and toxin B (CTAB) and IgYs against Interval 6. The antibodies were prepared as described above as 4.times. PEG preparations.
The hamsters were first predisposed to C. difficile infection with a 3 mg dose of Clindamycin-HCl (Sigma) administered orally in 1 ml of water. Approximately 24 hrs later, the animals were orally challenged with 1 ml of C. difficile strain ATCC 43596 in sterile saline containing approximately 200 organisms. One day after infection, the presence of toxin A and B was determined in the feces of the hamsters using a commercial immunoassay kit (Cytoclone A+B EPA, Cambridge Biotech) to verify establishment of infection. Four members of each group were randomly selected and tested. Feces from an uninfected hamster was tested as a negative control. All infected animals tested positive for the presence of toxin according to the manufacturer's procedure. The initiation of treatment then started approximately 24 hr post-infection.
The animals were dosed daily at roughly 4 hr intervals with 1 ml antibody preparation diluted in Ensure.RTM. (Ross Labs). The amount of specific antibodies given per dose (determined by affinity purification) was estimated to be about 400 .mu.g of anti-Interval 6 IgY (for animals in the Interval 6 group) and 100 tg and 70 .mu.g of anti-toxin A (Interval 6-specific) and anti-toxin B (Interval 3-specific; see Example 19), respectively, for the CTAB preparation. The animals were treated for 9 days and then observed for an additional 4 days for the presence of diarrhea and death. The results indicating the number of survivors and the number of dead 4 days post-infection are shown in Table 20.
TABLE 20______________________________________In vivo Therapeutic Treatment With Interval 6 AntibodiesTreatment Group Number Animals Alive Number Animals Dead______________________________________Preimmune 4 3CTAB 8 0Interval 6 8 0______________________________________
Antibodies directed against both Interval 6 and CTAB successfully prevented death from C. difficile when therapeutically administered 24 hr after infection. This result is significant since many investigators begin therapeutic treatment of hamsters with existing drugs (e.g., vancomycin, phenelfamycins, tiacumicins, etc.) 8 hr post-infection �Swanson, et al. (1991) Antimicrobial Agents and Chemotherapy 35:1108 and (1989) J. Antibiotics 42:94!.
Forty-two percent of hamsters treated with preimmune IgY died from CDAD. While the anti-Interval 6 antibodies prevented death in the treated hamsters, they did not eliminate all symptoms of CDAD as 3 animals presented with slight diarrhea. In addition, one CTAB-treated and one preimmune-treated animal also had diarrhea 14 days post-infection. These results indicate that anti-Interval 6 antibodies provide an effective means of therapy for CDAD.
EXAMPLE 17
Induction Of Toxin A Neutralizing Antibodies Requires Soluble Interval 6 Protein
As shown in Examples 11 (d) and 15, expression of recombinant proteins in E. coli may result in the production of either soluble or insoluble protein. If insoluble protein is produced, the recombinant protein is solubilized prior to immunization of animals. To determine whether, one or both of the soluble or insoluble recombinant proteins could be used to generate neutralizing antibodies to toxin A, the following experiment was performed. This example involved a) expression of the toxin A repeats and subfragments of these repeats in E. coli using a variety of expression vectors; b) identification of recombinant toxin A repeats and sub-regions to which neutralizing antibodies bind; and c) determination of the neutralization ability of antibodies raised against soluble and insoluble toxin A repeat immunogen.
a) Expiression Of The Toxin A Relpeats And Subfragments Of These Repeats In E. coli Using A Vairlety Of Expression Vectors
The Interval 6 immunogen utilized in Examples 15 and 16 was the pMA1870-2680 protein, in which the toxin A repeats are expressed as a soluble fusion protein with the MBP (described in Example 11). Interestingly, expression of this region (from the SpeI site to the end of the repeats, see FIG. 15B) in three other expression constructs, as either native (pPA1870-2680), poly-His tagged �pPA1870-2680 (H)! or biotin-tagged (pBA1870-2680) proteins resulted in completely insoluble protein upon induction of the bacterial host (see FIG. 15B). The host strain BL21 (Novagen) was used for expression of pBA1870-2680 and host strain BL21(DE3) (Novagen) was used for expression of pPA1870-2680 and pPA1870-2680(H). These insoluble proteins accumulated to high levels in inclusion bodies. Expression of recombinant plasmids in E. coli host cells grown in 2.times. YT medium was performed as described �Williams, et al. (1994), supra!.
As summarized in FIG. 15B, expression of fragments of the toxin A repeats (as either N-terminal SpeI-EcoRI fragments, or C-terminal EcoRI-end fragments) also yielded high levels of insoluble protein using pGEX (pGA1870-2190), PinPoint.TM.-Xa (pBA1870-2190 and pBA2250-2680) and pET expression systems (pPA1870-2190). The pGEX and pET expression systems are described in Example 11. The PinPoint.TM.-Xa expression system drives the expression of fusion proteins in E. coli. Fusion proteins from PinPoint.TM.-Xa vectors contain a biotin tag at the amino-terminal end and can be affinity purified SoftLink.TM. Soft Release avidin resin (Promega) under mild denaturing conditions (5 mM biotin).
The solubility of expressed proteins from the pPG1870-2190 and pPA1870-2190 expression constructs was determined after induction of recombinant protein expression under conditions reported to enhance protein solubility �These conditions comprise growth of the host at reduced temperature (30.degree. C.) and the utilization of high (1 mM IPTG) or low (0.1 mM IPTG) concentrations of inducer �Williams et al. (1994), supra!. All expressed recombinant toxin A protein was insoluble under these conditions. Thus, expression of these fragments of the toxin A repeats in pET and pGEX expression vectors results in the production of insoluble recombinant protein even when the host cells are grown at reduced temperature and using lower concentrations of the inducer. Although expression of these fragments in pMal vectors yielded affinity purifiable soluble fusion protein, the protein was either predominantly insoluble (pMA1870-2190) or unstable (pMA2250-2650). Attempts to solubilize expressed protein from the pMA1870-2190 expression construct using reduced temperature or lower inducer concentration (as described above) did not improve fusions protein solubility.
Collectively, these results demonstrate that expression of the toxin A repeat region in E. coli results in the production of insoluble recombinant protein, when expressed as either large (aa 1870-2680) or small (aa 1870-2190 or aa 2250-2680) fragments, in a variety of expression vectors (native or poly-his tagged pET, pCEX or PinPoint.TM.-Xa vectors), utilizing growth conditions shown to enhance protein solubility. The exception to this rule were fusions with the MBP, which enhanced protein solubility, either partially (pMA1870-2190) or fully (pM1870-2680).
b) Identification Of Recombinant Toxin A Repeats And Sub-Regions To Which Neutralizing Antibodies Bind
Toxin A repeat regions to which neutralizing antibodies bind were identified by utilizing recombinant toxin A repeat region proteins expressed as soluble or insoluble proteins to deplete protective antibodies from a polyclonal pool of antibodies against native C. difficile toxin A. An in vivo assay was developed to evaluate proteins for the ability to bind neutralizing antibodies.
The rational for this assay is as follows. Recombinant proteins were first pre-mixed with antibodies against native toxin A (CTA antibody; generated in Example 8) and allowed to react. Subsequently, C. difficile toxin A was added at a concentration lethal to hamsters and the mixture was administered to hamsters via IP injection. If the recombinant protein contains neutralizing epitopes, the CTA antibodies would lose their ability to bind toxin A resulting in diarrhea and/or death of the hamsters.
The assay was performed as follows. The lethal dose of toxin A when delivered orally to nine 40 to 50 g Golden Syrian hamsters (Sasco) was determined to be 10 to 30 .mu.g. The PEG-purified CTA antibody preparation was diluted to 0.5.times. concentration (i.e., the antibodies were diluted at twice the original yolk volume) in 0.1M carbonate buffer, pH 9.5. The antibodies were diluted in carbonate buffer to protect them from acid degradation in the stomach. The concentration of 0.5.times. was used because it was found to be the lowest effective concentration against toxin A. The concentration of Interval 6-specific antibodies in the 0.5.times. CTA prep was estimated to be 10-15 .mu.g/ml (estimated using the method described in Example 15).
The inclusion body preparation �insoluble Interval 6 protein; pPA1870-2680(H)! and the soluble Interval 6 protein �pMA1870-2680; see FIG. 15! were both compared for their ability to bind to neutralizing antibodies against C. difficile toxin A (CTA). Specifically, 1 to 2 mg of recombinant protein was mixed with 5 ml of a 0.5.times. CTA antibody prep (estimated to contain 60-70 .mu.g of Interval 6-specific antibody). After incubation for 1 hr at 37.degree. C., CTA (Tech Lab) at a final concentration of 30 .mu.g/ml was added and incubated for another 1 hr at 37.degree. C. One ml of this mixture containing 30 .mu.g of toxin A (and 10-15 .mu.g of Interval 6-specific antibody) was administered orally to 40-50 g Golden Syrian hamsters (Sasco). Recombinant proteins that result in the loss of neutralizing capacity of the CTA antibody would indicate that those proteins contain neutralizing epitopes. Preimmune and CTA antibodies (both at 0.5.times.) without the addition of any recombinant protein served as negative and positive controls, respectively.
Two other inclusion body preparations, both expressed as insoluble products in the pET vector, were tested; one containing a different insert (toxin B fragment) other than Interval 6 called pPB1850-2070 (see FIG. 18) which serves as a control for insoluble Interval 6, the other was a truncated version of the Interval 6 region called pPA1870-2190 (see FIG. 15B). The results of this experiment are shown in Table 21.
TABLE 21______________________________________Binding Of Neutralizing Antibodies By SolubleInterval 6 Protein Study Outcome After 24 HoursTreatment Group.sup.1 Healthy.sup.2 Diarrhea.sup.3 Dead.sup.4______________________________________Preimmune Ab 0 3 2CTA Ab 4 1 0CTA Ab + Int 6 (soluble) 1 2 2CTA Ab + Int 6 (insoluble) 5 0 0CTA Ab + pPB1850-2070 5 0 0CTA Ab + pPA1870-2190 5 0 0______________________________________ .sup.1 C. difficile toxin A (CTA) was added to each group. .sup.2 Animals showed no signs of illness. .sup.3 Animals developed diarrhea but did not die. .sup.4 Animals developed diarrhea and died.
Preimmune antibody was ineffective against toxin A, while anti-CTA antibodies at a dilute 0.5.times. concentration almost completely protected the hamsters against the enterotoxic effects of CTA. The addition of recombinant proteins pPB1850-2070 or pPA1870-2190 to the anti-CTA antibody had no effect upon its protective ability, indicating that these recombinant proteins do not bind to neutralizing antibodies. On the other hand, recombinant Interval 6 protein was able to bind to neutralizing anti-CTA antibodies and neutralized the in vivo protective effect of the anti-CTA antibodies. Four out of five animals in the group treated with anti-CTA antibodies mixed with soluble Interval 6 protein exhibited toxin associated toxicity (diarrhea and death). Moreover, the results showed that Interval 6 protein must be expressed as a soluble product in order for it to bind to neutralizing anti-CTA antibodies since the addition of insoluble Interval 6 protein had no effect on the neutralizing capacity of the CTA antibody prep.
c) Determination Of Neutralization Ability Of Antibodies Raised Against Soluble And Insoluble Toxin A Repeat Immunogen
To determine if neutralizing antibodies are induced against solubilized inclusion bodies, insoluble toxin A repeat protein was solubilized and specific antibodies were raised in chickens. Insoluble pPA1870-2680 protein was solubilized using the method described in Williams et al. (1994), supra. Briefly, induced cultures (500 ml) were pelleted by centrifugation at 3,000.times.g for 10 min at 4.degree. C. The cell pellets were resuspended thoroughly in 10 ml of inclusion body sonication buffer (25 mM HEPES pH 7.7, 100 mM KCl, 12.5 mM MgCl.sub.2, 20% glycerol, 0.1% (v/v) Nonidet P-40, 1 mM DTT). The suspension was transferred to a 30 ml non-glass centrifuge tube. Five hundred .mu.l of 10 mg/ml lysozyme was added and the tubes were incubated on ice for 30 min. The suspension was then frozen at -70.degree. C. for at least 1 hr. The suspension was thawed rapidly in a water bath at room temperature and then placed on ice. The suspension was then sonicated using at least eight 15 sec bursts of the microprobe (Branson Sonicator Model No. 450) with intermittent cooling on ice.
The sonicated suspension was transferred to a 35 ml Oakridge tube and centrifuged at 6,000.times.g for 10 min at 4.degree. C. to pellet the inclusion bodies. The pellet was washed 2 times by pipetting or vortexing in fresh, ice-cold RIPA buffer �0.1% SDS, 1% Triton X-100, 1% sodium deoxycholate in TBS (25 mM Tris-Cl pH 7.5, 150 mM NaCl)!. The inclusion bodies were recentrifuged after each wash. The inclusion bodies were dried and transferred using a small metal spatula to a 15 ml tube (Falcon). One ml of 10% SDS was added and the pellet was solubilized by gently pipetting the solution up and down using a 1 ml micropipettor. The solubilization was facilitated by heating the sample to 95.degree. C. when necessary.
Once the inclusion bodies were in solution, the samples were diluted with 9 volumes of PBS. The protein solutions were dialyzed overnight against a 100-fold volume of PBS containing 0.05% SDS at room temperature. The dialysis buffer was then changed to PBS containing 0.01% SDS and the samples were dialyzed for several hours to overnight at room temperature. The samples were stored at 4.degree. C. until used. Prior to further use, the samples were warmed to room temperature to allow any precipitated SDS to go back into solution.
The inclusion body preparation was used to immunize hens. The protein was dialyzed into PBS and emulsified with approximately equal volumes of CFA for the initial immunization or IFA for subsequent booster immunizations. On day zero, for each of the recombinant recombinant preparations, two egg laying white Leghorn hens were each injected at multiple sites (IM and SC) with 1 ml of recombinant protein-adjuvant mixture containing approximately 0.5-1.5 mg of recombinant protein. Booster immunizations of 1.0 mg were given of days 14 and day 28. Eggs were collected on day 32 and the antibody isolated using PEG as described in Example 14(a). High titers of toxin A specific antibodies were present (as assayed by ELISA, using the method described in Example 13). Titers were determined for both antibodies against recombinant polypeptides pPA1870-2680 and pl870-2680 and were found to be comparable at >1:62,500.
Antibodies against soluble Interval 6 (pMA1870-2680) and insoluble Interval 6 �(inclusion body), pPA1870-2680! were tested for neutralizing ability against toxin A using the in vivo assay described in Example 15(b). Preimmune antibodies and antibodies against toxin A (CTA) served as negative and positive controls, respectively. The results are shown in Table 22.
TABLE 22______________________________________Neutralization Of Toxin A By Antibodies AgainstSoluble Interval 6 Protein Study Outcome After 24 HoursAntibody Treatment Group Healthy.sup.1 Diarrhea.sup.2 Dead.sup.3______________________________________Preimmune 1 0 4CTA 5 0 0Interval 6 (Soluble).sup.4 5 0 0Interval 6 (Insoluble) 0 2 3______________________________________ .sup.1 Animals showed no sign of illness. .sup.2 Animal developed diarrhea but did not die. .sup.3 Animal developed diarrhea and died. .sup.4 400 .mu.g/ml.
Antibodies raised against native toxin A were protective while preimmune antibodies had little effect. As found using the in vitro CHO assay �described in Example 8(d)! where antibodies raised against the soluble Interval 6 could partially neutralize the effects of toxin A, here they were able to completely neutralize toxin A in vivo. In contrast, the antibodies raised against the insoluble Interval 6 was unable to neutralize the effects of toxin A in vivo as shown above (Table 22) and in vitro as shown in the CHO assay �described in Example 8(d)!.
These results demonstrate that soluble toxin A repeat immunogen is necessary to induce the production of neutralizing antibodies in chickens, and that the generation of such soluble immunogen is obtained only with a specific expression vector (pMal) containing the toxin A region spanning aa 1870-2680. That is to say, insoluble protein that is subsequently solubilized does not result in a toxin A antigen that will elicit a neutralizing antibody.
EXAMPLE 18
Cloning And Expression Of The C. difficile Toxin B Gene
The toxin B gene has been cloned and sequenced; the amino acid sequence deduced from the cloned nucleotide sequence predicts a MW of 269.7 kD for toxin B �Barroso et al., Nucl. Acids Res. 18:4004 (1990)!. The nucleotide sequence of the coding region of the entire toxin B gene is listed in SEQ ID NO:9. The amino acid sequence of the entire toxin B protein is listed in SEQ ID NO:10. The amino acid sequence consisting of amino acid residues 1850 through 2360 of toxin B is listed in SEQ ID NO:11. The amino acid sequence consisting of amino acid residues 1750 through 2360 of toxin B is listed in SEQ ID NO:12.
Given the expense and difficulty of isolating native toxin B protein, it would be advantageous to use simple and inexpensive procaryotic expression systems to produce and purify high levels of recombinant toxin B protein for immunization purposes. Ideally, the isolated recombinant protein would be soluble in order to preserve native antigenicity, since solubilized inclusion body proteins often do not fold into native conformations. Indeed as shown in Example 17, neutralizing antibodies against recombinant toxin A were only obtained when soluble recombinant toxin A polypeptides were used as the immunogen. To allow ease of purification, the recombinant protein should be expressed to levels greater than 1 mg/liter of E. coli culture.
To determine whether high levels of recombinant toxin B protein could be produced in E. coli, fragments of the toxin B gene were cloned into various prokaryotic expression vectors, and assessed for the ability to express recombinant toxin B protein in E. coli. This Example involved (a) cloning of the toxin B gene and (b) expression of the toxin B gene in E. coli.
a) Cloning Of The Toxin B Gene
The toxin B gene was cloned using PCR amplification from C. difficile genomic DNA. Initially, the gene was cloned in two overlapping fragments, using primer pairs P5/P6 and P7/P8. The location of these primers along the toxin B gene is shown schematically in FIG. 18. The sequence of each of these primers is: P5: 5' TAGAAAAAATGGCAAATGT 3' (SEQ ID NO:11); P6: 5' TTTCATCTTGTA GAGTCAAAG 3' (SEQ ID NO:12); P7: 5' GATGCCACAAGATGATTTAGTG 3' (SEQ ID NO:13); and P8: 5' CTAATTGAGCTGTATCAGGATC 3' (SEQ ID NO:14).
FIG. 18 also shows the location of the following primers along the toxin B gene: P9 which consists of the sequence 5' CGGAATTCCTAGAAAAAATGGCAA ATG 3' (SEQ ID NO:15); P10 which consists of the sequence 5' GCTCTAGAATGA CCATAAGCTAGCCA 3' (SEQ ID NO:16); P11 which consists of the sequence 5' CGGAATTCGAGTTGGTAGAAAGGTGGA 3' (SEQ ID NO:17); P13 which consists of the sequence 5' CGGAATTCGGTTATTATCTTAAGGATG 3' (SEQ ID NO:18); and P14 which consists of the sequence 5' CGGAATTCTTGATAACTGGAT TTGTGAC 3' (SEQ ID NO:19). The amino acid sequence consisting of amino acid residues 1852 through 2362 of toxin B is listed in SEQ ID NO:20. The amino acid sequence consisting of amino acid residues 1755 through 2362 of toxin B is listed in SEQ ID NO:21.
Clostridium difficile VPI strain 10463 was obtained from the American Type Culture Collection (ATCC 43255) and grown under anaerobic conditions in brain-heart infusion medium (Becton Dickinson). High molecular-weight C. difficile DNA was isolated essentially as described �Wren and Tabaqchali (1987) J. Clin. Microbiol., 25:2402!, except 1) 100 .mu.g/ml proteinase K in 0.5% SDS was used to disrupt the bacteria and 2) cetytrimethylammonium bromide (CTAB) precipitation �as described by Ausubel et al., Eds., Current Protocols in Molecular Biology, Vol. 2 (1989) Current Protocols! was used to remove carbohydrates from the cleared lysate. Briefly, after disruption of the bacteria with proteinase K and SDS, the solution is adjusted to approximately 0.7M NaCl by the addition of a 1/7 volume of 5M NaCl. A 1/10 volume of CTAB/NaCl (10% CTAB in 0.7M NaCl) solution was added and the solution was mixed thoroughly and incubated 10 min at 65.degree. C. An equal volume of chloroform/isoamyl alcohol (24:1) was added and the phases were thoroughly mixed. The organic and aqueous phases were separated by centrifugation in a microfuge for 5 min. The aqueous supernatant was removed and extracted with phenol/chloroform/isoamyl alcohol (25:24:1). The phases were separated by centrifugation in a microfuge for 5 min. The supernatant was transferred to a fresh tube and the DNA was precipitated with isopropanol. The DNA precipitate was pelleted by brief centrifugation in a microfuge. The DNA pellet was washed with 70% ethanol to remove residual CTAB. The DNA pellet was then dried and redissolved in TE buffer (10 mM Tris-HCl pH8.0, 1 mM EDTA). The integrity and yield of genomic DNA was assessed by comparison with a serial dilution of uncut lambda DNA after electrophoresis on an agarose gel.
Toxin B fragments were cloned by PCR utilizing a proofreading thermostable DNA polymerase �native Pfu polymerase (Stratagene)!. The high fidelity of this polymerase reduces the mutation problems associated with amplification by error prone polymerases (e.g., Taq polymerase). PCR amplification was performed using the PCR primer pairs P5 (SEQ ID NO:11) with P6 (SEQ ID NO:12) and P7 (SEQ ID NO:13) with P8 (SEQ ID NO:14) in 50 .mu.l reactions containing 10 mM Tris-HCl pH8.3, 50 mM KCl, 1.5 mM MgCl.sub.2, 200 .mu.M of each dNTP, 0.2 .mu.M each primer, and 50 ng C. difficile genomic DNA. Reactions were overlaid with 100 .mu.l mineral oil, heated to 94.degree. C. for 4 min, 0.5 .mu.l native Pfu polymerase (Stratagene) was added, and the reactions were cycled 30 times at 94.degree. C. for 1 min, 50.degree. C for 1 min, 72.degree. C. (2 min for each kb of sequence to be amplified), followed by 10 min at 72.degree. C. Duplicate reactions were pooled, chloroform extracted, and ethanol precipitated. After washing in 70% ethanol, the pellets were resuspended in 50 .mu.l TE buffer (10 mM Tris-HCl pH8.0, 1 mM EDTA).
The P5/P6 amplification product was cloned into pUC19 as outlined below. 10 .mu.l aliquots of DNA were gel purified using the Prep-a-Gene kit (BioRad), and ligated to SmaI restricted pUC19 vector. Recombinant clones were isolated and confirmed by restriction digestion using standard recombinant molecular biology techniques (Sambrook et al., 1989). Inserts from two independent isolates were identified in which the toxin B insert was oriented such that the vector BamHI and SacI sites were 5' and 3' oriented, respectively (pUCB10-1530). The insert-containing BamHI/SacI fragment was cloned into similarly cut pET23a-c vector DNA, and protein expression was induced in small scale cultures (5 ml) of identified clones.
Total protein extracts were isolated, resolved on SDS-PAGE gels, and toxin B protein identified by Western analysis utilizing a goat anti-toxin B affinity purified antibody (Tech Lab). Procedures for protein induction, SDS-PAGE, and Western blot analysis were performed as described in Williams et al. (1994), supra. In brief, 5 ml cultures of bacteria grown in 2.times. YT containing 100 .mu.g/ml ampicillin containing the appropriate recombinant clone were induced to express recombinant protein by addition of IPTG to 1 mM. The E. coli hosts used were: BL21(DE3) or BL21(DE3)LysS (Novagen) for pET plasmids.
Cultures were induced by the addition of IPTG to a final concentration of 1.0 mM when the cell density reached 0.5 OD.sub.600, and induced protein was allowed to accumulate for two hrs after induction. Protein samples were prepared by pelleting 1 ml aliquots of bacteria by centrifugation (1 min in microfuge), and resuspension of the pelleted bacteria in 150 .mu.l of 2.times.SDS-PAGE sample buffer (0.125 mM Tris-HCl pH 6.8, 2 mM EDTA, 6% SDS, 20% glycerol, 0.025% bromophenol blue; .beta.-mercaptoethanol is added to 5% before use). The samples were heated to 95.degree. C. for 5 min, then cooled and 5 or 10 .mu.ls loaded on 7.5% SDS-PAGE gels. High molecular weight protein markers (BioRad) were also loaded, to allow estimation of the MW of identified fusion proteins. After electrophoresis, protein was detected either generally by staining the gels with Coomassie Blue, or specifically, by blotting to nitrocellulose for Western blot detection of specific immunoreactive protein. The MW of induced toxin B reactive protein allowed the integrity of the toxin B reading frame to be determined.
The pET23b recombinant (pPB10-1530) expressed high MW recombinant toxin B reactive protein, consistent with predicted values. This confirmed that frame terminating errors had not occurred during PCR amplification. A pET23b expression clone containing the 10-1750aa interval of the toxin B gene was constructed, by fusion of the EcoRV-SpeI fragment of the P7/P8 amplification product to the P5-EcoRV interval of the P5/P6 amplification product (see FIG. 18) in pPB10-1530. The integrity of this clone (pPBI10-1750) was confirmed by restriction mapping, and Western blot detection of expressed recombinant toxin B protein. Levels of induced protein from both pPB10-1530 and pPB10-1750 were too low to facilitate purification of usable amounts of recombinant toxin B protein. The remaining 1750-2360 aa interval was directly cloned into pMAL or pET expression vectors from the P7/P8 amplification product as described below.
b) Expression Of The Toxin B Gene
i) Overview Of Expression Methodologies
Fragments of the toxin B gene were expressed as either native or fusion proteins in E. coli. Native proteins were expressed in either the pET23a-c or pET16b expression vectors (Novagen). The pET23 vectors contain an extensive polylinker sequence in all three reading frames (a-c vectors) followed by a C-terminal poly-histidine repeat. The pET16b vector contains a N-terminal poly-histidine sequence immediately 5' to a small polylinker. The poly-histidine sequence binds to Ni-Chelate columns and allows affinity purification of tagged target proteins �Williams et al. (1994), supra!. These affinity tags are small (10 aa for pET16b, 6 aa for pET23) allowing the expression and affinity purification of native proteins with only limited amounts of foreign sequences.
An N-terminal histidine-tagged derivative of pET16b containing an extensive cloning cassette was constructed to facilitate cloning of N-terminal poly-histidine tagged toxin B expressing constructs. This was accomplished by replacement of the promoter region of the pET23a and b vectors with that of the pET16b expression vector. Each vector was restricted with BglII and NdeI, and the reactions resolved on a 1.2% agarose gel. The pET16b promoter region (contained in a 200 bp BglII-NdeI fragment) and the promoter-less pET23a or b vectors were cut from the gel, mixed and Prep-A-Gene (BioRad) purified. The eluted DNA was ligated, and transformants screened for promoter replacement by NcoI digestion of purified plasmid DNA (the pETl16b promoter contains this site, the pET23 promoter does not). These clones (denoted pETHisa or b) contain the pET16b promoter (consisting of a pT7-lac promoter, ribosome binding site and poly-histidine (10aa) sequence) fused at the NdeI site to the extensive pET23 polylinker.
All MBP fusion proteins were constructed and expressed in the pMAL.TM.-c or pMAL.TM.-p2 vectors (New England Biolabs) in which the protein of interest is expressed as a C-terminal fusion with MBP. All pET plasmids were expressed in either the BL21(DE3) or BL21(DE3)LysS expression hosts, while pMal plasmids were expressed in the BL21 host.
Large scale (500 mls to 1 liter) cultures of each recombinant were grown in 2.times. YT broth, induced, and soluble protein fractions were isolated as described �Williams, et al. (1994), supra!. The soluble protein extracts were affinity chromatographed to isolate recombinant fusion protein, as described �Williams et al., (1994) supra!. In brief, extracts containing tagged pET fusions were chromatographed on a nickel chelate column, and eluted using imidazole salts or low pH (pH 4.0) as described by the distributor (Novagen or Qiagen). Extracts containing soluble pMAL fusion protein were prepared and chromatographed in PBS buffer over an amylose resin (New England Biolabs) column, and eluted with PBS containing 10 mM maltose as described �Williams et al. (1994), supra!.
ii) Overview Of Toxin B Expression
In both large expression constructs described in (a) above, only low level (i.e., less than 1 mg/liter of intact or nondegraded recombinant protein) expression of recombinant protein was detected. A number of expression constructs containing smaller fragments of the toxin B gene were then constructed, to determine if small regions of the gene can be expressed to high levels (i.e., greater than 1 mg/liter intact protein) without extensive protein degradation. All were constructed by in frame fusions of convenient toxin B restriction fragments to either the pMAL-c, pET23a-c, pET 16b or pETHisa-b expression vectors, or by engineering restriction sites at specific locations using PCR amplification �using the same conditions described in (a) above!. In all cases, clones were verified by restriction mapping, and, where indicated, DNA sequencing.
Protein preparations from induced cultures of each of these constructs were analyzed, by SDS-PAGE, to estimate protein stability (Coomassie Blue staining) and immunoreactivity against anti-toxin B specific antiserum (Western analysis). Higher levels of intact (i.e., nondegraded), full length fusion proteins were observed with the smaller constructs as compared with the larger recombinants, and a series of expression constructs spanning the entire toxin B gene were constructed (FIGS. 18, 19 and 20 and Table 23).
Constructs that expressed significant levels of recombinant toxin B protein (greater than 1 mg/liter intact recombinant protein) in E. coli were identified and a series of these clones that spans the toxin B gene are shown in FIG. 19 and summarized in Table 23. These clones were utilized to isolate pure toxin B recombinant protein from the entire toxin B gene. Significant protein yields were obtained from pMAL expression constructs spanning the entire toxin B gene, and yields of full length soluble fusion protein ranged from an estimated 1 mg/liter culture (pMB1100-1530) to greater than 20 mg/liter culture (pMB 1750-2360).
Representative purifications of MBP and poly-histidine-tagged toxin B recombinants are shown in FIGS. 21 and 22. FIG. 21 shows a Coomassie Blue stained 7.5% SDS-PAGE gel on which various protein samples extracted from bacteria harboring pMB1850-2360 were electrophoresed. Samples were loaded as follows: Lane 1: protein extracted from uninduced culture; Lane 2: induced culture protein; Lane 3: total protein from induced culture after sonication; Lane 4: soluble protein; and Lane 5: eluted affinity purified protein. FIG. 22 depicts the purification of recombinant proteins expressed in bacteria harboring either pPB1850-2360 (Lanes 1-3) or pPB1750-2360 (Lanes 4-6). Samples were loaded as follows: uninduced total protein (Lanes 1 and 4); induced total protein (Lanes 2 and 5); and eluted affinity purified protein (Lanes 3 and 6). The broad range molecular weight protein markers (BioRad) are shown in Lane 7.
Thus, although high level expression was not attained using large expression constructs from the toxin B gene, usable levels of recombinant protein were obtained by isolating induced protein from a series of smaller pMAL expression constructs that span the entire toxin B gene.
These results represent the first demonstration of the feasibility of expressing recombinant toxin B protein to high levels in E. coli. As well, expression of small regions of the putative ligand binding domain (repeat region) of toxin B as native protein yielded insoluble protein, while large constructs, or fusions to MBP were soluble (FIG. 19), demonstrating that specific methodologies are necessary to produce soluble fusion protein from this interval.
iii) Clone Construction And Expression Details
A portion of the toxin B gene containing the toxin B repeat region �amino acid residues 1852-2362 of toxin B (SEQ ID NO:20)! was isolated by PCR amplification of this interval of the toxin B gene from C. difficile genomic DNA. The sequence, and location within the toxin B gene, of the two PCR primers �P7 (SEQ ID NO:13) and P8 (SEQ ID NO: 14)! used to amplify this region are shown in FIG. 18.
DNA from the PCR amplification was purified by chloroform extraction and ethanol precipitation as described above. The DNA was restricted with SpeI, and the cleaved DNA was resolved by agarose gel electrophoresis. The restriction digestion with SpeI cleaved the 3.6 kb amplification product into a 1.8 kb doublet band. This doublet band was cut from the gel and mixed with appropriately cut, gel purified pMALc or pET23b vector. These vectors were prepared by digestion with HindIII, filling in the overhanging ends using the Klenow enzyme, and cleaving with XbaI (pMALc) or NheI (pET23b). The gel purified DNA fragments were purified using the Prep-A-Gene kit (BioRad) and the DNA was ligated, transformed and putative recombinant clones analyzed by restriction mapping.
pET and pMal clones containing the toxin B repeat insert (aa interval 1750-2360 of toxin B) were verified by restriction mapping, using enzymes that cleaved specific sites within the toxin B region. In both cases fusion of the toxin B SpeI site with either the compatible XbaI site (pMal) or compatible NheI site (pET) is predicted to create an in frame fusion. This was confirmed in the case of the pMB1750-2360 clone by DNA sequencing of the clone junction and 5' end of the toxin B insert using a MBP specific primer (New England Biolabs). In the case of the pET construct, the fusion of the blunt ended toxin B 3' end to the filled HindIII site should create an in-frame fusion with the C-terminal poly-histidine sequence in this vector. The pPB1750-2360 clone selected had lost, as predicted, the HindIII site at this clone junction; this eliminated the possibility that an additional adenosine residue was added to the 3' end of the PCR product by a terminal transferase activity of the Pfu polymerase, since fusion of this adenosine residue to the filled HindIII site would regenerate the restriction site (and was observed in several clones).
One liter cultures of each expression construct were grown, and fusion protein purified by affinity chromatography on either an amylose resin column (pMAL constructs; resin supplied by New England Biolabs) or Ni-chelate column (pET constructs; resin supplied by Qiagen or Novagen) as described �Williams et al. (1994), supra!. The integrity and purity of the fusion proteins were determined by Coomassie staining of SDS-PAGE protein gels as well as Western blot analysis with either an affinity purified goat polyclonal antiserum (Tech Lab), or a chicken polyclonal PEG prep, raised against the toxin B protein (CTB) as described above in Example 8. In both cases, affinity purification resulted in yields in excess of 20 mg protein per liter culture, of which greater than 90% was estimated to be full-length recombinant protein. It should be noted that the poly-histidine affinity tagged protein was released from the Qiagen Ni-NTA resin at low imidazole concentration (60 mM), necessitating the use of a 40 mM imidazole rather than a 60 mM imidazole wash step during purification.
A periplasmically secreted version of pMB1750-2360 was constructed by replacement of the promoter and MBP coding region of this construct with that from a related vector (pMAL.TM.-p2; New England Biolabs) in which a signal sequence is present at the N-terminus of the MBP, such that fusion protein is exported. This was accomplished by substituting a BglII-EcoRV promoter fragment from pMAL-p2 into pMB1750-2360. The yields of secreted, affinity purified protein (recovered from osmotic shock extracts as described by Riggs in Current Protocols in Molecular Biology, Vol. 2, Ausubel, et al., Eds. (1989), Current Protocols, pp. 16.6.1-16.6.14! from this vector (pMBp1750-2360) were 6.5 mg/liter culture, of which 50% was estimated to be full-length fusion protein.
The interval was also expressed in two non-overlapping fragments. pMB1750-1970 was constructed by introduction of a frameshift into pMB1750-2360, by restriction with HindIII, filling in the overhanging ends and religation of the plasmid. Recombinant clones were selected by loss of the HindIII site, and further restriction map analysis. Recombinant protein expression from this vector was more than 20 mg/liter of greater than 90% pure protein.
The complementary region was expressed in pMB1970-2360. This construct was created by removal of the 1750-1970 interval of pMB1750-2360. This was accomplished by restriction of this plasmid with EcoRI (in the pMalc polylinker 5' to the insert) and III, filling in the overhanging ends, and religation of the plasmid. The resultant plasmid, pMB1970-2360, was made using both intracellularly and secreted versions of the pMB1750-2360 vector.
No fusion protein was secreted in the pMBp1970-2360 version, perhaps due to a conformational constraint that prevents export of the fusion protein. However, the intracellularly expressed vector produced greater than 40 mg/liter of greater than 90% full-length fusion protein.
Constructs to precisely express the toxin B repeats in either pMalc (pNB 1850-2360) or pET16b (pPB1850-2360) were constructed as follows. The DNA interval including the toxin B repeats was PCR amplified as described above utilizing PCR primers P14 (SEQ ID NO:19) and P8 (SEQ ID NO:14). Primer P14 adds a EcoRI site immediately flanking the start of the toxin B repeats.
The amplified fragment was cloned into the pT7 Blue T-vector (Novagen) and recombinant clones in which single copies of the PCR fragment were inserted in either orientation were selected (pT71850-2360) and confirmed by restriction mapping. The insert was excised from two appropriately oriented independently isolated pT71850-2360 plasmids, with EcoRI (5' end of repeats) and PstI (in the flanking polylinker of the vector), and cloned into EcoRI/PstI cleaved pMalc vector. The resulting construct (pMB1850-2360) was confirmed by restriction analysis, and yielded 20 mg/l of soluble fusion protein �greater than 90% intact (i.e., nondegraded)! after affinity chromatography. Restriction of this plasmid with HindIII and religation of the vector resulted in the removal of the 1970-2360 interval. The resultant construct (pMB1850-1970) expressed greater than 70 mg/liter of 90% full length fusion protein.
The pPB1850-2360 construct was made by cloning a EcoRI (filled with Klenow)-BamHI fragment from a pT71850-2360 vector (opposite orientation to that used in the pMB1850-2360 construction) into NdeI (filled)/BamHI cleaved pET16b vector. Yields of affinity purified soluble fusion protein were 15 mg/liter, of greater than 90% full length fusion protein.
Several smaller expression constructs from the 1750-2070 interval were also constructed in His-tagged pET vectors, but expression of these plasmids in the BL21 (DE3) host resulted in the production of high levels of mostly insoluble protein (see Table 23 and FIG. 19). These constructs were made as follows.
pPB1850-1970 was constructed by cloning a BglII-HindIII fragment of pPB1850-2360 into BglII/HindIII cleaved pET23b vector. pPB1850-2070 was constructed by cloning a BglII-PvuII fragment of pPB1850-2360 into BglII/HindIII cleaved pET23b vector. pPB1750-1970(c) was constructed by removal of the internal HindIII fragment of a pPB1750-2360 vector in which the vector HindIII site was regenerated during cloning (presumably by the addition of an A residue to the amplified PCR product by terminal transferase activity of Pfu polymerase). The pPB1750-1970(n) construct was made by insertion of the insert containing the NdeI-HindIII fragment of pPB1750-2360 into identically cleaved pETHisb vector. All constructs were confirmed by restriction digestion.
An expression construct that directs expression of the 10-470 aa interval of toxin B was constructed in the pMalc vector as follows. A NheI (a site 5' to the insert in the pET23 vector)-AflII (filled) fragment of the toxin B gene from pPB10-1530 was cloned into XbaI (compatible with NheI)/HindIII (filled) pMalc vector. The integrity of the construct (pMB10-470) was verified by restriction mapping and DNA sequencing of the 5' clone junction using a MBP specific DNA primer (New England Biolabs). However, all expressed protein was degraded to the MBP monomer MW.
A second construct spanning this interval (aa 10-470) was constructed by cloning the PCR amplification product from a reaction containing the P9 (SEQ ID NO:15) and P10 (SEQ ID NO:16) primers (FIG. 18) into the pETHisa vector. This was accomplished by cloning the PCR product as an EcoRI-blunt fragment into EcoRI-HindIII restricted vector DNA; recombinant clones were verified by restriction mapping. Although this construct (pPB 10-520) allowed expression and purification (utilizing the N-terminal polyhistidine affinity tag) of intact fusion protein, yields were estimated at less than 500 .mu.g per liter culture.
Higher yield of recombinant protein from this interval (aa 10-520) were obtained by expression of the interval in two overlapping clones. The 10-330aa interval was cloned in both pETHisa and pMalc vectors, using the BamHI-AflIII (filled) DNA fragment from pPB10-520. This fragment was cloned into BamHI-HindIII (filled) restricted pMalc or BamHI-HincII restricted pETHisa vector. Recombinant clones were verified by restriction mapping. High level expression of either insoluble (pET) or soluble (pMal) fusion protein was obtained. Total yields of fusion protein from the pMB10-330 construct (FIG. 18) were 20 mg/liter culture, of which 10% was estimated to be full-length fusion protein. Although yields of this interval were higher and >90% full-length recombinant protein produced when expressed from the pET construct, the pMal fusion was utilized since the expressed protein was soluble and thus more likely to have the native conformation.
The pMB260-520 clone was constructed by cloning EcoRI-XbaI cleaved amplified DNA from a PCR reaction containing the P11 (SEQ ID NO:17) and P10 (SEQ ID NO:16) DNA primers (!FIG. 18) into similarly restricted pMalc vector. Yields of affinity purified protein were 10 mg/liter, of which approximately 50% was estimated to be full-length recombinant protein.
The aa510-1110 interval was expressed as described below. This entire interval was expressed as a pMal fusion by cloning the NheI-HindIII fragment of pUCB 10-1530 into XbaI-HindIII cleaved pMalc vector. The integrity of the construct (pMB510-1110) was verified by restriction mapping and DNA sequencing of the 5' clone junction using a MBP specific DNA primer. The yield of affinity purified protein was 25 mg/liter culture, of which 5% was estimated to be full-length fusion protein (1 mg/liter).
To attempt to obtain higher yields, this region was expressed in two fragments (aa510-820, and 820-1110) in the pMalc vector. The pMB510-820 clone was constructed by insertion of a SacI (in the pMalc polylinker 5' to the insert)-HpaI DNA fragment from pMB510-1110 into SacI/StuI restricted pMalc vector. The pMB820-1110 vector was constructed by insertion of the HpaI-HindIII fragment of pUCB10-1530 into BamHI (filled)/HindIII cleaved pMalc vector. The integrity of these constructs were verified by restriction mapping and DNA sequencing of the 5' clone junction using a MBP specific DNA primer.
Recombinant protein expressed from the pMB510-820 vector was highly unstable. However, high levels (20 mg/liter) of >90% full-length fusion protein were obtained from the pMB820-1105 construct. The combination of partially degraded pMB510-1110 protein (enriched for the 510-820 interval) with the pMB820-1110 protein provides usable amounts of recombinant antigen from this interval.
The aa1100-1750 interval was expressed as described below. The entire interval was expressed in the pMalc vector from a construct in which the AccI(filled)-SpeI fragment of pPB10-1750 was inserted into StuI/XbaI (XbaI is compatible with SpeI; StuI and filled AccI sites are both blunt ended) restricted pMalc. The integrity of this construct (pMB 1100-1750) was verified by restriction mapping and DNA sequencing of the clone junction using a MBP specific DNA primer. Although 15 mg/liter of affinity purified protein was isolated from cells harboring this construct, the protein was greater than 99% degraded to MBP monomer size.
A smaller derivative of pMB 1100-1750 was constructed by restriction of pMB1100-1750 with AflII and SalI (in the pMalc polylinker 3' to the insert), filling in the overhanging ends, and religating the plasmid. The resultant clone (verified by restriction digestion and DNA sequencing) has deleted the aal530-1750 interval, was designated pMB1100-1530. pMB1100-1530 expressed recombinant protein at a yield of greater than 40 mg/liter, of which 5% was estimated to be full-length fusion protein.
Three constructs were made to express the remaining interval. Initially, a BspHI (filled)-SpeI fragment from pPB10-1750 was cloned into EcoRI(filled)/XbaI cleaved pMalc vector. The integrity of this construct (pMB1570-1750) was verified by restriction mapping and DNA sequencing of the 5' clone junction using a MBP specific DNA primer. Expression of recombinant protein from this plasmid was very low, approximately 3 mg affinity purified protein per liter, and most was degraded to MBP monomer size. This region was subsequently expressed from a PCR amplified DNA fragment. A PCR reaction utilizing primers P13 �SEQ ID NO:18; P13 was engineered to introduce an EcoRI site 5' to amplified toxin B sequences! and P8 (SEQ ID NO: 14) was performed on C. difficile genomic DNA as described above. The amplified fragment was cleaved with EcoRI and SpeI, and cloned into EcoRI/XbaI cleaved pMalc vector. The resultant clone (pMB1530-1750) was verified by restriction map analysis, and recombinant protein was expressed and purified. The yield was greater than 20 mg protein per liter culture and it was estimated that 25% was full-length fusion protein; this was a significantly higher yield than the original pMB1570-1750 clone. The insert of pMB1530-1750 (in a EcoRI-SalI fragment) was transferred to the pETHisa vector (EcoRI/XhoI cleaved, XhoI and SalI ends are compatible). No detectable fusion protein was purified on Ni-Chelate columns from soluble lysates of cells induced to express fusion protein from this construct.
TABLE 23______________________________________Summary Of Toxin B Expression Constructs.sup.aClone Affinity Tag Yield (mg/liter) % Full Length______________________________________pPB10-1750 none low (estimated from ? Western blot hyb.)pPB10-1530 none low (as above) ?pMB10-470 MBP 15 mg/l 0%pPB10-520 poly-his 0.5 mg/l 20%pPB10-330 poly-his >20 mg/l (insoluble) 90%pMB10-330 MBP 20 mg/l 10%pMB260-520 MBP 10 mg/l 50%pMB510-1110 MBP 25 mg/l 5%pMB510-820 MBP degraded (by Western blot hyb)pMB820-1110 MBP 20 mg/l 90%pMB1100-1750 MBP 15 mg/l 0%pMB1100-1530 MBP 40 mg/l 5%pMB1570-1750 MBP 3 mg/l <5%pPB1530-1750 poly-his no purified ? protein detectedpMB1530-1750 MBP 20 mg/l 25%pMB1750-2360 MBP >20 mg/l >90%pMBp1750-2360 MBP 6.5 mg/l (secreted) 50%pPB1750-2360 poly-his >20 mg/l >90%pMB1750-1970 MBP >20 mg/l >90%pMB1970-2360 MBP 40 mg/l >90%pMBp1970-2360 MBP (no secretion) NApMB1850-2360 MBP 20 mg/l >90%pPB1850-2360 poly-his 15 mg/l >90%pMB1850-1970 MBP 70 mg/l >90%pPB1850-1970 poly-his >10 mg/l (insoluble) >90%pPB1850-2070 poly-his >10 mg/l (insoluble) >90%pPB1750-1970(c) poly-his >10 mg/l (insoluble) >90%pPB1750-1970(n) poly-his >10 mg/l (insoluble) >90%______________________________________ .sup.a Clones in italics are clones currently utilized to purify recombinant protein from each selected interval.
EXAMPLE 19
Identification, Purification And Induction Of Neutralizing Antibodies Against Recombinant C. difficile Toxin B Protein
To determine whether recombinant toxin B polypeptide fragments can generate neutralizing antibodies, typically animals would first be immunized with recombinant proteins and anti-recombinant antibodies are generated. These anti-recombinant protein antibodies are then tested for neutralizing ability in vivo or in vitro. Depending on the immunogenic nature of the recombinant polypeptide, the generation of high-titer antibodies against that protein may take several months. To accelerate this process and identify which recombinant polypeptide(s) may be the best candidate to generate neutralizing antibodies, depletion studies were performed. Specifically, recombinant toxin B polypeptide were pre-screened by testing whether they have the ability to bind to protective antibodies from a CTB antibody preparation and hence deplete those antibodies of their neutralizing capacity. Those recombinant polypeptides found to bind CTB, were then utilized to generate neutralizing antibodies. This Example involved: a) identification of recombinant sub-regions within toxin B to which neutralizing antibodies bind; b) identification of toxin B sub-region specific antibodies that neutralize toxin B in vivo; and c) generation and evaluation of antibodies reactive to recombinant toxin B polypeptides.
a) Identification Of Recombinant Sub-Regions Within Toxin B To Which Neutralizing Antibodies Bind
Sub-regions within toxin B to which neutralizing antibodies bind were identified by utilizing recombinant toxin B proteins to deplete protective antibodies from a polyclonal pool of antibodies against native C. difficile toxin B. An in vivo assay was developed to evaluate protein preparations for the ability to bind neutralizing antibodies. Recombinant proteins were first pre-mixed with antibodies directed against native toxin B (CTB antibody; see Example 8) and allowed to react for one hour at 37.degree. C. Subsequently, C. difficile toxin B (CTB; Tech Lab) was added at a concentration lethal to hamsters and incubated for another hour at 37.degree. C. After incubation this mixture was injected intraperitoneally (IP) into hamsters. If the recombinant polypeptide contains neutralizing epitopes, the CTB antibodies will lose its ability to protect the hamsters against death from CTB. If partial or complete protection occurs with the CTB antibody-recombinant mixture, that recombinant contains only weak or non-neutralizing epitopes of toxin B. This assay was performed as follows.
Antibodies against CTB were generated in egg laying Leghorn hens as described in Example 8. The lethal dosage (LD.sub.100) of C. difficile toxin B when delivered I.P. into 40 g female Golden Syrian hamsters (Charles River) was determined to be 2.5 to 5 .mu.g. Antibodies generated against CTB and purified by PEG precipitation could completely protect the hamsters at the I.P. dosage determined above. The minimal amount of CTB antibody needed to afford good protection against 5 .mu.g of CTB when injected I.P. into hamsters was also determined (1.times. PEG prep). These experiments defined the parameters needed to test whether a given recombinant protein could deplete protective CTB antibodies.
The cloned regions tested for neutralizing ability cover the entire toxin B gene and were designated as Intervals (INT) 1 through 5 (see FIG. 19). Approximately equivalent final concentrations of each recombinant polypeptide were tested. The following recombinant polypeptides were used: 1) a mixture of intervals 1 and 2 (INT-1,2); 2) a mixture of Intervals 4 and 5 (INT-4, 5) and 3) Interval 3 (INT-3). Recombinant proteins (each at about 1 mg total protein) were first preincubated with a final CTB antibody concentration of 1.times. �i.e., pellet dissolved in original yolk volume as described in Example 1(c)! in a final volume of 5 mls for 1 hour at 37.degree. C. Twenty-five .mu.g of CTB (at a concentration of 5 .mu.g/ml), enough CTB to kill 5 hamsters, was then added and the mixture was then incubated for 1 hour at 37.degree. C. Five, 40 g female hamsters (Charles River) in each treatment group were then each given 1 ml of the mixture I.P. using a tuberculin syringe with a 27 gauge needle. The results of this experiment are shown in Table 24.
TABLE 24______________________________________Binding Of Neutralizing Antibodies By INT 3 Protein Number Of Animals Number Of AnimalsTreatment Group.sup.1 Alive Dead______________________________________CTB antibodies 3 2CTB antibodies + INT1,2 3 2CTB antibodies + INT4,5 3 2CTB antibodies + INT 3 0 5______________________________________ .sup.1 C. difficile toxin B (CTB) was added to each group.
As shown in Table 24, the addition of recombinant proteins from INT-1, 2 or INT-4, 5 had no effect on the in vivo protective ability of the CTB antibody preparation compared to the CTB antibody preparation alone. In contrast, INT-3 recombinant polypeptide was able to remove all of the toxin B neutralizing ability of the CTB antibodies as demonstrated by the death of all the hamsters in that group.
The above experiment was repeated, using two smaller expressed fragments (pMB 1750-1970 and pMB 1970-2360, see FIG. 19) comprising the INT-3 domain to determine if that domain could be further subdivided into smaller neutralizing epitopes. In addition, full-length INT-3 polypeptide expressed as a nickel tagged protein (pPB1750-2360) was tested for neutralizing ability and compared to the original INT-3 expressed MBP fusion (pMB1750-2360). The results are shown in Table 25.
TABLE 25______________________________________Removal Of Neutralizing Antibodies By Repeat Containing Proteins Number Of Number OfTreatment Group.sup.1 Animals Alive Animals Dead______________________________________CTB antibodies 5 0CTB antibodies + pPB1750-2360 0 5CTB antibodies + pMB1750-2360 0 5CTB antibodies + pMB1970-2360 3 2CTB antibodies + pMB1750-1970 2 3______________________________________ .sup.1 C. difficile toxin B (CTB) was added to each group.
The results summarized in Table 25 indicate that the smaller polypeptide fragments within the INT-3 domain, pMB1750-1970 and pMB1970-2360, partially lose the ability to bind to and remove neutralizing antibodies from the CTB antibody pool. These results demonstrate that the full length INT-3 polypeptide is required to completely deplete the CTB antibody pool of neutralizing antibodies. This experiment also shows that the neutralization epitope of INT-3 can be expressed in alternative vector systems and the results are independent of the vector utilized or the accompanying fusion partner.
Other Interval 3 specific proteins were subsequently tested for the ability to remove neutralizing antibodies within the CTB antibody pool as described above. The Interval 3 specific proteins used in these studies are summarized in FIG. 23. In FIG. 23 the following abbreviations are used: pP refers to the pET23 vector; pM refers to the pMALc vector; B refers to toxin B; the numbers refer to the amino acid interval expressed in the clone. The solid black ovals represent the MBP; and HHH represents the poly-histidine tag.
Only recombinant proteins comprising the entire toxin B repeat domain (pMB1750-2360, pPB1750-2360 and pPB1850-2360) can bind and completely remove neutralizing antibodies from the CTB antibody pool. Recombinant proteins comprising only a portion of the toxin B repeat domain were not capable of completely removing neutralizing antibodies from the CTB antibody pool (pMB1750-1970 and pMB1970-2360 could partially remove neutralizing antibodies while pMB1850-1970 and pPB1850-2070 failed to remove any neutralizing antibodies from the CTB antibody pool).
The above results demonstrate that only the complete ligand binding domain (repeat region) of the toxin B gene can bind and completely remove neutralizing antibodies from the CTB antibody pool. These results demonstrate that antibodies directed against the entire toxin B repeat region are necessary for in vivo toxin neutralization (see FIG. 23; only the recombinant proteins expressed by the pMB1750-2360, pPB1750-2360 and pPB1850-2360 vectors are capable of completely removing the neutralizing antibodies from the CTB antibody pool).
These results represent the first indication that the entire repeat region of toxin B would be necessary for the generation of antibodies capable of neutralizing toxin B, and that sub-regions may not be sufficient to generate maximal titers of neutralizing antibodies.
b) Identification Of Toxin B Sub-Region Specific Antibodies That Neutralize Toxin B In Vivo
To determine if antibodies directed against the toxin B repeat region are sufficient for neutralization, region specific antibodies within the CTB antibody preparation were affinity purified, and tested for in vivo neutralization. Affinity columns containing recombinant toxin B repeat proteins were made as described below. A separate affinity column was prepared using each of the following recombinant toxin B repeat proteins: pPB1750-2360, pPB1850-2360, pMB1750-1970 and pMB1970-2360.
For each affinity column to be made, four ml of PBS-washed Actigel resin (Sterogene) was coupled overnight at room temperature with 5-10 mg of affinity purified recombinant protein (first extensively dialyzed into PBS) in 15 ml tubes (Falcon) containing a 1/10 final volume Ald-coupling solution (1M sodium cyanoborohydride). Aliquots of the supernatants from the coupling reactions, before and after coupling, were assessed by Coomassie staining of 7.5% SDS-PAGE gels. Based on protein band intensities, in all cases greater than 30% coupling efficiencies were estimated. The resins were poured into 10 ml columns (BioRad), washed extensively with PBS, pre-eluted with 4M guanidine-HCl (in 10 mM Tris-HCl, pH 8.0) and reequilibrated in PBS. The columns were stored at 4.degree. C.
Aliquots of a CTB IgY polyclonal antibody preparation (PEG prep) were affinity purified on each of the four columns as described below. The columns were hooked to a UV monitor (ISCO), washed with PBS and 40 ml aliquots of a 2.times. PEG prep (filter sterilized using a 0.45.mu. filter) were applied. The columns were washed with PBS until the baseline value was re-established. The columns were then washed with BBStween to elute nonspecifically binding antibodies, and reequilibrated with PBS. Bound antibody was eluted from the column in 4M guanidine-HCl (in 10 mM Tris-HCl, pH8.0). The eluted antibody was immediately dialyzed against a 100-fold excess of PBS at 4.degree. C. for 2 hrs. The samples were then dialyzed extensively against at least 2 changes of PBS, and affinity purified antibody was collected and stored at 4.degree. C. The antibody preparations were quantified by UV absorbance. The elution volumes were in the range of 4-8 ml. All affinity purified stocks contained similar total antibody concentrations, ranging from 0.25-0.35% of the total protein applied to the columns.
The ability of the affinity purified antibody preparations to neutralize toxin B in vivo was determined using the assay outlined in a) above. Affinity purified antibody was diluted 1:1 in PBS before testing. The results are shown in Table 26.
In all cases similar levels of toxin neutralization was observed, such that lethality was delayed in all groups relative to preimmune controls. This result demonstrates that antibodies reactive to the repeat region of the toxin B gene are sufficient to neutralize toxin B in vivo. The hamsters will eventually die in all groups, but this death is maximally delayed with the CTB PEG prep antibodies. Thus neutralization with the affinity purified (AP) antibodies is not as complete as that observed with the CTB prep before affinity chromatography. This result may be due to loss of activity during guanidine denaturation (during the elution of the antibodies from the affinity column) or the presence of antibodies specific to other regions of the toxin B gene that can contribute to toxin neutralization (present in the CTB PEG prep).
TABLE 26______________________________________Neutralization Of Toxin B By Affinity Purified Antibodies Number Number Animals AnimalsTreatment group.sup.a Alive.sup.b Dead.sup.b______________________________________Preimmune.sup.1 0 5CTB.sup.1 ; 400 .mu.g 5 0CTB (AP on pPB1750-2360);.sup.2 875 .mu.g 5 0CTB (AP on pMB1750-1970);.sup.2 875 .mu.g 5 0CTB (AP on pMB1970-2360);.sup.2 500 .mu.g 5 0______________________________________ .sup.a C. difficile toxin B (CTB) (Tech Lab; at 5 .mu.g/ml, 25 .mu.g total) at lethal concentration to hamsters is added to antibody and incubated for one hour at 37.degree. C. After incubation this mixture is injected intraperitoneally (IP) into hamsters. Each treatment group received toxin premixed with antibody raised against the indicated protein, as either: .sup.1 4X antibody PEG prep or .sup.2 affinity purified (AP) antibody (from CTB PEG prep, on indicated columns). The amount of specific antibod in each prep is indicated; the amount is directly determined for affinity purified preps and is estimated for the 4X CTB as described in Example 15 .sup.b The numbers in each group represent numbers of hamsters dead or alive, 2 hr post IP administration of toxin/antibody mixture.
The observation that antibodies affinity purified against the non-overlapping pMB1750-1970 and pMB1970-2360 proteins neutralized toxin B raised the possibility that either 1) antibodies specific to repeat sub-regions are sufficient to neutralize toxin B or 2) sub-region specific proteins can bind most or all repeat specific antibodies present in the CTB polyclonal pool. This would likely be due to conformational similarities between repeats, since homology in the primary amino acid sequences between different repeats is in the range of only 25-75% �Eichel-Streiber, et al. (1992) Molec. Gen. Genetics 233:260!. These possibilities were tested by affinity chromatography.
The CTB PEG prep was sequentially depleted 2.times. on the pMB1750-1970 column; only a small elution peak was observed after the second chromatography, indicating that most reactive antibodies were removed. This interval depleted CTB preparation was then chromatographed on the pPB1850-2360 column; no antibody bound to the column. The reactivity of the CTB and CTB (pMB1750-1970 depleted) preps to pPB1750-2360, pPB1850-2360, pMB1750-1970 and pMB1970-2360 proteins was then determined by ELISA using the protocol described in Example 13(c). Briefly, 96-well microtiter plates (Falcon, Pro-Bind Assay Plates) were coated with recombinant protein by adding 100 .mu.l volumes of protein at 1-2 .mu.g/ml in PBS containing 0.005% thimerosal to each well and incubating overnight at 4.degree. C. The next morning, the coating suspensions were decanted and the wells were washed three times using PBS. In order to block non-specific binding sites, 100 .mu.l of 1.0% BSA (Sigma) in PBS (blocking solution) was then added to each well, and the plates were incubated for 1 hr. at 37.degree. C. The blocking solution was decanted and duplicate samples of 150 .mu.l of diluted antibody was added to the first well of a dilution series. The initial testing serum dilution was (1/200 for CTB prep, (the concentration of depleted CTB was standardized by OD.sub.280) in blocking solution containing 0.5% Tween 20, followed by 5-fold serial dilutions into this solution. This was accomplished by serially transferring 30 .mu.l aliquots to 120 .mu.l buffer, mixing, and repeating the dilution into a fresh well. After the final dilution, 30 .mu.l was removed from the well such that all wells contained 120 .mu.l final volume. A total of 5 such dilutions were performed (4 wells total). The plates were incubated for 1 hr at 37.degree. C. Following this incubation, the serially diluted samples were decanted and the wells were washed three times using PBS containing 0.5% Tween 20 (PBST), followed by two 5 min washes using BBS-Tween and a final three washes using PBST. To each well, 100 .mu.l of 1/1000 diluted secondary antibody �rabbit anti-chicken IgG alkaline phosphatase (Sigma) diluted in blocking solution containing 0.5% Tween 20! was added, and the plate was incubated 1 hr at 37.degree. C. The conjugate solutions were decanted and the plates were washed 6 times in PBST, then once in 50 mM Na.sub.2 CO.sub.3, 10 mM MgCl.sub.2, pHE 9.5. The plates were developed by the addition of 100 .mu.l of a solution containing 1 mg/ml para-nitro phenyl phosphate (Sigma) dissolved in 50 mM Na.sub.2 CO.sub.3, 10 mM MgCl.sub.2, pH9.5 to each well. The plates were then incubated at room temperature in the dark for 5-45 min. The absorbency of each well was measured at 410 nm using a Dynatech MR 700 plate reader.
As predicted by the affinity chromatography results, depletion of the CTB prep on the pMB1750-1970 column removed all detectable reactivity to the pMB1970-2360 protein. The reciprocal purification of a CTB prep that was depleted on the pMB1970-2360 column yielded no bound antibody when chromatographed on the pMB1750-1970 column. These results demonstrate that all repeat reactive antibodies in the CTB polyclonal pool recognize a conserved structure that is present in non-overlapping repeats. Although it is possible that this conserved structure represents rare conserved linear epitopes, it appears more likely that the neutralizing antibodies recognize a specific protein conformation. This conclusion was also suggested by the results of Western blot hybridization analysis of CTB reactivity to these recombinant proteins.
Western blots of 7.5% SDS-PAGE gels, loaded and electrophoresed with defined quantities of each recombinant protein, were probed with the CTB polyclonal antibody preparation. The blots were prepared and developed with alkaline phosphatase as described in Example 3. The results are shown in FIG. 24.
FIG. 24 depicts a comparison of immunoreactivity of IgY antibody raised against either native or recombinant toxin B antigen. Equal amounts of pMB1750-1970 (lane 1), pMB1970-2360 (lane 2), pPB1850-2360 (lane 3) as well as a serial dilution of pPB1750-2360 (lanes 4-6 comprising 1.times., 1/10.times. and 1/100.times. amounts, respectively) proteins were loaded in duplicate and resolved on a 7.5% SDS-PAGE gel. The gel was blotted and each half was hybridized with PEG prep IgY antibodies from chickens immunized with either native CTB or pPB1750-2360 protein. Note that the full-length pMB1750-1970 protein was identified only by antibodies reactive to the recombinant protein (arrows).
Although the CTB prep reacts with the pPB1750-2360, pPB1850-2360, and pMB1970-2360 proteins, no reactivity to the pMB1750-1970 protein was observed (FIG. 24). Given that all repeat reactive antibodies can be bound by this protein during affinity chromatography, this result indicates that the protein cannot fold properly on Western blots. Since this eliminates all antibody reactivity, it is unlikely that the repeat reactive antibodies in the CTB prep recognize linear epitopes. This may indicate that in order to induce protective antibodies, recombinant toxin B protein will need to be properly folded.
c) Generation And Evaluation Of Antibodies Reactive To Recombinant Toxin B Polypeptides
i) Generation Of Antibodies Reactive To Recombinant Toxin B Proteins
Antibodies against recombinant proteins were generated in egg laying Leghorn hens as described in Example 13. Antibodies were raised �using Freunds adjuvant (Gibco) unless otherwise indicated! against the following recombinant proteins: 1) a mixture of Interval 1+2 proteins (see FIG. 18); 2) a mixture of interval 4 and 5 proteins (see FIG. 18); 3) pMB1970-2360 protein; 4) pPB1750-2360 protein; 5) pMB1750-2360; 6) pMB1750-2360 �Titermax adjuvant (Vaxcell)!; 7) pMB1750-2360 �Gerbu adjuvant (Biotech)!; 8) pMBp1750-2360 protein; 9) pPB1850-2360; and 10) pMB1850-2360.
Chickens were boosted at least 3 times with recombinant protein until ELISA reactivity �using the protocol described in b) above with the exception that the plates were coated with pPB1750-2360 protein! of polyclonal PEG preps was at least equal to that of the CTB polyclonal antibody PEG prep. ELISA titers were determined for the PEG preps from all of the above immunogens and were found to be comparable ranging from 1:12500 to 1:62500. High titers were achieved in all cases except in 6) pMB1750-2360 in which strong titers were not observed using the Titermax adjuvant, and this preparation was not tested further.
ii) Evaluation Of Antibodies Reactive To Recombinant Proteins By Western Blot Hybridization
Western blots of 7.5% SDS-PAGE gels, loaded and electrophoresed with defined quantities of recombinant protein (pMB1750-1970, pPB1850-2360, and pMB1970-2360 proteins and a serial dilution of the pPB1750-2360 to allow quantification of reactivity), were probed with the CTB, pPB1750-2360, pMB1750-2360 and pMB1970-2360 polyclonal antibody preparations (from chickens immunized using Freunds adjuvant). The blots were prepared and developed with alkaline phosphatase as described above in b).
As shown in FIG. 24, the CTB and pMB1970-2360 preps reacted strongly with the pPB1750-2360, pPB1850-2360, and pMB1970-2360 proteins while the pPB1750-2360 and pMB1970-2360 (Gerbu) preparations reacted strongly with all four proteins. The Western blot reactivity of the pPB1750-2360 and pMB1970-2360 (Gerbu) preparations were equivalent to that of the CTB preparation, while reactivity of the pMB1970-2360 preparation was <10% that of the CTB prep. Despite equivalent ELISA reactivities only weak reactivity (approximately 1%) to the recombinant proteins were observed in PEG preps from two independent groups immunized with the pMB1750-2360 protein and one group immunized with the pMB1750-2360 preparation using Freunds adjuvant.
Affinity purification was utilized to determine if this difference in immunoreactivity by Western blot analysis reflects differing antibody titers. Fifty ml 2.times. PEG preparations from chickens immunized with either pMB1750-2360 or pMB1970-2360 protein were chromatographed on the pPB1750-2360 affinity column from b) above, as described. The yield of affinity purified antibody (% total protein in preparation) was equivalent to the yield obtained from a CTB PEG preparation in b) above. Thus, differences in Western reactivity reflect a qualitative difference in the antibody pools, rather than quantitative differences., These results demonstrate that certain recombinant proteins are more effective at generating high affinity antibodies (as assayed by Western blot hybridization).
iii) In Vivo Neutralization Of Toxin B Using Antibodies Reactive To Recombinant Protein
The in vivo hamster model �described in Examples 9 and 14(b)! was utilized to assess the neutralizing ability of antibodies raised against recombinant toxin B proteins. The results from three experiments are shown below in Tables 27-29.
The ability of each immunogen to neutralize toxin B in vivo has been compiled and is shown in Table 30. As predicted from the recombinant protein-CTB premix studies (Table 24) only antibodies to Interval 3 (1750-2366) and not the other regions of toxin B (i.e., intervals 1-5) are protective. Unexpectedly, antibodies generated to INT-3 region expressed in pMAL vector (pMB1750-2360 and pMpB1750-2360) using Freunds adjuvant were non-neutralizing. This observation is reproducible, since no neutralization was observed in two independent immunizations with pMB1750-2360 and one immunization with pMpB1750-2360. The fact that 5.times. quantities of affinity purified toxin B repeat specific antibodies from pMB1750-2360 PEG preps cannot neutralize toxin B while 1.times. quantities of affinity purified anti-CTB antibodies can (Table 28) demonstrates that the differential ability of CTB antibodies to neutralize toxin B is due to qualitative rather than quantitative differences in these antibody preparations. Only when this region was expressed in an alternative vector (pPB1750-2360) or using an alternative adjuvant with the pMB1750-2360 protein were neutralizing antibodies generated. Importantly, antibodies raised using Freunds adjuvant to pPB1850-2360, which contains a fragment that is only 100 amino acids smaller than recombinant pPB1750-2360, are unable to neutralize toxin B in vivo (Table 27); note also that the same vector is used for both pPB1850-2360 and pPB 1750-2360.
TABLE 27______________________________________In Vivo Neutralization Of Toxin BTreatment Group.sup.a Number Animals Alive.sup.b Number Animals Dead.sup.b______________________________________Preimmune 0 5CTB 5 0INT1 + 2 0 5INT 4 + 5 0 5pMB1750-2360 0 5pMB1970-2360 0 5pPB1750-2360 5 0______________________________________ .sup.a C. difficile toxin B (CTB) (at 5 .mu.g/ml; 25 .mu.g total; Tech Lab) at lethal concentration to hamsters is added to antibody and incubated for one hour at 37.degree. C. After incubation this mixture is injected intraperitoneally (IP) into hamsters. Each treatment group received toxin premixed with antibody raised against the indicated protein, as a 4X antibody PEG prep. .sup.b The numbers in each group represent numbers of hamsters dead or alive, 2 hours post IP administration of toxin/antibody mixture.
TABLE 28______________________________________In Vivo Neutralization of Toxin B Using Affinity Purified Antibodies Number Animals Number AnimalsTreatment Group.sup.a Alive.sup.b Dead.sup.b______________________________________Preimmune(1) 0 5CTB(1) 5 0pPB1750-2360(1) 5 01.5 mg anti-pMB1750-2360(2) 1 41.5 mg anti-pMB1970-2360(2) 0 5300 .mu.g anti-CTB(2) 5 0______________________________________ .sup.a C. difficile toxin B (CTB) (at 5 .mu.g/ml; 25 .mu.g total; Tech Lab) at lethal concentration to hamsters is added to antibody and incubated for one hour at 37.degree. C. After incubation this mixture is injected intraperitoneally (IP) into hamsters. Each treatment group received toxin premixed with antibody raised against the indicated protein, as a 4X antibody PEG prep. .sup.b The numbers in each group represent numbers of hamsters dead or alive, 2 hours post IP administration of toxin/antibody mixture.
TABLE 29______________________________________Generation Of Neutralizing Antibodies Utilizing The Gerbu Adjuvant Number Animals Number AnimalsTreatment Group.sup.a Alive.sup.b Dead.sup.b______________________________________Preimmune 0 5CTB 5 0pMB1970-2360 0 5pMB1850-2360 0 5pPB1850-2360 0 5pMB1750-2360 (Gerbu adj) 5 0______________________________________ .sup.a C. difficile toxin B (CTB) (Tech Lab) at lethal concentration to hamsters is added to antibody and incubated for one hour at 37.degree. C. After incubation this mixture is injected intraperitoneally (IP) into hamsters. Each treatment group received toxin premixed with antibody raised against the indicated protein, as a 4X antibody PEG prep. .sup.b The numbers in each group represent numbers of hamsters dead or alive, 2 hrs post IP administration of toxin/antibody mixture.
TABLE 30______________________________________In Vivo Neutralization Of Toxin B In vivo Testes Antigen Neutrali-Immunogen Adjuvant Preparation.sup.a Utilized For AP tion.sup.b______________________________________Preimmune NA.sup.1 PEG NA noCTB (native) Titermax PEG NA yesCTB (native) Titermax AP pPB1750-2360 yesCTB (native) Titermax AP pPB1850-2360 yesCTB (native) Titermax AP pPB1750-1970 yesCTB (native) Titermax AP pPB1970-2360 yespMB1750-2360 Freunds PEG NA nopMB1750-2360 Freunds AP pPB1750-2360 nopMB1750-2360 Gerbu PEG NA yespMB1970-2360 Freunds PEG NA nopMB1970-2360 Freunds AP pPB1750-2360 nopPB1750-2360 Freunds PEG NA yespPB1850-2360 Freunds PEG NA nopMB1850-2360 Freunds PEG NA noINT 1 + 2 Freunds PEG NA noINT 4 + 5 Freunds PEG NA no______________________________________ .sup.a Either PEG preparation (PEG) or affinity purified antibodies (AP). .sup.b `Yes` denotes complete neutralization (0/5 dead) while `no` denote no neutralization (5/5 dead) of toxin B, 2 hours postadministration of mixture. .sup.1 `NA` denotes not applicable.
The pPB1750-2360 antibody pool confers significant in vivo protection, equivalent to that obtained with the affinity purified CTB antibodies. This correlates with the observed high affinity of this antibody pool (relative to the pMB1750-2360 or pMB1970-2360 pools) as assayed by Western blot analysis (FIG. 24). These results provide the first demonstration that in vivo neutralizing antibodies can be induced using recombinant toxin B protein as immunogen.
The failure of high concentrations of antibodies raised against the pMB1750-2360 protein (using Freunds adjuvant) to neutralize, while the use of Gerbu adjuvant and pMB1750-2360 protein generates a neutralizing response, demonstrates that conformation or presentation of this protein is essential for the induction of neutralizing antibodies. These results are consistent with the observation that the neutralizing antibodies produced when native CTB is used as an immunogen appear to recognize conformational epitopes �see section b) above!. This is the first demonstration that the conformation or presentation of recombinant toxin B protein is essential to generate high titers of neutralizing antibodies.
EXAMPLE 20
Determination Of Quantitative And Qualitative Differences Between pMB1750-2360, pMB1750-2360 (Gerbu) Or pPB1750-2360 IgY Polyclonal Antibody Preparations
In Example 19, it was demonstrated that toxin B neutralizing antibodies could be generated using specific recombinant toxin B proteins (pPB1750-2360) or specific adjuvants. Antibodies raised against pMB1750-2360 were capable of neutralizing the enterotoxin effect of toxin B when the recombinant protein was used to immunize hens in conjunction with the Gerbu adjuvant, but not when Freunds adjuvant was used. To determine the basis for these antigen and adjuvant restrictions, toxin B-specific antibodies present in the neutralizing and non-neutralizing PEG preparations were isolated by affinity chromatography and tested for qualitative or quantitative differences. The example involved a) purification of anti-toxin B specific antibodies from pMB1750-2360 and pPB1750-2360 PEG preparations and b) in vivo neutralization of toxin B using the affinity purified antibody.
a) Purification Of Specific Antibodies From pMB11750-2360 And pPB1750-2360 PEG Preparations
To purify and determine the concentration of specific antibodies (expressed as the percent of total antibody) within the pPB1750-2360 (Freunds and Gerbu) and pPB1750-2360 PEG preparations, defined quantities of these antibody preparations were chromatographed on an affinity column containing the entire toxin B repeat region (pPB1750-2360). The amount of affinity purified antibody was then quantified.
An affinity column containing the recombinant toxin B repeat protein, pPB1750-2360, was made as follows. Four ml of PBS-washed Actigel resin (Sterogene) was coupled with 5 mg of pPB1750-2360 affinity purified protein (dialyzed into PBS; estimated to be greater than 95% full length fusion protein) in a 15 ml tube (Falcon) containing 1/10 final volume Ald-coupling solution (1M sodium cyanoborohydride). Aliquots of the supernatant from the coupling reactions, before and after coupling, were assessed by Coomassie staining of 7.5% SDS-PAGE gels. Based on protein band intensities, greater than 95% (approximately 5 mg) of recombinant protein was coupled to the resin. The coupled resin was poured into a 10 ml column (BioRad), washed extensively with PBS, pre-eluted with 4M guanidine-HCl (in 10 mM Tris-HCl, pH 8.0; 0.005% thimerosal) and re-equilibrated in PBS and stored at 4.degree. C.
Aliquots of pMB1750-2360, pMB1750-2360 (Gerbu) or pPB1750-2360 IgY polyclonal antibody preparations (PEG preps) were affinity purified on the above column as follows. The column was attached to an UV monitor (ISCO), and washed with PBS. Forty ml aliquots of 2.times. PEG preps (filter sterilized using a 0.45.mu. filter and quantified by OD.sub.280 before chromatography) was applied. The column was washed with PBS until the baseline was re-established (the column flow-through was saved), washed with BBSTween to elute nonspecifically binding antibodies and re-equilibrated with PBS. Bound antibody was eluted from the column in 4M guanidine-HCl (in 10 mM Tris-HCL, pH 8.0, 0.005% thimerosal) and the entire elution peak collected in a 15 ml tube (Falcon). The column was re-equilibrated, and the column eluate re-chromatographed as described above. The antibody preparations were quantified by UV absorbance (the elution buffer was used to zero the spectrophotometer). Approximately 10 fold higher concentrations of total purified antibody was obtained upon elution of the first chromatography pass relative to the second pass. The low yield from the second chromatography pass indicated that most of the specific antibodies were removed by the first round of chromatography.
Pools of affinity purified specific antibodies were prepared by dialysis of the column elutes after the first column chromatography pass for the pMB1750-2360, pMB1750-2360 (Gerbu) or pPB1750-2360 IgY polyclonal antibody preparations. The elutes were collected on ice and immediately dialyzed against a 100-fold volume of PBS at 4.degree. C. for 2 hrs. The samples were then dialyzed against 3 changes of a 65-fold volume of PBS at 4.degree. C. Dialysis was performed for a minimum of 8 hrs per change of PBS. The dialyzed samples were collected, centrifuged to remove insoluble debris, quantified by OD.sub.280, and stored at 4.degree. C.
The percentage of toxin B repeat-specific antibodies present in each preparation was determined using the quantifications of antibody yields from the first column pass (amount of specific antibody recovered after first pass/total protein loaded). The yield of repeat-specific affinity purified antibody (expressed as the percent of total protein in the preparation) in: 1) the pMB1750-2360 PEG prep was approximately 0.5%, 2) the pMB1750-2360 (Gerbu) prep was approximately 2.3%, and 3) the pPB1750-2360 prep was approximately 0.4%. Purification of a CTB IgY polyclonal antibody preparation on the same column demonstrated that the concentration of toxin B repeat specific antibodies in the CTB preparation was 0.35%.
These results demonstrate that 1) the use of Gerbu adjuvant enhanced the titer of specific antibody produced against the pMB1750-2360 protein 5-fold relative to immunization using Freunds adjuvant, and 2) the differences seen in the in vivo neutralization ability of the pMB1750-2360 (not neutralizing) and pPB1750-2360 (neutralizing) and CTB (neutralizing) PEG preps seen in Example 19 was not due to differences in the titers of repeat-specific antibodies in the three preparations because the titer of repeat-specific antibody was similar for all three preps; therefore the differing ability of the three antibody preparations to neutralize toxin B must reflect qualitative differences in the induced toxin B repeat-specific antibodies. To confirm that qualitative differences exist between antibodies raised in hens immunized with different recombinant proteins and/or different adjuvants, the same amount of affinity purified anti-toxin B repeat (aa 1870-2360 of toxin B) antibodies from the different preparations was administered to hamsters using the in vivo hamster model as described below.
b) In vivo Neutralization Of Toxin B Using Affinity Purified Antibody
The in vivo hamster model was utilized to assess the neutralizing ability of the affinity purified antibodies raised against recombinant toxin B proteins purified in (a) above. As well, a 4.times. IgY PEG preparation from a second independent immunization utilizing the pPB1750-2360 antigen with Freunds adjuvant was tested for in vivo neutralization. The results are shown in Table 31.
The results shown in Table 31 demonstrate that:
1) as shown in Example 19 and reproduced here, 1.5 mg of affinity purified antibody from pMB1750-2360 immunized hens using Freunds adjuvant does not neutralize toxin B in vivo. However, 300 .mu.g of affinity purified antibody from similarly immunized hens utilizing Gerbu adjuvant demonstrated complete neutralization of toxin B in vivo. This demonstrates that Gerbu adjuvant, in addition to enhancing the titer of antibodies reactive to the pMB1750-2360 antigen relative to Freunds adjuvant (demonstrated in (a) above), also enhances the yield of neutralizing antibodies to this antigen, greater than 5 fold.
2) Complete in vivo neutralization of toxin B was observed with 1.5 mg of affinity purified antibody from hens immunized with pPB1750-2360
TABLE 31______________________________________In vivo Neutralization Of Toxin B Using Affinity Purified Antibodies NumberTreatment Group.sup.a Number Animals Alive.sup.b Animals Dead.sup.b______________________________________Preimmune.sup.1 0 5CTB (300 .mu.g).sup.2 5 0CTB (100 .mu.g).sup.2 1 4pMB1750-2360 (G) (5 mg)2 5 0pMB1750-2360 (G) (1.5 mg).sup.2 5 0pMB1750-2360 (G) (300 .mu.g).sup.2 5 0pMB1750-2360 (F) (1.5 mg).sup.2 0 5pPB1750-2360 (F) (1.5 mg).sup.2 5 0pPB1750-2360 (F) (300 .mu.g).sup.2 1 4CTB (100 .mu.g).sup.3 2 3pPB1750-2360 (F) (500 .mu.g).sup.1 5 0______________________________________ .sup.a C. difficile toxin B (CTB) (Tech Lab) at lethal concentration to hamsters (25 .mu.g) was added to the antibody (amount of specific antibod is indicated) and incubated for one hour at 37.degree. C. After incubation, this mixture was injected IP into hamsters (1/5 total mix injected per hamster). Each treatment group received toxin premixed with antibody raised aginst the indicated protein (G = gerbu adjuvant, F = Freunds adjuvant). .sup.1 indicates #the antibody was a 4X IgY PEG prep; .sup.2 indicates the antibody was affinity purified on a pPB18502360 resin; and .sup.3 indicates that the antibody was a 1X IgY PEG prep. .sup.b The numbers in each group represent numbers of hamsters dead or alive, 2 hrs post IP administration of toxin/antibody mixture.
antigen, but not with pMB1750-2360 antigen, when Freunds adjuvant was used. This demonstrates, using standardized toxin B repeat-specific antibody concentrations, that neutralizing antibodies were induced when pPB1750-2360 but not pMB1750-2360 was used as the antigen with Freunds adjuvant.
3) Complete in vivo neutralization was observed with 300 .mu.g of pMB1750-2360 (Gerbu) antibody, but not with 300 .mu.g of pPB1750-2360 (Freunds) antibody. Thus the pMB11750-2360 (Gerbu) antibody has a higher titer of neutralizing antibodies than the pPB1750-2360 (Freunds) antibody.
4) Complete neutralization of toxin B was observed using 300 .mu.g of CTB antibody �affinity purified (AP)! but not 100 .mu.g CTB antibody (AP or PEG prep). This demonstrates that greater than 100 .mu.g of toxin B repeat-specific antibody (anti-CTB) is necessary to neutralize 25 .mu.g toxin B in vivo in this assay, and that affinity purified antibodies specific to the toxin B repeat interval neutralize toxin B as effectively as the PEP prep of IgY raised against the entire CTB protein (shown in this assay).
5) As was observed with the initial pPB1750-2360 (IgY) PEG preparation (Example 19), complete neutralization was observed with a IgY PEG preparation isolated from a second independent group of pPB1750-2360 (Freunds) immunized hens. This demonstrates that neutralizing antibodies are reproducibly produced when hens are immunized with pPB1750-2360 protein utilizing Freunds adjuvant.
EXAMPLE 21
Diagnostic Enzyme Immunoassays For C. difficile Toxins A And B
The ability of the recombinant toxin proteins and antibodies raised against these recombinant proteins (described in the above examples) to form the basis of diagnostic assays for the detection of clostridial toxin in a sample was examined. Two immunoassay formats were tested to quantitatively detect C. difficile toxin A and toxin B from a biological specimen. The first format involved a competitive assay in which a fixed amount of recombinant toxin A or B was immobilized on a solid support (e.g., microtiter plate wells) followed by the addition of a toxin-containing biological specimen mixed with affinity-purified or PEG fractionated antibodies against recombinant toxin A or B. If toxin is present in a specimen, this toxin will compete with the immobilized recombinant toxin protein for binding to the anti-recombinant antibody thereby reducing the signal obtained following the addition of a reporter reagent. The reporter reagent detects the presence of antibody bound to the immobilized toxin protein.
In the second format, a sandwich immunoassay was developed using affinity-purified antibodies to recombinant toxin A and B. The affinity-purified antibodies to recombinant toxin A and B were used to coat microtiter wells instead of the recombinant polypeptides (as was done in the competitive assay format). Biological samples containing toxin A or B were then added to the wells followed by the addition of a reporter reagent to detect the presence of bound toxin in the well.
a) Competitive Immunoassay For The Detection Of C. difficile Toxin
Recombinant toxin A or B was attached to a solid support by coating 96 well microtiter plates with the toxin protein at a concentration of 1 .mu.g/ml in PBS. The plates were incubated overnight at 2-8.degree. C. The following morning, the coating solutions were removed and the remaining protein binding sites on the wells were blocked by filling each well with a PBS solution containing 0.5% BSA and 0.05% Tween-20. Native C. difficile toxin A or B (Tech Lab) was diluted to 4 .mu.g/ml in stool extracts from healthy Syrian hamsters (Sasco). The stool extracts were made by placing fecal pellets in a 15 ml centrifuge tube; PBS was added at 2 ml/pellet and the tube was vortexed to create a uniform suspension. The tube was then centrifuged at 2000 rpm for 5 min at room temperature. The supernatant was removed; this comprises the stool extract. Fifty .mu.l of the hamster stool extract was pipetted into each well of the microtiter plates to serve as the diluent for serial dilutions of the 4 .mu.g/ml toxin samples. One hundred .mu.l of the toxin samples at 4 .mu.g/ml was pipetted into the first row of wells in the microtiter plate, and 50 .mu.l aliquots were removed and diluted serially down the plate in duplicate. An equal volume of affinity purified antirecombinant toxin antibodies �1 ng/well of anti-pMA1870-2680 antibody was used for the detection of toxin A; 0.5 ng/well of anti-pMB1750-2360(Gerbu) was used for the detection of toxin B! were added to appropriate wells, and the plates were incubated at room temperature for 2 hours with gentle agitation. Wells serving as negative control contained antibody but no native toxin to compete for binding.
Unbound toxin and antibody were removed by washing the plates 3 to 5 times with PBS containing 0.05% Tween-20. Following the wash step, 100 .mu.l of rabbit anti-chicken IgG antibody conjugated to alkaline phosphatase (Sigma) was added to each well and the plates were incubated for 2 hours at room temperature. The plates were then washed as before to remove unbound secondary antibody. Freshly prepared alkaline phosphatase substrate (1 mg/ml p-nitrophenyl phosphate (Sigma) in 50 mM Na.sub.2 CO.sub.3, pH 9.5; 10 mM MgCl.sub.2) was added to each well. Once sufficient color developed, the plates were read on a Dynatech MR700 microtiter plate reader using a 410 nm filter.
The results are summarized in Tables 32 and 33. For the results shown in Table 32, the wells were coated with recombinant toxin A protein (pMA1870-2680). The amount of native toxin A added (present as an addition to solubilized hamster stool) to a given well is indicated (0 to 200 ng). Antibody raised against the recombinant toxin A protein, pMA1870-2680, was affinity purified on the an affinity column containing pPA1870-2680 (described in Example 20). As shown in Table 32, the recombinant toxin A protein and affinity-purified antitoxin can be used for the basis of a competitive immunoassay for the detection of toxin A in biological samples.
Similar results were obtained using the recombinant toxin B, pPB1750-2360, and antibodies raised against pMB1750-2360(Gerbu). For the results shown in Table 33, the wells were coated with recombinant toxin B protein (pPB1750-2360). The amount of native toxin B added (present as an addition to solubilized hamster stool) to a given well is indicated (0 to 200 ng). Antibody raised against the recombinant toxin B protein, pMB1750-2360(Gerbu), was affinity purified on the an affinity column containing pPB1850-2360 (described in Example 20). As shown in Table 33, the recombinant toxin B protein and affinity-purified antitoxin can be used for the basis of a competitive immunoassay for the detection of toxin B in biological samples.
In this competition assay, the reduction is considered significant over the background levels at all points; therefore the assay can be used to detect samples containing less than 12.5 ng toxin A/well and as little as 50-100 ng toxin B/well.
TABLE 32______________________________________Competitive Inhibition Of Anti-C. difficile Toxin A By Native Toxin Ang Toxin A/Well OD.sub.410 Readout______________________________________200 0.176100 0.25350 0.24025 0.25912.5 0.3096.25 0.3673.125 0.4170 0.590______________________________________
TABLE 33______________________________________Competitive Inhibition Of Anti-C. difficile Toxin B By Native Toxin Bng Toxin B/Well OD.sub.410 Readout______________________________________200 0.392100 0.56650 0.60725 0.77812.5 0.9706.25 0.9023.125 1.0400 1.055______________________________________
These competitive inhibition assays demonstrate that native C. difficile toxins and recombinant C. difficile toxin proteins can compete for binding to antibodies raised against recombinant C. difficile toxins demonstrating that these anti-recombinant toxin antibodies provide effective diagnostic reagents.
b) Sandwich Immunoassay For The Detection Of C. difficile Toxin
Affinity-purified antibodies against recombinant toxin A or toxin B were immobilized to 96 well microtiter plates as follows. The wells were passively coated overnight at 4.degree. C. with affinity purified antibodies raised against either pMA1870-2680 (toxin A) or pMB1750-2360(Gerbu) (toxin B). The antibodies were affinity purified as described in Example 20. The antibodies were used at a concentration of 1 g/ml and 100 .mu.l was added to each microtiter well. The wells were then blocked with 200 .mu.l of 0.5% BSA in PBS for 2 hours at room temperature and the blocking solution was then decanted. Stool samples from healthy Syrian hamsters were resuspended in PBS, pH 7.4 (2 ml PBS/stool pellet was used to resuspend the pellets and the sample was centrifuged as described above). The stool suspension was then spiked with native C. difficile toxin A or B (Tech Lab) at 4 .mu.g/ml. The stool suspensions containing toxin (either toxin A or toxin B) were then serially diluted two-fold in stool suspension without toxin and 50 .mu.l was added in duplicate to the coated microtiter wells. Wells containing stool suspension without toxin served as the negative control.
The plates were incubated for 2 hours at room temperature and then were washed three times with PBS. One hundred .mu.l of either goat anti-native toxin A or goat anti-native toxin B (Tech Lab) diluted 1:1000 in PBS containing 1% BSA and 0.05% Tween 20 was added to each well. The plates were incubated for another 2 hours at room temperature. The plates were then washed as before and 100 .mu.l of alkaline phosphatase-conjugated rabbit anti-goat IgG (Cappel, Durham, N.C.) was added at a dilution of 1:1000. The plates were incubated for another 2 hours at room temperature. The plates were washed as before then developed by the addition of 100 .mu.l/well of a substrate solution containing 1 mg/ml p-nitrophenyl phosphate (Sigma) in 50 mM Na.sub.2 CO.sub.3, pH 9.5; 10 mM MgCl.sub.2. The absorbance of each well was measured using a plate reader (Dynatech) at 410 nm. The assay results are shown in Tables 34 and 35.
TABLE 34______________________________________C. difficile Toxin A Detection In StoolUsing Affinity-Purified Antibodies Against Toxin Ang Toxin A/Well OD.sub.410 Readout______________________________________200 0.9100 0.850 0.7325 0.7112.5 0.596.25 0.4210 0______________________________________
TABLE 35______________________________________C. difficile Toxin B Detection In StoolUsing Affinity-Purified Antibodies Against Toxin Bng Toxin B/Well OD.sub.410 Readout______________________________________200 1.2100 0.97350 0.88725 0.84612.5 0.6516.25 0.4310 0.004______________________________________
The results shown in Tables 34 and 35 show that antibodies raised against recombinant toxin A and toxin B fragments can be used to detect the presence of C. difficile toxin in stool samples. These antibodies form the basis for a sensitive sandwich immunoassay which is capable of detecting as little as 6.25 ng of either toxin A or B in a 50 .mu.l stool sample. As shown above in Tables 34 and 35, the background for this sandwich immunoassay is extremely low; therefore, the sensitivity of this assay is much lower than 6.25 ng toxin/well. It is likely that toxin levels of 0.5 to 1.0 pg/well could be detected by this assay.
The results shown above in Tables 32-35 demonstrate clear utility of the recombinant reagents in C. difficile toxin detection systems.
EXAMPLE 22
Construction And Expression Of C. botulinum C Fragment Fusion Proteins
The C. botulinum type A neurotoxin gene has been cloned and sequenced �Thompson, et al., Eur. J. Biochem. 189:73 (1990)!. The nucleotide sequence of the toxin gene is available from the EMBL/GenBank sequence data banks under the accession number X52066; the nucleotide sequence of the coding region is listed in SEQ ID NO:27. The amino acid sequence of the C. botulinum type A neurotoxin is listed in SEQ ID NO:28. The type A neurotoxin gene is synthesized as a single polypeptide chain which is processed to form a dimer composed of a light and a heavy chain linked via disulfide bonds. The 50 kD carboxy-terminal portion of the heavy chain is referred to as the C fragment or the H.sub.C domain.
Previous attempts by others to express polypeptides comprising the C fragment of C. botulinum type A toxin as a native polypeptide (e.g., not as a fusion protein) in E. coli have been unsuccessful �H. F. LaPenotiere, et al. in Botulinum and Tetanus Neurotoxins, DasGupta, Ed., Plenum Press, New York (1993), pp. 463-466!. Expression of the C fragment as a fusion with the E. coli MBP was reported to result in the production of insoluble protein (H. F. LaPenotiere, et al., supra).
In order to produce soluble recombinant C fragment proteins in E. coli, fusion proteins comprising a synthetic C fragment gene derived from the C. botulinum type A toxin and either a portion of the C. difficile toxin protein or the MBP were constructed. This example involved a) the construction of plasmids encoding C fragment fusion proteins and b) expression of C. botulinum C fragment fusion proteins in E. coli.
a) Construction Of Plasmids Encoding C Fragment Fusion Proteins
In Example 11, it was demonstrated that the C. difficile toxin A repeat domain can be efficiently expressed and purified in E. coli as either native (expressed in the pET 23a vector in clone pPA1870-2680) or fusion (expressed in the pMALc vector as a fusion with the E. coli MBP in clone pMA1870-2680) proteins. Fusion proteins comprising a fusion between the MBP, portions of the C. difficile toxin A repeat domain (shown to be expressed as a soluble fusion protein) and the C fragment of the C. botulinum type A toxin were constructed. A fusion protein comprising the C fragment of the C. botulinum type A toxin and the MBP was also constructed.
FIG. 25 provides a schematic representation of the botulinal fusion proteins along with the donor constructs containing the C. difficile toxin A sequences or C botulinum C fragment sequences which were used to generate the botulinal fusion proteins. In FIG. 25, the solid boxes represent C. difficile toxin A gene sequences, the open boxes represent C. botulinum C fragment sequences and the solid black ovals represent the E. coli MBP. When the name for a restriction enzyme appears inside parenthesis, this indicates that the restriction site was destroyed during construction. An asterisk appearing with the name for a restriction enzyme indicates that this restriction site was recreated at the cloning junction.
In FIG. 25, a restriction map of the pMA1870-2680 and pPA1100-2680 constructs (described in Example 11) which contain sequences derived from the C. difficile toxin A repeat domain are shown; these constructs were used as the source of C. difficile toxin A gene sequences for the construction of plasmids encoding fusions between the C. botulinum C fragment gene and the C. difficile toxin A gene. The pMA1870-2680 expression construct expresses high levels of soluble, intact fusion protein (20 mg/liter culture) which can be affinity purified on an amylose column (purification described in Example 11d).
The pAlterBot construct (FIG. 25) was used as the source of C. botulinum C fragment gene sequences for the botulinal fusion proteins. pAlterBot was obtained from J. Middlebrook and R. Lemley at the U.S. Department of Defense. pAlterBot contains a synthetic C. botulinum C fragment inserted in to the pALTER-1.RTM. vector (Promega). This synthetic C fragment gene encodes the same amino acids as does the naturally occurring C fragment gene. The naturally occurring C fragment sequences, like most clostridial genes, are extremely A/T rich (Thompson et al., supra). This high A/T content creates expression difficulties in E. coli and yeast due to altered codon usage frequency and fortuitous polyadenylation sites, respectively. In order to improve the expression of C fragment proteins in E. coli, a synthetic version of the gene was created in which the non-preferred codons were replaced with preferred codons.
The nucleotide sequence of the C. botulinum C fragment gene sequences contained within pAlterBot is listed in SEQ ID NO:22. The first six nucleotides (ATGGCT) encode a methionine and alanine residue, respectively. These two amino acids result from the insertion of the C. botulinum C fragment sequences into the pALTER.RTM. vector and provide the initiator methionine residue. The amino acid sequence of the C. botulinum C fragment encoded by the sequences contained within pAlterBot is listed in SEQ ID NO:23. The first two amino acids (Met Ala) are encoded by vector-derived sequences. From the third amino acid residue onward (Arg), the amino acid sequence is identical to that found in the C. botulinum type A toxin gene.
The pMA1870-2680, pPA1100-2680 and pAlterBot constructs were used as progenitor plasmids to make expression constructs in which fragments of the C. difficile toxin A repeat domain were expressed as genetic fusions with the C. botulinum C fragment gene using the pMAL-c expression vector (New England BioLabs). The pMAL-c expression vector generates fusion proteins which contain the MBP at the amino-terminal end of the protein. A construct, pMBot, in which the C. botulinum C fragment gene was expressed as a fusion with only the MBP was constructed (FIG. 25). Fusion protein expression was induced from E. coli strains harboring the above plasmids, and induced protein was affinity purified on an amylose resin column.
i) Construction Of pBlueBot
In order to facilitate the cloning of the C. botulinum C fragment gene sequences into a number of desired constructs, the botulinal gene sequences were removed from pAlterBot and were inserted into the pBluescript plasmid (Stratagene) to generate pBlueBot (FIG. 25). pBlueBot was constructed as follows. Bacteria containing the pAlterBot plasmid were grown in medium containing tetracycline and plasmid DNA was isolated using the QIAprep-spin Plasmid Kit (Qiagen). One microgram of pAlterBot DNA was digested with NcoI and the resulting 3' recessed sticky end was made blunt using the Klenow fragment of DNA polymerase I (here after the Klenow fragment). The pAlterBot DNA was then digested with HindIII to release the botulinal gene sequences (the Bot insert) as a blunt (filled NcoI site)-HindIII fragment. pBluescript vector DNA was prepared by digesting 200 ng of pBluescript DNA with Smal and HindIII. The digestion products from both plasmids were resolved on an agarose gel. The appropriate fragments were removed from the gel, mixed and purified utilizing the Prep-a-Gene kit (BioRad). The eluted DNA was then ligated using T4 DNA ligase and used to transform competent DH5.alpha. cells (Gibco-BRL). Host cells were made competent for transformation using the calcium chloride protocol of Sambrook et al., supra at 1.82-1.83. Recombinant clones were isolated and confirmed by restriction digestion using standard recombinant molecular biology techniques (Sambrook et al, supra). The resultant clone, pBlueBot, contains several useful unique restriction sites flanking the Bot insert (i.e., the C. botulinum C fragment sequences derived from pAlterBot) as shown in FIG. 25.
ii) Construction Of C. difficile/C. botulinum/MBP Fusion Proteins
Constructs encoding fusions between the C. difficile toxin A gene and the C. botulinum C fragment gene and the MBP were made utilizing the same recombinant DNA methodology outlined above; these fusion proteins contained varying amounts of the C. difficile toxin A repeat domain.
The pMABot clone contains a 2.4 kb insert derived from the C. difficile toxin A gene fused to the Bot insert (i.e, the C. botulinum C fragment sequences derived from pAlterBot). pMABot (FIG. 25) was constructed by mixing gel-purified DNA from NotI/HindIII digested pBlueBot (the 1.2 kb Bot fragment), SpeI/NotI digested pPA1100-2680 (the 2.4 kb C. difficile toxin A repeat fragment) and XbaI/HindllI digested pMAL-c vector. Recombinant clones were isolated, confirmed by restriction digestion and purified using the QIAprep-spin Plasmid Kit (Qiagen). This clone expresses the toxin A repeats and the botulinal C fragment protein sequences as an in-frame fusion with the MBP.
The pMCABot construct contains a 1.0 kb insert derived from the C. difficile toxin A gene fused to the Bot insert (i.e, the C. botulinum C fragment sequences derived from pAlterBot). pMCABot was constructed by digesting the pMABot clone with EcoRI to remove the 5' end of the C. difficile toxin A repeat (see FIG. 25, the pMAL-c vector contains a EcoRi site 5' to the C. difficile insert in the pMABot clone). The restriction sites were filled and religated together after gel purification. The resultant clone (pMCABot, FIG. 25) generated an in-frame fusion between the MBP and the remaining 3' portion of the C. difficile toxin A repeat domain fused to the Bot gene.
The pMNABot clone contains the 1 kb SpeI/EcoRI (filled) fragment from the C. difficile toxin A repeat domain (derived from clone pPA 1100-2680) and the 1.2 kb C. botulinum C fragment gene as a NcoI (filled)/HindlII fragment (derived from pAlterBot). These two fragments were inserted into the pMAL-c vector digested with XbaI/HindIII. The two insert fragments were generated by digestion of the appropriate plasmid with EcoRI (pPA1100-2680) or NcoI (pAlterBot) followed by treatment with the Klenow fragment. After treatment with the Klenow fragment, the plasmids were digested with the second enzyme (either SpeI or HindIII). All three fragments were gel purified, mixed and Prep-a-Gene purified prior to ligation. Following ligation and transformation, putative recombinants were analyzed by restriction analysis; the EcoRI site was found to be regenerated at the fusion junction, as was predicted for a fusion between the filled EcoRI and NcoI sites.
A construct encoding a fusion protein between the botulinal C fragment gene and the MBP gene was constructed (i.e., this fusion lacks any C. difficile toxin A gene sequences) and termed pMBot. The pMBot construct was made by removal of the C. difficile toxin A sequences from the pMABot construct and fusing the C fragment gene sequences to the MBP. This was accomplished by digestion of pMABot DNA with StuI (located in the pMALc polylinker 5' to the XbaI site) and XbaI (located 3' to the NotI site at the toxA-Bot fusion junction), filling in the XbaI site using the Klenow fragment, gel purifying the desired restriction fragment, and ligating the blunt ends to circularize the plasmid. Following ligation and transformation, putative recombinants were analyzed by restriction mapping of the Bot insert (i.e, the C. botulinum C fragment sequences).
b) Expression Of C. botulinum C Fragment Fusion Proteins In E. coli
Large scale (1 liter) cultures of the pMAL-c vector, and each recombinant construct described above in (a) were grown, induced, and soluble protein fractions were isolated as described in Example 18. The soluble protein extracts were chromatographed on amylose affinity columns to isolate recombinant fusion protein. The purified recombinant fusion proteins were analyzed by running samples on SDS-PAGE gels followed by Coomassie staining and by Western blot analysis as described �Williams et al, (1994) supra!. In brief, extracts were prepared and chromatographed in column buffer (10 mM NaPO.sub.4, 0.5M NaCl, 10 mM .beta.-mercaptoethanol, pH 7.2) over an amylose resin (New England Biolabs) column, and eluted with column buffer containing 10 mM maltose as described �Williams, et al. (1994), supra!. An SDS-PAGE gel containing the purified protein samples stained with Coomassie blue is shown in FIG. 26.
In FIG. 26, the following samples were loaded. Lanes 1-6 contain protein purified from E. coli containing the pMAL-c, pPA1870-2680, pMABot, pMNABot, pMCABot and pMBot plasmids, respectively. Lane 7 contains broad range molecular weight protein markers (BioRad).
The protein samples were prepared for electrophoresis by mixing 5 .mu.l of eluted protein with 5 .mu.l of 2.times. SDS-PAGE sample buffer (0.125 mM Tris-HCl, pH 6.8, 2 mM EDTA, 6% SDS, 20% glycerol, 0.025% bromophenol blue; .beta.-mercaptoethanol is added to 5% before use). The samples were heated to 95.degree. C. for 5 min, then cooled and loaded on a 7.5% agarose SDS-PAGE gel. Broad range molecular weight protein markers were also loaded to allow estimation of the MW of identified fusion proteins. After electrophoresis, protein was detected generally by staining the gel with Coomassie blue.
In all cases the yields were in excess of 20 mg fusion protein per liter culture (see Table 36) and, with the exception of the pMCABot protein, a high percentage (i.e., greater than 20-50% of total eluted protein) of the eluted fusion protein was of a MW predicted for the full length fusion protein (FIG. 26). It was estimated (by visual inspection) that less than 10% of the pMCABot fusion protein was expressed as the full length fusion protein.
TABLE 36______________________________________Yield Of Affinity Purified C. botulinum C Fragment/MBP Fusion Proteins Yield (mg/liter Percentage of TotalConstruct of Culture) Soluble Protein______________________________________pMABot 24 5.0pMCABot 34 5.0pMNABot 40 5.5pMBot 22 5.0pMA1870-2680 40 4.8______________________________________
These results demonstrate that high level expression of intact C. botulinum C fragment/C. difficile toxin A fusion proteins in E. coli is feasible using the pMAL-c expression system. These results are in contrast to those reported by H. F. LaPenotiere, et al. (1993), supra. In addition, these results show that it is not necessary to fuse the botulinal C fragment gene to the C. difficile toxin A gene in order to produce a soluble fusion protein using the pMAL-c system in E. coli.
In order to determine whether the above-described botulinal fusion proteins were recognized by anti-C. botulinum toxin A antibodies, Western blots were performed. Samples containing affinity-purified proteins from E. coli containing the pMABot, pMCABot, pMNABot, pMBot, pMA1870-2680 or pMALc plasmids were analyzed. SDS-PAGE gels (7.5% acrylamide) were loaded with protein samples purified from each expression construct. After electrophoresis, the gels were blotted and protein transfer was confirmed by Ponceau S staining (as described in Example 12b).
Following protein transfer, the blots were blocked by incubation for 1 hr at 20.degree. C. in blocking buffer �PBST (PBS containing 0.1% Tween 20 and 5% dry milk)!. The blots were then incubated in 10 ml of a solution containing the primary antibody; this solution comprised a 1/500 dilution of an anti-C. botulinum toxin A IgY PEG prep (described in Example 3) in blocking buffer. The blots were incubated for 1 hr at room temperature in the presence of the primary antibody. The blots were washed and developed using a rabbit anti-chicken alkaline phosphatase conjugate (Boehringer Mannheim) as the secondary antibody as follows. The rabbit anti-chicken antibody was diluted to 1 .mu.g/ml in blocking buffer (10 ml final volume per blot) and the blots were incubated at room temperature for 1 hour in the presence of the secondary antibody. The blots were then washed successively with PBST, BBS-Tween and 50 mM Na.sub.2 CO.sub.3, pH 9.5. The blots were then developed in freshly-prepared alkaline phosphatase substrate buffer (100 .mu.g/ml nitro blue tetrazolium, 50 .mu.g/ml 5-bromo-chloro-indolylphosphate, 5 mM MgCl.sub.2 in 50 mM Na.sub.2 CO.sub.3, pH 9.5). Development was stopped by flooding the blots with distilled water and the blots were air dried.
This Western blot analysis detected anti-C. botulinum toxin reactive proteins in the pMABot, pMCABot, pMNABot and pMBot protein samples (corresponding to the predicted full length proteins identified above by Coomassie staining in FIG. 26), but not in the pMA1100-2680 or pMALc protein samples.
These results demonstrate that the relevant fusion proteins purified on an amylose resin as described above in section a) contained immunoreactive C botulinum C fragment protein as predicted.
EXAMPLE 23
Generation Of Neutralizing Antibodies By Nasal Administration Of pMBot Protein
The ability of the recombinant botulinal toxin proteins produced in Example 22 to stimulate a systemic immune response against botulinal toxin epitopes was assessed. This example involved: a) the evaluation of the induction of serum IgG titers produced by nasal or oral administration of botulinal toxin-containing C. difficile toxin A fusion proteins and b) the in vivo neutralization of C. botulinum type A neurotoxin by antirecombinant C. botulinum C fragment antibodies.
a) Evaluation Of The Induction Of Serum IgG Titers Produced By Nasal Or Oral Administration Of Botulinal Toxin-Containing C. Difficile Toxin A Fusion Proteins
Six groups containing five 6 week old CF female rats (Charles River) per group were immunized nasally or orally with one of the following three combinations using protein prepared in Example 22: (1) 250 .mu.g pMBot protein per rat (nasal and oral); 2) 250 .mu.g pMABot protein per rat (nasal and oral); 3) 125 .mu.g pMBot admixed with 125 .mu.g pMA1870-2680 per rat (nasal and oral). A second set of 5 groups containing 3 CF female rats/group were immunized nasally or orally with one of the following combinations (4) 250 .mu.g pMNABot protein per rat (nasal and oral) or 5) 250 .mu.g pMAL-c protein per rat (nasal and oral).
The fusion proteins were prepared for immunization as follows. The proteins (in column buffer containing 10 mM maltose) were diluted in 0.1M carbonate buffer, pH 9.5 and administered orally or nasally in a 200 .mu.l volume. The rats were lightly sedated with ether prior to administration. The oral dosing was accomplished using a 20 gauge feeding needle. The nasal dosing was performed using a P-200 micro-pipettor (Gilson). The rats were boosted 14 days after the primary immunization using the techniques described above and were bled 7 days later. Rats from each group were lightly etherized and bled from the tail. The blood was allowed to clot at 37.degree. C. for 1 hr and the serum was collected.
The serum from individual rats was analyzed using an ELISA to determine the anti-C. botulinum type A toxin IgG serum titer. The ELISA protocol used is a modification of that described in Example 13c. Briefly, 96-well microtiter plates (Falcon, Pro-Bind Assay Plates) were coated with C. botulinum type A toxoid (prepared as described in Example 3a) by placing 100 .mu.l volumes of C. botulinum type A toxoid at 2.5 .mu.g/ml in PBS containing 0.005% thimerosal in each well and incubating overnight at 4.degree. C. The next morning, the coating suspensions were decanted and all wells were washed three times using PBS.
In order to block non-specific binding sites, 100 .mu.l of blocking solution �0.5% BSA in PBS! was then added to each well and the plates were incubated for 1 hr at 37.degree. C. The blocking solution was decanted and duplicate samples of 150 .mu.l of diluted rat serum added to the first well of a dilution series. The initial testing serum dilution was 1:30 in blocking solution containing 0.5% Tween 20 followed by 5-fold dilutions into this solution. This was accomplished by serially transferring 30 .mu.l aliquots to 120 .mu.l blocking solution containing 0.5% Tween 20, mixing, and repeating the dilution into a fresh well. After the final dilution, 30 .mu.l was removed from the well such that all wells contained 120 .mu.l final volume. A total of 3 such dilutions were performed (4 wells total). The plates were incubated 1 hr at 37.degree. C. Following this incubation, the serially diluted samples were decanted and the wells were washed six times using PBS containing 0.5% Tween 20 (PBST). To each well, 100 .mu.l of a rabbit anti-Rat IgG alkaline phosphatase (Sigma) diluted (1/1000) in blocking buffer containing 0.5% Tween 20 was added and the plate was incubated for 1 hr at 37.degree. C. The conjugate solutions were decanted and the plates were washed as described above, substituting 50 mM Na.sub.2 CO.sub.3, pH 9.5 for the PBST in the final wash. The plates were developed by the addition of 100 .mu.l of a solution containing 1 mg/ml para-nitro phenyl phosphate (Sigma) dissolved in 50 mM Na.sub.2 CO.sub.3, 10 mM MgCl.sub.2, pH 9.5 to each well, and incubating the plates at room temperature in the dark for 5-45 min. The absorbency of each well was measured at 410 nm using a Dynatech MR 700 plate reader. The results are summarized in Tables 37 and 38 and represent mean serum reactivities of individual mice.
TABLE 37__________________________________________________________________________Determination Of Anti-C. botulinum Type A Toxin Serum IgG TitersFollowing Immunization With C. botulinum C Fragment-Containing FusionProteins Nasal OralRoute of Immunization pMBot & pMBot & PRE- pMA1870- pMA1870-Immunogen IMMUNE pMBot 2680 pMABot pMBot 2680 pMABot__________________________________________________________________________Dilution1:30 0.080 1.040 1.030 0.060 0.190 0.080 0.1201:159 0.017 0.580 0.540 0.022 0.070 0.020 0.0271:750 0.009 0.280 0.260 0.010 0.020 0.030 0.0141:3750 0.007 0.084 0.090 0.009 0.009 0.010 0.007#Rats 5 5 5 5 2 2Tested__________________________________________________________________________ *Numbers represent the average values obtained from two ELISA plates, standarized utilizing the preimmune control.
TABLE 38______________________________________Determination Of Anti-C. botulinum Type A Toxin Serum IgG TitersFollowing Immunization With C. botulinum C Fragment-ContainingFusion ProteinsRoute of Immunization PRE- Nasal OralImmunogen IMMUNE pMBot pMABot pMNABot pMNABot______________________________________Dilution1:30 0.040 0.557 0.010 0.015 0.0101:150 0.009 0.383 0.001 0.003 0.0021:750 0.001 0.140 0.000 0.000 0.0001:3750 0.000 0.040 0.000 0.000 0.000# Rats Tested 1 1 3 3______________________________________
The above ELISA results demonstrate that reactivity against the botulinal fusion proteins was strongest when the route of administration was nasal; only weak responses were stimulated when the botulinal fusion proteins were given orally. Nasally delivered pMbot and pMBot admixed with pMA1870-2680 invoked the greatest serum IgG response. These results show that only the pMBot protein is necessary to induce this response, since the addition of the pMA1870-2680 protein did not enhance antibody response (Table 37). Placement of the C. difficile toxin A fragment between the MBP and the C. botulinum C fragment protein dramatically reduced anti-bot IgG titer (see results using pMABot, pMCABot and pMNABot proteins).
This study demonstrates that the pMBot protein induces a strong serum IgG response directed against C. botulinum type A toxin when nasally administered.
b) In Vivo Neutralization Of C. botulinum Type A Neurotoxin By Anti-Recombinant C. Botulinum C Fragment Antibodies
The ability of the anti-C. botulinum type A toxin antibodies generated by nasal administration of recombinant botulinal fusion proteins in rats (Example 22) to neutralize C. botulinum type A toxin was tested in a mouse neutralization model. The mouse model is the art accepted method for detection of botulinal toxins in body fluids and for the evaluation of anti-botulinal antibodies �E. J. Schantz and D. A. Kautter, J. Assoc. Off. Anal. Chem. 61:96 (1990) and Investigational New Drug (BB-IND-3703) application by the Surgeon General of the Department of the Army to the Federal Food and Drug Administration!. The anti-C. botulinum type A toxin antibodies were prepared as follows.
Rats from the group given pMBot protein by nasal administration were boosted a second time with 250 .mu.g pMBot protein per rat and serum was collected 7 days later. Serum from one rat from this group and from a preimmune rat was tested for anti-C. botulinum type A toxin neutralizing activity in the mouse neutralization model described below.
The LD.sub.50 of a solution of purified C. botulinum type A toxin complex, obtained from Dr. Eric Johnson (University of Wisconsin Madison), was determined using the intraperitoneal (IP) method of Schantz and Kautter �J. Assoc. Off. Anal. Chem. 61:96 (1978)! using 18-22 gram female ICR mice and was found to be 3500 LD.sub.50 /ml. The determination of the LD.sub.50 was performed as follows. A Type A toxin standard was prepared by dissolving purified type A toxin complex in 25 mM sodium phosphate buffer, pH 6.8 to yield a stock toxin solution of 3.15.times.10.sup.7 LD.sub.50 /mg. The OD.sub.278 of the solution was determined and the concentration was adjusted to 10-20 .mu.g/ml. The toxin solution was then diluted 1:100 in gel-phosphate (30 mM phosphate, pH 6.4; 0.2% gelatin). Further dilutions of the toxin solution were made as shown below in Table 39. Two mice were injected IP with 0.5 ml of each dilution shown and the mice were observed for symptoms of botulism for a period of 72 hours.
TABLE 39______________________________________Determination Of The LD.sub.50 Of Purified C. botulinum TypeA Toxin ComplexDilution Number Dead at 72 hr______________________________________1:320 2/21:640 2/21:1280 2/21:2560 0/2 (sick after 72 hr)1:5120 0/2 (no symptoms)______________________________________
From the results shown in Table 39, the toxin titer was assumed to be between 2560 LD.sub.50 /ml and 5120 LD.sub.50 /ml (or about 3840 LD.sub.50 /ml). This value was rounded to 3500 LD.sub.50 /ml for the sake of calculation.
The amount of neutralizing antibodies present in the serum of rats immunized nasally with pMBot protein was then determined. Serum from two rats boosted with pMBot protein as described above and preimmune serum from one rat was tested as follows. The toxin standard was diluted 1:100 in gel-phosphate to a final concentration of 350 LD.sub.50 /ml. One milliliter of the diluted toxin standard was mixed with 25 .mu.l of serum from each of the three rats and 0.2 ml of gel-phosphate. The mixtures were incubated at room temperature for 30 min with occasional mixing. Each of two mice were injected with IP with 0.5 ml of the mixtures. The mice were observed for signs of botulism for 72 hr. Mice receiving serum from rats immunized with pMBot protein neutralized this challenge dose. Mice receiving preimmune rat serum died in less than 24 hr.
The amount of neutralizing anti-toxin antibodies present in the serum of rats immunized with pMBot protein was then quantitated. Serum antibody titrations were performed by mixing 0.1 ml of each of the antibody dilutions (see Table 40) with 0.1 ml of a 1:10 dilution of stock toxin solution (3.5.times.10.sub.4 LD.sub.50 /ml) with 1.0 ml of gel-phosphate and injecting 0.5 ml/IP into 2 mice per dilution. The mice were then observed for signs of botulism for 3 days (72 hr). The results are tabulated in Table 39.
As shown in Table 40 pMBot serum neutralized C. botulinum type A toxin complex when used at a dilution of 1:320 or less. A mean neutralizing value of 168 IU/ml was obtained for the pMBot serum (an IU is defined as 10,000 mouse LD.sub.50). This value translates to a circulating serum titer of about 3.7 IU/mg of serum protein. This neutralizing titer is comparable to the commercially available bottled concentrated (Connaught Laboratories, Ltd.) horse anti-C. botulinum antiserum. A 10 ml vial of Connaught antiserum contains about 200 mg/ml of protein;each ml can neutralize 750
TABLE 40______________________________________Quantitation Of Neutralizing Antibodies In pMBot Sera pMBBot.sup.aDilution Rat 1 Rat 2______________________________________1:20 2/2 2/21:40 2/2 2/21:80 2/2 2/21:160 2/2 2/21:320 2/2.sup.b 2/2.sup.b1:640 0/2 0/21:1280 0/2 0/21:2560 0/2 0/2______________________________________ .sup.a Numbers represent the number of mice surviving at 72 hours which received serum taken from rats immunized with the pMBot protein. .sup.b These mice survived but were sick after 72 hr.
IU of C. botulinum type A toxin. After administration of one vial to a hu.an, the circulating serum titer of the Connaught preparation would be approximately 25 IU/mi assuming an average serum volume of 3 liters). Thus, the circulating anti-C. botulinum titer seen in rats nasally immunized with pMBot protein (168 IU/ml) is 6.7 time higher than the necessary circulation titer of anti-C. botulinum antibody needed to be protective in humans.
These results demonstrate that antibodies capable of neutralizing C. botulinum type A toxin are induced when recombinant C. botulinum C fragment fusion protein produced in E. coli is used as an immunogen.
EXAMPLE 24
Production Of Soluble C. botulinum C Fragment Protein Substantially Free Of Endotoxin Contamination
Example 23 demonstrated that neutralizing antibodies are generated by immunization with the pMBot protein expressed in E. coli. These results showed that the pMBot fusion protein is a good vaccine candidate. However, immunogens suitable for use as vaccines should be pyrogen-free in addition to having the capability of inducing neutralizing antibodies. Expression clones and conditions that facilitate the production of C. botulinum C fragment protein for utililization as a vaccine were developed.
The example involved: (a) determination of pyrogen content of the pMBot protein; (b) generation of C. botulinum C fragment protein free of the MBP; (c) expression of C. botulinum C fragment protein using various expression vectors; and (d) purification of soluble C. botulinum C fragment protein substantially free of significant endotoxin contamination.
a) Determination Of The Pyrogen Content Of The pMBot Protein
In order to use a recombinant antigen as a vaccine in humans or other animals, the antigen preparation must be shown to be free of pyrogens. The most significant pyrogen present in preparations of recombinant proteins produced in gram-negative bacteria, such as E. coli, is endotoxin �F. C. Pearson, Pyrogens: endotoxins, LAL testing and depyrogentaion, (1985) Marcel Dekker, New York, pp. 23-56!. To evaluate the utility of the pMBot protein as a vaccine candidate, the endotoxin content in MBP fusion proteins was determined.
The endotoxin content of recombinant protein samples was assayed utilizing the Limulus assay (LAL kit; Associates of Cape Cod) according to the manufacturer's instructions. Samples of affinity-purified pMal-c protein and pMA1870-2680 were found to contain high levels of endotoxin �>50,000 EU/mg protein; EU (endotoxin unit)!. This suggested that MBP- or toxin A repeat-containing fusions with the botulinal C fragment should also contain high levels of endotoxin. Accordingly, removal of endotoxin from affinity-purified pMal-c and pMBot protein preparations was attempted as follows.
Samples of pMal-c and pMBot protein were depyrogenated with polymyxin to determine if the endotoxin could be easily removed. The following amount of protein was treated: 29 ml at 4.8 OD.sub.280 /ml for pMal-c and 19 mls at 1.44 OD.sub.280 /ml for pMBot. The protein samples were dialyzed extensively against PBS and mixed in a 50 ml tube (Falcon) with 0.5 ml PBS-equilibrated polymyxin B (Affi-Prep Polymyxin, BioRad). The samples were allowed to mix by rotating the tubes overnight at 4.degree. C. The polymyxin was pelleted by centrifugation for 30 min in a bench top centrifuge at maximum speed (approximately 2000.times.g) and the supernatant was removed. The recovered protein (in the supernatant) was quantified by OD.sub.280, and the endotoxin activity was assayed by LAL. In both cases only approximately 1/3 of the input protein was recovered and the polymyxin-treated protein retained significant endotoxin contamination (approximately 7000 EU/mg of pMBot).
The depyrogenation experiment was repeated using an independently purified pMal-c protein preparation and similar results were obtained. From these studies it was concluded that significant levels of endotoxin copurifies with these MBP fusion proteins using the amylose resin. Furthermore, this endotoxin cannot be easily removed by polymyxin treatment.
These results suggest that the presence of the MBP sequences on the fusion protein complicated the removal of endotoxin from preparations of the pMBot protein.
b) Generation Of C. botulinum C Fragment Protein Free Of The MBP
It was demonstrated that the pMBot fusion protein could not be easily purified from contaminating endotoxin in section a) above. The ability to produce a pyrogen-free (e.g., endotoxin-free) preparation of soluble botulinal C fragment protein free of the MBP tag was next investigated. The pMBot expression construct was designed to facilitate purification of the botulinal C fragment from the MBP tag by cleavage of the fusion protein by utilizing an engineered Factor Xa cleavage site present between the MBP and the botulinal C fragment. The Factor Xa cleavage was performed as follows.
Factor Xa (New England Biolabs) was added to the pMBot protein (using a 0.1-1.0% Factor Xa/pMBot protein ratio) in a variety of buffer conditions �e.g., PBS-NaCl (PBS containing 0.5M NaCl), PBS-NaCl containing 0.2% Tween 20, PBS, PBS containing 0.2% Tween 20, PBS-C (PBS containing 2 mM CaCl.sub.2), PBS-C containing either 0.1 or 0.5% Tween 20, PBS-C containing either 0.1 or 0.5% NP-40, PBS-C containing either 0.1 or 0.5% Triton X-100, PBS-C containing 0.1% sodium deoxycholate, PBS-C containing 0.1% SDS!. The Factor Xa digestions were incubated for 12-72 hrs at room temperature.
The extent of cleavage was assessed by Western blot or Coomassie blue staining of proteins following electrophoresis on denaturing SDS-PAGE gels, as described in Example 22. Cleavage reactions (and control samples of uncleaved pMBot protein) were centrifuged for 2 min in a microfuge to remove insoluble protein prior to loading the samples on the gel. The Factor Xa treated samples were compared with uncleaved, uncentrifuged pMBot samples on the same gel. The results of this analysis is summarized below.
1) Most (about 90%) pMBot protein could be removed by centrifugation, even when uncleaved control samples were utilized. This indicated that the pMBot fusion protein was not fully soluble (i.e., it exists as a suspension rather than as a solution). �This result was consistent with the observation that most affinity-purified pMBot protein precipitates after long term storage (>2 weeks) at 4.degree. C. Additionally, the majority (i.e., 75%) of induced pMBot protein remains in the pellet after sonication and clarification of the induced E. coli. Resuspension of these insoluble pellets in PBS followed by sonication results in partial solubilization of the insoluble pMBot protein in the pellets.!
2) The portion of pMBot protein that is fully in solution (about 10% of pMBot protein) is completely cleaved by Factor Xa, but the cleaved (released) botulinal C fragment is relatively insoluble such that only the cleaved MBP remains fully in solution.
3) None of the above reaction conditions enhanced solubility without also reducing effective cleavage. Conditions that effectively solubilized the cleaved botulinal C fragment were not identified.
4) The use of 0.1% SDS in the buffer used for Factor Xa cleavage enhanced the solubility of the pMBot protein (all of pMBot protein was soluble). However, the presence of the SDS prevented any cleavage of the fusion protein with Factor Xa.
5) Analysis of pelleted protein from the cleavage reactions indicated that both full length pMBot (ie., uncleaved) and cleaved botulinal C fragment protein precipitated during incubation.
These results demonstrate that purification of soluble botulinal C fragment protein after cleavage of the pMBot fusion protein is complicated by the insolubility of both the pMBot protein and the cleaved botulinal C fragment protein.
c) Expression Of C. botulinum C Fragment Using Various Expression Vectors
In order to determine if the solubility of the botulinal C fragment was enhanced by expressing the C fragment protein as a native protein, an N-terminal His-tagged protein or as a fusion with glutathione-S-transferase (GST), alternative expression plasmids were constructed. These expression constructs were generated utilizing the methodologies described in Example 22. FIG. 27 provides a schematic representation of the vectors described below.
In FIG. 27, the following abbreviations are used. pP refers to the pET23 vector. pHIS refers to the pETHisa vector. pBlue refers to the pBluescript vector. pM refers to the pMAL-c vector and pG refers to the pGEX3T vector (described in Example 11). The solid black lines represent C. botulinum C fragment gene sequences; the solid black ovals represent the MBP; the hatched ovals represent GST; "HHHHH (SEQ ID NO:30)" represents the poly-histidine tag. In FIG. 27, when the name for a restriction enzyme appears inside parenthesis, this indicates that the restriction site was destroyed during construction. An asterisk appearing with the name for a restriction enzyme indicates that this restriction site was recreated at a cloning junction.
Construction Of pPBot
In order to express the C. botulinum C fragment as a native (i.e., non-fused) protein, the pPBot plasmid (shown schematically in FIG. 27) was constructed as follows. The C fragment sequences present in pAlterBot (Example 22) were removed by digestion of pAlterBot with NcoI and HindIII. The NcoI/HindIII C fragment insert was ligated to pETHisa vector (described in Example 18b) which was digested with NcoI and HindIII. This ligation creates an expression construct in which the NcoI-encoded methionine of the botulinal C fragment is the initiator codon and directs expression of the native botulinal C fragment. The ligation products were used to transform competent BL21(DE3)pLysS cells (Novagen). Recombinant clones were identified by restriction mapping.
ii) Construction Of pHisBot
In order to express the C. botulinum C fragment containing a poly-histidine tag at the amino-terminus of the recombinant protein, the pHisBot plasmid (shown schematically in FIG. 27) was constructed as follows. The NcoI/HindIII botulinal C fragment insert from pAlterbot was ligated into the pETHisa vector which was digested with NheI and HindIII. The NcoI (on the C fragment insert) and NheI (on the pETHisa vector) sites were filled in using the Klenow fragment prior to ligation; these sites were then blunt end ligated (the NdeI site was regenerated at the clone junction as predicted). The ligation products were used to transform competent BL21(DE3)pLysS cells and recombinant clones were identified by restriction mapping.
The resulting pHisBot clone expresses the botulinal C fragment protein with a histidine-tagged N-terminal extension having the following sequence: MetGlyHisHisHisHisHisHisHisHisHisHisSerSerGlyHisIleGluGlyArgHisMetAla, (SEQ ID NO:24); the amino acids encoded by the botulinal C fragment gene are underlined and the vector encoded amino acids are presented in plain type. The nucleotide sequence present in the pETHisa vector which encodes the pHisBot fusion protein is listed in SEQ ID NO:25. The amino acid sequence of the pHlisBot protein is listed in SEQ ID NO:26.
iii) Construction Of pGBot
The botulinal C fragment protein was expressed as a fusion with the glutathione-S-transferase protein by constructing the pGBot plasmid (shown schematically in FIG. 27). This expression construct was created by cloning the NotI/SalI C fragment insert present in pBlueBot (Example 22) into the pGEX3T vector which was digested with SmaI and XhoI. The NotI site (present on the botulinal fragment) was made blunt prior to ligation using the Klenow fragment. The ligation products were used to transform competent BL21 cells.
Each of the above expression constructs were tested by restriction digestion to confirm the integrity of the constructs.
Large scale (1 liter) cultures of pPBot �BL21(DE3)pLysS host!, pHisBot �BL21(DE3)pLysS host! and pGBot (BL21 host) were grown in 2.times. YT medium and induced (using IPTG to 0.8-1.0 mM) for 3 hrs as described in Example 22. Total, soluble and insoluble protein preparations were prepared from 1 ml aliquots of each large scale culture �Williams et al. (1994), supra! and analyzed by SDS-PAGE. No obvious induced band was detectable in the pPBot or pHisBot samples by Coomassie staining, while a prominent insoluble band of the anticipated MW was detected in the pGBot sample. Soluble lysates of the pGBot large scale (resuspended in PBS) or pHisBot large scale �resuspended in Novagen 1.times. binding buffer (5 mM imidazole, 0.5M NaCl, 20 mM Tris-HCl, pH 7.9)! cultures were prepared and used to affinity purify soluble affinity-tagged protein as follows.
The pGBot lysate was affinity purified on a glutathione-agarose resin (Pharmacia) exac.mu.ly as described in Smith and Corcoran �Current Protocols in Molecular Biology, Supplement 28 (1994), pp. 16.7.1-16.7.7!. The pHisBot protein was purified on the His-Bind resin (Novagen) utilizing the His-bind buffer kit (Novagen) exactly as described by manufacturer.
Samples from the purification of both the pGBot and pHisBot proteins (including uninduced, induced, total, soluble, and affinity-purified eluted protein) were resolved on SDS-PAGE gels. Following electrophoresis, proteins were analyzed by Coomassie staining or by Western blot detection utilizing a chicken anti-C. botulinum Type A toxoid antibody (as described in Example 22).
These studies showed that the pGBot protein was almost entirely insoluble under the utilized conditions, while the pHisBot protein was soluble. Affinity purification of the pHisBot protein on this first attempt was inefficient, both in terms of yield (most of the immunoreactive botulinal protein did not bind to the His-bind resin) and purity (the botulinal protein was estimated to comprise approximately 20% of the total eluted protein).
d) Puirifcation Of Soluble C botulinum C Fragment Protein Substantially Free Of Endotoxin Contamination
The above studies showed that the pHisBot protein was expressed in E. coli as a soluble protein. However, the affinity purification of this protein on the His-bind resin was very inefficient. In order to improve the affinity purification of the soluble pHisBot protein (in terms of both yield and purity), an alternative poly-histidine binding affinity resin (Ni-NTA resin; Qiagen) was utilized. The Ni-NTA resin was reported to have a superior binding affinity (K.sub.d =1.times.10.sup.-13 at pH 8.0; Qiagen user manual) relative to the His-bind resin.
A soluble lysate (in Novagen 1.times. binding buffer) from an induced 1 liter 2.times. YT culture was prepared as described above. Briefly, the culture of pHisBot �B121(DE3)pLysS host! was grown at 37.degree. C. to an OD.sub.600 of 0.7 in 1 liter of 2.times. YT medium containing 100 .mu.g/ml ampicillin, 34 .mu.g/ml chloramphenicol and 0.2% glucose. Protein expression was induced by the addition of IPTG to 1 mM. Three hours after the addition of the IPTG, the cells were cooled for 15 min in a ice water bath and then centrifuged 10 min at 5000 rpm in a JA10 rotor (Beckman) at 4.degree. C. The pellets were resuspended in a total volume of 40 mls Novagen 1.times. binding buffer (5 mM imidazole, 0.5M NaCl, 20 mM Tris-HCl, pH 7.9), transferred to two 35 ml Oakridge tubes and frozen at -70.degree. C. for at least 1 hr. The tubes were thawed and the cells were lysed by sonication (4.times.20 second bursts using a Branson Sonifier 450 with a power setting of 6-7) on ice. The suspension was clarified by centrifugation for 20 min at 9,000 rpm (10,000.times.g) in a JA-17 rotor (Beckman).
The soluble lysate was brought to 0.1% NP40 and then was batch absorbed to 7 ml of a 1:1 slurry of Ni-NTA resin:binding buffer by stirring for 1 hr at 4.degree. C. The slurry was poured into a column having an internal diameter of 1 or 2.5 cm (BioRad). The column was then washed sequentially with 15 mls of Novagen 1.times. binding buffer containing 0.1% NP40, 15 ml of Novagen 1.times. buffer, 15 ml wash buffer (60 mM imidazole, 0.5M NaCl, 20 mM Tris-HCl, pH 7.9) and 15 ml NaHPO.sub.4 wash buffer (50 mM NaHPO.sub.4, pH 7.0, 0.3M NaCl, 10% glycerol). The bound protein was eluted by protonation of the resin using elution buffer (50 mM NaHPO.sub.4, pH 4.0, 0.3M NaCl, 10% glycerol). The eluted protein was stored at 4.degree. C.
Samples of total, soluble and eluted protein were resolved by SDS-PAGE. Protein samples were prepared for electrophoresis as described in Example 22b. Duplicate gels were stained with Coomassie blue to visualize the resolved proteins and C. botulinum type A toxin-reactive protein was detected by Western blot analysis as described in Example 22b. A representative Coomassie stained gel is shown in FIG. 28. In FIG. 28, the following samples were loaded on the 12.5% acrylamide gel. Lanes 1-4 contain respectively total protein, soluble protein, soluble protein present in the flow-through of the Ni-NTA column and affinity-purified pHisBot protein (i.e., protein released from the Ni-NTA resin by protonation). Lane 5 contains high molecular weight protein markers (BioRad).
The purification of pHisBot protein resulted in a yield of 7 mg of affinity purified protein from a 1 liter starting culture of BL21(DDE3)pLysS cells harboring the pHisBot plasmid. The yield of purified pHisBot protein represented approximately 0.4% of the total soluble protein in the induced culture. Analysis of the purified pHisBot protein by SDS-PAGE revealed that at least 90-95% of the protein was present as a single band (FIG. 28) of the predicted MW (50 kD). This 50 kD protein band was immunoreactive with anti-C. botulinum type A toxin antibodies. The extinction coefficient of the protein preparation was determined to be 1.4 (using the Pierce BCA assay) or 1.45 (using the Lowry assay) OD.sub.280 per 1 mg/ml solution.
Samples of pH neutralized eluted pHisBot protein were resolved on a KB 803 HPLC column (Shodex). Although His-tagged proteins are retained by this sizing column (perhaps due to the inherent metal binding ability of the proteins), the relative mobility of the pHisBot protein was consistent with that expected for a non-aggregated protein in solution. Most of the induced pHisBot protein was determined to be soluble under the growth and solubilization conditions utilized above (i.e., greater than 90% of the pHisBot protein was found to be soluble as judged by comparison of the levels of pHisBot protein seen in total and soluble protein samples prepared from BL21(DE3)pLysS cells containing the pHisBot plasmid). SDS-PAGE analysis of samples obtained after centrifugation, extended storage at -20.degree. C., and at least 2 cycles of freezing and thawing detected no protein loss (due to precipitation), indicating that the pHisBot protein is soluble in the elution buffer (i.e., 50 mM NaHPO.sub.4, pH 4.0, 0.3M NaCl, 10% glycerol).
Determination of endotoxin contamination in the affinity purified pHisBot preparation (after pH neutralization) using the LAL assay (Associates of Cape Cod) detected no significant endotoxin contamination. The assay was performed using the endpoint chromogenic method (without diazo-coupling) according to the manufacturer's instructions. This method can detect concentrations of endotoxin greater than or equal to 0.03 EU/ml (EU refers to endotoxin units). The LAL assay was run using 0.5 ml of a solution comprising 0.5 mg pHisBot protein in 50 mM NaHPO.sub.4, pH 7.0, 0.3M NaCl, 10% glycerol; 30-60 EU were detected in the 0.5 ml sample. Therefore, the affinity purified pHisBot preparation contains 60-120 EU/mg of protein. FDA Guidelines for the administration of parenteral drugs require that a composition to be administered to a human contain less than 5 EU/kg body weight (The average human body weight is 70 kg; therefore up to 349 EU units can be delivered in a parental dose.). Because very small amount of protein are administered in a vaccine preparation (generally in the range of 10-500 .mu.g of protein), administration of affinity purified pHisBot containing 60-120 EU/mg protein would result in delivery of only a small percentage of the permissible endotoxin load. For example, administration of 10-500 .mu.g of purified pHisBot to a 70 kg human, where the protein preparation contains 60 EU/mg protein, results in the introduction of only 0.6 to 30 EU �i.e., 0.2 to 8.6% of the maximum allowable endotoxin burden per parenteral dose (less than 5 EU/kg body weight)!.
The above results demonstrate that endotoxin (LPS) does not copurify with the pHisBot protein using the above purification scheme. Preparations of recombinantly produced pHisBot protein containing lower levels of endotoxin (less than or equal to 2 EU/mg recombinant protein) may be produced by washing the Ni-NTA column with wash buffer until the OD.sub.280 returns to baseline levels (i.e., until no more UV-absorbing material comes off of the column).
The above results illustrate a method for the production and purification of soluble, botulinal C fragment protein substantially free of endotoxin.
EXAMPLE 25
Optimization Of The Expression And Purification Of pHisBot Protein
The results shown in Example 24d demonstrated that the pHisBot protein is an excellent candidate for use as a vaccine as it could be produced as a soluble protein in E. coli and could be purified free of pyrogen activity. In order to optimize the expression and purification of the pHisBot protein, a variety of growth and purification conditions were tested.
a) Growth Parameters
i) Host Strains
The influence of the host strain utilized upon the production of soluble pHisBot protein was investigated. A large scale purification of pHisBot was performed �as described in Example 24d above! using the BL21(DE3) host (Novagen) rather than the BL21(DE3)pLysS host. The deletion of the pLysS plasmid in the BL21(DE3) host yielded higher levels of expression due to de-repression of the plasmid's T7-lac promoter. However, the yield of affinity-purified soluble recombinant protein was very low (approximately 600 .mu.g/ liter culture) when purified under conditions identical to those described in Example 24d above. This result was due to the fact that expression in the BL21(DE3) host yielded very high level expression of the pHisBot protein as insoluble inclusion bodies as shown by SDS-PAGE analysis of protein prepared from induced BL21(DE3) cultures (FIG. 29, lanes 1-7, described below). These results demonstrate that the pHisBot protein is not inherently toxic to E. coli cells and can be expressed to high levels using the appropriate promoter/host combination.
FIG. 29 shows a Coomassie blue stained SDS-PAGE gel (12.5% acrylamide) onto which extracts prepared from BL21(DE3) cells containing the pHisBot plasmid were loaded. Each lane was loaded with 2.5 .mu.l protein sample mixed with 2.5 .mu.l of 2.times. SDS sample buffer. The samples were handled as described in Example 22b. The following samples were applied to the gel. Lanes 1-7 contain protein isolated from the BL21(DE3) host. Lanes 8-14 contain proteins isolated from the BL21(DE3)pLysS host. Total protein was loaded in lanes 1, 2, 4, 6, 8, 10 and 12. Soluble protein was loaded in Lanes 3, 5, 7, 9, 11 and 13. Lane 1 contains protein from uninduced host cells. Lanes 2-13 contain protein from host cells induced for 3 hours. IPTG was added to a final concentration of 0.1 mM (Lanes 6-7), 0.3 mM (Lanes 4-5) or 1.0 mM (Lanes 2, 3, 8-13). The cultures were grown in LB broth (Lanes 8-9), 2.times. YT broth (Lanes 10-11) or terrific broth (Lanes 1-7, 12-13). The pHisBot protein seen in Lanes 3, 5 and 7 is insoluble protein which spilled over from Lanes 2, 4 and 6, respectively. High molecular weight protein markers (BioRad) were loaded in Lane 14.
A variety of expression conditions were tested to determine if the BL21(DE3) host could be utilized to express soluble pHisBot protein at suitably high levels (i.e., about 10 mg/ml). The conditions altered were temperature (growth at 37 or 30.degree. C.), culture medium (2.times. YT, LB or Terrific broth) and inducer levels (0.1, 0.3 or 1.0 mM IPTG). All combinations of these variables were tested and the induction levels and solubility was then assessed by SDS-PAGE analysis of total and soluble extracts �prepared from 1 ml samples as described in Williams et al., (1994), supra!.
All cultures were grown in 15 ml tubes (Falcon #2057). All culture medium was prewarmed overnight at the appropriate temperature and were supplemented with 100 .mu.g/ml ampicillin and 0.2% glucose. Terrific broth contains 12 g/l bacto-tryptone, 24 g/l bacto-yeast extract and 100 ml/l of a solution comprising 0.17M KH.sub.2 PO.sub.4, 0.72M K.sub.2 HPO.sub.4. Cultures were grown in a incubator on a rotating wheel (to ensure aeration) to an OD.sub.600 of approximately 0.4, and induced by the addition of IPTG. In all cases, high level expression of insoluble pHisBot protein was observed, regardless of temperature, medium or inducer concentration.
The effect of varying the concentration of IPTG upon 2.times. YT cultures grown at 23.degree. C. was then investigated. IPTG was added to a final concentration of either 1 mM, 0.1 mM, 0.05 mM or 0.01 mM. At this temperature, similar levels of pHis Bot protein was induced in the presence of either 1 or 0.1 mM IPTG; these levels of expression was lower than that observed at higher temperatures. Induced protein levels were reduced at 0.05 mM IPTG and absent at 0.01 mM IPTG (relative to 1.0 and 0.1 mM IPTG inductions at 23.degree. C.). However, no conditions were observed in which the induced pHisBot protein was soluble in this host. Thus, although expression levels are superior in the BL21(DE3) host (as compared to the BL21(DE3)pLysS host), conditions that facilitate the production of soluble protein in this host could not be identified.
These results demonstrate that production of soluble pHisBot protein was achieved using the BL21(DE3)pLysS host in conjunction with the T7-lac promoter.
ii) Effect Of Varying Temperature, Medium And IPTG Concentration And Length Of Induction
The effect growing the host cells in various mediums upon the expression of recombinant botulinal protein from the pHisBot expression construct �in the BL21(DE3)pLysS host! was investigated. BL21(DE3)pLysS cells containing the pHisBot plasmid were grown in either LB, 2.times. YT or Terrific broth at 37.degree. C. The cells were induced using 1 mM IPTG for a 3 hr induction period. Expression of pHisBot protein was found to be the highest when the cells were grown in 2.times. YT broth (see FIG. 29, lanes 8-13).
The cells were then grown at 30.degree. C. in 2.times. YT broth and the concentration of IPTG was varied from 1.0, 0.3 or 0.1 mM and the length of induction was either 3 or 5 hours. Expression of pHisBot protein was similar at all 3 inducer concentrations utilized and the levels of induced protein were higher after a 5 hr induction as compared to a 3 hr induction.
Using the conditions found to be optimal for the expression of pHisBot protein, a large scale culture was grown in order to provide sufficient material for a large scale purification of the pHisBot protein. Three 1 liter cultures were grown in 2.times. YT medium containing 100 .mu.g/ml ampicillin, 34 .mu.g/ml chloramphenicol and 0.2% glucose. The cultures were grown at 30.degree. C. and were induced with 1.0 mM IPTG for a 5 hr period. The cultures were harvested and a soluble lysate were prepared as described in Example 18. A large scale purification was performed as described in Example 24d with the exception that except the soluble lysate was batch absorbed for 3 hours rather than for 1 hour. The final yield was 13 mg pHisBot protein/liter culture. The pHisBot protein represented 0.75% of the total soluble protein.
The above results demonstrate growth conditions under which soluble pHisBot protein is produced (i.e., use of the BL21(DE3)pLysS host, 2.times. YT medium, 30.degree. C., 1.0 mM IPTG for 5 hours).
Optimization Of Purification Parameters
For optimization of purification conditions, large scale cultures (3.times.1 liter) were grown at 30.degree. C. and induced with 1 mM IPTG for 5 hours as described above. The cultures were pooled, distributed to centrifuge bottles, cooled and pelleted as described in Example 24d. The cell pellets were frozen at -70.degree. C. until used. Each cell pellet represented 1/3 of a liter starting culture and individual bot.mu.les were utilized for each optimization experiment described below. This standardized the input bacteria used for each experiment, such that the yields of affinity purified pHisBot protein could be compared between different optimization experiments.
i) Binding Specificity (pH Protonation)
A lysate of pHisBot culture was prepared in PBS (pH 8.0) and applied to a 3 ml Ni-NTA column equilibrated in PBS (pH 8.0) using a flow rate of 0.2 ml/min (3-4 column volumes/hr) using an Econo chromatography system (BioRad). The column was washed with PBS (pH 8.0) until the absorbance (OD.sub.280) of the elute was at baseline levels. The flow rate was then increased to 2 ml/min and the column was equilibrated in PBS (pH 7.0). A pH gradient (pH 7.0 to 4.0 in PBS) was applied in order to elute the bound pHisBot protein from the column. Fractions were collected and aliquots were resolved on SDS-PAGE gels. The PAGE gels were subjected to Western blotting and the pHisBot protein was detected using a chicken anti-C botulinum Type A toxoid antibody as described in Example 22.
From the Western blot analysis it was determined that the pHisBot protein begins to elute from the Ni-NTA column at pH 6.0. This is consistent with the predicted elution of a His-tagged protein monomer at pH 5.9.
These results demonstrate that the pH at which the pHisBot protein is protonated (released) from Ni-NTA resin in PBS buffer is pH 6.0.
ii) Binding Specificity (Imidazole Competition)
In order to define purification conditions under which the native E. coli proteins could be removed from the Ni-NTA column while leaving the pJHisBot protein bound to the column, the following experiment was performed. A lysate of pHisBot culture was prepared in 50 mM NaHPO.sub.4, 0.5M NaCl, 8 mM imidazole (pH 7.0). This lysate was applied to a 3 ml Ni-NTA column equilibrated in 50 mM NaHPO.sub.4, 0.5M NaCl (pH 7.0) using an Econo chromatography system (BioRad). A flow rate of 0.2 ml/min (3-4 column volumes/hr) was utilized. The column was washed with 50 mM NaHPO.sub.4, 0.5M NaCl (pH 7.0) until the absorbance of the elute returned to baseline. The flow rate was then increased to 2 ml/min.
The column was eluted using an imidazole step gradient �in 50 mM NaHPO.sub.4, 0.5M NaCl (pH 7.0)!. Elution steps were 20 mM, 40 mM, 60 mM, 80 mM, 100 mM, 200 mM, 1.0M imidazole, followed by a wash using 0.1 mM EDTA (to strip the nickel from the column and remove any remaining protein). In each step, the wash was continued until the OD.sub.280 returned to baseline. Fractions were resolved on SDS-PAGE gels, Western blotted, and pHisBot protein detected using a chicken anti-C. botulinum Type A toxoid antibody as described in Example 22. Duplicate gels were stained with Coomassie blue to detect eluted protein in each fraction.
The results of the PAGE analysis showed that most of the non-specifically binding bacterial protein was removed by the 20 mM imidiazole wash, with the remaining bacterial proteins being removed in the 40 and 60 mM imidazole washes. The pHisBot protein began to elute at 100 mM imidazole and was quantitatively eluted in 200 mM imidazole.
These results precisely defined the window of imidazole wash stringency that optimally removes E. coli proteins from the column while specifically retaining the pHisBot protein in this buffer. These results provided conditions under which the pHisBot protein can be purified free of contaminating host proteins.
iii) Purification Buffers And Optimized Purification Protocols
A variety of purification parameters were tested during the development of an optimized protocol for batch purification of soluble pHisBot protein. The results of these analyses are summarized below.
Batch purifications were performed (as described in Example 24d) using several buffers to determine if alternative buffers could be utilized for binding of the pHisBot protein to the Ni-NTA column. It was determined that quantitative binding of pHisBot protein to the Ni-NTA resin was achieved in either Tris-HCl (pH 7.9) or NaHPO.sub.4 (pH 8.0) buffers. Binding of the pHisBot protein in NaHPO.sub.4 buffer was not inhibited using 5 mM, 8 mM or 60 mM imidazole. Quantitative elution of bound pHisBot protein was obtained in buffers containing 50 mM NaHP0.sub.4, 0.3M NaCl (pH 3.5-4.0), with or without 10% glycerol. However, quantitation of soluble affinity purified pHisBot protein before and after a freeze thaw (following several weeks storage of the affinity purified elute at -20.degree. C.) revealed that 94% of the protein was recovered using the glycerol-containing buffer, but only 68% of the protein was recovered when the buffer lacking glycerol was employed. This demonstrates that glycerol enhanced the solubility of the pHisBot protein in this low pH buffer when the eluted protein was stored at freezing temperatures (e.g., -20.degree. C.). Neutralization of pH by addition of NaH.sub.2 PO.sub.4 buffer did not result in obvious protein precipitation.
It was determined that quantitative binding of pHisBot protein using the batch format occurred after 3 hrs (FIG. 30), but not after 1 hr of binding at 4.degree. C. (the resin was stirred during binding). FIG. 30 depicts a Coomaisse blue stained SDS-PAGE gel (7.5% acrylamide) containing samples of proteins isolated during the purification of pHisBot protein from lysate prepared from the BL21(DE3)pLysS host. Each lane was loaded with 5 .mu.l of protein sample mixed with 5 .mu.l of 2.times. sample buffer and processed as described in Example 22b. Lane 1 contains high molecular weight protein markers (BioRad). Lanes 2 and 3 contain protein eluted from the Ni-NTA resin. Lane 4 contains soluble protein after a 3 hr batch incubation with the Ni-NTA resin. Lanes 5 and 6 contain soluble and total protein, respectively. FIG. 30 demonstrates that the pHisBot protein is completely soluble �compare Lanes 5 and 6 which show that a similar amount of the 50 kD pHisBot protein is seen in both; if a substantial amount (greater than 20%) of the pHisBot protein were partially insoluble in the host cell, more pHisBot protein would be seen in lane 6 (total protein) as compared to lane 5 (soluble protein)!. FIG. 30 also demonstrates that the pHisBot protein is completely removed from the lysate after batch absorption with the Ni-NTA resin for 3 hours (compare Lanes 4 and 5).
The reported high affinity interaction of the Ni-NTA resin with His-tagged proteins (K.sub.d =1.times.10.sup.-13 at pH 8.0) suggested that it should be possible to manipulate the resin-protein complexes without significant release of the bound protein. Indeed, it was determined that after the recombinant protein was bound to the Ni-NTA resin, the resin-pHisBot protein complex was highly stable and remained bound following repeated rounds of centrifugation of the resin for 2 min at 1600.times.g. When this centrifugation step was performed in a 50 ml tube (Falcon), a tight resin pellet formed. This allowed the removal of spent soluble lysate by pouring off the supernatant followed by resuspension of the pellet in wash buffer. Further washes can be performed by centrifugation. The ability to perform additional washes permits the development of protocols for batch absorption of large volumes of lysate with removal of the lysate being performed simply by centrifugation following binding of the recombinant protein to the resin.
A simplified, integrated purification protocol was developed as follows. A soluble lysate was made by resuspending the induced cell pellet in binding buffer �50 mM NaHPO.sub.4, 0.5M NaCl, 60 mM imidazole (pH 8.0)!, sonicating 4.times.20 sec and centrifuging for 20 min at 10,000.times.g. NP-40 was added to 0.1% and Ni-NTA resin (equilibrated in binding buffer) was added. Eight milliliters of a 1:1 slurry (resin:binding buffer) was used per liter of starting culture. The mixture was stirred for 3 hrs at 4.degree. C. The slurry was poured into a column having a 1 cm internal diameter (BioRad), washed with binding buffer containing 0.1% NP40, then binding buffer until baseline was established (these steps may alternatively be performed by centrifugation of the resin, resuspension in binding buffer containing NP40 followed by centrifugation and resuspension in binding buffer). Imidazole was removed by washing the resin with 50 mM NaHPO.sub.4, 0.3M NaCl (pH 7.0). Protein bound to the resin was eluted using the same buffer (50 mM NaHPO.sub.4, 0.3M NaCl) having a reduced pH (pH 3.5-4.0).
A pilot purification was performed following this protocol and yielded 18 mg/liter affinity-purified pHisBot. The pHisBot protein was greater than 90% pure as estimated by Coomassie staining of an SDS-PAGE gel. This represents the highest observed yield of soluble affinity-purified pHisBot protein and this protocol eliminates the need for separate imidazole-containing binding and wash buffers. In addition to providing a simplified and efficient protocol for the affinity purification of recombinant pHisBot protein, the above results provide a variety of purification conditions under which pHisBot protein can be isolated.
EXAMPLE 26
The pHisBot Protein Is An Effective Immunogen
In Example 23 it was demonstrated that neutralizing antibodies are generated in mouse serum after nasal immunization with the pMBot protein. However, the pMBot protein was found to copurify with significant amounts of endotoxin which could not be easily removed. The pHisBot protein, in contrast, could be isolated free of significant endotoxin contamination making pHisBot a superior candidate for vaccine production. To further assess the suitability of pHisBot as a vaccine, the immunogenicity of the pHisBot protein was determined and a comparison of the relative immunogenicity of pMBot and pHisBot proteins in mice was performed as follows.
Two groups of eight BALBc mice were immunized with either pMBot protein or pHisBot protein using Gerbu GMDP adjuvant (CC Biotech). pMBot protein (in PBS containing 10 mM maltose) or pHisBot protein (in 50 mMNaHPO.sub.4, 0.3M NaCl, 10% glycerol, pH 4.0) was mixed with Gerbu adjuvant and used to immunize mice. Each mouse received an IP injection of 100 .mu.l antigen/adjuvant mix (50 .mu.g antigen plus 1 .mu.g adjuvant) on day 0. Mice were boosted as described above with the exception that the route of administration was IM on day 14 and 28. The mice were bled on day 77 and anti-C. botulinum Type A toxoid titers were determined using serum collected from individual mice in each group (as described in Example 23). The results are shown in Table 40.
TABLE 40__________________________________________________________________________Anti-C. botulinum Type A Toxoid Serum IgG Titers In Individual MiceImmunized WithpMBot or pHisBot ProteinPreimmune.sup.1 pMBot.sup.2 pHisBot.sup.2Sample Dilution Sample Dilution Sample DilutionMouse # 1:50 1:250 1:1250 1:6250 1:50 1:250 1:1250 1:6250 1:50 1:250 1:1250 1:620__________________________________________________________________________1 0.678 0.190 0.055 0.007 1.574 0.799 0.320 0.0932 1.161 0.931 0.254 0.075 1.513 0.829 0.409 0.1343 1.364 0.458 0.195 0.041 1.596 1.028 0.453 0.1224 1.622 1.189 0.334 0.067 1.552 0.840 0.348 0.0905 1.612 1.030 0.289 0.067 1.629 1.580 0.895 0.2336 0.913 0.242 0.069 0.013 1.485 0.952 0.477 0.1457 0.910 0.235 0.058 0.014 1.524 0.725 0.269 0.0698 0.747 0.234 0.058 0.014 1.274 0.427 0.116 0.029Mean 0.048 0.021 0.011 0.002 1.133 0.564 0.164 0.037 1.518 0.896 0.411 0.114Titer__________________________________________________________________________ .sup.1 The preimmune sample represents the average from 2 sets of duplicate wells containing serum from a individual mouse immunized with recombinant Staphylococcus enterotoxin B (SEB) antigen. This antigen is immunologically unrelated to C. botulinum toxin and provides a control serum. .sup.2 Average of duplicate wells.
The results shown above in Table 40 demonstrate that both the pMBot and pHisBot proteins are immunogenic in mice as 100% of the mice (8/8) in each group seroconverted from non-immune to immune status. The results also show that the average titer of anti-C. botulinum Type A toxoid lgG is 2-3 fold higher after immunization with the pHisBot protein relative to immunization with the pMBot protein. This suggests that the pBHisBot protein may be a superior immunogen to the pMBot protein.
EXAMPLE 27
Immunization With The Recombinant pHisBot Protein Generates Neutralizing Antibodies
The results shown in Example 26 demonstrated that both the pHisBot and pMBot proteins were capable of inducing high titers of anti-C. botulinum type A toxoid-reactive antibodies in immunized hosts. The ability of the immune sera from mice immunized with either the pHisBot or pMBot proteins to neutralize C. botulinum type A toxoid in vivo was determined using the mouse neutralization assay described in Example 23b.
The two groups of eight BALBc mice immunized with either pMBot protein or pHisBot protein in Example 26 were boosted again one week after the bleeding on day 77. The boost was performed by mixing pMBot protein (in PBS containing 10 mM maltose) or pHisBot protein (in 50 mM NaHPO.sub.4, 0.3M NaCl, 10% glycerol, pH 4.0) with Gerbu adjuvant as described in Example 26. Each mouse received an IP injection of 100 .mu.l antigen/adjuvant mix (50 .mu.g antigen plus 1 .mu.g adjuvant). The mice were bled 6 days after this boost and the serum from mice within a group was pooled. Serum from preimmune mice was also collected (this serum is the same serum described in the footnote to Table 40).
The presence of neutralizing antibodies in the pooled or preimmune serum was detected by challenging mice with 5 LD.sub.50 units of type A toxin mixed with 100 .mu.l of pooled serum. The challenge was performed by mixing (per mouse to be injected) 100 .mu.l of serum from each pool with 100 .mu.l of purified type A toxin standard (50 LD.sub.50 /ml prepared as described in Example 23b) and 500 .mu.l of gel-phosphate. The mixtures were incubated for 30 min at room temperature with occasional mixing. Each of four mice were injected IP with the mixtures (0.7 ml/mouse). The mice were observed for signs of botulism for 72 hours. Mice receiving toxin mixed with serum from mice immunized with either the pJHisBot or pMBot proteins showed no signs of botulism intoxication. In contrast, mice receiving preimmune serum died in less than 24 hours.
These results demonstrate that antibodies capable of neutralizing C. botulinum type A toxin are induced when either of the recombinant C. botulinum C fragment proteins pHisBot or pMBot are used as immunogens.
From the above it is clear that the present invention provides compositions and methods for the preparation of effective vaccines against C. botulinum neurotoxin. It is also contemplated that the recombinant botulinal proteins be used for the production of antitoxins.
__________________________________________________________________________# SEQUENCE LISTING- (1) GENERAL INFORMATION:- (iii) NUMBER OF SEQUENCES: 30- (2) INFORMATION FOR SEQ ID NO:1:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 24 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:# 24CATC TGAC- (2) INFORMATION FOR SEQ ID NO:2:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 24 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:# 24GTGT TGAA- (2) INFORMATION FOR SEQ ID NO:3:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 20 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:# 20 GACC- (2) INFORMATION FOR SEQ ID NO:4:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 19 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:# 19 TAT- (2) INFORMATION FOR SEQ ID NO:5:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 8133 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 1..8130- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:- ATG TCT TTA ATA TCT AAA GAA GAG TTA ATA AA - #A CTC GCA TAT AGC ATT 48Met Ser Leu Ile Ser Lys Glu Glu Leu Ile Ly - #s Leu Ala Tyr Ser Ile# 15- AGA CCA AGA GAA AAT GAG TAT AAA ACT ATA CT - #A ACT AAT TTA GAC GAA 96Arg Pro Arg Glu Asn Glu Tyr Lys Thr Ile Le - #u Thr Asn Leu Asp Glu# 30- TAT AAT AAG TTA ACT ACA AAC AAT AAT GAA AA - #T AAA TAT TTG CAA TTA 144Tyr Asn Lys Leu Thr Thr Asn Asn Asn Glu As - #n Lys Tyr Leu Gln Leu# 45- AAA AAA CTA AAT GAA TCA ATT GAT GTT TTT AT - #G AAT AAA TAT AAA ACT 192Lys Lys Leu Asn Glu Ser Ile Asp Val Phe Me - #t Asn Lys Tyr Lys Thr# 60- TCA AGC AGA AAT AGA GCA CTC TCT AAT CTA AA - #A AAA GAT ATA TTA AAA 240Ser Ser Arg Asn Arg Ala Leu Ser Asn Leu Ly - #s Lys Asp Ile Leu Lys# 80- GAA GTA ATT CTT ATT AAA AAT TCC AAT ACA AG - #C CCT GTA GAA AAA AAT 288Glu Val Ile Leu Ile Lys Asn Ser Asn Thr Se - #r Pro Val Glu Lys Asn# 95- TTA CAT TTT GTA TGG ATA GGT GGA GAA GTC AG - #T GAT ATT GCT CTT GAA 336Leu His Phe Val Trp Ile Gly Gly Glu Val Se - #r Asp Ile Ala Leu Glu# 110- TAC ATA AAA CAA TGG GCT GAT ATT AAT GCA GA - #A TAT AAT ATT AAA CTG 384Tyr Ile Lys Gln Trp Ala Asp Ile Asn Ala Gl - #u Tyr Asn Ile Lys Leu# 125- TGG TAT GAT AGT GAA GCA TTC TTA GTA AAT AC - #A CTA AAA AAG GCT ATA 432Trp Tyr Asp Ser Glu Ala Phe Leu Val Asn Th - #r Leu Lys Lys Ala Ile# 140- GTT GAA TCT TCT ACC ACT GAA GCA TTA CAG CT - #A CTA GAG GAA GAG ATT 480Val Glu Ser Ser Thr Thr Glu Ala Leu Gln Le - #u Leu Glu Glu Glu Ile145 1 - #50 1 - #55 1 -#60- CAA AAT CCT CAA TTT GAT AAT ATG AAA TTT TA - #C AAA AAA AGG ATG GAA 528Gln Asn Pro Gln Phe Asp Asn Met Lys Phe Ty - #r Lys Lys Arg Met Glu# 175- TTT ATA TAT GAT AGA CAA AAA AGG TTT ATA AA - #T TAT TAT AAA TCT CAA 576Phe Ile Tyr Asp Arg Gln Lys Arg Phe Ile As - #n Tyr Tyr Lys Ser Gln# 190- ATC AAT AAA CCT ACA GTA CCT ACA ATA GAT GA - #T ATT ATA AAG TCT CAT 624Ile Asn Lys Pro Thr Val Pro Thr Ile Asp As - #p Ile Ile Lys Ser His# 205- CTA GTA TCT GAA TAT AAT AGA GAT GAA ACT GT - #A TTA GAA TCA TAT AGA 672Leu Val Ser Glu Tyr Asn Arg Asp Glu Thr Va - #l Leu Glu Ser Tyr Arg# 220- ACA AAT TCT TTG AGA AAA ATA AAT AGT AAT CA - #T GGG ATA GAT ATC AGG 720Thr Asn Ser Leu Arg Lys Ile Asn Ser Asn Hi - #s Gly Ile Asp Ile Arg225 2 - #30 2 - #35 2 -#40- GCT AAT AGT TTG TTT ACA GAA CAA GAG TTA TT - #A AAT ATT TAT AGT CAG 768Ala Asn Ser Leu Phe Thr Glu Gln Glu Leu Le - #u Asn Ile Tyr Ser Gln# 255- GAG TTG TTA AAT CGT GGA AAT TTA GCT GCA GC - #A TCT GAC ATA GTA AGA 816Glu Leu Leu Asn Arg Gly Asn Leu Ala Ala Al - #a Ser Asp Ile Val Arg# 270- TTA TTA GCC CTA AAA AAT TTT GGC GGA GTA TA - #T TTA GAT GTT GAT ATG 864Leu Leu Ala Leu Lys Asn Phe Gly Gly Val Ty - #r Leu Asp Val Asp Met# 285- CTT CCA GGT ATT CAC TCT GAT TTA TTT AAA AC - #A ATA TCT AGA CCT AGC 912Leu Pro Gly Ile His Ser Asp Leu Phe Lys Th - #r Ile Ser Arg Pro Ser# 300- TCT ATT GGA CTA GAC CGT TGG GAA ATG ATA AA - #A TTA GAG GCT ATT ATG 960Ser Ile Gly Leu Asp Arg Trp Glu Met Ile Ly - #s Leu Glu Ala Ile Met305 3 - #10 3 - #15 3 -#20- AAG TAT AAA AAA TAT ATA AAT AAT TAT ACA TC - #A GAA AAC TTT GAT AAA1008Lys Tyr Lys Lys Tyr Ile Asn Asn Tyr Thr Se - #r Glu Asn Phe Asp Lys# 335- CTT GAT CAA CAA TTA AAA GAT AAT TTT AAA CT - #C ATT ATA GAA AGT AAA1056Leu Asp Gln Gln Leu Lys Asp Asn Phe Lys Le - #u Ile Ile Glu Ser Lys# 350- AGT GAA AAA TCT GAG ATA TTT TCT AAA TTA GA - #A AAT TTA AAT GTA TCT1104Ser Glu Lys Ser Glu Ile Phe Ser Lys Leu Gl - #u Asn Leu Asn Val Ser# 365- GAT CTT GAA ATT AAA ATA GCT TTC GCT TTA GG - #C AGT GTT ATA AAT CAA1152Asp Leu Glu Ile Lys Ile Ala Phe Ala Leu Gl - #y Ser Val Ile Asn Gln# 380- GCC TTG ATA TCA AAA CAA GGT TCA TAT CTT AC - #T AAC CTA GTA ATA GAA1200Ala Leu Ile Ser Lys Gln Gly Ser Tyr Leu Th - #r Asn Leu Val Ile Glu385 3 - #90 3 - #95 4 -#00- CAA GTA AAA AAT AGA TAT CAA TTT TTA AAC CA - #A CAC CTT AAC CCA GCC1248Gln Val Lys Asn Arg Tyr Gln Phe Leu Asn Gl - #n His Leu Asn Pro Ala# 415- ATA GAG TCT GAT AAT AAC TTC ACA GAT ACT AC - #T AAA ATT TTT CAT GAT1296Ile Glu Ser Asp Asn Asn Phe Thr Asp Thr Th - #r Lys Ile Phe His Asp# 430- TCA TTA TTT AAT TCA GCT ACC GCA GAA AAC TC - #T ATG TTT TTA ACA AAA1344Ser Leu Phe Asn Ser Ala Thr Ala Glu Asn Se - #r Met Phe Leu Thr Lys# 445- ATA GCA CCA TAC TTA CAA GTA GGT TTT ATG CC - #A GAA GCT CGC TCC ACA1392Ile Ala Pro Tyr Leu Gln Val Gly Phe Met Pr - #o Glu Ala Arg Ser Thr# 460- ATA AGT TTA AGT GGT CCA GGA GCT TAT GCG TC - #A GCT TAC TAT GAT TTC1440Ile Ser Leu Ser Gly Pro Gly Ala Tyr Ala Se - #r Ala Tyr Tyr Asp Phe465 4 - #70 4 - #75 4 -#80- ATA AAT TTA CAA GAA AAT ACT ATA GAA AAA AC - #T TTA AAA GCA TCA GAT1488Ile Asn Leu Gln Glu Asn Thr Ile Glu Lys Th - #r Leu Lys Ala Ser Asp# 495- TTA ATA GAA TTT AAA TTC CCA GAA AAT AAT CT - #A TCT CAA TTG ACA GAA1536Leu Ile Glu Phe Lys Phe Pro Glu Asn Asn Le - #u Ser Gln Leu Thr Glu# 510- CAA GAA ATA AAT AGT CTA TGG AGC TTT GAT CA - #A GCA AGT GCA AAA TAT1584Gln Glu Ile Asn Ser Leu Trp Ser Phe Asp Gl - #n Ala Ser Ala Lys Tyr# 525- CAA TTT GAG AAA TAT GTA AGA GAT TAT ACT GG - #T GGA TCT CTT TCT GAA1632Gln Phe Glu Lys Tyr Val Arg Asp Tyr Thr Gl - #y Gly Ser Leu Ser Glu# 540- GAC AAT GGG GTA GAC TTT AAT AAA AAT ACT GC - #C CTC GAC AAA AAC TAT1680Asp Asn Gly Val Asp Phe Asn Lys Asn Thr Al - #a Leu Asp Lys Asn Tyr545 5 - #50 5 - #55 5 -#60- TTA TTA AAT AAT AAA ATT CCA TCA AAC AAT GT - #A GAA GAA GCT GGA AGT1728Leu Leu Asn Asn Lys Ile Pro Ser Asn Asn Va - #l Glu Glu Ala Gly Ser# 575- AAA AAT TAT GTT CAT TAT ATC ATA CAG TTA CA - #A GGA GAT GAT ATA AGT1776Lys Asn Tyr Val His Tyr Ile Ile Gln Leu Gl - #n Gly Asp Asp Ile Ser# 590- TAT GAA GCA ACA TGC AAT TTA TTT TCT AAA AA - #T CCT AAA AAT AGT ATT1824Tyr Glu Ala Thr Cys Asn Leu Phe Ser Lys As - #n Pro Lys Asn Ser Ile# 605- ATT ATA CAA CGA AAT ATG AAT GAA AGT GCA AA - #A AGC TAC TTT TTA AGT1872Ile Ile Gln Arg Asn Met Asn Glu Ser Ala Ly - #s Ser Tyr Phe Leu Ser# 620- GAT GAT GGA GAA TCT ATT TTA GAA TTA AAT AA - #A TAT AGG ATA CCT GAA1920Asp Asp Gly Glu Ser Ile Leu Glu Leu Asn Ly - #s Tyr Arg Ile Pro Glu625 6 - #30 6 - #35 6 -#40- AGA TTA AAA AAT AAG GAA AAA GTA AAA GTA AC - #C TTT ATT GGA CAT GGT1968Arg Leu Lys Asn Lys Glu Lys Val Lys Val Th - #r Phe Ile Gly His Gly# 655- AAA GAT GAA TTC AAC ACA AGC GAA TTT GCT AG - #A TTA AGT GTA GAT TCA2016Lys Asp Glu Phe Asn Thr Ser Glu Phe Ala Ar - #g Leu Ser Val Asp Ser# 670- CTT TCC AAT GAG ATA AGT TCA TTT TTA GAT AC - #C ATA AAA TTA GAT ATA2064Leu Ser Asn Glu Ile Ser Ser Phe Leu Asp Th - #r Ile Lys Leu Asp Ile# 685- TCA CCT AAA AAT GTA GAA GTA AAC TTA CTT GG - #A TGT AAT ATG TTT AGT2112Ser Pro Lys Asn Val Glu Val Asn Leu Leu Gl - #y Cys Asn Met Phe Ser# 700- TAT GAT TTT AAT GTT GAA GAA ACT TAT CCT GG - #G AAG TTG CTA TTA AGT2160Tyr Asp Phe Asn Val Glu Glu Thr Tyr Pro Gl - #y Lys Leu Leu Leu Ser705 7 - #10 7 - #15 7 -#20- ATT ATG GAC AAA ATT ACT TCC ACT TTA CCT GA - #T GTA AAT AAA AAT TCT2208Ile Met Asp Lys Ile Thr Ser Thr Leu Pro As - #p Val Asn Lys Asn Ser# 735- ATT ACT ATA GGA GCA AAT CAA TAT GAA GTA AG - #A ATT AAT AGT GAG GGA2256Ile Thr Ile Gly Ala Asn Gln Tyr Glu Val Ar - #g Ile Asn Ser Glu Gly# 750- AGA AAA GAA CTT CTG GCT CAC TCA GGT AAA TG - #G ATA AAT AAA GAA GAA2304Arg Lys Glu Leu Leu Ala His Ser Gly Lys Tr - #p Ile Asn Lys Glu Glu# 765- GCT ATT ATG AGC GAT TTA TCT AGT AAA GAA TA - #C ATT TTT TTT GAT TCT2352Ala Ile Met Ser Asp Leu Ser Ser Lys Glu Ty - #r Ile Phe Phe Asp Ser# 780- ATA GAT AAT AAG CTA AAA GCA AAG TCC AAG AA - #T ATT CCA GGA TTA GCA2400Ile Asp Asn Lys Leu Lys Ala Lys Ser Lys As - #n Ile Pro Gly Leu Ala785 7 - #90 7 - #95 8 -#00- TCA ATA TCA GAA GAT ATA AAA ACA TTA TTA CT - #T GAT GCA AGT GTT AGT2448Ser Ile Ser Glu Asp Ile Lys Thr Leu Leu Le - #u Asp Ala Ser Val Ser# 815- CCT GAT ACA AAA TTT ATT TTA AAT AAT CTT AA - #G CTT AAT ATT GAA TCT2496Pro Asp Thr Lys Phe Ile Leu Asn Asn Leu Ly - #s Leu Asn Ile Glu Ser# 830- TCT ATT GGG GAT TAC ATT TAT TAT GAA AAA TT - #A GAG CCT GTT AAA AAT2544Ser Ile Gly Asp Tyr Ile Tyr Tyr Glu Lys Le - #u Glu Pro Val Lys Asn# 845- ATA ATT CAC AAT TCT ATA GAT GAT TTA ATA GA - #T GAG TTC AAT CTA CTT2592Ile Ile His Asn Ser Ile Asp Asp Leu Ile As - #p Glu Phe Asn Leu Leu# 860- GAA AAT GTA TCT GAT GAA TTA TAT GAA TTA AA - #A AAA TTA AAT AAT CTA2640Glu Asn Val Ser Asp Glu Leu Tyr Glu Leu Ly - #s Lys Leu Asn Asn Leu865 8 - #70 8 - #75 8 -#80- GAT GAG AAG TAT TTA ATA TCT TTT GAA GAT AT - #C TCA AAA AAT AAT TCA2688Asp Glu Lys Tyr Leu Ile Ser Phe Glu Asp Il - #e Ser Lys Asn Asn Ser# 895- ACT TAC TCT GTA AGA TTT ATT AAC AAA AGT AA - #T GGT GAG TCA GTT TAT2736Thr Tyr Ser Val Arg Phe Ile Asn Lys Ser As - #n Gly Glu Ser Val Tyr# 910- GTA GAA ACA GAA AAA GAA ATT TTT TCA AAA TA - #T AGC GAA CAT ATT ACA2784Val Glu Thr Glu Lys Glu Ile Phe Ser Lys Ty - #r Ser Glu His Ile Thr# 925- AAA GAA ATA AGT ACT ATA AAG AAT AGT ATA AT - #T ACA GAT GTT AAT GGT2832Lys Glu Ile Ser Thr Ile Lys Asn Ser Ile Il - #e Thr Asp Val Asn Gly# 940- AAT TTA TTG GAT AAT ATA CAG TTA GAT CAT AC - #T TCT CAA GTT AAT ACA2880Asn Leu Leu Asp Asn Ile Gln Leu Asp His Th - #r Ser Gln Val Asn Thr945 9 - #50 9 - #55 9 -#60- TTA AAC GCA GCA TTC TTT ATT CAA TCA TTA AT - #A GAT TAT AGT AGC AAT2928Leu Asn Ala Ala Phe Phe Ile Gln Ser Leu Il - #e Asp Tyr Ser Ser Asn# 975- AAA GAT GTA CTG AAT GAT TTA AGT ACC TCA GT - #T AAG GTT CAA CTT TAT2976Lys Asp Val Leu Asn Asp Leu Ser Thr Ser Va - #l Lys Val Gln Leu Tyr# 990- GCT CAA CTA TTT AGT ACA GGT TTA AAT ACT AT - #A TAT GAC TCT ATC CAA3024Ala Gln Leu Phe Ser Thr Gly Leu Asn Thr Il - #e Tyr Asp Ser Ile Gln# 10050- TTA GTA AAT TTA ATA TCA AAT GCA GTA AAT GA - #T ACT ATA AAT GTA CTA3072Leu Val Asn Leu Ile Ser Asn Ala Val Asn As - #p Thr Ile Asn Val Leu# 10205- CCT ACA ATA ACA GAG GGG ATA CCT ATT GTA TC - #T ACT ATA TTA GAC GGA3120Pro Thr Ile Thr Glu Gly Ile Pro Ile Val Se - #r Thr Ile Leu Asp Gly# 10401030 - # 1035- ATA AAC TTA GGT GCA GCA ATT AAG GAA TTA CT - #A GAC GAA CAT GAC CCA3168Ile Asn Leu Gly Ala Ala Ile Lys Glu Leu Le - #u Asp Glu His Asp Pro# 10550- TTA CTA AAA AAA GAA TTA GAA GCT AAG GTG GG - #T GTT TTA GCA ATA AAT3216Leu Leu Lys Lys Glu Leu Glu Ala Lys Val Gl - #y Val Leu Ala Ile Asn# 10705- ATG TCA TTA TCT ATA GCT GCA ACT GTA GCT TC - #A ATT GTT GGA ATA GGT3264Met Ser Leu Ser Ile Ala Ala Thr Val Ala Se - #r Ile Val Gly Ile Gly# 10850- GCT GAA GTT ACT ATT TTC TTA TTA CCT ATA GC - #T GGT ATA TCT GCA GGA3312Ala Glu Val Thr Ile Phe Leu Leu Pro Ile Al - #a Gly Ile Ser Ala Gly# 11005- ATA CCT TCA TTA GTT AAT AAT GAA TTA ATA TT - #G CAT GAT AAG GCA ACT3360Ile Pro Ser Leu Val Asn Asn Glu Leu Ile Le - #u His Asp Lys Ala Thr# 11201110 - # 1115- TCA GTG GTA AAC TAT TTT AAT CAT TTG TCT GA - #A TCT AAA AAA TAT GGC3408Ser Val Val Asn Tyr Phe Asn His Leu Ser Gl - #u Ser Lys Lys Tyr Gly# 11350- CCT CTT AAA ACA GAA GAT GAT AAA ATT TTA GT - #T CCT ATT GAT GAT TTA3456Pro Leu Lys Thr Glu Asp Asp Lys Ile Leu Va - #l Pro Ile Asp Asp Leu# 11505- GTA ATA TCA GAA ATA GAT TTT AAT AAT AAT TC - #G ATA AAA CTA GGA ACA3504Val Ile Ser Glu Ile Asp Phe Asn Asn Asn Se - #r Ile Lys Leu Gly Thr# 11650- TGT AAT ATA TTA GCA ATG GAG GGG GGA TCA GG - #A CAC ACA GTG ACT GGT3552Cys Asn Ile Leu Ala Met Glu Gly Gly Ser Gl - #y His Thr Val Thr Gly# 11805- AAT ATA GAT CAC TTT TTC TCA TCT CCA TCT AT - #A AGT TCT CAT ATT CCT3600Asn Ile Asp His Phe Phe Ser Ser Pro Ser Il - #e Ser Ser His Ile Pro# 12001190 - # 1195- TCA TTA TCA ATT TAT TCT GCA ATA GGT ATA GA - #A ACA GAA AAT CTA GAT3648Ser Leu Ser Ile Tyr Ser Ala Ile Gly Ile Gl - #u Thr Glu Asn Leu Asp# 12150- TTT TCA AAA AAA ATA ATG ATG TTA CCT AAT GC - #T CCT TCA AGA GTG TTT3696Phe Ser Lys Lys Ile Met Met Leu Pro Asn Al - #a Pro Ser Arg Val Phe# 12305- TGG TGG GAA ACT GGA GCA GTT CCA GGT TTA AG - #A TCA TTG GAA AAT GAC3744Trp Trp Glu Thr Gly Ala Val Pro Gly Leu Ar - #g Ser Leu Glu Asn Asp# 12450- GGA ACT AGA TTA CTT GAT TCA ATA AGA GAT TT - #A TAC CCA GGT AAA TTT3792Gly Thr Arg Leu Leu Asp Ser Ile Arg Asp Le - #u Tyr Pro Gly Lys Phe# 12605- TAC TGG AGA TTC TAT GCT TTT TTC GAT TAT GC - #A ATA ACT ACA TTA AAA3840Tyr Trp Arg Phe Tyr Ala Phe Phe Asp Tyr Al - #a Ile Thr Thr Leu Lys# 12801270 - # 1275- CCA GTT TAT GAA GAC ACT AAT ATT AAA ATT AA - #A CTA GAT AAA GAT ACT3888Pro Val Tyr Glu Asp Thr Asn Ile Lys Ile Ly - #s Leu Asp Lys Asp Thr# 12950- AGA AAC TTC ATA ATG CCA ACT ATA ACT ACT AA - #C GAA ATT AGA AAC AAA3936Arg Asn Phe Ile Met Pro Thr Ile Thr Thr As - #n Glu Ile Arg Asn Lys# 13105- TTA TCT TAT TCA TTT GAT GGA GCA GGA GGA AC - #T TAC TCT TTA TTA TTA3984Leu Ser Tyr Ser Phe Asp Gly Ala Gly Gly Th - #r Tyr Ser Leu Leu Leu# 13250- TCT TCA TAT CCA ATA TCA ACG AAT ATA AAT TT - #A TCT AAA GAT GAT TTA4032Ser Ser Tyr Pro Ile Ser Thr Asn Ile Asn Le - #u Ser Lys Asp Asp Leu# 13405- TGG ATA TTT AAT ATT GAT AAT GAA GTA AGA GA - #A ATA TCT ATA GAA AAT4080Trp Ile Phe Asn Ile Asp Asn Glu Val Arg Gl - #u Ile Ser Ile Glu Asn# 13601350 - # 1355- GGT ACT ATT AAA AAA GGA AAG TTA ATA AAA GA - #T GTT TTA AGT AAA ATT4128Gly Thr Ile Lys Lys Gly Lys Leu Ile Lys As - #p Val Leu Ser Lys Ile# 13750- GAT ATA AAT AAA AAT AAA CTT ATT ATA GGC AA - #T CAA ACA ATA GAT TTT4176Asp Ile Asn Lys Asn Lys Leu Ile Ile Gly As - #n Gln Thr Ile Asp Phe# 13905- TCA GGC GAT ATA GAT AAT AAA GAT AGA TAT AT - #A TTC TTG ACT TGT GAG4224Ser Gly Asp Ile Asp Asn Lys Asp Arg Tyr Il - #e Phe Leu Thr Cys Glu# 14050- TTA GAT GAT AAA ATT AGT TTA ATA ATA GAA AT - #A AAT CTT GTT GCA AAA4272Leu Asp Asp Lys Ile Ser Leu Ile Ile Glu Il - #e Asn Leu Val Ala Lys# 14205- TCT TAT AGT TTG TTA TTG TCT GGG GAT AAA AA - #T TAT TTG ATA TCC AAT4320Ser Tyr Ser Leu Leu Leu Ser Gly Asp Lys As - #n Tyr Leu Ile Ser Asn# 14401430 - # 1435- TTA TCT AAT ACT ATT GAG AAA ATC AAT ACT TT - #A GGC CTA GAT AGT AAA4368Leu Ser Asn Thr Ile Glu Lys Ile Asn Thr Le - #u Gly Leu Asp Ser Lys# 14550- AAT ATA GCG TAC AAT TAC ACT GAT GAA TCT AA - #T AAT AAA TAT TTT GGA4416Asn Ile Ala Tyr Asn Tyr Thr Asp Glu Ser As - #n Asn Lys Tyr Phe Gly# 14705- GCT ATA TCT AAA ACA AGT CAA AAA AGC ATA AT - #A CAT TAT AAA AAA GAC4464Ala Ile Ser Lys Thr Ser Gln Lys Ser Ile Il - #e His Tyr Lys Lys Asp# 14850- AGT AAA AAT ATA TTA GAA TTT TAT AAT GAC AG - #T ACA TTA GAA TTT AAC4512Ser Lys Asn Ile Leu Glu Phe Tyr Asn Asp Se - #r Thr Leu Glu Phe Asn# 15005- AGT AAA GAT TTT ATT GCT GAA GAT ATA AAT GT - #A TTT ATG AAA GAT GAT4560Ser Lys Asp Phe Ile Ala Glu Asp Ile Asn Va - #l Phe Met Lys Asp Asp# 15201510 - # 1515- ATT AAT ACT ATA ACA GGA AAA TAC TAT GTT GA - #T AAT AAT ACT GAT AAA4608Ile Asn Thr Ile Thr Gly Lys Tyr Tyr Val As - #p Asn Asn Thr Asp Lys# 15350- AGT ATA GAT TTC TCT ATT TCT TTA GTT AGT AA - #A AAT CAA GTA AAA GTA4656Ser Ile Asp Phe Ser Ile Ser Leu Val Ser Ly - #s Asn Gln Val Lys Val# 15505- AAT GGA TTA TAT TTA AAT GAA TCC GTA TAC TC - #A TCT TAC CTT GAT TTT4704Asn Gly Leu Tyr Leu Asn Glu Ser Val Tyr Se - #r Ser Tyr Leu Asp Phe# 15650- GTG AAA AAT TCA GAT GGA CAC CAT AAT ACT TC - #T AAT TTT ATG AAT TTA4752Val Lys Asn Ser Asp Gly His His Asn Thr Se - #r Asn Phe Met Asn Leu# 15805- TTT TTG GAC AAT ATA AGT TTC TGG AAA TTG TT - #T GGG TTT GAA AAT ATA4800Phe Leu Asp Asn Ile Ser Phe Trp Lys Leu Ph - #e Gly Phe Glu Asn Ile# 16001590 - # 1595- AAT TTT GTA ATC GAT AAA TAC TTT ACC CTT GT - #T GGT AAA ACT AAT CTT4848Asn Phe Val Ile Asp Lys Tyr Phe Thr Leu Va - #l Gly Lys Thr Asn Leu# 16150- GGA TAT GTA GAA TTT ATT TGT GAC AAT AAT AA - #A AAT ATA GAT ATA TAT4896Gly Tyr Val Glu Phe Ile Cys Asp Asn Asn Ly - #s Asn Ile Asp Ile Tyr# 16305- TTT GGT GAA TGG AAA ACA TCG TCA TCT AAA AG - #C ACT ATA TTT AGC GGA4944Phe Gly Glu Trp Lys Thr Ser Ser Ser Lys Se - #r Thr Ile Phe Ser Gly# 16450- AAT GGT AGA AAT GTT GTA GTA GAG CCT ATA TA - #T AAT CCT GAT ACG GGT4992Asn Gly Arg Asn Val Val Val Glu Pro Ile Ty - #r Asn Pro Asp Thr Gly# 16605- GAA GAT ATA TCT ACT TCA CTA GAT TTT TCC TA - #T GAA CCT CTC TAT GGA5040Glu Asp Ile Ser Thr Ser Leu Asp Phe Ser Ty - #r Glu Pro Leu Tyr Gly# 16801670 - # 1675- ATA GAT AGA TAT ATA AAT AAA GTA TTG ATA GC - #A CCT GAT TTA TAT ACA5088Ile Asp Arg Tyr Ile Asn Lys Val Leu Ile Al - #a Pro Asp Leu Tyr Thr# 16950- AGT TTA ATA AAT ATT AAT ACC AAT TAT TAT TC - #A AAT GAG TAC TAC CCT5136Ser Leu Ile Asn Ile Asn Thr Asn Tyr Tyr Se - #r Asn Glu Tyr Tyr Pro# 17105- GAG ATT ATA GTT CTT AAC CCA AAT ACA TTC CA - #C AAA AAA GTA AAT ATA5184Glu Ile Ile Val Leu Asn Pro Asn Thr Phe Hi - #s Lys Lys Val Asn Ile# 17250- AAT TTA GAT AGT TCT TCT TTT GAG TAT AAA TG - #G TCT ACA GAA GGA AGT5232Asn Leu Asp Ser Ser Ser Phe Glu Tyr Lys Tr - #p Ser Thr Glu Gly Ser# 17405- GAC TTT ATT TTA GTT AGA TAC TTA GAA GAA AG - #T AAT AAA AAA ATA TTA5280Asp Phe Ile Leu Val Arg Tyr Leu Glu Glu Se - #r Asn Lys Lys Ile Leu# 17601750 - # 1755- CAA AAA ATA AGA ATC AAA GGT ATC TTA TCT AA - #T ACT CAA TCA TTT AAT5328Gln Lys Ile Arg Ile Lys Gly Ile Leu Ser As - #n Thr Gln Ser Phe Asn# 17750- AAA ATG AGT ATA GAT TTT AAA GAT ATT AAA AA - #A CTA TCA TTA GGA TAT5376Lys Met Ser Ile Asp Phe Lys Asp Ile Lys Ly - #s Leu Ser Leu Gly Tyr# 17905- ATA ATG AGT AAT TTT AAA TCA TTT AAT TCT GA - #A AAT GAA TTA GAT AGA5424Ile Met Ser Asn Phe Lys Ser Phe Asn Ser Gl - #u Asn Glu Leu Asp Arg# 18050- GAT CAT TTA GGA TTT AAA ATA ATA GAT AAT AA - #A ACT TAT TAC TAT GAT5472Asp His Leu Gly Phe Lys Ile Ile Asp Asn Ly - #s Thr Tyr Tyr Tyr Asp# 18205- GAA GAT AGT AAA TTA GTT AAA GGA TTA ATC AA - #T ATA AAT AAT TCA TTA5520Glu Asp Ser Lys Leu Val Lys Gly Leu Ile As - #n Ile Asn Asn Ser Leu# 18401830 - # 1835- TTC TAT TTT GAT CCT ATA GAA TTT AAC TTA GT - #A ACT GGA TGG CAA ACT5568Phe Tyr Phe Asp Pro Ile Glu Phe Asn Leu Va - #l Thr Gly Trp Gln Thr# 18550- ATC AAT GGT AAA AAA TAT TAT TTT GAT ATA AA - #T ACT GGA GCA GCT TTA5616Ile Asn Gly Lys Lys Tyr Tyr Phe Asp Ile As - #n Thr Gly Ala Ala Leu# 18705- ACT AGT TAT AAA ATT ATT AAT GGT AAA CAC TT - #T TAT TTT AAT AAT GAT5664Thr Ser Tyr Lys Ile Ile Asn Gly Lys His Ph - #e Tyr Phe Asn Asn Asp# 18850- GGT GTG ATG CAG TTG GGA GTA TTT AAA GGA CC - #T GAT GGA TTT GAA TAT5712Gly Val Met Gln Leu Gly Val Phe Lys Gly Pr - #o Asp Gly Phe Glu Tyr# 19005- TTT GCA CCT GCC AAT ACT CAA AAT AAT AAC AT - #A GAA GGT CAG GCT ATA5760Phe Ala Pro Ala Asn Thr Gln Asn Asn Asn Il - #e Glu Gly Gln Ala Ile# 19201910 - # 1915- GTT TAT CAA AGT AAA TTC TTA ACT TTG AAT GG - #C AAA AAA TAT TAT TTT5808Val Tyr Gln Ser Lys Phe Leu Thr Leu Asn Gl - #y Lys Lys Tyr Tyr Phe# 19350- GAT AAT AAC TCA AAA GCA GTC ACT GGA TGG AG - #A ATT ATT AAC AAT GAG5856Asp Asn Asn Ser Lys Ala Val Thr Gly Trp Ar - #g Ile Ile Asn Asn Glu# 19505- AAA TAT TAC TTT AAT CCT AAT AAT GCT ATT GC - #T GCA GTC GGA TTG CAA5904Lys Tyr Tyr Phe Asn Pro Asn Asn Ala Ile Al - #a Ala Val Gly Leu Gln# 19650- GTA ATT GAC AAT AAT AAG TAT TAT TTC AAT CC - #T GAC ACT GCT ATC ATC5952Val Ile Asp Asn Asn Lys Tyr Tyr Phe Asn Pr - #o Asp Thr Ala Ile Ile# 19805- TCA AAA GGT TGG CAG ACT GTT AAT GGT AGT AG - #A TAC TAC TTT GAT ACT6000Ser Lys Gly Trp Gln Thr Val Asn Gly Ser Ar - #g Tyr Tyr Phe Asp Thr# 20001990 - # 1995- GAT ACC GCT ATT GCC TTT AAT GGT TAT AAA AC - #T ATT GAT GGT AAA CAC6048Asp Thr Ala Ile Ala Phe Asn Gly Tyr Lys Th - #r Ile Asp Gly Lys His# 20150- TTT TAT TTT GAT AGT GAT TGT GTA GTG AAA AT - #A GGT GTG TTT AGT ACC6096Phe Tyr Phe Asp Ser Asp Cys Val Val Lys Il - #e Gly Val Phe Ser Thr# 20305- TCT AAT GGA TTT GAA TAT TTT GCA CCT GCT AA - #T ACT TAT AAT AAT AAC6144Ser Asn Gly Phe Glu Tyr Phe Ala Pro Ala As - #n Thr Tyr Asn Asn Asn# 20450- ATA GAA GGT CAG GCT ATA GTT TAT CAA AGT AA - #A TTC TTA ACT TTG AAT6192Ile Glu Gly Gln Ala Ile Val Tyr Gln Ser Ly - #s Phe Leu Thr Leu Asn# 20605- GGT AAA AAA TAT TAC TTT GAT AAT AAC TCA AA - #A GCA GTT ACC GGA TTG6240Gly Lys Lys Tyr Tyr Phe Asp Asn Asn Ser Ly - #s Ala Val Thr Gly Leu# 20802070 - # 2075- CAA ACT ATT GAT AGT AAA AAA TAT TAC TTT AA - #T ACT AAC ACT GCT GAA6288Gln Thr Ile Asp Ser Lys Lys Tyr Tyr Phe As - #n Thr Asn Thr Ala Glu# 20950- GCA GCT ACT GGA TGG CAA ACT ATT GAT GGT AA - #A AAA TAT TAC TTT AAT6336Ala Ala Thr Gly Trp Gln Thr Ile Asp Gly Ly - #s Lys Tyr Tyr Phe Asn# 21105- ACT AAC ACT GCT GAA GCA GCT ACT GGA TGG CA - #A ACT ATT GAT GGT AAA6384Thr Asn Thr Ala Glu Ala Ala Thr Gly Trp Gl - #n Thr Ile Asp Gly Lys# 21250- AAA TAT TAC TTT AAT ACT AAC ACT GCT ATA GC - #T TCA ACT GGT TAT ACA6432Lys Tyr Tyr Phe Asn Thr Asn Thr Ala Ile Al - #a Ser Thr Gly Tyr Thr# 21405- ATT ATT AAT GGT AAA CAT TTT TAT TTT AAT AC - #T GAT GGT ATT ATG CAG6480Ile Ile Asn Gly Lys His Phe Tyr Phe Asn Th - #r Asp Gly Ile Met Gln# 21602150 - # 2155- ATA GGA GTG TTT AAA GGA CCT AAT GGA TTT GA - #A TAT TTT GCA CCT GCT6528Ile Gly Val Phe Lys Gly Pro Asn Gly Phe Gl - #u Tyr Phe Ala Pro Ala# 21750- AAT ACG GAT GCT AAC AAC ATA GAA GGT CAA GC - #T ATA CTT TAC CAA AAT6576Asn Thr Asp Ala Asn Asn Ile Glu Gly Gln Al - #a Ile Leu Tyr Gln Asn# 21905- GAA TTC TTA ACT TTG AAT GGT AAA AAA TAT TA - #C TTT GGT AGT GAC TCA6624Glu Phe Leu Thr Leu Asn Gly Lys Lys Tyr Ty - #r Phe Gly Ser Asp Ser# 22050- AAA GCA GTT ACT GGA TGG AGA ATT ATT AAC AA - #T AAG AAA TAT TAC TTT6672Lys Ala Val Thr Gly Trp Arg Ile Ile Asn As - #n Lys Lys Tyr Tyr Phe# 22205- AAT CCT AAT AAT GCT ATT GCT GCA ATT CAT CT - #A TGC ACT ATA AAT AAT6720Asn Pro Asn Asn Ala Ile Ala Ala Ile His Le - #u Cys Thr Ile Asn Asn# 22402230 - # 2235- GAC AAG TAT TAC TTT AGT TAT GAT GGA ATT CT - #T CAA AAT GGA TAT ATT6768Asp Lys Tyr Tyr Phe Ser Tyr Asp Gly Ile Le - #u Gln Asn Gly Tyr Ile# 22550- ACT ATT GAA AGA AAT AAT TTC TAT TTT GAT GC - #T AAT AAT GAA TCT AAA6816Thr Ile Glu Arg Asn Asn Phe Tyr Phe Asp Al - #a Asn Asn Glu Ser Lys# 22705- ATG GTA ACA GGA GTA TTT AAA GGA CCT AAT GG - #A TTT GAG TAT TTT GCA6864Met Val Thr Gly Val Phe Lys Gly Pro Asn Gl - #y Phe Glu Tyr Phe Ala# 22850- CCT GCT AAT ACT CAC AAT AAT AAC ATA GAA GG - #T CAG GCT ATA GTT TAC6912Pro Ala Asn Thr His Asn Asn Asn Ile Glu Gl - #y Gln Ala Ile Val Tyr# 23005- CAG AAC AAA TTC TTA ACT TTG AAT GGC AAA AA - #A TAT TAT TTT GAT AAT6960Gln Asn Lys Phe Leu Thr Leu Asn Gly Lys Ly - #s Tyr Tyr Phe Asp Asn# 23202310 - # 2315- GAC TCA AAA GCA GTT ACT GGA TGG CAA ACC AT - #T GAT GGT AAA AAA TAT7008Asp Ser Lys Ala Val Thr Gly Trp Gln Thr Il - #e Asp Gly Lys Lys Tyr# 23350- TAC TTT AAT CTT AAC ACT GCT GAA GCA GCT AC - #T GGA TGG CAA ACT ATT7056Tyr Phe Asn Leu Asn Thr Ala Glu Ala Ala Th - #r Gly Trp Gln Thr Ile# 23505- GAT GGT AAA AAA TAT TAC TTT AAT CTT AAC AC - #T GCT GAA GCA GCT ACT7104Asp Gly Lys Lys Tyr Tyr Phe Asn Leu Asn Th - #r Ala Glu Ala Ala Thr# 23650- GGA TGG CAA ACT ATT GAT GGT AAA AAA TAT TA - #C TTT AAT ACT AAC ACT7152Gly Trp Gln Thr Ile Asp Gly Lys Lys Tyr Ty - #r Phe Asn Thr Asn Thr# 23805- TTC ATA GCC TCA ACT GGT TAT ACA AGT ATT AA - #T GGT AAA CAT TTT TAT7200Phe Ile Ala Ser Thr Gly Tyr Thr Ser Ile As - #n Gly Lys His Phe Tyr# 24002390 - # 2395- TTT AAT ACT GAT GGT ATT ATG CAG ATA GGA GT - #G TTT AAA GGA CCT AAT7248Phe Asn Thr Asp Gly Ile Met Gln Ile Gly Va - #l Phe Lys Gly Pro Asn# 24150- GGA TTT GAA TAC TTT GCA CCT GCT AAT ACG GA - #T GCT AAC AAC ATA GAA7296Gly Phe Glu Tyr Phe Ala Pro Ala Asn Thr As - #p Ala Asn Asn Ile Glu# 24305- GGT CAA GCT ATA CTT TAC CAA AAT AAA TTC TT - #A ACT TTG AAT GGT AAA7344Gly Gln Ala Ile Leu Tyr Gln Asn Lys Phe Le - #u Thr Leu Asn Gly Lys# 24450- AAA TAT TAC TTT GGT AGT GAC TCA AAA GCA GT - #T ACC GGA CTG CGA ACT7392Lys Tyr Tyr Phe Gly Ser Asp Ser Lys Ala Va - #l Thr Gly Leu Arg Thr# 24605- ATT GAT GGT AAA AAA TAT TAC TTT AAT ACT AA - #C ACT GCT GTT GCA GTT7440Ile Asp Gly Lys Lys Tyr Tyr Phe Asn Thr As - #n Thr Ala Val Ala Val# 24802470 - # 2475- ACT GGA TGG CAA ACT ATT AAT GGT AAA AAA TA - #C TAC TTT AAT ACT AAC7488Thr Gly Trp Gln Thr Ile Asn Gly Lys Lys Ty - #r Tyr Phe Asn Thr Asn# 24950- ACT TCT ATA GCT TCA ACT GGT TAT ACA ATT AT - #T AGT GGT AAA CAT TTT7536Thr Ser Ile Ala Ser Thr Gly Tyr Thr Ile Il - #e Ser Gly Lys His Phe# 25105- TAT TTT AAT ACT GAT GGT ATT ATG CAG ATA GG - #A GTG TTT AAA GGA CCT7584Tyr Phe Asn Thr Asp Gly Ile Met Gln Ile Gl - #y Val Phe Lys Gly Pro# 25250- GAT GGA TTT GAA TAC TTT GCA CCT GCT AAT AC - #A GAT GCT AAC AAT ATA7632Asp Gly Phe Glu Tyr Phe Ala Pro Ala Asn Th - #r Asp Ala Asn Asn Ile# 25405- GAA GGT CAA GCT ATA CGT TAT CAA AAT AGA TT - #C CTA TAT TTA CAT GAC7680Glu Gly Gln Ala Ile Arg Tyr Gln Asn Arg Ph - #e Leu Tyr Leu His Asp# 25602550 - # 2555- AAT ATA TAT TAT TTT GGT AAT AAT TCA AAA GC - #G GCT ACT GGT TGG GTA7728Asn Ile Tyr Tyr Phe Gly Asn Asn Ser Lys Al - #a Ala Thr Gly Trp Val# 25750- ACT ATT GAT GGT AAT AGA TAT TAC TTC GAG CC - #T AAT ACA GCT ATG GGT7776Thr Ile Asp Gly Asn Arg Tyr Tyr Phe Glu Pr - #o Asn Thr Ala Met Gly# 25905- GCG AAT GGT TAT AAA ACT ATT GAT AAT AAA AA - #T TTT TAC TTT AGA AAT7824Ala Asn Gly Tyr Lys Thr Ile Asp Asn Lys As - #n Phe Tyr Phe Arg Asn# 26050- GGT TTA CCT CAG ATA GGA GTG TTT AAA GGG TC - #T AAT GGA TTT GAA TAC7872Gly Leu Pro Gln Ile Gly Val Phe Lys Gly Se - #r Asn Gly Phe Glu Tyr# 26205- TTT GCA CCT GCT AAT ACG GAT GCT AAC AAT AT - #A GAA GGT CAA GCT ATA7920Phe Ala Pro Ala Asn Thr Asp Ala Asn Asn Il - #e Glu Gly Gln Ala Ile# 26402630 - # 2635- CGT TAT CAA AAT AGA TTC CTA CAT TTA CTT GG - #A AAA ATA TAT TAC TTT7968Arg Tyr Gln Asn Arg Phe Leu His Leu Leu Gl - #y Lys Ile Tyr Tyr Phe# 26550- GGT AAT AAT TCA AAA GCA GTT ACT GGA TGG CA - #A ACT ATT AAT GGT AAA8016Gly Asn Asn Ser Lys Ala Val Thr Gly Trp Gl - #n Thr Ile Asn Gly Lys# 26705- GTA TAT TAC TTT ATG CCT GAT ACT GCT ATG GC - #T GCA GCT GGT GGA CTT8064Val Tyr Tyr Phe Met Pro Asp Thr Ala Met Al - #a Ala Ala Gly Gly Leu# 26850- TTC GAG ATT GAT GGT GTT ATA TAT TTC TTT GG - #T GTT GAT GGA GTA AAA8112Phe Glu Ile Asp Gly Val Ile Tyr Phe Phe Gl - #y Val Asp Gly Val Lys# 27005# 8133 GGC TAAAla Pro Gly Ile Tyr Gly2705 2710- (2) INFORMATION FOR SEQ ID NO:6:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 2710 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:- Met Ser Leu Ile Ser Lys Glu Glu Leu Ile Ly - #s Leu Ala Tyr Ser Ile# 15- Arg Pro Arg Glu Asn Glu Tyr Lys Thr Ile Le - #u Thr Asn Leu Asp Glu# 30- Tyr Asn Lys Leu Thr Thr Asn Asn Asn Glu As - #n Lys Tyr Leu Gln Leu# 45- Lys Lys Leu Asn Glu Ser Ile Asp Val Phe Me - #t Asn Lys Tyr Lys Thr# 60- Ser Ser Arg Asn Arg Ala Leu Ser Asn Leu Ly - #s Lys Asp Ile Leu Lys# 80- Glu Val Ile Leu Ile Lys Asn Ser Asn Thr Se - #r Pro Val Glu Lys Asn# 95- Leu His Phe Val Trp Ile Gly Gly Glu Val Se - #r Asp Ile Ala Leu Glu# 110- Tyr Ile Lys Gln Trp Ala Asp Ile Asn Ala Gl - #u Tyr Asn Ile Lys Leu# 125- Trp Tyr Asp Ser Glu Ala Phe Leu Val Asn Th - #r Leu Lys Lys Ala Ile# 140- Val Glu Ser Ser Thr Thr Glu Ala Leu Gln Le - #u Leu Glu Glu Glu Ile145 1 - #50 1 - #55 1 -#60- Gln Asn Pro Gln Phe Asp Asn Met Lys Phe Ty - #r Lys Lys Arg Met Glu# 175- Phe Ile Tyr Asp Arg Gln Lys Arg Phe Ile As - #n Tyr Tyr Lys Ser Gln# 190- Ile Asn Lys Pro Thr Val Pro Thr Ile Asp As - #p Ile Ile Lys Ser His# 205- Leu Val Ser Glu Tyr Asn Arg Asp Glu Thr Va - #l Leu Glu Ser Tyr Arg# 220- Thr Asn Ser Leu Arg Lys Ile Asn Ser Asn Hi - #s Gly Ile Asp Ile Arg225 2 - #30 2 - #35 2 -#40- Ala Asn Ser Leu Phe Thr Glu Gln Glu Leu Le - #u Asn Ile Tyr Ser Gln# 255- Glu Leu Leu Asn Arg Gly Asn Leu Ala Ala Al - #a Ser Asp Ile Val Arg# 270- Leu Leu Ala Leu Lys Asn Phe Gly Gly Val Ty - #r Leu Asp Val Asp Met# 285- Leu Pro Gly Ile His Ser Asp Leu Phe Lys Th - #r Ile Ser Arg Pro Ser# 300- Ser Ile Gly Leu Asp Arg Trp Glu Met Ile Ly - #s Leu Glu Ala Ile Met305 3 - #10 3 - #15 3 -#20- Lys Tyr Lys Lys Tyr Ile Asn Asn Tyr Thr Se - #r Glu Asn Phe Asp Lys# 335- Leu Asp Gln Gln Leu Lys Asp Asn Phe Lys Le - #u Ile Ile Glu Ser Lys# 350- Ser Glu Lys Ser Glu Ile Phe Ser Lys Leu Gl - #u Asn Leu Asn Val Ser# 365- Asp Leu Glu Ile Lys Ile Ala Phe Ala Leu Gl - #y Ser Val Ile Asn Gln# 380- Ala Leu Ile Ser Lys Gln Gly Ser Tyr Leu Th - #r Asn Leu Val Ile Glu385 3 - #90 3 - #95 4 -#00- Gln Val Lys Asn Arg Tyr Gln Phe Leu Asn Gl - #n His Leu Asn Pro Ala# 415- Ile Glu Ser Asp Asn Asn Phe Thr Asp Thr Th - #r Lys Ile Phe His Asp# 430- Ser Leu Phe Asn Ser Ala Thr Ala Glu Asn Se - #r Met Phe Leu Thr Lys# 445- Ile Ala Pro Tyr Leu Gln Val Gly Phe Met Pr - #o Glu Ala Arg Ser Thr# 460- Ile Ser Leu Ser Gly Pro Gly Ala Tyr Ala Se - #r Ala Tyr Tyr Asp Phe465 4 - #70 4 - #75 4 -#80- Ile Asn Leu Gln Glu Asn Thr Ile Glu Lys Th - #r Leu Lys Ala Ser Asp# 495- Leu Ile Glu Phe Lys Phe Pro Glu Asn Asn Le - #u Ser Gln Leu Thr Glu# 510- Gln Glu Ile Asn Ser Leu Trp Ser Phe Asp Gl - #n Ala Ser Ala Lys Tyr# 525- Gln Phe Glu Lys Tyr Val Arg Asp Tyr Thr Gl - #y Gly Ser Leu Ser Glu# 540- Asp Asn Gly Val Asp Phe Asn Lys Asn Thr Al - #a Leu Asp Lys Asn Tyr545 5 - #50 5 - #55 5 -#60- Leu Leu Asn Asn Lys Ile Pro Ser Asn Asn Va - #l Glu Glu Ala Gly Ser# 575- Lys Asn Tyr Val His Tyr Ile Ile Gln Leu Gl - #n Gly Asp Asp Ile Ser# 590- Tyr Glu Ala Thr Cys Asn Leu Phe Ser Lys As - #n Pro Lys Asn Ser Ile# 605- Ile Ile Gln Arg Asn Met Asn Glu Ser Ala Ly - #s Ser Tyr Phe Leu Ser# 620- Asp Asp Gly Glu Ser Ile Leu Glu Leu Asn Ly - #s Tyr Arg Ile Pro Glu625 6 - #30 6 - #35 6 -#40- Arg Leu Lys Asn Lys Glu Lys Val Lys Val Th - #r Phe Ile Gly His Gly# 655- Lys Asp Glu Phe Asn Thr Ser Glu Phe Ala Ar - #g Leu Ser Val Asp Ser# 670- Leu Ser Asn Glu Ile Ser Ser Phe Leu Asp Th - #r Ile Lys Leu Asp Ile# 685- Ser Pro Lys Asn Val Glu Val Asn Leu Leu Gl - #y Cys Asn Met Phe Ser# 700- Tyr Asp Phe Asn Val Glu Glu Thr Tyr Pro Gl - #y Lys Leu Leu Leu Ser705 7 - #10 7 - #15 7 -#20- Ile Met Asp Lys Ile Thr Ser Thr Leu Pro As - #p Val Asn Lys Asn Ser# 735- Ile Thr Ile Gly Ala Asn Gln Tyr Glu Val Ar - #g Ile Asn Ser Glu Gly# 750- Arg Lys Glu Leu Leu Ala His Ser Gly Lys Tr - #p Ile Asn Lys Glu Glu# 765- Ala Ile Met Ser Asp Leu Ser Ser Lys Glu Ty - #r Ile Phe Phe Asp Ser# 780- Ile Asp Asn Lys Leu Lys Ala Lys Ser Lys As - #n Ile Pro Gly Leu Ala785 7 - #90 7 - #95 8 -#00- Ser Ile Ser Glu Asp Ile Lys Thr Leu Leu Le - #u Asp Ala Ser Val Ser# 815- Pro Asp Thr Lys Phe Ile Leu Asn Asn Leu Ly - #s Leu Asn Ile Glu Ser# 830- Ser Ile Gly Asp Tyr Ile Tyr Tyr Glu Lys Le - #u Glu Pro Val Lys Asn# 845- Ile Ile His Asn Ser Ile Asp Asp Leu Ile As - #p Glu Phe Asn Leu Leu# 860- Glu Asn Val Ser Asp Glu Leu Tyr Glu Leu Ly - #s Lys Leu Asn Asn Leu865 8 - #70 8 - #75 8 -#80- Asp Glu Lys Tyr Leu Ile Ser Phe Glu Asp Il - #e Ser Lys Asn Asn Ser# 895- Thr Tyr Ser Val Arg Phe Ile Asn Lys Ser As - #n Gly Glu Ser Val Tyr# 910- Val Glu Thr Glu Lys Glu Ile Phe Ser Lys Ty - #r Ser Glu His Ile Thr# 925- Lys Glu Ile Ser Thr Ile Lys Asn Ser Ile Il - #e Thr Asp Val Asn Gly# 940- Asn Leu Leu Asp Asn Ile Gln Leu Asp His Th - #r Ser Gln Val Asn Thr945 9 - #50 9 - #55 9 -#60- Leu Asn Ala Ala Phe Phe Ile Gln Ser Leu Il - #e Asp Tyr Ser Ser Asn# 975- Lys Asp Val Leu Asn Asp Leu Ser Thr Ser Va - #l Lys Val Gln Leu Tyr# 990- Ala Gln Leu Phe Ser Thr Gly Leu Asn Thr Il - #e Tyr Asp Ser Ile Gln# 10050- Leu Val Asn Leu Ile Ser Asn Ala Val Asn As - #p Thr Ile Asn Val Leu# 10205- Pro Thr Ile Thr Glu Gly Ile Pro Ile Val Se - #r Thr Ile Leu Asp Gly# 10401030 - # 1035- Ile Asn Leu Gly Ala Ala Ile Lys Glu Leu Le - #u Asp Glu His Asp Pro# 10550- Leu Leu Lys Lys Glu Leu Glu Ala Lys Val Gl - #y Val Leu Ala Ile Asn# 10705- Met Ser Leu Ser Ile Ala Ala Thr Val Ala Se - #r Ile Val Gly Ile Gly# 10850- Ala Glu Val Thr Ile Phe Leu Leu Pro Ile Al - #a Gly Ile Ser Ala Gly# 11005- Ile Pro Ser Leu Val Asn Asn Glu Leu Ile Le - #u His Asp Lys Ala Thr# 11201110 - # 1115- Ser Val Val Asn Tyr Phe Asn His Leu Ser Gl - #u Ser Lys Lys Tyr Gly# 11350- Pro Leu Lys Thr Glu Asp Asp Lys Ile Leu Va - #l Pro Ile Asp Asp Leu# 11505- Val Ile Ser Glu Ile Asp Phe Asn Asn Asn Se - #r Ile Lys Leu Gly Thr# 11650- Cys Asn Ile Leu Ala Met Glu Gly Gly Ser Gl - #y His Thr Val Thr Gly# 11805- Asn Ile Asp His Phe Phe Ser Ser Pro Ser Il - #e Ser Ser His Ile Pro# 12001190 - # 1195- Ser Leu Ser Ile Tyr Ser Ala Ile Gly Ile Gl - #u Thr Glu Asn Leu Asp# 12150- Phe Ser Lys Lys Ile Met Met Leu Pro Asn Al - #a Pro Ser Arg Val Phe# 12305- Trp Trp Glu Thr Gly Ala Val Pro Gly Leu Ar - #g Ser Leu Glu Asn Asp# 12450- Gly Thr Arg Leu Leu Asp Ser Ile Arg Asp Le - #u Tyr Pro Gly Lys Phe# 12605- Tyr Trp Arg Phe Tyr Ala Phe Phe Asp Tyr Al - #a Ile Thr Thr Leu Lys# 12801270 - # 1275- Pro Val Tyr Glu Asp Thr Asn Ile Lys Ile Ly - #s Leu Asp Lys Asp Thr# 12950- Arg Asn Phe Ile Met Pro Thr Ile Thr Thr As - #n Glu Ile Arg Asn Lys# 13105- Leu Ser Tyr Ser Phe Asp Gly Ala Gly Gly Th - #r Tyr Ser Leu Leu Leu# 13250- Ser Ser Tyr Pro Ile Ser Thr Asn Ile Asn Le - #u Ser Lys Asp Asp Leu# 13405- Trp Ile Phe Asn Ile Asp Asn Glu Val Arg Gl - #u Ile Ser Ile Glu Asn# 13601350 - # 1355- Gly Thr Ile Lys Lys Gly Lys Leu Ile Lys As - #p Val Leu Ser Lys Ile# 13750- Asp Ile Asn Lys Asn Lys Leu Ile Ile Gly As - #n Gln Thr Ile Asp Phe# 13905- Ser Gly Asp Ile Asp Asn Lys Asp Arg Tyr Il - #e Phe Leu Thr Cys Glu# 14050- Leu Asp Asp Lys Ile Ser Leu Ile Ile Glu Il - #e Asn Leu Val Ala Lys# 14205- Ser Tyr Ser Leu Leu Leu Ser Gly Asp Lys As - #n Tyr Leu Ile Ser Asn# 14401430 - # 1435- Leu Ser Asn Thr Ile Glu Lys Ile Asn Thr Le - #u Gly Leu Asp Ser Lys# 14550- Asn Ile Ala Tyr Asn Tyr Thr Asp Glu Ser As - #n Asn Lys Tyr Phe Gly# 14705- Ala Ile Ser Lys Thr Ser Gln Lys Ser Ile Il - #e His Tyr Lys Lys Asp# 14850- Ser Lys Asn Ile Leu Glu Phe Tyr Asn Asp Se - #r Thr Leu Glu Phe Asn# 15005- Ser Lys Asp Phe Ile Ala Glu Asp Ile Asn Va - #l Phe Met Lys Asp Asp# 15201510 - # 1515- Ile Asn Thr Ile Thr Gly Lys Tyr Tyr Val As - #p Asn Asn Thr Asp Lys# 15350- Ser Ile Asp Phe Ser Ile Ser Leu Val Ser Ly - #s Asn Gln Val Lys Val# 15505- Asn Gly Leu Tyr Leu Asn Glu Ser Val Tyr Se - #r Ser Tyr Leu Asp Phe# 15650- Val Lys Asn Ser Asp Gly His His Asn Thr Se - #r Asn Phe Met Asn Leu# 15805- Phe Leu Asp Asn Ile Ser Phe Trp Lys Leu Ph - #e Gly Phe Glu Asn Ile# 16001590 - # 1595- Asn Phe Val Ile Asp Lys Tyr Phe Thr Leu Va - #l Gly Lys Thr Asn Leu# 16150- Gly Tyr Val Glu Phe Ile Cys Asp Asn Asn Ly - #s Asn Ile Asp Ile Tyr# 16305- Phe Gly Glu Trp Lys Thr Ser Ser Ser Lys Se - #r Thr Ile Phe Ser Gly# 16450- Asn Gly Arg Asn Val Val Val Glu Pro Ile Ty - #r Asn Pro Asp Thr Gly# 16605- Glu Asp Ile Ser Thr Ser Leu Asp Phe Ser Ty - #r Glu Pro Leu Tyr Gly# 16801670 - # 1675- Ile Asp Arg Tyr Ile Asn Lys Val Leu Ile Al - #a Pro Asp Leu Tyr Thr# 16950- Ser Leu Ile Asn Ile Asn Thr Asn Tyr Tyr Se - #r Asn Glu Tyr Tyr Pro# 17105- Glu Ile Ile Val Leu Asn Pro Asn Thr Phe Hi - #s Lys Lys Val Asn Ile# 17250- Asn Leu Asp Ser Ser Ser Phe Glu Tyr Lys Tr - #p Ser Thr Glu Gly Ser# 17405- Asp Phe Ile Leu Val Arg Tyr Leu Glu Glu Se - #r Asn Lys Lys Ile Leu# 17601750 - # 1755- Gln Lys Ile Arg Ile Lys Gly Ile Leu Ser As - #n Thr Gln Ser Phe Asn# 17750- Lys Met Ser Ile Asp Phe Lys Asp Ile Lys Ly - #s Leu Ser Leu Gly Tyr# 17905- Ile Met Ser Asn Phe Lys Ser Phe Asn Ser Gl - #u Asn Glu Leu Asp Arg# 18050- Asp His Leu Gly Phe Lys Ile Ile Asp Asn Ly - #s Thr Tyr Tyr Tyr Asp# 18205- Glu Asp Ser Lys Leu Val Lys Gly Leu Ile As - #n Ile Asn Asn Ser Leu# 18401830 - # 1835- Phe Tyr Phe Asp Pro Ile Glu Phe Asn Leu Va - #l Thr Gly Trp Gln Thr# 18550- Ile Asn Gly Lys Lys Tyr Tyr Phe Asp Ile As - #n Thr Gly Ala Ala Leu# 18705- Thr Ser Tyr Lys Ile Ile Asn Gly Lys His Ph - #e Tyr Phe Asn Asn Asp# 18850- Gly Val Met Gln Leu Gly Val Phe Lys Gly Pr - #o Asp Gly Phe Glu Tyr# 19005- Phe Ala Pro Ala Asn Thr Gln Asn Asn Asn Il - #e Glu Gly Gln Ala Ile# 19201910 - # 1915- Val Tyr Gln Ser Lys Phe Leu Thr Leu Asn Gl - #y Lys Lys Tyr Tyr Phe# 19350- Asp Asn Asn Ser Lys Ala Val Thr Gly Trp Ar - #g Ile Ile Asn Asn Glu# 19505- Lys Tyr Tyr Phe Asn Pro Asn Asn Ala Ile Al - #a Ala Val Gly Leu Gln# 19650- Val Ile Asp Asn Asn Lys Tyr Tyr Phe Asn Pr - #o Asp Thr Ala Ile Ile# 19805- Ser Lys Gly Trp Gln Thr Val Asn Gly Ser Ar - #g Tyr Tyr Phe Asp Thr# 20001990 - # 1995- Asp Thr Ala Ile Ala Phe Asn Gly Tyr Lys Th - #r Ile Asp Gly Lys His# 20150- Phe Tyr Phe Asp Ser Asp Cys Val Val Lys Il - #e Gly Val Phe Ser Thr# 20305- Ser Asn Gly Phe Glu Tyr Phe Ala Pro Ala As - #n Thr Tyr Asn Asn Asn# 20450- Ile Glu Gly Gln Ala Ile Val Tyr Gln Ser Ly - #s Phe Leu Thr Leu Asn# 20605- Gly Lys Lys Tyr Tyr Phe Asp Asn Asn Ser Ly - #s Ala Val Thr Gly Leu# 20802070 - # 2075- Gln Thr Ile Asp Ser Lys Lys Tyr Tyr Phe As - #n Thr Asn Thr Ala Glu# 20950- Ala Ala Thr Gly Trp Gln Thr Ile Asp Gly Ly - #s Lys Tyr Tyr Phe Asn# 21105- Thr Asn Thr Ala Glu Ala Ala Thr Gly Trp Gl - #n Thr Ile Asp Gly Lys# 21250- Lys Tyr Tyr Phe Asn Thr Asn Thr Ala Ile Al - #a Ser Thr Gly Tyr Thr# 21405- Ile Ile Asn Gly Lys His Phe Tyr Phe Asn Th - #r Asp Gly Ile Met Gln# 21602150 - # 2155- Ile Gly Val Phe Lys Gly Pro Asn Gly Phe Gl - #u Tyr Phe Ala Pro Ala# 21750- Asn Thr Asp Ala Asn Asn Ile Glu Gly Gln Al - #a Ile Leu Tyr Gln Asn# 21905- Glu Phe Leu Thr Leu Asn Gly Lys Lys Tyr Ty - #r Phe Gly Ser Asp Ser# 22050- Lys Ala Val Thr Gly Trp Arg Ile Ile Asn As - #n Lys Lys Tyr Tyr Phe# 22205- Asn Pro Asn Asn Ala Ile Ala Ala Ile His Le - #u Cys Thr Ile Asn Asn# 22402230 - # 2235- Asp Lys Tyr Tyr Phe Ser Tyr Asp Gly Ile Le - #u Gln Asn Gly Tyr Ile# 22550- Thr Ile Glu Arg Asn Asn Phe Tyr Phe Asp Al - #a Asn Asn Glu Ser Lys# 22705- Met Val Thr Gly Val Phe Lys Gly Pro Asn Gl - #y Phe Glu Tyr Phe Ala# 22850- Pro Ala Asn Thr His Asn Asn Asn Ile Glu Gl - #y Gln Ala Ile Val Tyr# 23005- Gln Asn Lys Phe Leu Thr Leu Asn Gly Lys Ly - #s Tyr Tyr Phe Asp Asn# 23202310 - # 2315- Asp Ser Lys Ala Val Thr Gly Trp Gln Thr Il - #e Asp Gly Lys Lys Tyr# 23350- Tyr Phe Asn Leu Asn Thr Ala Glu Ala Ala Th - #r Gly Trp Gln Thr Ile# 23505- Asp Gly Lys Lys Tyr Tyr Phe Asn Leu Asn Th - #r Ala Glu Ala Ala Thr# 23650- Gly Trp Gln Thr Ile Asp Gly Lys Lys Tyr Ty - #r Phe Asn Thr Asn Thr# 23805- Phe Ile Ala Ser Thr Gly Tyr Thr Ser Ile As - #n Gly Lys His Phe Tyr# 24002390 - # 2395- Phe Asn Thr Asp Gly Ile Met Gln Ile Gly Va - #l Phe Lys Gly Pro Asn# 24150- Gly Phe Glu Tyr Phe Ala Pro Ala Asn Thr As - #p Ala Asn Asn Ile Glu# 24305- Gly Gln Ala Ile Leu Tyr Gln Asn Lys Phe Le - #u Thr Leu Asn Gly Lys# 24450- Lys Tyr Tyr Phe Gly Ser Asp Ser Lys Ala Va - #l Thr Gly Leu Arg Thr# 24605- Ile Asp Gly Lys Lys Tyr Tyr Phe Asn Thr As - #n Thr Ala Val Ala Val# 24802470 - # 2475- Thr Gly Trp Gln Thr Ile Asn Gly Lys Lys Ty - #r Tyr Phe Asn Thr Asn# 24950- Thr Ser Ile Ala Ser Thr Gly Tyr Thr Ile Il - #e Ser Gly Lys His Phe# 25105- Tyr Phe Asn Thr Asp Gly Ile Met Gln Ile Gl - #y Val Phe Lys Gly Pro# 25250- Asp Gly Phe Glu Tyr Phe Ala Pro Ala Asn Th - #r Asp Ala Asn Asn Ile# 25405- Glu Gly Gln Ala Ile Arg Tyr Gln Asn Arg Ph - #e Leu Tyr Leu His Asp# 25602550 - # 2555- Asn Ile Tyr Tyr Phe Gly Asn Asn Ser Lys Al - #a Ala Thr Gly Trp Val# 25750- Thr Ile Asp Gly Asn Arg Tyr Tyr Phe Glu Pr - #o Asn Thr Ala Met Gly# 25905- Ala Asn Gly Tyr Lys Thr Ile Asp Asn Lys As - #n Phe Tyr Phe Arg Asn# 26050- Gly Leu Pro Gln Ile Gly Val Phe Lys Gly Se - #r Asn Gly Phe Glu Tyr# 26205- Phe Ala Pro Ala Asn Thr Asp Ala Asn Asn Il - #e Glu Gly Gln Ala Ile# 26402630 - # 2635- Arg Tyr Gln Asn Arg Phe Leu His Leu Leu Gl - #y Lys Ile Tyr Tyr Phe# 26550- Gly Asn Asn Ser Lys Ala Val Thr Gly Trp Gl - #n Thr Ile Asn Gly Lys# 26705- Val Tyr Tyr Phe Met Pro Asp Thr Ala Met Al - #a Ala Ala Gly Gly Leu# 26850- Phe Glu Ile Asp Gly Val Ile Tyr Phe Phe Gl - #y Val Asp Gly Val Lys# 27005- Ala Pro Gly Ile Tyr Gly2705 2710- (2) INFORMATION FOR SEQ ID NO:7:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 811 amino (B) TYPE: amino acid (C) STRANDEDNESS: unknown (D) TOPOLOGY: unknown- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:- Ser Tyr Lys Ile Ile Asn Gly Lys His Phe Ty - #r Phe Asn Asn Asp Gly# 15- Val Met Gln Leu Gly Val Phe Lys Gly Pro As - #p Gly Phe Glu Tyr Phe# 30- Ala Pro Ala Asn Thr Gln Asn Asn Asn Ile Gl - #u Gly Gln Ala Ile Val# 45- Tyr Gln Ser Lys Phe Leu Thr Leu Asn Gly Ly - #s Lys Tyr Tyr Phe Asp# 60- Asn Asn Ser Lys Ala Val Thr Gly Trp Arg Il - #e Ile Asn Asn Glu Lys#80- Tyr Tyr Phe Asn Pro Asn Asn Ala Ile Ala Al - #a Val Gly Leu Gln Val# 95- Ile Asp Asn Asn Lys Tyr Tyr Phe Asn Pro As - #p Thr Ala Ile Ile Ser# 110- Lys Gly Trp Gln Thr Val Asn Gly Ser Arg Ty - #r Tyr Phe Asp Thr Asp# 125- Thr Ala Ile Ala Phe Asn Gly Tyr Lys Thr Il - #e Asp Gly Lys His Phe# 140- Tyr Phe Asp Ser Asp Cys Val Val Lys Ile Gl - #y Val Phe Ser Thr Ser145 1 - #50 1 - #55 1 -#60- Asn Gly Phe Glu Tyr Phe Ala Pro Ala Asn Th - #r Tyr Asn Asn Asn Ile# 175- Glu Gly Gln Ala Ile Val Tyr Gln Ser Lys Ph - #e Leu Thr Leu Asn Gly# 190- Lys Lys Tyr Tyr Phe Asp Asn Asn Ser Lys Al - #a Val Thr Gly Leu Gln# 205- Thr Ile Asp Ser Lys Lys Tyr Tyr Phe Asn Th - #r Asn Thr Ala Glu Ala# 220- Ala Thr Gly Trp Gln Thr Ile Asp Gly Lys Ly - #s Tyr Tyr Phe Asn Thr225 2 - #30 2 - #35 2 -#40- Asn Thr Ala Glu Ala Ala Thr Gly Trp Gln Th - #r Ile Asp Gly Lys Lys# 255- Tyr Tyr Phe Asn Thr Asn Thr Ala Ile Ala Se - #r Thr Gly Tyr Thr Ile# 270- Ile Asn Gly Lys His Phe Tyr Phe Asn Thr As - #p Gly Ile Met Gln Ile# 285- Gly Val Phe Lys Gly Pro Asn Gly Phe Glu Ty - #r Phe Ala Pro Ala Asn# 300- Thr Asp Ala Asn Asn Ile Glu Gly Gln Ala Il - #e Leu Tyr Gln Asn Glu305 3 - #10 3 - #15 3 -#20- Phe Leu Thr Leu Asn Gly Lys Lys Tyr Tyr Ph - #e Gly Ser Asp Ser Lys# 335- Ala Val Thr Gly Trp Arg Ile Ile Asn Asn Ly - #s Lys Tyr Tyr Phe Asn# 350- Pro Asn Asn Ala Ile Ala Ala Ile His Leu Cy - #s Thr Ile Asn Asn Asp# 365- Lys Tyr Tyr Phe Ser Tyr Asp Gly Ile Leu Gl - #n Asn Gly Tyr Ile Thr# 380- Ile Glu Arg Asn Asn Phe Tyr Phe Asp Ala As - #n Asn Glu Ser Lys Met385 3 - #90 3 - #95 4 -#00- Val Thr Gly Val Phe Lys Gly Pro Asn Gly Ph - #e Glu Tyr Phe Ala Pro# 415- Ala Asn Thr His Asn Asn Asn Ile Glu Gly Gl - #n Ala Ile Val Tyr Gln# 430- Asn Lys Phe Leu Thr Leu Asn Gly Lys Lys Ty - #r Tyr Phe Asp Asn Asp# 445- Ser Lys Ala Val Thr Gly Trp Gln Thr Ile As - #p Gly Lys Lys Tyr Tyr# 460- Phe Asn Leu Asn Thr Ala Glu Ala Ala Thr Gl - #y Trp Gln Thr Ile Asp465 4 - #70 4 - #75 4 -#80- Gly Lys Lys Tyr Tyr Phe Asn Leu Asn Thr Al - #a Glu Ala Ala Thr Gly# 495- Trp Gln Thr Ile Asp Gly Lys Lys Tyr Tyr Ph - #e Asn Thr Asn Thr Phe# 510- Ile Ala Ser Thr Gly Tyr Thr Ser Ile Asn Gl - #y Lys His Phe Tyr Phe# 525- Asn Thr Asp Gly Ile Met Gln Ile Gly Val Ph - #e Lys Gly Pro Asn Gly# 540- Phe Glu Tyr Phe Ala Pro Ala Asn Thr Asp Al - #a Asn Asn Ile Glu Gly545 5 - #50 5 - #55 5 -#60- Gln Ala Ile Leu Tyr Gln Asn Lys Phe Leu Th - #r Leu Asn Gly Lys Lys# 575- Tyr Tyr Phe Gly Ser Asp Ser Lys Ala Val Th - #r Gly Leu Arg Thr Ile# 590- Asp Gly Lys Lys Tyr Tyr Phe Asn Thr Asn Th - #r Ala Val Ala Val Thr# 605- Gly Trp Gln Thr Ile Asn Gly Lys Lys Tyr Ty - #r Phe Asn Thr Asn Thr# 620- Ser Ile Ala Ser Thr Gly Tyr Thr Ile Ile Se - #r Gly Lys His Phe Tyr625 6 - #30 6 - #35 6 -#40- Phe Asn Thr Asp Gly Ile Met Gln Ile Gly Va - #l Phe Lys Gly Pro Asp# 655- Gly Phe Glu Tyr Phe Ala Pro Ala Asn Thr As - #p Ala Asn Asn Ile Glu# 670- Gly Gln Ala Ile Arg Tyr Gln Asn Arg Phe Le - #u Tyr Leu His Asp Asn# 685- Ile Tyr Tyr Phe Gly Asn Asn Ser Lys Ala Al - #a Thr Gly Trp Val Thr# 700- Ile Asp Gly Asn Arg Tyr Tyr Phe Glu Pro As - #n Thr Ala Met Gly Ala705 7 - #10 7 - #15 7 -#20- Asn Gly Tyr Lys Thr Ile Asp Asn Lys Asn Ph - #e Tyr Phe Arg Asn Gly# 735- Leu Pro Gln Ile Gly Val Phe Lys Gly Ser As - #n Gly Phe Glu Tyr Phe# 750- Ala Pro Ala Asn Thr Asp Ala Asn Asn Ile Gl - #u Gly Gln Ala Ile Arg# 765- Tyr Gln Asn Arg Phe Leu His Leu Leu Gly Ly - #s Ile Tyr Tyr Phe Gly# 780- Asn Asn Ser Lys Ala Val Thr Gly Trp Gln Th - #r Ile Asn Gly Lys Val785 7 - #90 7 - #95 8 -#00- Tyr Tyr Phe Met Pro Asp Thr Ala Met Ala Al - #a# 810- (2) INFORMATION FOR SEQ ID NO:8:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 91 amino (B) TYPE: amino acid (C) STRANDEDNESS: unknown (D) TOPOLOGY: unknown- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:- Ser Tyr Lys Ile Ile Asn Gly Lys His Phe Ty - #r Phe Asn Asn Asp Gly# 15- Val Met Gln Leu Gly Val Phe Lys Gly Pro As - #p Gly Phe Glu Tyr Phe# 30- Ala Pro Ala Asn Thr Gln Asn Asn Asn Ile Gl - #u Gly Gln Ala Ile Val# 45- Tyr Gln Ser Lys Phe Leu Thr Leu Asn Gly Ly - #s Lys Tyr Tyr Phe Asp# 60- Asn Asn Ser Lys Ala Val Thr Gly Trp Arg Il - #e Ile Asn Asn Glu Lys#80- Tyr Tyr Phe Asn Pro Asn Asn Ala Ile Ala Al - #a# 90- (2) INFORMATION FOR SEQ ID NO:9:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 7101 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 1..7098- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:- ATG AGT TTA GTT AAT AGA AAA CAG TTA GAA AA - #A ATG GCA AAT GTA AGA 48Met Ser Leu Val Asn Arg Lys Gln Leu Glu Ly - #s Met Ala Asn Val Arg# 15- TTT CGT ACT CAA GAA GAT GAA TAT GTT GCA AT - #A TTG GAT GCT TTA GAA 96Phe Arg Thr Gln Glu Asp Glu Tyr Val Ala Il - #e Leu Asp Ala Leu Glu# 30- GAA TAT CAT AAT ATG TCA GAG AAT ACT GTA GT - #C GAA AAA TAT TTA AAA 144Glu Tyr His Asn Met Ser Glu Asn Thr Val Va - #l Glu Lys Tyr Leu Lys# 45- TTA AAA GAT ATA AAT AGT TTA ACA GAT ATT TA - #T ATA GAT ACA TAT AAA 192Leu Lys Asp Ile Asn Ser Leu Thr Asp Ile Ty - #r Ile Asp Thr Tyr Lys# 60- AAA TCT GGT AGA AAT AAA GCC TTA AAA AAA TT - #T AAG GAA TAT CTA GTT 240Lys Ser Gly Arg Asn Lys Ala Leu Lys Lys Ph - #e Lys Glu Tyr Leu Val# 80- ACA GAA GTA TTA GAG CTA AAG AAT AAT AAT TT - #A ACT CCA GTT GAG AAA 288Thr Glu Val Leu Glu Leu Lys Asn Asn Asn Le - #u Thr Pro Val Glu Lys# 95- AAT TTA CAT TTT GTT TGG ATT GGA GGT CAA AT - #A AAT GAC ACT GCT ATT 336Asn Leu His Phe Val Trp Ile Gly Gly Gln Il - #e Asn Asp Thr Ala Ile# 110- AAT TAT ATA AAT CAA TGG AAA GAT GTA AAT AG - #T GAT TAT AAT GTT AAT 384Asn Tyr Ile Asn Gln Trp Lys Asp Val Asn Se - #r Asp Tyr Asn Val Asn# 125- GTT TTT TAT GAT AGT AAT GCA TTT TTG ATA AA - #C ACA TTG AAA AAA ACT 432Val Phe Tyr Asp Ser Asn Ala Phe Leu Ile As - #n Thr Leu Lys Lys Thr# 140- GTA GTA GAA TCA GCA ATA AAT GAT ACA CTT GA - #A TCA TTT AGA GAA AAC 480Val Val Glu Ser Ala Ile Asn Asp Thr Leu Gl - #u Ser Phe Arg Glu Asn145 1 - #50 1 - #55 1 -#60- TTA AAT GAC CCT AGA TTT GAC TAT AAT AAA TT - #C TTC AGA AAA CGT ATG 528Leu Asn Asp Pro Arg Phe Asp Tyr Asn Lys Ph - #e Phe Arg Lys Arg Met# 175- GAA ATA ATT TAT GAT AAA CAG AAA AAT TTC AT - #A AAC TAC TAT AAA GCT 576Glu Ile Ile Tyr Asp Lys Gln Lys Asn Phe Il - #e Asn Tyr Tyr Lys Ala# 190- CAA AGA GAA GAA AAT CCT GAA CTT ATA ATT GA - #T GAT ATT GTA AAG ACA 624Gln Arg Glu Glu Asn Pro Glu Leu Ile Ile As - #p Asp Ile Val Lys Thr# 205- TAT CTT TCA AAT GAG TAT TCA AAG GAG ATA GA - #T GAA CTT AAT ACC TAT 672Tyr Leu Ser Asn Glu Tyr Ser Lys Glu Ile As - #p Glu Leu Asn Thr Tyr# 220- ATT GAA GAA TCC TTA AAT AAA ATT ACA CAG AA - #T AGT GGA AAT GAT GTT 720Ile Glu Glu Ser Leu Asn Lys Ile Thr Gln As - #n Ser Gly Asn Asp Val225 2 - #30 2 - #35 2 -#40- AGA AAC TTT GAA GAA TTT AAA AAT GGA GAG TC - #A TTC AAC TTA TAT GAA 768Arg Asn Phe Glu Glu Phe Lys Asn Gly Glu Se - #r Phe Asn Leu Tyr Glu# 255- CAA GAG TTG GTA GAA AGG TGG AAT TTA GCT GC - #T GCT TCT GAC ATA TTA 816Gln Glu Leu Val Glu Arg Trp Asn Leu Ala Al - #a Ala Ser Asp Ile Leu# 270- AGA ATA TCT GCA TTA AAA GAA ATT GGT GGT AT - #G TAT TTA GAT GTT GAT 864Arg Ile Ser Ala Leu Lys Glu Ile Gly Gly Me - #t Tyr Leu Asp Val Asp# 285- ATG TTA CCA GGA ATA CAA CCA GAC TTA TTT GA - #G TCT ATA GAG AAA CCT 912Met Leu Pro Gly Ile Gln Pro Asp Leu Phe Gl - #u Ser Ile Glu Lys Pro# 300- AGT TCA GTA ACA GTG GAT TTT TGG GAA ATG AC - #A AAG TTA GAA GCT ATA 960Ser Ser Val Thr Val Asp Phe Trp Glu Met Th - #r Lys Leu Glu Ala Ile305 3 - #10 3 - #15 3 -#20- ATG AAA TAC AAA GAA TAT ATA CCA GAA TAT AC - #C TCA GAA CAT TTT GAC1008Met Lys Tyr Lys Glu Tyr Ile Pro Glu Tyr Th - #r Ser Glu His Phe Asp# 335- ATG TTA GAC GAA GAA GTT CAA AGT AGT TTT GA - #A TCT GTT CTA GCT TCT1056Met Leu Asp Glu Glu Val Gln Ser Ser Phe Gl - #u Ser Val Leu Ala Ser# 350- AAG TCA GAT AAA TCA GAA ATA TTC TCA TCA CT - #T GGT GAT ATG GAG GCA1104Lys Ser Asp Lys Ser Glu Ile Phe Ser Ser Le - #u Gly Asp Met Glu Ala# 365- TCA CCA CTA GAA GTT AAA ATT GCA TTT AAT AG - #T AAG GGT ATT ATA AAT1152Ser Pro Leu Glu Val Lys Ile Ala Phe Asn Se - #r Lys Gly Ile Ile Asn# 380- CAA GGG CTA ATT TCT GTG AAA GAC TCA TAT TG - #T AGC AAT TTA ATA GTA1200Gln Gly Leu Ile Ser Val Lys Asp Ser Tyr Cy - #s Ser Asn Leu Ile Val385 3 - #90 3 - #95 4 -#00- AAA CAA ATC GAG AAT AGA TAT AAA ATA TTG AA - #T AAT AGT TTA AAT CCA1248Lys Gln Ile Glu Asn Arg Tyr Lys Ile Leu As - #n Asn Ser Leu Asn Pro# 415- GCT ATT AGC GAG GAT AAT GAT TTT AAT ACT AC - #A ACG AAT ACC TTT ATT1296Ala Ile Ser Glu Asp Asn Asp Phe Asn Thr Th - #r Thr Asn Thr Phe Ile# 430- GAT AGT ATA ATG GCT GAA GCT AAT GCA GAT AA - #T GGT AGA TTT ATG ATG1344Asp Ser Ile Met Ala Glu Ala Asn Ala Asp As - #n Gly Arg Phe Met Met# 445- GAA CTA GGA AAG TAT TTA AGA GTT GGT TTC TT - #C CCA GAT GTT AAA ACT1392Glu Leu Gly Lys Tyr Leu Arg Val Gly Phe Ph - #e Pro Asp Val Lys Thr# 460- ACT ATT AAC TTA AGT GGC CCT GAA GCA TAT GC - #G GCA GCT TAT CAA GAT1440Thr Ile Asn Leu Ser Gly Pro Glu Ala Tyr Al - #a Ala Ala Tyr Gln Asp465 4 - #70 4 - #75 4 -#80- TTA TTA ATG TTT AAA GAA GGC AGT ATG AAT AT - #C CAT TTG ATA GAA GCT1488Leu Leu Met Phe Lys Glu Gly Ser Met Asn Il - #e His Leu Ile Glu Ala# 495- GAT TTA AGA AAC TTT GAA ATC TCT AAA ACT AA - #T ATT TCT CAA TCA ACT1536Asp Leu Arg Asn Phe Glu Ile Ser Lys Thr As - #n Ile Ser Gln Ser Thr# 510- GAA CAA GAA ATG GCT AGC TTA TGG TCA TTT GA - #C GAT GCA AGA GCT AAA1584Glu Gln Glu Met Ala Ser Leu Trp Ser Phe As - #p Asp Ala Arg Ala Lys# 525- GCT CAA TTT GAA GAA TAT AAA AGG AAT TAT TT - #T GAA GGT TCT CTT GGT1632Ala Gln Phe Glu Glu Tyr Lys Arg Asn Tyr Ph - #e Glu Gly Ser Leu Gly# 540- GAA GAT GAT AAT CTT GAT TTT TCT CAA AAT AT - #A GTA GTT GAC AAG GAG1680Glu Asp Asp Asn Leu Asp Phe Ser Gln Asn Il - #e Val Val Asp Lys Glu545 5 - #50 5 - #55 5 -#60- TAT CTT TTA GAA AAA ATA TCT TCA TTA GCA AG - #A AGT TCA GAG AGA GGA1728Tyr Leu Leu Glu Lys Ile Ser Ser Leu Ala Ar - #g Ser Ser Glu Arg Gly# 575- TAT ATA CAC TAT ATT GTT CAG TTA CAA GGA GA - #T AAA ATT AGT TAT GAA1776Tyr Ile His Tyr Ile Val Gln Leu Gln Gly As - #p Lys Ile Ser Tyr Glu# 590- GCA GCA TGT AAC TTA TTT GCA AAG ACT CCT TA - #T GAT AGT GTA CTG TTT1824Ala Ala Cys Asn Leu Phe Ala Lys Thr Pro Ty - #r Asp Ser Val Leu Phe# 605- CAG AAA AAT ATA GAA GAT TCA GAA ATT GCA TA - #T TAT TAT AAT CCT GGA1872Gln Lys Asn Ile Glu Asp Ser Glu Ile Ala Ty - #r Tyr Tyr Asn Pro Gly# 620- GAT GGT GAA ATA CAA GAA ATA GAC AAG TAT AA - #A ATT CCA AGT ATA ATT1920Asp Gly Glu Ile Gln Glu Ile Asp Lys Tyr Ly - #s Ile Pro Ser Ile Ile625 6 - #30 6 - #35 6 -#40- TCT GAT AGA CCT AAG ATT AAA TTA ACA TTT AT - #T GGT CAT GGT AAA GAT1968Ser Asp Arg Pro Lys Ile Lys Leu Thr Phe Il - #e Gly His Gly Lys Asp# 655- GAA TTT AAT ACT GAT ATA TTT GCA GGT TTT GA - #T GTA GAT TCA TTA TCC2016Glu Phe Asn Thr Asp Ile Phe Ala Gly Phe As - #p Val Asp Ser Leu Ser# 670- ACA GAA ATA GAA GCA GCA ATA GAT TTA GCT AA - #A GAG GAT ATT TCT CCT2064Thr Glu Ile Glu Ala Ala Ile Asp Leu Ala Ly - #s Glu Asp Ile Ser Pro# 685- AAG TCA ATA GAA ATA AAT TTA TTA GGA TGT AA - #T ATG TTT AGC TAC TCT2112Lys Ser Ile Glu Ile Asn Leu Leu Gly Cys As - #n Met Phe Ser Tyr Ser# 700- ATC AAC GTA GAG GAG ACT TAT CCT GGA AAA TT - #A TTA CTT AAA GTT AAA2160Ile Asn Val Glu Glu Thr Tyr Pro Gly Lys Le - #u Leu Leu Lys Val Lys705 7 - #10 7 - #15 7 -#20- GAT AAA ATA TCA GAA TTA ATG CCA TCT ATA AG - #T CAA GAC TCT ATT ATA2208Asp Lys Ile Ser Glu Leu Met Pro Ser Ile Se - #r Gln Asp Ser Ile Ile# 735- GTA AGT GCA AAT CAA TAT GAA GTT AGA ATA AA - #T AGT GAA GGA AGA AGA2256Val Ser Ala Asn Gln Tyr Glu Val Arg Ile As - #n Ser Glu Gly Arg Arg# 750- GAA TTA TTG GAT CAT TCT GGT GAA TGG ATA AA - #T AAA GAA GAA AGT ATT2304Glu Leu Leu Asp His Ser Gly Glu Trp Ile As - #n Lys Glu Glu Ser Ile# 765- ATA AAG GAT ATT TCA TCA AAA GAA TAT ATA TC - #A TTT AAT CCT AAA GAA2352Ile Lys Asp Ile Ser Ser Lys Glu Tyr Ile Se - #r Phe Asn Pro Lys Glu# 780- AAT AAA ATT ACA GTA AAA TCT AAA AAT TTA CC - #T GAG CTA TCT ACA TTA2400Asn Lys Ile Thr Val Lys Ser Lys Asn Leu Pr - #o Glu Leu Ser Thr Leu785 7 - #90 7 - #95 8 -#00- TTA CAA GAA ATT AGA AAT AAT TCT AAT TCA AG - #T GAT ATT GAA CTA GAA2448Leu Gln Glu Ile Arg Asn Asn Ser Asn Ser Se - #r Asp Ile Glu Leu Glu# 815- GAA AAA GTA ATG TTA ACA GAA TGT GAG ATA AA - #T GTT ATT TCA AAT ATA2496Glu Lys Val Met Leu Thr Glu Cys Glu Ile As - #n Val Ile Ser Asn Ile# 830- GAT ACG CAA ATT GTT GAG GAA AGG ATT GAA GA - #A GCT AAG AAT TTA ACT2544Asp Thr Gln Ile Val Glu Glu Arg Ile Glu Gl - #u Ala Lys Asn Leu Thr# 845- TCT GAC TCT ATT AAT TAT ATA AAA GAT GAA TT - #T AAA CTA ATA GAA TCT2592Ser Asp Ser Ile Asn Tyr Ile Lys Asp Glu Ph - #e Lys Leu Ile Glu Ser# 860- ATT TCT GAT GCA CTA TGT GAC TTA AAA CAA CA - #G AAT GAA TTA GAA GAT2640Ile Ser Asp Ala Leu Cys Asp Leu Lys Gln Gl - #n Asn Glu Leu Glu Asp865 8 - #70 8 - #75 8 -#80- TCT CAT TTT ATA TCT TTT GAG GAC ATA TCA GA - #G ACT GAT GAG GGA TTT2688Ser His Phe Ile Ser Phe Glu Asp Ile Ser Gl - #u Thr Asp Glu Gly Phe# 895- AGT ATA AGA TTT ATT AAT AAA GAA ACT GGA GA - #A TCT ATA TTT GTA GAA2736Ser Ile Arg Phe Ile Asn Lys Glu Thr Gly Gl - #u Ser Ile Phe Val Glu# 910- ACT GAA AAA ACA ATA TTC TCT GAA TAT GCT AA - #T CAT ATA ACT GAA GAG2784Thr Glu Lys Thr Ile Phe Ser Glu Tyr Ala As - #n His Ile Thr Glu Glu# 925- ATT TCT AAG ATA AAA GGT ACT ATA TTT GAT AC - #T GTA AAT GGT AAG TTA2832Ile Ser Lys Ile Lys Gly Thr Ile Phe Asp Th - #r Val Asn Gly Lys Leu# 940- GTA AAA AAA GTA AAT TTA GAT ACT ACA CAC GA - #A GTA AAT ACT TTA AAT2880Val Lys Lys Val Asn Leu Asp Thr Thr His Gl - #u Val Asn Thr Leu Asn945 9 - #50 9 - #55 9 -#60- GCT GCA TTT TTT ATA CAA TCA TTA ATA GAA TA - #T AAT AGT TCT AAA GAA2928Ala Ala Phe Phe Ile Gln Ser Leu Ile Glu Ty - #r Asn Ser Ser Lys Glu# 975- TCT CTT AGT AAT TTA AGT GTA GCA ATG AAA GT - #C CAA GTT TAC GCT CAA2976Ser Leu Ser Asn Leu Ser Val Ala Met Lys Va - #l Gln Val Tyr Ala Gln# 990- TTA TTT AGT ACT GGT TTA AAT ACT ATT ACA GA - #T GCA GCC AAA GTT GTT3024Leu Phe Ser Thr Gly Leu Asn Thr Ile Thr As - #p Ala Ala Lys Val Val# 10050- GAA TTA GTA TCA ACT GCA TTA GAT GAA ACT AT - #A GAC TTA CTT CCT ACA3072Glu Leu Val Ser Thr Ala Leu Asp Glu Thr Il - #e Asp Leu Leu Pro Thr# 10205- TTA TCT GAA GGA TTA CCT ATA ATT GCA ACT AT - #T ATA GAT GGT GTA AGT3120Leu Ser Glu Gly Leu Pro Ile Ile Ala Thr Il - #e Ile Asp Gly Val Ser# 10401030 - # 1035- TTA GGT GCA GCA ATC AAA GAG CTA AGT GAA AC - #G AGT GAC CCA TTA TTA3168Leu Gly Ala Ala Ile Lys Glu Leu Ser Glu Th - #r Ser Asp Pro Leu Leu# 10550- AGA CAA GAA ATA GAA GCT AAG ATA GGT ATA AT - #G GCA GTA AAT TTA ACA3216Arg Gln Glu Ile Glu Ala Lys Ile Gly Ile Me - #t Ala Val Asn Leu Thr# 10705- ACA GCT ACA ACT GCA ATC ATT ACT TCA TCT TT - #G GGG ATA GCT AGT GGA3264Thr Ala Thr Thr Ala Ile Ile Thr Ser Ser Le - #u Gly Ile Ala Ser Gly# 10850- TTT AGT ATA CTT TTA GTT CCT TTA GCA GGA AT - #T TCA GCA GGT ATA CCA3312Phe Ser Ile Leu Leu Val Pro Leu Ala Gly Il - #e Ser Ala Gly Ile Pro# 11005- AGC TTA GTA AAC AAT GAA CTT GTA CTT CGA GA - #T AAG GCA ACA AAG GTT3360Ser Leu Val Asn Asn Glu Leu Val Leu Arg As - #p Lys Ala Thr Lys Val# 11201110 - # 1115- GTA GAT TAT TTT AAA CAT GTT TCA TTA GTT GA - #A ACT GAA GGA GTA TTT3408Val Asp Tyr Phe Lys His Val Ser Leu Val Gl - #u Thr Glu Gly Val Phe# 11350- ACT TTA TTA GAT GAT AAA ATA ATG ATG CCA CA - #A GAT GAT TTA GTG ATA3456Thr Leu Leu Asp Asp Lys Ile Met Met Pro Gl - #n Asp Asp Leu Val Ile# 11505- TCA GAA ATA GAT TTT AAT AAT AAT TCA ATA GT - #T TTA GGT AAA TGT GAA3504Ser Glu Ile Asp Phe Asn Asn Asn Ser Ile Va - #l Leu Gly Lys Cys Glu# 11650- ATC TGG AGA ATG GAA GGT GGT TCA GGT CAT AC - #T GTA ACT GAT GAT ATA3552Ile Trp Arg Met Glu Gly Gly Ser Gly His Th - #r Val Thr Asp Asp Ile# 11805- GAT CAC TTC TTT TCA GCA CCA TCA ATA ACA TA - #T AGA GAG CCA CAC TTA3600Asp His Phe Phe Ser Ala Pro Ser Ile Thr Ty - #r Arg Glu Pro His Leu# 12001190 - # 1195- TCT ATA TAT GAC GTA TTG GAA GTA CAA AAA GA - #A GAA CTT GAT TTG TCA3648Ser Ile Tyr Asp Val Leu Glu Val Gln Lys Gl - #u Glu Leu Asp Leu Ser# 12150- AAA GAT TTA ATG GTA TTA CCT AAT GCT CCA AA - #T AGA GTA TTT GCT TGG3696Lys Asp Leu Met Val Leu Pro Asn Ala Pro As - #n Arg Val Phe Ala Trp# 12305- GAA ACA GGA TGG ACA CCA GGT TTA AGA AGC TT - #A GAA AAT GAT GGC ACA3744Glu Thr Gly Trp Thr Pro Gly Leu Arg Ser Le - #u Glu Asn Asp Gly Thr# 12450- AAA CTG TTA GAC CGT ATA AGA GAT AAC TAT GA - #A GGT GAG TTT TAT TGG3792Lys Leu Leu Asp Arg Ile Arg Asp Asn Tyr Gl - #u Gly Glu Phe Tyr Trp# 12605- AGA TAT TTT GCT TTT ATA GCT GAT GCT TTA AT - #A ACA ACA TTA AAA CCA3840Arg Tyr Phe Ala Phe Ile Ala Asp Ala Leu Il - #e Thr Thr Leu Lys Pro# 12801270 - # 1275- AGA TAT GAA GAT ACT AAT ATA AGA ATA AAT TT - #A GAT AGT AAT ACT AGA3888Arg Tyr Glu Asp Thr Asn Ile Arg Ile Asn Le - #u Asp Ser Asn Thr Arg# 12950- AGT TTT ATA GTT CCA ATA ATA ACT ACA GAA TA - #T ATA AGA GAA AAA TTA3936Ser Phe Ile Val Pro Ile Ile Thr Thr Glu Ty - #r Ile Arg Glu Lys Leu# 13105- TCA TAT TCT TTC TAT GGT TCA GGA GGA ACT TA - #T GCA TTG TCT CTT TCT3984Ser Tyr Ser Phe Tyr Gly Ser Gly Gly Thr Ty - #r Ala Leu Ser Leu Ser# 13250- CAA TAT AAT ATG GGT ATA AAT ATA GAA TTA AG - #T GAA AGT GAT GTT TGG4032Gln Tyr Asn Met Gly Ile Asn Ile Glu Leu Se - #r Glu Ser Asp Val Trp# 13405- ATT ATA GAT GTT GAT AAT GTT GTG AGA GAT GT - #A ACT ATA GAA TCT GAT4080Ile Ile Asp Val Asp Asn Val Val Arg Asp Va - #l Thr Ile Glu Ser Asp# 13601350 - # 1355- AAA ATT AAA AAA GGT GAT TTA ATA GAA GGT AT - #T TTA TCT ACA CTA AGT4128Lys Ile Lys Lys Gly Asp Leu Ile Glu Gly Il - #e Leu Ser Thr Leu Ser# 13750- ATT GAA GAG AAT AAA ATT ATC TTA AAT AGC CA - #T GAG ATT AAT TTT TCT4176Ile Glu Glu Asn Lys Ile Ile Leu Asn Ser Hi - #s Glu Ile Asn Phe Ser# 13905- GGT GAG GTA AAT GGA AGT AAT GGA TTT GTT TC - #T TTA ACA TTT TCA ATT4224Gly Glu Val Asn Gly Ser Asn Gly Phe Val Se - #r Leu Thr Phe Ser Ile# 14050- TTA GAA GGA ATA AAT GCA ATT ATA GAA GTT GA - #T TTA TTA TCT AAA TCA4272Leu Glu Gly Ile Asn Ala Ile Ile Glu Val As - #p Leu Leu Ser Lys Ser# 14205- TAT AAA TTA CTT ATT TCT GGC GAA TTA AAA AT - #A TTG ATG TTA AAT TCA4320Tyr Lys Leu Leu Ile Ser Gly Glu Leu Lys Il - #e Leu Met Leu Asn Ser# 14401430 - # 1435- AAT CAT ATT CAA CAG AAA ATA GAT TAT ATA GG - #A TTC AAT AGC GAA TTA4368Asn His Ile Gln Gln Lys Ile Asp Tyr Ile Gl - #y Phe Asn Ser Glu Leu# 14550- CAG AAA AAT ATA CCA TAT AGC TTT GTA GAT AG - #T GAA GGA AAA GAG AAT4416Gln Lys Asn Ile Pro Tyr Ser Phe Val Asp Se - #r Glu Gly Lys Glu Asn# 14705- GGT TTT ATT AAT GGT TCA ACA AAA GAA GGT TT - #A TTT GTA TCT GAA TTA4464Gly Phe Ile Asn Gly Ser Thr Lys Glu Gly Le - #u Phe Val Ser Glu Leu# 14850- CCT GAT GTA GTT CTT ATA AGT AAG GTT TAT AT - #G GAT GAT AGT AAG CCT4512Pro Asp Val Val Leu Ile Ser Lys Val Tyr Me - #t Asp Asp Ser Lys Pro# 15005- TCA TTT GGA TAT TAT AGT AAT AAT TTG AAA GA - #T GTC AAA GTT ATA ACT4560Ser Phe Gly Tyr Tyr Ser Asn Asn Leu Lys As - #p Val Lys Val Ile Thr# 15201510 - # 1515- AAA GAT AAT GTT AAT ATA TTA ACA GGT TAT TA - #T CTT AAG GAT GAT ATA4608Lys Asp Asn Val Asn Ile Leu Thr Gly Tyr Ty - #r Leu Lys Asp Asp Ile# 15350- AAA ATC TCT CTT TCT TTG ACT CTA CAA GAT GA - #A AAA ACT ATA AAG TTA4656Lys Ile Ser Leu Ser Leu Thr Leu Gln Asp Gl - #u Lys Thr Ile Lys Leu# 15505- AAT AGT GTG CAT TTA GAT GAA AGT GGA GTA GC - #T GAG ATT TTG AAG TTC4704Asn Ser Val His Leu Asp Glu Ser Gly Val Al - #a Glu Ile Leu Lys Phe# 15650- ATG AAT AGA AAA GGT AAT ACA AAT ACT TCA GA - #T TCT TTA ATG AGC TTT4752Met Asn Arg Lys Gly Asn Thr Asn Thr Ser As - #p Ser Leu Met Ser Phe# 15805- TTA GAA AGT ATG AAT ATA AAA AGT ATT TTC GT - #T AAT TTC TTA CAA TCT4800Leu Glu Ser Met Asn Ile Lys Ser Ile Phe Va - #l Asn Phe Leu Gln Ser# 16001590 - # 1595- AAT ATT AAG TTT ATA TTA GAT GCT AAT TTT AT - #A ATA AGT GGT ACT ACT4848Asn Ile Lys Phe Ile Leu Asp Ala Asn Phe Il - #e Ile Ser Gly Thr Thr# 16150- TCT ATT GGC CAA TTT GAG TTT ATT TGT GAT GA - #A AAT GAT AAT ATA CAA4896Ser Ile Gly Gln Phe Glu Phe Ile Cys Asp Gl - #u Asn Asp Asn Ile Gln# 16305- CCA TAT TTC ATT AAG TTT AAT ACA CTA GAA AC - #T AAT TAT ACT TTA TAT4944Pro Tyr Phe Ile Lys Phe Asn Thr Leu Glu Th - #r Asn Tyr Thr Leu Tyr# 16450- GTA GGA AAT AGA CAA AAT ATG ATA GTG GAA CC - #A AAT TAT GAT TTA GAT4992Val Gly Asn Arg Gln Asn Met Ile Val Glu Pr - #o Asn Tyr Asp Leu Asp# 16605- GAT TCT GGA GAT ATA TCT TCA ACT GTT ATC AA - #T TTC TCT CAA AAG TAT5040Asp Ser Gly Asp Ile Ser Ser Thr Val Ile As - #n Phe Ser Gln Lys Tyr# 16801670 - # 1675- CTT TAT GGA ATA GAC AGT TGT GTT AAT AAA GT - #T GTA ATT TCA CCA AAT5088Leu Tyr Gly Ile Asp Ser Cys Val Asn Lys Va - #l Val Ile Ser Pro Asn# 16950- ATT TAT ACA GAT GAA ATA AAT ATA ACG CCT GT - #A TAT GAA ACA AAT AAT5136Ile Tyr Thr Asp Glu Ile Asn Ile Thr Pro Va - #l Tyr Glu Thr Asn Asn# 17105- ACT TAT CCA GAA GTT ATT GTA TTA GAT GCA AA - #T TAT ATA AAT GAA AAA5184Thr Tyr Pro Glu Val Ile Val Leu Asp Ala As - #n Tyr Ile Asn Glu Lys# 17250- ATA AAT GTT AAT ATC AAT GAT CTA TCT ATA CG - #A TAT GTA TGG AGT AAT5232Ile Asn Val Asn Ile Asn Asp Leu Ser Ile Ar - #g Tyr Val Trp Ser Asn# 17405- GAT GGT AAT GAT TTT ATT CTT ATG TCA ACT AG - #T GAA GAA AAT AAG GTG5280Asp Gly Asn Asp Phe Ile Leu Met Ser Thr Se - #r Glu Glu Asn Lys Val# 17601750 - # 1755- TCA CAA GTT AAA ATA AGA TTC GTT AAT GTT TT - #T AAA GAT AAG ACT TTG5328Ser Gln Val Lys Ile Arg Phe Val Asn Val Ph - #e Lys Asp Lys Thr Leu# 17750- GCA AAT AAG CTA TCT TTT AAC TTT AGT GAT AA - #A CAA GAT GTA CCT GTA5376Ala Asn Lys Leu Ser Phe Asn Phe Ser Asp Ly - #s Gln Asp Val Pro Val# 17905- AGT GAA ATA ATC TTA TCA TTT ACA CCT TCA TA - #T TAT GAG GAT GGA TTG5424Ser Glu Ile Ile Leu Ser Phe Thr Pro Ser Ty - #r Tyr Glu Asp Gly Leu# 18050- ATT GGC TAT GAT TTG GGT CTA GTT TCT TTA TA - #T AAT GAG AAA TTT TAT5472Ile Gly Tyr Asp Leu Gly Leu Val Ser Leu Ty - #r Asn Glu Lys Phe Tyr# 18205- ATT AAT AAC TTT GGA ATG ATG GTA TCT GGA TT - #A ATA TAT ATT AAT GAT5520Ile Asn Asn Phe Gly Met Met Val Ser Gly Le - #u Ile Tyr Ile Asn Asp# 18401830 - # 1835- TCA TTA TAT TAT TTT AAA CCA CCA GTA AAT AA - #T TTG ATA ACT GGA TTT5568Ser Leu Tyr Tyr Phe Lys Pro Pro Val Asn As - #n Leu Ile Thr Gly Phe# 18550- GTG ACT GTA GGC GAT GAT AAA TAC TAC TTT AA - #T CCA ATT AAT GGT GGA5616Val Thr Val Gly Asp Asp Lys Tyr Tyr Phe As - #n Pro Ile Asn Gly Gly# 18705- GCT GCT TCA ATT GGA GAG ACA ATA ATT GAT GA - #C AAA AAT TAT TAT TTC5664Ala Ala Ser Ile Gly Glu Thr Ile Ile Asp As - #p Lys Asn Tyr Tyr Phe# 18850- AAC CAA AGT GGA GTG TTA CAA ACA GGT GTA TT - #T AGT ACA GAA GAT GGA5712Asn Gln Ser Gly Val Leu Gln Thr Gly Val Ph - #e Ser Thr Glu Asp Gly# 19005- TTT AAA TAT TTT GCC CCA GCT AAT ACA CTT GA - #T GAA AAC CTA GAA GGA5760Phe Lys Tyr Phe Ala Pro Ala Asn Thr Leu As - #p Glu Asn Leu Glu Gly# 19201910 - # 1915- GAA GCA ATT GAT TTT ACT GGA AAA TTA ATT AT - #T GAC GAA AAT ATT TAT5808Glu Ala Ile Asp Phe Thr Gly Lys Leu Ile Il - #e Asp Glu Asn Ile Tyr# 19350- TAT TTT GAT GAT AAT TAT AGA GGA GCT GTA GA - #A TGG AAA GAA TTA GAT5856Tyr Phe Asp Asp Asn Tyr Arg Gly Ala Val Gl - #u Trp Lys Glu Leu Asp# 19505- GGT GAA ATG CAC TAT TTT AGC CCA GAA ACA GG - #T AAA GCT TTT AAA GGT5904Gly Glu Met His Tyr Phe Ser Pro Glu Thr Gl - #y Lys Ala Phe Lys Gly# 19650- CTA AAT CAA ATA GGT GAT TAT AAA TAC TAT TT - #C AAT TCT GAT GGA GTT5952Leu Asn Gln Ile Gly Asp Tyr Lys Tyr Tyr Ph - #e Asn Ser Asp Gly Val# 19805- ATG CAA AAA GGA TTT GTT AGT ATA AAT GAT AA - #T AAA CAC TAT TTT GAT6000Met Gln Lys Gly Phe Val Ser Ile Asn Asp As - #n Lys His Tyr Phe Asp# 20001990 - # 1995- GAT TCT GGT GTT ATG AAA GTA GGT TAC ACT GA - #A ATA GAT GGC AAG CAT6048Asp Ser Gly Val Met Lys Val Gly Tyr Thr Gl - #u Ile Asp Gly Lys His# 20150- TTC TAC TTT GCT GAA AAC GGA GAA ATG CAA AT - #A GGA GTA TTT AAT ACA6096Phe Tyr Phe Ala Glu Asn Gly Glu Met Gln Il - #e Gly Val Phe Asn Thr# 20305- GAA GAT GGA TTT AAA TAT TTT GCT CAT CAT AA - #T GAA GAT TTA GGA AAT6144Glu Asp Gly Phe Lys Tyr Phe Ala His His As - #n Glu Asp Leu Gly Asn# 20450- GAA GAA GGT GAA GAA ATC TCA TAT TCT GGT AT - #A TTA AAT TTC AAT AAT6192Glu Glu Gly Glu Glu Ile Ser Tyr Ser Gly Il - #e Leu Asn Phe Asn Asn# 20605- AAA ATT TAC TAT TTT GAT GAT TCA TTT ACA GC - #T GTA GTT GGA TGG AAA6240Lys Ile Tyr Tyr Phe Asp Asp Ser Phe Thr Al - #a Val Val Gly Trp Lys# 20802070 - # 2075- GAT TTA GAG GAT GGT TCA AAG TAT TAT TTT GA - #T GAA GAT ACA GCA GAA6288Asp Leu Glu Asp Gly Ser Lys Tyr Tyr Phe As - #p Glu Asp Thr Ala Glu# 20950- GCA TAT ATA GGT TTG TCA TTA ATA AAT GAT GG - #T CAA TAT TAT TTT AAT6336Ala Tyr Ile Gly Leu Ser Leu Ile Asn Asp Gl - #y Gln Tyr Tyr Phe Asn# 21105- GAT GAT GGA ATT ATG CAA GTT GGA TTT GTC AC - #T ATA AAT GAT AAA GTC6384Asp Asp Gly Ile Met Gln Val Gly Phe Val Th - #r Ile Asn Asp Lys Val# 21250- TTC TAC TTC TCT GAC TCT GGA ATT ATA GAA TC - #T GGA GTA CAA AAC ATA6432Phe Tyr Phe Ser Asp Ser Gly Ile Ile Glu Se - #r Gly Val Gln Asn Ile# 21405- GAT GAC AAT TAT TTC TAT ATA GAT GAT AAT GG - #T ATA GTT CAA ATT GGT6480Asp Asp Asn Tyr Phe Tyr Ile Asp Asp Asn Gl - #y Ile Val Gln Ile Gly# 21602150 - # 2155- GTA TTT GAT ACT TCA GAT GGA TAT AAA TAT TT - #T GCA CCT GCT AAT ACT6528Val Phe Asp Thr Ser Asp Gly Tyr Lys Tyr Ph - #e Ala Pro Ala Asn Thr# 21750- GTA AAT GAT AAT ATT TAC GGA CAA GCA GTT GA - #A TAT AGT GGT TTA GTT6576Val Asn Asp Asn Ile Tyr Gly Gln Ala Val Gl - #u Tyr Ser Gly Leu Val# 21905- AGA GTT GGG GAA GAT GTA TAT TAT TTT GGA GA - #A ACA TAT ACA ATT GAG6624Arg Val Gly Glu Asp Val Tyr Tyr Phe Gly Gl - #u Thr Tyr Thr Ile Glu# 22050- ACT GGA TGG ATA TAT GAT ATG GAA AAT GAA AG - #T GAT AAA TAT TAT TTC6672Thr Gly Trp Ile Tyr Asp Met Glu Asn Glu Se - #r Asp Lys Tyr Tyr Phe# 22205- AAT CCA GAA ACT AAA AAA GCA TGC AAA GGT AT - #T AAT TTA ATT GAT GAT6720Asn Pro Glu Thr Lys Lys Ala Cys Lys Gly Il - #e Asn Leu Ile Asp Asp# 22402230 - # 2235- ATA AAA TAT TAT TTT GAT GAG AAG GGC ATA AT - #G AGA ACG GGT CTT ATA6768Ile Lys Tyr Tyr Phe Asp Glu Lys Gly Ile Me - #t Arg Thr Gly Leu Ile# 22550- TCA TTT GAA AAT AAT AAT TAT TAC TTT AAT GA - #G AAT GGT GAA ATG CAA6816Ser Phe Glu Asn Asn Asn Tyr Tyr Phe Asn Gl - #u Asn Gly Glu Met Gln# 22705- TTT GGT TAT ATA AAT ATA GAA GAT AAG ATG TT - #C TAT TTT GGT GAA GAT6864Phe Gly Tyr Ile Asn Ile Glu Asp Lys Met Ph - #e Tyr Phe Gly Glu Asp# 22850- GGT GTC ATG CAG ATT GGA GTA TTT AAT ACA CC - #A GAT GGA TTT AAA TAC6912Gly Val Met Gln Ile Gly Val Phe Asn Thr Pr - #o Asp Gly Phe Lys Tyr# 23005- TTT GCA CAT CAA AAT ACT TTG GAT GAG AAT TT - #T GAG GGA GAA TCA ATA6960Phe Ala His Gln Asn Thr Leu Asp Glu Asn Ph - #e Glu Gly Glu Ser Ile# 23202310 - # 2315- AAC TAT ACT GGT TGG TTA GAT TTA GAT GAA AA - #G AGA TAT TAT TTT ACA7008Asn Tyr Thr Gly Trp Leu Asp Leu Asp Glu Ly - #s Arg Tyr Tyr Phe Thr# 23350- GAT GAA TAT ATT GCA GCA ACT GGT TCA GTT AT - #T ATT GAT GGT GAG GAG7056Asp Glu Tyr Ile Ala Ala Thr Gly Ser Val Il - #e Ile Asp Gly Glu Glu# 23505- TAT TAT TTT GAT CCT GAT ACA GCT CAA TTA GT - #G ATT AGT GAA#7098Tyr Tyr Phe Asp Pro Asp Thr Ala Gln Leu Va - #l Ile Ser Glu# 23650# 7101- (2) INFORMATION FOR SEQ ID NO:10:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 2366 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:- Met Ser Leu Val Asn Arg Lys Gln Leu Glu Ly - #s Met Ala Asn Val Arg# 15- Phe Arg Thr Gln Glu Asp Glu Tyr Val Ala Il - #e Leu Asp Ala Leu Glu# 30- Glu Tyr His Asn Met Ser Glu Asn Thr Val Va - #l Glu Lys Tyr Leu Lys# 45- Leu Lys Asp Ile Asn Ser Leu Thr Asp Ile Ty - #r Ile Asp Thr Tyr Lys# 60- Lys Ser Gly Arg Asn Lys Ala Leu Lys Lys Ph - #e Lys Glu Tyr Leu Val# 80- Thr Glu Val Leu Glu Leu Lys Asn Asn Asn Le - #u Thr Pro Val Glu Lys# 95- Asn Leu His Phe Val Trp Ile Gly Gly Gln Il - #e Asn Asp Thr Ala Ile# 110- Asn Tyr Ile Asn Gln Trp Lys Asp Val Asn Se - #r Asp Tyr Asn Val Asn# 125- Val Phe Tyr Asp Ser Asn Ala Phe Leu Ile As - #n Thr Leu Lys Lys Thr# 140- Val Val Glu Ser Ala Ile Asn Asp Thr Leu Gl - #u Ser Phe Arg Glu Asn145 1 - #50 1 - #55 1 -#60- Leu Asn Asp Pro Arg Phe Asp Tyr Asn Lys Ph - #e Phe Arg Lys Arg Met# 175- Glu Ile Ile Tyr Asp Lys Gln Lys Asn Phe Il - #e Asn Tyr Tyr Lys Ala# 190- Gln Arg Glu Glu Asn Pro Glu Leu Ile Ile As - #p Asp Ile Val Lys Thr# 205- Tyr Leu Ser Asn Glu Tyr Ser Lys Glu Ile As - #p Glu Leu Asn Thr Tyr# 220- Ile Glu Glu Ser Leu Asn Lys Ile Thr Gln As - #n Ser Gly Asn Asp Val225 2 - #30 2 - #35 2 -#40- Arg Asn Phe Glu Glu Phe Lys Asn Gly Glu Se - #r Phe Asn Leu Tyr Glu# 255- Gln Glu Leu Val Glu Arg Trp Asn Leu Ala Al - #a Ala Ser Asp Ile Leu# 270- Arg Ile Ser Ala Leu Lys Glu Ile Gly Gly Me - #t Tyr Leu Asp Val Asp# 285- Met Leu Pro Gly Ile Gln Pro Asp Leu Phe Gl - #u Ser Ile Glu Lys Pro# 300- Ser Ser Val Thr Val Asp Phe Trp Glu Met Th - #r Lys Leu Glu Ala Ile305 3 - #10 3 - #15 3 -#20- Met Lys Tyr Lys Glu Tyr Ile Pro Glu Tyr Th - #r Ser Glu His Phe Asp# 335- Met Leu Asp Glu Glu Val Gln Ser Ser Phe Gl - #u Ser Val Leu Ala Ser# 350- Lys Ser Asp Lys Ser Glu Ile Phe Ser Ser Le - #u Gly Asp Met Glu Ala# 365- Ser Pro Leu Glu Val Lys Ile Ala Phe Asn Se - #r Lys Gly Ile Ile Asn# 380- Gln Gly Leu Ile Ser Val Lys Asp Ser Tyr Cy - #s Ser Asn Leu Ile Val385 3 - #90 3 - #95 4 -#00- Lys Gln Ile Glu Asn Arg Tyr Lys Ile Leu As - #n Asn Ser Leu Asn Pro# 415- Ala Ile Ser Glu Asp Asn Asp Phe Asn Thr Th - #r Thr Asn Thr Phe Ile# 430- Asp Ser Ile Met Ala Glu Ala Asn Ala Asp As - #n Gly Arg Phe Met Met# 445- Glu Leu Gly Lys Tyr Leu Arg Val Gly Phe Ph - #e Pro Asp Val Lys Thr# 460- Thr Ile Asn Leu Ser Gly Pro Glu Ala Tyr Al - #a Ala Ala Tyr Gln Asp465 4 - #70 4 - #75 4 -#80- Leu Leu Met Phe Lys Glu Gly Ser Met Asn Il - #e His Leu Ile Glu Ala# 495- Asp Leu Arg Asn Phe Glu Ile Ser Lys Thr As - #n Ile Ser Gln Ser Thr# 510- Glu Gln Glu Met Ala Ser Leu Trp Ser Phe As - #p Asp Ala Arg Ala Lys# 525- Ala Gln Phe Glu Glu Tyr Lys Arg Asn Tyr Ph - #e Glu Gly Ser Leu Gly# 540- Glu Asp Asp Asn Leu Asp Phe Ser Gln Asn Il - #e Val Val Asp Lys Glu545 5 - #50 5 - #55 5 -#60- Tyr Leu Leu Glu Lys Ile Ser Ser Leu Ala Ar - #g Ser Ser Glu Arg Gly# 575- Tyr Ile His Tyr Ile Val Gln Leu Gln Gly As - #p Lys Ile Ser Tyr Glu# 590- Ala Ala Cys Asn Leu Phe Ala Lys Thr Pro Ty - #r Asp Ser Val Leu Phe# 605- Gln Lys Asn Ile Glu Asp Ser Glu Ile Ala Ty - #r Tyr Tyr Asn Pro Gly# 620- Asp Gly Glu Ile Gln Glu Ile Asp Lys Tyr Ly - #s Ile Pro Ser Ile Ile625 6 - #30 6 - #35 6 -#40- Ser Asp Arg Pro Lys Ile Lys Leu Thr Phe Il - #e Gly His Gly Lys Asp# 655- Glu Phe Asn Thr Asp Ile Phe Ala Gly Phe As - #p Val Asp Ser Leu Ser# 670- Thr Glu Ile Glu Ala Ala Ile Asp Leu Ala Ly - #s Glu Asp Ile Ser Pro# 685- Lys Ser Ile Glu Ile Asn Leu Leu Gly Cys As - #n Met Phe Ser Tyr Ser# 700- Ile Asn Val Glu Glu Thr Tyr Pro Gly Lys Le - #u Leu Leu Lys Val Lys705 7 - #10 7 - #15 7 -#20- Asp Lys Ile Ser Glu Leu Met Pro Ser Ile Se - #r Gln Asp Ser Ile Ile# 735- Val Ser Ala Asn Gln Tyr Glu Val Arg Ile As - #n Ser Glu Gly Arg Arg# 750- Glu Leu Leu Asp His Ser Gly Glu Trp Ile As - #n Lys Glu Glu Ser Ile# 765- Ile Lys Asp Ile Ser Ser Lys Glu Tyr Ile Se - #r Phe Asn Pro Lys Glu# 780- Asn Lys Ile Thr Val Lys Ser Lys Asn Leu Pr - #o Glu Leu Ser Thr Leu785 7 - #90 7 - #95 8 -#00- Leu Gln Glu Ile Arg Asn Asn Ser Asn Ser Se - #r Asp Ile Glu Leu Glu# 815- Glu Lys Val Met Leu Thr Glu Cys Glu Ile As - #n Val Ile Ser Asn Ile# 830- Asp Thr Gln Ile Val Glu Glu Arg Ile Glu Gl - #u Ala Lys Asn Leu Thr# 845- Ser Asp Ser Ile Asn Tyr Ile Lys Asp Glu Ph - #e Lys Leu Ile Glu Ser# 860- Ile Ser Asp Ala Leu Cys Asp Leu Lys Gln Gl - #n Asn Glu Leu Glu Asp865 8 - #70 8 - #75 8 -#80- Ser His Phe Ile Ser Phe Glu Asp Ile Ser Gl - #u Thr Asp Glu Gly Phe# 895- Ser Ile Arg Phe Ile Asn Lys Glu Thr Gly Gl - #u Ser Ile Phe Val Glu# 910- Thr Glu Lys Thr Ile Phe Ser Glu Tyr Ala As - #n His Ile Thr Glu Glu# 925- Ile Ser Lys Ile Lys Gly Thr Ile Phe Asp Th - #r Val Asn Gly Lys Leu# 940- Val Lys Lys Val Asn Leu Asp Thr Thr His Gl - #u Val Asn Thr Leu Asn945 9 - #50 9 - #55 9 -#60- Ala Ala Phe Phe Ile Gln Ser Leu Ile Glu Ty - #r Asn Ser Ser Lys Glu# 975- Ser Leu Ser Asn Leu Ser Val Ala Met Lys Va - #l Gln Val Tyr Ala Gln# 990- Leu Phe Ser Thr Gly Leu Asn Thr Ile Thr As - #p Ala Ala Lys Val Val# 10050- Glu Leu Val Ser Thr Ala Leu Asp Glu Thr Il - #e Asp Leu Leu Pro Thr# 10205- Leu Ser Glu Gly Leu Pro Ile Ile Ala Thr Il - #e Ile Asp Gly Val Ser# 10401030 - # 1035- Leu Gly Ala Ala Ile Lys Glu Leu Ser Glu Th - #r Ser Asp Pro Leu Leu# 10550- Arg Gln Glu Ile Glu Ala Lys Ile Gly Ile Me - #t Ala Val Asn Leu Thr# 10705- Thr Ala Thr Thr Ala Ile Ile Thr Ser Ser Le - #u Gly Ile Ala Ser Gly# 10850- Phe Ser Ile Leu Leu Val Pro Leu Ala Gly Il - #e Ser Ala Gly Ile Pro# 11005- Ser Leu Val Asn Asn Glu Leu Val Leu Arg As - #p Lys Ala Thr Lys Val# 11201110 - # 1115- Val Asp Tyr Phe Lys His Val Ser Leu Val Gl - #u Thr Glu Gly Val Phe# 11350- Thr Leu Leu Asp Asp Lys Ile Met Met Pro Gl - #n Asp Asp Leu Val Ile# 11505- Ser Glu Ile Asp Phe Asn Asn Asn Ser Ile Va - #l Leu Gly Lys Cys Glu# 11650- Ile Trp Arg Met Glu Gly Gly Ser Gly His Th - #r Val Thr Asp Asp Ile# 11805- Asp His Phe Phe Ser Ala Pro Ser Ile Thr Ty - #r Arg Glu Pro His Leu# 12001190 - # 1195- Ser Ile Tyr Asp Val Leu Glu Val Gln Lys Gl - #u Glu Leu Asp Leu Ser# 12150- Lys Asp Leu Met Val Leu Pro Asn Ala Pro As - #n Arg Val Phe Ala Trp# 12305- Glu Thr Gly Trp Thr Pro Gly Leu Arg Ser Le - #u Glu Asn Asp Gly Thr# 12450- Lys Leu Leu Asp Arg Ile Arg Asp Asn Tyr Gl - #u Gly Glu Phe Tyr Trp# 12605- Arg Tyr Phe Ala Phe Ile Ala Asp Ala Leu Il - #e Thr Thr Leu Lys Pro# 12801270 - # 1275- Arg Tyr Glu Asp Thr Asn Ile Arg Ile Asn Le - #u Asp Ser Asn Thr Arg# 12950- Ser Phe Ile Val Pro Ile Ile Thr Thr Glu Ty - #r Ile Arg Glu Lys Leu# 13105- Ser Tyr Ser Phe Tyr Gly Ser Gly Gly Thr Ty - #r Ala Leu Ser Leu Ser# 13250- Gln Tyr Asn Met Gly Ile Asn Ile Glu Leu Se - #r Glu Ser Asp Val Trp# 13405- Ile Ile Asp Val Asp Asn Val Val Arg Asp Va - #l Thr Ile Glu Ser Asp# 13601350 - # 1355- Lys Ile Lys Lys Gly Asp Leu Ile Glu Gly Il - #e Leu Ser Thr Leu Ser# 13750- Ile Glu Glu Asn Lys Ile Ile Leu Asn Ser Hi - #s Glu Ile Asn Phe Ser# 13905- Gly Glu Val Asn Gly Ser Asn Gly Phe Val Se - #r Leu Thr Phe Ser Ile# 14050- Leu Glu Gly Ile Asn Ala Ile Ile Glu Val As - #p Leu Leu Ser Lys Ser# 14205- Tyr Lys Leu Leu Ile Ser Gly Glu Leu Lys Il - #e Leu Met Leu Asn Ser# 14401430 - # 1435- Asn His Ile Gln Gln Lys Ile Asp Tyr Ile Gl - #y Phe Asn Ser Glu Leu# 14550- Gln Lys Asn Ile Pro Tyr Ser Phe Val Asp Se - #r Glu Gly Lys Glu Asn# 14705- Gly Phe Ile Asn Gly Ser Thr Lys Glu Gly Le - #u Phe Val Ser Glu Leu# 14850- Pro Asp Val Val Leu Ile Ser Lys Val Tyr Me - #t Asp Asp Ser Lys Pro# 15005- Ser Phe Gly Tyr Tyr Ser Asn Asn Leu Lys As - #p Val Lys Val Ile Thr# 15201510 - # 1515- Lys Asp Asn Val Asn Ile Leu Thr Gly Tyr Ty - #r Leu Lys Asp Asp Ile# 15350- Lys Ile Ser Leu Ser Leu Thr Leu Gln Asp Gl - #u Lys Thr Ile Lys Leu# 15505- Asn Ser Val His Leu Asp Glu Ser Gly Val Al - #a Glu Ile Leu Lys Phe# 15650- Met Asn Arg Lys Gly Asn Thr Asn Thr Ser As - #p Ser Leu Met Ser Phe# 15805- Leu Glu Ser Met Asn Ile Lys Ser Ile Phe Va - #l Asn Phe Leu Gln Ser# 16001590 - # 1595- Asn Ile Lys Phe Ile Leu Asp Ala Asn Phe Il - #e Ile Ser Gly Thr Thr# 16150- Ser Ile Gly Gln Phe Glu Phe Ile Cys Asp Gl - #u Asn Asp Asn Ile Gln# 16305- Pro Tyr Phe Ile Lys Phe Asn Thr Leu Glu Th - #r Asn Tyr Thr Leu Tyr# 16450- Val Gly Asn Arg Gln Asn Met Ile Val Glu Pr - #o Asn Tyr Asp Leu Asp# 16605- Asp Ser Gly Asp Ile Ser Ser Thr Val Ile As - #n Phe Ser Gln Lys Tyr# 16801670 - # 1675- Leu Tyr Gly Ile Asp Ser Cys Val Asn Lys Va - #l Val Ile Ser Pro Asn# 16950- Ile Tyr Thr Asp Glu Ile Asn Ile Thr Pro Va - #l Tyr Glu Thr Asn Asn# 17105- Thr Tyr Pro Glu Val Ile Val Leu Asp Ala As - #n Tyr Ile Asn Glu Lys# 17250- Ile Asn Val Asn Ile Asn Asp Leu Ser Ile Ar - #g Tyr Val Trp Ser Asn# 17405- Asp Gly Asn Asp Phe Ile Leu Met Ser Thr Se - #r Glu Glu Asn Lys Val# 17601750 - # 1755- Ser Gln Val Lys Ile Arg Phe Val Asn Val Ph - #e Lys Asp Lys Thr Leu# 17750- Ala Asn Lys Leu Ser Phe Asn Phe Ser Asp Ly - #s Gln Asp Val Pro Val# 17905- Ser Glu Ile Ile Leu Ser Phe Thr Pro Ser Ty - #r Tyr Glu Asp Gly Leu# 18050- Ile Gly Tyr Asp Leu Gly Leu Val Ser Leu Ty - #r Asn Glu Lys Phe Tyr# 18205- Ile Asn Asn Phe Gly Met Met Val Ser Gly Le - #u Ile Tyr Ile Asn Asp# 18401830 - # 1835- Ser Leu Tyr Tyr Phe Lys Pro Pro Val Asn As - #n Leu Ile Thr Gly Phe# 18550- Val Thr Val Gly Asp Asp Lys Tyr Tyr Phe As - #n Pro Ile Asn Gly Gly# 18705- Ala Ala Ser Ile Gly Glu Thr Ile Ile Asp As - #p Lys Asn Tyr Tyr Phe# 18850- Asn Gln Ser Gly Val Leu Gln Thr Gly Val Ph - #e Ser Thr Glu Asp Gly# 19005- Phe Lys Tyr Phe Ala Pro Ala Asn Thr Leu As - #p Glu Asn Leu Glu Gly# 19201910 - # 1915- Glu Ala Ile Asp Phe Thr Gly Lys Leu Ile Il - #e Asp Glu Asn Ile Tyr# 19350- Tyr Phe Asp Asp Asn Tyr Arg Gly Ala Val Gl - #u Trp Lys Glu Leu Asp# 19505- Gly Glu Met His Tyr Phe Ser Pro Glu Thr Gl - #y Lys Ala Phe Lys Gly# 19650- Leu Asn Gln Ile Gly Asp Tyr Lys Tyr Tyr Ph - #e Asn Ser Asp Gly Val# 19805- Met Gln Lys Gly Phe Val Ser Ile Asn Asp As - #n Lys His Tyr Phe Asp# 20001990 - # 1995- Asp Ser Gly Val Met Lys Val Gly Tyr Thr Gl - #u Ile Asp Gly Lys His# 20150- Phe Tyr Phe Ala Glu Asn Gly Glu Met Gln Il - #e Gly Val Phe Asn Thr# 20305- Glu Asp Gly Phe Lys Tyr Phe Ala His His As - #n Glu Asp Leu Gly Asn# 20450- Glu Glu Gly Glu Glu Ile Ser Tyr Ser Gly Il - #e Leu Asn Phe Asn Asn# 20605- Lys Ile Tyr Tyr Phe Asp Asp Ser Phe Thr Al - #a Val Val Gly Trp Lys# 20802070 - # 2075- Asp Leu Glu Asp Gly Ser Lys Tyr Tyr Phe As - #p Glu Asp Thr Ala Glu# 20950- Ala Tyr Ile Gly Leu Ser Leu Ile Asn Asp Gl - #y Gln Tyr Tyr Phe Asn# 21105- Asp Asp Gly Ile Met Gln Val Gly Phe Val Th - #r Ile Asn Asp Lys Val# 21250- Phe Tyr Phe Ser Asp Ser Gly Ile Ile Glu Se - #r Gly Val Gln Asn Ile# 21405- Asp Asp Asn Tyr Phe Tyr Ile Asp Asp Asn Gl - #y Ile Val Gln Ile Gly# 21602150 - # 2155- Val Phe Asp Thr Ser Asp Gly Tyr Lys Tyr Ph - #e Ala Pro Ala Asn Thr# 21750- Val Asn Asp Asn Ile Tyr Gly Gln Ala Val Gl - #u Tyr Ser Gly Leu Val# 21905- Arg Val Gly Glu Asp Val Tyr Tyr Phe Gly Gl - #u Thr Tyr Thr Ile Glu# 22050- Thr Gly Trp Ile Tyr Asp Met Glu Asn Glu Se - #r Asp Lys Tyr Tyr Phe# 22205- Asn Pro Glu Thr Lys Lys Ala Cys Lys Gly Il - #e Asn Leu Ile Asp Asp# 22402230 - # 2235- Ile Lys Tyr Tyr Phe Asp Glu Lys Gly Ile Me - #t Arg Thr Gly Leu Ile# 22550- Ser Phe Glu Asn Asn Asn Tyr Tyr Phe Asn Gl - #u Asn Gly Glu Met Gln# 22705- Phe Gly Tyr Ile Asn Ile Glu Asp Lys Met Ph - #e Tyr Phe Gly Glu Asp# 22850- Gly Val Met Gln Ile Gly Val Phe Asn Thr Pr - #o Asp Gly Phe Lys Tyr# 23005- Phe Ala His Gln Asn Thr Leu Asp Glu Asn Ph - #e Glu Gly Glu Ser Ile# 23202310 - # 2315- Asn Tyr Thr Gly Trp Leu Asp Leu Asp Glu Ly - #s Arg Tyr Tyr Phe Thr# 23350- Asp Glu Tyr Ile Ala Ala Thr Gly Ser Val Il - #e Ile Asp Gly Glu Glu# 23505- Tyr Tyr Phe Asp Pro Asp Thr Ala Gln Leu Va - #l Ile Ser Glu# 23650- (2) INFORMATION FOR SEQ ID NO:11:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 19 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:11:# 19 TGT- (2) INFORMATION FOR SEQ ID NO:12:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 21 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:12:#21 CAAA G- (2) INFORMATION FOR SEQ ID NO:13:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 22 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:13:# 22TAG TG- (2) INFORMATION FOR SEQ ID NO:14:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 22 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:14:# 22GGA TC- (2) INFORMATION FOR SEQ ID NO:15:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 27 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:15:# 27 AATG GCAAATG- (2) INFORMATION FOR SEQ ID NO:16:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 26 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:16:# 26 AAGC TAGCCA- (2) INFORMATION FOR SEQ ID NO:17:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 27 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:17:# 27 AGAA AGGTGGA- (2) INFORMATION FOR SEQ ID NO:18:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 27 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:18:# 27 TCTT AAGGATG- (2) INFORMATION FOR SEQ ID NO:19:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 28 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:19:# 28 TGGA TTTGTGAC- (2) INFORMATION FOR SEQ ID NO:20:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 511 amino (B) TYPE: amino acid (C) STRANDEDNESS: unknown (D) TOPOLOGY: unknown- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:20:- Leu Ile Thr Gly Phe Val Thr Val Gly Asp As - #p Lys Tyr Tyr Phe Asn# 15- Pro Ile Asn Gly Gly Ala Ala Ser Ile Gly Gl - #u Thr Ile Ile Asp Asp# 30- Lys Asn Tyr Tyr Phe Asn Gln Ser Gly Val Le - #u Gln Thr Gly Val Phe# 45- Ser Thr Glu Asp Gly Phe Lys Tyr Phe Ala Pr - #o Ala Asn Thr Leu Asp# 60- Glu Asn Leu Glu Gly Glu Ala Ile Asp Phe Th - #r Gly Lys Leu Ile Ile#80- Asp Glu Asn Ile Tyr Tyr Phe Asp Asp Asn Ty - #r Arg Gly Ala Val Glu# 95- Trp Lys Glu Leu Asp Gly Glu Met His Tyr Ph - #e Ser Pro Glu Thr Gly# 110- Lys Ala Phe Lys Gly Leu Asn Gln Ile Gly As - #p Tyr Lys Tyr Tyr Phe# 125- Asn Ser Asp Gly Val Met Gln Lys Gly Phe Va - #l Ser Ile Asn Asp Asn# 140- Lys His Tyr Phe Asp Asp Ser Gly Val Met Ly - #s Val Gly Tyr Thr Glu145 1 - #50 1 - #55 1 -#60- Ile Asp Gly Lys His Phe Tyr Phe Ala Glu As - #n Gly Glu Met Gln Ile# 175- Gly Val Phe Asn Thr Glu Asp Gly Phe Lys Ty - #r Phe Ala His His Asn# 190- Glu Asp Leu Gly Asn Glu Glu Gly Glu Glu Il - #e Ser Tyr Ser Gly Ile# 205- Leu Asn Phe Asn Asn Lys Ile Tyr Tyr Phe As - #p Asp Ser Phe Thr Ala# 220- Val Val Gly Trp Lys Asp Leu Glu Asp Gly Se - #r Lys Tyr Tyr Phe Asp225 2 - #30 2 - #35 2 -#40- Glu Asp Thr Ala Glu Ala Tyr Ile Gly Leu Se - #r Leu Ile Asn Asp Gly# 255- Gln Tyr Tyr Phe Asn Asp Asp Gly Ile Met Gl - #n Val Gly Phe Val Thr# 270- Ile Asn Asp Lys Val Phe Tyr Phe Ser Asp Se - #r Gly Ile Ile Glu Ser# 285- Gly Val Gln Asn Ile Asp Asp Asn Tyr Phe Ty - #r Ile Asp Asp Asn Gly# 300- Ile Val Gln Ile Gly Val Phe Asp Thr Ser As - #p Gly Tyr Lys Tyr Phe305 3 - #10 3 - #15 3 -#20- Ala Pro Ala Asn Thr Val Asn Asp Asn Ile Ty - #r Gly Gln Ala Val Glu# 335- Tyr Ser Gly Leu Val Arg Val Gly Glu Asp Va - #l Tyr Tyr Phe Gly Glu# 350- Thr Tyr Thr Ile Glu Thr Gly Trp Ile Tyr As - #p Met Glu Asn Glu Ser# 365- Asp Lys Tyr Tyr Phe Asn Pro Glu Thr Lys Ly - #s Ala Cys Lys Gly Ile# 380- Asn Leu Ile Asp Asp Ile Lys Tyr Tyr Phe As - #p Glu Lys Gly Ile Met385 3 - #90 3 - #95 4 -#00- Arg Thr Gly Leu Ile Ser Phe Glu Asn Asn As - #n Tyr Tyr Phe Asn Glu# 415- Asn Gly Glu Met Gln Phe Gly Tyr Ile Asn Il - #e Glu Asp Lys Met Phe# 430- Tyr Phe Gly Glu Asp Gly Val Met Gln Ile Gl - #y Val Phe Asn Thr Pro# 445- Asp Gly Phe Lys Tyr Phe Ala His Gln Asn Th - #r Leu Asp Glu Asn Phe# 460- Glu Gly Glu Ser Ile Asn Tyr Thr Gly Trp Le - #u Asp Leu Asp Glu Lys465 4 - #70 4 - #75 4 -#80- Arg Tyr Tyr Phe Thr Asp Glu Tyr Ile Ala Al - #a Thr Gly Ser Val Ile# 495- Ile Asp Gly Glu Glu Tyr Tyr Phe Asp Pro As - #p Thr Ala Gln Leu# 510- (2) INFORMATION FOR SEQ ID NO:21:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 608 amino (B) TYPE: amino acid (C) STRANDEDNESS: unknown (D) TOPOLOGY: unknown- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:21:- Ser Glu Glu Asn Lys Val Ser Gln Val Lys Il - #e Arg Phe Val Asn Val# 15- Phe Lys Asp Lys Thr Leu Ala Asn Lys Leu Se - #r Phe Asn Phe Ser Asp# 30- Lys Gln Asp Val Pro Val Ser Glu Ile Ile Le - #u Ser Phe Thr Pro Ser# 45- Tyr Tyr Glu Asp Gly Leu Ile Gly Tyr Asp Le - #u Gly Leu Val Ser Leu# 60- Tyr Asn Glu Lys Phe Tyr Ile Asn Asn Phe Gl - #y Met Met Val Ser Gly#80- Leu Ile Tyr Ile Asn Asp Ser Leu Tyr Tyr Ph - #e Lys Pro Pro Val Asn# 95- Asn Leu Ile Thr Gly Phe Val Thr Val Gly As - #p Asp Lys Tyr Tyr Phe# 110- Asn Pro Ile Asn Gly Gly Ala Ala Ser Ile Gl - #y Glu Thr Ile Ile Asp# 125- Asp Lys Asn Tyr Tyr Phe Asn Gln Ser Gly Va - #l Leu Gln Thr Gly Val# 140- Phe Ser Thr Glu Asp Gly Phe Lys Tyr Phe Al - #a Pro Ala Asn Thr Leu145 1 - #50 1 - #55 1 -#60- Asp Glu Asn Leu Glu Gly Glu Ala Ile Asp Ph - #e Thr Gly Lys Leu Ile# 175- Ile Asp Glu Asn Ile Tyr Tyr Phe Asp Asp As - #n Tyr Arg Gly Ala Val# 190- Glu Trp Lys Glu Leu Asp Gly Glu Met His Ty - #r Phe Ser Pro Glu Thr# 205- Gly Lys Ala Phe Lys Gly Leu Asn Gln Ile Gl - #y Asp Tyr Lys Tyr Tyr# 220- Phe Asn Ser Asp Gly Val Met Gln Lys Gly Ph - #e Val Ser Ile Asn Asp225 2 - #30 2 - #35 2 -#40- Asn Lys His Tyr Phe Asp Asp Ser Gly Val Me - #t Lys Val Gly Tyr Thr# 255- Glu Ile Asp Gly Lys His Phe Tyr Phe Ala Gl - #u Asn Gly Glu Met Gln# 270- Ile Gly Val Phe Asn Thr Glu Asp Gly Phe Ly - #s Tyr Phe Ala His His# 285- Asn Glu Asp Leu Gly Asn Glu Glu Gly Glu Gl - #u Ile Ser Tyr Ser Gly# 300- Ile Leu Asn Phe Asn Asn Lys Ile Tyr Tyr Ph - #e Asp Asp Ser Phe Thr305 3 - #10 3 - #15 3 -#20- Ala Val Val Gly Trp Lys Asp Leu Glu Asp Gl - #y Ser Lys Tyr Tyr Phe# 335- Asp Glu Asp Thr Ala Glu Ala Tyr Ile Gly Le - #u Ser Leu Ile Asn Asp# 350- Gly Gln Tyr Tyr Phe Asn Asp Asp Gly Ile Me - #t Gln Val Gly Phe Val# 365- Thr Ile Asn Asp Lys Val Phe Tyr Phe Ser As - #p Ser Gly Ile Ile Glu# 380- Ser Gly Val Gln Asn Ile Asp Asp Asn Tyr Ph - #e Tyr Ile Asp Asp Asn385 3 - #90 3 - #95 4 -#00- Gly Ile Val Gln Ile Gly Val Phe Asp Thr Se - #r Asp Gly Tyr Lys Tyr# 415- Phe Ala Pro Ala Asn Thr Val Asn Asp Asn Il - #e Tyr Gly Gln Ala Val# 430- Glu Tyr Ser Gly Leu Val Arg Val Gly Glu As - #p Val Tyr Tyr Phe Gly# 445- Glu Thr Tyr Thr Ile Glu Thr Gly Trp Ile Ty - #r Asp Met Glu Asn Glu# 460- Ser Asp Lys Tyr Tyr Phe Asn Pro Glu Thr Ly - #s Lys Ala Cys Lys Gly465 4 - #70 4 - #75 4 -#80- Ile Asn Leu Ile Asp Asp Ile Lys Tyr Tyr Ph - #e Asp Glu Lys Gly Ile# 495- Met Arg Thr Gly Leu Ile Ser Phe Glu Asn As - #n Asn Tyr Tyr Phe Asn# 510- Glu Asn Gly Glu Met Gln Phe Gly Tyr Ile As - #n Ile Glu Asp Lys Met# 525- Phe Tyr Phe Gly Glu Asp Gly Val Met Gln Il - #e Gly Val Phe Asn Thr# 540- Pro Asp Gly Phe Lys Tyr Phe Ala His Gln As - #n Thr Leu Asp Glu Asn545 5 - #50 5 - #55 5 -#60- Phe Glu Gly Glu Ser Ile Asn Tyr Thr Gly Tr - #p Leu Asp Leu Asp Glu# 575- Lys Arg Tyr Tyr Phe Thr Asp Glu Tyr Ile Al - #a Ala Thr Gly Ser Val# 590- Ile Ile Asp Gly Glu Glu Tyr Tyr Phe Asp Pr - #o Asp Thr Ala Gln Leu# 605- (2) INFORMATION FOR SEQ ID NO:22:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 1330 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 1..1314- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:22:- ATG GCT CGT CTG CTG TCT ACC TTC ACT GAA TA - #C ATC AAG AAC ATC ATC 48Met Ala Arg Leu Leu Ser Thr Phe Thr Glu Ty - #r Ile Lys Asn Ile Ile# 15- AAT ACC TCC ATC CTG AAC CTG CGC TAC GAA TC - #C AAT CAC CTG ATC GAC 96Asn Thr Ser Ile Leu Asn Leu Arg Tyr Glu Se - #r Asn His Leu Ile Asp# 30- CTG TCT CGC TAC GCT TCC AAA ATC AAC ATC GG - #T TCT AAA GTT AAC TTC 144Leu Ser Arg Tyr Ala Ser Lys Ile Asn Ile Gl - #y Ser Lys Val Asn Phe# 45- GAT CCG ATC GAC AAG AAT CAG ATC CAG CTG TT - #C AAT CTG GAA TCT TCC 192Asp Pro Ile Asp Lys Asn Gln Ile Gln Leu Ph - #e Asn Leu Glu Ser Ser# 60- AAA ATC GAA GTT ATC CTG AAG AAT GCT ATC GT - #A TAC AAC TCT ATG TAC 240Lys Ile Glu Val Ile Leu Lys Asn Ala Ile Va - #l Tyr Asn Ser Met Tyr# 80- GAA AAC TTC TCC ACC TCC TTC TGG ATC CGT AT - #C CCG AAA TAC TTC AAC 288Glu Asn Phe Ser Thr Ser Phe Trp Ile Arg Il - #e Pro Lys Tyr Phe Asn# 95- TCC ATC TCT CTG AAC AAT GAA TAC ACC ATC AT - #C AAC TGC ATG GAA AAC 336Ser Ile Ser Leu Asn Asn Glu Tyr Thr Ile Il - #e Asn Cys Met Glu Asn# 110- AAT TCT GGT TGG AAA GTA TCT CTG AAC TAC GG - #T GAA ATC ATC TGG ACT 384Asn Ser Gly Trp Lys Val Ser Leu Asn Tyr Gl - #y Glu Ile Ile Trp Thr# 125- CTG CAG GAC ACT CAG GAA ATC AAA CAG CGT GT - #T GTA TTC AAA TAC TCT 432Leu Gln Asp Thr Gln Glu Ile Lys Gln Arg Va - #l Val Phe Lys Tyr Ser# 140- CAG ATG ATC AAC ATC TCT GAC TAC ATC AAT CG - #C TGG ATC TTC GTT ACC 480Gln Met Ile Asn Ile Ser Asp Tyr Ile Asn Ar - #g Trp Ile Phe Val Thr145 1 - #50 1 - #55 1 -#60- ATC ACC AAC AAT CGT CTG AAT AAC TCC AAA AT - #C TAC ATC AAC GGC CGT 528Ile Thr Asn Asn Arg Leu Asn Asn Ser Lys Il - #e Tyr Ile Asn Gly Arg# 175- CTG ATC GAC CAG AAA CCG ATC TCC AAT CTG GG - #T AAC ATC CAC GCT TCT 576Leu Ile Asp Gln Lys Pro Ile Ser Asn Leu Gl - #y Asn Ile His Ala Ser# 190- AAT AAC ATC ATG TTC AAA CTG GAC GGT TGT CG - #T GAC ACT CAC CGC TAC 624Asn Asn Ile Met Phe Lys Leu Asp Gly Cys Ar - #g Asp Thr His Arg Tyr# 205- ATC TGG ATC AAA TAC TTC AAT CTG TTC GAC AA - #A GAA CTG AAC GAA AAA 672Ile Trp Ile Lys Tyr Phe Asn Leu Phe Asp Ly - #s Glu Leu Asn Glu Lys# 220- GAA ATC AAA GAC CTG TAC GAC AAC CAG TCC AA - #T TCT GGT ATC CTG AAA 720Glu Ile Lys Asp Leu Tyr Asp Asn Gln Ser As - #n Ser Gly Ile Leu Lys225 2 - #30 2 - #35 2 -#40- GAC TTC TGG GGT GAC TAC CTG CAG TAC GAC AA - #A CCG TAC TAC ATG CTG 768Asp Phe Trp Gly Asp Tyr Leu Gln Tyr Asp Ly - #s Pro Tyr Tyr Met Leu# 255- AAT CTG TAC GAT CCG AAC AAA TAC GTT GAC GT - #C AAC AAT GTA GGT ATC 816Asn Leu Tyr Asp Pro Asn Lys Tyr Val Asp Va - #l Asn Asn Val Gly Ile# 270- CGC GGT TAC ATG TAC CTG AAA GGT CCG CGT GG - #T TCT GTT ATG ACT ACC 864Arg Gly Tyr Met Tyr Leu Lys Gly Pro Arg Gl - #y Ser Val Met Thr Thr# 285- AAC ATC TAC CTG AAC TCT TCC CTG TAC CGT GG - #T ACC AAA TTC ATC ATC 912Asn Ile Tyr Leu Asn Ser Ser Leu Tyr Arg Gl - #y Thr Lys Phe Ile Ile# 300- AAG AAA TAC GCG TCT GGT AAC AAG GAC AAT AT - #C GTT CGC AAC AAT GAT 960Lys Lys Tyr Ala Ser Gly Asn Lys Asp Asn Il - #e Val Arg Asn Asn Asp305 3 - #10 3 - #15 3 -#20- CGT GTA TAC ATC AAT GTT GTA GTT AAG AAC AA - #A GAA TAC CGT CTG GCT1008Arg Val Tyr Ile Asn Val Val Val Lys Asn Ly - #s Glu Tyr Arg Leu Ala# 335- ACC AAT GCT TCT CAG GCT GGT GTA GAA AAG AT - #C TTG TCT GCT CTG GAA1056Thr Asn Ala Ser Gln Ala Gly Val Glu Lys Il - #e Leu Ser Ala Leu Glu# 350- ATC CCG GAC GTT GGT AAT CTG TCT CAG GTA GT - #T GTA ATG AAA TCC AAG1104Ile Pro Asp Val Gly Asn Leu Ser Gln Val Va - #l Val Met Lys Ser Lys# 365- AAC GAC CAG GGT ATC ACT AAC AAA TGC AAA AT - #G AAT CTG CAG GAC AAC1152Asn Asp Gln Gly Ile Thr Asn Lys Cys Lys Me - #t Asn Leu Gln Asp Asn# 380- AAT GGT AAC GAT ATC GGT TTC ATC GGT TTC CA - #C CAG TTC AAC AAT ATC1200Asn Gly Asn Asp Ile Gly Phe Ile Gly Phe Hi - #s Gln Phe Asn Asn Ile385 3 - #90 3 - #95 4 -#00- GCT AAA CTG GTT GCT TCC AAC TGG TAC AAT CG - #T CAG ATC GAA CGT TCC1248Ala Lys Leu Val Ala Ser Asn Trp Tyr Asn Ar - #g Gln Ile Glu Arg Ser# 415- TCT CGC ACT CTG GGT TGC TCT TGG GAG TTC AT - #C CCG GTT GAT GAC GGT1296Ser Arg Thr Leu Gly Cys Ser Trp Glu Phe Il - #e Pro Val Asp Asp Gly# 430# 1330 CG CTG TAACCCGGGA AAGCTTTrp Gly Glu Arg Pro Leu 435- (2) INFORMATION FOR SEQ ID NO:23:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 438 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:23:- Met Ala Arg Leu Leu Ser Thr Phe Thr Glu Ty - #r Ile Lys Asn Ile Ile# 15- Asn Thr Ser Ile Leu Asn Leu Arg Tyr Glu Se - #r Asn His Leu Ile Asp# 30- Leu Ser Arg Tyr Ala Ser Lys Ile Asn Ile Gl - #y Ser Lys Val Asn Phe# 45- Asp Pro Ile Asp Lys Asn Gln Ile Gln Leu Ph - #e Asn Leu Glu Ser Ser# 60- Lys Ile Glu Val Ile Leu Lys Asn Ala Ile Va - #l Tyr Asn Ser Met Tyr# 80- Glu Asn Phe Ser Thr Ser Phe Trp Ile Arg Il - #e Pro Lys Tyr Phe Asn# 95- Ser Ile Ser Leu Asn Asn Glu Tyr Thr Ile Il - #e Asn Cys Met Glu Asn# 110- Asn Ser Gly Trp Lys Val Ser Leu Asn Tyr Gl - #y Glu Ile Ile Trp Thr# 125- Leu Gln Asp Thr Gln Glu Ile Lys Gln Arg Va - #l Val Phe Lys Tyr Ser# 140- Gln Met Ile Asn Ile Ser Asp Tyr Ile Asn Ar - #g Trp Ile Phe Val Thr145 1 - #50 1 - #55 1 -#60- Ile Thr Asn Asn Arg Leu Asn Asn Ser Lys Il - #e Tyr Ile Asn Gly Arg# 175- Leu Ile Asp Gln Lys Pro Ile Ser Asn Leu Gl - #y Asn Ile His Ala Ser# 190- Asn Asn Ile Met Phe Lys Leu Asp Gly Cys Ar - #g Asp Thr His Arg Tyr# 205- Ile Trp Ile Lys Tyr Phe Asn Leu Phe Asp Ly - #s Glu Leu Asn Glu Lys# 220- Glu Ile Lys Asp Leu Tyr Asp Asn Gln Ser As - #n Ser Gly Ile Leu Lys225 2 - #30 2 - #35 2 -#40- Asp Phe Trp Gly Asp Tyr Leu Gln Tyr Asp Ly - #s Pro Tyr Tyr Met Leu# 255- Asn Leu Tyr Asp Pro Asn Lys Tyr Val Asp Va - #l Asn Asn Val Gly Ile# 270- Arg Gly Tyr Met Tyr Leu Lys Gly Pro Arg Gl - #y Ser Val Met Thr Thr# 285- Asn Ile Tyr Leu Asn Ser Ser Leu Tyr Arg Gl - #y Thr Lys Phe Ile Ile# 300- Lys Lys Tyr Ala Ser Gly Asn Lys Asp Asn Il - #e Val Arg Asn Asn Asp305 3 - #10 3 - #15 3 -#20- Arg Val Tyr Ile Asn Val Val Val Lys Asn Ly - #s Glu Tyr Arg Leu Ala# 335- Thr Asn Ala Ser Gln Ala Gly Val Glu Lys Il - #e Leu Ser Ala Leu Glu# 350- Ile Pro Asp Val Gly Asn Leu Ser Gln Val Va - #l Val Met Lys Ser Lys# 365- Asn Asp Gln Gly Ile Thr Asn Lys Cys Lys Me - #t Asn Leu Gln Asp Asn# 380- Asn Gly Asn Asp Ile Gly Phe Ile Gly Phe Hi - #s Gln Phe Asn Asn Ile385 3 - #90 3 - #95 4 -#00- Ala Lys Leu Val Ala Ser Asn Trp Tyr Asn Ar - #g Gln Ile Glu Arg Ser# 415- Ser Arg Thr Leu Gly Cys Ser Trp Glu Phe Il - #e Pro Val Asp Asp Gly# 430- Trp Gly Glu Arg Pro Leu 435- (2) INFORMATION FOR SEQ ID NO:24:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 23 amino (B) TYPE: amino acid (C) STRANDEDNESS: unknown (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:24:- Met Gly His His His His His His His His Hi - #s His Ser Ser Gly His# 15- Ile Glu Gly Arg His Met Ala 20- (2) INFORMATION FOR SEQ ID NO:25:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 1402 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 1..1386- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:25:- ATG GGC CAT CAT CAT CAT CAT CAT CAT CAT CA - #T CAC AGC AGC GGC CAT 48Met Gly His His His His His His His His Hi - #s His Ser Ser Gly His# 15- ATC GAA GGT CGT CAT ATG GCT AGC ATG GCT CG - #T CTG CTG TCT ACC TTC 96Ile Glu Gly Arg His Met Ala Ser Met Ala Ar - #g Leu Leu Ser Thr Phe# 30- ACT GAA TAC ATC AAG AAC ATC ATC AAT ACC TC - #C ATC CTG AAC CTG CGC 144Thr Glu Tyr Ile Lys Asn Ile Ile Asn Thr Se - #r Ile Leu Asn Leu Arg# 45- TAC GAA TCC AAT CAC CTG ATC GAC CTG TCT CG - #C TAC GCT TCC AAA ATC 192Tyr Glu Ser Asn His Leu Ile Asp Leu Ser Ar - #g Tyr Ala Ser Lys Ile# 60- AAC ATC GGT TCT AAA GTT AAC TTC GAT CCG AT - #C GAC AAG AAT CAG ATC 240Asn Ile Gly Ser Lys Val Asn Phe Asp Pro Il - #e Asp Lys Asn Gln Ile# 80- CAG CTG TTC AAT CTG GAA TCT TCC AAA ATC GA - #A GTT ATC CTG AAG AAT 288Gln Leu Phe Asn Leu Glu Ser Ser Lys Ile Gl - #u Val Ile Leu Lys Asn# 95- GCT ATC GTA TAC AAC TCT ATG TAC GAA AAC TT - #C TCC ACC TCC TTC TGG 336Ala Ile Val Tyr Asn Ser Met Tyr Glu Asn Ph - #e Ser Thr Ser Phe Trp# 110- ATC CGT ATC CCG AAA TAC TTC AAC TCC ATC TC - #T CTG AAC AAT GAA TAC 384Ile Arg Ile Pro Lys Tyr Phe Asn Ser Ile Se - #r Leu Asn Asn Glu Tyr# 125- ACC ATC ATC AAC TGC ATG GAA AAC AAT TCT GG - #T TGG AAA GTA TCT CTG 432Thr Ile Ile Asn Cys Met Glu Asn Asn Ser Gl - #y Trp Lys Val Ser Leu# 140- AAC TAC GGT GAA ATC ATC TGG ACT CTG CAG GA - #C ACT CAG GAA ATC AAA 480Asn Tyr Gly Glu Ile Ile Trp Thr Leu Gln As - #p Thr Gln Glu Ile Lys145 1 - #50 1 - #55 1 -#60- CAG CGT GTT GTA TTC AAA TAC TCT CAG ATG AT - #C AAC ATC TCT GAC TAC 528Gln Arg Val Val Phe Lys Tyr Ser Gln Met Il - #e Asn Ile Ser Asp Tyr# 175- ATC AAT CGC TGG ATC TTC GTT ACC ATC ACC AA - #C AAT CGT CTG AAT AAC 576Ile Asn Arg Trp Ile Phe Val Thr Ile Thr As - #n Asn Arg Leu Asn Asn# 190- TCC AAA ATC TAC ATC AAC GGC CGT CTG ATC GA - #C CAG AAA CCG ATC TCC 624Ser Lys Ile Tyr Ile Asn Gly Arg Leu Ile As - #p Gln Lys Pro Ile Ser# 205- AAT CTG GGT AAC ATC CAC GCT TCT AAT AAC AT - #C ATG TTC AAA CTG GAC 672Asn Leu Gly Asn Ile His Ala Ser Asn Asn Il - #e Met Phe Lys Leu Asp# 220- GGT TGT CGT GAC ACT CAC CGC TAC ATC TGG AT - #C AAA TAC TTC AAT CTG 720Gly Cys Arg Asp Thr His Arg Tyr Ile Trp Il - #e Lys Tyr Phe Asn Leu225 2 - #30 2 - #35 2 -#40- TTC GAC AAA GAA CTG AAC GAA AAA GAA ATC AA - #A GAC CTG TAC GAC AAC 768Phe Asp Lys Glu Leu Asn Glu Lys Glu Ile Ly - #s Asp Leu Tyr Asp Asn# 255- CAG TCC AAT TCT GGT ATC CTG AAA GAC TTC TG - #G GGT GAC TAC CTG CAG 816Gln Ser Asn Ser Gly Ile Leu Lys Asp Phe Tr - #p Gly Asp Tyr Leu Gln# 270- TAC GAC AAA CCG TAC TAC ATG CTG AAT CTG TA - #C GAT CCG AAC AAA TAC 864Tyr Asp Lys Pro Tyr Tyr Met Leu Asn Leu Ty - #r Asp Pro Asn Lys Tyr# 285- GTT GAC GTC AAC AAT GTA GGT ATC CGC GGT TA - #C ATG TAC CTG AAA GGT 912Val Asp Val Asn Asn Val Gly Ile Arg Gly Ty - #r Met Tyr Leu Lys Gly# 300- CCG CGT GGT TCT GTT ATG ACT ACC AAC ATC TA - #C CTG AAC TCT TCC CTG 960Pro Arg Gly Ser Val Met Thr Thr Asn Ile Ty - #r Leu Asn Ser Ser Leu305 3 - #10 3 - #15 3 -#20- TAC CGT GGT ACC AAA TTC ATC ATC AAG AAA TA - #C GCG TCT GGT AAC AAG1008Tyr Arg Gly Thr Lys Phe Ile Ile Lys Lys Ty - #r Ala Ser Gly Asn Lys# 335- GAC AAT ATC GTT CGC AAC AAT GAT CGT GTA TA - #C ATC AAT GTT GTA GTT1056Asp Asn Ile Val Arg Asn Asn Asp Arg Val Ty - #r Ile Asn Val Val Val# 350- AAG AAC AAA GAA TAC CGT CTG GCT ACC AAT GC - #T TCT CAG GCT GGT GTA1104Lys Asn Lys Glu Tyr Arg Leu Ala Thr Asn Al - #a Ser Gln Ala Gly Val# 365- GAA AAG ATC TTG TCT GCT CTG GAA ATC CCG GA - #C GTT GGT AAT CTG TCT1152Glu Lys Ile Leu Ser Ala Leu Glu Ile Pro As - #p Val Gly Asn Leu Ser# 380- CAG GTA GTT GTA ATG AAA TCC AAG AAC GAC CA - #G GGT ATC ACT AAC AAA1200Gln Val Val Val Met Lys Ser Lys Asn Asp Gl - #n Gly Ile Thr Asn Lys385 3 - #90 3 - #95 4 -#00- TGC AAA ATG AAT CTG CAG GAC AAC AAT GGT AA - #C GAT ATC GGT TTC ATC1248Cys Lys Met Asn Leu Gln Asp Asn Asn Gly As - #n Asp Ile Gly Phe Ile# 415- GGT TTC CAC CAG TTC AAC AAT ATC GCT AAA CT - #G GTT GCT TCC AAC TGG1296Gly Phe His Gln Phe Asn Asn Ile Ala Lys Le - #u Val Ala Ser Asn Trp# 430- TAC AAT CGT CAG ATC GAA CGT TCC TCT CGC AC - #T CTG GGT TGC TCT TGG1344Tyr Asn Arg Gln Ile Glu Arg Ser Ser Arg Th - #r Leu Gly Cys Ser Trp# 445- GAG TTC ATC CCG GTT GAT GAC GGT TGG GGT GA - #A CGT CCG CTG#1386Glu Phe Ile Pro Val Asp Asp Gly Trp Gly Gl - #u Arg Pro Leu# 460# 1402- (2) INFORMATION FOR SEQ ID NO:26:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 462 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:26:- Met Gly His His His His His His His His Hi - #s His Ser Ser Gly His# 15- Ile Glu Gly Arg His Met Ala Ser Met Ala Ar - #g Leu Leu Ser Thr Phe# 30- Thr Glu Tyr Ile Lys Asn Ile Ile Asn Thr Se - #r Ile Leu Asn Leu Arg# 45- Tyr Glu Ser Asn His Leu Ile Asp Leu Ser Ar - #g Tyr Ala Ser Lys Ile# 60- Asn Ile Gly Ser Lys Val Asn Phe Asp Pro Il - #e Asp Lys Asn Gln Ile# 80- Gln Leu Phe Asn Leu Glu Ser Ser Lys Ile Gl - #u Val Ile Leu Lys Asn# 95- Ala Ile Val Tyr Asn Ser Met Tyr Glu Asn Ph - #e Ser Thr Ser Phe Trp# 110- Ile Arg Ile Pro Lys Tyr Phe Asn Ser Ile Se - #r Leu Asn Asn Glu Tyr# 125- Thr Ile Ile Asn Cys Met Glu Asn Asn Ser Gl - #y Trp Lys Val Ser Leu# 140- Asn Tyr Gly Glu Ile Ile Trp Thr Leu Gln As - #p Thr Gln Glu Ile Lys145 1 - #50 1 - #55 1 -#60- Gln Arg Val Val Phe Lys Tyr Ser Gln Met Il - #e Asn Ile Ser Asp Tyr# 175- Ile Asn Arg Trp Ile Phe Val Thr Ile Thr As - #n Asn Arg Leu Asn Asn# 190- Ser Lys Ile Tyr Ile Asn Gly Arg Leu Ile As - #p Gln Lys Pro Ile Ser# 205- Asn Leu Gly Asn Ile His Ala Ser Asn Asn Il - #e Met Phe Lys Leu Asp# 220- Gly Cys Arg Asp Thr His Arg Tyr Ile Trp Il - #e Lys Tyr Phe Asn Leu225 2 - #30 2 - #35 2 -#40- Phe Asp Lys Glu Leu Asn Glu Lys Glu Ile Ly - #s Asp Leu Tyr Asp Asn# 255- Gln Ser Asn Ser Gly Ile Leu Lys Asp Phe Tr - #p Gly Asp Tyr Leu Gln# 270- Tyr Asp Lys Pro Tyr Tyr Met Leu Asn Leu Ty - #r Asp Pro Asn Lys Tyr# 285- Val Asp Val Asn Asn Val Gly Ile Arg Gly Ty - #r Met Tyr Leu Lys Gly# 300- Pro Arg Gly Ser Val Met Thr Thr Asn Ile Ty - #r Leu Asn Ser Ser Leu305 3 - #10 3 - #15 3 -#20- Tyr Arg Gly Thr Lys Phe Ile Ile Lys Lys Ty - #r Ala Ser Gly Asn Lys# 335- Asp Asn Ile Val Arg Asn Asn Asp Arg Val Ty - #r Ile Asn Val Val Val# 350- Lys Asn Lys Glu Tyr Arg Leu Ala Thr Asn Al - #a Ser Gln Ala Gly Val# 365- Glu Lys Ile Leu Ser Ala Leu Glu Ile Pro As - #p Val Gly Asn Leu Ser# 380- Gln Val Val Val Met Lys Ser Lys Asn Asp Gl - #n Gly Ile Thr Asn Lys385 3 - #90 3 - #95 4 -#00- Cys Lys Met Asn Leu Gln Asp Asn Asn Gly As - #n Asp Ile Gly Phe Ile# 415- Gly Phe His Gln Phe Asn Asn Ile Ala Lys Le - #u Val Ala Ser Asn Trp# 430- Tyr Asn Arg Gln Ile Glu Arg Ser Ser Arg Th - #r Leu Gly Cys Ser Trp# 445- Glu Phe Ile Pro Val Asp Asp Gly Trp Gly Gl - #u Arg Pro Leu# 460- (2) INFORMATION FOR SEQ ID NO:27:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 3891 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 1..3888- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:27:- ATG CAA TTT GTT AAT AAA CAA TTT AAT TAT AA - #A GAT CCT GTA AAT GGT 48Met Gln Phe Val Asn Lys Gln Phe Asn Tyr Ly - #s Asp Pro Val Asn Gly# 15- GTT GAT ATT GCT TAT ATA AAA ATT CCA AAT GT - #A GGA CAA ATG CAA CCA 96Val Asp Ile Ala Tyr Ile Lys Ile Pro Asn Va - #l Gly Gln Met Gln Pro# 30- GTA AAA GCT TTT AAA ATT CAT AAT AAA ATA TG - #G GTT ATT CCA GAA AGA 144Val Lys Ala Phe Lys Ile His Asn Lys Ile Tr - #p Val Ile Pro Glu Arg# 45- GAT ACA TTT ACA AAT CCT GAA GAA GGA GAT TT - #A AAT CCA CCA CCA GAA 192Asp Thr Phe Thr Asn Pro Glu Glu Gly Asp Le - #u Asn Pro Pro Pro Glu# 60- GCA AAA CAA GTT CCA GTT TCA TAT TAT GAT TC - #A ACA TAT TTA AGT ACA 240Ala Lys Gln Val Pro Val Ser Tyr Tyr Asp Se - #r Thr Tyr Leu Ser Thr# 80- GAT AAT GAA AAA GAT AAT TAT TTA AAG GGA GT - #T ACA AAA TTA TTT GAG 288Asp Asn Glu Lys Asp Asn Tyr Leu Lys Gly Va - #l Thr Lys Leu Phe Glu# 95- AGA ATT TAT TCA ACT GAT CTT GGA AGA ATG TT - #G TTA ACA TCA ATA GTA 336Arg Ile Tyr Ser Thr Asp Leu Gly Arg Met Le - #u Leu Thr Ser Ile Val# 110- AGG GGA ATA CCA TTT TGG GGT GGA AGT ACA AT - #A GAT ACA GAA TTA AAA 384Arg Gly Ile Pro Phe Trp Gly Gly Ser Thr Il - #e Asp Thr Glu Leu Lys# 125- GTT ATT GAT ACT AAT TGT ATT AAT GTG ATA CA - #A CCA GAT GGT AGT TAT 432Val Ile Asp Thr Asn Cys Ile Asn Val Ile Gl - #n Pro Asp Gly Ser Tyr# 140- AGA TCA GAA GAA CTT AAT CTA GTA ATA ATA GG - #A CCC TCA GCT GAT ATT 480Arg Ser Glu Glu Leu Asn Leu Val Ile Ile Gl - #y Pro Ser Ala Asp Ile145 1 - #50 1 - #55 1 -#60- ATA CAG TTT GAA TGT AAA AGC TTT GGA CAT GA - #A GTT TTG AAT CTT ACG 528Ile Gln Phe Glu Cys Lys Ser Phe Gly His Gl - #u Val Leu Asn Leu Thr# 175- CGA AAT GGT TAT GGC TCT ACT CAA TAC ATT AG - #A TTT AGC CCA GAT TTT 576Arg Asn Gly Tyr Gly Ser Thr Gln Tyr Ile Ar - #g Phe Ser Pro Asp Phe# 190- ACA TTT GGT TTT GAG GAG TCA CTT GAA GTT GA - #T ACA AAT CCT CTT TTA 624Thr Phe Gly Phe Glu Glu Ser Leu Glu Val As - #p Thr Asn Pro Leu Leu# 205- GGT GCA GGC AAA TTT GCT ACA GAT CCA GCA GT - #A ACA TTA GCA CAT GAA 672Gly Ala Gly Lys Phe Ala Thr Asp Pro Ala Va - #l Thr Leu Ala His Glu# 220- CTT ATA CAT GCT GGA CAT AGA TTA TAT GGA AT - #A GCA ATT AAT CCA AAT 720Leu Ile His Ala Gly His Arg Leu Tyr Gly Il - #e Ala Ile Asn Pro Asn225 2 - #30 2 - #35 2 -#40- AGG GTT TTT AAA GTA AAT ACT AAT GCC TAT TA - #T GAA ATG AGT GGG TTA 768Arg Val Phe Lys Val Asn Thr Asn Ala Tyr Ty - #r Glu Met Ser Gly Leu# 255- GAA GTA AGC TTT GAG GAA CTT AGA ACA TTT GG - #G GGA CAT GAT GCA AAG 816Glu Val Ser Phe Glu Glu Leu Arg Thr Phe Gl - #y Gly His Asp Ala Lys# 270- TTT ATA GAT AGT TTA CAG GAA AAC GAA TTT CG - #T CTA TAT TAT TAT AAT 864Phe Ile Asp Ser Leu Gln Glu Asn Glu Phe Ar - #g Leu Tyr Tyr Tyr Asn# 285- AAG TTT AAA GAT ATA GCA AGT ACA CTT AAT AA - #A GCT AAA TCA ATA GTA 912Lys Phe Lys Asp Ile Ala Ser Thr Leu Asn Ly - #s Ala Lys Ser Ile Val# 300- GGT ACT ACT GCT TCA TTA CAG TAT ATG AAA AA - #T GTT TTT AAA GAG AAA 960Gly Thr Thr Ala Ser Leu Gln Tyr Met Lys As - #n Val Phe Lys Glu Lys305 3 - #10 3 - #15 3 -#20- TAT CTC CTA TCT GAA GAT ACA TCT GGA AAA TT - #T TCG GTA GAT AAA TTA1008Tyr Leu Leu Ser Glu Asp Thr Ser Gly Lys Ph - #e Ser Val Asp Lys Leu# 335- AAA TTT GAT AAG TTA TAC AAA ATG TTA ACA GA - #G ATT TAC ACA GAG GAT1056Lys Phe Asp Lys Leu Tyr Lys Met Leu Thr Gl - #u Ile Tyr Thr Glu Asp# 350- AAT TTT GTT AAG TTT TTT AAA GTA CTT AAC AG - #A AAA ACA TAT TTG AAT1104Asn Phe Val Lys Phe Phe Lys Val Leu Asn Ar - #g Lys Thr Tyr Leu Asn# 365- TTT GAT AAA GCC GTA TTT AAG ATA AAT ATA GT - #A CCT AAG GTA AAT TAC1152Phe Asp Lys Ala Val Phe Lys Ile Asn Ile Va - #l Pro Lys Val Asn Tyr# 380- ACA ATA TAT GAT GGA TTT AAT TTA AGA AAT AC - #A AAT TTA GCA GCA AAC1200Thr Ile Tyr Asp Gly Phe Asn Leu Arg Asn Th - #r Asn Leu Ala Ala Asn385 3 - #90 3 - #95 4 -#00- TTT AAT GGT CAA AAT ACA GAA ATT AAT AAT AT - #G AAT TTT ACT AAA CTA1248Phe Asn Gly Gln Asn Thr Glu Ile Asn Asn Me - #t Asn Phe Thr Lys Leu# 415- AAA AAT TTT ACT GGA TTG TTT GAA TTT TAT AA - #G TTG CTA TGT GTA AGA1296Lys Asn Phe Thr Gly Leu Phe Glu Phe Tyr Ly - #s Leu Leu Cys Val Arg# 430- GGG ATA ATA ACT TCT AAA ACT AAA TCA TTA GA - #T AAA GGA TAC AAT AAG1344Gly Ile Ile Thr Ser Lys Thr Lys Ser Leu As - #p Lys Gly Tyr Asn Lys# 445- GCA TTA AAT GAT TTA TGT ATC AAA GTT AAT AA - #T TGG GAC TTG TTT TTT1392Ala Leu Asn Asp Leu Cys Ile Lys Val Asn As - #n Trp Asp Leu Phe Phe# 460- AGT CCT TCA GAA GAT AAT TTT ACT AAT GAT CT - #A AAT AAA GGA GAA GAA1440Ser Pro Ser Glu Asp Asn Phe Thr Asn Asp Le - #u Asn Lys Gly Glu Glu465 4 - #70 4 - #75 4 -#80- ATT ACA TCT GAT ACT AAT ATA GAA GCA GCA GA - #A GAA AAT ATT AGT TTA1488Ile Thr Ser Asp Thr Asn Ile Glu Ala Ala Gl - #u Glu Asn Ile Ser Leu# 495- GAT TTA ATA CAA CAA TAT TAT TTA ACC TTT AA - #T TTT GAT AAT GAA CCT1536Asp Leu Ile Gln Gln Tyr Tyr Leu Thr Phe As - #n Phe Asp Asn Glu Pro# 510- GAA AAT ATT TCA ATA GAA AAT CTT TCA AGT GA - #C ATT ATA GGC CAA TTA1584Glu Asn Ile Ser Ile Glu Asn Leu Ser Ser As - #p Ile Ile Gly Gln Leu# 525- GAA CTT ATG CCT AAT ATA GAA AGA TTT CCT AA - #T GGA AAA AAG TAT GAG1632Glu Leu Met Pro Asn Ile Glu Arg Phe Pro As - #n Gly Lys Lys Tyr Glu# 540- TTA GAT AAA TAT ACT ATG TTC CAT TAT CTT CG - #T GCT CAA GAA TTT GAA1680Leu Asp Lys Tyr Thr Met Phe His Tyr Leu Ar - #g Ala Gln Glu Phe Glu545 5 - #50 5 - #55 5 -#60- CAT GGT AAA TCT AGG ATT GCT TTA ACA AAT TC - #T GTT AAC GAA GCA TTA1728His Gly Lys Ser Arg Ile Ala Leu Thr Asn Se - #r Val Asn Glu Ala Leu# 575- TTA AAT CCT AGT CGT GTT TAT ACA TTT TTT TC - #T TCA GAC TAT GTA AAG1776Leu Asn Pro Ser Arg Val Tyr Thr Phe Phe Se - #r Ser Asp Tyr Val Lys# 590- AAA GTT AAT AAA GCT ACG GAG GCA GCT ATG TT - #T TTA GGC TGG GTA GAA1824Lys Val Asn Lys Ala Thr Glu Ala Ala Met Ph - #e Leu Gly Trp Val Glu# 605- CAA TTA GTA TAT GAT TTT ACC GAT GAA ACT AG - #C GAA GTA AGT ACT ACG1872Gln Leu Val Tyr Asp Phe Thr Asp Glu Thr Se - #r Glu Val Ser Thr Thr# 620- GAT AAA ATT GCG GAT ATA ACT ATA ATT ATT CC - #A TAT ATA GGA CCT GCT1920Asp Lys Ile Ala Asp Ile Thr Ile Ile Ile Pr - #o Tyr Ile Gly Pro Ala625 6 - #30 6 - #35 6 -#40- TTA AAT ATA GGT AAT ATG TTA TAT AAA GAT GA - #T TTT GTA GGT GCT TTA1968Leu Asn Ile Gly Asn Met Leu Tyr Lys Asp As - #p Phe Val Gly Ala Leu# 655- ATA TTT TCA GGA GCT GTT ATT CTG TTA GAA TT - #T ATA CCA GAG ATT GCA2016Ile Phe Ser Gly Ala Val Ile Leu Leu Glu Ph - #e Ile Pro Glu Ile Ala# 670- ATA CCT GTA TTA GGT ACT TTT GCA CTT GTA TC - #A TAT ATT GCG AAT AAG2064Ile Pro Val Leu Gly Thr Phe Ala Leu Val Se - #r Tyr Ile Ala Asn Lys# 685- GTT CTA ACC GTT CAA ACA ATA GAT AAT GCT TT - #A AGT AAA AGA AAT GAA2112Val Leu Thr Val Gln Thr Ile Asp Asn Ala Le - #u Ser Lys Arg Asn Glu# 700- AAA TGG GAT GAG GTC TAT AAA TAT ATA GTA AC - #A AAT TGG TTA GCA AAG2160Lys Trp Asp Glu Val Tyr Lys Tyr Ile Val Th - #r Asn Trp Leu Ala Lys705 7 - #10 7 - #15 7 -#20- GTT AAT ACA CAG ATT GAT CTA ATA AGA AAA AA - #A ATG AAA GAA GCT TTA2208Val Asn Thr Gln Ile Asp Leu Ile Arg Lys Ly - #s Met Lys Glu Ala Leu# 735- GAA AAT CAA GCA GAA GCA ACA AAG GCT ATA AT - #A AAC TAT CAG TAT AAT2256Glu Asn Gln Ala Glu Ala Thr Lys Ala Ile Il - #e Asn Tyr Gln Tyr Asn# 750- CAA TAT ACT GAG GAA GAG AAA AAT AAT ATT AA - #T TTT AAT ATT GAT GAT2304Gln Tyr Thr Glu Glu Glu Lys Asn Asn Ile As - #n Phe Asn Ile Asp Asp# 765- TTA AGT TCG AAA CTT AAT GAG TCT ATA AAT AA - #A GCT ATG ATT AAT ATA2352Leu Ser Ser Lys Leu Asn Glu Ser Ile Asn Ly - #s Ala Met Ile Asn Ile# 780- AAT AAA TTT TTG AAT CAA TGC TCT GTT TCA TA - #T TTA ATG AAT TCT ATG2400Asn Lys Phe Leu Asn Gln Cys Ser Val Ser Ty - #r Leu Met Asn Ser Met785 7 - #90 7 - #95 8 -#00- ATC CCT TAT GGT GTT AAA CGG TTA GAA GAT TT - #T GAT GCT AGT CTT AAA2448Ile Pro Tyr Gly Val Lys Arg Leu Glu Asp Ph - #e Asp Ala Ser Leu Lys# 815- GAT GCA TTA TTA AAG TAT ATA TAT GAT AAT AG - #A GGA ACT TTA ATT GGT2496Asp Ala Leu Leu Lys Tyr Ile Tyr Asp Asn Ar - #g Gly Thr Leu Ile Gly# 830- CAA GTA GAT AGA TTA AAA GAT AAA GTT AAT AA - #T ACA CTT AGT ACA GAT2544Gln Val Asp Arg Leu Lys Asp Lys Val Asn As - #n Thr Leu Ser Thr Asp# 845- ATA CCT TTT CAG CTT TCC AAA TAC GTA GAT AA - #T CAA AGA TTA TTA TCT2592Ile Pro Phe Gln Leu Ser Lys Tyr Val Asp As - #n Gln Arg Leu Leu Ser# 860- ACA TTT ACT GAA TAT ATT AAG AAT ATT ATT AA - #T ACT TCT ATA TTG AAT2640Thr Phe Thr Glu Tyr Ile Lys Asn Ile Ile As - #n Thr Ser Ile Leu Asn865 8 - #70 8 - #75 8 -#80- TTA AGA TAT GAA AGT AAT CAT TTA ATA GAC TT - #A TCT AGG TAT GCA TCA2688Leu Arg Tyr Glu Ser Asn His Leu Ile Asp Le - #u Ser Arg Tyr Ala Ser# 895- AAA ATA AAT ATT GGT AGT AAA GTA AAT TTT GA - #T CCA ATA GAT AAA AAT2736Lys Ile Asn Ile Gly Ser Lys Val Asn Phe As - #p Pro Ile Asp Lys Asn# 910- CAA ATT CAA TTA TTT AAT TTA GAA AGT AGT AA - #A ATT GAG GTA ATT TTA2784Gln Ile Gln Leu Phe Asn Leu Glu Ser Ser Ly - #s Ile Glu Val Ile Leu# 925- AAA AAT GCT ATT GTA TAT AAT AGT ATG TAT GA - #A AAT TTT AGT ACT AGC2832Lys Asn Ala Ile Val Tyr Asn Ser Met Tyr Gl - #u Asn Phe Ser Thr Ser# 940- TTT TGG ATA AGA ATT CCT AAG TAT TTT AAC AG - #T ATA AGT CTA AAT AAT2880Phe Trp Ile Arg Ile Pro Lys Tyr Phe Asn Se - #r Ile Ser Leu Asn Asn945 9 - #50 9 - #55 9 -#60- GAA TAT ACA ATA ATA AAT TGT ATG GAA AAT AA - #T TCA GGA TGG AAA GTA2928Glu Tyr Thr Ile Ile Asn Cys Met Glu Asn As - #n Ser Gly Trp Lys Val# 975- TCA CTT AAT TAT GGT GAA ATA ATC TGG ACT TT - #A CAG GAT ACT CAG GAA2976Ser Leu Asn Tyr Gly Glu Ile Ile Trp Thr Le - #u Gln Asp Thr Gln Glu# 990- ATA AAA CAA AGA GTA GTT TTT AAA TAC AGT CA - #A ATG ATT AAT ATA TCA3024Ile Lys Gln Arg Val Val Phe Lys Tyr Ser Gl - #n Met Ile Asn Ile Ser# 10050- GAT TAT ATA AAC AGA TGG ATT TTT GTA ACT AT - #C ACT AAT AAT AGA TTA3072Asp Tyr Ile Asn Arg Trp Ile Phe Val Thr Il - #e Thr Asn Asn Arg Leu# 10205- AAT AAC TCT AAA ATT TAT ATA AAT GGA AGA TT - #A ATA GAT CAA AAA CCA3120Asn Asn Ser Lys Ile Tyr Ile Asn Gly Arg Le - #u Ile Asp Gln Lys Pro# 10401030 - # 1035- ATT TCA AAT TTA GGT AAT ATT CAT GCT AGT AA - #T AAT ATA ATG TTT AAA3168Ile Ser Asn Leu Gly Asn Ile His Ala Ser As - #n Asn Ile Met Phe Lys# 10550- TTA GAT GGT TGT AGA GAT ACA CAT AGA TAT AT - #T TGG ATA AAA TAT TTT3216Leu Asp Gly Cys Arg Asp Thr His Arg Tyr Il - #e Trp Ile Lys Tyr Phe# 10705- AAT CTT TTT GAT AAG GAA TTA AAT GAA AAA GA - #A ATC AAA GAT TTA TAT3264Asn Leu Phe Asp Lys Glu Leu Asn Glu Lys Gl - #u Ile Lys Asp Leu Tyr# 10850- GAT AAT CAA TCA AAT TCA GGT ATT TTA AAA GA - #C TTT TGG GGT GAT TAT3312Asp Asn Gln Ser Asn Ser Gly Ile Leu Lys As - #p Phe Trp Gly Asp Tyr# 11005- TTA CAA TAT GAT AAA CCA TAC TAT ATG TTA AA - #T TTA TAT GAT CCA AAT3360Leu Gln Tyr Asp Lys Pro Tyr Tyr Met Leu As - #n Leu Tyr Asp Pro Asn# 11201110 - # 1115- AAA TAT GTC GAT GTA AAT AAT GTA GGT ATT AG - #A GGT TAT ATG TAT CTT3408Lys Tyr Val Asp Val Asn Asn Val Gly Ile Ar - #g Gly Tyr Met Tyr Leu# 11350- AAA GGG CCT AGA GGT AGC GTA ATG ACT ACA AA - #C ATT TAT TTA AAT TCA3456Lys Gly Pro Arg Gly Ser Val Met Thr Thr As - #n Ile Tyr Leu Asn Ser# 11505- AGT TTG TAT AGG GGG ACA AAA TTT ATT ATA AA - #A AAA TAT GCT TCT GGA3504Ser Leu Tyr Arg Gly Thr Lys Phe Ile Ile Ly - #s Lys Tyr Ala Ser Gly# 11650- AAT AAA GAT AAT ATT GTT AGA AAT AAT GAT CG - #T GTA TAT ATT AAT GTA3552Asn Lys Asp Asn Ile Val Arg Asn Asn Asp Ar - #g Val Tyr Ile Asn Val# 11805- GTA GTT AAA AAT AAA GAA TAT AGG TTA GCT AC - #T AAT GCA TCA CAG GCA3600Val Val Lys Asn Lys Glu Tyr Arg Leu Ala Th - #r Asn Ala Ser Gln Ala# 12001190 - # 1195- GGC GTA GAA AAA ATA CTA AGT GCA TTA GAA AT - #A CCT GAT GTA GGA AAT3648Gly Val Glu Lys Ile Leu Ser Ala Leu Glu Il - #e Pro Asp Val Gly Asn# 12150- CTA AGT CAA GTA GTA GTA ATG AAG TCA AAA AA - #T GAT CAA GGA ATA ACA3696Leu Ser Gln Val Val Val Met Lys Ser Lys As - #n Asp Gln Gly Ile Thr# 12305- AAT AAA TGC AAA ATG AAT TTA CAA GAT AAT AA - #T GGG AAT GAT ATA GGC3744Asn Lys Cys Lys Met Asn Leu Gln Asp Asn As - #n Gly Asn Asp Ile Gly# 12450- TTT ATA GGA TTT CAT CAG TTT AAT AAT ATA GC - #T AAA CTA GTA GCA AGT3792Phe Ile Gly Phe His Gln Phe Asn Asn Ile Al - #a Lys Leu Val Ala Ser# 12605- AAT TGG TAT AAT AGA CAA ATA GAA AGA TCT AG - #T AGG ACT TTG GGT TGC3840Asn Trp Tyr Asn Arg Gln Ile Glu Arg Ser Se - #r Arg Thr Leu Gly Cys# 12801270 - # 1275- TCA TGG GAA TTT ATT CCT GTA GAT GAT GGA TG - #G GGA GAA AGG CCA CTG3888Ser Trp Glu Phe Ile Pro Val Asp Asp Gly Tr - #p Gly Glu Arg Pro Leu# 12950# 3891- (2) INFORMATION FOR SEQ ID NO:28:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 1296 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:28:- Met Gln Phe Val Asn Lys Gln Phe Asn Tyr Ly - #s Asp Pro Val Asn Gly# 15- Val Asp Ile Ala Tyr Ile Lys Ile Pro Asn Va - #l Gly Gln Met Gln Pro# 30- Val Lys Ala Phe Lys Ile His Asn Lys Ile Tr - #p Val Ile Pro Glu Arg# 45- Asp Thr Phe Thr Asn Pro Glu Glu Gly Asp Le - #u Asn Pro Pro Pro Glu# 60- Ala Lys Gln Val Pro Val Ser Tyr Tyr Asp Se - #r Thr Tyr Leu Ser Thr# 80- Asp Asn Glu Lys Asp Asn Tyr Leu Lys Gly Va - #l Thr Lys Leu Phe Glu# 95- Arg Ile Tyr Ser Thr Asp Leu Gly Arg Met Le - #u Leu Thr Ser Ile Val# 110- Arg Gly Ile Pro Phe Trp Gly Gly Ser Thr Il - #e Asp Thr Glu Leu Lys# 125- Val Ile Asp Thr Asn Cys Ile Asn Val Ile Gl - #n Pro Asp Gly Ser Tyr# 140- Arg Ser Glu Glu Leu Asn Leu Val Ile Ile Gl - #y Pro Ser Ala Asp Ile145 1 - #50 1 - #55 1 -#60- Ile Gln Phe Glu Cys Lys Ser Phe Gly His Gl - #u Val Leu Asn Leu Thr# 175- Arg Asn Gly Tyr Gly Ser Thr Gln Tyr Ile Ar - #g Phe Ser Pro Asp Phe# 190- Thr Phe Gly Phe Glu Glu Ser Leu Glu Val As - #p Thr Asn Pro Leu Leu# 205- Gly Ala Gly Lys Phe Ala Thr Asp Pro Ala Va - #l Thr Leu Ala His Glu# 220- Leu Ile His Ala Gly His Arg Leu Tyr Gly Il - #e Ala Ile Asn Pro Asn225 2 - #30 2 - #35 2 -#40- Arg Val Phe Lys Val Asn Thr Asn Ala Tyr Ty - #r Glu Met Ser Gly Leu# 255- Glu Val Ser Phe Glu Glu Leu Arg Thr Phe Gl - #y Gly His Asp Ala Lys# 270- Phe Ile Asp Ser Leu Gln Glu Asn Glu Phe Ar - #g Leu Tyr Tyr Tyr Asn# 285- Lys Phe Lys Asp Ile Ala Ser Thr Leu Asn Ly - #s Ala Lys Ser Ile Val# 300- Gly Thr Thr Ala Ser Leu Gln Tyr Met Lys As - #n Val Phe Lys Glu Lys305 3 - #10 3 - #15 3 -#20- Tyr Leu Leu Ser Glu Asp Thr Ser Gly Lys Ph - #e Ser Val Asp Lys Leu# 335- Lys Phe Asp Lys Leu Tyr Lys Met Leu Thr Gl - #u Ile Tyr Thr Glu Asp# 350- Asn Phe Val Lys Phe Phe Lys Val Leu Asn Ar - #g Lys Thr Tyr Leu Asn# 365- Phe Asp Lys Ala Val Phe Lys Ile Asn Ile Va - #l Pro Lys Val Asn Tyr# 380- Thr Ile Tyr Asp Gly Phe Asn Leu Arg Asn Th - #r Asn Leu Ala Ala Asn385 3 - #90 3 - #95 4 -#00- Phe Asn Gly Gln Asn Thr Glu Ile Asn Asn Me - #t Asn Phe Thr Lys Leu# 415- Lys Asn Phe Thr Gly Leu Phe Glu Phe Tyr Ly - #s Leu Leu Cys Val Arg# 430- Gly Ile Ile Thr Ser Lys Thr Lys Ser Leu As - #p Lys Gly Tyr Asn Lys# 445- Ala Leu Asn Asp Leu Cys Ile Lys Val Asn As - #n Trp Asp Leu Phe Phe# 460- Ser Pro Ser Glu Asp Asn Phe Thr Asn Asp Le - #u Asn Lys Gly Glu Glu465 4 - #70 4 - #75 4 -#80- Ile Thr Ser Asp Thr Asn Ile Glu Ala Ala Gl - #u Glu Asn Ile Ser Leu# 495- Asp Leu Ile Gln Gln Tyr Tyr Leu Thr Phe As - #n Phe Asp Asn Glu Pro# 510- Glu Asn Ile Ser Ile Glu Asn Leu Ser Ser As - #p Ile Ile Gly Gln Leu# 525- Glu Leu Met Pro Asn Ile Glu Arg Phe Pro As - #n Gly Lys Lys Tyr Glu# 540- Leu Asp Lys Tyr Thr Met Phe His Tyr Leu Ar - #g Ala Gln Glu Phe Glu545 5 - #50 5 - #55 5 -#60- His Gly Lys Ser Arg Ile Ala Leu Thr Asn Se - #r Val Asn Glu Ala Leu# 575- Leu Asn Pro Ser Arg Val Tyr Thr Phe Phe Se - #r Ser Asp Tyr Val Lys# 590- Lys Val Asn Lys Ala Thr Glu Ala Ala Met Ph - #e Leu Gly Trp Val Glu# 605- Gln Leu Val Tyr Asp Phe Thr Asp Glu Thr Se - #r Glu Val Ser Thr Thr# 620- Asp Lys Ile Ala Asp Ile Thr Ile Ile Ile Pr - #o Tyr Ile Gly Pro Ala625 6 - #30 6 - #35 6 -#40- Leu Asn Ile Gly Asn Met Leu Tyr Lys Asp As - #p Phe Val Gly Ala Leu# 655- Ile Phe Ser Gly Ala Val Ile Leu Leu Glu Ph - #e Ile Pro Glu Ile Ala# 670- Ile Pro Val Leu Gly Thr Phe Ala Leu Val Se - #r Tyr Ile Ala Asn Lys# 685- Val Leu Thr Val Gln Thr Ile Asp Asn Ala Le - #u Ser Lys Arg Asn Glu# 700- Lys Trp Asp Glu Val Tyr Lys Tyr Ile Val Th - #r Asn Trp Leu Ala Lys705 7 - #10 7 - #15 7 -#20- Val Asn Thr Gln Ile Asp Leu Ile Arg Lys Ly - #s Met Lys Glu Ala Leu# 735- Glu Asn Gln Ala Glu Ala Thr Lys Ala Ile Il - #e Asn Tyr Gln Tyr Asn# 750- Gln Tyr Thr Glu Glu Glu Lys Asn Asn Ile As - #n Phe Asn Ile Asp Asp# 765- Leu Ser Ser Lys Leu Asn Glu Ser Ile Asn Ly - #s Ala Met Ile Asn Ile# 780- Asn Lys Phe Leu Asn Gln Cys Ser Val Ser Ty - #r Leu Met Asn Ser Met785 7 - #90 7 - #95 8 -#00- Ile Pro Tyr Gly Val Lys Arg Leu Glu Asp Ph - #e Asp Ala Ser Leu Lys# 815- Asp Ala Leu Leu Lys Tyr Ile Tyr Asp Asn Ar - #g Gly Thr Leu Ile Gly# 830- Gln Val Asp Arg Leu Lys Asp Lys Val Asn As - #n Thr Leu Ser Thr Asp# 845- Ile Pro Phe Gln Leu Ser Lys Tyr Val Asp As - #n Gln Arg Leu Leu Ser# 860- Thr Phe Thr Glu Tyr Ile Lys Asn Ile Ile As - #n Thr Ser Ile Leu Asn865 8 - #70 8 - #75 8 -#80- Leu Arg Tyr Glu Ser Asn His Leu Ile Asp Le - #u Ser Arg Tyr Ala Ser# 895- Lys Ile Asn Ile Gly Ser Lys Val Asn Phe As - #p Pro Ile Asp Lys Asn# 910- Gln Ile Gln Leu Phe Asn Leu Glu Ser Ser Ly - #s Ile Glu Val Ile Leu# 925- Lys Asn Ala Ile Val Tyr Asn Ser Met Tyr Gl - #u Asn Phe Ser Thr Ser# 940- Phe Trp Ile Arg Ile Pro Lys Tyr Phe Asn Se - #r Ile Ser Leu Asn Asn945 9 - #50 9 - #55 9 -#60- Glu Tyr Thr Ile Ile Asn Cys Met Glu Asn As - #n Ser Gly Trp Lys Val# 975- Ser Leu Asn Tyr Gly Glu Ile Ile Trp Thr Le - #u Gln Asp Thr Gln Glu# 990- Ile Lys Gln Arg Val Val Phe Lys Tyr Ser Gl - #n Met Ile Asn Ile Ser# 10050- Asp Tyr Ile Asn Arg Trp Ile Phe Val Thr Il - #e Thr Asn Asn Arg Leu# 10205- Asn Asn Ser Lys Ile Tyr Ile Asn Gly Arg Le - #u Ile Asp Gln Lys Pro# 10401030 - # 1035- Ile Ser Asn Leu Gly Asn Ile His Ala Ser As - #n Asn Ile Met Phe Lys# 10550- Leu Asp Gly Cys Arg Asp Thr His Arg Tyr Il - #e Trp Ile Lys Tyr Phe# 10705- Asn Leu Phe Asp Lys Glu Leu Asn Glu Lys Gl - #u Ile Lys Asp Leu Tyr# 10850- Asp Asn Gln Ser Asn Ser Gly Ile Leu Lys As - #p Phe Trp Gly Asp Tyr# 11005- Leu Gln Tyr Asp Lys Pro Tyr Tyr Met Leu As - #n Leu Tyr Asp Pro Asn# 11201110 - # 1115- Lys Tyr Val Asp Val Asn Asn Val Gly Ile Ar - #g Gly Tyr Met Tyr Leu# 11350- Lys Gly Pro Arg Gly Ser Val Met Thr Thr As - #n Ile Tyr Leu Asn Ser# 11505- Ser Leu Tyr Arg Gly Thr Lys Phe Ile Ile Ly - #s Lys Tyr Ala Ser Gly# 11650- Asn Lys Asp Asn Ile Val Arg Asn Asn Asp Ar - #g Val Tyr Ile Asn Val# 11805- Val Val Lys Asn Lys Glu Tyr Arg Leu Ala Th - #r Asn Ala Ser Gln Ala# 12001190 - # 1195- Gly Val Glu Lys Ile Leu Ser Ala Leu Glu Il - #e Pro Asp Val Gly Asn# 12150- Leu Ser Gln Val Val Val Met Lys Ser Lys As - #n Asp Gln Gly Ile Thr# 12305- Asn Lys Cys Lys Met Asn Leu Gln Asp Asn As - #n Gly Asn Asp Ile Gly# 12450- Phe Ile Gly Phe His Gln Phe Asn Asn Ile Al - #a Lys Leu Val Ala Ser# 12605- Asn Trp Tyr Asn Arg Gln Ile Glu Arg Ser Se - #r Arg Thr Leu Gly Cys# 12801270 - # 1275- Ser Trp Glu Phe Ile Pro Val Asp Asp Gly Tr - #p Gly Glu Arg Pro Leu# 12950- (2) INFORMATION FOR SEQ ID NO:29:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 12 amino (B) TYPE: amino acid (C) STRANDEDNESS: Not R - #elevant (D) TOPOLOGY: Not Relev - #ant- (ii) MOLECULE TYPE: peptide- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 12#/note= "The asparagine residue at this posi - #tion contains an amide group."- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:29:- Cys Gln Thr Ile Asp Gly Lys Lys Tyr Tyr Ph - #e Asn# 10- (2) INFORMATION FOR SEQ ID NO:30:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 5 amino (B) TYPE: amino acid (C) STRANDEDNESS: Not R - #elevant (D) TOPOLOGY: Not Relev - #ant- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:30:- His His His His His1 5__________________________________________________________________________

Number	Name	Date
5080895	Tokoro	Jan 1992
5196193	Carroll	Mar 1993
5268295	Serrero	Dec 1993

	Number	Date
Parent	329154	Oct 1994
Parent	161907	Dec 1993
Parent	985321	Dec 1992
Parent	429791	Oct 1989

Vaccine for clostridium botulinum neurotoxin

Information

Patent Number

Date Filed

Date Issued

Inventors

Original Assignees

Examiners

Agents

CPC

US Classifications

Field of Search

US

International Classifications

Abstract

Description

Claims

Parent Case Info

US Referenced Citations (3)

Non-Patent Literature Citations (115)

Continuation in Parts (4)