The present application relates to the technical field of biomedicine, and specifically relates to a viral vector-based RNA delivery system and a use thereof.
Accompanying this filing is a Sequence Listing entitled “00204-004US1.xml”, created on Jan. 16, 2024 and having 149,245 bytes of data, machine formatted on IBM-PC, MS-Windows operating system. The sequence listing is hereby incorporated herein by reference in its entirety for all purposes.
RNA interference (RNAi) therapy has been considered a promising strategy to treat human diseases since its invention. However, it has faced numerous issues during clinical practice, and the progress of the therapy's development has fallen short of expectations.
It is generally believed that RNA cannot remain stable outside the cell for a long time, because RNA will be degraded into fragments due to the abundance of RNase in the extracellular environment. It is therefore crucial to find a method that can stabilize RNA outside the cell and enable it to enter targeted tissues, thereby enhancing the effect of RNAi therapy.
There are currently several patents concerning siRNA, mainly focusing on the following aspects: 1. Designing siRNA for medical application. 2. Chemically modifying siRNA in order to enhance its stability in vivo and increase the yield. 3. Refining the design of various artificial carriers, including lipid nanoparticles, cationic polymers and viruses, to improve the efficiency of siRNA delivery in vivo. Among them, there are a number of patents regarding the third aspect. The primary cause for this is that researchers have realized the absence of suitable siRNA delivery systems for safely, accurately and efficiently deliver siRNA to target tissues. This challenge has become the fundamental limitation of RNAi therapy.
Biological viruses are small, simple-structured, non-cellular organisms that contain only one type of nucleic acid (DNA or RNA) and must be parasitic in living cells and multiply by replication. Viral vectors can bring genetic material into cells. The principle is to use the molecular mechanism of viruses to transfer their genomes into other cells for infection. This can occur in intact living organisms (in vivo) or in cell cultures (in vitro). It is mainly used in basic research, gene therapy or vaccines. However, there are currently few studies on using viruses as carriers to deliver RNA, especially siRNA, by special self-assembly mechanisms.
Chinese patent CN108624590A discloses an siRNA capable of inhibiting the expression of DDR2 gene. Chinese patent CN108624591A discloses an siRNA capable of silencing ARPC4 gene, and the siRNA is modified with α-phosphorus-selenium. Chinese patent CN108546702A discloses an siRNA targeting a long non-coding RNA, DDX11-AS1. Chinese patent CN106177990A discloses an siRNA precursor that can be used for the treatment of various tumors. These patents devise specific siRNAs and target certain diseases caused by genetic mutations.
Chinese patent CN108250267A discloses a polypeptide and a polypeptide-siRNA induced co-assembly, where the polypeptide acts as a carrier of siRNA. Chinese patent CN108117585A discloses a polypeptide to target and to introduce siRNA for promoting apoptosis of breast cancer cells, also utilizing the polypeptide as a carrier of siRNA. Chinese patent CN108096583A discloses a nanoparticle carrier, which can be loaded with siRNA that has curative effect on breast cancer while containing chemotherapeutic drugs. These patents are all inventions on siRNA carriers, whose technical solutions share the common feature of pre-assembling the carrier and siRNA in vitro before introducing them to the host. In fact, this is characteristic for most of the currently designed delivery techniques. However, these delivery systems pose a common issue that such artificially synthesized exogenous delivery system is prone to be cleared by the host's circulatory system, cause immunogenic reactions, and even potentially be toxic to certain cell types and tissues.
The research team of the present invention found that endogenous cells can selectively encapsulate miRNAs into exosomes. Exosomes can deliver miRNA to receptor cells, and the secreted miRNA can effectively block the expression of target genes at a relatively low concentration. Exosomes are biocompatible with the host immune system and possess the inherent ability to protect and transport miRNA across biological barriers in vivo, thereby having the potential to overcome problems associated with siRNA delivery. For example, Chinese patent CN110699382A discloses a method for preparing exosomes delivering siRNA, which involves techniques of isolating exosomes from plasma and encapsulating siRNA into exosomes by electroporation.
However, such techniques for isolating or preparing exosomes in vitro often necessitate obtaining a large amount of exosomes through cell culture, together with the step of siRNA encapsulation, which makes the clinical cost of large-scale application of the product too high for patients to afford. More importantly, the intricate production/purification process of exosomes makes it almost impossible to comply with GMP standards.
So far, medicinal products containing exosomes as active ingredients have not received approval from CFDA. The main challenge lies in ensuring the consistency of exosome products, which results in these products failing to obtain drug production licenses. If this issue can be resolved, it would significantly advance RNAi therapy.
Therefore, the development of a safe, precise and efficient siRNA delivery system is a crucial part to improve the efficacy of RNAi therapy and advance it further.
In view of this, the embodiments of the present application provide a viral vector-based RNA delivery system and a use thereof to solve the technical deficiencies existing in the existing technology.
The present application provides a viral vector-based RNA delivery system, comprising a viral vector carrying an RNA fragment to be delivered, wherein the viral vector is capable of enriching and endogenously spontaneously forming a complex comprising the RNA fragment in a host organ or tissue, and the complex is capable of entering and binding to a target tissue, and delivering the RNA fragment into the target tissue. After the RNA fragment is delivered to the target tissue, it can inhibit the expression of its matching gene, thereby inhibiting the disease development in the target tissue.
Optionally, the viral vector is an adenovirus-associated virus.
Optionally, the adenovirus-associated virus is adenovirus-associated virus type 5, adenovirus-associated virus type 8 or adenovirus-associated virus type 9.
Optionally, the RNA fragment comprises one, two or more RNA sequences with medical significance, and the RNA sequence is siRNA, shRNA or miRNA with medical significance.
Optionally, the viral vector comprises a promoter and a targeting tag, wherein the targeting tag is capable of forming a targeting structure of the complex in the host organ or tissue, the targeting tag is located on the surface of the complex, and the complex seeks for and binds to the target tissue through the targeting structure, and delivers the RNA fragment into the target tissue.
Optionally, the viral vector comprises a circuit selected from the group consisting of promoter-RNA fragment, promoter-targeting tag, and promoter-RNA fragment-targeting tag, or a combination thereof, and the viral vector comprises at least an RNA fragment and a targeting tag, wherein the RNA fragment and the targeting tag are located in the same circuit or in different circuits.
Optionally, the viral vector further comprises a flanking sequence, a compensation sequence and a loop sequence that facilitate the correct folding and expression of the circuit, and the flanking sequence comprises 5′ flanking sequence and 3′ flanking sequence;
the viral vector comprises a circuit selected from the group consisting of 5′ promoter-5′ flanking sequence-RNA fragment-loop sequence-compensation sequence-3′ flanking sequence, 5′-promoter-targeting tag, and 5′ promoter-targeting tag-5′ flanking sequence-RNA fragment-loop sequence-compensation sequence-3′ flanking sequence, or a combination thereof.
Optionally, the 5′ flanking sequence has a sequence that is identical to or more than 80% homologous with ggatcctggaggcttgctgaaggctgtatgctgaattc (SEQ ID NO: 1);
the loop sequence has a sequence that is identical to or more than 80% homologous with gttttggccactgactgac (SEQ ID NO:2);
the 3′ flanking sequence has a sequence that is identical to or more than 80% homologous with accggtcaggacacaaggcctgttactagcactcacatggaacaaatggcccagatctggccgcactcgag (SEQ ID NO:3);
the compensation sequence has a reverse complementary sequence to the RNA fragment in which any 1 to 5 bases have been deleted, so that the compensation sequence is not expressed.
Preferably, the compensation sequence has a reverse complementary sequence to the RNA fragment in which any 1 to 3 bases have been deleted.
More preferably, the compensation sequence has a reverse complementary sequence to the RNA fragment in which any 1 to 3 consecutively arranged bases have been deleted.
Most preferably, the compensation sequence has a reverse complementary sequence to the RNA fragment in which bases at positions 9 and 10 have been deleted.
Optionally, in the case where the viral vector comprises two or more of the circuits, adjacent circuits are linked via a sequence composed of sequences 1-3 (sequence 1-sequence 2-sequence 3);
wherein, sequence 1 is CAGATC, sequence 2 is a sequence of 5-80 bases, and sequence 3 is TGGATC.
Optionally, in the case where the viral vector comprises two or more of the gene circuits, adjacent gene circuits are linked via sequence 4 or a sequence with more than 80% homology to sequence 4;
wherein, sequence 4 is CAGATCTGGCCGCACTCGAGGTAGTGAGTCGACCAGTGGATC (SEQ ID NO:6).
Optionally, the organ or tissue is liver, and the complex is an exosome.
Optionally, the targeting tag is a targeting peptide or targeting protein with targeting function.
Optionally, the targeting peptide is selected from the group consisting of RVG targeting peptide, GE11 targeting peptide, PTP targeting peptide, TCP-1 targeting peptide, and MSP targeting peptide;
the targeting protein is selected from the group consisting of RVG-LAMP2B fusion protein, GE11-LAMP2B fusion protein, PTP-LAMP2B fusion protein, TCP-1-LAMP2B fusion protein, and MSP-LAMP2B fusion protein.
Optionally, the RNA sequence is 15-25 nucleotides in length. For example, the RNA sequence may be 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides in length. Preferably, the RNA sequence is 18-22 nucleotides in length.
Optionally, the RNA sequence has a sequence that is identical to, more than 80% homologous with, or of a nucleic acid molecule encoding a sequence selected from the group consisting of siRNA of EGFR gene, siRNA of KRAS gene, siRNA of VEGFR gene, siRNA of mTOR gene, siRNA of TNF-α gene, siRNA of integrin-α gene, siRNA of B7 gene, siRNA of TGF-β 1 gene, siRNA of H2-K gene, siRNA of H2-D gene, siRNA of H2-L gene, siRNA of HLA gene, siRNA of GDF15 gene, an antisense strand of miRNA-21, an antisense strand of miRNA-214, siRNA of TNC gene, siRNA of PTP1B gene, siRNA of mHTT gene, siRNA of Lrrk2 gene, siRNA of α-synuclein gene, and a combination thereof. It should be noted that the RNA sequence in “a nucleic acid molecule encoding a sequence selected from” the following herein also includes RNA sequences with more than 80% homology to the above-mentioned RNA sequence.
Wherein, the siRNAs of the above-mentioned genes are RNA sequences that have the function of inhibiting the expression of the gene. Numerous RNA sequences with this function exist and cannot all be listed here, and the following sequences with better effects are provided as examples.
The siRNA of the EGFR gene has a sequence that is identical to or more than 80% homologous with UGUUGCUUCUCUUAAUUCCU (SEQ ID NO:7), AAAUGAUCUUCAAAAGUGCCC (SEQ ID NO:8), UCUUUAAGAAGGAAAGAUCAU (SEQ ID NO:9), AAUAUUCGUAGCAUUUAUGGA (SEQ ID NO:10), UAAAAAUCCUCACAUAUACUU (SEQ ID NO: 11), or other sequences that inhibit EGFR gene expression.
The siRNA of the KRAS gene has a sequence that is identical to or more than 80% homologous with UGAUUUAGUAUUAUUUAUGGC (SEQ ID NO:12), AAUUUGUUCUCUAUAAUGGUG (SEQ ID NO: 13), UAAUUUGUUCUCUAUAAUGGU (SEQ ID NO:14), UUAUGUUUUCGAAUUUCUCGA (SEQ ID NO:15), UGUAUUUACAUAAUUACACAC (SEQ ID NO: 16), or other sequences that inhibit KRAS gene expression.
The siRNA of the VEGFR gene has a sequence that is identical to or more than 80% homologous with AUUUGAAGAGUUGUAUUAGCC (SEQ ID NO:17), UAAUAGACUGGUAACUUUCAU (SEQ ID NO:18), ACAACUAUGUACAUAAUAGAC (SEQ ID NO:19), UUUAAGACAAGCUUUUCUCCA (SEQ ID NO:20), AACAAAAGGUUUUUCAUGGAC (SEQ ID NO:21), or other sequences that inhibit VEGFR gene expression.
The siRNA of the mTOR gene has a sequence that is identical to or more than 80% homologous with AGAUAGUUGGCAAAUCUGCCA (SEQ ID NO:22), ACUAUUUCAUCCAUAUAAGGU (SEQ ID NO:23), AAAAUGUUGUCAAAGAAGGGU (SEQ ID NO:24), AAAAAUGUUGUCAAAGAAGGG (SEQ ID NO:25), UGAUUUCUUCCAUUUCUUCUC (SEQ ID NO:26), or other sequences that inhibit mTOR gene expression.
The siRNA of the TNF-α gene has a sequence that is identical to or more than 80% homologous with AAAACAUAAUCAAAAGAAGGC (SEQ ID NO:27), UAAAAAACAUAAUCAAAAGAA (SEQ ID NO:28), AAUAAUAAAUAAUCACAAGUG (SEQ ID NO:29), UUUUCACGGAAAACAUGUCUG (SEQ ID NO:30), AAACAUAAUCAAAAGAAGGCA (SEQ ID NO: 31), or other sequences that inhibit TNF-α gene expression.
The siRNA of the integrin-α gene has a sequence that is identical to or more than 80% homologous with AUAAUCAUCUCCAUUAAUGUC (SEQ ID NO:32), AAACAAUUCCUUUUUUAUCUU (SEQ ID NO:33), AUUAAAACAGGAAACUUUGAG (SEQ ID NO:34), AUAAUGAAGGAUAUACAACAG (SEQ ID NO:35), UUCUUUAUUCAUAAAAGUCUC (SEQ ID NO:36), or other sequences that inhibit integrin-α gene expression.
The siRNA of the B7 gene has a sequence that is identical to or more than 80% homologous with UUUUCUUUGGGUAAUCUUCAG (SEQ ID NO:37), AGAAAAAUUCCACUUUUUCUU (SEQ ID NO:38), AUUUCAAAGUCAGAUAUACUA (SEQ ID NO:39), ACAAAAAUUCCAUUUACUGAG (SEQ ID NO:40), AUUAUUGAGUUAAGUAUUCCU (SEQ ID NO:41), or other sequences that inhibit B7 gene expression.
The siRNA of the TGF-β1 gene has a sequence that is identical to or more than 80% homologous with ACGGAAAUAACCUAGAUGGGC (SEQ ID NO:42), UGAACUUGUCAUAGAUUUCGU (SEQ ID NO:43), UUGAAGAACAUAUAUAUGCUG (SEQ ID NO:44), UCUAACUACAGUAGUGUUCCC (SEQ ID NO:45), UCUCAGACUCUGGGGCCUCAG (SEQ ID NO:46), or other sequences that inhibit TGF-β 1 gene expression.
The siRNA of the H2-K gene has a sequence that is identical to or more than 80% homologous with AAAAACAAAUCAAUCAAACAA (SEQ ID NO:47), UCAAAAAAACAAAUCAAUCAA (SEQ ID NO:48), UAUGAGAAGACAUUGUCUGUC (SEQ ID NO:49), AACAAUCAAGGUUACAUUCAA (SEQ ID NO:50), ACAAAACCUCUAAGCAUUCUC (SEQ ID NO:51), or other sequences that inhibit H2-K gene expression.
The siRNA of the H2-D gene has a sequence that is identical to or more than 80% homologous with AAUCUCGGAGAGACAUUUCAG (SEQ ID NO:52), AAUGUUGUGUAAAGAGAACUG (SEQ ID NO: 53), AACAUCAGACAAUGUUGUGUA (SEQ ID NO:54), UGUUAACAAUCAAGGUCACUU (SEQ ID NO:55), AACAAAAAAACCUCUAAGCAU (SEQ ID NO:56), or other sequences that inhibit H2-D gene expression.
The siRNA of the H2-L gene has a sequence that is identical to or more than 80% homologous with GAUCCGCUCCCAAUACUCCGG (SEQ ID NO:57), AUCUGCGUGAUCCGCUCCCAA (SEQ ID NO:58), UCGGAGAGACAUUUCAGAGCU (SEQ ID NO:59), UCUCGGAGAGACAUUUCAGAG (SEQ ID NO:60), AAUCUCGGAGAGACAUUUCAG (SEQ ID NO:61), or other sequences that inhibit H2-L gene expression.
The siRNA of the HLA gene has a sequence that is identical to or more than 80% homologous with AUCUGGAUGGUGUGAGAACCG (SEQ ID NO:62), UGUCACUGCUUGCAGCCUGAG (SEQ ID NO:63), UCACAAAGGGAAGGGCAGGAA (SEQ ID NO:64), UUGCAGAAACAAAGUCAGGGU (SEQ ID NO:65), ACACGAACACAGACACAUGCA (SEQ ID NO:66), or other sequences that inhibit HLA gene expression.
The siRNA of the GDF15 gene has a sequence that is identical to or more than 80% homologous with UAUAAAUACAGCUGUUUGGGC (SEQ ID NO:67), AGACUUAUAUAAAUACAGCUG (SEQ ID NO:68), AAUUAAUAAUAAAUAACAGAC (SEQ ID NO:69), AUCUGAGAGCCAUUCACCGUC (SEQ ID NO:70), UGCAACUCCAGCUGGGGCCGU (SEQ ID NO: 71), or other sequences that inhibit GDF15 gene expression.
The siRNA of the TNC gene has a sequence that is identical to or more than 80% homologous with AUGAAAUGUAAAAAAAGGGA (SEQ ID NO:72), AAUCAUAUCCUUAAAAUGGAA (SEQ ID NO:73), UAAUCAUAUCCUUAAAAUGGA (SEQ ID NO:74), UGAAAAAUCCUUAGUUUUCAU (SEQ ID NO:75), AGAAGUAAAAAACUAUUGCGA (SEQ ID NO:76), or other sequences that inhibit TNC gene expression.
The siRNA of the PTP1B gene has a sequence that is identical to or more than 80% homologous with UGAUAUAGUCAUUAUCUUCUU (SEQ ID NO:77), UCCAUUUUUAUCAAACUAGCG (SEQ ID NO:78), AUUGUUUAAAUAAAUAUGGAG (SEQ ID NO:79), AAUUUUAAUACAUUAUUGGUU (SEQ ID NO:80), UUUAUUAUUGUACUUUUUGAU (SEQ ID NO:81), or other sequences that inhibit PTP1B gene expression.
The siRNA of the mHTT gene has a sequence that is identical to or more than 80% homologous with UAUGUUUUCACAUAUUGUCAG (SEQ ID NO:82), AUUUAGUAGCCAACUAUAGAA (SEQ ID NO:83), AUGUUUUUCAAUAAAUGUGCC (SEQ ID NO:84), UAUGAAUAGCAUUCUUAUCUG (SEQ ID NO:85), UAUUUGUUCCUCUUAAUACAA (SEQ ID NO:86), or other sequences that inhibit mHTT gene expression.
The siRNA of the Lrrk2 gene has a sequence that is identical to or more than 80% homologous with AUUAACAUGAAAAUAUCACUU (SEQ ID NO:87), UUAACAAUAUCAUAUAAUCUU (SEQ ID NO:88), AUCUUUAAAAUUUGUUAACGC (SEQ ID NO:89), UUGAUUUAAGAAAAUAGUCUC (SEQ ID NO:90), UUUGAUAACAGUAUUUUUCUG (SEQ ID NO:91), or other sequences that inhibit Lrrk2 gene expression.
The siRNA of the α-synuclein gene has a sequence that is identical to or more than 80% homologous with AUAUAUUAACAAAUUUCACAA (SEQ ID NO:92), AAGUAUUAUAUAUAUUAACAA (SEQ ID NO:93), AUAACUUUAUAUUUUUGUCCU (SEQ ID NO:94), UAACUAAAAAAUUAUUUCGAG (SEQ ID NO:95), UCGAAUAUUAUUUAUUGUCAG (SEQ ID NO:96), or other sequences that inhibit α-synuclein gene expression.
The antisense strand of miRNA-21 is 5′-TCAACATCAGTCTGATAAGCTA-3′ (SEQ ID NO:97).
It should be noted that the above-mentioned “more than 80% homologous with” a sequence may refer to a homology of 85%, 88%, 90%, 95%, 98%, etc.
Optionally, the RNA fragment includes the RNA sequence and a modified RNA sequence obtained by ribose modification to the RNA sequence. That is to say, the RNA fragment may consist of at least one RNA sequence, at least one modified RNA sequence, or the RNA sequence and the modified RNA sequence.
In the present invention, the isolated nucleic acid also includes variants and derivatives thereof. Those skilled in the art can use common methods to modify the nucleic acid. Such modification includes (but not limited to) methylation modification, hydrocarbon modification, glycosylation modification (such as 2-methoxy-glycosyl modification, hydroxyl-glycosyl modification, saccharide ring modification), nucleic acid modification, peptide fragment modification, lipid modification, halogen modification, and nucleic acid modification (such as “TT” modification). In one embodiment of the present invention, the modification is an internucleotide linkage, for example selected from the group consisting of phosphorothioate, 2′-O methoxyethyl (MOE), 2′-fluoro, alkyl phosphonate, phosphorodithioate, alkyl phosphonothioate, phosphoramidate, carbamate, carbonate, phosphotriester, acetamidate, carboxymethyl ester, and combinations thereof. In one embodiment of the present invention, the modification is a modification of nucleotides, for example, selected from the group consisting of peptide nucleic acid (PNA), locked nucleic acid (LNA), arabinose nucleic acid (FANA), analogs and derivatives thereof, and combinations thereof. Preferably, the modification is 2′ fluoropyrimidine modification. 2′ Fluoropyrimidine modification is to replace the 2′-OH of the pyrimidine nucleotide of RNA with 2′-F. 2′-F modification can make RNA difficult to be recognized by RNase in vivo, thereby increasing the stability of RNA fragment during transportation in vivo.
Optionally, the delivery system is a delivery system for use in a mammal including human.
The present application also provides use of the viral vector-based RNA delivery system as described in any paragraph above in the manufacture of a medicament for treating a disease.
Optionally, the medicament is administered by oral administration, inhalation, subcutaneous injection, intramuscular injection, or intravenous injection, preferably by intravenous injection.
Optionally, the disease is a cancer, pulmonary fibrosis, colitis, obesity, cardiovascular disease caused by obesity, type 2 diabetes, Huntington's disease, Parkinson's disease, myasthenia gravis, Alzheimer's disease, or graft-versus-host disease.
Optionally, the medicament comprises the above-mentioned viral vector. Specifically, the viral vector herein refers to a viral vector carrying an RNA fragment, or carrying an RNA fragment and a targeting tag. It can enter the host and is capable of enriching in the liver and self-assembling into a complex, an exosome. The complex can deliver the RNA fragment to the target tissue, allowing the RNA fragment to be expressed in the target tissues, thereby inhibiting the expression of its matching gene and achieving the purpose of treating diseases.
The dosage form of the medicament may be tablets, capsules, powders, granules, pills, suppositories, ointments, solutions, suspensions, lotions, gels, pastes, etc.
The technical effects of this application include:
The viral vector-based RNA delivery system provided in the present application uses a virus as a carrier, and as a mature injection, the virus has safety and reliability that have been fully verified, and has a very good druggability. The RNA sequence that exerts the final effect is encapsulated and transported by endogenous exosomes, with no immune responses, and there is no need to verify the safety of the exosomes. The delivery system can deliver all kinds of small molecule RNAs and has strong versatility. Moreover, the preparation of viruses is much cheaper than the preparation of exosomes, proteins, polypeptides and the like, with good economy. The viral vector-based RNA delivery system provided in the present application can tightly bind to AGO2 and be enriched into a complex (exosomes) after self-assembly in vivo, which not only prevents its premature degradation and maintains its stability in circulation, but also facilitates receptor cell absorption, intracytoplasmic release and lysosomal escape, and only a low dose is required.
The use of the viral vector-based RNA delivery system provided in this application in the medicament offers a platform of drug delivery that facilitates the establishment of further foundations for RNA drug research and development. This significantly advances the development and utilization of RNA drugs.
Specific embodiments of the present application will be described below in conjunction with the accompanying drawings.
First, the technical terms, experimental methods, etc. involved in the present invention are explained.
Hematoxylin-eosin staining, referred to as HE staining, is one of the most basic and widely used technical methods in the teaching and scientific research of histology and pathology.
Hematoxylin stain is alkaline and can stain the basophilic structures of tissues (such as ribosomes, nuclei and ribonucleic acid in the cytoplasm, etc.) into blue-purple, and eosin is an acidic dye that can stain eosinophilic structures of tissues (such as intracellular and intercellular proteins, Lewy bodies, Mallory bodies, and most of the cytoplasm) into pink, making the morphology of the entire cell tissue clearly visible.
The specific steps of HE staining include: sample tissue fixation and sectioning; tissue sample deparaffinizing; tissue sample hydration; hematoxylin staining of tissue sections, differentiation and anti-blue; eosin staining of tissue sections and dehydration; air-drying and sealing tissue sample sections; and finally, observation and taking pictures under a microscope.
Western Blot transfers proteins to a membrane and then uses antibodies for detection. For known expressed proteins, the corresponding antibodies can be used as primary antibodies for detection. For the expression products of new genes, the antibodies against the fusion part can be used for detection.
In Western Blot, polyacrylamide gel electrophoresis is employed, where the detected object is protein, the “probe” is an antibody, and the “color development” uses a labeled secondary antibody. The protein sample separated by PAGE is transferred to a solid-phase carrier (such as nitrocellulose film), where it is absorbed through non-covalent bonds without changing the type or biological activity of the polypeptide separated by electrophoresis. The protein or peptide on the solid-phase carrier acts as an antigen and reacts immunologically with the corresponding antibody. Then, it reacts with the second antibody labeled with either enzyme or isotope. The protein component expressed by the specific target gene is separated through electrophoresis and detected through substrate color development or autoradiography. The process primarily comprises of extracting proteins, quantifying proteins, preparing gels, running electrophoresis, transferring membranes, performing immunolabeling, and developing.
Immunohistochemistry (also known as immunocytochemistry), based on the antigen-antibody reaction, i.e., the principle of specific binding of antigen and antibody, is the process of identifying antigens (polypeptides or proteins) in tissue cells, determining their localization, and studying them qualitatively and relative quantitatively by chemical reaction of the chromogenic agent (fluorescein, enzyme, metal ion, or isotope) of the labeled antibody to develop color.
The main steps of immunohistochemistry include soaking sections, airing overnight, deparaffinizing in xylene followed by alcohol of gradient concentrations (100%, 95%, 90%, 80%, 75%, 70%, 50%, 3 min each time), using double distilled water, adding dropwise 3% hydrogen peroxide solution to remove catalase, washing with water, repairing antigen, adding dropwise 5% BSA, blocking for 1 h, diluting primary antibody, washing with PBS buffer, incubating with secondary antibody, washing with PBS buffer, developing color with chromogenic solution, washing with water, staining with hematoxylin, dehydrating with ethanol of gradient concentrations, and sealing with neutral gum.
The detection of siRNA, protein and mRNA levels involved in the present invention is all performed by injecting an RNA delivery system into mice to establish an in vitro mouse stem cell model. qRT-PCR is used to detect the expression levels of mRNA and siRNA in cells and tissues. The absolute quantification of siRNA is determined by drawing a standard curve with a standard product. The expression level of each siRNA or mRNA relative to the internal reference can be represented by 2-ΔCT, where ΔCT=Csample-Cinternal reference. The internal reference gene used is U6 snRNA (in tissue) or miR-16 (in serum, exosomes) molecules when amplifying siRNA, and is GAPDH or 18 s RNA when amplifying mRNA. Western blotting is used to detect the expression level of proteins in cells and tissues, and ImageJ software is used for protein quantitative analysis.
In the figures provided by the present invention, “*” means P<0.05, “**” means P<0.01, and “***” means P<0.005.
In the present invention, unless otherwise specified, the scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. Moreover, the reagents, materials and procedures used herein are all reagents, materials and procedures widely used in the corresponding fields.
In this example, a viral vector-based RNA delivery system is provided, which comprises a viral vector carrying an RNA fragment to be delivered, wherein the viral vector is capable of enriching and endogenously spontaneously forming a complex comprising the RNA fragment in a host organ or tissue, and the complex is capable of entering and binding to a target tissue, and delivering the RNA fragment into the target tissue.
In this example, the viral vector further comprises a promoter and a targeting tag. The viral vector comprises a circuit selected from the group consisting of promoter-RNA sequence, promoter-targeting tag, and promoter-RNA sequence-targeting tag, or a combination thereof, and the viral vector comprises at least an RNA fragment and a targeting tag, wherein the RNA fragment and the targeting tag are located in the same circuit or in different circuits. In other words, the viral vector may only comprise promoter-RNA sequence-targeting tag, or a combination of promoter-RNA sequence and promoter-targeting tag, or a combination of promoter-targeting tag and promoter-RNA sequence-targeting tag.
In
Further, the viral vector can also comprise a flanking sequence, a compensation sequence and a loop sequence that facilitate the correct folding and expression of the circuit, and the flanking sequence comprises 5′ flanking sequence and 3′ flanking sequence; the viral vector comprises a circuit selected from the group consisting of 5′ promoter-5′ flanking sequence-RNA fragment-loop sequence-compensation sequence-3′ flanking sequence, 5′-promoter-targeting tag, and 5′ promoter-targeting tag-5′ flanking sequence-RNA fragment-loop sequence-compensation sequence-3′ flanking sequence, or a combination thereof.
Wherein, the 5′ flanking sequence preferably has a sequence that is identical to or more than 80% homologous with ggatcctggaggcttgctgaaggctgtatgctgaattc (SEQ ID NO: 1), including sequences with 85%, 90%, 92%, 95%, 98%, or 99% homology with ggatcctggaggcttgctgaaggctgtatgctgaattc (SEQ ID NO: 1).
The loop sequence preferably has a sequence that is identical to or more than 80% homologous with gttttggccactgactgac (SEQ ID NO:2), including sequences with 85%, 90%, 92%, 95%, 98%, 99% homology with gttttggccactgactgac (SEQ ID NO:2).
The 3′ flanking sequence preferably has a sequence that is identical to or more than 80% homologous with accggtcaggacacaaggcctgttactagcactcacatggaacaaatggcccagatctggccgcactcgag (SEQ ID NO:3), including sequences with 85%, 90%, 92%, 95%, 98%, 99% homology with accggtcaggacacaaggcctgttactagcactcacatggaacaaatggcccagatctggccgcactcgag (SEQ ID NO:3).
The compensation sequence is the reverse complementary sequence of the RNA fragment with any 1-5 bases deleted. In the case where the RNA fragment contains only one RNA sequence, the compensation sequence may be the reverse complementary sequence of the RNA sequence with any 1-5 bases deleted.
Preferably, the compensation sequence is the reverse complementary sequence of the RNA fragment with any 1-3 bases deleted. In the case where the RNA fragment contains only one RNA sequence, the compensation sequence may be the reverse complementary sequence of the RNA sequence with any 1-3 bases deleted.
More preferably, the compensation sequence is the reverse complementary sequence of the RNA fragment with any 1-3 contiguous bases deleted. In the case where the RNA fragment contains only one RNA sequence, the compensation sequence may be the reverse complementary sequence of the RNA sequence with any 1-3 contiguous bases deleted.
Most preferably, the compensation sequence is the reverse complementary sequence of the RNA fragment with the base at position 9 and/or 10 deleted. In the case where the RNA fragment contains only one RNA sequence, the compensation sequence may be a reverse complementary sequence of the RNA sequence with the base at position 9 and/or 10 deleted. Deleting the base at position 9 and/or 10 has the best effect.
It should be noted that the above-mentioned flanking sequence, compensation sequence, and loop sequence are not randomly selected, but are determined based on a large number of theoretical studies and experiments. With the cooperation of the above-mentioned certain flanking sequence, compensation sequence, and loop sequence, the expression rate of RNA fragments can be maximized.
In
The above sequences are specifically shown in Table 1 below.
indicates data missing or illegible when filed
In the case where the viral vector carries two or more circuits, adjacent gene circuits can be linked via sequence 1-sequence 2-sequence 3; wherein, sequence 1 is preferably CAGATC, sequence 2 may be a sequence of 5-80 bases, such as 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75 bases, preferably a sequence of 10-50 bases, more preferably a sequence of 20-40 bases, and sequence 3 is preferably TGGATC.
More preferably, in the case where the viral vector carries two or more circuits, adjacent gene circuits are linked via sequence 4 or a sequence with more than 80% homology to sequence 4; wherein sequence 4 is CAGATCTGGCCGCACTCGAGGTAGTGAGTCGACCAGTGGATC (SEQ ID NO:6).
The sequences are specifically shown in Table 3 below.
The RNA fragment may comprise one, two or more RNA sequences with medical significance. The RNA sequence can be expressed in the target receptor, and the compensation sequence cannot be expressed in the target receptor. The RNA sequence may be an siRNA sequence, shRNA sequence or miRNA sequence, preferably an siRNA sequence.
The length of an RNA sequence is 15-25 nucleotides (nt), preferably 18-22 nt, such as 18 nt, 19 nt, 20 nt, 21 nt, or 22 nt. The range of the sequence length is not chosen arbitrarily but was determined after repeated trials. A large number of experiments have proved that in the case where the length of the RNA sequence is less than 18 nt, especially less than 15 nt, the RNA sequence is mostly invalid and will not play a role. In the case where the length of the RNA sequence is greater than 22 nt, especially greater than 25 nt, not only does the cost of the circuit increase greatly, but the effect is no better than that of an RNA sequence with a length of 18-22 nt, and the economic benefits are poor. Therefore, in the case where the length of the RNA sequence is 15-25 nt, especially 18-22 nt, the cost and function can be balanced with the best effect.
RNA sequences of different lengths are shown in Table 4 below.
The RNA sequence has a sequence that is identical to, more than 80% homologous with, or of a nucleic acid molecule encoding a sequence selected from the group consisting of siRNA of EGFR gene, siRNA of KRAS gene, siRNA of VEGFR gene, siRNA of mTOR gene, siRNA of TNF-α gene, siRNA of integrin-α gene, siRNA of B7 gene, siRNA of TGF-β 1 gene, siRNA of H2-K gene, siRNA of H2-D gene, siRNA of H2-L gene, siRNA of HLA gene, siRNA of GDF15 gene, an antisense strand of miRNA-21, an antisense strand of miRNA-214, siRNA of TNC gene, siRNA of PTP1B gene, siRNA of mHTT gene, siRNA of Lrrk2 gene, siRNA of α-synuclein gene, and a combination thereof.
The siRNAs and the antisense strands of miRNAs of the above-mentioned genes can inhibit the expression or mutation of the genes and miRNAs, thereby achieving the effect of inhibiting diseases. These diseases include, but are not limited to: cancer, pulmonary fibrosis, colitis, obesity, cardiovascular disease caused by obesity, type 2 diabetes, Huntington's disease, Parkinson's disease, myasthenia gravis, Alzheimer's disease, graft-versus-host disease and related diseases. The related diseases herein refer to the associated diseases, complications or sequelae that appear during the formation or development of any one or several of the above diseases, or other diseases that are related to the above diseases to a certain extent. Among them, cancers include but are not limited to: gastric cancer, kidney cancer, lung cancer, liver cancer, brain cancer, blood cancer, bowel cancer, skin cancer, lymphatic cancer, breast cancer, bladder cancer, esophageal cancer, head and neck squamous cell carcinoma, hemangioma, glioblastoma, or melanoma.
The number of RNA sequences in an RNA fragment is 1, 2 or more. For example, if glioma needs to be treated, siRNA of EGFR gene and siRNA of TNC gene can both be used in the same viral vector; and if enteritis needs to be treated, siRNA of TNF-α gene, siRNA of integrin-α gene and siRNA of B7 gene can all be used.
Taking the combined use of “siRNA1” and “siRNA2” on the same viral vector as an example, the functional structural region of the viral vector can be expressed as (promoter-siRNA 1)-linker-(promoter-siRNA2)-linker-(promoter-targeting tag), or (promoter-targeting tag-siRNA 1)-linker-(promoter-targeting tag-siRNA2), or (promoter-siRNA1)-linker-(promoter-targeting tag-siRNA2), etc.
More specifically, the functional structural region of the viral vector can be expressed as (5′-promoter-5′ flanking sequence-siRNA1-loop sequence-compensation sequence-3′ flanking sequence)-linker-(5′-promoter-5′flanking sequence-siRNA2-loop sequence-compensation sequence-3′ flanking sequence)-linker-(5′-promoter-targeting tag), or (5′-promoter-targeting tag-5′ flanking sequence-siRNA1-loop sequence-compensation sequence-3′ flanking sequence)-linker-(5′-promoter-targeting tag-5′ flanking sequence-siRNA2-loop sequence-compensating sequence-3′ flanking sequence), or (5′-promoter-5′ flanking sequence-siRNA1-loop sequence-compensation sequence-3′ flanking sequence)-linker-(5′-promoter-targeting tag-5′ flanking sequence-siRNA2-loop sequence-compensation sequence-3′ flanking sequence), or (5′-promoter-targeting tag-5′ flanking sequence-siRNA1-siRNA2-loop sequence-compensation sequence-3′ flanking sequence), etc. Other situations can be deduced in this way and will not be repeated here. The above linker can be “sequence 1-sequence 2-sequence 3” or “sequence 4”, and a bracket indicates a complete circuit.
Preferably, the above-mentioned RNA can also be obtained by ribose modification of the RNA sequence (siRNA, shRNA or miRNA), preferably 2′ fluoropyrimidine modification. 2′ Fluoropyrimidine modification is to replace the 2′-OH of the pyrimidine nucleotide of siRNA, shRNA or miRNA with 2′-F. 2′-F modification can make siRNA, shRNA or miRNA difficult to be recognized by RNase in the human body, thereby increasing the stability of RNA during transportation in vivo.
Preferably, the above-mentioned RNA can also be obtained by ribose modification of the RNA sequence (siRNA, shRNA or miRNA), preferably 2′ fluoropyrimidine modification. 2′ Fluoropyrimidine modification is to replace the 2′-OH of the pyrimidine nucleotide of siRNA, shRNA or miRNA with 2′-F. 2′-F modification can make siRNA, shRNA or miRNA difficult to be recognized by RNase in the human body, thereby increasing the stability of RNA during transportation in vivo.
The host organ or tissue described in this example is preferably the liver. The liver is the most active cell opening and closing tissue among all mammalian tissues and organs.
After specifically selecting to infect the liver, the viral vector will release the RNA fragment (siRNA, shRNA or miRNA). The liver tissue can spontaneously encapsulate the RNA fragment into exosomes, and these exosomes become RNA delivery mechanisms (a complex structure containing the desired RNA to be delivered and having a targeting structure).
In order to enable the exosomes to have the ability of “precise guidance”, a targeting tag can be designed in the virus injected into the body, and the targeting tag will also be assembled into the exosomes by the liver tissue, especially when selecting certain targeting tags, they can be inserted into the surface of exosomes to become a targeting structure that can guide exosomes. This can greatly improve the accuracy of the RNA delivery mechanism of the present invention and greatly improve the efficiency of potential drug delivery.
The selection of targeting tags is a process that requires creative work. On the one hand, it is necessary to select available targeting tags according to the target tissue, and on the other hand, it is also necessary to ensure that the targeting tag can stably appear on the surface of exosomes to achieve targeting function. Targeting tags that have been screened include targeting peptides, targeting proteins, and antibodies. Wherein, targeting peptides include but are not limited to RVG targeting peptide (with the nucleotide sequence as shown in SEQ ID No: 1), GE11 targeting peptide (with the nucleotide sequence as shown in SEQ ID No: 2), PTP targeting peptide (with the nucleotide sequence as shown in SEQ ID No: 3), TCP-1 targeting peptide (with the nucleotide sequence as shown in SEQ ID No: 4), or MSP targeting peptide (with the nucleotide sequence as shown in SEQ ID No: 5); targeting proteins include but are not limited to RVG-LAMP2B fusion protein (with the nucleotide sequence as shown in SEQ ID No: 6), GE11-LAMP2B fusion protein (with the nucleotide sequence as shown in SEQ ID No: 7), PTP-LAMP2B fusion protein (with the nucleotide sequence as shown in SEQ ID No: 8), TCP-1-LAMP2B fusion protein (with the nucleotide sequence as shown in SEQ ID No: 9), or MSP-LAMP2B fusion protein (with the nucleotide sequence as shown in SEQ ID No: 10).
Among them, RVG targeting peptide and RVG-LAMP2B fusion protein can precisely target brain tissue; GE11 targeting peptide and GE11-LAMP2B fusion protein can precisely target organs or tissues with high expression of EGFR, such as lung cancer tissue with EGFR mutation; PTP targeting peptide and PTP-LAMP2B fusion protein can precisely target the pancreas, especially the plectin-1 protein specifically expressed in human and mouse pancreatic cancer tissues; TCP-1 targeting peptide and TCP-1-LAMP2B fusion protein can precisely target the colon; and MSP targeting peptide and MSP-LAMP2B fusion protein can precisely target muscle tissue.
In practical applications, the targeting tag can be flexibly matched with various RNA fragments, and different targeting tags can play different roles with different RNA fragments. For example, RVG targeting peptide and RVG-LAMP2B fusion protein can be combined with siRNA of EGFR gene, siRNA of TNC gene or a combination of the two to treat glioblastoma, be combined with siRNA of PTP1B gene to treat obesity, be combined with siRNA of mHTT gene to treat Huntington's disease, or be combined with siRNA of LRRK2 gene to treat Parkinson's disease; GE11 targeting peptide and GE11-LAMP2B fusion protein can be combined with siRNA of EGFR gene to treat lung cancer and other diseases induced by high expression or mutation of EGFR gene; TCP-1 targeting peptide or TCP-1-LAMP2B fusion protein can be combined with siRNA of TNF-α gene, siRNA of integrin-α gene, siRNA of B7 gene or any combination of the above three to treat colitis or colon cancer.
The selection and structural design of viral vectors is one of the core contents of the technology disclosed in the present invention. After research, the viral vector is preferably adenovirus-associated virus (AAV), and more preferably adenovirus-associated virus type 5 (AAV-5), Adenovirus-associated virus type 8 (AAV-8) or adenovirus-associated virus type 9 (AAV-9).
In addition, in order to achieve the purpose of precise delivery, we experimented with a variety of viral vector loading schemes and came up with another optimized scheme: the viral vector can also be composed of a variety of viruses with different structures, one of which contains a promoter and targeting tag, other viruses contain promoters and RNA fragments. That is, the targeting tag and RNA fragment are loaded into different viral vectors, and the two viral vectors are injected into the body. The targeting effect is no worse than the targeting effect produced by loading the same targeting tag and RNA fragment into one viral vector.
More preferably, when two different viral vectors are injected into the host body, the viral vector containing the RNA sequence can be injected first, and then the viral vector containing the targeting tag can be injected 1-2 hours later, so that a better target effect can be achieved.
The delivery systems described above can be used in mammals including humans.
In order to verify the feasibility of the delivery system, we conducted the following experiments:
First, referring to
For the core gene circuit construct, we designed a scheme that encodes an optimized siRNA expression backbone part under the control of a promoter part to maximize guide strand expression while minimizing undesired passenger strand expression, see
Next, we examined whether the core circuit directs the loading of siRNA into exosomes. HEK293T cells were transfected with the control scrambled circuit (CMV-scrR) or CMV-siRE circuit, and the exosomes in cell culture medium were characterized. Nanoparticle tracking analysis (NTA) revealed that similar amounts of exosomes were secreted in each group with similar size and distribution, peaking at 128-131 nm. Transmission electron microscopy (TEM) confirmed that the purified exosomes exhibited a typical round-shaped vesicular morphology and had correct size. Moreover, enrichment of specific exosome markers (CD63, TSG101 and CD9) was only detected in purified exosomes but not in cell culture medium. These results demonstrate that transfection with circuits did not affect the size, structure or number of exosomes generated by HEK293T cells. Finally, a significant amount of EGFR siRNA was detected in exosomes derived from HEK293T and Hepa 1-6 cells transfected with the CMV-siRE circuit, see
For the design of the targeting tag of the circuit, a sequence encoding a targeting tag fused to the N-terminus of Lamp2b (a canonical exosome membrane protein) was inserted downstream of the CMV promoter, see
Next, we examined whether the circuit enables the self-assembly of siRNAs into exosomes in vitro. HEK293T cells were transfected with a CMV directed circuit encoding both EGFR and TNC siRNAs along with an RVG tag (CMV RVG-siRE). The results showed that exosomes derived from the cell culture medium displayed typical morphology and size distribution, indicating that modification with the composable-core circuit did not alter the physical properties of exosomes. Moreover, a complete circuit encoding both EGFR and TNC siRNAs and a targeting tag (CMV Flag-siRE) was constructed. Exosomes generated from the transfected HEK293T and hep 1-6 cells were successfully immunoprecipitated, and both EGFR and TNC siRNAs were abundantly present in the immunoprecipitated exosomes, see
Furthermore, AGO2 is widely expressed in organisms and is a core component of the RNA-induced silencing complex. It has endoribonuclease activity and can inhibit the expression of target genes by promoting the maturation of siRNA and regulating its biosynthesis and function.
Since siRNA processing is dependent on Argonaute 2 (AGO2) and the proper loading of siRNA into AGO2 is expected to enhance the on-target effects of siRNA, another immunoprecipitation experiment was performed to assess the association of AGO2 with siRNAs in exosomes. Experiments demonstrated that EGFR and TNC siRNAs were readily detected in the exosomes precipitated with anti-AGO2 antibody, suggesting that our design guarantees the loading of siRNA into the RNA-induced silencing complex (RISC) and facilitates the efficient transport of AGO2-bound siRNA into exosomes. Finally, to investigate whether the in vitro assembled siRNAs are functional, exosomes derived from HEK293T cells transfected with the CMV-RVG-siRE+T circuit were incubated with the U87MG glioblastoma cells. A dose-dependent downregulation of EGFR and TNC expression in U87MG cells was achieved, see
Therefore, the viral vector-based RNA delivery system provided in this example uses a virus as a carrier, and as a mature injection, the virus has safety and reliability that have been fully verified, and has a very good druggability. The RNA sequence that exerts the final effect is encapsulated and transported by endogenous exosomes, with no immune responses, and there is no need to verify the safety of the exosomes. The delivery system can deliver all kinds of small molecule RNAs and has strong versatility. Moreover, the preparation of viral vectors is much cheaper than the preparation of exosomes, proteins, polypeptides and the like, with good economy. The viral vector-based RNA delivery system provided in this example can tightly bind to AGO2 and be enriched into a complex (exosomes) after self-assembly in vivo, which not only prevents its premature degradation and maintains its stability in circulation, but also facilitates receptor cell absorption, intracytoplasmic release and lysosomal escape, and only a low dose is required.
On the basis of Example 1, a medicament is provided in this example. The medicament comprises a viral vector carrying an RNA fragment to be delivered, wherein the viral vector is capable of enriching and endogenously spontaneously forming a complex comprising the RNA fragment in a host organ or tissue, and the complex is capable of entering and binding to a target tissue, and delivering the RNA fragment into the target tissue. After the RNA fragment is delivered to the target tissue, it can inhibit the expression of its matching gene, thereby inhibiting the disease development in the target tissue.
Optionally, the RNA fragment comprises one, two or more RNA sequences with medical significance, and the RNA sequence is siRNA, shRNA or miRNA with medical significance.
In
Optionally, the viral vector comprises a promoter and a targeting tag, wherein the targeting tag is capable of forming a targeting structure of the complex in the host organ or tissue, the targeting tag is located on the surface of the complex, and the complex seeks for and binds to the target tissue through the targeting structure, and delivers the RNA fragment into the target tissue.
For explanations of the viral vector, RNA fragment, targeting tag, etc. in this example, please refer to Example 1 and will not be repeated here.
The medicament can enter the human body by oral administration, inhalation, subcutaneous injection, intramuscular injection or intravenous injection, and then be delivered to the target tissue through the viral vector-based RNA delivery system described in Example 1 to exert a therapeutic effect.
The medicament can be used to treat cancer, pulmonary fibrosis, colitis, obesity, cardiovascular disease caused by obesity, type 2 diabetes, Huntington's disease, Parkinson's disease, myasthenia gravis, Alzheimer's disease, or graft-versus-host disease.
The medicament in this example may also comprise a pharmaceutically acceptable carrier, which includes but is not limited to diluents, buffers, emulsions, encapsulating agents, excipients, fillers, adhesives, sprays, transdermal absorption agents, wetting agents, disintegrants, absorption accelerators, surfactants, colorants, flavoring agents, adjuvants, desiccants, adsorption carriers, etc.
The dosage form of the medicament provided in this example may be tablets, capsules, powders, granules, pills, suppositories, ointments, solutions, suspensions, lotions, gels, pastes, etc.
The medicament provided in this example uses a virus as a carrier, and as a mature injection, the viral vector has safety and reliability that have been fully verified, and has a very good druggability. The RNA sequence that exerts the final effect is encapsulated and transported by endogenous exosomes, with no immune responses, and there is no need to verify the safety of the exosomes. The delivery system can deliver all kinds of small molecule RNAs and has strong versatility. Moreover, the preparation of viruses is much cheaper than the preparation of exosomes, proteins, polypeptides and the like, with good economy. The medicament provided in the present application can tightly bind to AGO2 and be enriched into a complex (exosomes) after self-assembly in vivo, which not only prevents its premature degradation and maintains its stability in circulation, but also facilitates receptor cell absorption, intracytoplasmic release and lysosomal escape, and only a low dose is required.
On the basis of Example 1 or 2, use of a viral vector-based RNA delivery system in the manufacture of a medicament for treating a disease is provided in this example. The medicament is used for treating colitis. This example will specifically illustrate the effect of the viral vector-based RNA delivery system in the treatment of colitis through the following two experiments.
In the first experiment, we set up 3 experimental groups and 2 control groups. The experimental groups were AAV-CMV-siRTNF-α (low) group, AAV-CMV-siRTNF-α (medium) group, and AAV-CMV-siRTNF-α (high) group; and the control groups were Normal group and AAV-CMV scrR group.
The experimental protocol is shown in
The in vivo expression of the AAV system was monitored by small animal in vivo imaging. The results are shown in
DSS-induced chronic colitis model was then constructed, during which weights was recorded every two days. The results are shown in
At the end of the tenth week of model construction, the in vivo expression of the AAV system was monitored by small animal in vivo imaging, and then the mice were sacrificed for observation of the colon. The results are shown in
The disease index of mice in each group was scored and counted, and the results are shown in
The levels of TNF-α siRNA in mice of each group were detected, and the results are shown in
The levels of TNF-α mRNA in mice of each group were detected, and the results are shown in
The pro-inflammatory cytokines IL-6, 11-12 and IL-23 in the mouse colon were detected, and the results are shown in
HE staining and pathological scoring statistics were performed on mouse colon sections, and the results are shown in
The above experiments show that the use of AAV with high affinity for the liver to encapsulate the CMV-siRTNF-α circuit can achieve long-term expression of TNF-α siRNA and long term TNF-α silencing, and can alleviate colitis to a certain extent, with great drug potential and clinical research value.
In the second experiment, we set up three experimental groups and two control groups. Wherein, the experimental groups were AAV-CMV-siRT+B+I (low) group, AAV-CMV-siRT+B+I (medium) group, and AAV-CMV-siRT+B+I (high) group; and the control groups were Normal group and AAV-CMV-scrR group.
The AAV-CMV-siRT+B+I (low) group, AAV-CMV-siRT+B+I (medium) group, and AAV CMV-siRT+B+I (high) group used AAV-5 type adeno-associated virus with high affinity for the liver to encapsulate the TNF-α siRNA, B7-siRNA and Integrin α4 siRNA element tandem drug delivery system (AAV-CMV-siRT+B+I). Mice were injected with 25 μL, 50 μL and 100 μL of AAV solution with a titer of 1012 V·g/ml through the tail vein.
The in vivo expression of the AAV system was monitored by small animal in vivo imaging. The results are shown in
DSS-induced chronic colitis model was then constructed, during which weights was recorded every two days. The results are shown in
At the end of the tenth week of model construction, the in vivo expression of the AAV system was monitored by small animal in vivo imaging, and then the mice were sacrificed for observation of the colon. The results are shown in
The disease index of mice in each group was scored and counted, and the results are shown in
The levels of TNF-α siRNA, B7 siRNA and integrin α4 siRNA were detected in mouse plasma, and the results are shown in
The levels of TNF-α siRNA, B7 siRNA and integrin α4 siRNA were detected in mouse liver, and the results are shown in
The levels of TNF-α siRNA, B7 siRNA and integrin α4 siRNA were detected in mouse colon, and the results are shown in
The levels of TNF-α mRNA, B7 mRNA and integrin α4 mRNA were detected in mouse colon, and the results are shown in
HE staining and pathological scoring statistics were performed on mouse colon sections, and the results are shown in
The above experiments show that the use of AAV with high affinity for the liver to encapsulate the CMV-siRT+B+I circuit can achieve long-term expression of TNF-α siRNA, B7 siRNA and integrin α4 siRNA and multiple target gene silencing, and can significantly alleviate the degree of colon inflammation, with great drug potential and clinical research value.
On the basis of Example 1 or 2, use of a viral vector-based RNA delivery system in the manufacture of a medicament for treating a disease is provided in this example. The medicament is used for treating lung cancer. This example will specifically illustrate the effect of the viral vector-based RNA delivery system in the treatment of lung cancer through the following four experiments.
In the first experiment, we used AAV-5 adeno-associated virus with high affinity for the liver to encapsulate the EGFR siRNA system (AAV-CMV EGFR siRNA) and the KRAS siRNA system (AAV-CMV KRAS siRNA). Mice were injected with 100 μL of AAV solution with a titer of 1012 V·g/ml through the tail vein. The in vivo expression of the AAV system was monitored by small animal in vivo imaging. After 3 weeks, it was found that the AAV system was stably expressed in the body, especially in the liver.
In the second experiment, one experimental group and two control groups were set up, wherein the experimental group was the AAV-CMV KRAS-siRNA group, and the control groups were the PBS group and the AAV-CMV-scrR group.
The same number of mice were selected from each group. Mouse lung cancer cells (LLC cells) were injected into the mice, and CT scanning technology was used to observe the progress of mouse model establishment. After 30 days, the successfully established mice were administered once every two days. Specifically, mice in the PBS group/AAV-CMV-scrR group/AAV-CMV KRAS siRNA group were injected with PBS buffer/AAV-CMV-scrR/AAV-CMV KRAS siRNA once every two days for treatment. Survival analysis and tumor evaluation were performed on the mice. Treatment was stopped after 7 administrations.
The survival of mice in each group was counted within 100 days after treatment, and the results are shown in
CT scanning was performed on mice in each group before and after administration. 3D modeling of mouse lung tissue was performed based on the CT images, and the tumor volume was calculated. The results are shown in
The expression levels of KRAS protein and mRNA in the lung of mice in each group were detected by RT-qPCR and Western blotting, respectively, and the results are shown in
The above experiments show that AAV-CMV-KRAS siRNA had a significant therapeutic effect on lung cancer tumors in mice.
In the third experiment, one experimental group and two control groups were set up, wherein the experimental group was the AAV-CMV EGFR-siRNA group, and the control groups were the PBS group and the AAV-CMV-scrR group.
EGFR-DEL19 mouse model was constructed and fed with doxycycline feed to induce tumor occurrence. After 30 days, the successfully constructed mice were administered once every two days. Specifically, mice in the PBS group/AAV-CMV-scrR group/AAV-CMV EGFR siRNA group were injected with PBS buffer/AAV-CMV-scrR/AAV-CMV EGFR siRNA once every two days for treatment. Survival analysis and tumor evaluation were performed on the mice. Treatment was stopped after 7 administrations.
The survival of mice in each group was counted within 100 days after treatment, and the results are shown in
CT scanning was performed on mice in each group before and after administration, and the CT images are shown in
The expression levels of EGFR protein and mRNA in the lung of mice in each group were detected by RT-qPCR and Western blotting, respectively, and the results are shown in
The above experiments show that AAV-CMV-EGFR siRNA had a significant therapeutic effect on EGFR-mutated lung cancer tumors in mice.
In the fourth experiment, two experimental groups and two control groups were set up, wherein the experimental groups were the AAV-CMV KRAS-siRNA group the AAV-CMV EGFR-siRNA group, and the control groups were the PBS group and the AAV-CMV-scrR group.
EGFR-DEL19 mouse model was constructed and fed with doxycycline feed to induce tumor occurrence. After 30 days, the successfully constructed mice were administered once every two days. Specifically, mice in the PBS group/AAV-CMV-scrR group/AAV-CMV EGFR siRNA group/AAV-CMV KRAS siRNA group were injected with PBS buffer/AAV-CMV-scrR/AAV CMV EGFR siRNA/AAV-CMV KRAS siRNA once every two days for treatment.
After treatment, alanine aminotransferase (ALT), aspartate aminotransferase (AST), total bilirubin (TBIL), serum alkaline phosphatase (ALP), creatinine (CREA) and blood urea nitrogen (BUN) were detected in each group of mice, and the results are shown in
The above experiments demonstrate that the EGFR siRNA system (AAV-CMV-EGFR siRNA) and KRAS siRNA system (AAV-CMV-KRAS siRNA) encapsulated with AAV-5 type adeno-associated virus with high affinity for the liver is safe and reliable and will not produce negative effects, which is suitable for large-scale promotion and application.
On the basis of Example 1 or 2, use of a viral vector-based RNA delivery system in the manufacture of a medicament for treating a disease is provided in this example. The medicament is used for treating pulmonary fibrosis. This example will specifically illustrate the effect of the viral vector-based RNA delivery system in the treatment of pulmonary fibrosis through the following experiments.
In this example, AAV-5 type adeno-associated virus with high affinity for the liver was used to encapsulate anti-miR-21/TGF-β1 siRNA/anti-miR-21+TGF-β1 siRNA system to obtain AAV-anti-miR21/AAV TGF-β1 siRNA/AAV-MIX, respectively. Mice were injected with 100 μL of AAV solution with a titer of 1012 V·g/ml through the tail vein. The in vivo expression of the AAV system was monitored by small animal in vivo imaging, and after 3 weeks, the AAV system was stably expressed in the body, especially in the liver.
Mice were then selected for modeling. After the modeling was successful, PBS buffer/AAV scrR/AAV-anti-miR21/AAV TGF-β1 siRNA/AAV-MIX (10 mg/kg) was injected into mice to obtain PBS group/AAV scrR group/AAV-anti-miR21 group/AAV TGF-β1 siRNA group/AAV-MIX group, respectively.
The relative TGF-β1 mRNA level was detected in mice in the Normal group, PBS group, AAV-scrR group, and AAV TGF-β 1 siRNA group, and the results are shown in
The relative miR21 mRNA level was detected in mice in the Normal group, PBS group, AAV-scrR group, and AAV-anti-miR21 group, and the results are shown in
Hydroxyproline is the main component of collagen, and its content reflects the degree of pulmonary fibrosis. The hydroxyproline content of mice in each group was detected, and the results are shown in
On the basis of Example 1 or 2, use of a viral vector-based RNA delivery system in the manufacture of a medicament for treating a disease is provided in this example. The medicament is used for treating glioblastoma. This example will specifically illustrate the effect of the viral vector-based RNA delivery system in the treatment of glioblastoma through the following experiments.
In this example, AAV-5 type adeno-associated virus with high affinity for the liver was used to encapsulate the EGFR siRNA system (AAV-CMV RVG-siRE) and the EGFR siRNA and TNC siRNA system (AAV-CMV RVG-siRE+T). Mice were injected with 100 μL of AAV solution with a titer of 1012 V·g/ml through the tail vein. The in vivo expression of the AAV system was monitored by small animal in vivo imaging, and after 3 weeks, the AAV system was stably expressed in the body, especially in the liver.
Mice were selected and injected with glioblastoma cells (U-87 MG-Luc cells). From the 7th day to the 21st day, mice were injected with PBS buffer/AAV-CMV-scrR/AAV-CMV RVG-siRE/AAV-CMV RVG-siRE+T (5 mg/kg) every two days for treatment, to obtain PBS group/AAV scrR group/AAV-CMV RVG-siRE group/AAV-CMV RVG-siRE+T group, respectively.
Survival analysis was performed on mice in each group, and the survival rate of mice in each group was counted at 20 days, 40 days, 60 days, and 80 days after receiving treatment. The results are shown in
Tumor evaluation was performed on mice in each group. Specifically, BLI in vivo imaging was performed on mice on days 7, 14, 28, and 35. The results are shown in
On the basis of Example 1 or 2, use of a viral vector-based RNA delivery system in the manufacture of a medicament for treating a disease is provided in this example. The medicament is used for treating obesity. This example will specifically illustrate the effect of the viral vector-based RNA delivery system in the treatment of obesity through the following experiments.
AAV-5 type adeno-associated virus with high affinity for the liver was used to encapsulate the PTP1B siRNA system (AAV-CMV-siRP/AAV-CMV RVG-siRP). Mice were injected with 100 μL of AAV solution with a titer of 1012 V·g/ml through the tail vein. The in vivo expression of the AAV system was monitored by small animal in vivo imaging, and after 3 weeks, the AAV system was stably expressed in the body, especially in the liver.
C57BL/6 mice were selected and injected with PBS buffer/AAV-CMV-scrR/AAV-CMV siRP/AAV-CMV RVG-siRP 12 weeks later, and once every two days for 24 days to obtain PBS group/AAV-CMV-scrR group/AAV-CMV-siRP group/AAV-CMV RVG-siRP group, respectively. The changes in body weight, weight of epididymal fat pads, initial food intake, serum leptin content, blood sugar content, basal glucose content, serum total cholesterol (TC), triglyceride (TG), low-density lipoprotein protein (LDL), body length, and food intake of mice in each group were detected and counted. The results are as follows.
As shown in
As shown in
As shown in
As shown in
As shown in
As shown in
As shown in
As shown in
As shown in
The above experiments can demonstrate that AAV-CMV-siRP and AAV-CMV RVG-siRP had a certain degree of inhibitory effect on obesity.
On the basis of Example 1 or 2, use of a viral vector-based RNA delivery system in the manufacture of a medicament for treating a disease is provided in this example. The medicament is used for treating Huntington's disease. This example will specifically illustrate the effect of the viral vector-based RNA delivery system in the treatment of Huntington's disease through the following experiments.
In this example, AAV-5 type adeno-associated virus with high affinity for the liver was used to encapsulate the HTT siRNA system (AAV-CMV RVG-siRmHTT). Mice were injected with 100 μL of AAV solution with a titer of 1012 V·g/ml through the tail vein. The in vivo expression of the AAV system was monitored by small animal in vivo imaging, and after 3 weeks, the AAV system was stably expressed in the body, especially in the liver.
Mice was then selected for modeling. After the completion of modeling, mice were injected with PBS buffer/AAV-CMV-scrR/AAV-CMV-siRmHTT/AAV-CMV RVG-siRmHTT to obtain PBS group/AAV-CMV-scrR group/AAV-CMV-siRmHTT group/AAV-CMV RVG-siRmHTT group. After the above solution was injected into the tail vein, the plasma exosomes were isolated, labeled with PKH26 dye, and co-cultured with cells to observe the absorption of exosomes by cells. The results are as follows.
As shown in
As shown in
As shown in
As shown in
As shown in
As shown in
The above experiments can demonstrate that intravenous injection of AAV-CMV RVG-siRmHTT can help reduce mHTT protein and toxic aggregates in the striatum and cortex, thereby exerting a therapeutic effect on Huntington's disease.
The terms “upper”, “lower”, “front”, “back”, “left”, “right”, etc. used herein are only used to express the relative positional relationship between related parts, but not to limit the absolute position of these related parts.
The terms “first”, “second”, etc. used herein are only used to distinguish each other, but do not indicate the degree of importance, order, or the prerequisite for each other's existence.
The terms “equal”, “identical”, etc. used herein are not limitations in a strict mathematical and/or geometric sense, but also include errors that are understandable by those skilled in the art and allowed in manufacturing or use.
Unless otherwise stated, numerical ranges herein include not only the entire range within both endpoints, but also several subranges subsumed therein.
The preferred specific embodiments and examples of the present application have been described in detail above in conjunction with the accompanying drawings. However, the present application is not limited to the above-mentioned embodiments and examples. Within the scope of knowledge possessed by those skilled in the art, various changes can be made without departing from the concept of the present application.
| Number | Date | Country | Kind |
|---|---|---|---|
| 202110336982.1 | Mar 2021 | CN | national |
This application is a continuation application of International Application No. PCT/CN2022/083601, filed Mar. 29, 2022, which application claims priority to Chinese Application No. CN202110336982.1, filed Mar. 29, 2021, the disclosures of which are incorporated herein by reference in their entirety.
| Number | Date | Country | |
|---|---|---|---|
| Parent | PCT/CN2022/083601 | Mar 2022 | US |
| Child | 18374253 | US |