The present disclosure relates to diagnostic and therapeutic conjugates and use of such conjugates to diagnose and treat cancer. More particularly, the present disclosure relates to biomedical polymer nanoconjugates and their use to diagnose and treat cancer.
Cancer (malignant neoplasm) is the number two killer of people in the U.S. Each year in the U.S. more than a million people are diagnosed with cancer and half of those will ultimately die from the disease. Cancer occurs when normal living mammalian cells undergo neoplastic (malignant) transformation. Cancer is tenacious in its ability to uncontrollably and rapidly metastasize throughout the mammalian body, thus giving rise to a high mortality rate.
Cancer cure rates have increased dramatically over the years. This positive trend is a result of the widespread use of improved screening procedures that often lead to the early diagnosis/detection of cancer. However, as more selective treatment strategies have been developed, it is necessary to develop new and improved early stage clinical diagnostic procedures that can be used far earlier to determine a potential treatment strategy based on the biological properties and proliferation of the cancer. In addition, it is desired to develop non-invasive procedures that can be used for determining either a positive or negative response to a treatment strategy as early as possible thus extending the mammalian host's viability.
The first step in clinically treating cancer is to accurately diagnose the location and presence of the disease. This means determine the location of the cancer and confirm that the suspected cancer is cancer. The area of the body where the tumor or cancer is identified using symptomatology reports from a patient and then x-rays or other diagnostic tools are utilized to verify the initial symptoms and to identify the specific location of the cancer. That the location is cancerous is ultimately determined from a biopsy. Examination of a sample of suspected cancerous growth by a cancer specialist examining the biopsy confirms that the tissue is either benign or it is malignant cancer and if it is cancer, then what type of cancer and what the stage of development of the cancer is determined. Non-invasive imaging techniques are revolutionizing understanding diseases at the cellular and molecular levels. However, more is needed.
Among the current available non-invasive imaging modalities, positron emission tomography (PET) has demonstrated its great potential in the field of molecular imaging due to its superior sensitivity and specificity in diverse applications, the very small amount of agent required and the ability to quantitatively analyze the regions of interest. Since the completion of human genome sequence, there have been considerable research interests in the assessment of gene functions and protein-protein interactions non-invasively using molecular imaging approaches. Of the various PET probes that have been developed to image gene expression in small animal models, oligonucleotides appear to be an inexhaustible gold mine for the development of new tracers with high specificity considering that an oligonucleotide with more than 12 nucleobases could represent a unique sequence in the whole human genome with a gene number estimated between 24,000 and 30,000, and alternative polyadenylation and splicing could result in a number of messenger ribonucleic acid (mRNA) between 46,000 and 85,000.
The techniques of antisense mRNA originated from the natural modulation of gene replication and expression in bacteria via small complementary RNA molecules in an opposite direction (antisense). However, the naturally occurring oligonucleotides with 2′-deoxyphosphodiester cannot be directly applied to nuclear imaging because they are rapidly degraded in vivo by endo- and exo-nucleases. To increase the in vivo stability of oligonucleotides without significant alteration of their pharmacokinetics and targeting properties, many chemical modifications have been made to the sugar-phosphate backbone, including morpholino, phosphorothioate, phosphoroamidate, methylphosphonate, 2′- or 3′-modified derivatives, peptide nucleic acids (PNAs), and locked nucleic acids. Peptide nucleic acids (PNAs) are a unique type of oligonucleotides, which was initially introduced by Nielsen et al. in 1991 as ligands for the double stranded DNA recognition. They are synthetic DNA mimics featuring a chain with repeating N-(2-aminoethyl)glycine units instead of the sugar-phosphate backbone.
Due to the structural characteristics (e.g., neutrality and flexibility), PNAs are resistant to the in vivo enzymatic degradation. PNAs bind complementary DNAs or RNAs with high affinity and specificity even under low ionic strength conditions. Recent work has shown that PNAs can be used as molecular hybridization probes, and nuclear imaging tracers.
Using antisense PNAs as molecular imaging probes has a major obstacle in that they have very poor permeability across biologic membranes, which is inherent from their structural feature. Therefore for the hybridization of an unmodified PNA with its target mRNA molecule in vitro, it often requires that the PNA be physically injected into the intracellular plasma. Attempts to overcome this obstacle have been resorted to the drug-delivery techniques, which include using cationic lipids (or polyamines) and liposomes, nanoparticles, and direct conjugation with monoclonal antibody or peptides, etc. Recently it was reported that PNAs with four lysines at the C terminus (PNA-K4 oligomers) demonstrated sequence-specific antisense activity in most tissues that expressed a specific gene.
Radionuclides such as 60Cu, 61Cu and 64Cu among other radionuclides respectively are utilized extensively in the diagnosis and treatment of cancer in living mammals. These radionuclides are useful for diagnosis (60Cu, 61Cu and 64Cu); internal radiation therapy (61Cu and 64Cu) because of their positron—emission and/or toxicity to cancer and their characteristic intermediate half-life and multiple decay mode. Such diagnostic and therapeutic efforts against cancer include the effective administration of radiolabeled chemicals using highly purified 60Cu, 61Cu and 64Cu. 64Cu is particularly useful. The principal advantage to such use is that the radionuclide identifies a location for the cancer as well as provides a cytotoxic effect against the cancer.
Synthetic methodologies are enabling advances in the design of polymeric materials that actively control cellular and physiologic responses. These methods produce materials that are incorporated into scaffolds adaptive to body blood lumens and capable of performing specific functions while being minimally detrimental to normal cellular processes and surrounding tissues for use in therapeutic, drug delivery, and tissue engineering applications.
However, a need continues to exist for enhanced methods that can more accurately diagnose cancer and more particularly assess the response to anticancer therapy, as such methods would have a significant positive impact on determining optimal therapy for treating cancer patients. Also new methods are needed to treat cancer.
So despite the aforegoing remarkable advances and other advances in cancer diagnostics and cancer detection technology, it remains highly desirable to have an enhanced cancer detection and treatment system for use in a living mammal such as in a living human.
The present disclosure provides a functional biologically active functional water dispersible synthetic conjugate useful for early stage diagnosing and treating cancer in a living mammal, comprising a nanoscale particle having associated therewith an intracellular targeting ligand comprising a PNA, or another nuclease resistant oligonucleotide analog such as MOE-mRNA (2′-methoxyethyl mRNA) or LNA (locked nucleic acid), having a sequence that binds selectively to an uniquely expressed or overexpressed mRNA specific to the cancer or disease state in a living mammal. In one aspect the uniquely overexpressed target specific to the cancer or disease state is the unr mRNA (see SEQ ID NO: 2) which can be targeted by the antisense sequence PNA50 (see SEQ ID NO: 3).
In a further aspect, a permeation peptide is additionally associated with a biologically active particle conjugate and PNA. In a further aspect the permeation peptide is an effective permeation peptide which comprises the HIV-1 TAT protein transduction domain further comprising a polypeptide having a sequence such as the sequence shown in SEQ ID NO: 1.
In a further aspect, a functional biologically active particle conjugate comprises water dispersible biomedically and pharmacologically acceptable polydispersity globular macromolecules, particles, or nanoparticles. Useful particles include those particles disclosed in the U.S. Pat. No. 6,383,500 which issued to Karen Wooley et al. on May 7, 2002 (hereafter referred to as the '500 patent) which is incorporated herein in its entirety by reference. Further useful particles include dendrimers, micelles, liposomes, etc. as disclosed in Pharmacol. Rev. 2001, 53, 283-318; Nature Rev. Drug Disc. 2003, 2, 347-360.
In an aspect a method of identifying uniquely expressed or overexpressed mRNA comprises using SAGE or DNA chip to quantify gene expression in a target cell, comparing the gene expression profile to expression databases, and identifying a sequence that is most differentially expressed and is in the highest amount or is uniquely expressed to identify an mRNA of interest, obtaining a clone containing the cDNA for the mRNA of interest and producing the mRNA in vitro by RNA polymerase, mapping accessible sites by either the modified RT-ROL assay and/or SAABS assay, screening potential ODNs by the Dynabead dot blot assay and quantifying the binding of ODNs by the Dynabead direct binding assay with 32P-labeled ODN.
In a further aspect, the identified sequence is modified to obtain a useful targeting ligand by synthesizing and recovering Cys-Tyr-PNA-Lys4 corresponding to the tightest binding ODNs (or with another permeation peptide in place of Lys4), quantifying binding of the hybrid PNAs by the Dynabead direct binding assay with radioiodinated PNA, conjoining the highest affinity PNAs to fluorescein and DOTA for fluorescence assays of cell binding in vitro or in vivo (mouse xenograft) and conjoining PNAs with the highest affinity to SCK nanoparticles through an appended lysine or other suitable accommodating site-specific coupling moiety.
In an aspect, an isolated, purified and characterized PNA having a unr mRNA binding antisense sequence PNA50 (see SEQ ID NO: 3).
In an aspect, an intracellular targeting ligand comprises a PNA, or another nuclease resistant oligonucleotide analog such as MOE-mRNA or LNA, having a sequence that binds selectively to an uniquely expressed or overexpressed mRNA specific to the cancer or disease state and a permeation peptide (e.g., HIV-1 TAT protein transduction domain, See SEQ ID NO: 1). In one aspect the uniquely overexpressed target specific to the cancer or disease state is the unr mRNA (see SEQ ID NO: 2) which can be targeted by the antisense sequence PNA50 (See SEQ ID NO: 3).
In an aspect, an intra intracellular targeting ligand useful for detection of cancer in a living mammal comprises a PNA, or another nuclease resistant oligonucleotide analog such as MOE-mRNA or LNA, having a sequence that binds selectively to an uniquely expressed or overexpressed mRNA specific to the cancer or a nuclease resistant oligonucleotide analog MOE-mRNA or LNA, a permeation peptide and a reporter capable of detecting cancer, such as an emission capable fluorophore or a radionuclide or both a fluorophore and a radionuclide. In an aspect the living mammal is a living human.
In an aspect, an active targeting cancer detection system comprises a particle based moiety having associated therewith a PNA or another nuclease resistant oligonucleotide analog that does not activate the degradation of the mRNA by RNase H, such as MOE-mRNA or LNA, having a unr mRNA binding sequence such as PNA50 (See SEQ ID NO: 3) or any sequence that binds selectively to an unique or overexpressed mRNA specific to the cancer or disease state, a permeation peptide (e.g., HIV-1 TAT protein transduction domain See SEQ ID NO: 1), and a reporter capable of detecting cancer, such as an emission capable fluorophore or a radionuclide or both a fluorophore and a radionuclide.
In an aspect, a diagnostic target-specific imaging probe comprises a particle-based moiety having associated therewith a PNA or another nuclease resistant oligonucleotide analog that does not activate the degradation of the mRNA by RNase H, such as MOE-mRNA or LNA, having a unr mRNA binding sequence such as PNA50 (see SEQ ID NO: 3) or any sequence that binds selectively to an uniquely expressed or overexpressed mRNA specific to the cancer or disease state, a permeation peptide (e.g., HIV-1 TAT protein transduction domain, see SEQ ID NO: 1), and a diagnostic imaging detectable amount of at least one detectably labeled compound.
In an aspect, a method of detecting cancer comprises administering an effective amount of a particle-based moiety having associated therewith a PNA or another nuclease resistant oligonucleotide analog that does not activate the degradation of the mRNA by RNase H, such as MOE-mRNA or LNA, having a unr mRNA binding sequence such as PNA50 (see SEQ ID NO: 3) or any sequence that reactively and selectively binds to an uniquely expressed or overexpressed mRNA specific to the cancer, and a permeation peptide and a reporter capable of detecting the cancer, such as an emission-capable fluorophore, or a radionuclide, or both a fluorophore and a radionuclide. In an aspect the detected reporter identifies the locus of the cancer in the living mammal.
In an aspect, an anticancer composition effective for treating human or non-human neoplastic disorders comprises a particle-based moiety having associated therewith at least a PNA or another nuclease resistant oligonucleotide analog that does not activate the degradation of the mRNA by RNAseH, such as MOE-mRNA or LNA, having a unr mRNA binding sequence such as PNA50 (see SEQ ID NO: 3) or any sequence that binds selectively to an uniquely expressed or overexpressed mRNA specific to the cancer or disease state, a permeation peptide, and an effective amount of at least one chemotherapeutic compound, cytotoxic compound, radionuclide or prodrug in the composition, and optionally further comprising a pharmaceutically acceptable carrier such as saline solution.
In an aspect, a radiotherapeutic composition effective for treating human or non-human neoplastic disorders comprises a particle conjugate comprising a particle-based moiety having associated therewith at least a PNA or another nuclease resistant oligonucleotide analog that does not activate the degradation of the mRNA by RNase H, such as MOE-mRNA or LNA, having a unr mRNA binding sequence such as PNA50 (see SEQ ID NO: 3) or any sequence that binds selectively to an uniquely expressed or overexpressed mRNA specific to the cancer or disease state, a permeation peptide, and an effective amount of at least one radionuclide with cytotoxic properties, and optionally further comprising a pharmaceutically acceptable carrier such as saline solution.
In an aspect, a method for determining response to anticancer therapy in a living mammal comprises administering to a living mammal an imaging probe comprising a particle-based moiety having associated therewith a PNA or another nuclease resistant oligonucleotide analog that does not activate the degradation of the target mRNA by RNase H, such as MOE-mRNA or LNA, having a unr mRNA binding sequence such as PNA50 (see SEQ ID NO: 3) or any sequence that binds selectively to a unique or overexpressed mRNA specific to the cancer or disease state, a permeation peptide, and a diagnostic imaging detectable amount of at least one detectably labeled compound at a first selected time, detecting an image of a tissue, administering the imaging probe a second time after the anticancer therapy, detecting an image of the same tissue, comparing the two images and determining a response based on that comparison.
In an aspect, a method of screening candidate chemicals for toxicity/lethality to cancer comprises administering, to a mammal, a particle conjugate comprising a PNA or another nuclease resistant oligonucleotide analog that does not activate the degradation of the mRNA by RNase H, such as MOE-mRNA or LNA, having a unr mRNA binding sequence such as PNA50 (see SEQ ID NO: 3) or any sequence that binds selectively to a uniquely or overexpressed mRNA specific to the cancer or disease state, a permeation peptide, and diagnostic imaging detectable amount of at least one detectably labeled compound at a first time, detecting and acquiring an image of a tissue, administering to the mammal a candidate chemical, detecting and acquiring an image of tissue, comparing the detected images and making a determination as to whether there has been a prophylactic effect on the progression of the cancer. In an aspect the PNA is conjugated to a biologically active water dispersible nanoparticle.
In as aspect, a pharmaceutical kit comprises a container. In an aspect the container houses a PNA or another nuclease resistant oligonucleotide analog that does not activate the degradation of the target mRNA by RNase H, such as MOE-mRNA or LNA, having a unr mRNA binding sequence such as PNA50 (see SEQ ID NO: 3) or any sequence that binds selectively to an unique or overexpressed mRNA specific to a cancer or disease state, a permeation peptide, a pharmaceutical agent selected from the group consisting of chemotherapeutic drugs, cytotoxic drugs, prodrugs, and a radiopharmaceutical, and optionally a suitable pharmaceutically acceptable carrier. In an aspect the PNA is conjugated to a biologically active nanoparticle.
In an aspect, a PNA-guided tumor therapy comprises administering to a mammalian patient a therapeutically effective amount of a PNA or another nuclease resistant oligonucleotide analog that does not activate the degradation of the mRNA by RNase H, such as MOE-mRNA or LNA, having a unr mRNA binding sequence such as PNA50 (see SEQ ID NO: 3) or any sequence that binds selectively to a unique or overexpressed mRNA specific to the cancer or disease state and a permeation peptide, whereby the particle conjugate is self guided to the tumor by the PNA and a pharmaceutical agent selected from at least one chemotherapeutic drug, cytotoxic drug, prodrug and a radiopharmaceutical. In an aspect the PNA is conjugated to a biologically active nanoparticle.
In an aspect, a medical apparatus useful for treating and detecting cancer, comprises a particle based moiety functioning as a scaffold and having associated therewith a PNA or another nuclease resistant oligonucleotide analog that does not activate the degradation of the mRNA by RNase H, such as MOE-mRNA or LNA, having a unr mRNA binding sequence such as PNA50 (see SEQ ID NO: 3) or any sequence that binds selectively to a unique or overexpressed mRNA specific to cancer or disease state, and a permeation peptide. In an aspect the unique or overexpressed mRNA is a signature of cancer or a disease state in a living mammal and the methods, compositions, apparatus and scaffolding described herein provide a method of uniquely diagnosing and targeting that signature.
In an aspect, a bioactive pharmaceutical composition useful for treating cancer comprises a PNA or another nuclease resistant oligonucleotide analog that does not activate the degradation of the mRNA by RNase H, such as MOE-mRNA or LNA, having a unr mRNA binding sequence such as PNA50 (see SEQ ID NO: 3) or any sequence that binds selectively to a uniquely expressed or overexpressed mRNA specific to the cancer or disease state, and a permeation peptide. If desired, the pharmaceutical composition comprises a pharmaceutical, or a pharmaceutically acceptable water soluble salt thereof, and a pharmaceutically acceptable carrier, excipient, or diluent or saline composition. The pharmaceutically active agent can be present within the particles. In an aspect a nano-scale particle-based moiety is conjugated to the PNA or analog.
In a further aspect, a method of effectively delivering a bioactive pharmaceutically active agent to a cell, tissue, organ, or animal, comprises contacting the cell, tissue, organ, or animal in vivo or in vitro, with a PNA or another nuclease resistant oligonucleotide analog that does not activate the degradation of the mRNA by RNase H, such as MOE-mRNA or LNA, having a unr mRNA binding sequence such as PNA50 (see SEQ ID NO: 3) or any sequence that binds selectively to a unique or overexpressed mRNA specific to the cancer or disease state, a permeation peptide and further comprising a pharmaceutically active agent. In aspect the permeation peptide comprises HIV-1 TAT protein transduction domain having SEQ ID NO: 1). In an aspect a biologically active particle is associated with the PNA or analog.
The present disclosure provides new beneficial therapeutic nanoparticle conjugates and their use as molecular probes for the early stage detection of cancer and/or as therapeutic agents for the treatment of cancer. More in particular the present disclosure provides a unique targeting ligand optionally associated with biomedical nanoparticles which is useful in a medical diagnostic method to diagnose cancer or in a therapeutic method to treat cancer in a living mammal such as cancer in a living human.
The present disclosure provides an enhanced functional delivery system and process for effectively delivering particle conjugates into cells as effective cell, gene therapy, drug therapy and radiotherapy to living mammals such as to living humans.
The inventors discovered cell permeable SCK-PNA nanoconjugates having as an intracellular targeting ligand a PNA or another nuclease resistant oligonucleotide analog that does not activate the degradation of the mRNA by RNase H, such as MOE-mRNA or LNA, having a functional unr mRNA binding sequence such as PNA50 (see SEQ ID NO: 3) or a sequence that binds selectively to a unique or overexpressed marker mRNA specific to the cancer or disease state. The inventors have shown utility here in that their nanoconjugates with PNA50 concentrate in MCF-7 cells in vitro and in a mouse xenograft. The uniquely or overexpressed mRNA is referred to herein as a recognition element.
SCK nanoparticles are especially useful in that SCK nanoparticles provide high valency and functionality for highly functionally capable association with chelators and chemotherapeutic drugs, cytotoxic drugs and prodrugs. The increased valency is highly desired in that an increased number of functionalities can be advantageously capably attached to or associated with the nanoparticles thereby providing increased efficacy to the conjugated nanoparticles.
SCK nanoparticles useful herein include, but are not limited to, self-assemblying micellar assemblies of amphiphilic copolymers that have been stabilized through the incorporation of covalent cross-links in the shell layer. More particularly the particles comprise amphiphilic copolymers, having a cross linked shell domain and an interior core domain. Also provided are compositions comprising such particles including pharmaceutical compositions, methods of making the present particles and methods of using such particles for example for effective delivery of pharmaceutically active agents. In an aspect a useful particle includes a particle comprising an amphiphilic copolymer and having a core and a crosslinked shell which differs from the core in hydrophilicity and hydrophobicity, the shell comprising a region of the copolymer which differs in hydrophilicity and hydrophobicity from another region of the copolymer in the core, the copolymer being cross linked in the region within the shell, the copolymer region in the shell having a degree of crosslinking ranging from about 1% to about 80%, the copolymer being selected from among amphiphilic copolymers physically conducive to forming micelles prior to crosslinking. In an aspect an illustrative useful multifunctional nanodevice platform comprises the platforms disclosed in U.S. Pat. No. 6,471,968 which issued to Baker, Jr., et al on Oct. 29, 2002 and particles disclosed in U.S. Pat. No. 6,383,500 which issued to Karen L. Wooley et al On May 7, 2002. U.S. Pat. Nos. 6,471,968 and 6,383,500 are incorporated herein in their entirety by reference.
As used herein the term “SCK” means shell crosslinked knedel shell crosslinked nanoparticle.
As used herein, the term “nanodevice” refers to and includes, but is not limited to, small (e.g., invisible to the unaided human eye) compositions containing or associated with one or more useful “agents.” In its simplest form, the nanodevice comprises a physical composition such as a nanoparticle or a dendrimer associated with at least one agent that provides biological functionality (e.g., a radionuclide or a therapeutic agent).
In an aspect, a useful permeation peptide is the transduction domain of the HIV-1 TAT protein which is used to capably enable cell membrane transduction. (SEQ ID NO: 1)
As used herein the term “PTD” means Protein Transduction Domain and indicates the HIV-1 TAT protein transduction domain (see SEQ ID NO: 1)
In another aspect, a useful permeation peptide is the nuclear localizing sequence, herein referred to as “NLS”, for example, SEQ ID NO: 17 (KPKKKRKV), or the Lys4 tetrapeptide (SEQ ID NO: 18), which are used to capably enable cell membrane transduction of attached molecules or nanodevices.
Without being bound by theory these permeation peptide(s) are believed to capably and effectively enable reversible intracellular mobility/translocation of attached molecules and nanodevices and advantageously thereby allow useful cell targeting of molecules or nanodevices through binding to intracellular targets such as mRNA or other cell receptors, such as intracellular cytostolic proteins or membrane receptors, thereby increasing the numbers of cancer or disease-specific receptors.
In an aspect, the nanodevice is targeted to that target mRNA which is uniquely expressed or is significantly overexpressed in a living mammal afflicted with a disease such that the unique expression or significantly overexpression is significantly indicative of the presence of a disease or disease state in that living mammal having that unique or over expression of mRNA. Without being bound by theory, this enhanced targeting availability is believed to provide an enhanced method and system for the diagnosis and detection of cancer. Such targeting of a diseased cell is effected by an antisense PNA or other nucleic acid analog on the nanoconjugate that is complementary to a unique or overexpressed mRNA sequence that is unique to the diseased cancer cell in the living mammal. By complementary it is meant that the PNA or analog has a sequence that can recognize and bind to the mRNA which is associated with a disease by Watson Crick base pairing. Alternatively the targeting is effected by the PNA or other nucleic acid analog acting in a stand alone capacity. In an aspect the living mammal is a living human.
As used herein, the phrase “ . . . does not activate the degradation of the mRNA by RNase H . . . ” is meant that the moiety avoids mRNA degradation by RNase H and the mRNA remains significantly viable and functional.
In some aspects of the present disclosure, the living human is suspected of having cancer and a diagnosis is desired to confirm that, or in some aspects the presence of cancer is confirmed and a therapeutic treatment is desired.
In some aspects the cancer includes, but is not limited to, lung cancer, breast cancer, melanoma, colon cancer, renal cancer, testicular cancer, ovarian cancer, prostate cancer, hepatic cancer, germ cancer, epithelial cancer, head and neck cancer, pancreatic cancer, glioblastoma, astrocytoma, oligodendroglioma, ependymomas, neurofibrosarcoma, meningioma, liver cancer, spleen cancer, lymph node cancer, small intestine cancer, colon cancer, stomach cancer, thyroid cancer, endometrium cancer, skin cancer, esophagus cancer, and bone marrow cancer. In some embodiments, compositions comprising nanodevices, and any other desired components (e.g., pharmaceutically acceptable carriers, adjuvants and excipients) are administered to the subject. The present disclosure is not limited by the route of administration. Such efficacious administration routes include, but are not limited to, endoscopic, intratracheal, intralesion, percutaneous, intravenous, subcutaneous, and intratumoral administration.
Briefly, as is described herein, the inventors synthesized PNAs by using automated Fmoc solid phase synthesis on an ABI 8909 synthesizer using commercially available PNA and amino acid monomers and tri-tert-butyl-DOTA. PNA50 (see SEQ ID NO: 3) is a sequence that is complementary to (i.e., antisense), and shows high affinity (KD 20 μM) for site 2828-2845 of the unr mRNA (GI: 20070240) that is overexpressed in MCF-7 breast cancer cell line, as discovered by the inventors by a reverse transcriptase random oligodeoxynucleotide library assay (RT-ROL).
PNA50S (see SEQ ID NO: 4) is the sense sequence (has the same sequence as site 2828-2845) and is not complementary and shows little affinity (KD>10,000 pM) for the unr mRNA. The mRNA-recognition element is not limited to PNA, but in an aspect is a nuclease resistant oligonucleotide analog such as MOE-mRNA or LNA. In an aspect the mRNA-recognition element is MOE-mRNA. In an aspect the mRNA recognition element is LNA.
Bifunctional chelators (“BFC”) used to prepare new bioconjugates labeled with radionuclides of 2+ and 3+ metals include functional derivatives of 1,4,7,10-tetraazacyclododecane-1,4,7,10-tetraacetic acid (DOTA, CAS Reg #60239-18-1), 1,4,8,11-tetraazacyclotetradecane-1,4,8,11-tetraacetic acid (TETA, CAS Reg #339091-75-7), diethylenetriaminepentaacetic acid (DTPA, CAS Reg #67-43-6), wherein CAS means Chemical Abstracts Service.
The aforementioned three BFCs (herein after respectively DOTA, TETA, and DTPA) are commercially available from Macrocyclics Inc. (2110 Research Row, Suite 425, Dallas Tex. U.S.A.), Sigma-Aldrich Chemical Co. (3050 Spruce St., St. Louis Mo. U.S.A.), and/or Strem Chemicals, Inc. (7 Mulliken Way Newburyport Mass. U.S.A.). If desired, one of skill in the art can synthesize BFCs useful herein after reading this application.
In an aspect functional group(s) are effectively used for conjugation of radionuclides to SCK nanoparticles, including but not limited to carboxylic acid or amino groups. They are conjugated through multi-atom spacers (for example —(CH2)n—) to the nitrogen or carbon atoms of BFCs wherein n is an integer independently varying from 2 to about 10. In a further aspect, functional groups are useful for effective conjugation of a pharmaceutical agent such as a cytotoxic prodrug and radiopharmaceutical to the particle conjugate.
As to radionuclides, useful but not limiting radionuclides include 2+ and 3+ metal radioisotopes of biomedical interests (transition metals, lanthanides and actinides). The radionuclides may further extend to using radioiodine upon successful introduction of tyrosine or p-hydroxystyrene into the SCK.
The inventors provide data demonstrating the tumor-targeting (diagnostic) capability of a 64Cu-labeled SCK(PTD)-PNA nanoconjugate in MCF-7 tumor-bearing laboratory living mice as evidence of the credible, specific and general utility of the present disclosure.
The inventors synthesized and recovered (DOTA-SCK(PTD)-PNA50) and (DOTA-SCK(PTD)-PNA50S) as shown hereinafter. These nanoconjugates were each respectively recovered and purified as the titled respective material.
Nanoconjugate (DOTA-SCK(PTD)-PNA50) has a targeting sequence (PNA50) that is complementary (antisense) to the unr mRNA, which the inventors discovered is overexpressed in living MCF-7 breast cancer cells.
Nanoconjugate (DOTA-SCK(PTD)-PNA50S) has a control sequence (PNA50S) that is not complementary (sense). Both these nanoconjugates were respectively radiolabeled by the inventors with 64Cu, and were evaluated in a breast cancer mouse model (MCF-7 xenograft).
The inventors' data from that evaluation (of the aforementioned nanoconjugates) show that the MCF-7 tumor specificity of both nanoconjugates is about the same as the specificity of free respective DOTA-PNA50-K4 and DOTA-PNA50S-K4. Furthermore, compared to free PNAs and free SCKs, the SCK nanoconjugates surprisingly showed more optimal features (e.g., lower accumulation in the mice liver and kidneys) for either imaging by PET or therapy.
Advantageously the transduceable medical system of the present disclosure is capable of reversibly transducing peptides, proteins and synthetic constructs, which are not normally able to access intracellular components, across the cellular plasma membrane of living cells. This utility provides an enhanced technique available as a research tool.
As an aspect of the present disclosure, the inventors identified and selected the MCF-7 breast cancer cell line as a target cell line because the inventors discovered by analysis of SAGE libraries that that this breast cancer cell line possesses an overexpressed (10-fold) mRNA (unr) that is also very abundant (about 5,000 copies per cell). This present disclosure is not limited to MCF-7 cells and unr mRNA as over-expressed or uniquely expressed mRNAs can be found in other cancer cells by analysis of SAGE libraries or by DNA chip analysis.
The inventors identified sequences in the folded unr mRNA that are tightly bound by a complementary PNA (in this instance PNA50) by a RT-ROL assay. These are targeted sequences.
The inventors confirmed tight binding of PNA50 (approx. 10 pM KD) by a newly developed binding assay (Dynabead assay). The inventors confirmed that the sense sequence that is complementary to PNA50 (PNA50S) does not bind significantly.
The inventors confirmed binding to MCF-7 cells in cell culture by preparing and using fluorescently tagged PNA50 and PNA50S with attached NLS peptide sequence (F-PNA50x-NLS). X is either 50 or 50S.
The inventors confirmed selective targeting of MCF-7 tumor cells in mice by a 64Cu-tagged DOTA-PNA50x-K4, where DOTA binds the 64Cu, and K4 is four lysines for cell permeation. A selectivity of about 3:1 was observed for PNA50 as compared to PNA50S.
The inventors synthesized PNA50x-Lys for attachment to 64Cu-SCK-PTD and generated MCF-7 tumor detection device, which showed a selectivity level similar to that of free PNA. X is either 50 or 50S.
As used herein the singular forms “a”, “an” and “the” include plural referents unless the context clearly dictates otherwise. As used herein, the term “unr mRNA” means mRNA deriving from the transcription of the unr gene, the transcription unit located immediately upstream of the N-ras gene in the genome of several mammalian species.
As used herein the term “MOE-mRNA” means 2′-methoxyethyl mRNA which is a class of nucleic acid analogs complementary to the RNA template region and substituted in 2′ position with a 2-methoxyethyl group.
As used herein the term “ODN” means oligodeoxynucleotide.
As used herein the term “cDNA” means complementary DNA which is DNA that is synthesized, by reverse transcriptase, from a mRNA template.
As used herein, the term “PNA” means Peptide Nucleic Acid which is a synthetic DNA mimic featuring a chain with repeating N-(2-aminoethyl)glycine units instead of the sugar-phosphate backbone. Commercial monomers used to synthesize PNAs are N-aminoethyl-N-(adenin-9-ylacetyl)glycine, herein referred to as “A” in PNA sequences, N-aminoethyl-N-(cytosin-1-ylacetyl)glycine, herein referred to as “C” in PNA sequences, N-aminoethyl-N-(guanin-9-ylacetyl)glycine, herein referred to as “G” in PNA sequences, and N-aminoethyl-N-(thymin-1-ylacetyl)glycine, herein referred to as “T” in PNA sequences.
Without being bound by theory, it is believed that PNA mimics the behavior of DNA and binds complementary nucleic acid strands and because of the neutral backbone of PNA results in stronger binding and greater specificity than normally achieved.
As used herein the term “PNA-K4” means a PNA-conjugate with four lysines at the C terminus.
As used herein the term “LNA” means Locked Nucleic Acid which is an RNA derivative in which the ribose ring is constrained by a methylene linkage between the 2′-oxygen and the 4′-carbon. LNA monomers are bicyclic compounds structurally similar to RNA nucleosides. In LNA the furanose ring conformation is restricted by a methylene linker that connects the 2′-O position to the 4′-C position. Thus nucleic acids containing one or more LNA modifications are referred to herein as LNA.
As used therein the term “RT-ROL assay” means Reverse Transcriptase Random Oligodeoxynucleotide Library assay. In this assay antisense binding sites are identified by the ability of a random 9-mer oligonucleotide library terminating a specific base and a PCR tag to prime complementary DNA synthesis by reverse transcriptase. The cDNA is then amplified by PCR with a radiolabeled primer having the same sense as the RNA, and an unlabelled primer having the same sequence as the PCR tag.
As used herein the term “PCR” means Polymerase Chain Reaction which is a technique to amplify a specific region of single or double-stranded DNA.
As used herein the term “RT-PCR” means Reverse Transcriptase Polymerase Chain Reaction (aka RNA phenotyping, RNA-PCR or message amplification phenotyping) which is a method for amplification of a specific mRNA by prior use of reverse transcriptase to form a cDNA, then use of PCR to amplify the cDNA.
As used herein the term “SAABS” means Serial Analysis of Antisense Binding Sites.
As used herein the terms “PET” and “SPECT” mean Positron Emission Tomography and Single Photon Emission Computed Tomography, respectively.
As used herein, microPET (microPET®, Concorde Microsystems Inc., Knoxville, Tenn. USA) is a non limiting example of small animal imaging devices with high resolution useful in detecting the invention in vivo. Other manufacturer also offers other small animal scanner, for example Mosaic® from Phillips.
The term “biologically active,” as used herein, refers to a protein or other biologically active molecules (e.g., catalytic RNA) having structural, regulatory, or biochemical functions of a naturally occurring molecule.
The term “shell domain” means the outermost domain or peripheral layer of a particle of the present disclosure. When produced in a hydrophilic continuous medium, the peripheral layer of the micelles giving rise to such particles (and the peripheral layer of the particles themselves) is substantially hydrophilic; when produced in a hydrophobic continuous medium, the peripheral layer of the micelles giving rise to such particles (and the peripheral layer of the particles themselves) is substantially hydrophobic.
The term “interior core domain” means the domain of a micelle or particle interior to the shell domain.
The term “amphiphilic copolymer” means a copolymer which contains at least one hydrophilic domain and at least one hydrophobic domain.
The term “block copolymer” means a linear polymer having regions or blocks along its backbone chain which are characterized by similar hydrophilicity, hydrophobicity, or chemistry. The term “diblock copolymer” means a block copolymer comprising two blocks. The term “triblock copolymer” means a block copolymer comprising three blocks. The term “multiblock copolymer” means a block copolymer comprising a plurality of blocks.
The term “aggregation number” means the average number of amphiphilic copolymer molecules per micelle or particle.
The term “glass transition temperature”, herein referred to also with the symbol “Tg”, means the temperature at which a polymer changes from a glassy, hard state to a flexible state.
The term “micelle” includes without limitation micelles having shapes of spheres, cylinders, discs, needles, cones, vesicles, globules, rods, elipsoids, and any other shape that a micelle can assume under the conditions described herein, or any other shape that can be adopted through aggregation of the amphiphilic copolymers.
The term “particle” means a particle and the largest domain of which is less than one micron includes, but is not limited to, nanoparticles. Dendrimer may be employed as particles herein. Their branching shape provides them with large surface area to which to attach therapeutic agents or other biologically active molecules. In an aspect one dendrimer is associated or carries a molecule that recognizes cancer cells, a therapeutic agent to kill those cells, and a molecule that recognizes the signals of cell death. The shape of the particles includes spheres, cylinders, discs, needles, cones, vesicles, globules, rods, elipsoids, and any other shape that a micelle can assume under the conditions described herein, or any other shape that can be adopted through aggregation of the amphiphilic copolymers.
The term “monomer” means a molecule which is capable of combining with a number of like or unlike molecules to form a polymer.
The term “isolated” with respect to a composition such as a protein that the material has been prepared and recovered in a state substantially free of any and all components which might be normally present with it in nature.
The term “pharmaceutically active agent” means any physiologically or pharmacologically active substance that produces a local or systemic effect in animals, including warm-blooded mammals, humans, and primates; avians; household, sport, and farm animals; laboratory animals; fishes; reptiles; and zoo animals. As used herein, the term “test compound” or “candidate” refers to any chemical entity, pharmaceutical, drug and the like that can possibly be used to treat or prevent a disease, illness, sickness or disorder of bodily function. Test compounds include both known and potential therapeutic compounds. A test compound can be determined to be therapeutic by screening using the screening methods and screening compositions of the present disclosure. A known therapeutic compound refers to a therapeutic compound that has been shown to be effective in such treatment or prevention.
The term “sample” as used herein is used in its broadest sense and includes environmental and biological samples. Biological samples include viable and representative samples including animal, including human, fluid (e.g., blood, plasma and serum), solid (e.g., stool), tissue, liquid foods (e.g., milk) and solid foods (e.g., vegetables).
The term “permeable” pertains to the property of a domain whereby selected atoms or molecules can pass through the domain.
As used herein, the term “peptide” is any of a group of compounds comprising two or more amino acids linked by chemical bonding between their respective carboxyl and amino groups. The term “peptide” includes peptides and proteins that are of sufficient length and composition to affect a biological response, e.g. antibody production or cytokine activity whether or not the peptide is a hapten. The term “peptide” includes modified amino acids, such modifications including, but not limited to, phosphorylation, glycosylation, pegylation, lipidization and methylation.
As used herein, the term “polypeptide” is any of a group of natural or synthetic polymers made up of amino acids chemically linked together such as peptides linked together. The term “polypeptide” includes peptides, proteins, translated nucleic acid and fragments thereof.
As used herein, the term “polynucleotide” includes nucleotide sequences and partial sequences, DNA, cDNA, RNA variant isoforms, splice variants, allelic variants and fragments thereof.
The terms “protein”, “polypeptide” and “peptide” are used interchangeably herein when referring to a translated nucleic acid (e.g. a gene product).
As used herein, the term “nucleic acid” refers to oligonucleotides or polynucleotides such as deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) as well as analogs of either RNA or DNA, for example made from nucleotide analogs any of which are in single or double stranded form. As used herein the phrase “The Expedite 8909 Nucleic Acid Synthesis System” includes the 8909 synthesis system as well as synthesis systems which effectively synthesize DNA and RNA oligonucleotides as well as peptide nucleic acids (PNA) The 8909 system synthesizes short primers and probes as well as sequences exceeding 100-mer in scales ranging from 50 nmol to 15 μmol. This is available from SCIENTIFIC INC., Suite 111, 2131 Pleasant, Hill Rd Duluth Ga. 30096.
As used herein the term “nuclease resistant oligonucleotides” includes oligonucleotides usefully modified to exhibit resistance to nucleases and to hybridize with appropriate strength and fidelity to its targeted mRNA. Useful nuclease resistant oligonucleotides include those having various 2′-substitutions have been introduced in the oligonucleotides. The nuclease resistance of these compounds has been increased by the introduction of 2′-substituents such as halo, alkoxy and allyloxy groups.
As used herein the term “oligonucleotide” refers to a plurality of nucleotides joined together in a specific sequence from naturally and non-naturally occurring nucleobases. Useful nucleobases inside these joined through a sugar moiety via phosphorus linkages, and include adenine, guanine, adenine, cytosine, uracil, thymine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl, 2-propyl and other alkyl adenines, 5-halo uracil, 5-halo cytosine, 6-aza uracil, 6-aza cytosine and 6-aza thymine, pseudo uracil, 4-thiouracil, 8-halo adenine, 8-aminoadenine, 8-thiol adenine, 8-thiolalkyl adenines, 8-hydroxyl adenine and other 8-substituted adenines, 8-halo guanines, 8-amino guanine, 8-thiol guanine, 8-thiolalkyl guanines, 8-hydroxyl guanine and other 8-substituted guanines, other aza and deaza uracils, other aza and deaza thymidines, other aza and deaza cytosines, other aza and deaza adenines, other aza and deaza guanines, 5-trifluoromethyl uracil and 5-trifluoro cytosine. The sugar moiety may be deoxyribose or ribose. Useful oligonucleotides comprise modified nucleobases or nucleobases having other modifications, and in particular modifications that increase their nuclease resistance.
As used herein, the terms “bifunctional chelator” or “BFC” refer to organic compounds containing two or more donor atoms spatially situated so as to form coordinate bonds with the same metal atom (first function) and a chemical group suitable for conjugation to a biologically active moiety (second function). Useful chelators include those which are “multidentate”, which means they have multiple donor atoms available for simultaneous complexing with a suitable metal atom.
As used herein, the term “patient” and “subject” are synonymous and are used interchangeably herein and refer to living organisms.
As used herein, the term “expression” includes the biosynthesis of a product as an expression product from a gene such as the transcription of a structural gene into mRNA and the translation of mRNA into at least one peptide or at least one polypeptide.
As used here, the terms “isoforms” and “splice variant” includes alternative occurring forms of RNA transcribed from a genome as well as polypeptides encoded by a splice variant of mRNA transcribed from a gene.
As used herein, the term “therapeutic agent” is any molecule or atom which is conjugated, fused or otherwise affixed to a tumor targeting moiety to produce a conjugate which is useful for cancer therapy.
As used herein, the term “label” includes a detectable label which includes any radiolabeled species including 64Cu, fluorescent agents such as fluorescent proteins, and paramagnetic ions.
As used herein, the term “mammal” includes living mammals including living humans and living non-human animals such as murine, porcine, canine, rodentia and feline.
As used herein, the term “antisense” means a polynucleotide or analog whose sequence of bases is complementary to messenger RNA.
As used herein, the term “sense” means a polynucleotide or analog whose sequence of bases is identical to messenger RNA.
As used herein a “therapeutic amount” is an amount of drug or drug-conjugated moiety which produces a desired or detectable therapeutic effect on or in a mammal.
As used herein, the term “probe” includes DNA or RNA molecules of specific base sequence, labeled either radioactively or with a fluorophore, that are used to detect the complementary base sequence by hybridization.
As used herein pZero plasmid is used for a SAGE analysis from Invitrogen.
As used herein, the term “radiolabeled counterpart(s)” includes respective radiolabeled compounds.
As used herein, the term “detectably labeled” includes the respective radiolabeled compounds having an effective amount of an emitting radiolabel therewith and suitably accepting an emitting radiolabel for use in effective administration to living mammals.
As used herein, the symbol “Cu” means copper, “C” means carbon, “H” means hydrogen, “O” means oxygen, “N” means nitrogen, “Br” means bromine, “D” means deuterium, “Cl” means chlorine, “P” means phosphorous, “I” means iodine, “Na” means sodium, “Ar” means argon, “Kr” means krypton, “He” means helium, “Ne” means neon, “Ni” means nickel, “Li” means lithium.
As used herein in peptide sequences the codes “K” and “Lys” mean Lysine, “C” and “Cys” mean Cysteine, “Y” and “Tyr” mean Tyrosine, “P” and “Pro” mean Proline, “R” and “Arg” mean Arginine, “V” and “Val” mean Valine, “Q” and “Gln” mean Glutamine, “G” and “Gly” mean Glycine.
As used herein, the term “administration” includes the effective giving of a compound or moiety by any useful means to a living mammal and its successful introduction into the mammal such as in its gastrointestinal tract or in a blood lumen of the mammal in an effective method which results in that compound, its salt, its ions, metabolites or derivatives thereof being made biologically available to that mammal receiving administration of compound for medicinal use. In an aspect the mammal is a human. In an aspect the mammal is a nonhuman such as a rodent, a canine, or a feline. In an aspect the compound is made biologically available to the gastro intestinal tract of a living mammal patient.
As used herein, the expression “pharmaceutically acceptable” applies to a composition or its radiolabeled counterpart which contains composition ingredients that are compatible with other ingredients of the composition as well as physiologically acceptable to the recipient, e.g. a mammal such as a human, without the resulting production of excessive undesirable and unacceptable physiological effects or a deleterious impact on the mammal being administered the pharmaceutical composition. In an aspect, a composition for use comprises one or more carriers, useful excipients and/or diluents.
As used herein, the term “dosage” includes that amount of compound which, when effectively administered to a living mammal, provides an effective amount of biologically available compound to the living mammal.
As used herein the term “patient” includes a living human subject and a human individual. In an aspect the patient includes a human, and a living non-human such as feline, canine, horse and murine.
Particle based moieties useful in the polymer conjugates herein include those particles disclosed in U.S. Pat. No. 6,383,500 which issued to Karen L. Wooley et al. on May 7, 2002 (hereinafter the '500 patent) which is incorporated herein in its entirety by references. The particles of the '500 patent comprise amphiphilic copolymers and have a crosslinked shell domain, which can be permeable, and an interior core domain. Such particles can comprise a hydrophilic, crosslinked, permeable shell domain and a hydrophobic interior core domain. The amphiphilic copolymers of the particles can be crosslinked via functional groups within the hydrophilic shell domain, for example by condensation reactions, addition reactions, or chain polymerization reactions.
In an aspect of the present disclosure, the hydrophobic interior core domain of the particles disclosed in the '500 patent can also be crosslinked via functional groups in their hydrophobic domains.
In an aspect of the present disclosure, the particles disclosed in the '500 patent comprising amphiphilic copolymers having a crosslinked shell domain and an interior core domain comprise a hydrophobic, crosslinked shell domain, which is permeable, and a hydrophilic interior core domain. The amphiphilic copolymers of such particles can be crosslinked via functional groups within the hydrophobic shell domain, for example by condensation reactions, addition reactions, or chain polymerization reactions. In another embodiment of the present disclosure, the hydrophilic interior core domain of such particles can also be crosslinked. In this case, the amphiphilic copolymers can be crosslinked via functional groups in their hydrophilic domains.
In an aspect, useful nanoparticles comprise an inner core and an outer coating. The particles are attached to a cancer targeting moiety that interact preferably with cancer calls. The particles are also affixed with a substance akin to a dye that makes them visible on magnetic resonance imagining or are labeled with an appropriate emitting ligand such as radioactive copper-64.
In yet another aspect, the particles of the present disclosure comprise aliphatic copolymers, comprising an outermost crosslinked domain, which can be permeable, a series of additional crosslinked (permeable) domains, and a domain interior to each of the crosslinked (permeable) domains, producing an “onion-like” structure.
The inventors have discovered a method for identifying a mRNA for selective targeting and then identifying the PNAs that will bind to it.
In practicing this method, one first identifies the mRNA for targeting. Basically one uses a SAGE or DNA chip to quantify gene expression in the target cell, compares the gene expression profile to all expression databases and identifies a sequence that is most differentially expressed and is in the highest amount or is uniquely expressed to identify an mRNA of interest, obtains a clone containing the cDNA for the mRNA of interest and produces the mRNA in vitro by RNA polymerase, maps accessible sites by either the modified RT-ROL assay and/or SAABS assay, screens potential ODNs by the Dynabead dot blot assay, quantifies the binding of ODNs by the Dynabead direct binding assay with 32P-labeled ODN, synthesizes and recovers Cys-Tyr-PNA-Lys4 corresponding to the tightest binding ODNs (or with another permeation peptide in place of Lys4) quantifies binding of the hybrid PNAs by the Dynabead direct binding assay with radioiodinated PNA, conjoins the highest affinity PNAs to fluorescein and DOTA for fluorescence assays of cell binding in vitro or in vivo (mouse xenograft) and conjoins PNAs with the highest affinity to SCK nanoparticles through an appended lysine or other suitable accommodating site-specific coupling moiety.
As used herein the term “SAGE” means Serial Analysis of Gene Expression which is a method to efficiently count large numbers of mRNA transcripts by sequencing short tags.
Radionuclides:
In an aspect, a diagnostic imaging composition is provided comprising a polymer conjugate, a chelator and a radionuclide. Typically a chelator is employed to functionally and capably associate a radionuclide with the polymer conjugate. The radionuclide may be conjugated with the polymer or with the PNA alone.
For example, a radioisotope can be appended to the polymer conjugate using techniques known in the art, for example, techniques analogous to those described in Lewis et al. (Bioconjug Chem 2001, 12:320-324) and in Liu et al. (Bioconjug Chem 1997, 8:621-636).
The polymer conjugate can be conjugated with a chelating group which is then labeled with a radionuclide, such as a metallic radioisotope. Such chelating groups are well known in the art and include polycarboxylic acids such as for example ethylenediaminetetraacetic acid (EDTA, CAS Reg #60-00-4), derivatives of 1,4,7,10-tetraazacyclododecane-1,4,7,10-tetraacetic acid (DOTA, CAS Reg #60239-18-1), 1,4,8,11-Tetraazacyclotetradecane-1,4,8,11-tetraacetic acid (TETA, CAS Reg #339091-75-7), diethylenetriaminepentaacetic acid (DTPA, CAS Reg #67-43-6) and the crossbridged CB-TE2A. and the like, or analogs or homologs thereof, as well as the chelating groups disclosed in Anderson and Welch (Chem. Rev. 99: 2219-2234, 1999) and Jurisson and Lydon (Chem. Rev. 99: 2205-2218, 1999).
A chelating group for the radionuclide therein may be attached directly to the polymer conjugate by means of a divalent or bifunctional organic linker group. Such bifunctional linker groups are well known in the art and are preferably less than about 50 angstroms in length. Illustrative, nonlimiting examples of useful suitable linker groups include 2-carboxymethyl, 3-carboxypropyl, 4-carboxybutyl, and the like.
A bifunctional chelator is of value in the present disclosure in this aspect. As used herein, the term “bifunctional chelator” refers to any organic compound containing two or more donor atoms spatially situated so as to form coordinate bonds with the same metal atom (first functionality) and a functional group suitable for the conjugation to the targeting moiety (second functionality). Useful chelators are those which are “multidentate”, which means they have multiple donor atoms available for simultaneous complexing with a metal atom. If desired, one or more bifunctional chelators may be employed.
For diagnostic applications herein, acyclic bifunctional chelators may be satisfactory. For therapy type applications herein macrocyclic bifunctionals are better suited.
In an aspect, a radioactive metal ion, such as 64Cu2+, is attached to a polymer conjugate via a bifunctional chelator, the latter functioning as a metal coordinating bifunctional chelator. In an aspect the radioactive metal ion is said to be associated with the polymer conjugate and the metal coordinating bifunctional chelator produces that association.
Without being bound by theory, the purpose of the bifunctional chelator, is to maintain a stable complex with the radioactive metal ion to produce a high-contrast image and, for radiotherapy, to prevent leakage spread of radioactivity into healthy (non-target) organs and tissues throughout the living mammalian body.
The emissions from the radioactive metal allow both 3-D visualization of tumors through PET, SPECT, and microPET, and therapy of tumors due to specific delivery of a cytotoxic radiation dose to tumor cells.
The reactions between the chelator, the polymer conjugate, and the detectable radionuclide are carried out using known methods, and preferably are performed at a pH at which the polymer conjugate is stable and under condition effective to enable the efficient carrying out of the reactions. Illustratively in a method, a complex is formed between the chelator and a detectable radionuclide prior to coupling with the polymer conjugate. In another method, a chelator is complexed first with a non-detectable metal ion and then with the polymer conjugate. The non-detectable metal ion may subsequently be replaced by the desired detectable element via a transmetallation process. It is understood that all reactions and synthesis conditions employed herein are those which suitably accommodate the desired reaction and synthesis and allow it to satisfactorily progress to its desired completion.
With respect to radionuclides, PET (including microPET) and SPECT are useful non-invasive molecular diagnostic imaging (standard) procedures that produce (i.e., capture and optionally record) multiple acquisitions i.e. images of the body's biological functions and in an aspect are used to determine the extent of malignant disease. In an aspect, these imaging procedures show the presence and distribution of a radiolabeled detectable functionally emitting chemical associated with the polymer conjugate acquired at various selected times. Advantageously these imaging procedures depict metabolic characteristics of tissues and changes therein.
A “detectable element” as used herein is defined as any element, preferably a metal ion, which exhibits a property detectable in therapeutic or in vivo diagnostic techniques. For example, a nonlimiting example of a detectable element is a metal ion that emits detectable radiation or a metal ion that is capable of influencing NMR relaxation properties and that is capable of forming a conjugate or complex with the described nanoparticle moiety. Suitable detectable metal ions as used herein include, for example, heavy elements or rare earth ions such as the paramagnetic ions, Gd3+, Fe3+, Mn2+ and Cr2+. By way of example, a nonlimiting example of detectable element is a fluorescent metal ions, such as Eu3+, and radionuclides, such as gamma-emitting radionuclides, beta-emitting radionuclides, and positron-emitting radionuclides.
Any radionuclide suitable for imaging or therapy can be employed to prepare a functional polymer conjugate. For example, suitable nonlimiting examples of useful radionuclides include: Actinium-225, Astatine-225, Bismuth-212, Bismuth-213, Bromine-75, Bromine-76, Carbon-11, Cerium-141, Chromium-51, Copper-60, Copper-67, Dysprosium-166, Fluorine-18, Copper-61, Copper-62, Copper-64, Gadolinium-152, Gadolinium-153, Gold-195m, Holmium-166, Indium-111, Indium-110m, Iodine-123, Iodine-124, Iodine-131, Iron-55, Iron-59, Lutetium-177, Nitrogen-13, Oxygen-15, Palladium-103, Radium-224, Rhenium-186Rhenium-188, Rubidium-81, Rubidium-82, Rubidium-86, Ruthenium-103, Ruthenium-106, Samarium-153, Scandium-46, Tantalum-178, Technetium-94m, Technetium-99m, Thallium-201, Titanium-45, Ytterbium-169, Yttrium-86, Yttrium-90, and Zirconium-89.
In an aspect, positron emission tomography (PET) comprises detection of two gamma-rays deriving from annihilation of positrons emitted from radionuclides that decay by positron emission and are located within a mammalian patient's body.
A large number of scintillation detectors detect these photon pairs and measure the sum of radioactivity along many different paths through the patient undergoing measurement. Appropriate software associated with the instrument reconstructs a three-dimensional image of the patient and the concentrations of radionuclides can be expressed in quantitative units of radiotracer concentration per ml of tissue.
In an aspect, single photon emission computed tomography (SPECT) comprises detection of single gamma-rays emitted from radionuclides that decay by gamma emission and are located within a mammalian patient's body.
SPECT imaging comprises external measurement of the single photon emitted anisotropically by a radioactive compound labeled with gamma-emitting radionuclides. Photons are selected by a collimator. Generally collimators for SPECT imaging are lead and comprise thousands of various shaped parallel channels through which—and only through which—gamma rays are allowed to pass. Generally such collimators are positioned over a single crystal of NaI contained in the Gamma camera in an arrangement referred to as an Anger camera. The image or acquisition from the camera is the captured image which is presented to a human operator as part of the image. In an aspect multi-acquisition is used. In an aspect a multi-acquisition is carried out over an elapsed time interval.
In an aspect a PET and/or a SPECT and/or microPET image is taken of a mammal after the satisfactory administration of a radionuclide of to the mammal.
In an aspect, images are taken over elapsed time in dynamic fashion to assemble a developing or developed scenario of situations in the mammalian patient.
Once a radiolabeled compound(s) is adequately administered to a patient, the emitting radioactivity travels through gastro-intestinal tract or through the vascular system of the body and localizes in the appropriate areas of the body (based on targeting) and is detected by PET or SPECT scanners.
Typically an adequate amount of time is allowed to pass for the treated living mammal to come to an equilibrium state following satisfactory administration of the radioligand to the mammal. Typically the mammal is placed in a position near the PET or SPECT or microPET instrument allowing satisfactory operation of the instrument. The PET, microPET, and SPECT instruments are equipped with all necessary operable software and operation requirements. They are turned on i.e. energized and made operable by supplying 100/220 volts electric power to the respective instruments.
Generally after a living mammal has received its administration of the radiolabeled moiety, the mammal is taken to an examination room that houses the scanner, which has an opening in the middle. In an aspect the mammal is moved into the hole of the machine. The images are displayed on the monitor of a computer, suitably equipped and operably coupled to the scanner instrument for acquiring.
In an aspect a copper radiolabeled material (compound(s)) is administered to a living mammal patient. In an aspect the radiolabeled emits a functional externally detectable amount of desired radioactivity in the mammal. In a medical aspect the amount of emitted radioactivity is an amount which imparts a diagnostic or therapeutic benefit to the mammalian patient having cancer. In an aspect a therapeutic benefit is that benefit which is medicinally and therapeutically beneficial to the living mammalian afflicted with cancer. In an aspect a cytotoxic amount is an effective lethal amount of a therapeutic compound which beneficially kills or retards cancer cells.
Useful radiochemical methods are found in the textbook Welch M J, Redvanly C S, Handbook of Radiopharmaceuticals: Radiochemistry and Applications, Chichester: Wiley, 2003.
In an aspect a copper radiolabeled material is effectively administered to a mammal or to a biological sample thereof or there from and the sample is analyzed and a diagnosis is made or obtained. In an aspect, a biological sample of the mammal comprises a representative sample taken of at least one of blood, vessels, atheroma, liver, and other body tissues a well as biopsies of body organs such as a liver biopsy or a muscle biopsy of a living mammal. In an aspect, the amount of biological sample is that amount or volume which is sufficient to provide for an effective and discerning analysis.
In an aspect a mammal host is selected from at least one of a living human and non human animal such as canine, feline, equestrian, murine including dogs, cats, rabbits, guinea pigs, hamsters, mice, rats, rodents, horses, goats, sheep, pigs and cows. In an aspect the mammal host is a living patient.
In an aspect, depending on its form, the administered formulation is suitably formulated for ease of facilitation of administration and use by the mammal patient and may contain a binder, disintegrating agent, lubricant, sweetener, a liquid carrier.
In an aspect, a copper radiolabeled compound is administered to a mammal as a pharmacologically acceptable composition. Pharmacologically acceptable compositions such as solutions of a labeled compound or its salts can be prepared in water, optionally mixed with a nontoxic surfactant.
In an aspect, the amount of time elapsing between imaging procedures is a sufficient time which provides for a useful and meaningful comparison of acquired images.
Accordingly, the present disclosure includes a pharmaceutical composition comprising a labeled compound as described hereinabove; or a pharmaceutically acceptable salt thereof; and a pharmaceutically acceptable diluent or carrier.
In an aspect a therapeutic rate titration is performed wherein the living mammalian afflicted with cancer is administered a series of dosages and respective effects therefrom or thereafter are determined at respective dosages and times by methods known to those in the pharmacology art. In this manner a therapeutic dosage curve or titration is obtained for determining dosage for that mammal patient.
Administration may be performed by any effective local or systemic application as appropriate. Administration of compositions may be done by inhalation, orally, rectally or parenterally, such as by intramuscular, subcutaneous, intraarticular, intracranial, intradermal, intraocular, intraperitoneal, intrathecal and intravenous injection.
In an aspect, an internal radiation cancer therapy useful on living mammals comprises administering anti-cancer compounds synthetically labeled with 64Cu to such living mammals. In an aspect, a treatment of malignant neoplasms in living mammals (human and nonhuman) comprises administering anti-cancer compounds labeled with 64Cu.
In an aspect, a method for pharmacologically treating a mammalian tumor in a mammal comprises administering to a mammal having a tumor a composition including a tumor-inhibiting amount of at least one 64Cu labeled compound. In an aspect the living mammal is nonhuman.
In an aspect, a method for in vivo detection of cancer cell(s) in living mammalian tissue samples comprises contacting a mammalian tissue sample with an in vivo effective diagnostic imaging amount of at least one 64Cu labeled compound for a time and under conditions sufficient and effective for binding of labeled compound to the cancer cell(s) and detecting such binding indicative of an association with the presence and location of cancer in the contacted cell(s). In an aspect the detecting is by image acquisition. In an aspect the 64Cu labeled compound is a tracer for cancer. In an aspect, the cell(s) is in a previously obtained biological sample from a mammal. In an aspect such binding is indicative of the presence of and location of a cancer cell. In an aspect, the mammal is a living human and the radionuclide is 60Cu, 61Cu or 64Cu. In an aspect the living mammal is a nonhuman mammal. In an aspect the extent of binding is determined by comparing the amount of radioactivity administered to the animal with the amount of radioactivity and location of radioactivity detected by image acquisition.
In an aspect, a method for determining progression or regression of a cancer in a living mammal comprises administering to a living mammal a diagnostic imaging detectable amount of at least one highly purified 64Cu labeled compound at a first selected time, detecting an image of a cancer tissue in the mammal being treated at a second selected (later) time respectively detecting an image of a cancer tissue at both times, comparing the images and determining if the detected cancer tissue in the image at the later time is bigger or smaller than the detected cancer tissue in the image at the first time. In an aspect the elapsed time between the first time and second time is selected to be a time duration significant amount. In an aspect the living mammal is nonhuman. In an aspect the comparison is used to determine progression or regression of a cancer in a mammal.
Pharmaceutical Compositions
In an aspect a pharmaceutical composition comprises a particle conjugate and a pharmaceutical agent or a PNA and a pharmaceutical agent. In an aspect the pharmaceutical agent comprises at least one of a cancer drug, a prodrug or a radionuclide.
The particle conjugate further comprises a nano-scale particle based moiety having associated therewith a permeation peptide (e.g., the HIV-1 TAT protein transduction domain) and a nucleic acid analog capable of binding to a complementary disease specific mRNA sequence, wherein use of the nucleic acid analog does not lead to the destruction of the disease specific mRNA sequence, wherein particles comprise amphiphilic copolymers having a crosslinked shell domain, which can be permeable, and an interior core domain, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier, excipient, or diluent.
The pharmaceutically active agent can be contained within the particle or conjugated to it. The pharmaceutically active agent can be present in the particle dissolved in the crosslinked shell domain (which can be permeable), or covalently attached to a component of the crosslinked shell domain, or in the form of a fine dispersion within the crosslinked shell domain, or on the surface of the crosslinked shell domain.
Alternatively, the pharmaceutically active agent can be present in the particle dissolved in the interior core domain, or covalently attached to a component of the interior core domain, in the form of a fine dispersion within the interior core domain, or on the surface of the interior core domain, or at the interface between the crosslinked shell domain and the interior core domain.
The pharmaceutically active agent can also be present both in the crosslinked shell domain and in the interior core domain, or covalently attached to components of each domain, or in the form of a fine dispersion within each domain, or on the surface of each domain.
The pharmaceutically active agent can be introduced to the polymer conjugate in a variety of different ways. For example, in the process of forming particles of the present disclosure, the pharmaceutically active agent can be present in the solvent system employed to form the micelles that are the precursors to the particles of the present disclosure. Upon formation of the particles, the pharmaceutically active agent is entrapped therein. Alternatively, pre-formed particles can be suspended in a solvent containing the active agent, and thus take up the pharmaceutically active agent from solution. In addition, the pharmaceutically active agent can be sprayed in the form of a solution or a melt onto the surface of the pre-formed particles. In another example, the pre-formed particles can be treated with a vapor containing the pharmaceutically active agent. The pharmaceutically active agent can also be vacuum infiltrated into the pre-formed particles.
The pharmaceutically active agent can be associated with or affixed to the amphiphilic copolymers which comprise the particles of the present disclosure either chemically or physically. The association or affixing can be performed either prior to the preparation of the particles or after the preparation of the particles.
When present in polymer conjugate of the present disclosure as described above, the pharmaceutically active agent can be released there from. It is fully expected that such release can be sustained, i.e. not immediate, but rather over an extended period of time, thereby making particles of the present disclosure containing pharmaceutically (or other active) agents useful as sustained release delivery vehicles.
Pharmaceutically Active Agents
Nonlimiting examples of useful pharmaceutically active agents that can be used with these polymer conjugates include inorganic and organic compounds without limitation, including drugs that act on the peripheral nerves, adrenergic receptors, cholinergic receptors, nervous system, skeletal muscles, cardiovascular system, smooth muscles, blood circulatory system, synaptic sites, neuroeffector junctional sites, endocrine system, hormone systems, immunological system, reproductive system, skeletal system, alimentary and excretory systems, inhibitory of autocoids and histamine systems. The active drugs that can be delivered for the purpose of acting on these recipients include anticonvulsants, analgesics, anti-inflammatories, calcium antagonists, anesthetics, antimicrobials, antimalarials, antiparasitics, antihypertensives, antihistamines, antipyretics, alpha-andrenergic agonist, alpha-blockers, anti-tumor compounds, biocides, bactericides, bronchial dilators, beta-andrenergic blocking drugs, contraceptives, cardiovascular drugs, calcium channel inhibitors, depressants, diagnostics, diuretics, electrolytes, hypnotics, hormonals, hyperglycemics, muscle contractants, muscle relaxants, opthalmics, psychic energizers, parasympathomimetics, sedatives, sympathomimetics, tranquilizers, urinary tract drugs, vaginal drugs, vitamins, nonsteroidal anti-inflammatory drugs, angiotensin converting enzymes, polypeptide drugs, and the like.
Nonlimiting examples of useful pharmaceutically active agents that are highly soluble in water and that can be used in conjunction with the particles of the present disclosure include prochlorperazine edisylate, ferrous sulfate, aminocaproic acid, potassium chloride, mecamylamine hydrochloride, procainamide hydrochloride, amphetamine sulfate, benzphetamine hydrochloride, isoproterenol sulfate, methamphetamine hydrochloride, phenmetrazine hydrochloride, bethanechol chloride, methacholine chloride, pilocarpine hydrochloride, atropine sulfate, scopolamine bromide, isopropamide iodide, tridihexethyl chloride, phenformin hydrochloride, methylphenidate hydrochloride, cimetidine hydrochloride, theophylline cholinate, cephalexin hydrochloride, and the like.
Exemplary pharmaceutically active agents that are poorly soluble in water and that can be used in conjunction with the particles of the present disclosure include diphenidol, meclizine hydrochloride, prochlorperazine maleate, phenoxybenzamine, thiethylperazine maleate, anisindone, diphenadione, erythrityl tetranitrate, digoxin, isofluorophate, acetazolamide, methazolamide, bendro-flumethiazide, chlorpropamide, tolazamide, chlormadinone acetate, phenaglycodol, allopurinol, aluminum aspirin, methotrexate, acetyl sulfisoxazole, erythromycin, progestins, sterogenic, progestational, corticosteroids, hydrocortisone hydrocorticosterone acetate, cortisone acetate, triamcinolone, methyltestosterone, 17 beta-estradiol, ethinyl estradiol, ethinyl estradiol 3-methyl ether, prednisolone, 17 beta-hydroxyprogesterone acetate, 19-nor-progesterone, norgestrel, morethindrone, norethisterone, norethiederone, progesterone, norgesterone, norethynodrel, and the like.
Examples of other pharmaceutically active agents that can be used in conjunction with the particles of the present disclosure include aspirin, boron-containing antitumor compounds, indomethacin, naproxen, fenoprofen, sulindac, indoprofen, nitroglycerin, isosorbide dinitrate, propranolol, timolol, atenolol, alprenolol, cimetidine, clonidine, imipramine, levodopa, chloropromazine, methyldopa, dihydroxyphenylalanine, pivaloyloxyethyl ester of alpha-methyl dopa hydrochloride, theophylline, calcium gluconate, ketoprofen, ibuprofen, cephalexin, erythromycin, haloperidol, zomepirac, ferrous lactate, vincamine, diazepam, phenoxybenzamine, diltiazem, milrinone, captopril, madol, quanabenz, hydrochlorothiazide, ranitidine, flurbiprofen, fenbufen, fluprofen, tolmetin, alclofenac, mefenamic, flufenamic, difuninal, nimodipine, nitrendipine, nisoldipine, nicardipine, felodipine, lidoflazine, tiapamil, gallopamil, amlodipine, mioflazine, lisinolpril, enalapril, captopril, ramipril, famotidine, nizatidine, sucralfate, etinidine, tertatolol, minoxidil, chlordiazepoxide, chlordiazepoxide hydrochloride, diazepan, amitriptylin hydrochloride, imipramine hydrochloride, imipramine pamoate, enitabas, verapamil, losartan, and the like. Other beneficial pharmaceutically active agents known in the art that can be used in conjunction with the particles of the present disclosure are disclosed in Pharmaceutical Sciences, 14th Ed., edited by Remington, (1979) published by Mack Publishing Co., Easton Pa.; The Drug, The Nurse, The Patient, Including Current Drug Handbook, by Falconer, et al., (1974-1976) published by Saunders Company, Philadelphia, Pa.; Medicinal Chemistry, 3rd Ed., Vol. 1 and 2, by Burger, published by Wiley-Interscience, New York; Goodman & Gilman's The Pharmacological Basis of Therapeutics, 9th Ed., edited by Hardman, et al., (1996) published by McGraw-Hill, New York, N.Y.; and in Physicians' Desk Reference, 51st Ed., (1997) published by Medical Economics Co., Montvale, N.J.
Prodrugs
Prodrugs are useful in pharmaceutical compositions of the present disclosure and in an aspect such drugs may be conjugated to the polymer conjugate. Prodrugs are pharmacologically inactive derivatives of active drugs. Prodrugs are designed to maximize the amount of active drug that reaches its respective effective site of action through manipulation of the physicochemical, biopharmaceutical or pharmacokinetic properties of the drug. Prodrugs are capably converted into the pharmaceutically active drug within the body through enzymatic or non-enzymatic reactions after the prodrugs are administered to the patient.
In an aspect, a useful drug has cytotoxicity greater than that of the prodrug. Typically, the prodrug has an enzyme cleavable covalent link between a drug and a chemical moiety associated therewith although some useful moieties of prodrug include the salt form (such as water soluble form) of an active drug molecule. Typically a partly or essentially water soluble salt form would be employed, including those moieties wherein there is a covalent link between a drug and chemical moiety and includes salts of the prodrug such as those which are moderately or highly water soluble such as alkali metals, ammonium and amine salts and alkaline earth metal salts.
Nonlimiting examples of useful prodrugs include 5-(aziridine-1-yl)-2,4-nitrobenzamide, peptidyl-p-phenylenediamine-mustard, benzoic acid mustard glutamates, 6-methoxypurine arabinonucleoside, 5-fluorocytosine, glucose, hypoxanithine, methotrexate-alane, N-(94-(-D-galactopyranosyl), benzyloxycarbonyl)-daunorubicine, amygdalin, azobenzene mustards, gamma-glutamyl-p-phenylenediamine mustard, phenolmustard-glucuronide, epirubicin-glucuronide, vinca-cephalosporin, nitrogen-mustard-cephalosporin, phenolmustard phosphate, doxorubicine phosphate, mitomycin phosphate, etoposide phosphate, palytoxin-4-hydroxyphenyl-acetamide, cyclophosphamide isofamide and 4-nitrobenzyloxycarbonyl derivatives.
Additional typical useful non-limiting drugs include 5-(aziridin-1-yl)-4-hydroxyl-amino-2-nitrobenzamide, phenylenediamine-mustard, ganciclovir triphosphate, adenine arabinonucleoside, triphosphate(araATP), 5-fluorouracid, hydrogen peroxide, superoxide, methotrexate, daunorubicin, cyanide, phenylendiamine mustards, phenyldiamine mustard, phenolmustard, epirubicin, 4-desacetylvinblastine-3-carboxyhydrazide, nitrogen mustards, doxorubicin, mitomycin alcohol, etoposide, palytoxin, melphalan, phosphoamide mustard (+acrolein), 5-(aziridin-1-yl)-4-hydroxylamino-2-nitrobenzamine, actinomycin D and mitomycin C.
Cancer Drugs (Cytotoxic)
Drugs cytotoxic to cancer are useful in pharmaceutical compositions of the present disclosure and in an aspect such drugs may be conjugated to the polymer conjugate or to the PNA.
Typical non-limiting examples of useful cytotoxic drugs include aldesleukin, alemtuzumab, alitretinoin, allopurinol, altretamine, amifostine, anastrozole, arsenic trioxide, BCG Live, bexarotene, bleomycin, calusterone, capecitabine, carboplatin, carmustine, celecoxib, chlorambucil, cisplatin, cladribine, cyclophosphamide, cytarabine, dacarbazine, dactinomycin, darbepoetin alfa, denileukin diftitox, dexrazoxane, docetaxel, doxorubicin, dromostanolone, Elliot's B solution, epirubicin, epoetin alfa, estramustine, etoposide phosphate, exemestane, filgrastim, floxuridine, fludarabine, fulvestrant, gemcitabine, gemtuzumab, goserelin acetate, hydroxyurea, ibritumomab tiuxetan, idarubicin, ifosfamide, imatinib mesylate, interferon alfa-2a, interferon alfa-2b, irinotecan, letrozole, leucovorin, levamisole, mechlorethamine, megestrol acetate, melphalan, L-PAM, mercaptopurine 6-MP, mesna, methotrexate, methoxsalen, mitomycin C, mitotane, mitoxantrone, androlone phenpropionate, nofetumomab, oprelvekin, oxaliplatin, paclitaxel, pamidronate, pegademase, pegaspargase, pegfilgrastim, entostatin, pipobroman, plicamycin, mithramycin, porfimer sodium, procarbazine, quinacrine, rasburicase, rituximab, sargramostim, streptozocin, talc, tamoxifen, trastuzumab, tretinoin, uracil mustard, valrubicin, vinblastine, tamoxifen, temozolomide, teniposide, testolactone, 6-thioguanine, thiotepa, topotecan, toremifene, tositumomab, vincristine, vinorelbine and zoledronate.
In another aspect, the present disclosure provides a method for delivering a nucleic acid molecule to a cell, tissue, or organ, comprising contacting the cell, tissue, or organ, in vivo or in vitro, with a composition containing a polymer conjugate of the present disclosure and a nucleic acid molecule for a period time sufficient to deliver the nucleic acid molecule to the cell, tissue, or organ. The nucleic acid molecule can, for example, be present on the surface of the particle, or within the particle. The nucleic acid molecule can be DNA or RNA for example, an antisense oligonucleotide, a vector, or any other type of nucleic acid molecule commonly employed in genetic engineering techniques
Pharmaceutical Methods
As noted above, polymer conjugates of the present disclosure comprising a pharmaceutically active agent can be used for sustained release and delivery of such agents to treat a variety of conditions.
As used herein the term “pharmaceutically active agent” includes at least one of a prodrug, a cytotoxic drug or a radiopharmaceutical. Optionally if desired one may label prodrug, cytotoxic drug or both.
In one aspect, the present disclosure provides a method of effectively delivering a pharmaceutical composition chemically or physically associated with the particles of the present disclosure. The method comprises administering to the mammal a composition comprising the particles having associated therewith at least one of a permeation peptide (e.g., HIV-1 TAT protein transduction domain, see SEQ ID NO: 1) and a PNA or another nuclease resistant oligonucleotide analog, such as MOE-mRNA or LNA, having a unr mRNA binding sequence such as PNA50 (see SEQ ID NO: 3) or any sequence that binds selectively to an unique or overexpressed mRNA specific to the cancer or disease state.
In another aspect, the present disclosure provides a method of delivering a pharmaceutically active agent to a cell, tissue, or organ, comprising contacting the cell, tissue, or organ with an effective amount of a polymer conjugate, the polymer conjugate comprising a particle based moiety having associated therewith at least one of a permeation peptide (e.g., the HIV-1 TAT protein transduction domain) and a PNA or another nuclease resistant oligonucleotide analog, such as MOE-mRNA or LNA, having unr mRNA binding sequence such as PNA50 (see SEQ ID NO: 3) or any sequence that binds selectively to an unique or overexpressed mRNA specific to the cancer or disease state and a pharmaceutically active agent, the contact being for a period of time sufficient to introduce the pharmaceutically active agent to the locus of the cell, tissue, or organ. The method, for example, can comprise contacting the cell, tissue, or organ in vitro or in vivo with the effective amount of the particles.
As to dosages, formulations, and routes of administration for the prophylaxis or treatment of the conditions referred to above, the particles of the present disclosure can be used as particles per se. Pharmaceutically acceptable salts are particularly suitable for medical applications because of their greater aqueous solubility and physiological compatibility relative to the parent particle. Such salts must clearly have pharmaceutically acceptable anions or cations. Suitable pharmaceutically acceptable acid addition salts of the particles of the present disclosure when possible include those derived from inorganic acids, such as hydrochloric, hydrobromic, phosphoric, metaphosphoric, nitric, sulfonic, and sulfuric acids, and organic acids such as acetic, benzenesulfonic, benzoic, citric, ethanesulfonic, fumaric, gluconic, glycolic, lactic, lactobionic, maleic, malic, methanesulfonic, succinic, toluenesulfonic, tartaric, and trifluoroacetic acids. The chloride salt is particularly preferred for medical purposes. Suitable pharmaceutically acceptable base salts include ammonium salts, alkaline metal salts such as sodium and potassium salts, and alkaline earth salts such as magnesium and calcium salts.
The polymer conjugates of the present disclosure can be effectively and sufficiently administered to a living mammal with an acceptable carrier in the form of a pharmaceutical composition. The carrier must, of course, be acceptable in the sense of being compatible with the other ingredients of the composition and must not be deleterious to the recipient. The carrier can be a solid or a liquid or both, and is preferably formulated with the particle as a unit-dose composition, for example a powder or tablet, which can contain from 0.05% to 95% by weight of the active particles. Other pharmacologically active substances can also be present, including other particles of the present disclosure. The pharmaceutical compositions of the present disclosure can be prepared by any of the well known techniques of pharmacy, consisting essentially of admixing the components together.
In an aspect, a living patient such as a living mammal such as a living human is treated for cancer according to the present disclosure. In that situation a pharmaceutically useful moiety is administered to the patient in a “therapeutically effective amount”.
In an aspect pharmaceutical compositions for use herein include in addition to active ingredient, such as a prodrug, cytotoxic drug or radiopharmaceutical, a pharmaceutically acceptable excipient, carrier, buffer, stabilizer or other materials well known to those skilled in the art. Such materials should be non-toxic and should not interfere with the efficacy of the active ingredient. The precise nature of the carrier or other material will depend on the route of administration, which may be oral, or by injection, e.g. cutaneous, subcutaneous or intravenous.
These pharmaceutical compositions may be administered by any conventional means available for administering pharmaceutical compositions to living mammals.
The amount of pharmaceutical composition required to achieve the desired biological effect will, of course, depend on a number of factors such as the specific particle or agent chosen, the use for which it is intended, the mode of administration, and the clinical condition of the recipient.
In general, an effective daily pharmaceutical composition dose can be in the range of from about 5 to about 5,000 mg/kg of bodyweight/day, preferably from about 10 to about 2,000 mg/kg bodyweight/day, more preferably from about 20 to about 1,000 mg/kg bodyweight/day. This total daily dose can be administered to the patient in a single dose, or in proportionate multiple subdoses. Subdoses can be administered 2 to 6 times per day. If desired, doses can be in sustained release form effective to obtain the desired results.
Orally administrable unit dose formulations, such as liquids, tablets, or capsules, can contain, for example, from about 1 to about 5,000 mg of the particles, preferably about 2 to about 2,000 mg of the particles, more preferably from about 10 to about 1,000 mg of the particles. In the case of pharmaceutically acceptable salts, the weights indicated above refer to the weight of the particle ion derived from the salt.
Oral delivery of particles of the present disclosure can include formulations, as are well known in the art, to provide prolonged or sustained delivery of the particles to the gastrointestinal tract by any number of mechanisms. These include, but are not limited to, pH sensitive release from the dosage form based on the changing pH of the small intestine, slow erosion of a tablet or capsule, retention in the stomach based on the physical properties of the formulation, bioadhesion of the dosage form to the mucosal lining of the intestinal tract, or enzymatic release of the particles from the dosage form. The intended effect is to extend the time period over which the active particles are delivered to the site of action (the gastrointestinal tract) by manipulation of the dosage form. Thus, enteric-coated and enteric-coated controlled release formulations are within the scope of the present disclosure. Suitable enteric coatings include cellulose acetate phthalate, polyvinylacetate phthalate, hydroxypropylmethylcellulose phthalate and anionic polymers of methacrylic acid and methacrylic acid methyl ester.
Pharmaceutical compositions according to the present disclosure include those suitable for oral, rectal, topical, buccal (e.g., sublingual), and parenteral (e.g., subcutaneous, intramuscular, intradermal, or intravenous) administration, although the most suitable route in any given case will depend on the nature and severity of the condition being treated and on the nature of the particular particle which is being used. In most cases, the preferred route of administration is oral.
Pharmaceutical compositions suitable for oral administration can be presented in discrete units, such as liquids, capsules, cachets, lozenges, or tablets, each containing a predetermined amount of at least one type of particle of the present disclosure; as a powder or granules; as a solution or a suspension in an aqueous or non-aqueous liquid; or as an oil-in-water or water-in-oil emulsion. As indicated, such compositions can be prepared by any suitable method of pharmacy which includes the step of bringing into association the active particle(s) and the carrier (which can constitute one or more accessory ingredients). In general, the compositions are prepared by uniformly and intimately admixing the active particles with a liquid or finely divided solid carrier, or both, and then, if necessary, shaping the product. For example, a tablet can be prepared by compressing or molding a powder or granules containing the particles, optionally with one or more assessory ingredients. Compressed tablets can be prepared by compressing, in a suitable machine, the particles in a free-flowing form, such as a powder or granules optionally mixed with a binder, lubricant, inert diluent and/or surface active/dispersing agent(s). Molded tablets can be made by molding, in a suitable machine, the powdered particles moistened with an inert liquid diluent.
Pharmaceutical compositions suitable for buccal (sub-lingual) administration include lozenges comprising particles of the present disclosure in a flavored base, usually sucrose, and acacia or tragacanth, and pastilles comprising particles in an inert base such as gelatin and glycerin or sucrose and acacia.
Pharmaceutical compositions suitable for parenteral administration conveniently comprise sterile aqueous preparations of particles of the present disclosure. These preparations are preferably administered intravenously, although administration can also be effected by means of subcutaneous, intramuscular, or intradermal injection. Such preparations can conveniently be prepared by admixing the particles with water and rendering the resulting solution sterile and isotonic with the blood. Injectable compositions according to the present disclosure will generally contain from 0.1 to 5% w/w of a particles disclosed herein.
Pharmaceutical compositions suitable for rectal administration are preferably presented as unit-dose suppositories. These can be prepared by admixing particles of the present disclosure with one or more onventional solid carriers, for example, cocoa butter, and then shaping the resulting mixture.
Pharmaceutical compositions suitable for topical application to the skin preferably take the form of an ointment, cream, lotion, paste, gel, spray, aerosol, or oil. Carriers which can be used include vaseline, lanoline, polyethylene glycols, alcohols, and combinations of two or more thereof. The active particle is generally present at a concentration of from 0.1 to 15% w/w of the composition, for example, from 0.5 to 2%.
Transdermal administration is also possible. Pharmaceutical compositions suitable for transdermal administration can be presented as discrete patches adapted to remain in intimate contact with the epidermis of the recipient for a prolonged period of time. Such patches suitably contain particles of the present disclosure in an optionally buffered, aqueous solution, dissolved and/or dispersed in an adhesive, or dispersed in a polymer. A suitable concentration of the active particle is about 1% to 35%, preferably about 3% to 15%. As one particular possibility, the particle can be delivered from the patch by electrotransport or iontophoresis, for example, as described in Pharmaceutical Research, 3(6), 318 (1986).
If desired, the amount of particles that can be combined with carrier materials to produce a single dosage form to be administered will vary depending upon the host treated and the particular mode of administration.
The solid dosage forms for oral administration including capsules, tablets, pills, powders, and granules noted above comprise one or more types of particle of the present disclosure admixed with at least one inert diluent such as sucrose, lactose, or starch. Such dosage forms can also comprise, as in normal practice, additional substances other than inert diluents, e.g., lubricating agents such as magnesium stearate. In the case of capsules, tablets, and pills, the dosage forms can also comprise buffering agents. Tablets and pills can additionally be prepared with enteric coatings.
Liquid dosage forms for oral administration can include pharmaceutically acceptable emulsions, solutions, suspensions, syrups, and elixirs containing inert diluents commonly used in the art, such as water. Such compositions can also comprise adjuvants, such as wetting agents, emulsifying and suspending agents, and sweetening, flavoring, and perfuming agents.
Injectable preparations, for example, sterile injectable aqueous or oleaginous suspensions can be formulated according to the known art using suitable dispersing or setting agents and suspending agents. The sterile injectable preparation can also be a sterile injectable solution or suspension in a nontoxic parenterally acceptable diluent or solvent, for example, as a solution in 1,3-butanediol. Among the acceptable vehicles and solvents that can be employed are water, Ringer's solution, and isotonic sodium chloride solution. In addition, sterile, fixed oils are conventionally employed as a solvent or suspending medium. For this purpose any bland fixed oil can be employed including synthetic mono- or diglycerides. In addition, fatty acids such as oleic acid find use in the preparation of injectables.
Pharmaceutically acceptable carriers encompass all the foregoing and the like.
As those of ordinary skill in the art will recognize, after reading this specification the foregoing discussion is also applicable to the use of particles as described herein, wherein such particles comprise a pharmaceutically active agent intended to be self delivered to a site in the body.
Treatment Regimen
The dosage regimen to prevent, give relief from, or ameliorate a disease condition, is selected in accordance with a variety of factors. These include the type, age, weight, sex, diet, and medical condition of the patient, the severity of the disease, the route of administration, pharmacological considerations such as the activity, efficacy, pharmacokinetics and toxicology profiles of the particular particle or particle/pharmaceutically active agent combination employed, whether a drug delivery system is utilized, and whether the particles are administered as part of a drug combination. Thus, the dosage regimen actually employed can vary widely and therefore deviate from the preferred dosage regimen illustratively set forth above.
Detectable Emitting Fluorescence Labeling
Various useful fluorescent compounds may be successfully employed to label the polymer nano-conjugate including using fluorescing moieties, such as green fluorescent proteins, organelle-specific dyes and ion indicators, or a combination of fluorescing markers (for example a fluorochrome with green emission light for one moiety and another fluorochrome with blue emission for a different moiety).
Fluorescent moieties such as proteins may be employed as a fluorescing marker if desired and would be visualized through a microscope with appropriate light source or quantified by exposing to a suitable light source and determining fluorescence by a spectrofluorometer.
In an aspect, the fluorescence signal from the probe is expressed directly as the emission of GFP or any other fluorescent protein attached to the probe when the fluorescent protein is excited at an appropriate wavelength of bombarded light. In an aspect, a functional immunoprobe produces a discernible, detectable and measurable fluorescence signal (or luminescence signal), an image (of captured fluorescence) which is competently reliably and accurately captured by visual inspection aided by a microscope or acquired by appropriate camera and computer software to be displayed visually on a computer monitor for a person for viewing. The intensity and duration of the fluorescence signal is detectable and is reproducible. The images of fluorescing cells may be projected on a monitor and compared to another image of a standard. A person can then visually compare such images and make a determination on whether there is a difference between the images compared.
As used herein the term “fluorescent protein” refers to any protein that is genetically encoded and expressed as a fusion with a wild type or mutant subunit type such that it emits a fluorescent signal that is detectable using appropriate methods when excited at the necessary wavelength of light.
As used herein, the term “GFP” refers to the Green Fluorescent Protein from Aequorea victoria.
In an aspect, useful nonlimiting illustrative fluorescent proteins include modified green fluorescent proteins including but not limited to those disclosed in U.S. Pat. No. 6,319,669 which issued to Roger Tsien on Nov. 20, 2001, Wavelength Engineering Fluorescent Proteins, Modified Green Fluorescent Proteins as disclosed in U.S. Pat. No. 5,625,048 which issued to Roger Tsien on Apr. 29, 1997 and Modified Green Fluorescent Proteins as disclosed in U.S. Pat. No. 5,777,079 which issued to Roger Tsien on Jul. 7, 1998. See http://www.uspto.gov/patft/index.html in this regard.
Advantageously because of the selective reactivity of the SCK shell or core and the hydrophobicity of the SCK core, many fluorophores (in number and type) may be are attached or sequestered if desired into the SCK nanostructure.
Homo Sapiens NRAS-related gene (UNR) mRNA) with the PNA50 binding site
aGly-Arg-Lys-Lys-Arg-Arg is a potential nuclear localization sequence.
The following non-limiting examples illustrate various aspects of the present disclosure.
EXAMPLE SETS A-F hereinafter shows aspects of the present disclosure.
EXAMPLE SET A shows preparation of SCK nanoparticles
EXAMPLE SET B shows peptide-derivatized SCK-cross-linked nanoparticles along with synthesis and characterization illustrating preparing of peptide permeation associated with a biologically active particle as disclosed in Becker et al. (Bioconjug. Chem., 2004, 15, 699-709) which is incorporated herein in its entirety by reference.
EXAMPLE SET C shows peptide-derivatized shell-cross-linked nanoparticles and associated biocompatibility evaluation as disclosed in Becker et al. (Bioconjug. Chem., 2004, 15, 710-717) which is incorporated herein in its entirety by reference.
EXAMPLE SET D shows microPET imaging of MCF-7 tumor in mice via unr mRNA-targeted peptide nucleic acids as disclosed in Sun et al. (Bioconj. Chem., 2005, 16, 294-305) which is incorporated herein in its entirety by reference.
EXAMPLE SET E shows targeting MCF-7 cells with antisense PNAs to uniquely overexpressed unr mRNA.
EXAMPLE SET F shows microPET imaging of MCF-7 tumor in mice via shell-cross-linked nanoparticles conjugated to unr mRNA-targeted peptide nucleic acids and a permeation peptide.
Abbreviations used in the following examples: “ζ” means zeta potential, “5(6)-FAM SE” means 5(6)-carboxyfluorescein succinimidyl ester, “7-AAD” means 7-aminoactinomysin, “AFM” means atomic force microscopy, “ATCC” means American Type Culture Collection, “ATRP” means atom transfer radical polymerization, “Bio-dUTP” means biotinylated deoxyuridine triphosphate, “BSS” means Earle's balanced salt solution, “cDNA” means complementary DNA, “Chloramine-T” means N-chloro-p-toluensulfonamide sodium salt, “CHO cells” means chinese hamster ovary cells, “DCM” means dichloromethane, “DIEA” means diisopropylethylamine, “DLS” means dynamic light scattering, “DMF” means dimethylformamide, “Dn” means number-average hydrodynamic diameter, “dNTP” means deoxynucleotide triphosphate, “DOTA” means 1,4,7,10-tetraazacyclododecane-N,N′,N″,N″′-tetraacetic acid, “DSC” means differential scanning calorimetry, “DTPA” means diethylenetriaminepentaacetic acid, “Dv” means volume-average diameter, “Dz” means intensity-average diameter, “EDTA” means ethylenediaminetetraacetic acid, “ELISA” means enzyme-linked immunosorbent assay, “EOB” means end of bombardment, “equiv.” means equivalent(s), “FACS” means fluorescence activated cell sorting, “FBS” means fetal bovine serum, “FITC” means fluorescein isothiocyanate, “Fmoc” means 9-fluorenylmethoxycarbonyl, “FPLC” means fast protein liquid chromatography, “FTSC” means fluorescein-5-thiosemicarbazide, “HATU” means O-(7-Azabenzo-triazol-1-yl)-1,1,3,3-tetramethyluronium hexafluorophosphate, “HBSS” means Hank's balanced salt solution, “HEPES” means 4-(2-hydroxyethyl)piperazine-1-ethanesulfonic acid, “HPLC” means high performance liquid chromatography, “i.p.” means intraperitoneal, “i.v.” means intravenous, “ID” means injected dose, “IgG” means immunoglobulin G, “IL1-β” means interleukin-1 beta, “IR” means infra-red, “Kd” means dissociation constant, “MALDI-TOF” means matrix assisted laser desorption ionization—time of flight, “MALS” means multi angle light scattering, “MEM” means Eagle's minimum essential medium, “Mn” means number-average molecular weight, “Mp” means peak-average molecular weight, “MS” means mass spectrometry, “MTT” means 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-2H-tetrazolium bromide, “Mw” means weigh-average molecular weight, “MWCO” means molecular weight cut-off, “NLS” means nuclear localization sequence, “NMP” means N-methylpyrrolidone, “NMR” means nuclear magnetic resonance, “NTP” means nucleotide triphosphate, “ODN” means oligodeoxynucleotide, “p.i.” means post injection, “PAA” means poly(acrylic acid), “PAGE” means polyacrylamide gel electrophoresis, “PALS” means phase analysis light scattering, “PBS” means phosphate buffered saline, “PCR” means polymerase chain reaction, “PET” means positron emission tomography, “PMA” means poly(methyl acrylate), “PMDETA” means N-[2-(Dimethylamino)ethyl]N,N′,N′-trimethyl-1,2-ethanediamine, “PNA” means peptide nucleic acid, “PS” means phosphatidylserine, “PTA” phospho-tungstinic acid, “PTD” means protein transduction domain (See Seq. 1), “r.t.” means room temperature, “RES” means reticulo-endothelial system, “ROI” means region of interest, “RT-PCR” means real-time polymerase chain reaction, “RT-ROL” means reverse transcriptase random oligodeoxynucleotide library, “s.c.” means subcutaneous, “SAABS” means serial analysis of antisense binding sites, “SAGE” means serial analysis of gene expression, “SCID” means severe combined immunodeficiency, “SCK” means shell crosslinked nanoparticles, “SDS” means sodium dodecyl sulfate, “SE” means sedimentation equilibrium, “SEC” means size exclusion chromatography, “SPECT” means single photon emission computed tomography, “SUV” means standard uptake value, “T/B” means tumor to blood ratio, “T/M” means tumor to muscle ratio, “TCPS” means tissue culture polystyrene, “TEM” means transmission electron microscopy, “TFA” means trifluoroacetic acid, “Tg” means glass transition temperature, “THF” means tetrahydrofuran, “TIS” means triisopropyl silane, “TNF-α” means tumor necrosis factor alpha, “unr” means upstream of N-ras or N-ras related gene, “UV” means ultra-violet, “v” means partial specific volume, “δ” means chemical shift.
Poly(tert-butyl acrylate): A 100 mL Schlenk flask that had been oven dried overnight, flame dried under vacuum, and back filled with argon was charged with copper(I) bromide (891.6 mg, 6.21 mmol). Tert-butyl acrylate (38.00 mL, 259.4 mmol), N-[2-(Dimethylamino)ethyl]N,N′,N′-trimethyl-1,2-ethanediamine) (PMDETA) (1.297 mL, 6.21 mmol), and ethyl-2-bromoproprionate (403 μL, 3.10 mmol), were added via argon washed syringes. The solution was degassed by three cycles of freeze-pump-thaw, and following the final thaw cycle the mixture was allowed to stir for 10 min before being immersed in an oil bath at 50° C. After 80 min, the oil bath was removed and the reaction vessel was immersed in liquid nitrogen to quench the polymerization reaction. The reaction mixture was dissolved in tetrahydrofuran (THF), and passed through an alumina plug to remove the metal/ligand catalyst system. The polymer solution was concentrated and then precipitated and recovered into cold methanol. The isolated yield was 28.83 g (85%).
Poly(tert-butyl acrylate-b-styrene-d8): A 100 mL Schlenk flask that had been oven dried overnight, flame dried under vacuum, and back filled with argon was charged with copper(I) bromide (45.8 mg, 0.32 mmol) and poly(tert-butyl acrylate) 2 (0.7234 g, 9.77 e−2 mmol). PMDETA (66.5 μL, 0.32 mmol), and styrene-d8 (3.000 mL, 2.62 mmol), were added via argon washed syringes. The solution was degassed by three cycles of freeze-pump-thaw, and following the final thaw cycle the mixture was allowed to stir for 10 min before being immersed in an oil bath at 75° C. After 150 min, the oil bath was removed and the reaction vessel was immersed in liquid nitrogen to quench the polymerization reaction. The reaction mixture was dissolved in THF, and passed through an alumina plug to remove the metal/ligand catalyst system. The polymer solution was concentrated and then precipitated and recovered into a cold methanol/water solution. Mn=22,500 from SEC, based on MALS. Mw/Mn=1.06. The isolated yield was 2.0714 g (44%).
Poly(acrylic acid-b-styrene-d8): The poly(tert-butyl acrylate) block of 3 was cleaved selectively by adding 50.00 mL of trifluoroacetic acid (TFA) to 1.0624 g (4.72 e−2 mmol) of the diblock 2 in 150 mL of dichloromethane. After 36 hours, the solvent was evaporated in vacuo; the residue was dissolved in THF and purified by dialysis in presoaked cellulose dialysis tubing (12-14 kDa Molecular weight cut-off (MWCO)) against nanopure water for 3 days. Lyophilization yielded pure poly(acrylic acid-b-styrene-d8) recovered as a white powder. Yield: 0.8956 g (98%)
Micelle Formation.
Spherical micelles of narrow size distribution were obtained by dissolving the purified block copolymer 4 (0.5186 g, 2.30 e−5 mol) in 250.00 mL of THF (2.07 mg/mL) followed by gradual addition (15.00 mL/h) of an equal volume 5 mM sodium phosphate, 5 mM sodium chloride, pH 7.4 buffer to induce micellization. The micelles were allowed to stir for 12 h before being transferred to a dialysis and concentration cell (10 kDa MWCO) and dialyzed with 3.0 L of buffer. The final volume was 650 mL of buffered micelle solution for a final concentration of 0.80 mg/mL.
Shell Crosslinked (SCK) Nanoparticle Formation.
Vi121: 2,2′-(ethylenedioxy)-bis(ethylamine) (67 μL, 0.46 mmol) was added to 0.500 L of micelle solution (0.80 mg/mL) of poly(acrylic acid-b-styrene-d8). After 30 minutes, an aqueous solution (100 mg/mL) of 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (1.040 g, 5.46 mmol) was added to the reaction vessel. The reaction mixture was allowed to stir for 24 h, and the SCK solution was concentrated to 200 mL in a concentration cell and washed with 3.0 L of nanopure water to remove the reaction byproducts. A small portion was removed for analysis and the remainder of the SCK solution was lyophilized. (
General Procedure for SCK-PNA conjugate formation.
To a stirred solution of SCK (0.53 mg/mL, 2.4 nmoles (particle)) was added Lys-PNA (12 nmoles, 5 equiv.) in 0.5 mL water over a 3 minute period. The mixture was allowed to stir for 30 minutes prior to the addition of 50 equiv. of 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide methiodide (120 nmoles) as a solution in 0.3 mL of water over a 2 minute period. The reaction was stirred for 16 hours at ambient temperature, and subsequently transferred to dialysis tubing (10 kDa MWCO) and allowed to dialyze for 4 days against nanopure water. UV-visible spectroscopy demonstrated an average of 4 PNAs per particle (80% coupling efficiency).
Characterization of the SCK-PNA conjugate prepared above.
Equimolar amounts of SCK and SCK-PNA conjugate were analyzed by UV-visible spectroscopy to determine the concentrations of PNA within solution, by subtracting the measured absorbance of the SCK at 260 nm from the measured absorbance at 260 nm for the PNA-SCK conjugate, and the molarity of PNA within solution was determined using a molar extinction coefficient of 150,000 M−1 cm−1 (See
To a stirred solution of the aforementioned SCK-PNA (1.8 mL, 0.53 mg/mL, 1.7 nmoles (particle)) was added Fluorescein-5-thiosemicarbazide (FTSC) (8.5 nmoles, 7.4 μg, 5 equiv. per particle) in 0.2 mL water over a 5 minute period. The mixture was allowed to stir for 30 minutes prior to the addition of 7.5 equiv. of 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide methiodide (13.6 nmoles, 3.9 μg) as a solution in 0.1 mL of water over a 2 minute period. The reaction was allowed to stir for 16 hours at ambient temperature, and subsequently transferred to dialysis tubing (10 kDa MWCO) and allowed to dialyze for 2 days against nanopure water. Final volume was 2.0 mL, which was subsequently concentrated again to its original volume (1.8 mL)
Preparation of PNA- and PTD-Functionalized SCK Nanoparticles and Fluorescent Labeling.
SCK-PNA-FTSC-PTD.
To a stirred solution of SCK-PNA-PTD (1.8 mL, 0.53 mg/mL, 1.7 nmoles (particle)) was added PTD (17 nmoles, 0.030 mg, 10 equiv. per particle) in 0.3 mL water over a 5 minute period. The mixture was allowed to stir for 30 minutes prior to the addition of 7.5 equiv. of 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide methiodide (26 nmoles, 7.7 μg) as a solution in 0.1 mL of water over a 2 minute period. The reaction was allowed to stir for 16 hours at ambient temperature, and subsequently transferred to dialysis tubing (10 kDa MWCO) and allowed to dialyze for 3 days against nanopure water.
SCK-PNA-PTD.
To a stirred solution of SCK-PNA (9.0 mL, 0.53 mg/mL, 8.6 nmoles (particle)) was added PTD from an aqueous solution (190 nmoles, 0.35 mg, 22 equiv. per particle). The mixture was allowed to stir for 30 minutes prior to the addition of 22 equiv. of 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide methiodide as a solution in 0.2 mL of water over a 5 minute period. The reaction was allowed to stir for 16 hours at ambient temperature, after which the reaction was transferred to dialysis bag (10 kDa MWCO) and dialyzed against water for 5 days. The final volume was returned to 8.0 mL via stirred cell ultrafiltration.
Preparation of PNA- and PTD-Functionalized SCK Nanoparticles and Conjugation with Chelator for Radiolabeling.
SCK-PNA-PTD-DOTA.
To a stirred solution of SCK-PNA-PTD (8.0 mL, 0.53 mg/mL, 7.8 nmoles (particle)) was added DOTA-NH2-tri-tert-butyl ester (structure shown in
We have demonstrated that our conjugation of the protein transduction domain (PTD) from the HIV-1 Tat protein to shell-cross-linked (SCK) nanoparticles is an efficacious method to facilitate cell surface binding and transduction of SCK nanoparticles (Liu et al., Biomacromol., 2001, 2, 362-368). Attaching increasing numbers of peptide sequences to SCK nanoparticles in a global solution-state functionalization strategy has been devised as a method for increasing the efficiency of the cell-penetrating process.
In this example, the numbers of peptides per SCK were controlled through stoichiometric balance and measured by using two independent methods, UV-visible spectroscopy and phenylglyoxal analysis. PTD was conjugated in 0.005, 0.01, and 0.02 molar ratios, relative to the acrylic acid residues in the shell, to the SCK nanoparticles resulting in SCK populations possessing nominally 52, 104, and 210 (41, 83, and 202 as measured by phenylglyoxal analysis) PTD peptides per particle, respectively. The methodologies for the block copolymer and nanoparticle syntheses, peptide derivatization, and characterization of peptide-functionalized SCK nanoparticles are reported and the feasibility and efficiency of intracellular internalization of the respective SCKs were quantified.
Test Procedures
Materials.
Unless otherwise listed, all solvents and reagents were purchased from Sigma Aldrich Chemical Co. (St. Louis, Mo.) and used as received. Monomers were purchased from Sigma Aldrich and distilled over calcium hydride. Fmoc-protected amino acids and preloaded solid-phase Wang resins were purchased from NovaBiochem-CalBiochem Corp (San Diego, Calif.). Spectra/Por dialysis membranes (Spectrum Laboratories, Inc., Rancho Dominguez, Calif.) were purchased from Fisher Scientific Company (Pittsburgh, Pa.). Prolong antifade mounting medium was purchased from Molecular Probes Inc. (Eugene, Oreg.).
Measurements.
1H NMR (300 MHz) and 13C NMR (75 MHz) spectra were recorded as solutions on a Varian Mercury 300 MHz spectrometer with the solvent signal as standard. IR spectra were obtained on a Perkin-Elmer Spectrum BX FT-IR system using diffuse reflectance sampling accessories. Mass spectra were obtained from a Voyager DE-RP MALDI-TOF mass spectrometer (PE Biosystem). HPLC was performed using a Hewlett-Packard Series 1100 with reversed phase C18 column (Dynamax, 300 Å, Rainin) equipped with quaternary pump, solvent degasser, and diode array detector.
Size Exclusion Chromatography (SEC).
Size exclusion chromatography was conducted on a Model 150-CV (Waters Chromatography Inc., Medford, Mass.). The instrument was equipped with a Model 410 differential refractometer, a Model PD2040 dual-angle (15° and) 90° light scattering detector (Precision Detectors Inc., Bellingham, Mass.), and a three-column set of gel-mixed-bed styrene-divinylbenzene columns (Polymer Laboratories Inc., Amherst, Mass.). The SEC system was equilibrated at 35° C. in anhydrous THF, which served as the polymer solvent and eluent (flow rate set to 1.00 mL/min then determined gravimetrically). An injection volume of 400 μL was used, and the polymer concentrations ranged from 5 to 10 mg/mL. Data collection was performed with program Precision Acquire (Precision Detectors Inc., Bellingham, Mass.). Data analysis was performed with program Discovery32 (Precision Detectors Inc., Bellingham, Mass.). Interdetector delay volume and the light scattering detector calibration constant were determined from a nearly monodisperse polystyrene calibrant (Mp=90000 g/mol, Mw/Mn<1.04: Pressure Chemical Co., Pittsburgh, Pa.). The differential refractometer was calibrated with standard polystyrene reference material (SRM 706; NIST, Gaithersburg, Md.), of known specific refractive index increment, dn/dc (0.184 mL/g). The dn/dc of the analyzed polymers was then determined from the differential refractometer response.
Differential Scanning Calorimetry (DSC).
The glass transition temperature (Tg) was measured by differential scanning calorimetry on a Perkin-Elmer DSC-4 differential scanning calorimeter. Heating rates were 10° C./min and reported values of Tg were measured at the midpoint of the inflection tangent, upon the third heating scan.
Sedimentation Equilibrium (SE).
A Beckman Instruments Co. Model Optima XL-I analytical ultracentrifuge operated with a Model An60-Ti, four-hole rotor was used to centrifuge 50 mM NaH2PO4, 50 mM NaCl, pH 7.1 solutions of the SCK to sedimentation equilibrium. All measurements were made at 20±0.1° C. Rotor speeds of 2000, 3000, 5000 and 8000 rpm were used. Sedimentation equilibrium data were obtained for three SCK solution concentrations. Resulting sedimentation equilibrium profiles were recorded with the instrument's Rayleigh interferometric (refractive index) detection optics. The ultracentrifuge sample cell was assembled from an Epon charcoal-filled, six-channel centerpiece and matched sapphire windows. The solution volume and the cell's optical path length were 110 μL, and 12 mm, respectively. The solution volume and optical path length employed corresponded to a “short” column sedimentation equilibrium test with a column height of approximately 2.5 mm. A centrifugation time of 3 to 5 days was used to reach sedimentation equilibrium. Partial specific volume (v) values for the SCKs were determined via sedimentation equilibrium analysis for protonated and deuterated buffer solutions of SCKs as described in Remsen et al. (Macromol., 1999, 32, 3685-3689). Solutions of the SCK in deuterated buffer were prepared by exhaustive dialysis of protonated buffer stock solutions of SCKs against 50 mM phosphate buffered saline (PBS), pD 7.1. In 99.9 atom % D2O, Calculation of molecular weight employed a built-in data analysis program that employed standard multicomponent least-squares fitting routines. Density at 20.0±0.1° C. for protonated and deuterated buffers was determined with a Mettler-Parr digital density meter. Measurements of v were reproducible to within ±1% of the mean value given by three determinations. The values of v obtained by SE were also used for the determination of the weight concentrations of SCK nanoparticle solutions. The digital density meter was employed to measure the solution density at 20.0±0.1° C. for the SCK solutions and their corresponding PBS to an accuracy of ±0.0001 g/mL.
These values were used in conjunction with the SE-measured value of v to determine the weight concentration (CSCK) of the SCK solution in PBS:
CSCK=(pSCK−pb)/(1−vpb) where pb is the density of the buffer and pSCK is the density of the SCK solution.
UV-Visible Spectroscopy.
Absorption measurements were made using a Molecular Devices Corp (Sunnyvale, Calif.) UV-visible spectrophotometer. A Thermomax multiplate reader using SOFTmax PRO software was employed. The concentrations of PTD and SCK in aqueous solutions of functionalized SCK nanoparticles were simultaneously determined using the UV absorbance measured at 230 and 276 nm. Measurements obtained at 230 and 276 nm corresponded to the turbidity of the SCK nanoparticle and the tyrosine (TYR) absorbance of the PTD at these wavelengths. The total absorbance for a functionalized SCK at a given wavelength, Aλ, was given by the sum of the absorbances of the nanoparticle's SCK component, ASCKλ, and its PTD component, ATYRλ:
A230=ASCK230+ATYR230 Equation (1)
A276=ASCK276+ATYR276 Equation (2)
The individual concentrations of the SCK and PTD (CSCK and CTYR, respectively) components constituting a functionalized nanoparticle were obtained by simultaneously solving equations 1 and 2 after calibration of the UV spectrum at 230 and 276 nm with PTD and SCK standards of known concentration. The calibration yielded a set of calibration coefficients, K, for the components at 230 and 276 nm:
A230=KSCK230+CSCK+KTYR230CTYR Equation (3)
A276=KSCK276+CSCK+KTYR276CTYR Equation (4)
Measured values A230 and A276 were substituted into equations 3 and 4 which were expressed in matrix form (equation 5) and then solved by inversion of the matrix of calibration coefficients, K:
A=KC Equation (5)
K−1A=K−1KC Equation (6)
C=K−1A Equation (7)
Substitution of computed values of K−1 in equation 7 above provided the expressions used to calculate the weight concentrations of SCK and PTD in solution:
CSCK=8.6405A230−41.5418A276 Equation (8)
CTYR=9.5652A230−1.5869A276 Equation (9)
Testally determined weight concentrations were converted to molar concentrations using the known molecular weight of the PTD and the measured molecular weight of the SCK. Molar concentrations of each component provided the requisite information to evaluate the number of peptides (PTD) per SCK nanoparticle (no. peptides per SCK=CPTD(M)/CSCK(M)).
Phenylglyoxal Analysis Measurements.
The number of arginine residues (and PTD) was determined using phenylglyoxal analysis. The assay was calibrated by adding aliquots (100 μL) of a PTD solution (100 μL in PBS with 10% methanol, volume fraction) in row 1 of a quartz 96-well plate and diluting serially through column 11. SCK solutions (100 μL) (0.0, 0.5, 1.0, and 2.0%) of known concentrations (1.20, 2.00, 1.20, and 0.60 mg/mL. respectively) were added to each well in the first column and diluted serially as described above. An aliquot (100 μL) of a phenylglyoxal solution (600 μM), in identical buffer, was then added to each well of the plate, and the reaction was allowed to incubate at 4° C. overnight. The 96-well plate was read for absorbance at X=310 nm in each well. The control phenylglyoxal absorbance spectrum was subtracted from the PTD absorbance spectra, and by plotting the residual absorbance numbers vs the known concentration of PTD in each well, a calibration curve was generated from which the amount of PTD in unknown solutions could be determined. Measurement of the SCK concentrations by other methods and converting molar ratios provided quantitative information on the number of peptides per particle in each of the four samples.
Dynamic Light Scattering (DLS).
Hydrodynamic diameter distribution and distribution averages for the SCKs in PBS solution were determined by dynamic light scattering. A Brookhaven Instruments Co. (Holtsville, N.Y.) DLS system equipped with a Model BI-9000AT digital correlator, a Model EMI-9865 photomultiplier, and a Model 95-2 Ar ion laser (Lexel Corporation, Fremont, Calif.), operated at 514.5 nm, was used. Measurements were made at 20±0.1° C. Nanoparticles were dialyzed into 50 mM PBS, pH 7.1, prior to analysis. Buffered nanoparticle solutions were either centrifuged in a model 5414 microfuge (Brinkman Instrument Company, Westbury, N.Y.) for 4 min or filtered through 0.22 μm poly(vinylidene fluoride) and 0.1 μm ceramic filters (Whatman, Maidstone, UK) to remove dust particles. Scattered light was collected at a fixed angle of 90°. The digital correlator was operated with 522 ratio spaced channels, an initial delay of 1.6 μs, a final delay of 10 ms, and a duration time of 15 min. A photomultiplier aperture of 400 μm was used, and the incident laser power was adjusted to obtain a photon counting rate between 200 and 300 Kcps. Only measurements for which the measured and calculated baselines of the intensity autocorrelation function agreed to within ±0.1% were used to calculate nanoparticle hydrodynamic diameter values. All determinations were made in triplicate. The calculations of the nanoparticle diameter distributions and distribution averages were performed with the ISDA software package (Brookhaven Instruments Co, Brookhaven Instruments Limited, Chapel House, Stock Wood, Redditch, Worcestershire, B96 6ST, UK), which employed single-exponential fitting, cumulants analysis, and non-negatively constrained least-squares particle size distribution analysis routines.
Zeta Potential.
Zeta potential (ζ) values for the SCKs were determined with a Brookhaven Instrument Co. (Holtsville, N.Y., USA) Model ZetaPlus zeta potential analyzer. Measurements were made following dialysis (MWCO 12-14 kDa dialysis tubing, Spectrum Laboratories, Rancho Dominguez, Calif., USA) of SCK solutions into 1 mM KH2PO4, 1 mM KCl, pH 7.1 buffer. Data were acquired in the phase analysis light scattering (PALS) mode, following solution equilibration at 25° C. Calculation of ζ from the measured nanoparticle electrophoretic mobility (μ) employed the Smoluchowski equation: μ=∈ζ/η where E and ∈ are the dielectric constant and the absolute viscosity of the medium, respectively. Measurements of ζ were reproducible to within ±2 mV of the mean value given by 16 determinations of 10 data accumulations.
Transmission Electron Microscopy (TEM).
Transmission electron microscopy carbon grids were prepared by oxygen plasma treatment to make the surface hydrophilic. Particle samples were diluted 9:1 in water and further diluted 1:1 with a 1% (mass fraction) phospho-tungstinic acid (PTA) stain. Micrographs were collected at 100000 magnifications and calibrated using a 41 nm polyacrylamide bead from NIST. Histograms of particle diameters were generated from the analyses of a minimum of 150 particles from at least three different micrographs.
Atomic Force Microscopy (AFM).
Tapping-mode atomic force microscopy measurements were conducted in air with a Nanoscope III Bioscope system (Digital Instruments, Santa Barbara, Calif.) operated under ambient conditions with standard silicon tips (OTESPA-70; L, 160 μm; normal spring constant, 50 N/m; resonance frequency, 246-282 kHz). The samples were prepared for AFM analysis by depositing a 2-μL drop of the solution onto freshly cleaved mica and allowing it to dry freely in air. Histograms of particle heights were generated from the section analysis of a minimum of 150 particles from at least five different analyses regions. Cell Lines. Chinese hamster ovary (CHO) cells (ATCC, American Type Culture Collection, Manassas, Va.) were obtained from Washington University in St. Louis. CHO cells were maintained in RPMI 1640 (Life Technologies, Rockville, Md.) culture medium supplemented with 10% (volume fraction) heat-inactivated fetal bovine serum (FBS, Life Technologies, Rockville, Md.), in 5% CO2:95% air (volume fractions) at 37° C.
Transduction Tests.
CHO cells were cultured, counted, and resuspended to a final concentration of 100,000 cells/mL. An aliquot of the cell suspension (3.00 mL) was deposited into each well of a tissue culture treated six-well plate (Falcon, 3043), which contained a No. 1.5 glass cover slip (Corning). After 48 h, the cells (50-60% confluence) in each six-well plate were washed with PBS (2×5.00 mL). An aliquot of serum free RPMI 1640 medium (3.00 mL) was added to each well followed by the respective SCK solutions (1.00 mL each). The plates were then returned to the incubator to incubate at 37° C. After 1 h, the nanoparticles were removed, and each well was washed with PBS (3×5.00 mL). The cells were then fixed using a 4% (mass fraction) paraformaldehyde solution (2.00 mL) in each well and allowing ambient temperature incubation for 1 h. After fixation, the cells were mounted in Prolong antifade mounting medium (Molecular Probes, Eugene, Oreg.) and viewed under bright field and fluorescent conditions using an Olympus IX-70 inverted microscope. The transduction tests were repeated using RPMI 1640 medium supplemented with 0.1% (mass fraction) sodium azide, and at 4 and 37° C. For quantification by flow cytometry, the transduction tests were repeated except that the cells were grown directly on the tissue cultured plates instead of glass cover slips. The cells were trypsinized to remove most of the surface bound particles and release the cells from the plate, centrifuged at 4° C., and resuspended in PBS and stored on ice briefly. Less than 5 min prior to flow cytometry analysis, propidium iodide (5.0 μL) was added to each centrifuge tube. Analysis was done on a FACS Calibur (BD Biosciences, Franklin Lakes, N.J.) instrument using CellQuest software.
Fluorescence and Confocal Microscopy.
Confocal microscopy was accomplished using a Leica TCS SP2 scanning confocal microscopy system equipped with Ar+, Kr+, and HeNe laser systems. The excitation wavelength was 488 nm, and the emission was collected over the range of 510-530 nm. Optical slices were taken on 0.5 μm centers with the Leica software, compiling the collections of images into the 3-D reconstructions. The incubation and fixation testal parameters outlined previously were strictly adhered to in the confocal microscopy tests with the following exceptions. The cover slips from the 37° C. tests were mounted on slides fitted with a small spacer and PBS was added as the medium. These tests were repeated with cells being incubated at 4° C. for 1 h and washed and mounted with cold buffer. The cells were viewed for a maximum of 20 min as live whole, unfixed specimens.
Fmoc-Solid-Phase Synthesis of PTD on Resin.
The protein transduction domain sequence (GGGGYGRKKRRQRRR; SEQ ID NO: 19) was synthesized by standard solid-phase synthesis using 9-fluorenylmethoxycarbonyl (Fmoc) chemistry. A small amount of beads were removed and washed with N-methylpyrrolidone (NMP), dimethylformamide (DMF), CH2Cl2, and methanol three times each. Peptide cleavage was achieved through treatment of the resin with a 10 mL 95% TFA: 2.5% triisopropyl silane (TIS): 2.5% water solution (volume fractions) for a minimum of 4 h. The solution was filtered, and the beads were rinsed with TFA. The solution was concentrated in vacuo, and the concentrate was precipitated into cold ether. The precipitates were effectively centrifuged at 3500 rpm for 10 min. The supernatant was decanted, the pellet was resuspended in cold ether, and the centrifugation process was repeated. The pellet was purified and recovered by reversed phase HPLC. MS (MALDI): 1789.5022 [M+H]+ (calcd: 1788.03 MW). TFA is C2HF3O2, available from AppliChem GmbH, Ottoweg 4, D-64291 Darmstadt, Germany
Poly(tert-butyl acrylate) (2).
A 100 mL Schlenk flask that had been oven-dried overnight, flame-dried under vacuum, and back-filled with argon was charged with copper(I) bromide (891.6 mg, 6.2×10−3 mol). tert-Butyl acrylate (38.00 mL, 2.6×10−1 mol), PMDETA (1.30 mL, 6.2×10−3 mol), and ethyl-2-bromopropionate (403 μL, 3.1×10−3 mol) were added via argon-washed syringes. The solution was degassed by three cycles of freeze-pump-thaw, and following the final thaw cycle, the mixture was stirred for 10 min before being immersed in an oil bath at 50° C. After 80 min, the polymerization was quenched by immersion in liquid nitrogen. The reaction mixture was dissolved in THF and passed through an alumina plug to remove the metal/ligand catalyst system. The polymer solution was concentrated and the product recoved by being precipitated into cold methanol. Mn 7400 from SEC. based on MALS. Mw/Mn=1.12. The recovery yield of the isolated product was 28.83 g (85%). (Tg)tBA=33° C. IR: 3440, 2980, 1750, 1450, 1380, 1265, 1150, 850, 760, 625 cm−1. 1H NMR (CDCl3) δ 1.05 (d, CH3CH end group), 1.22 (t, CH3CH2O end group), 1.20-1.50 (broad, (CH3)3C), 1.24-1.70 (broad, meso and racemo CH2 of the polymer backbone), 1.74-1.94 (broad, meso CH2 of the polymer backbone), 2.15-2.35 (broad, CH of the polymer backbone), 4.05 (br overlapping m, CH3CH2O and CHBr end groups) ppm. 13C NMR (CDCl3,) δ 27.9-28, 35.5-37.4, 41.5-41.4, 80.3, 173.6, 173.9 ppm.
Poly(tert-butyl acrylate-b-methyl acrylate) (3).
A Schlenk flask (100 mL) was oven-dried overnight, flame-dried under vacuum, back-filled with argon, and charged with copper I bromide (184.1 mg, 1.3×10−3 mol) and poly(tert-butyl acrylate) 2 (4.7381 g, 6.4×10−4 mol). PMDETA (268 μL, 1.3×10−3 mol) and methyl acrylate (30.00 mL, 3.3×10−1 mol) were added via argon-washed syringes. The solution was degassed by three cycles of freeze-pump-thaw, and following the final thaw cycle, the mixture was stirred for 10 min before being immersed in an oil bath at 68° C. After 70 min, the polymerization was quenched by immersion in liquid nitrogen. The reaction mixture was dissolved in THF and passed through an alumina plug to remove the metal/ligand catalyst system. The polymer solution was concentrated and then precipitated into a cold methanol/water solution. Mn=23400 from SEC, based on MALS. Mw/Mn=1.13. The yield was 9.18 g (16%). (Tg)PtBA=32° C. (Tg)PMA=14° C. IR: 3650, 3450, 2970, 1990, 1550, 1450, 1180, 1080, 850 750, 625 cm−1. 1H NMR (CDCl3) δ 1.20-1.50 (broad, (CH3)3C), 1.25-1.95 (broad, CH2 of the polymer backbone), 1.74-1.94 (broad, CH2 of the polymer backbone), 2.15-2.40 (broad, CH of the polymer backbone), 3.55-3.65 (broad. OCH3,) ppm. 13C NMR (CDCl3) δ 27.9-28, 35.5-37.4, 41.5-41.4, 51.5, 80.3, 173.4, 173.6 ppm.
Poly(acrylic acid-b-methyl acrylate) (4).
The tert-butyl esters along the poly(tert-butyl acrylate) block of 3 were cleaved selectively by adding TFA (30.00 mL) to the diblock, 3 (8.5600 g. 3.66×10−4 mol), in dichloromethane (100 mL). After 36 h, the solvent was evaporated in vacuo, and the residue was dissolved in THF and purified by dialysis in presoaked dialysis tubing (MWCO 12-14 kDa) against Nanopure (18.0 mΩ cm−1) water for 3 days. Lyophilization yielded poly(acrylic acid-b-methyl acrylate) as a white powder. Yield: 7.25 g (98%); (Tg)PAA=145° C. (Tg)PMA=14° C. IR: 3500-2500, 1760, 1660, 1445, 1280, 1180, 1050, 850, 725, 610 cm−1. 1H NMR (CDCl3) δ 1.25-2.0 (broad, CH2 of the polymer backbone), 1.74-1.94 (broad, CH2 of the polymer backbone), 2.20-2.45 (broad, CH of the polymer backbone), 3.55-3.65 (broad. OCH3,) ppm. 13C NMR (CDCl3,) δ 34-36.4, 40.5-42.4, 50.5, 173, 178 ppm.
Micelle Formation.
Polymer micelles of narrow size distribution were obtained by dissolving the block copolymer 4 (1.9968 g, 8.53×10−5 mol) in THF (1.000 L, 1.997 mg/mL) followed by gradual addition (20.00 mL/h) of an equal volume of nonsolvent (H2O) for the hydrophobic poly(methyl acrylate) to induce micellization. The micelles were stirred for 12 h before being transferred to presoaked and rinsed dialysis bags (MWCO 12-14 kDa) and dialyzed against Nanopure (18.0 MΩ cm−1) water for 3 days to remove the organic solvent. The final volume was 2.250 L of aqueous micelle solution for a final concentration of 0.89 mg/mL. DLS: Dh=38 nm, ZETA: ζ=−27±0.7 mV, TEM: 21.3±3.8 nm.
Shell-Crosslinked (SCK) Nanoparticle Formation.
2,2′-(Ethylenedioxy)-bis(ethylamine) (192 μL, 1.3×10−3 mol) was added to 2.125 L of micelle solution (0.90 mg/mL) of poly(acrylic acid-b-methyl acrylate). After 30 mm, an aqueous solution of 1-(3′-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (2.0201 g, 1.05×10−2 mol) was added to the reaction vessel. The reaction mixture was stirred for 24 h, and it was then dialyzed.
The tert-butyl esters were cleaved selectively through treatment of the diblock copolymer with TFA in CH2Cl2 for 36 h, against Nanopure water for 3 days to remove residuals. The SCKs were dialyzed into 50 mM sodium phosphate. 50 mM sodium chloride, pH 7.4 buffer, and the number-average hydrodynamic diameter (Dn) of were determined by dynamic light scattering. DLS: Dn=37 nm. ZETA: ζ=−20±0.5 mV. TEM: 18.3±3.6 nm. AFM: 3.8±1.8 nm. IR: 3385, 2949, 1738, 1568, 1442, 1163, 829 cm−1. DSC: Tg=15° C. 1H NMR (D2O:THF-d8, 1:2 (volume fraction)) δ 1-3.0 (aliphatic protons of polymer backbone), 3.50-3.70 (OCH3) ppm.
General procedure for global solution state functionalization of (SCK) nanoparticles with various molar ratios of PTD.
An SCK solution (50.00 mL, 0.895 mg/mL) was placed into a 100 mL round-bottom flask equipped with a stir bar. Sodium chloride (1.00 g) was placed into each of the flasks to minimize aggregation. A stock solution (50.00 mg/mL) of 1-(3′-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride in sodium phosphate buffer, pH 7.4 was prepared, and 1.00 mL aliquots (2.5×10−4 mol) were added to each flask to activate the acrylic acid residues. A stock solution (18.21 mg/mL) of the PTD peptide was made in sodium phosphate buffer, pH 7.4, and aliquots of the solution were added to the respective flasks 20 min after the addition of the carbodiimide.
0.5% PTD Functionalized.
A PTD stock solution (61 μL, 18.21 mg/mL, 6.25×10−7 mol) was added to the activated SCK solution, and the mixture was allowed to react overnight. Following the allocated reaction time, the solution was transferred to presoaked dialysis tubing (MWCO 12-14 kDa) and allowed to dialyze for 3 days against 50 mM sodium phosphate, 50 mM sodium chloride, pH 7.4 buffer, prior to analysis. DLS: Dn=35±3 nm. ZETA: ζ=−28±0.9 mV. TEM: 20.2±3.7 nm.
1.0% PTD Functionalized.
A PTD stock solution (123 μL, 18.21 mg/mL, 1.25×10−6 mol) was added to the activated SCK solution, and the mixture was allowed to react overnight. Following the allocated reaction time, the solution was transferred to presoaked dialysis tubing (MWCO 12-14 kDa) and allowed to dialyze for 3 days against 50 mM sodium phosphate, 50 mM sodium chloride, pH 7.4 buffer, prior to analysis. DLS: Dn=36±3 nm. ZETA: ζ−23±0.7 mV. TEM: 21.4±3.6 nm.
2.0% PTD Functionalized.
A PTD stock solution (245 μL, 18.21 mg/mL, 2.50×10−6 mol) was added to the activated SCK solution, and the mixture was allowed to react overnight. Following the allocated reaction time, the solution was transferred to presoaked dialysis tubing (MWCO 12-14 kDa) and allowed to dialyze for 3 days against 50 mM sodium phosphate, 50 mM sodium chloride, pH 7.4 buffer, prior to analysis. DLS: Dn=32±3 nm. ZETA: ζ=−22±0.5 mV. TEM: 21.6±3.3 nm.
General Procedure for the Conjugation of a Fluorescent Tag to the PTD-Functionalized Nanoparticles.
The respective PTD-functionalized SCK solutions (10.00 mL. 0.895 mg/mL) (2.24×10 mol) were placed into 50 mL round-bottom flasks. A 4.0 M KCl solution (1.00 mL) was added to each flask. The vessels were allowed to equilibrate for 30 min before 0.500 mL of a 50 mg/mL carbodiimide stock solution (1.25×10−4 mol) was added to each vessel. After 15 min, 200 μL of a 0.400 mg/mL stock solution (1.58×10−7 mol) of the fluorescein derivative was added to each round-bottom flask, and the reactions were stirred overnight. The solutions were then transferred to successfully presoaked dialysis bags (MWCO 12-14 kDa) and allowed to dialyze for 3 days against 50 mM phosphate, 50 mM NaCl buffer at pH 7.4. The reaction resulted in approximately 70 fluorophores being coupled to each nanoparticle based on calculations assuming ideal reaction efficiency.
SCK Synthesis and Peptide Derivitization.
The amphiphilic block copolymer precursor to the SCKs was prepared by sequential atom transfer radical polymerizations of tert-butyl acrylate and methyl acrylate followed by the selective acidolysis of the tert-butyl esters. The poly(tert-butyl acrylate) macroinitiator was afforded through the polymerization of tert-butyl acrylate at 50° C. for 80 min using ethyl 2-bromopropionate as the initiator and the CuIBr/PMDETA catalytic system. The chain was further extended through the addition polymerization of methyl acrylate in bulk in the presence of CuIBr/PMDETA at 68° C. for 70 min as shown in
SCKs were formed by intramicellar conversion of approximately 50% of the 1-[3′-(dimethylamino)propyl]-3-ethylcarbodiimide hydrochloride activated acrylic acid residues in the shell layer to amides using 2,2′-(ethyl-enedioxy)bis(ethylamine), as shown in process
The SCKs were effectively and successfully functionalized with various molar quantities of PTD under high ionic strength conditions to minimize aggregation and interparticle cross-linking in a global solution state functionalization process. A linker-derivatized 5(6)-carboxylfluorescein dye (approximately 70 fluorophores per particle) was coupled to each of the SCK samples 6-9 to facilitate observation under fluorescence conditions.
Molecular Weight and Aggregation Number.
The absolute weight-average molecular weight, Mw, of PTD-functionalized SCK nanoparticles was evaluated by sedimentation equilibrium (SE) analysis. Representative SE data (fringe displacement versus radial position, r) are presented in
SE analysis of Mw employed the nonlinear, least-squares fitting of sedimentation equilibrium profiles represented by the data in
Collection of SE Profiles Using UV-Visible Detection Optics Allowed the Analysis of the Peptide Content of the Nanoparticles at Centrifugation Equilibrium.
Free peptides were uniformly dispersed throughout the solution volume while the relatively massive particles were depleted from the meniscus along with the peptides bound to them. Therefore, the amount of free vs SCK-bound peptide in solution was determined by the ratio of absorbance at the meniscus to the absorbance of the unfunctionalized micelle and SCK. No absorbance for the tyrosine (λ276) was detected near the meniscus in the 0.5% and 1.0% solutions relative to controls at 5,000 rpm, indicating that all of the absorbance from the tyrosine residue of the PTD sequence is associated with the SCK nanoparticle as shown in
A slight amount of absorbance observed for the 2.0% functionalized SCK solution suggested free peptide in solution however, increasing the rotor speed to 8,000 rpm, which depleted the meniscus of nanoparticles, indicated that no free peptide was present in the solution (
Particle Analysis.
The SCK nanoparticles were characterized extensively to probe for the differences in size, surface charge, and morphology as a result of post-cross-linking functionalization with the arginine-rich PTD sequence. Dynamic light scattering (DLS) measurements were collected in PBS, pH 7.4. This precaution was used to minimize dilute solution aggregation of the nanoparticles. The polymeric micelle precursor to the SCK was shown to have a number-average diameter, Dn, of 38±3 nm. The corresponding SCK, prepared with 50% cross-linking of its shell, was found to have a Dn of 37±2 nm. A comparison of Dn values calculated using the nonnegatively constrained least squares (NNLS) model for the diameter distributions of the 0.5% (7), 1.0% (8), and 2.0% (9), PTD-functionalized nanoparticles resulted in values of 35±3, 36±3, and 32±4 nm, respectively. When the volume-average diameter, Dv, and the intensity-average diameter, Dz, distributions for the nanoparticles were calculated, the presence of small amounts of aggregated species, representing a maximum of 5 vol %, was apparent in the Dv and Dz diameter distributions. The likely source of these larger diameter fractions is interparticle crosslinking due to the presence of the PTD sequence; however, it is unknown whether the nature of the aggregation arises from covalent cross-linking or electrostatic attraction. These findings are consistent with the large increases noted in Mw for the PTD-functionalized SCKs relative to Mw obtained for preformed SCK, 6. Since these aggregated species were less than 100 nm in diameter, filtration and/or dialysis were not effective in their removal from the majority population of smaller nanoparticles. However, because these species represent less than 1% of the nanoparticle population by number, the contribution of these aggregates to data sets collected using imaging methods, such as atomic force microscopy (AFM), transmission electron microscopy (TEM) and confocal fluorescence microscopy, was negligible. Analysis of the SCKs by TEM depicted circular shapes that possessed narrow size distributions. The observed TEM nanoparticle diameters were smaller than those measured as Dn in buffer solution, due to drying and the effects of the phosphotunstic acid staining process employed during the TEM sample preparation. Zeta potential measurements also showed a diminishment in the negative surface charge density with increasing functionalization. The zeta potential (ζ) data for the functionalized SCKs are included in Table 1.
Quantification of PTD Functionalization.
The number of peptides per particle in each sample was quantified using UV-visible spectroscopy and reaction of phenylglyoxal with the guanidine functionality of arginine as two independent methods of analysis. The number of peptides per particle was measured from UV spectroscopy (Equations 1-9) by solving simultaneously for the peptide and SCK concentration using absorbance measurements recorded at two different wavelengths, λ230 and λ276. Analysis of SCK samples 7, 8, and 9 resulted in values of 38, 86, and ˜500 peptides per particle, respectively. The large number of peptides measured in sample 9 is a result of a slight amount of turbidity arising from aggregation, which dominates the absorbance measurement at 230 nm as shown in
The second assay performed to quantify the number of peptides per particle employed absorbance measurements at 310 nm, which exhibited a negligible contribution from solution turbidity. Phenylglyoxal reacts specifically with the guanidine group of arginine residues under mild conditions. The PTD sequence contains six arginine residues which react with one phenylglyoxal moiety each in a mechanism outlined by Jairajpuri et al. (Biochem., 1998, 37, 10780-10791).
Measurements made using this method, again comparing molar ratios, resulted in degrees of functionalization of 41, 83, and 202 peptides for 7, 8, and 9, respectively. These values are in good agreement with the dual wavelength, simultaneous UV spectroscopic determinations for the degree of functionalization in 7 and 8. The value 202 determined by the phenylglyoxal method for 9 was in better agreement with expected values based on the measured Mw for the SCK (Table 1). The validity of the phenylglyoxal method as a specific assay for the PTD moieties attached to a SCK was also confirmed by performing the same testal conditions for the nonfunctionalized SCK, as a negative control test, which showed no absorbance due to the phenylglyoxal derivatization and thus no reaction of phenylygloxal with the unfunctionalized SCK, (6).
Cell Transduction Tests.
A mixture of 5 and (6)-carboxy-fluorescein derivatized with a 2,2′-(ethylenedioxy)bis-(ethylamine) linker was conjugated to the PTD-functionalized nanoparticles to visually image binding interactions of the conjugates with mammalian cells using fluorescence microscopy. This type of fluorophore derivatization does not contribute to enhanced cellular uptake. The conjugation was performed on a molar equivalence basis and resulted in approximately 70 dye molecules per particle, assuming complete conversion. Free dye did not contribute to the analysis, as it was removed via dialysis against PBS. The cell uptake of PTD-functionalized SCKs was investigated by the in vitro transduction of CHO cells. Numerous examples exist describing the sequence specificity, mechanism, cofactor, and cell-type dependence on the efficiency of cellular uptake. The mechanism, efficiency, and energy dependence of the particle translocation was investigated in this instance by varying the metabolic conditions of the tests. Conditions included 1 h incubation times at 37° C. and 4° C. in serum free media, and in the presence of 0.1% sodium azide. Bright field, fluorescence, and confocal microscopies were performed on live cells as well as specimens that were fixed through 1 h incubations at ambient temperature in a 4% paraformaldehyde solution. Confocal microscopy of fixed cells clearly showed an accumulation of the fluorescent PTD functionalized nanoparticles inside the cells in all cases. Although the nonfunctionalized nanoparticles are also internalized, the apparent fluorescence intensities are qualitatively less than those of the PTD functionalized particles. Since fixation of cells involves the inherent perturbation of the cellular membrane, live cells were viewed without fixation to see whether rapid internalization occurred without the benefit of fixation.
In the cases where the cells were not fixed with the 4% paraformaldehyde solution, the non-PTD-functionalized SCKs were not observed in the intracellular space under fluorescence conditions when incubated at 37° C. or 4° C., and therefore it was determined that they were either not internalized nonspecifically or not at a level that was readily measurable using optical or fluorescence microscopies. However, the 0.5%, 1.0%, and 2.0% PTD-functionalized SCK nanoparticles were readily internalized at 37° C., 4° C., and in the presence of 0.1% sodium azide, regardless of disruptive fixative processes that may or may not contribute to an enhanced nonspecific effect.
Flow Cytometry Analysis.
The efficiency of PTD-functionalized SCK cell transduction was quantified by fluorescence activated cell sorting (FACS). Data in Table 2 following, which indicate the percentage of cells that are fluorescent for the respective samples, depict a trend of increasing cell transduction efficiency with increasing PTD/SCK stoichiometry. The slight decrease in the efficiency of uptake at 4° C. and in the presence of sodium azide, which depletes cellular ATP, relative to measured values at physiological temperatures show that endocytotic processes are also contributing to the SCK internalization. However, it is evident that non-endocytotic pathways contribute significantly to cell entry. While FACS analysis of the PTD-functionalized SCKs suggests multiple mechanisms of uptake, the intracellular internalization as visualized by live cell confocal microscopy is evident FACS analysis does not discriminate between internalized and surface bound particles, and efforts to further quantify the efficiency of uptake and exchange of the respective samples by radiolabeling methods are ongoing. The involvement of a single cellular process governing the internalization process has been shown to be increasing unlikely. While the ionic interactions between the TAT-derivatized species and the cell membrane are generally thought to be the initial step in the internalization process, the overall negative surface charge density, as measured by zeta potential, of the PTD-functionalized SCK nanoparticles suggest that further evidence is required to bolster that assessment. Recently, Dowdy et al. (Nat. Med., 2004, 10, 310-315) have shown that TAT-fusion proteins were internalized in a multistep process starting with a receptor-independent association of the fusion protein with the cell surface followed by a lipid raft-dependent macropinocytosis, which was demonstrated to be independent of interleukin-2 receptor/raft-, caveolar- and clathrin-mediated endocytosis. While these findings shed critical new and thorough insights on the mechanism of internalization, additional research on the nature of the initial construct-cell surface association step is needed.
The assembly of well-defined polymeric nanoparticles has been described, and subsequent functionalization of the SCK nanoparticles with PTD has been shown to facilitate their transduction across cellular membranes. The numbers of peptides per SCK were controlled through stoichiometric balance and measured by two independent methods. The feasibility and efficiency of intracellular internalization were quantified and confirmed.
The inventors used conjugation of the protein transduction domain (PTD) from the HIV-1 Tat protein to shell cross-linked (SCK) nanoparticles as a method to successfully facilitate cell surface binding and cell transduction.
Following assembly, the constructs (SCKs) were evaluated in vitro and in vivo to obtain a preliminary biocompatibility assessment. The effects of SCK exposure on cell viability were evaluated using a metabolic 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-2H-tetrazolium bromide (MTT) and a fluorescent apoptosis assay. Furthermore, stages of apoptosis were quantified by flow cytometry. Although higher levels of peptide functionalization resulted in decreased metabolic function as measured by MTT assay, advantageously significant apoptosis was not observed below 500 mg/L for our samples.
To evaluate the potential immunogenic response of the peptide-derivatized constructs, a real-time polymerase chain reaction (RT-PCR) system that allows for the in vitro analysis and quantification of the cellular inflammatory responses tumor necrosis factor alpha (TNF-α) and interleukin-1 beta (IL1-β) was utilized. The inflammatory response to the peptide-functionalized SCK nanoparticles as measured by RT-PCR show statistically significant increases in the levels of both TNF-α and IL1-β relative to tissue culture polystyrene (TCPS). Fortunately, the measured cytokine levels did not preclude the further testing of SCKs in an in vivo mouse immunization protocol. In this limited assay living mice, measured increases in immunoglobulin G (IgG) concentration in the sera were minimal with no specific interactions being isolated, and more importantly, none of the mice (>50) subjected to the three 100 μg immunization protocol have died. Additionally, advantageously no gross morphological changes were observed in postmortem organ histology examinations.
Materials.
Fmoc-protected amino acids and preloaded solid-phase Wang resins were purchased from NovaBiochem-CalBiochem Corp (San Diego, Calif.). Sodium dodecyl sulfate (SDS),3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-2H-tetrazolium bromide (98%) (MTT), Tween20, mouse IgG (Fc, Sigma 1-8765), and goat anti-mouse IgG alkaline phosphatase conjugate (Fc specific, Sigma A-1418) were purchased from Sigma Aldrick (St. Louis, Mo.). Alkaline phosphate substrate solution was purchased from BioRad (Hercules, Calif.). Spectra/Por dialysis membranes (Spectrum Laboratories, Inc., Rancho Dominguez, Calif.), 96-well polystyrene plates (Falcon), and ELISA plates (Nunc-Immuno, Maxisorp) were purchased from Fisher Scientific Company (Pittsburgh, Pa.). QuantiTect SYBR Green RT-PCR Kit and Rneasy Kit were obtained from Qiagen (Valencia, Calif.). Primer identification, isolation, and probe development were nearly identical to methods described in Bailey et al. (J. Biomed. Mater. Res., 2004, 69, 305-313 and J. Dental. Res., 2004).
Certain commercial materials and equipment are identified in this specification in order to specify adequately the test procedure. In no instance does such identification imply recommendation by the National Institute of Standards and Technology nor does it imply that the material or equipment identified is necessarily the best available for this purpose.
The Animal Facility at the Washington University Department of Biology in St. Louis, St. Louis, Mo. performed immunizations, sera collections, and organ histology. Animal studies were conducted under Protocol 20010343 approved by the Animal Studies Committee of Washington University in St. Louis, St. Louis, Mo.
Cell Lines.
Mouse myeloma B cells (ATCC, Manassas, Va.), CRL-1581.1, and CHO cells (ATCC) were obtained as gifts from Washington University in St. Louis, St. Louis, Mo. Mouse myeloma B cells were cultured in RPMI (Life Technologies, Rockville, Md., USA) 1640 medium using TCM serum replacement (10%, volume fraction) obtained from Celox Laboratories (St. Paul, Minn.). RAW 264.7 cells were purchased from ATCC. RAW 264.7 and CHO cells were maintained in RPMI supplemented with 10% (volume fraction) heat-inactivated fetal bovine serum (FBS, Life Technologies, Rockville, Md., USA), in 5% CO2:95% air (volume fractions) at 37° C. To harvest, RAW 264.7 cells were washed with calcium- and magnesium-free phosphate-buffered saline and subsequently incubated with Hank balanced salt solution (HBSS) to promote release from the flask.
Determining Cell Viability via MTT Assay.
Mouse myeloma B cells were counted and diluted into fresh media at concentrations of 50,000 cells/mL and an aliquot (100 μL) was seeded to each well in a 96-well plate. After deposition of the cell suspension, the plates were placed in an incubator (37° C., 5% CO2, volume fraction) and allowed to grow for 24 h. Fresh 96-well plates were loaded with sterile buffer (40 μL), and the first column of each row was loaded with polymer or SCK stock solutions of known concentration. The first columns in each plate were then diluted serially from columns 2 to 11. The last columns were held as controls with no polymer or SCK added. Fresh medium (50 μL) was then added to every well in the plates. The original plates were removed from the incubator, and the premixed sample solutions were added to the corresponding wells in each plate. After 24 h incubation, the inoculated plates were removed from the incubator, and an aliquot of MTT (Sigma) (20 μL, 5.00 mg/mL) in PBS (0.05 mol/L phosphate, 0.05 mol/L sodium chloride, pH 7.4) was added to each well. The plates were returned to the incubator and allowed to equilibrate for 2 h. After 2 h, extraction buffer (80 μL, 20% (mass fraction) SDS (Sigma) in 50:50 DMF:H2O, volume fraction, pH 4.7) was added to each well to extract the aqueous insoluble formazan product. The plates were then returned to the incubator for 18 h to allow for the extraction after which the absorbance of each solution was measured at 560 nm. Concentrations were determined by the weight of lyophilized polymer sample dissolved in PBS and then adjusted for the dilution of the medium. Results are an average of four values, and the standard deviation is reported for each concentration.
Apoptosis Assay.
Apoptotic analysis of RAW 264.7 cells was assessed using the Guava Nexin Kit (Guava Technologies, Hayward, Calif.). RAW 264.7 cells were plated in 12-well plates at 50,000 to 100,000 cells per well and allowed to adhere for 24 h, after which the cells were inoculated with 100 μL aliquots of the respective samples. The initial quantity of SCK was suspended in 0.500 mL of PBS. The respective samples were subsequently added to RAW 264.7 cultures (100 μL). After 24 h, the media was removed from the cells, and the cultures were washed with PBS. To promote release from the plate, the cells were incubated with 1 mL of HBSS for 30 min. The cells were then gently removed from the plate, and the volume was adjusted to 300 μL. The cell suspension was incubated with 5 μL of Nexin 7-AAD and 5 μL of Annexin V-PE for 5 min in a light-protected environment and subsequently analyzed.
Flow Cytometry.
Apoptotic analysis of RAW 264.7 cells incubated on the thin films or in the presence of the nanoparticles was assessed using the Guava Nexin Kit (Guava Technologies, Hayward, Calif.). RAW 264.7 cells were plated in 24-well plates (50,000 to 100,000) cells per well and allowed to adhere on tyrosine-derived polycarbonate thin films or tissue culture polystyrene for 24 h prior to analysis by flow cytommetry. Full testal details were described previously.
mRNA Extraction.
Cells were plated in sterile 150 mm×25 mm nonpyrogenic polystyrene dishes (Daigger, Vernon Hills, Ill.). SCK nanoparticles were added to plated cells 24 h following seeding. The mRNA extraction was carried out using the materials and protocol provided in the Rneasy Kit from Qiagen (Valencia, Calif.). The mRNA extraction protocol was followed according to the manufacturer's specification, except a 21-gauge needle was used to homogenize the sample. The RNA was treated with RNA Secure immediately following elution and stored at −20° C. Standard spectrophotometric measurements were taken, and a 2% (mass fraction) agarose gel stained with 10 μg/mL ethidium bromide (Sigma, St. Louis, Mo.) was used to image the RNA. Densitometry was performed using the Versa Doc imaging system (Bio-Rad, Hercules, Calif.).
Standards.
The plasmids containing the cDNA inserts for TNF-α, IL-1β, and the 18 S ribosomal subunit were purchased from ATCC. The plasmids were grown in luria-bertani (LB) medium (ATCC, medium 1065) with 100 μg/mL of ampicillin for selection purposes. Plasmid DNA was isolated using the Plasmid Giga Kit (Qiagen, Valencia, Calif.) following the Qiagen's protocol. Spectrophotometric measurements were made at 260 nm, and a 1% (mass fraction) agarose gel stained with 10 μg/mL ethidium bromide (Sigma, St. Louis, Mo.) was used to image the DNA. Densitometry was performed using the Versa Doc imaging system (Bio-Rad, Hercules, Calif.).
Primer Design.
Primers were designed using Primerfinder (Whitehead Institute for Biomedical Research) for the RT-PCR tests. The primers generated were used in both PCR and RT-PCR tests. They are as follows: 18S: 5′ AGCGACCAAAGGAACCATAA 3′ and 3′ CTCCTCCTCCTCCTCTCTCG 5; TNF-α: 5′ TTTCCTCCCAATACCCCTTC 3′ and 3′ AGTGCAAAGGCTCCAAAGAA 5; IL-1β: 5′ TGTGAAATGCCACCTTTTGA 3′ and 3′ GTAGCTGCCACAGCTTCTCC 5′.
The amplicons generated from these primers are 204 base pairs, 202 base pairs, and 205 base pairs, respectively. DNA sequencing was performed using the Big Dye Terminator Kit (ABI, Foster City, Calif.) on a 310 DNA Genetic Analyzer (ABI, Foster City, Calif.).
RT-PCR.
RT-PCR was carried out using the QuantiTect SYBR Green RT-PCR Kit and protocol (Qiagen, Valencia, Calif.). All RT-PCR tests were performed using the iCycler (Bio-Rad, Hercules, Calif.). The protocol utilizes the following thermal parameters: Reverse Transcription: 30 min at 50° C. Activation step: 15 min at 95° C. Three-step cycling: denaturation for 30 seconds at 95° C., annealing for 2 min at 57° C., extension for 2 min at 72° C. for 45 cycles. A melt curve was subsequently performed to analyze the products generated, which began at 50° C. and increased to 95° C. in 1° C. increments.
Immunization of Mice.
For each sample, five live mice (female, balb c, 7 weeks old) were inoculated with 100 μL of polymer or SCK solution (1 mg/mL in PBS) at 0, 4, and 8 weeks. The mice were bled for preimmunoserum screening prior to the primary injection. Blood samples were then collected 14 d after 4 and 8-week booster immunizations, respectively. Serum was obtained after clotting at 4° C., for 24 h, and centrifugation. Serum samples were stored at −20° C. in small aliquots for later use.
Determining Antibody Titer by ELISA Assay.
Samples for ELISA for the five mice were first prepared by dilution in five 96-well plates. PBS buffer (100 μL) was added to each well in the plates. The serum vials were thawed, and each serum sample (5 μL) was diluted 1:100 in PBS and was transferred, in quadruplicate, in aliquots (100 μL) to the first four wells in the top row of each corresponding plate. The serum obtained following the first booster immunization was added to the next four wells, and the serum obtained following the second booster immunization was added to the final four wells, columns 9 to 12. The serum was then serially diluted 2-fold in rows 2-7 in each plate. Following dilution, 100 μL from each well was transferred to a corresponding ELISA (Nunc-Immuno, Maxisorp) plate and incubated overnight at 4° C. The wells were washed three times with PBS (300 μL) containing 0.05% (mass fraction) Tween 20 (Sigma), and the remaining binding sites on the plates were blocked with sodium caseinate (100 μL, 2.5%, mass fraction, in PBS) followed by overnight incubation at 4° C. The wells were again washed three times, and a 1:40,000 dilution of goat anti-mouse IgG alkaline phosphatase conjugate (100 μL, Sigma) was added to each well and allowed to incubate for 1 h at room temperature before being washed five times. Alkaline phosphatase substrate solution (100 μL, Bio-Rad) was added to each well. Color development was allowed to take place for 30 min and then was quenched with 4 mol/L H2SO4 (50 μL per well). Absorption measurements were made at 405 nm. To determine the absolute antibody concentrations, mouse IgG standards were run in parallel with each ELISA plate. Serial dilutions of mouse IgG (from 5.00 to 0.08 μg/mL) were used to generate the linear calibration plot of absorbance vs concentration. The value corresponding to 0 g/mL was the background reading and was subtracted from all samples.
The assessment of material biocompatibility is a complicated process, which includes both in vitro and in vivo measurement methods, each of which depend on the physical and chemical nature of the material and the nature of the biological interaction. Surface characteristics such as hydrophobicity, morphology, surface charge, and chemical functionality are all known to play key roles in governing cell adhesion and proliferation. Several physicochemical parameters for the PTD-derivatized SCK nanoparticles whose syntheses and characterization are described in the previous example (B) are outlined in Table 1. However, a clear framework outlining the critical physiochemical and surface-mediated interactions within which to facilitate the development of materials minimally detrimental to cells does not exist. For applications concerning the delivery of macromolecules into cells, the enhanced efficiency of conjugate transduction must be weighed against any detrimental biological interactions including effects on both cell viability and immune response. The cell viabilities in the presence of the peptide-derivatized polymeric constructs were evaluated by MTT assay, which monitors enzymatic activity of a cell organelle (in this case mitochondria), and flow cytometry. Previously, the protein transduction sequence has been used at concentrations of up to 100 μL without affecting the viability of certain cell lines (Suzuki et al., J. Biol. Chem., 2002, 277, 2437-2443).
As illustrated by the data shown in
In addition to the MTT enzymatic assay, the peptide-derivatized nanoparticles have been evaluated by a fluorescent flow cytometry test to determine the effects of incubation with SCKs upon the induction of apoptosis. Apoptosis is characterized by numerous morphological changes, the first of which involves the translocation of phosphatidylserine (PS) from the inner to the outer surface of the cellular plasma membrane. Once exposed to the extracellular environment, PS sites are accessible to Annexin V, a phospholipid binding protein with a high affinity for PS. For measurement purposes, Annexin V is conjugated to FITC and used for the identification of cells in the early stages of apoptosis via flow cytometry. Because PS binding sites are also accessible when the cells are in a necrotic state, Annexin V is not an absolute marker of apoptosis. Therefore, it is often used in conjunction with 7-aminoactinomysin, (7-AAD) which binds to exposed nucleic acids, when the cell membrane integrity is compromised. Cells that are negative (unstained) for both Annexin V and 7-AAD have no indications of apoptosis: PS translocation has not occurred, and the plasma membrane remains intact. Cells that are Annexin V (+) and 7-AAD (−), however, are in early apoptosis, as PS binding sites are exposed, but the plasma membrane is still intact. Cells that are (+) for both Annexin V and 7-AAD are either in the late apoptosis (irreversible) stage or are not viable.
The flow cytometry data shown in
Immunogenicity Results.
The extent of PTD functionality is of significant importance as it may affect the immune response. The nature of the response has significant clinical implications, as severe inflammatory responses may prevent in vivo applications. Recent literature has reported that the addition of HIV-1 TAT PTD enhances minigene epitope presentation in tissue culture, but the attachment of PTD to full-length proteins does not enhance the immune response of the construct (Liefert et al., Gene Ther., 2002, 9, 1422-1428). The reported data were for a 1:1 stoichiometry of PTD:protein, and it is unclear whether the presentation of multiple copies of the sequence on the surface of an SCK would have a synergistic or negligible effect on the cellular immune response. The initiation and propagation of an immune response is ultimately regulated by cytokines. Cytokines are the primary mediators of a host immune response and are able to both induce apoptosis and modulate survival through the activation of genes in response to bacterial toxins, inflammatory products, and other invasive stimuli. Two of the most important cytokines in the acute inflammatory response are tumor necrosis factor alpha (TNF-α) and interleukin-1 beta (IL1-β). TNF-α is synthesized and secreted by macrophages. TNF-α is part of a complex network of cytokines and is capable of initiating cascades, which control the synthesis and expression of signaling molecules, hormones, and their receptors. Knowledge of the cellular cytokine profile is key to identifying the processes involved in the immune response and crucial to the further elucidation on the physicochemical properties of the bioconjugate that are inducing the response. Another prominent cytokine involved in the inflammatory responses is interleukin-1 (IL-1). Although IL-1 protects the organism by enhancing the response to pathogens and initiating healing process, its overproduction can induce numerous pathological consequences including septic shock and leukemia. The measurement of mRNA levels has been used widely to measure cytokine proliferation, which is responsible for the initiation, mediation, and propagation of cellular inflammatory responses. The genetic expression profiles of IL-1β and TNF-α have been measured by real-time polymerase chain reaction (RT-PCR). In this study, the mRNA profiles of TNF-α and IL-1β in response to PTD, SCKs, and SCKs derivatized with increasing amounts of PTD sequences were investigated using RT-PCR. In the previous example, PTD was conjugated in (0.005, 0.01, and 0.02) molar ratios, relative to the acrylic acid residues in the shell, to the SCK nanoparticles resulting in SCK populations nominally possessing 52, 104, and 210 (41, 83, and 202 as measured by phenylglyoxal) PTD peptides per particle, respectively. RAW 264.7 cells were used because they retain the characteristics of primary cultured macrophages in vitro, including the ability to release cytokines. Cells were exposed to the respective SCK nanoparticle samples by adding the conjugates to the murine macrophages 24 h following seeding. After a 24 h incubation period, the mRNA was extracted from the cell populations. Using a reverse transcriptase enzyme, mRNA is converted to the cDNA template necessary for amplification. Once cDNA is generated, gene specific primers, a DNA polymerase, and a fluorescent moiety are utilized to amplify and label the amplicon generated. The gene product accumulation was then measured during the exponential phase of the amplification reaction. The copy number from each of the samples was obtained by extrapolating to a standard gene curve of known concentration and copy number to yield quantitative data. The assay also includes the analysis of mRNA that does not change in relative abundance (18S) during the course of treatment to serve as an internal control. The genetic profiles of the inflammatory response to SCKs (1-3), PTD (4), PTD-functionalized SCK nanoparticles (5-10), and tissue culture polystyrene (TCPS, 11) are shown in
TNF-α mRNA synthesis was up-regulated 2-fold to 14-fold (depending on concentration) in response to exposure of the parent SCK nanoparticle, 6, over TCPS. It is interesting to note that the highest concentration, 10.0 mg/L, of the parent SCK 6 actually caused less of an increase, 2.2-fold, than lower concentrations, 0.1 and 1.0 mg/L, of SCK 6, 13.5-fold and 13.2-fold, respectively. When looking at the effects of parent SCK concentration on TNF-α production, the difference between 0.1 and 1.0 mg/mL is statistically insignificant, while the 10.0 mg/mL sample measures 6.1-fold less than at the 1.0 mg/mL level. Interestingly, the down-regulation of TNF-α has been demonstrated previously in liposome vectors formulated with cationic lipids. The measured TNF-α levels for the PTD-functionalized SCKs are less than the levels of the parent SCK in all cases (1.5-fold to 3.0-fold) and show no concentration or functionality dependence. The levels of TNF-measured in response to the peptide-functionalized nanoparticles, regardless of the extent of derivatization and concentration tested, are statistically insignificant when compared to the levels induced by the PTD domain itself. The copy numbers, fold increases, and the p values (p<0.05 significant at 95% confidence, derived from the students t-test) indicating statistical significance are listed in Table 2 following.
The measured increases of IL1-β production in response to PTD-, SCK-, and PTD-functionalized SCKs are much more pronounced than the copy number levels of TNF-α as compared to TCPS. The measured levels range from 18.8-fold to 483.5-fold increases over TCPS and 1-fold to 25.4-fold increase over SCKs of similar concentration and show statistical dependence with regard to both concentration and PTD functionalization. The differences in TNF-α and IL1-β expression measured in this series reflect different pathways of signal transduction with regard to both the time frame and the severity of the response to the respective inflammatory stimuli.
Following the in vitro measurements on cell viability and inflammatory response, the SCKs and PTD-derivatized SCKs were then tested in vivo to gauge their immunogenic response in balb/c mice. Enzyme-linked immunosorbent assays (ELISA) were used to quantify the increases in IgG production in response to immunization with the test compounds. Efforts to isolate specific responses by plating the SCKs on the ELISA plate prior to serum incubation were not successful due to an insignificant specific antibody response. This result can be attributed to two possible factors: (1) the nanoparticles could induce a nonspecific immune response, and (2) the sera used for the ELISA measurements were collected 14 days following the respective immunization, a sufficiently long time that any acute inflammatory response may have passed. We therefore decided to look at the increases in IgG concentration on an individual mouse basis to look for relatively large increases.
While limited in scope, the immunogenicity results for the SCKs functionalized to a lesser degree are consistent with the literature, but when large numbers of PTD are presented, the particles do elicit an increase in IgG concentration within the serum. While no specific responses could be detected for the any of the SCK nanoparticles, it is perhaps more important that no deaths resulted from the mice (>50) being subjected to the immunization protocol (3×100 μg) and no gross morphological changes were observed in postmortem organ histology examinations.
SCK nanoparticles were derivatized with various stoichiometric derivatizations with PTD and were evaluated in vitro and in vivo for biocompatibility. The initial evaluation and early identification of detrimental interactions between biological species and SCK nanoparticles are crucial to further efforts to develop in vivo applications. Apoptosis assays measured by flow cytometry have complemented enzymatic (MTT) toxicity results demonstrating a lack of detrimental effects on cell viability below 500 mg/L for all the samples. Although higher levels of peptide functionalization resulted in decreased metabolic function, loss of cell viability was observed at a sufficiently high concentration, suggesting the use of even 2% PTD-functionalized SCKs would not be prohibited in vivo. In addition, RT-PCR data provided quantitative information regarding the lack of immunogenicity elicited by SCKs and peptide-derivatized SCK nanoparticles. The inflammatory response to the peptide-functionalized SCK nanoparticles as measured by RT-PCR show increases in the levels of both TNF-α and IL1-β relative to TCPS. Although these levels are statistically significant and show large increases of IL1-β with increasing peptide functionalization, the levels did not preclude the preliminary testing of SCKs in vivo. An in vivo mouse immunization model found measured increases in IgG concentration were minimal with no specific interactions being identified, and more importantly, none of the mice (>50) subjected to the three 100 μg immunization protocol died. Additionally, no gross morphological changes were observed in postmortem organ histology examinations. While these in vitro assessments and preliminary in vivo tests show promising results, additional in vivo animal studies, which are currently in progress including biodistribution and nanoparticle clearance, are needed to compliment these initial findings and to extend the potential therapeutic applications of functionalized SCKs. However, up-regulation of IL1-β and larger than expected IgG increases for the 2.0% PTD-functionalized SCKs suggest that nanoparticles functionalized in polyvalent strategies may be interesting scaffolds for the attachment of known antigens for use in vaccination applications.
The present disclosure provides novel systems and compositions for the treatment and monitoring of diseases (e.g., cancer). For example, the present disclosure provides systems and compositions that target, and sense pathophysiological defects, allow for imaging of the defects, provide the appropriate therapeutic based on the diseased state, monitor the response to the delivered therapeutic, and identify residual disease. In preferred embodiments of the present disclosure, the compositions are small enough to readily enter a patient's or subjects cells.
In this example the inventors designed and synthesized three antisense and one sense hybrid PNAs (peptide nucleic acids) with a four-lysine tail at the carboxy terminus to the unr mRNA that is highly and abundantly overexpressed in a breast cancer cell line (MCF-7). A DOTA (1,4,7,10-tetraazacyclododecane-N,N′,N″,N″′-tetraacetic acid) chelating moiety was added to the amino terminal end of the PNAs so that they could be radiolabeled with 64Cu for biodistribution and microPET imaging studies in normal and MCF-7 tumor bearing mice. All four PNA conjugates were successfully labeled with 64Cu under mild conditions with a specific activity of ca. 200 mCi/μmol (or 7,400 MBq/μmol) at time of injection. Biodistribution of two 64Cu-labeled conjugates with antisense and sense sequences of unr mRNA (PNA50 and PNA50S) were performed in normal balb/c mice via two injection modes (intravenous and intraperitoneal). Both conjugates exhibited a rather similar in vivo behavior featuring high uptake and long retention in kidney, and low uptake and efficient clearance in blood and muscle. The administration forms did not change the pattern of tissue distribution, while the intraperitoneal mode gave a much slower release rate of the conjugates. The MCF-7 tumor (100-320 mg) in CB-17 severe combined immunodeficiency (SCID) mice was imaged with all four 64Cu-labeled PNA conjugates by microPET probably because of the high specific activity, but the image contrast varies with different time points and different compounds. The quantification of microPET images was carried out to evaluate the concentration of the radiolabeled PNA conjugates in the regions of interest (ROIs), and the results are in agreement with the data of post imaging biodistribution study (24 h post injection). Of the PNA conjugates studied in this work, 64Cu-DOTA-Y-PNA50-K4 showed the best image quality of the tumor at all time points. As determined by the post imaging biodistribution, the tumor/muscle ratio (6.6±1.1) of 64Cu-DOTA-Y-PNA50-K4 is among the highest reported for radiolabeled oligonucleotides. Our work further strengthens the potential of antigene and antisense PNAs to be utilized as specific molecular probes for early detection of cancer and ultimately for patient-specific radiotherapy.
Materials.
DOTA-tris(t-Butyl ester) was purchased from Macrocyclics Inc. (Dallas, Tex.), diisopropylethylamine (DIEA), TFA, m-cresol and diethyl ether (anhydride) were purchased from Aldrich (St. Louis, Mo.). Fmoc-protected amino acids (D-Lys(Boc)-OH and Tyr(tBu)—OH) were purchased from NovaBiochem (La Jolla, Calif.). O-(7-Azabenzo-triazol-1-yl)-1,1,3,3-tetramethyluronium hexafluorophosphate (HATU), Fmoc-XAL PEG-PS resin, PNA building blocks (Fmoc-A-(Bhoc)-OH, Fmoc-C-(Bhoc)-OH, Fmoc-G-(Bhoc)-OH and Fmoc-T-OH) and other reagents and solvents for PNA and peptide synthesis were purchased from Applied Biosystems (Foster City, Calif.). UV spectral data were acquired on a Bausch and Lomb Spectronic 1001 spectrophotometer or Varian Cary 100 Bio UV-Visible Spectrophotometer. Matrix-assisted laser desorption ionization (MALDI) mass spectra of PNA-peptide conjugates were measured on PerSeptive Voyager RP MALDI-time of flight (TOF) mass spectrometer using sinapinic acid as a matrix and calibrated versus insulin (average [M+H+]=5734.5) that was present as an internal standard. High-pressure liquid chromatography was carried out on Beckman Coulter System Gold 126 with an array detector. Copper-64 was prepared on the Washington University Medical School in St. Louis, Mo. Cyclotron CS-15 cyclotron by the 64Ni(p,n)64Cu nuclear reaction at a specific activity of 50-200 mCi/μg at the end of bombardment (EOB) as previously described. Water was distilled and then deionized (18 MΩ/cm2) by passing through a Milli-Q water filtration system (Millipore Corp., Bedford, Mass.). Diethylenetriaminepentaacetic acid (DTPA), ammonium acetate, and sodium chloride were purchased from Fluka Chemie AG (Buchs, Switzerland). Dry powder in foil pouches for the preparation of 10 mM phosphate buffered saline (PBS), pH 7.4, and 4-(2-hydroxyethyl)piperazine-1-ethanesulfonic acid (HEPES) were purchased from Sigma-Aldrich (St. Louis, Mo.). Solvents (e.g., acetone, methanol, etc.) were purchased from Fisher Scientific (Pittsburgh, Pa.) and used as received. Saline (0.9% NaCl solution) was purchased from American Pharmaceutical Partners, Inc. (Schaumburg, Ill.). Centricons (YM-3: MWCO 3,000 Da) were purchased from Millipore Corporation (Bedford, Mass.). Fast protein liquid chromatography (FPLC) and radio-FPLC were performed using an Amersham Pharmacia Biotech ÄKTA FPLC (Amersham Biosciences Corp. Piscataway, N.J.) equipped with a Beckman 170 Radioisotope Detector (Beckman Instruments, Inc. Fullerton, Calif.). The Superdex™ 75 was bought from Amersham Biosciences Corp. (Piscataway, N.J.). PBS, Trypsin/EDTA, and cell culture media and additives were purchased from the tissue culture support center of Washington University School of Medicine (St. Louis, Mo.). Fetal bovine serum (FBS), Earle's balanced salt solution (BSS), and insulin were bought from Sigma (St. Louis, Mo.). CB-17 SCID mice were purchased from the Charles River Laboratories (Wilmington, Mass.).
Tissue Culture and Animal Model.
The MCF-7 cell line was obtained from American Type Culture Collection (ATCC, Manassas, Va.). MCF-7 cells were grown in Eagle's minimum essential medium (MEM) with Earle's BSS and 2 mM L-glutamine modified to contain 1 mM sodium pyruvate, 0.1 mM non-essential amino acids, 1.5 mg/mL sodium bicarbonate supplemented with 10% FBS and 0.01 mg/mL bovine insulin. To establish MCF-7 human breast xanografts, each CB-17 SCID mice was implanted with a 60-day subcutaneous (s.c.) slow release estrogen pellets (1.7 mg 17β-estradiol/pellet; Innovative Research of America, Sarasota, Fla.) 48 h prior to the s.c. injection of MCF-7 cells into the nape of neck. Cultured MCF-7 cells were harvested from monolayer using PBS and trypsin/EDTA, and suspended in media with FBS. The cell suspension was centrifuged and resuspended in PBS at the concentration of 1×108 cells per milliliter. It was then mixed 1:1 with Matrigel and injected s.c. (1×107 cells per mouse, injection volume 200 μL) into the nape of the neck of CB-17 SCID mice (5-6 weeks of age). After the cell injection, the animals were monitored twice a week by general observations. The tumor was noticed to grow in the first week and allowed to grow five weeks to reach a palpable size for microPET imaging studies. The tumor weight was 100-320 mg as determined by post imaging biodistribution.
Synthesis of the DOTA-(D)-Y-PNA-K4 Conjugates
NH2—Y-PNA-K4 conjugates were synthesized continuously on universal support XAL-PEG-PS resin on a 2 mmol scale with standard solid phase Fmoc off chemistry in Expedite 8909 Synthesizer (Applied Biosystems) by loading the fifth and sixth building block channel with Fmoc-D-Lys and Fmoc Tyr(tBu) respectively and programming the sequence accordingly under standard automated PNA synthesis protocol. DOTA-tris(t-Butyl ester) (11.5 mg, 20 mmol) was dissolved in 100 μl NMP, then 100 μl HATU DMF solution (0.2 M) and 100 μl base solution (0.2 M DIEA, 0.3 M 2,6-lutidine in DMF) were added, the mixture was introduced into the cartridge containing PNA-K4-resin manually with a syringe and pushed back and forth with a second syringe to agitate the resin suspension every 10 min for 1 hour. Then the resin was washed with DMF and dichloromethane (DCM) and dried by passing nitrogen. Treatment of the resin with TFA/m-cresol (4:1) for 12 h at room temperature (r.t.) was used to cleave the conjugates and remove the side chain protective groups. Ethyl ether (8-10 volumes) was added to the TFA solution to precipitate the product as yellow solid. The crude product was purified by reversed phase HPLC on a Microsorb C18 column (300 Å pore, 5 μm particle size, 4.6×250 mm) using a 5% to 70% linear gradient of solvent B (0.1% TFA in acetonitrile) in A (0.1% TFA in water) over 65 min at the flow rate of 1 ml/min. The effluent was monitored by absorbance at 260 nm and the major peaks were collected, concentrated to dryness in vacuum, and characterized by MALDI-TOF mass spectrometry.
Radiolabeling of DOTA-Y-PNA-K4 Conjugates with 64Cu.
Copper-64 chloride (typically in 0.1 M HCl) was converted to 64Cu-citrate by adding an appropriate volume of 0.1M ammonium citrate buffer (pH 7.0) to the 64CuCl2 solution. Prior to labeling, the stock solutions of DOTA-Y-PNA-K4 conjugates were heated at 80° C. for 10 min to minimize the self-pairing and plastic wall sticky property of the PNA conjugates. To 200 μL of a DOTA-Y-PNA-K4 conjugate solution (40 μM), 20 μL of 64Cu-citrate was added (2-4 mCi). The resulting solution was incubated at 60° C. for 1-2 h in a thermomixer (1,000 rpm). After incubation, 5 μL of 10 mM DTPA solution was added to the 64Cu-DOTA-Y-PNA-K4 solution. The solution was vortexed for a few seconds and left at r.t. for 10 min. It was then centrifuged at least two times through a Centricon-YM3 (MWCO 3,000 Da) with 10 mM PBS buffer (pH 7.4) to remove the 64Cu-DTPA complex and/or free 64Cu-activity. The radiochemical purity (RCP) of the 64Cu-labeled DOTA-Y-PNA-K4 conjugate was monitored by FPLC. The product was then diluted with 10 mM PBS buffer (pH 7.4) to prepare appropriate doses for biodistribution and microPET imaging studies.
FPLC Analysis.
A 100 μL of analyte was injected into a Superdex™ 75 gel filtration column, which was then eluted with 20 mM HEPES and 150 mM NaCl (pH 7.3) buffer at an isocratic flow rate of 0.5 mL/min. The UV wavelength was preset to 280 nm, the radioactivity was monitored by an online Beckman radio-detector. Under these conditions, the retention times of the 64Cu-DOTA-Y-PNA-K4 and DOTA-Y-PNA-K4 were ca. 31-35 min.
Biodistribution Studies.
All animal studies were performed in compliance with guidelines set by the Washington University in St. Louis, Mo. Animal Studies Committee. Copper-64 labeled DOTA-Y-PNA-K4 solutions were diluted with saline. Normal balb/c mice weighing 20-30 g (n=4 per time point) were anesthetized with isoflurane and injected with 10-12 μCi of activity via the tail vein (i.v.) or ca. 55 μCi of radioactivity via intraperitoneal (i.p.) injection. The injected volume of activity per mouse was 100 mL. The mice were anesthetized prior to sacrifice (by decapitation) at each time point. Organs of interest were removed, weighed, and counted. Standards were prepared and counted along with the samples to calculate the percent injected dose per gram (% ID/g) and percent injected dose per organ (% ID/organ).
MicroPET Imaging Studies.
The microPET imaging studies were carried out using the microPET® R4 (rodent) scanner (Concorde Microsystems Inc., Knoxville, Tenn.). MCF-7 tumor-bearing CB-17 SCID mice were anesthetized with 1-2% vaporized isoflurane and injected with ca. 200-400 μCi of activity in 120 μL saline via the tail vein (64Cu-DOTA-Y-PNA50: 210 μCi; 64Cu-DOTA-Y-PNA50S: 347 μCi; 64Cu-DOTA-Y-PNAS: 253 μCi; 64Cu-DOTA-Y-PNA7: 361 μCi). At specific time points (1 h, 4 h, and 24 h) post injection, the mice were re-anesthetized and then immobilized in a supine position on custom-built support beds with attached anesthetic gas nose cones for data collection. Within 4 h p.i., the imaging collection time was 10 min; at 24 h p.i., the imaging collection time was 20 min.
Radioactive tracer accumulation (64Cu-labed PNAs) in a targeted organ was measured using the standardized uptake value (SUV). The SUVs were obtained by the quantification of the regions of interest (ROIs) by viewing these areas in the selected tissues and averaging the activity concentration corrected for decay over the contained voxels (multiple image slices) at the time points p.i.
After the microPET imaging at 24 h p.i., the animals were sacrificed and biodistribution studies were performed. The ratios of tumor to blood (T/B) and tumor to muscle (T/M) were calculated. The unpaired t-test on the biodistribution and microPET quantitation data was performed using Prism, v. 4.00 (Graphpad, San Diego, Calif.).
Selection of the Antisense PNAs.
The sequences of the antisense PNAs were selected by a procedure that will be described in greater detail in Example set E. Three of these antisense PNAs and one sense PNA were selected for imaging studies: PNA50 with a Kd of 21 μM, PNAS, with a Kd of 22 μM, PNA7 with a Kd of 15 μM, and PNA50S (sense form of PNA50) with a Kd of >10 nM in 0.1 M NaCl, 50 mM EDTA, 2 mM cacodylic acid.
Synthesis of DOTA-Y-PNA-K4 Conjugates (Table 1)
The PNAs were synthesized using standard automated solid phase Fmoc synthesis on an ABI 8909 DNA synthesizer with a PNA option (this synthesizer is no longer commercially available from the original manufacturer). The unnatural D-isomer of lysine was used to inhibit enzymatic degradation of the K4 permeation peptide unit. The DOTA group was added manually in the last step of the synthesis to the amino terminal (“5′-end”) of the PNA via the commercially available tri-t-butylester, and the HPLC purified products characterized by MALDI-TOF.
Radiolabeling of DOTA-Y-PNA-K4 Conjugates.
Four DOTA-Y-PNA-K4 conjugates were all successfully radiolabeled with 64Cu in 0.1 M ammonium citrate buffer (pH 7.0) under mild conditions (at 60° C. for 1-2 h) in yields of 32-61% (decay corrected). After DTPA challenge of non-specifically bound 64Cu-activity and Centricon-YM3 (MWCO: 3,000 Da) separation, the radiochemical purity of the 64Cu-labeled PNA conjugates was nearly 100% as determined by radio-FPLC: both the radioactivity and UV (280 nm) curves only showed a single strong peak with the same retention time in the range of 30-35 min. The 64Cu-labeled PNA conjugates remained 100% intact after being kept in saline overnight.
Biodistribution of 64Cu-DOTA-Y-PNA-K4 conjugates in normal balb/c mice.
In order to better evaluate the in vivo kinetics of the 64Cu-labeled PNA conjugates, the biodistribution studies were carried out with two different injection modes in normal balb/c mice: intravenous (tail vein) injection (i.v.) and intraperitoneal injection (i.p.).
Tail Vein Injection.
The biodistribution data of 64Cu-DOTA-Y-PNA50-K4 and 64Cu-DOTA-Y-PNA50S-K4 in blood, liver, kidneys, and muscle are presented as percent of injected dose per organ (% ID/organ) at 20 min, 1 h, and 4 h post injection (p.i.) in
Intraperitoneal Injection.
The biodistribution of 64Cu-DOTA-Y-PNA50-K4 and 64Cu-DOTA-Y-PNA50S-K4 via the intraperitoneal injection mode was performed in normal balb/c mice (n=3) at 24 h and 48 h p.i. The biodistribution data in selected organs are shown in
MicroPET Imaging of 64Cu-DOTA-Y-PNA-K4 Conjugates.
The microPET imaging was performed in MCF-7 tumor-bearing CB-17 SCID mice with 64Cu-DOTA-Y-PNA-K4 conjugates at 1 h, 4 h, and 24 h p.i. Of the four compounds, 64Cu-DOTA-Y-PNA50-K4 exhibited visually the highest image contrast of tumor, which was implanted in the nape of the neck, out to 24 h p.i. (
The microPET images were analyzed by the quantification of radiotracer accumulation in the regions of interest (ROIs). The time-activity curves of the four PNA conjugates in kidneys (represented by the left kidney), liver, and tumor were shown in
Biodistribution Data of Post Imaging.
The post imaging biodistribution experiments were carried out right after the microPET imaging at 24 p.i. The concentrations of the four PNA conjugates in blood, liver, kidneys, muscle, and tumor were represented by percent of injected dose per gram of tissue (% ID/g) as shown in
Our approach to the design of cell-specific imaging agents is based on (1) the identification of an abundant unique or uniquely overexpressed mRNA in the target cell (2) the selection of a high affinity antisense PNA for the target mRNA, (3) covalent attachment of a permeation peptide that allows for reversible cell entry, and (4) covalent or high affinity attachment of positron-emitting radionuclide with high specific activity. In our approach, the biological function of the mRNA is irrelevant, all that matters is that it is uniquely overexpressed and abundant in the target cell. As such this approach differs from other antisense approaches that often target oncogenes, which are only present in low copy number (<100). For this initial study we used SAGE analysis to identify the uniquely overexpressed (approximately 10-fold) and abundant unr mRNA in the MCF-7 cancer cell line (approximately 5000 copies/cell), and an RT-ROL assay to identify high affinity antisense binding sites on the mRNA. PNAs complementary to these sites were conjoined to the recently described permeation peptide Lys4 and the highest affinity PNAs were conjoined to the 64Cu binding ligand DOTA to create the MCF-7 cell-specific PET imaging agent.
Antisense oligonucleotides have been reported as nuclear imaging probes (PET and SPECT) in forms of unmodified oligomers or viral/non-viral carrier-oligomer conjugates. While the carrier systems could significantly enhance the tumor accumulation of oligonucleotides due to the increased payload of the carriers, a major concern is how to address whether the biodistribution is determined by the carrier or the oligomer. This method may also encounter the common difficulties of drug delivery systems, such as sequestration by reticulo-endothelial system (RES) and immunogenicity of the carriers. It is self-evident that unmodified or minimally modified oligonucleotides should be studied in-depth before they could be applied to the gene transfection or drug delivery systems for various proposes.
As a special class of oligonucleotide analogs, the biological behavior of peptide nucleic acids has been extensively studied in vitro and in vivo since they were first proposed. In contrast, the utilization of PNAs as imaging probes of cancer for PET and SPECT is very limited, probably because the accumulation of the PNA imaging probes in the tumors could barely reach a detectable level. Recently, Sazani et al. (Nat. Biotechnol., 2002, 20, 1228-1233) reported that a PNA with four lysine at its N terminus exhibited superior in vivo properties and sequence-specific activity compared to its analog with one lysine. Therefore, we introduced the four-lysine tail to our unr mRNA targeting PNAs and further incorporated a DOTA chelating moiety for 64Cu microPET imaging and tissue distribution studies.
The labeling of DOTA-Y-PNA-K4 conjugates with 64Cu was straightforward. The radiochemical yields were reasonably high, and nearly perfect radiochemical purity was achieved after DTPA challenge of non-specifically bound 64Cu and centricon separation. The specific activity of the 64Cu-labeled PNA conjugates was ca. 200 mCi/μmol (7,400 MBq/μmol) at the injection time, which is the highest specific activity ever achieved for radiolabeled oligonucleotides to the best of knowledge. The radiolabeling conditions were optimized from the trials varying reaction temperature, time, pH, and media (data not shown).
Concerned that our PNA conjugates might have rapid in vivo kinetics, we carried out biodistribution experiments in normal mice via i.v. and i.p. modes. The biodistribution via i.v. was performed within a short time period (4 h) post injection, while the i.p. experiment was conducted at 24 h and 48 h p.i. All the four PNA compounds showed high kidney uptake and long retention throughout time (
As shown in the microPET images (
In summary, we have designed and synthesized four PNA with a four-lysine tail at the C terminus, one with a sense sequence and three with antisense sequences for the unr mRNA, which is overexpressed in MCF-7 cell line. In order to evaluate their in vivo behavior and tumor-targeting property, we incorporated a DOTA-moiety into the PNAs so that the conjugates can be radiolabeled with 64Cu for biodistribution and microPET imaging studies in normal and MCF-7 tumor bearing mice. Of the PNA conjugated studied, 64Cu-DOTA-Y-PNA50-K4 showed the best image contrast of MCF-7 tumor in CB-17 SCID mice, and its tumor/muscle ratio is reproducible and the highest among the radiolabeled oligonucleotides that have been reported for in vivo detection of tumor. Our studies further indicate that antigene and antisense PNAs have great potential to be developed as oncogene- or mRNA-specific probes for early diagnosis of specific cancers. In addition, such antisense 64Cu-PNA constructs may also be able to function as patient specific therapeutics because of the decay characteristics of 64Cu when delivered in higher amounts.
We discovered a uniquely overexpressed and highly abundant mRNA specific to a cell and successfully used that mRNA as an internal receptor for an antisense PNA molecule that showed it was capable of reversibly entering cells.
We discovered that our method is advantageous for targeting MCF-7 breast cancer cells which uniquely overexpress a very abundant unr mRNA (upstream of N-ras or N-ras related gene). Antisense binding sites on the unr mRNA were mapped by application of an improved RT-ROL assay, and a newly developed SAABS (serial analysis antisense binding sites) assay. The relative affinity of ODNs complementary to the antisense binding sites was obtained by a newly developed dot-blot assay. Dissociation constants for tight binding ODNs identified through the dot blot assay were obtained by a newly developed Dynabead assay. Hybrid PNAs corresponding to the ODNs with the highest affinities were synthesized with an N-terminal CysTyr and C-terminal Lys4 sequence and their binding quantified by the Dynabead assay. Hybrid PNAs with Kd's of approx. 10 pM for unr mRNA were identified in this manner and shown to bind to unr mRNA extracted from MCF-7 cells by a PCR assay. Two fluorescently labeled PNAs with the NLS (nuclear localization sequence) permeation peptide were shown to selectively bind to MCF-7 cells in vitro by both fluorescence microscopy and a bulk fluorescence assay, thereby validating this antisense approach for cancer cell targeting.
Identification and Selection of a Cancer-Specific Overexpressed mRNA.
To validate the antisense cell targeting approach, we searched the NCBI SAGE database (http://www.ncbi.nlm.nih.gov/SAGE/) for abundant mRNAs that are >10-fold overexpressed in standard cancer cell lines compared to any normal cell lines. In doing so we discovered that the well studied MCF-7 breast cancer cell line contains an almost 10-fold higher amount of the unr mRNA (GI: 20070240), or upstream of N-RAS otherwise known as the NRAS-related gene, than normal cell lines, and is present at a level of about 5,000 tags/million, or roughly 5,000 copies per cell. We found a full length cDNA clone from the I.M.A.G.E. consortium (5285557 from the NIH_MGC—96 library, UniGene Libary 6001), and obtained the pBluescriptR vector containing the cDNA through the ATCC (American Tissue Culture Collection, #7020864). We were able to successfully produce the unr mRNA in high yield and homogeneity by in vitro transcription with T7 RNA polymerase. The unr mRNA was recovered for use as reported herein.
RT-ROL Assay.
To identify the sites on the unr mRNA that could bind PNAs, we adopted and improved a mapping method based on using random oligonucleotides attached to a PCR tag to prime reverse transcription followed by PCR amplification. In the original method priming end was a completely random sequence, making it difficult to precisely assign the PCR products to a specific sequence. To get around this problem we synthesized a set of four separate primers each containing a PCR tag and a random 9-mer terminating in unique nucleotide (
Serial Analysis of Antisense Binding Sites—SAABS.
A potential problem with the RT-ROL assay is that that priming of reverse transcription might be sensitive to secondary structure, and as a result, the intensity of the PCR bands produced in the RT-ROL assay might not correspond to the actual binding affinity. To eliminate this problem we developed an enzyme independent method for mapping antisense binding sites that adapts methodology used in SAGE (Serial Analysis of Gene Expression) to determine the sequence and relative frequency of members of a random library of ODNs that bind to an mRNA molecule.
The overall procedure is shown in
Dynabead Dot Blot Assay.
To determine the relative affinity of ODNs for the antisense binding sites determined by the RT-ROL and SAABS assays, we developed a sensitive and semi quantitative dot blot assay. In our first attempts we used a standard protocol that involves photocrosslinking of antisense ODNs to a nylon membrane and then quantifying the amount of radiolabeled mRNA that becomes bound. Unfortunately, this technique did not appear to be very reproducible, probably because of the non-uniformity of UV crosslinking of ODNs of varying sequence to the nylon membrane.
In developing a better dot blotting method for screening ODN binding sites, we investigated the use of Dynabeads to anchor the RNA to the blot. We found that the binding capacity of the streptavidin coated beads for biotinylated unr mRNA produced by transcription in the presence of Bio-dUTP, to be about 1 μmol of RNA/20 μL of Dynabeads (
The Dynabeads were then used to bind the mRNA to the nylon membrane in the dot blot assay (
Dynabead ODN Binding Assay.
Initially we attempted to obtain ODN binding constants to the unr mRNA by a Centricon centrifugal filtration assay. In this assay 5′-32P-radiolabeled ODN incubated with increasing concentrations of mRNA, and bound ODN is separated from free ODN by centrifugation through a filter that does not allow the mRNA, and any ODN-bound mRNA to pass through the filter. Unfortunately, this method did not work very well due to problems with non-specific binding the filter. To get around this problem, we developed a new Dynabead-based assay method which makes use of a magnetic field to separate molecules bound to a Dynabead from free molecules in solution without the use of a filter (
Design and Synthesis of the Antisense PNAs.
Because ODNs are readily degraded in vivo and additionally cause cleavage of the mRNA transcript to which they are bound via RNase H enzyme activity, they are not suitable for in vivo targeting. Peptide nucleic acid (PNA) is ideally suited for this purpose because it is a nucleic acid analog with a peptide backbone in place of a sugar phosphate backbone that is highly resistant to degradation, does not activate RNase H activity and also has high affinity for complementary mRNA. We therefore designed hybrid PNAs corresponding to the 4 tightest binding ODNs, and ODN 5-2 which is less tightly bound. A sense sequence corresponding to PNA50-2S was also made as a control. The PNAs were synthesized with 4 lysines at the carboxy terminus (
PNA Binding Affinity.
The binding affinity of the PNAs for the unr mRNA were determined by monitoring bound and free 131I-labeled PNA as a function of mRNA concentration using the Dynabead method that we developed for the ODNs (
In the first set of PNA binding tests we discovered that we were not recovering the entire radioactivity. We were able to trace this to non-specific binding of the PNA to the standard polyethylene microfuge tubes. After ordering and testing a number of tubes and microtiter plates advertised as minimizing binding of peptides and nucleic acids, we found that the Corning NBS microtiter plates had the lowest binding affinity. Individual tubes were obtained by sawing the plates into pieces. Triplicate sets of data were obtained and a plot of % bound as a function of RNA concentration was fit to a simple two state binding equilibrium as we had done for the ODNs (
The binding affinities of the PNAs for the sites are much greater (lower Kds) than that of the corresponding ODNs. The difference is binding affinity under physiological conditions is likely to be much greater than it would appear from the tabulated data since the PNA dissociation constants were obtained at the physiological concentration of 0.1 M NaCl, whereas the ODN dissociation constants were acquired at 1 M salt. At 0.1 M salt the Kds for the ODNs are expected to be greater due to electrostatic repulsions, whereas the PNAs are expected to have lower Kds due to favorable electrostatic attraction with the Lys4 tail. The control PNA, PNA 50-2S which is identical in sequence to the mRNA target showed no significant binding in the range of RNA concentrations that bound tightly to the antisense sequences.
Binding of PNA50-2 to Unr mRNA Isolated from MCF-7 Cells.
To determine whether or not the 50-2 antisense binding site identified by the RT-ROL and SAABS assays on unr mRNA produced by T7 RNA polymerase in vitro exists on unr mRNA produced by MCF-7 cells in vivo we devised a simple RT-PCR assay. For this assay, total RNA from MCF-7 is subjected to RT-PCR with various combinations of primers as illustrated in
Binding of Fluorescently Labeled PNAs to MCF-7 Cells.
Initially we expected that Cys-Tyr-PNA-Lys4 hybrid PNAs would be able to enter cells in vitro because of the presence of the Lys4 permeation peptide and that we could study this process by labeling the cysteine with a fluorescent reporter group. Unfortunately, we found that the fluorescein labeled PNAs formed aggregates and did not enter the cells, whereas a fluorescein labeled CysArg9 peptide did. To see if changing the permeation peptide would help with the cell culture targeting tests we synthesized a series of fluorescently PNAs with the nuclear localization sequence (NLS), KPKKKRKV (SEQ ID NO: 17; Table 2) following, which contains an additional lysine and arginine, along with a proline and valine. When MCF-7 cells were incubated with 1.0 μM Flu-PNA-NLS for 4 h, 24 h and 48 h, and then washed 5 times with PBS prior to fixation with paraformaldehyde, PNA50-2 and PNA7 showed that highest fluorescence staining of the cells, whereas PNAS-2 and PNA50-2S showed comparatively little (
We have developed and successfully used a modified RT-ROL and a new SAABS methodology for identifying antisense binding sites on mRNA produced in vitro, and Dynabead-based assays for determining the binding affinity of antisense ODNs and PNAs for these sites. Furthermore, we showed that antisense PNAs against the unr mRNA which is abundantly overexpressed in the MCF-7 breast cancer cell line concentrates within these cells when attached to the NLS permeation peptide, whereas a non-complementary sequence did not.
Image clone 5285557 containing the unr (upstream of N-ras) mRNA sequence (D1S155E, NM—007158.2, GI: 20070240, ATTC clone #7020864). pZero plasmid for SAGE analysis is from Invitrogen. The MCF-7 cell line was obtained the Washington University Medical School in St. Louis. 5(6)-carboxyfluorescein succinimidyl ester (5(6)-FAM SE) was purchased from Molecular Probes, diisopropylethylamine (DIEA), trifluoroacetic acid (TFA), m-cresol and diethyl ether (anhydride) were purchased from Aldrich. α-N-9-Fluorenylmethoxycarbonyl (Fmoc) protected amino acids (Val-OH, Pro-OH, Lys(Boc)-OH and Arg(Pbf)-OH) were purchased from NovaBiochem. O-(7-Azabenzo-triazol-1-yl)-1,1,3,3-tetramethyluronium hexafluorophosphate (HATU), Fmoc-XAL PEG-PS resin, PNA building blocks (Fmoc-A-(Bhoc)-OH, Fmoc-C-(Bhoc)-OH, Fmoc-G-(Bhoc)-OH and Fmoc-T-OH) and other reagents and solvents for PNA and peptide synthesis were purchased from PerSeptive Biosystems. Fluorescence spectra were recorded on SPEX Fluoromax instrument. UV spectral data were acquired on a Bausch and Lomb Spectronic 1001 spectrophotometer or Varian Cary 100 Bio UV-Visible Spectrophotometer. Matrix-assisted laser desorption ionization (MALDI) mass spectra of PNA-peptide conjugates were measured on PerSeptive Voyager RP MALDI-time of flight (TOF) mass spectrometer using sinapinic acid as a matrix and calibrated versus insulin (average [M+H+]=5734.5) that was present as an internal standard. High-pressure liquid chromatography was carried out on Beckman Coulter System Gold 126 with Microsorb RP C18 column (300 Å pore, 5 μm particle size, 4.6×250 mm) using 1 mL/min linear gradients of solvent B (0.1% TFA in acetonitrile) in A (0.1% TFA in water). Peptide-PNA conjugates were quantified by spectrophotometric A260 values.
Successful Production of Unr RNA.
Transcription reactions were carried out using the Promega RiboMAX Large Scale RNA production system utilizing the T7 promoter at the 5′-end of the unr gene in the IMAGE clone and cleaving the clone at the unique NdeI site at the 3′-end of the gene prior to transcription. Transcription was allowed to proceed with T7 RNA polymerase and NTPs for 3 h at 37° C., and was followed by DNase treatment, LiCl precipitation, phenol extraction, and ethanol precipitation. NTPs were then removed with a NucAway spin column. Radiolabeled RNA was produced with [α-32P]-UTP. The final purified unr RNA is quite homogeneous and corresponds in size to the expected 3.4 Kb transcript. For the Dynabead assay, the unr mRNA was transcribed in the presence of Bio-dUTP.
RT-ROL Mapping of Antisense Sites on Unr RNA.
The ODNs for mapping the antisense binding sites on the unr RNA by the modified RT-ROL assay are shown in
SAABS Method for Mapping Antisense Sites on Unr mRNA.
Dynabeads (Dynabead M-280streptavidin, DynalBiotech) were first washed with solution A (DEPC-treated 0.1 M NaOH, DEPC-treated 0.05 M NaCl), followed by three times with solution B (DEPC-treated 0.1 M NaCl), and then washed two times with 100 μL of hybridization solution (1M NaCl, Tris-HCl pH 7.4). The beads were then resuspended in 50 μl of hybridization solution. The RNA (3 μL of 3 μg/μl) was incubated with 2 μl of CRNA-Bio (4.7 μg/μl) and of 45 μl of hybridization buffer at 65° C. for 5 min, and then cooled at room temperature for 10 min. The RNA solution was then added to a suspension of the beads at 25° C. for 20 min. The beads were then washed three times using hybridization buffer, and then resuspended in 50 μl of hybridization solution. The ROL ODN (5 μl) were then annealed with the complementary ODNs CS1 (12 μl), and CS2 (8.6 μl) in hybridization buffer (23 μl) by heating at 65° C. for 5 min, and then cooled to room temperature for 10 min. The RNA solution was then mixed with S1-ROL-S2 together with 2 μl RNasein inhibitor, and incubated at 27° C. for 1 h. During the incubation, the beads were resuspended every 15 min by pipetting. Following the incubation, the beads were washed 6 times with the hybridization solution and then resuspended in 100 μl of H2O. Thirty cycles of PCR were carried out with Taq DNA polymerase, and 5′-biotinylated S1 and CS2 primers. After amplification, the reaction mix was directly loaded onto a 12% denaturing PAGE gel and electrophoresis was carried out at 10 V/cm for 4 hours. The 50 bp band was excised and purified by use of Strepavidin beads. The 50 bp PCR product was directly digested with Nla III at 37° C. overnight to release the tags. The digested product was loaded onto 4% agarose gel and run at 10 V/cm. After staining the gel with 0.25 ng/ml ethidium bromide, the 12 bp band was excised. Ligation of the 12-mers was carried out at 16° C. for overnight. Concatemers were isolated using the Qiaquick Gel Extraction Kit (Qiagen), following the manufacturer's manual. The pellet was dissolved in ligation buffer and ligation was carried out with T4 DNA Ligase and ATP at 16° C. for 2 h. The mixture was then electrophoresed on a 1% agarose gel (TAE) and fractions with 300-500 bp length were excised. Concatemers were ligated into the SphI site of pZero-1 (Invitrogen) with T4 DNA ligase and ATP for 4 h at 16° C. and then transfected into E. coli, following the manufacturer's manual (Oneshot Top10,invitrogen). The transfectants were plated on low salt LB plates containing 50 ng/ml Zeocin™ and incubate for about 18 h at 37° C. Zeocin™ resistant transformants were picked using pipette tips, incubated in 5 ml SOB containing 50 μl/ml Zeocin™ and grown overnight at 37° C. Plasmid DNA was prepared by the Rapid method (Molecular Clone) and Plasmid min prep kit (Qiageon). Digest DNA using XbaI and HindIII, analyze digestion in 1% agarose gel. Plasmids containing sizable inserts were then forwarded for sequence analysis using the Sp6 primer.
ODN Dynabead Binding Assay.
The radiolabeled ODN (100 pM) was incubated with the 0.003 nM-10 nM of biotinylated mRNA and 1 μL of Rnase inhibitor for 4 h at 37° C. in a total volume of 100 μL. Then Dynabeads M-280 Steptaviden (Dynal Biotech) were added, 25 μL for 10 nM RNA, 12.5 μL for 3 nM RNA and 5 μL for all other concentrations of RNA, and mixed for 30 min. The beads were separated by a magnet and the solution removed. The beads were resuspended in 100 μL of water and both solutions counted by liquid scintillation to give free and bound fractions directly.
ODN Binding Data Analysis.
A plot of fraction bound vs. mRNA concentration was fitted by non-linear least squares fitting with the Kalaidagraph program to the following analytical curve:
here:
C=fraction of ODN non-specifically bound
[ODN]=total ODN concentration
[RNA]=total RNA concentration
Kd=dissociation constant
PNA-Lys4 Peptide Synthesis and Purification.
The hybrid PNA-peptides were synthesized in 2 μmol scale on an ABI 8909 automated DNA/PNA synthesizer using Fmoc chemistry and the manufacturer's protocols, reagents and PNA monomers. After completion of automated synthesis, PNAs were cleaved from the solid support and the bases were deprotected using trifluoroacetic acid:m-cresol (4:1) for 2 h and then precipitated with diethyl ether. The hybrid PNA-peptides were purified by reverse phase chromatography on a Microsorb-MV 300-5 column, (250×4 6 mm column, 300 A pore sizes, Varian Inc.) C-18 column with a 0-5% B/5 min, 5-60% B/30 min, 60-95% B/5 min, 95% B for 5 min, 95%-0%/10 min where A=0.1% TFA in water, B=0.08% TFA in CH3CN. The fractions containing the products were evaporated to dryness in a Savant Speedvac, and redissolved in pure water.
Radioiodination of the PNA-Peptides with 131I.
The PNA-peptides were radioiodinated by a procedure described for iodination of PNAs with 125I. Thus Na131I (12 μL, 5 mCi/120 μL solution from Amersham) was added to 2 μL of water and 2 μL of 1 M sodium phosphate, pH 7, then 2 μL of 100 μM NaI was added, followed by 4 μL of 1 mM chloramine-T and 4 μL of 100 μM PNA. The reaction was mixed by micropipetting, and allowed to stand for 5 min at room temperature and quenched with 4 μL of 10 mM sodium metabisulfite. The reaction mixture was then diluted with 80 μL of water and placed onto a Waters Sep-Pak cartridge (Vac C18, 6 cc, Part # WAT036905) that had been prewashed with 5 mL of 0.1% TFA in water. The unreacted Na131I (average of 27% of the total radioactivity) was washed out with 10 mL of 0.1% TFA in water. This was followed by 5-10 mL of 5% acetonitrile in 0.1% TFA/water, which contained little radioactivity. The radiolabeled PNA-peptide (average of 42% of the radioactivity) was eluted with 5 mL of 40% CH3CN in 0.1% TFA/water, leaving an average of 31% of the total radioactivity on the column. The average recovery of the labeled PNA-peptide was 57%. An aliquot of the fraction containing the labeled PNA-peptide was then diluted down to make a 100 μM stock solution. The actual concentration was then determined base on the activity of the solution in comparison to the 5 mL stock solution.
PNA Dynabead Binding Assay.
The Dynabead assay was carried out as described above for the ODNs except that Corning non-binding assay tubes were used that were cut out of Corning® 96 Well White Flat Bottom Polystyrene NBS™ Microplates (Corning #3600) which have a polyethylene oxide-like surface. The binding tests were carried out in triplicate. Specifically, the radiolabeled PNA (13-26 pM) was incubated with the 0.1-1000 pM of biotinylated mRNA and 1 μL of RNAse inhibitor for 4 h at 37° C. in a total volume of 100 μL of 0.1 M NaCl, 50 mM EDTA, 2 mM cacodylic acid. Then 5 μL Dynabeads M-280 Steptaviden (Dynal Biotech) were added and mixed for 2 h. The beads were separated by a magnet and the supernatant transferred to a liquid scintillation vial. The beads were washed with 100 μL buffer three times and the washes transferred to the first scintillation vial. The beads were then transferred to a liquid scintillation vial by suspending in 100 μL of buffer three times. Liquid scintillation fluid (5 mL of CytoScint plus) was then added and both scintillation vials counted by liquid scintillation to give free and bound fractions directly.
PNA Binding Data Analysis.
The binding data for three tests was averaged and analyzed by fitting the % bound (% B) vs RNA concentration data to the analytical expression shown below for a two state binding equilibrium using a non-linear least squares fitting algorithm in Kalaidagraph in which the data was weighted according to their standard deviations. NSB is the % non-specifically bound (to be fit), SB is the % specifically bound (to be fit), [PNA] is the concentration of PNA used (a constant), [RNA] equals the concentration of RNA, a variable, and Kd is the dissociation constant for the PNA (to be fit).
Synthesis of the Flu-PNAs-NLS Conjugates.
A solid supported NLS peptide (NH2-KPKKKRKV-; SEQ ID NO: 17) was synthesized on a 2 μmol scale by manual benchtop Fmoc off synthesis on the universal support XAL-PEG-PS resin. Deprotection was carried out with 20% piperidine in DMF (v/v) and the coupling step was conducted in presence of N-Fmoc amino acid, HATU (4.0 eq) and DIEA (8 eq) in DMF. Capping was conducted with 5% acetic anhydride and 6% lutidine in DMF, alternate washing was applied between each procedure with methanol and DMF, after sequential amino acid coupling cycles finished, the resulted peptide-resin was washed with DMF and DCM and loaded in Expedite 8909 Synthesizer (Applied Biosystems) without deprotection. The PNAs-peptide conjugates were synthesized continuously by coupling PNA building blocks on N-terminus of NLS peptide which is attached on resin under standard automated PNA synthesis protocol. The cartridge containing NH2-PNA-peptide-resin was taken out of the synthesizer after PNA synthesis was complete. 5(6)-Carboxyfluorescein succinimidyl ester (10.7 mg, 20 μmol) was dissolved in 300 μl DMF, after DIEA (11 ul, 60 μmol) was added, the mixture was introduced into the cartridge with syringe and push the solution back and forth to agitate the resin suspension once 10 min during 1 hour. Then the resin was washed with DMF and DCM and dried by passing nitrogen. TFA/m-cresol (4:1) was used to cleave the conjugates and remove the side chain protective groups by treating Flu-PNA-peptide-resin for 2 h at RT 8-10 fold of ethyl ether was added into isolated TFA mixture to precipitate the expected product as yellow solid. The resulted crude products were purified by reversed phase HPLC on a Microsorb C18 column (300 Å pore, 5 μm particle size, 4.6×250 mm) using 5% to 70% linear gradient of solvent B (0.1% TFA in acetonitrile) in A (0.1% TFA in water) over 65 min at the flow rate of 1 ml/min. The effluent was monitored by absorbance at both 260 nm and 440 nm and the major peaks were collected, concentrated to dryness in vacuo, and characterized by MALDI-TOF mass spectrometry.
Assessment of MCF-7 Targeting Ability of Flu-PNA-NLS Conjugates by Fluorescent Microscopy and a Bulk Fluorescent Assay.
The MCF-7 cell line was obtained from American Type Culture Collection (ATCC), and was grown in Eagle's Minimal Essential medium with Earle's balanced salt solution and 2 mM L-glutamine (EMEM) (ATCC), supplemented with 0.01 mg/ml bovine insulin, 10% fetal bovine serum (Gibco), penicillin (20 units/ml) and streptomycin (20 μg/ml) (Gibco), at 37° C. in a humid atmosphere containing 5% CO2. MCF-7 were seeded onto eight-well glass chamber slides (Nunc; Naperville, Ill.), and grown to ˜60% confluence. The culture medium removed and the cells were washed with PBS and 300 μl of fresh culture medium with 1.0 μM Flu-PNAs was added. The cells were incubated at 37° C. in a humid atmosphere containing 5% CO2 for 4 h, 24 h and 48 h, and then washed five times with PBS. The cells were fixed at room temperature by addition of 4% (v/v) paraformaldehyde in PBS for 20 min, followed by three rinses with PBS. The cells were mounted with fluorescence antifading mounting medium following the recommended procedures of the manufacturer (Vector Laboratories, Burlingame, Calif.). Preparations were analyzed by fluorescence microscopy. The MCF-7 cells were treated as above with fluorescein labeled PNA NLS conjugates for 24 h. Following this the cells were lysed and the fluorescence of the mixture was measured at 520 nm with excitation at 488 nm on a SPEX fluorimeter.
In this example the inventors synthesized one targeting and one control nanoparticle bearing the antisense PNA50 and the sense PNAS sequences, respectively, to image the unr mRNA that is highly and abundantly overexpressed in a breast cancer cell line (MCF-7). A DOTA (1,4,7,10-tetraazacyclododecane-N,N′,N″,N″′-tetraacetic acid) chelating moiety was conjugated to the surface of the nanoparticles so that they could be radiolabeled with 64Cu for biodistribution and microPET imaging studies in MCF-7 tumor bearing mice. Furthermore, the protein transduction domain (PTD) of the HIV-1 TAT protein (see SEQ ID NO: 1) was conjugated for cell membrane crossing. The two nanoparticle were successfully labeled with 64Cu under mild conditions and were injected in CB-17 severe combined immunodeficiency (SCID) mice bearing MCF-7 xenografts (ca. 100 mg). MicroPET imaging revealed uptake of both targeting and control PNA-conjugated nanoparticles in MCF-7 tumors. However, the uptake of the SCK-PNA50 conjugate was higher compared to the SCK-PNA50S. Post-imaging biodistribution data comparison (24 h post injection) revealed a similar tumor specificity for SCK-conjugated and free PNA50 over PNA50S, suggesting the potential of PNA-conjugated SCKs as tumor specific molecular probes for early detection of cancer and ultimately for patient specific radiotherapy.
SCKs and PNAs were synthesized and purified as reported in EXAMPLES SETS A and E, respectively. PNA50, PNA50S, PTD and DOTA were conjugated on the surface of the SCKs as reported in Example set B. Radiolabeling with 64Cu and purification of DOTA-SCK(PTD)-PNA50 and DOTA-SCK(PTD)-PNA50S were carried out as reported in Example set D. MCF-7 xenografted CB-17 SCID mice were obtained as described in Example set D.
MicroPET Imaging Studies.
The microPET imaging studies were carried out using the microPET® R4 (rodent) scanner (Concorde Microsystems Inc., Knoxville, Tenn.). MCF-7 tumor-bearing CB-17 SCID mice were anesthetized with 1-2% vaporized isoflurane and injected with ca. 100-150 μCi of activity in 100 μL saline via the tail vein. At specific time points (1 h, 4 h, and 24 h) post injection, the mice were re-anesthetized and then immobilized in a supine position on custom-built support beds with attached anesthetic gas nose cones for data collection. After the microPET imaging at 24 h p.i., the animals were sacrificed and biodistribution studies were performed. The ratios of tumor to blood (T/B) and tumor to muscle (T/M) were calculated.
The sequences of the antisense and sense PNAs were selected by a procedure that was described in EXAMPLE SET E. PNA50 with a Kd of 21 μM for the 2828-18 binding site of the unr mRNA and PNA50S with a Kd of >10 nM were selected to be conjugated on the SCK surface to obtain a targeting construct and a control one, respectively. Together with the PNAs, the nanoparticles were conjugated to PTD for cell membrane cressing and to DOTA for 64Cu-labeling. The two nanoconjugates were successfully radiolabeled with 64Cu in 0.1 M ammonium citrate buffer (pH 6.5) under mild conditions (3 h at 60° C.).
After DTPA challenge of non-specifically bound 64Cu-activity and Centricon-YM100 (MWCO: 100,000 Da) separation, the radiochemical purity of the 64Cu-labeled PNA conjugates was nearly 100% as determined by radio-FPLC.
CB-17 SCID mice bearing MCF-7 xenografts were administered of 64Cu-DOTA-SCK(PTD)-PNA50 and 64Cu-DOTA-SCK(PTD)-PNAS via tail vein injection. The mice were imaged at 1 h, 4 h and 24 h post injection, then they were euthanized, the main organs were explanted, weighed and counted in a gamma counter together with standards to obtain the percent injected dose per gram tissue (% ID/g) and the percent injected dose per organ (% ID/organ).
The microPET images in
The post-imaging biodistribution results are consistent with this finding and the tumor/muscle and tumor/blood ratios (
64Cu-DOTA-SCK(PTD)-PNA50 and 64Cu-DOTA-SCK(PTD)-PNAS
64Cu-DOTA-
64Cu-DOTA-
64Cu-DOTA-
64Cu-DOTA-
Compared to the native SCK, the PNA- and PTD-conjugated nanoparticles have a lower accumulation in blood (64Cu-TETA-SCK: 1.05±0.33% ID/g; 64Cu-DOTA-SCK(PTD)-PNA50: 0.4631% ID/g; 64Cu-DOTA-SCK(PTD)-PNA50S: 0.4969% ID/g) and liver (64Cu-TETA-SCK: 23.34±3.76% ID/organ; 64Cu-DOTA-SCK(PTD)-PNA50: 3.7090% ID/organ; 64Cu-DOTA-SCK(PTD)-PNA50S: 2.9515% ID/organ). At the same time, the derivatized SCKs have a lower uptake in kidney at 24 h post injection, as compared to the non-conjugated PNAs (64Cu-DOTA-SCK(PTD)-PNA50: 0.3858% ID/organ; 64Cu-DOTA-SCK(PTD)-PNA50S: 0.2726% ID/organ; 64Cu-DOTA-PNA50-K4: 29.95±3.28% ID/organ; 64Cu-DOTA-PNA50S-K4: 22.72±8.45% ID/organ). The comparison of the biodistribution data in blood, kidney and liver is depicted in
In summary, we have designed and synthesized two shell cross-linked nanoparticle bearing PNAs with different affinity for a mRNA overexpressed in MCF-7 tumor cells (ca. 5000 copies per cell): a targeting SCK conjugated with the antisense sequence PNA50 and a control SCK conjugated with the sense sequence PNA50s. Upon conjugation to the nanoparticle, the antisense sequence maintained a highest affinity for the target mRNA compared to the sense sequence, as confirmed by both microPET imaging (
This application is a divisional application of U.S. patent application Ser. No. 11/250,830, filed Oct. 14, 2005, which claims the benefit of U.S. provisional patent application 60/619,242 filed Oct. 15, 2004, which are incorporated herein by reference in their entireties.
The present disclosure was made with government support under Grant 0210247 awarded by the National Science Foundation, Contract N01-CO-27103 awarded by the National Cancer Institute and National Research Service Award (NRSA) 5-T32-GM08785-02 awarded by the National Institutes of Health. The Government has certain rights in this disclosure.
Number | Name | Date | Kind |
---|---|---|---|
5625048 | Tsien et al. | Apr 1997 | A |
5777079 | Tsien et al. | Jul 1998 | A |
6165720 | Felgner et al. | Dec 2000 | A |
6319669 | Tsien et al. | Nov 2001 | B1 |
6383500 | Wooley et al. | May 2002 | B1 |
6471968 | Baker, Jr. et al. | Oct 2002 | B1 |
8354093 | Becker et al. | Jan 2013 | B2 |
20050038239 | Catchpole | Feb 2005 | A1 |
Entry |
---|
Golub et al., “Molecular Classification of Cancer: Class Discovery and Class Prediction by Gene Expression Monitoring,” Science, 286(5439), 531-537 (1999). |
Lewis et al., “Radiometal-Labeled Peptide—PNA Conjugates for Targeting bcl-2 Expression: Preparation, Characterization, and in Vitro mRNA Binding,” Bioconjugate Chemistry, 13(6), 1176-1180 (2002). |
Moghimi et al., “Long-Circulating and Target-Specific Nanoparticles: Theory to Practice,” Pharmacol. Rev. 2001, 53(2), 283-318. |
Duncan, “The dawning era of polymer therapeutics,” Nature Rev. Drug Disc. 2, 347-360 (2003). |
Lewis et al., “An improved method for conjugating monoclonal antibodies with N-hydroxysulfosuccinimidyl DOTA,” Bioconjug. Chem. 12:320-324 (2001). |
Liu et al., “99mTc labeling of highly potent small peptides,” Bioconjug. Chem. 8:621-636 (1997). |
Anderson and Welch, “Radiometal-Labeled Agents (Non-Technetium) for Diagnostic Imaging,” Chem. Rev. 99: 2219-2234 (1999). |
Jurisson and Lydon, “Potential Technetium Small Molecule Radiopharmaceuticals,” Chem. Rev. 99: 2205-2218 (1999). |
Welch et al., Handbook of Radiopharmaceuticals: Radiochemistry and Applications, Chichester: Wiley, 2003. pp. 1-12. |
Tyle et al., “Iontophoretic Devices for Drug Delivery,” Pharma. Research, 3(6), 318-326, (1986). |
Yoon et al., “Characteristics of HIV-Tat Protein Transduction Domain,” J. Microbiol., 42(4), 328-335 (2004). |
Becker et al., “Peptide-derivatized shell crosslinked (SCK) nanoparticles: 1. Synthesis and characterization,” Bioconjug. Chem., 15, 699-709 (2004). |
Becker et al., “Peptide-derivatized shell crosslinked (SCK) nanoparticles: 2. Biocompatibility evaluation,” Bioconjug. Chem., 15, 710-717 (2004). |
Sun et al., “MicroPET imaging of MCF-7 tumors in mice via unr mRNA targeted peptide nucleic acids,” Bioconj. Chem., 16, 294-305 (2005). |
Liu et al., “Nanostructured Materials Designed for Cell Binding Transduction,” Biomacromolecules, 2, 362-368 (2001). |
Remsen et al., “Solution and surface charge properties of shell cross-linked knedel nanoparticles,” Macromol., 1999, 32, 3685-3689. |
Jairajpuri et al., “Charge and solvation effects in anion recognition centers: an inquiry exploiting reactive arginines,” Biochem., 37, 10780-10791 (1998). |
Wadia et al., “Transducible TAT-HA fusogenic peptide enhances escape of TAT-fusion proteins after lipid raft macropinocytosis,” Nat. Med., 10, 310-315 (2004). |
Bailey et al., “Quantification of inflammatory cellular responses using real-time polymerase chain reaction,” J. Biomed. Mater. Res., 69, 305-313 (2004). |
Suzuki et al., “Possible Existence of Common Internalization Mechanisms among Arginine-rich Peptides,” J. Biol. Chem., 277, 2437-2443 (2002). |
Liefert et al., “Full-length proteins attached to the HIV tat protein transduction domain are neither transduced between cells, nor exhibit enhanced immunogenicity,” Gene Ther., 9, 1422-1428 (2002). |
Sazani et al., “Systemically delivered antisense oligomers upregulate gene expression in mouse tissues,”Nat. Biotechnol., 20, 1228-1233 (2002). |
McMahon et al., “Pharmacokinetics and tissue distribution of a peptide nucleic acid after intravenous administration,” Antisense Nucleic Acid Drug Dev., 12, 65-70 (2002). |
Roivainen et al., “68Ga-Labeled Oligonucleotides for in Vivo Imaging with PET,” J. Nucl. Med., 45, 347-355 (2004). |
Nielsen et al., “Sequence-selective recognition of DNA by strand displacement with a thymine-substituted polyamide,” Science 254 (5037), 1497-500 (1991). |
Number | Date | Country | |
---|---|---|---|
20130230452 A1 | Sep 2013 | US |
Number | Date | Country | |
---|---|---|---|
Parent | 11250830 | Oct 2005 | US |
Child | 13705682 | US |