Patent Application
20190144852
An electronic version of the Sequence Listing is filed herewith, the contents of which are incorporated by reference in their entirety. The electronic file is 219 kilobytes in size, and titled 18-1731_SequenceListing_ST25.txt.
The present disclosure provides systems, compositions, and methods for targeted genome engineering based on an orthogonal tri-functional CRISPR system that combines transcriptional activation, transcriptional interference, and gene deletion (CRISPR-AID). The present disclosure further provides a multi-functional genome-wide CRISPR (MAGIC) system and method for high throughput genotype-phenotype mapping.
Microbial cell factories have been increasingly engineered to produce fuels, chemicals, and pharmaceuticals using various renewable feedstocks (Nielsen, J., et al., Cell 164: 1185-1197 (2016); Du, J., et al., J. Ind. Microbiol. Biotechnol. 38:873-890 (2011)). However, microorganisms have evolved robust metabolic and regulatory networks to survive and grow in specific environments rather than to synthesize the products of industrial interest. Therefore, metabolic engineering of the producing microorganisms is required to rewire the cellular metabolism, i.e. to enhance the supply of the precursor metabolites (Lian, J. & Zhao, H., J., Ind. Microbiol. Biotechnol. 42: 437-451 (2015); Lian, J., et al., Metab. Eng. 24:139-149 (2014); Lian, J., et al., Metab. Eng. 23:92-99 (2014)), to maximize fermentation titer, yield, and productivity for commercially viable processes. To perturb the extensive regulation and complex interactions between metabolic pathways, researchers often need to modify multiple metabolic engineering targets with different modes of regulation, such as to increase expression of genes encoding rate-limiting enzymes, decrease expression of essential genes, and remove expression of competing pathways (Nielsen, J., et al., Cell 164:1185-1197 (2016)). Researchers should be able to control a full spectrum of expression profiles for multiple genes of interest simultaneously. Unfortunately, such rewiring of cellular metabolism is often carried out sequentially and with low throughput, which is largely due to the lack of facile and multiplex genome engineering tools. Homologous recombination based gene replacement is commonly used for genome engineering of the producing microorganisms, but suffers from low efficiency and throughput and is labor and time intensive (Hegemann, J. H., et al., Methods Mol. Biol. 313:129-144 (2006)). Consequently, genome engineering targets are mainly tested individually or in a few combinations. However, due to the limited knowledge on the regulation of cellular metabolism, it is highly desirable to test more metabolic engineering targets in combinations, particularly for those with synergistic interactions. Therefore, development of a combinatorial metabolic engineering strategy to modify the host genome in a modular, parallel, and high throughput manner will be critical to the optimization of microbial cell factories.
Additionally, functional profiling of genotype-phenotype relationships has broad applications in both fundamental biology and biotechnology, such as to decipher the genetic determinants of microbial pathogenesis and construct cell factories with maximal production of the desired metabolites (Si, T., et al., Biotechnol. Adv. 33:1420-1432, (2015)). Nevertheless, the understanding of the complexity of cellular network is rather limited. For example, in the most well-studied eukaryote Saccharomyces cerevisiae, about 1000 genes are included in the most advanced genome-scale metabolic models, while there are more than 6000 genes in the yeast genome (Lian, J., et al., Metab. Eng., (2018); Nielsen, J. & Keasling, J. D., Cell 164:1185-1197, (2016)). In other words, most of the genes have not been clearly mapped into biological pathways or phenotypic traits. Therefore, the identification of genetic determinants particularly for those that work synergistically remains the biggest challenge for understanding and engineering complex phenotypes.
There have been no reports on the development of a multi-functional genome-scale CRISPR system. In other words, the genotypic diversity created by exiting methods is not comprehensive, as both upregulation and downregulation of multiple targets are generally required to engineer the desired phenotype.
The present disclosure relates to a system for targeted genome engineering and methods for altering the expression of genes and interrogating the function of genes.
One aspect of the disclosure provides a system for targeted genome engineering, the system comprising one or more vectors comprising: (i) a first single guide RNA (sgRNA) that is capable of binding a target nucleic acid and binding a first nuclease-deficient RNA-guided DNA endonuclease protein; (ii) a second sgRNA that is capable of binding a target nucleic acid and binding a second nuclease-deficient RNA-guided DNA endonuclease protein; (iii) a third sgRNA that is capable of binding a target nucleic acid and binding a catalytically-active RNA-guided DNA endonuclease protein; (iv) a polynucleotide encoding a first nuclease-deficient RNA-guided DNA endonuclease protein that binds to the first sgRNA and causes transcriptional activation; (v) a polynucleotide encoding a second nuclease-deficient RNA-guided DNA endonuclease protein that binds to the second sgRNA and causes transcriptional interference; and (vi) a polynucleotide encoding a catalytically active RNA-guided DNA endonuclease protein that binds to the third sgRNA and causes a double-stranded nucleic acid break and causes gene deletion. In some embodiments, components (i), (ii), (iii), (iv), (v), and (vi) of the system for targeted genome engineering are located on the same or different vectors of the system.
In some embodiments of the disclosure, the catalytically active RNA-guided DNA endonuclease protein is CRISPR associated protein (Cas9). In other embodiments, the Cas9 is from Streptococcus pyogenes (SpCas9), Neisseria meningitides (NmCas9), Streptococcus thermophiles (St1Cas9), or Staphylococcus aureus (SaCas9).
In some embodiments of the disclosure, the system for targeted genome engineering comprises one or more vectors that are plasmids or viral vectors.
In some embodiments of the disclosure, the system for targeted genome engineering comprises a first nuclease-deficient RNA-guided DNA endonuclease protein that is functional only when bound to the first sgRNA; a second nuclease-deficient RNA-guided DNA endonuclease protein that is functional only when bound to the second sgRNA; and a catalytically active RNA-guided DNA endonuclease protein that is functional only when bound to the third sgRNA.
In other embodiments of the disclosure, the system for targeted genome engineering does not utilize synthetic CRISPR-repressible promoters or synthetic CRISPR-activatable promoters.
In some embodiments of the disclosure, all of the sgRNAs of the system for targeted genome engineering are expressed in an expression cassette comprising a type II promoter or a type III promoter.
Another aspect of the disclosure provides a polynucleotide comprising a nucleotide sequence encoding a Cpf1 nuclease-deficient RNA-guided DNA endonuclease protein operably linked to at least one VP64-p65AD (VP) activator domain. In some embodiments of the disclosure, the Cpf1 protein is from Lachnospiraceae bacterium or Acidaminococcus sp. In other embodiments of the disclosure, the Cpf1 nuclease-deficient RNA-guided DNA endonuclease protein comprises the sequence of amino acids set forth in SEQ ID NO:573 or at least 95% sequence identity to the sequence set forth in SEQ ID NO:573. In yet other embodiments of the disclosure, the polynucleotide encodes the sequence of amino acids set forth in SEQ ID NO:574 or at least 95% sequence identity to the sequence set forth in SEQ ID NO:574.
Yet another aspect of the present disclosure provides a polynucleotide comprising a nucleotide sequence encoding a Cas9 RNA-guided DNA endonuclease protein operably linked to more than one repression domain. In some embodiments of the disclosure, the Cas9 protein is from Streptococcus pyogenes, Neisseria meningitides, Streptococcus thermophiles, or Staphylococcus aureus. In other embodiments of the disclosure, the Cas9 RNA-guided DNA endonuclease protein comprises the sequence of amino acids set forth in SEQ ID NO:575 or at least 95% sequence identity to the sequence set forth in SEQ ID NO:575. In yet other embodiments of the disclosure, the polynucleotide encodes the sequence of amino acids set forth in SEQ ID NO:576 or at least 95% sequence identity to the sequence set forth in SEQ ID NO:576.
In some embodiments of the disclosure, the polynucleotide comprises a nucleotide sequence encoding a dSpCas9 protein operably linked to the C-terminal end to a RD11 repression domain, wherein a RD5 repression domain is operably linked to the C-terminal end of the RD11 domain, wherein a RD2 repression domain is operably linked to the C-terminal end of the RD5 domain. In other embodiments of the disclosure, the at least one repression domain is operably linked to the N-terminal and/or C-terminal ends of the nuclease-deficient RNA-guided DNA endonuclease protein, or operably linked in tandem at the C-terminal end of the nuclease-deficient RNA-guided DNA endonuclease protein.
Yet another aspect of the present disclosure provides a method of altering the expression of gene products, the method comprising: introducing into a cell the system of targeted genome engineering described above, wherein the expression of at least one gene product is increased, the expression of at least one gene product is decreased, and the expression of at least one gene products is deleted relative to a cell that has not been transformed with the system for targeted genome engineering.
In some embodiments of the present disclosure, the method of altering the expression of gene products further comprises selecting for successfully transformed cells by applying selective pressure.
In some embodiments of the present disclosure, the method occurs in vivo or in vitro.
In some embodiments of the present disclosure, the cell involved in the method of altering the expression of gene products is a eukaryotic cell. In other embodiments of the present disclosure, the cell is a yeast cell. In yet other embodiments, the yeast cell is Saccharomyces cerevisiae.
In some embodiments of the present disclosure, the at least one gene product is a protein involved in the mevalonate pathway. In other embodiments of the present disclosure, the expression of HMG1 is increased, the expression of ERGS is decreased, and the expression of ROX1 is deleted.
In some embodiments of the present disclosure, the method of altering the expression of gene products further comprises increasing production of an isoprenoid in the cell. In other embodiments, the isoprenoid is β-carotene.
In some embodiments of the present disclosure, the method of altering the expression of gene products further comprises increasing expression of a surface protein on the cell. In some embodiments, the expression of PDI1 is increased, the expression of MNN9 is decreased, and the expression of PMR1 is deleted. In other embodiments, the method further comprises increasing EGII display levels and cellulase activity.
Yet another aspect of the present disclosure provides a method of identifying the genetic basis of one or more phenotypes of cells, the method comprising: (i) preparing three genome-scale sgRNA expressing plasmid libraries from oligonucleotides wherein the first genome-scale sgRNA expressing plasmid library is for upregulating genes of the cells, wherein the second genome-scale sgRNA expressing plasmid library is for downregulating genes of the cells, and the third genome-scale sgRNA expressing plasmid library is for deleting genes of the cells; (ii) transforming the three genome-scale sgRNA expressing plasmid libraries into the cells; (iii) introducing into the cells a polynucleotide encoding a first nuclease-deficient RNA-guided DNA endonuclease protein that binds to the sgRNA of the first genome-scale sgRNA expressing plasmid library and causes transcriptional activation of genes of a cell, a polynucleotide encoding a second nuclease-deficient RNA-guided DNA endonuclease protein that binds to the sgRNA of the second genome-scale sgRNA expressing plasmid library and causes transcriptional repression of genes of the cells, and a polynucleotide encoding a catalytically active RNA-guided DNA endonuclease protein that binds to a the sgRNA of the third genome-scale sgRNA expressing plasmid library and causes double-stranded nucleic acid breaks and gene deletion of genes of a cell; (iv) isolating transformed cells with one or more phenotypes; and (v) determining the genomic loci of the DNA molecule that causes the one or more phenotypes.
In some embodiments of the disclosure, the cell is a yeast cell. In other embodiments, the cell is a eukaryotic cell.
In some embodiments of the method of identifying the genetic basis of one or more phenotypes of a cell, the phenotype is furfural tolerance or yeast surface display of recombinant proteins.
Therefore, provided herein are orthogonal and generally applicable tri-functional CRISPR systems comprising CRISPRa, CRISPRi, and CRISPRd (CRISPR-AID) for metabolic engineering of eukaryotic and prokaryotic cells, both in vitro and in vivo. Due to the modular and multiplex advantages of the CRISPR system, CRISPR-AID can be used for combinatorial optimization of various metabolic engineering targets and exploration of the synergistic interactions among transcriptional activation, transcriptional interference, and gene deletion in S. cerevisiae.
As further described herein, the tri-functional CRISPR system can be combined with array-synthesized oligo pools to create a multi-functional genome-wide CRISPR (MAGIC) system. While most existing methods for genome-scale engineering are limited to a single mode of genomic alteration (i.e., overexpression, repression, or deletion), the MAGIC system can be used for high throughput genotype-phenotype mapping to identify novel genetic determinants of complex phenotypes, particularly those with synergistic interactions when regulated to different expression levels.
Additional features and advantages are described herein, and will be apparent from the following Detailed Description, Drawings and the claims.
The features, objects and advantages other than those set forth above will become more readily apparent when consideration is given to the detailed description below. Such detailed description makes reference to the following drawings, wherein:
While the present methods and compositions are susceptible to various modifications and alternative forms, exemplary embodiments thereof are shown by way of example in the drawings and are herein described in detail. It should be understood, however, that the description of exemplary embodiments is not intended to limit the methods and compositions to the particular forms disclosed, but on the contrary, the intention is to cover all modifications, equivalents and alternatives falling within the spirit and scope of the methods and compositions as defined by the embodiments above and the claims below. Reference should therefore be made to the embodiments above and claims below for interpreting the scope of the methods and compositions.
The system and methods now will be described more fully hereinafter with reference to the accompanying drawings, in which some, but not all embodiments of the methods and compositions are shown. Indeed, the methods and compositions can be embodied in many different forms and should not be construed as limited to the embodiments set forth herein; rather, these embodiments are provided so that this disclosure will satisfy applicable legal requirements.
Likewise, many modifications and other embodiments of the system and methods described herein will come to mind to one of skill in the art to which the systems and methods pertains having the benefit of the teachings presented in the foregoing descriptions and the associated drawings. Therefore, it is to be understood that the methods and compositions are not to be limited to the specific embodiments disclosed and that modifications and other embodiments are intended to be included within the scope of the appended claims. Although specific terms are employed herein, they are used in a generic and descriptive sense only and not for purposes of limitation.
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of skill in the art to which the systems and methods pertain.
Articles “a” and “an” are used herein to refer to one or to more than one (i.e. at least one) of the grammatical object of the article. By way of example, “an element” means at least one element and can include more than one element.
As used herein, the term “and/or” includes any and all combinations of one or more of the associated listed items. As used herein, the singular forms “a,” “an,” and “the” are intended to include the plural forms as well as the singular forms, unless the context clearly indicates otherwise.
The embodiments illustratively described herein suitably can be practiced in the absence of any element or elements, limitation or limitations that are not specifically disclosed herein. Thus, for example, in each instance herein any of the terms “comprising,” “consisting essentially of,” and “consisting of” may be replaced with either of the other two terms, while retaining their ordinary meanings.
The term “about” in association with a numerical value means that the numerical value can vary plus or minus by 5% or less of the numerical value.
CRISPR-CAS9 System
The Clustered Regularly Interspersed Short Palindromic Repeats/CRISPR-associated (CRISPR/Cas) system includes recently identified types of sequence-specific nucleases. CRISPR/Cas molecules are components of a prokaryotic adaptive immune system that is functionally analogous to eukaryotic RNA interference, using RNA base pairing to direct DNA or RNA cleavage. Directing DNA double stranded breaks requires two components: the Cas9 protein, which functions as an endonuclease, and CRISPR RNA (crRNA) and tracer RNA (tracrRNA) sequences that aid in directing the Cas9/RNA complex to target DNA sequence. The modification of a single targeting RNA can be sufficient to alter the nucleotide target of a Cas9 protein. In some cases, crRNA and tracrRNA can be engineered as a single cr/tracrRNA hybrid to direct Cas9 cleavage activity. The CRISPR/Cas system can be used in bacteria, yeast, humans, and zebrafish.
CRISPR-AID System
Designing an optimal microbial cell factory often requires overexpression, knock-down, and knock-out of multiple gene targets. Unfortunately, such rewiring of cellular metabolism is often carried out sequentially and with low throughput. A combinatorial metabolic engineering strategy based on a tri-functional CRISPR system is described herein that combines orthogonal proteins for transcriptional activation, transcriptional interference, and gene deletion (CRISPR-AID) in eukaryotic and prokaryotic cells (e.g., mammalian, bacterial, yeast cells)
CRISPR-AID, a tri-functional CRISPR system combining transcriptional activation (CRISPRa), transcriptional interference (CRISPRi), and gene deletion (CRISPRd), for combinatorial metabolic engineering is provided herein. The systems enable the exploration of the gain- and loss-of-function combinations that work synergistically to improve the desired phenotypes. CRISPR-AID not only includes three modes of genome engineering (gene activation, gene interference, and gene deletion), but also has different mechanisms of genome modulation than, for example, RNAi and offers several advantages. For example, down-regulation using CRISPRi or RNAi is required for the modulation of essential genes, while CRISPRd enables more stable and in many cases significant phenotypes when targeting non-essential genes; CRISPRa is less biased for overexpression of large genes during large scale combinatorial optimization; CRISPRi blocks transcription in the nucleus while RNAi affects mRNA stability and translation, and CRISPRi is generally found to have higher repression efficiency in many situations. Using CRISPR-AID, different modes of genomic modifications (i.e. activation, interference, and deletion) can be introduced via gRNAs on a plasmid or other delivery method. Combinatorial metabolic engineering can be achieved by testing all the possible gRNA combinations. All the combinations of the metabolic engineering targets of the metabolic and regulatory network related to a desired phenotype can be explored.
One embodiment provides a system for targeted genome engineering, the system comprising one or more vectors comprising: (i) a first single guide RNA (sgRNA) that is capable of binding a target nucleic acid and binding a first nuclease-deficient RNA-guided DNA endonuclease protein; (ii) a second sgRNA that is capable of binding a target nucleic acid and binding a second nuclease-deficient RNA-guided DNA endonuclease protein; (iii) a third sgRNA that is capable of binding a target nucleic acid and binding a catalytically-active RNA-guided DNA endonuclease protein; (iv) a polynucleotide encoding a first nuclease-deficient RNA-guided DNA endonuclease protein that binds to the first sgRNA and causes transcriptional activation; (v) a polynucleotide encoding a second nuclease-deficient RNA-guided DNA endonuclease protein that binds to the second sgRNA and causes transcriptional interference; and (vi) a polynucleotide encoding a catalytically active RNA-guided DNA endonuclease protein that binds to the third sgRNA and causes a double-stranded nucleic acid break and causes gene deletion.
The system for targeted genome engineering can comprise more than one first single guide RNA (sgRNA) (e.g., 2, 3, 4, 5, 10, or more) that are capable of binding a target nucleic acid sequence and binding a first nuclease-deficient RNA-guided DNA endonuclease protein; more than one second sgRNA (e.g., 2, 3, 4, 5, 10, or more) that are capable of binding a target nucleic acid sequence and binding a second nuclease-deficient RNA-guided DNA endonuclease protein; more than one third sgRNA (e.g., 2, 3, 4, 5, 10, or more) that is capable of binding a target nucleic acid and binding a catalytically-active RNA-guided DNA endonuclease protein; a polynucleotide encoding a first nuclease-deficient RNA-guided DNA endonuclease protein that binds to the first group of sgRNA and causes transcriptional activation; a polynucleotide encoding a second nuclease-deficient RNA-guided DNA endonuclease protein that binds to the second group of sgRNA and causes transcriptional interference; and a polynucleotide encoding a catalytically active RNA-guided DNA endonuclease protein that binds to the third group of sgRNA and causes a double-stranded nucleic acid break and causes gene deletion.
The single guide RNA (sgRNA) capable of directing nuclease-deficient RNA-guided DNA endonuclease mediated transcriptional activation of target DNA, the sgRNA capable of causing transcriptional interference, and the sgRNA that capable of directing catalytically active RNA-guided DNA endonuclease mediated gene deletion or knock-out of target DNA can each target a different target nucleic acid.
As used herein, the term “targeted genome engineering” refers to a type of genetic engineering in which DNA is inserted, deleted, modified, modulated or replaced in the genome of a living organism or cell. Targeted genome engineering can involve integrating nucleic acids into or deleting nucleic acids from genomic DNA at a target site of interest in order to manipulate (e.g., increase, decrease, knockout, activate, interfere with) the expression of one or more genes. Targeted genome engineering can also involve recruiting RNA polymerase to or repressing RNA polymerase at a target site of interest in the genomic DNA in order to activate or repress expression of one or more genes.
Several aspects of the disclosure relate to vector systems comprising one or more vectors, or vectors as such. Vectors can be designed for expression of nuclease deficient RNA-guided DNA endonucleases, catalytically active RNA-guided DNA endonucleases, and polynucleotides (e.g. nucleic acid transcripts, proteins, or enzymes) in prokaryotic or eukaryotic cells. For example, nuclease deficient RNA-guided DNA endonucleases, catalytically active RNA-guided DNA endonucleases or polynucleotides can be expressed in bacterial cells such as Escherichia coli, insect cells (using baculovirus expression vectors), yeast cells, or mammalian cells. Suitable cells are discussed further in Goeddel, GENE EXPRESSION TECHNOLOGY: METHODS IN ENZYMOLOGY 185, Academic Press, San Diego, Calif. (1990). Alternatively, the recombinant expression vector can be transcribed and translated in vitro, for example using T7 promoter regulatory sequences and T7 polymerase.
A vector or expression vector is a replicon, such as a plasmid, phage, or cosmid, to which another nucleic acid segment can be attached so as to bring about the replication of the attached segment. A vector is capable of transferring polynucleotides (e.g. gene sequences) to target cells.
Expression refers to the process by which a polynucleotide is transcribed from a DNA template (such as into a sgRNA, tRNA or mRNA) and/or the process by which a transcribed mRNA is subsequently translated into peptides, polypeptides, or proteins. Transcripts and encoded polypeptides can be collectively referred to as “gene product.” A polypeptide is a linear polymer of amino acids that are linked by peptide bonds. If the polynucleotide is derived from genomic DNA, expression may include splicing of the mRNA in a eukaryotic cell.
Many suitable expression vectors and features thereof are known in the art. Expression vectors can contain, without limitation, a centromeric (CEN) sequence, an autonomous replication sequence (ARS), a promoter, an origin of replication, and a marker gene (e.g., auxotrophic, antibiotic, or other selectable markers). Examples of expression vectors may include plasmids, yeast artificial chromosomes, 2μπι plasmids, yeast integrative plasmids, yeast replicative plasmids, shuttle vectors, and episomal plasmids. Examples of vectors that can be used with the CRISPR-AID and CRISPR-MAGIC systems include, for example, BsaI-free pRS423, and those described in Table 1 and Table 2.
One or more vectors can be plasmids or viral vectors. In other embodiments, the viral vector is a lentivirus vector, an adenovirus vector, or an adeno-associated vector (AAV).
In some embodiments, a vector is a yeast expression vector. Examples of vectors for expression in yeast Saccharomyces cerevisiae include pYepSec1 (Baldari, et al., 1987. EMBO J. 6: 229-234), pMFa (Kuijan and Herskowitz, 1982. Cell 30: 933-943), pJRY88 (Schultz et al., 1987. Gene 54: 113-123), pYES2 (Invitrogen Corporation, San Diego, Calif.), and picZ (InVitrogen Corp, San Diego, Calif.).
In some embodiments, a vector drives protein expression in insect cells using baculovirus expression vectors. Baculovirus vectors available for expression of proteins in cultured insect cells (e.g., SF9 cells) include the pAc series (Smith, et al., 1983. Mol. Cell. Biol. 3: 2156-2165) and the pVL series (Lucklow and Summers, 1989. Virology 170: 31-39).
In some embodiments, a vector is capable of driving expression of one or more sequences in mammalian cells using a mammalian expression vector. Examples of mammalian expression vectors include, but are not limited to, pCDM8 (Seed, 1987. Nature 329: 840) and pMT2PC (Kaufman, et al., 1987. EMBO J. 6: 187-195). When used in mammalian cells, the expression vector's control functions are typically provided by one or more regulatory elements. For example, commonly used promoters are derived from polyoma, adenovirus 2, cytomegalovirus, simian virus 40, and others disclosed herein and known in the art. For other suitable expression systems for both prokaryotic and eukaryotic cells see, e.g., Chapters 16 and 17 of Sambrook, et al., MOLECULAR CLONING: A LABORATORY MANUAL. 2nd ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989.
In some embodiments, a recombinant mammalian expression vector is capable of directing expression of a nucleic acid in a particular cell type (e.g., tissue-specific regulatory elements are used to express the nucleic acid). Tissue-specific regulatory elements are known in the art. Non-limiting examples of suitable tissue-specific promoters include the albumin promoter (liver-specific; Pinkert, et al., 1987. Genes Dev. 1: 268-277), lymphoid-specific promoters (Calame and Eaton, 1988. Adv. Immunol. 43: 235-275), in particular promoters of T cell receptors (Winoto and Baltimore, 1989. EMBO J. 8: 729-733) and immunoglobulins (Baneiji, et al., 1983. Cell 33: 729-740; Queen and Baltimore, 1983. Cell 33: 741-748), neuron-specific promoters (e.g., the neurofilament promoter; Byrne and Ruddle, 1989. Proc. Natl. Acad. Sci. USA 86: 5473-5477), pancreas-specific promoters (Edlund, et al., 1985. Science 230: 912-916), and mammary gland-specific promoters (e.g., milk whey promoter; U.S. Pat. No. 4,873,316 and European Application Publication No. 264,166). Developmentally-regulated promoters are also encompassed, e.g., the murine hox promoters (Kessel and Gruss, 1990. Science 249: 374-379) and the α-fetoprotein promoter (Campes and Tilghman, 1989. Genes Dev. 3: 537-546).
Vectors can be introduced and propagated in a prokaryote. In some embodiments, a prokaryote is used to amplify copies of a vector to be introduced into a eukaryotic cell or as an intermediate vector in the production of a vector to be introduced into a eukaryotic cell (e.g. amplifying a plasmid as part of a viral vector packaging system). In some embodiments, a prokaryote is used to amplify copies of a vector and express one or more nucleic acids, such as to provide a source of one or more proteins for delivery to a host cell or host organism. Expression of proteins in prokaryotes is most often carried out in Escherichia coli with vectors containing constitutive or inducible promoters directing the expression of either fusion or non-fusion proteins. Fusion vectors add a number of amino acids to a protein encoded therein, such as to the amino terminus of the recombinant protein. Such fusion vectors may serve one or more purposes, such as: (i) to increase expression of recombinant protein; (ii) to increase the solubility of the recombinant protein; and (iii) to aid in the purification of the recombinant protein by acting as a ligand in affinity purification. Often, in fusion expression vectors, a proteolytic cleavage site is introduced at the junction of the fusion moiety and the recombinant protein to enable separation of the recombinant protein from the fusion moiety subsequent to purification of the fusion protein. Such enzymes, and their cognate recognition sequences, include Factor Xa, thrombin and enterokinase. Example fusion expression vectors include pGEX (Pharmacia Biotech Inc; Smith and Johnson, 1988. Gene 67: 31-40), pMAL (New England Biolabs, Beverly, Mass.) and pRIT5 (Pharmacia, Piscataway, N.J.) that fuse glutathione S-transferase (GST), maltose E binding protein, or protein A. respectively, to the target recombinant protein.
Examples of suitable inducible non-fusion E. coli expression vectors include pTrc (Amrann et al., (1988) Gene 69:301-315) and pET 11d (Studier et al., GENE EXPRESSION TECHNOLOGY: METHODS IN ENZYMOLOGY 185, Academic Press, San Diego, Calif. (1990) 60-89).
A promoter is any nucleic acid sequence that regulates the initiation of transcription for a particular polypeptide-encoding nucleic acid under its control. A promoter minimally includes the genetic elements necessary for the initiation of transcription (e.g., RNA polymerase Ill-mediated transcription), and can further include one or more genetic regulatory elements that serve to specify the prerequisite conditions for transcriptional initiation. Promoter means a cis-acting DNA sequence, generally 80-120 base pairs long and located upstream of the initiation site of a gene, to which RNA polymerase may bind and initiate correct transcription. There can be associated additional transcription regulatory sequences which provide on/off regulation of transcription and/or which enhance (increase) expression of the downstream coding sequence. A coding sequence is the part of a gene or cDNA which codes for the amino acid sequence of a protein, or for a functional RNA such as a tRNA or rRNA.
A promoter can be encoded by an endogenous genome of a cell, or it can be introduced as part of a recombinantly engineered polynucleotide. A promoter sequence can be taken from one species and used to drive expression of a gene in a cell of a different species. A promoter sequence can also be artificially designed for a particular mode of expression in a particular species, through random mutation or rational design. In recombinant engineering applications, specific promoters are used to express a recombinant gene under a desired set of physiological or temporal conditions or to modulate the amount of expression of a recombinant nucleic acid. Promoters used in the systems described herein include, for example, type II promoters (e.g., TEF1p, GPDp, PGK1p, and HXT7p) and type III promoters (SNR52p, PROp, and TYRp).
Regulatory elements are promoters, enhancers, internal ribosomal entry sites (IRES), and other expression control elements (e.g. transcription termination signals, such as polyadenylation signals and poly-U sequences). Such regulatory elements are described, for example, in Goeddel, (1990). Regulatory elements include those that direct constitutive expression of a nucleotide sequence in many types of host cell and those that direct expression of the nucleotide sequence only in certain host cells (e.g., tissue-specific regulatory sequences). A tissue-specific promoter can direct expression primarily in a desired tissue of interest, such as muscle, neuron, bone, skin, blood, specific organs (e.g. liver, pancreas), or particular cell types (e.g. lymphocytes). Regulatory elements can also direct expression in a temporal-dependent manner, such as in a cell-cycle dependent or developmental stage-dependent manner, which may or may not also be tissue or cell-type specific. In some embodiments, a vector for expressing gRNAs and/or RNA-guided DNA endonuclease proteins comprises one or more pol III promoters, one or more pol II promoters, one or more pol I promoters, or combinations thereof. Examples of pol III promoters include, but are not limited to, U6 and H1 promoters.
Regulatory elements also include enhancer elements, such as WPRE; CMV enhancers; the R-U5′ segment in LTR of HTLV-I (Mol. Cell. Biol., Vol. 8(1), p. 466-472, 1988); SV40 enhancer; and the intron sequence between exons 2 and 3 of rabbit β-globin (Proc. Natl. Acad. Sci. USA., Vol. 78(3), p. 1527-31, 1981).
Reporter yeast strains can be used in the systems and methods described herein. Reporter yeast stains can be transformed with one or more reporter plasmids containing gRNAs for transcriptional activation, interference, and deletion. Reporter plasmids can be used for observing the function of genetic elements, and contain a reporter or marker gene (e.g., luciferase or GFP) that offers a read-out of the activity of the genetic element. For example, a promoter of interest could be engineered upstream of the luciferase gene to determine the level of transcription driven by that promoter. The reporter plasmids can be linearized before transformation into a yeast cell. The purpose of linearization of the reporter plasmids is to integrate them into the genome. To demonstrate the CRISPR-AID system in yeast, a reporter yeast strain can be used comprising mCherry driven by a medium-strength promoter CYC1p for CRISPRa (transcriptional activation), mVenus driven by a strong promoter TEF1p for CRISPRi (transcriptional interference), and ADE2, an endogenous gene whose disruption results in the formation of red colonies in adenine deficient synthetic medium, for CRISPRd (gene deletion).
Transcriptional activation or activate refers to activation of gene expression, which can include, but is not limited to, increasing the levels of gene products or initiating gene expression of a previously inactive gene. Robust and controllable systems for activation of native gene expression have been pursued for multiple applications in gene therapy, regenerative medicine, and synthetic biology. These systems, rather than introducing heterologous genes that are expressed from constitutive or tunable promoters, use proteins that regulate transcription of genes in their natural chromosomal context. When activated, the amount of a gene product or gene expression can be increased by about 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50 fold or more.
Transcriptional interference refers to the suppressive, direct, and in cis influence of one transcription process by a secondary transcriptional process. Transcriptional interference can be achieved by either blocking transcriptional initiation (i.e. binding to the promoter region) or transcriptional elongation (i.e. binding to the coding sequences). The result of transcriptional interference is that the amount of a gene product or gene expression is decreased by about 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50 fold or more.
As used herein, the terms “gene deletion” or “knockout” refers to a genetic technique in which a gene is made inoperative. That is, a gene product is not expressed. Knocking out two genes simultaneously results in a double knockout. Similarly, triple knockout (TKO) and quadruple knockouts (QKO) are used to describe three or four knocked out genes, respectively. Heterozygous knockouts refer to when only one of the two gene copies (alleles) is knocked out, and homozygous knockouts refer to when both gene copies are knocked out. Therefore, the expression of at least one gene product is altered (e.g., increased, decreased, knocked out, deleted, or activated) using the targeted genome engineering systems described herein, relative to an unaltered cell. In an embodiment, the expression of one or more gene products are increased, the expression of one or more gene produces are decreased, and the expression of one or more gene products are knocked out by at least three separately-acting RNA-guided DNA endonucleases.
Endonucleases
A nuclease protein is a non-specific endonuclease. It is directed to a specific DNA target by a gRNA, where it causes a double-strand break. Nuclease-deficient RNA-guided DNA endonucleases can cause transcriptional activation or transcriptional interference. There are many versions of RNA-guided DNA endonucleases isolated from different bacteria.
Each RNA-guided DNA endonuclease binds to its target sequence only in the presence of a protospacer adjacent motif (PAM), on the non-targeted DNA strand. Therefore, the locations in a genome that can be targeted by different RNA-guided DNA endonuclease can be dictated by locations of PAM sequences. A catalytically-active RNA-guided DNA endonuclease cuts 3-4 nucleotides upstream of the PAM sequence. Recognition of the PAM sequence by a RNA-guided DNA endonuclease protein is thought to destabilize the adjacent DNA sequence, allowing interrogation of the sequence by the sgRNA, and allowing the sgRNA-DNA pairing when a matching sequence is present. Exemplary protospacers and PAM motifs the can be used of the systems and methods described herein are listed in Table 2. The three independent RNA-guided DNA endonuclease proteins of the tri-functional systems described herein can have protospacer adjacent motif (PAM) sequences and gRNA scaffold sequences that are different from each other.
RNA-guided DNA endonucleases isolated from different bacterial species recognize different PAM sequences. For example, the SpCas9 nuclease cuts upstream of the PAM sequence 5′-NGG-3′ (where “N” can be any nucleotide base), while the PAM sequence 5′-NNGRR(N)-3′ is required for SaCas9 (from Staphylococcus aureus) to target a DNA region for editing. While the PAM sequence itself is necessary for cleavage, it is not included in the single guide RNA sequence. A nuclease-deficient RNA-guided DNA endonuclease protein is directed by RNA base pairing to target DNA, but is not capable of cleaving the phosphodiester bond within a polynucleotide chain. Thus, a nuclease-deficient RNA-guided endonuclease protein can be used to specifically target any region of the genome without causing cleavage. RNA-guided DNA endonucleases (e.g., Cas9) are rendered nuclease-deficient by amino acid point mutations. For example, the H840A and D10A mutations in the HHN-nuclease domain and RuvC1 domain, respectively, in the Cas9 from Streptococcus pyogenes inactivate cleavage activity, but do not prevent binding of the RNA-guided DNA endonuclease. Additionally, an E832A mutation in the Cpf1 protein from Lachnospiraceae bacterium ND2006 inactivates cleavage activity, but does not prevent binding. Nuclease-deficient RNA-guided DNA endonuclease proteins include, but are not limited to, nuclease-deficient Cas9 from Streptococcus pyogenes (dSpCas9), nuclease-deficient Cas9 from Staphylococcus aureus (dSaCas9), nuclease-deficient Cas9 from Streptococcus thermophiles (dSt1Cas9), nuclease-deficient Cpf1 from Lachnospiraceae bacterium ND2006 (dLbCpf1), and nuclease-deficient Cpf1 from Acidaminococcus sp. BV3L6 (AsCpf1). Nuclease-deficient RNA-guided DNA endonuclease proteins can be fused with various effector domains (e.g., transcriptional activators, repression domains, or fluorescent proteins). Transcriptional activation or interference can be achieved by fusing an activation or repression domain to a nuclease-deficient CRISPR protein (e.g., Cas9, Cpf1).
A nuclease-deficient RNA-guided DNA endonuclease protein can be operably linked to at least one activation domain to form a nuclease-deficient RNA-guided DNA endonuclease that causes transcriptional activation. As used here, the term “activation domain” refers to a transcription factor that increases transcription of the gene that it targets. Activation domains can be derived from a transcription factor protein. Activation domains can contain amino acid compositions rich in acidic amino acids, hydrophobic amino acids, prolines, glutamines, or hydroxylated amino acids. Alpha helix structural motifs can also be common in activation domains. Activation domains contain about 5 amino acids to about 200 amino acids (La Russa, M. F., et al., Mol. Cell. Biol. 35:3800-3809 (2015); Maeder, M. I., et al., Nat. Methods 10:977-979 (2013); Qi, I.S., et al., Cell 152:1173-1183 (2013); Gilbert, L. A., et al., Cell 159:647-661 (2014); Zalatan, J. G., et al., Cell 160:339-350 (2015); Chavez A., et al., Nat. Methods 12:326-8 (2015)).
Two DNA sequences are operably linked if the nature of the linkage does not interfere with the ability of the sequences to affect their normal functions relative to each other. For instance, a promoter region would be operably linked to a coding sequence of the protein if the promoter were capable of effecting transcription of that coding sequence.
A nuclease-deficient RNA-guided DNA endonuclease protein can be, for example dSpCas9, dSaCas9, dSt1Cas9, or dLbCpf1 and an activation domain can be, for example, VP64 (V), VP64-p65AD (VP), VP64-p65AD-Rta (VPR), or GAL4-AD. A nuclease-deficient RNA-guided DNA endonuclease protein can be, for example, dLbCpf1 and a one activation domain can be, for example, VP64-p65AD (VP).
A nuclease-deficient RNA-guided DNA endonuclease protein can be operably linked to at least one repression domain to form a nuclease-deficient RNA-guided DNA endonuclease protein that causes transcriptional interference. A repression domain is a transcription factor that decreases transcription of the gene that it targets. (La Russa, M. F., et al., Mol. Cell. Biol. 35:3800-3809 (2015); Maeder, M. I., et al., Nat. Methods 10:977-979 (2013); Qi, I. S., et al., Cell 152:1173-1183 (2013); Gilbert, L. A., et al., Cell 159:647-661 (2014); Zalatan, J. G., et al., Cell 160:339-350 (2015)). Like activation domains, repression domains can vary in length and amino acid sequence, and do not have significant sequence homology with one another. Repression domains can have amino acid compositions rich in alanines, prolines, and charged amino acids. Repression domains can contain about 5 amino acids to about 200 amino acids. A repression domain can be small (e.g., about 5 to 200 amino acids, about 5 to 150 amino acids, about 10 to 100 amino acids, about 20 to 80 amino acids, about 10 to 50 amino acids) while demonstrating strong transcriptional repression.
A nuclease-deficient RNA-guided DNA endonuclease protein can be operably linked multiple repression domains (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10 or more repression domains) to form a nuclease-deficient RNA-guided DNA endonuclease protein that causes transcriptional interference.
Examples of nuclease-deficient RNA-guided DNA endonuclease protein that cause transcriptional interference include dSpCas9, dSaCas9, dSt1Cas9, or dLbCpf1. Examples of repression domains include MXI1, RD1 (TUP1), RD2, RD3, RD4, RD5 (MIG1), RD6, RD7, RD8, RD9, RD10, RD11 (UME6), or KRAB or combinations thereof. Furthermore, there are several mammalian transcription factors (e.g., p53, Erg-1, C/EBPc) that can function as both activation domains and repression domains.
A catalytically active RNA-guided DNA endonuclease protein is an RNA-guided DNA endonuclease protein that is directed by RNA base pairing and capable of cleaving a phosphodiester bond within a polynucleotide chain. Catalytically active RNA-guided DNA endonuclease proteins include, for example, Cas9 from Streptococcus pyogenes (SpCas9), Neisseria meningitides (NmCas9), Streptococcus thermophiles (St1Cas9), and Staphylococcus aureus (SaCas9) and Cpf1 from Lachnospiraceae bacterium ND2006 (LbCpf1) and Acidaminococcus sp. BV3L6 (AsCpf1).
As used herein, the term “target DNA” refers to chromosomal DNA. Target DNA includes nucleic acids that can be activated, repressed, deleted, knocked-out, or interfered with. For example, target DNA can include protein coding sequences and promoter sequences. Target DNA can be about 18 nucleotides to about 25 nucleotides in length. Target DNA for CRISPRa can be, for example, about 250 base pairs upstream of the coding sequences or about 200 base pairs upstream of the transcription starting site (TSS). Target DNA for CRISPRa can be, for example, about 23 base pairs (e.g., 21, 22, 23, 24, or 25 base pairs) in length. Target DNA for CRISPRi can be, for example, about 100 base pairs to about 150 base pairs upstream of the coding sequences or 50 base pairs to about 100 base pairs upstream of the TSS. Target DNA for CRISPRa can be, for example, about 20 base pairs (e.g., 18, 19, 20, 21, or 22 base pairs) in length. Target DNA for CRISPRd can be, for example, about 21 base pairs (e.g., 19, 20, 21, 22 or 23 base pairs) in length. Most organisms have the same genomic DNA in every cell, but only certain genes are active in each cell to allow for cell function and differentiation within the body. The genome of an organism (encoded by the genomic DNA) is the (biological) information of heredity which is passed from one generation of organism to the next.
A system described herein can further comprise one or more additional sgRNA molecules that are capable of binding a target nucleic acid and a catalytically-active RNA-guided DNA endonuclease protein that causes a double-stranded nucleic acid break of one or more additional target nucleic acid molecules. In this aspect, the genome can be cut at several different sites (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 sites) at or near the same time, and the homology directed repair donor included in the sgRNA expression plasmid can be inserted into those one or more sites (Bao, Z., et al., 2015, ACS Synth. Biol., 5:585-594).
The systems described herein can utilize orthogonal RNA-guided DNA endonuclease proteins. Orthogonal refers to ligand-protein pairs, whereby the RNA-guided DNA endonuclease protein is only functional when in the presence of its cognate gRNA pair. For example, a nuclease-deficient RNA-guided DNA endonuclease protein (e.g., dSpCas9, dSaCas9, dSt1Cas9, and dLbCpf1) is functional only when bound to a sgRNA ortholog. A catalytically active RNA-guided DNA endonuclease protein (e.g., Cas9) can be functional only when bound to a sgRNA ortholog. The gRNA structure sequences as well as the PAM sequences are different, both of which endow the activity of the CRISPR proteins described in Table 7 to be orthogonal.
A nuclease-deficient RNA-guided DNA endonuclease or catalytically active RNA-guided DNA endonuclease, can be expressed from an expression cassette. An expression cassette is a distinct component of vector DNA comprising a gene and regulatory elements to be expressed by a transformed or transfected cell, whereby the expression cassette directs the cell to make RNA and protein. Different expression cassettes can be transformed or transfected into different organisms including bacteria, yeast, plants, and mammalian cells as long as the correct regulatory element sequences are used.
Once a target DNA and RNA-guided DNA endonuclease have been selected, the next step is to design a specific guide RNA sequence. Several software tools exist for designing an optimal guide with minimum off-target effects and maximum on-target efficiency. Examples include Synthego Design Tool, Desktop Genetics, Benchling, and MIT CRISPR Designer.
sgRNA
As used herein, “single guide RNA” (the terms “single guide RNA,” “guide RNA (gRNA),” and “sgRNA” may be used interchangeably herein) refers to a single RNA species capable of directing catalytically active RNA-guided DNA endonuclease mediated single stranded or double stranded cleavage of target DNA; capable of directing nuclease-deficient RNA-guided DNA endonuclease mediated transcriptional activation of target DNA; capable of directing nuclease-deficient RNA-guided DNA endonuclease mediated transcriptional interferences of target DNA. Single-stranded gRNA sequences are transcribed from double-stranded DNA sequences inside the cell.
A guide RNA is a specific RNA sequence that recognizes a target DNA region of interest and directs a RNA-guided DNA endonuclease there for editing. A gRNA has at least two regions. First, a crispr RNA (crRNA) or spacer sequence, which is a nucleotide sequence complementary to the target DNA, and second a tracr RNA, which serves as a binding scaffold for the RNA-guided DNA endonuclease. The gRNA sequence that is complementary to the target DNA is known as the protospacer. The crRNA and tracr RNA can exist as one molecule or as two separate molecules, as they are in nature. gRNA and sgRNA as used herein refer to a single molecule comprising at least a crRNA region and a tracr RNA region or two separate molecules wherein the first comprises the crRNA region and the second comprises a tracr RNA region. The crRNA region of the gRNA is a customizable component that enables specificity in every CRISPR reaction. A guide RNA used in the systems and methods can also comprise an endoribonuclease recognition site (e.g., Csy4) for multiplex processing of gRNAs. If an endoribonuclease recognition site is introduced between neighboring gRNA sequences, more than one gRNA can be transcribed in a single expression cassette.
A guide RNA used in the systems and methods are short, single-stranded polynucleotide molecules about 20 nucleotides to about 300 nucleotides in length. The spacer sequence (targeting sequence) that hybridizes to a complementary region of the target DNA of interest can be about 20-30 nucleotides in length.
A sgRNA capable of directing nuclease-deficient RNA-guided DNA endonuclease mediated transcriptional activation of target DNA can be about 43 nucleotides (e.g., about 40, 41, 42, 43, 44, 45, or 46 nucleotides) in length. A sgRNA can guide a nuclease-deficient RNA-guided DNA endonuclease near the promoter or enhancer regions of a gene to activate transcription (e.g., about 250 bp upstream of the coding sequences or about 200 bp upstream of the TSS). The activation domain(s) of the nuclease-deficient RNA-guided DNA endonuclease recruits RNA polymerase to activate the expression of the target gene.
A sgRNA capable of directing nuclease-deficient RNA-guided DNA endonuclease mediated transcriptional interference of target DNA can be about 96 nucleotides (e.g., about 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100 nucleotides) in length. A sgRNA can guide a nuclease-deficient RNA-guided DNA endonuclease near the promoter or enhancer regions of a gene to interfere with transcription (e.g., about 100-150 bp upstream of the coding sequence or 50-100 bp upstream of TSS). The repression domain(s) of the nuclease-deficient RNA-guided DNA endonuclease interferes with the binding of the RNA polymerase, which in turn represses transcription of the target gene.
A sgRNA capable of directing catalytically-active RNA-guided DNA endonuclease mediated gene deletion of target DNA can be can be about 248 nucleotides (e.g., 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, or 260 nucleotides) in length. A sgRNA can guide a catalytically active RNA-guided DNA endonuclease to the coding sequence of a gene. The sgRNA used to direct gene deletion can include DNA donor sequences for homology-directed repair.
sgRNAs can be synthetically generated or by making the sgRNA in vivo or in in vitro, starting from a DNA template.
One method of making sgRNAs comprises expressing the sgRNA sequence in cells from a transformed or transfected plasmid. The sgRNA sequence is cloned into a plasmid vector, which is then introduced into cells. The cells use their normal RNA polymerase enzyme to transcribe the genetic information in the newly introduced DNA to generate the sgRNA.
sgRNA can also be made by in vitro transcription (IVT). sgRNA is transcribed from a corresponding DNA sequence outside the cell. A DNA template is designed that contains the guide sequence and an additional RNA polymerase promoter site upstream of the sgRNA sequence. The sgRNA is then transcribed using commercially available kits with reagents and recombinant RNA polymerase.
sgRNAs can also be synthetically generated. Synthetically generated sgRNAs can be chemically modified to prevent degradation of the molecule within the cell.
Exemplary oligonucleotides that can be used to synthesize gRNAs of the systems described herein are listed in Table 4 and Table 5.
A sgRNA can target a regulatory element (e.g., a promoter, enhancer, or other regulatory element) in the target genome. A sgRNA can also target a coding sequence in the target genome.
The sgRNAs of the system and methods described herein can also be truncated (e.g., comprising 12-16 nucleotide targeting sequences). For example, Sg27 gRNAs is a truncated version of the full length Sg1. The sgRNA can be unmodified or modified. For example, modified sgRNAs can comprise one or more 2′-O-methyl and/or 2′-O-methyl phosphorothioate nucleotides.
A first single guide RNA (sgRNA) that is capable of binding a target nucleic acid sequence and binding a first nuclease-deficient RNA-guided DNA endonuclease protein; a second sgRNA that is capable of binding a target nucleic acid sequence and binding a second nuclease-deficient RNA-guided DNA endonuclease protein; a third sgRNA that is capable of binding a target nucleic acid sequence and binding a catalytically active RNA-guided DNA endonuclease protein; a polynucleotide encoding a first nuclease-deficient RNA-guided DNA endonuclease protein that binds to the first sgRNA and causes transcriptional activation; a polynucleotide encoding a second nuclease-deficient RNA-guided DNA endonuclease protein that binds to the second sgRNA and causes transcriptional interference; and a polynucleotide encoding a catalytically active RNA-guided DNA endonuclease protein that binds to the third sgRNA and causes a double-stranded nucleic acid break and causes gene deletion can be located on the same or different vectors of the system.
The three sgRNAs or three pools of sgRNAs that can be used in the systems and methods herein are orthogonal to each other, meaning that the first sgRNA or first pool of sgRNAs are only be recognized by the nuclease-deficient RNA-guided DNA endonuclease capable of causing transcriptional activation; the second sgRNA or second pool of sgRNAs can only be recognized by the nuclease-deficient RNA-guided DNA endonuclease capable of causing transcriptional interference; and, the third sgRNA or third pool of sgRNAs can only be recognized by the catalytically active RNA-guided DNA endonuclease capable of causing gene deletion.
sgRNAs are not particularly limited and can be any sgRNA. A sgRNA that is capable of binding a nuclease-deficient RNA-guided DNA endonuclease protein that causes transcriptional activation can be, for example, sg6, sg149, sg150, sg155, sg156, sg157, sg175, sg221, or sg218. A sgRNA that is capable of binding a nuclease-deficient RNA-guided DNA endonuclease protein that causes transcriptional interference can be, for example, sg1, sg27, sg28, sg112, sg113, sg114, sg172, sg120, sg121, sg230, or sg204. A sgRNA that is capable of binding a catalytically active RNA-guided DNA endonuclease protein that causes a double-stranded nucleic acid break and causes gene deletion can be, for example, sg11, sg186, sg205, sg265, sg266, or sg267.
sgRNA that is capable of binding a target nucleic acid sequence and binding a nuclease-deficient RNA-guided DNA endonuclease protein that causes transcriptional interference can be expressed in an expression cassette comprising a type II promoter or a type III promoter.
One or more vectors that express sgRNA and/or RNA-guided DNA endonuclease proteins can further comprise a polynucleotide encoding for a marker protein. The marker protein can be, for example, an antibiotic resistance protein or a florescence protein for easier monitoring of genome integration and expression, and to label or track particular cells.
A polynucleotide encoding a marker protein can be expressed on a separate vector from a vector that expresses sgRNA and/or RNA-guided DNA endonuclease proteins.
A marker protein is a protein encoded by a gene that when introduced into a cell (prokaryotic or eukaryotic) confers a trait suitable for artificial selection. Marker proteins are used in laboratory, molecular biology, and genetic engineering applications to indicate the success of a transformation, a transfection or other procedure meant to introduce foreign DNA into a cell. Marker proteins include, but are not limited to, proteins that confer resistance to antibiotics, herbicides, or other compounds, which would be lethal to cells, organelles or tissues not expressing the resistance gene or allele. Selection of transformants is accomplished by growing the cells or tissues under selective pressure, i.e., on media containing the antibiotic, herbicide or other compound. If the marker protein is a “lethal” marker, cells which express the marker protein will live, while cells lacking the marker protein will die. If the marker protein is “non-lethal,” transformants (i.e., cells expressing the selectable marker) will be identifiable by some means from non-transformants, but both transformants and non-transformants will live in the presence of the selection pressure.
Selective pressure refers to the influence exerted by some factor (such as an antibiotic, heat, light, pressure, or a marker protein) on natural selection to promote one group of organisms or cells over another. In the case of antibiotic resistance, applying antibiotics cause a selective pressure by killing susceptible cells, allowing antibiotic-resistant cells to survive and multiply.
Selective pressure can be applied by contacting the cells with an antibiotic and selecting the cells that survive. The antibiotic can be, for example, kanamycin, puromycin, spectinomycin, streptomycin, ampicillin, carbenicillin, bleomycin, erythromycin, polymyxin B, tetracycline, or chloramphenicol.
In some embodiments, the systems and methods do not utilize synthetic CRISPR-repressible promoters (e.g., CRP-a) or synthetic CRISPR-activatable promoters (e.g., CAP). Synthetic CRISPR-repressible or CRISPR-activatable promoters are designed for CRISPRa and CRISPRi in mammalian cells (Kiani, S., et al., 2015, Nat. Methods, 12:1051-1054). A repressible promoter can express genes constitutively unless they are switched off by a repressor (e.g., protein or small molecule). An activatable promoter, or inducible promoter, can express genes only when an activator (e.g., protein or small molecule) is present.
Polynucleotides of the Systems
Also provided are examples of polynucleotides useful in the systems and methods described herein.
The terms “polynucleotide,” “nucleotide,” and “oligonucleotide” are used interchangeably. They refer to a polymeric form of nucleotides of any length, either deoxyribonucleotides or ribonucleotides, or analogs thereof. Polynucleotides may have any three dimensional structure, and may perform any function, known or unknown. Nucleic acid molecule means a single- or double-stranded linear polynucleotide containing either deoxyribonucleotides or ribonucleotides that are linked by 3′-5′-phosphodiester bonds. A nucleic acid construct is a nucleic acid molecule which is isolated from a naturally occurring gene or which has been modified to contain segments of nucleic acid which are combined and juxtaposed in a manner which would not otherwise exist in nature. The following are non-limiting examples of polynucleotides: coding or non-coding regions of a gene or gene fragment, loci (locus) defined from linkage analysis, exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, short interfering RNA (siRNA), short-hairpin RNA (shRNA), single guide RNA (sgRNA), micro-RNA (miRNA), ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, and primers. A polynucleotide may comprise one or more modified nucleotides, such as methylated nucleotides and nucleotide analogs. If present, modifications to the nucleotide structure may be imparted before or after assembly of the polymer. The sequence of nucleotides may be interrupted by non-nucleotide components. A polynucleotide may be further modified after polymerization, such as by conjugation with a labeling component.
A recombinant nucleic acid molecule, for instance a recombinant DNA molecule, is a novel nucleic acid sequence formed in vitro through the ligation of two or more nonhomologous DNA molecules (for example a recombinant plasmid containing one or more inserts of foreign DNA cloned into at least one cloning site).
Homology refers to the similarity between two nucleic acid sequences. Homology among DNA, RNA, or proteins is typically inferred from their nucleotide or amino acid sequence similarity. Significant similarity is strong evidence that two sequences are related by evolutionary changes from a common ancestral sequence. Alignments of multiple sequences are used to indicate which regions of each sequence are homologous. The term “percent homology” is used herein to mean “sequence similarity.” The percentage of identical nucleic acids or residues (percent identity) or the percentage of nucleic acids residues conserved with similar physicochemical properties (percent similarity), e.g. leucine and isoleucine, is used to quantify the homology.
Complement or complementary sequence means a sequence of nucleotides which forms a hydrogen-bonded duplex with another sequence of nucleotides according to Watson-Crick base-pairing rules. For example, the complementary base sequence for 5′-AAGGCT-3′ is 3′-TTCCGA-5′. Downstream refers to a relative position in DNA or RNA and is the region towards the 3′ end of a strand. Upstream means on the 5′ side of any site in DNA or RNA.
As described herein, “sequence identity” is related to sequence homology. Homology comparisons may be conducted by eye or using sequence comparison programs. These commercially available computer programs may calculate percent (%) homology between two or more sequences and may also calculate the sequence identity shared by two or more amino acid or nucleic acid sequences. Sequence homologies may be generated by any of a number of computer programs known in the art, for example BLAST or FASTA.
Percentage (%) sequence identify can be calculated over contiguous sequences, i.e., one sequence is aligned with the other sequence and each amino acid or nucleotide in one sequence is directly compared with the corresponding amino acid or nucleotide in the other sequence, one residue at a time. This is called an “ungapped” alignment. Ungapped alignments are performed only over a relatively short number of residues. Although this is a very simple and consistent method, it fails to take into consideration that, for example, in an otherwise identical pair of sequences, one insertion or deletion may cause the following amino acid residues to be put out of alignment, thus potentially resulting in a large reduction in percent homology when a global alignment is performed. Therefore, most sequence comparison methods are designed to produce optimal alignments that take into consideration possible insertions and deletions without unduly penalizing the overall homology or identity score. This is achieved by inserting “gaps” in the sequence alignment to try to maximize local homology or identity.
A polynucleotide can comprise a nucleotide sequence encoding a nuclear localization sequence (NLS). A NLS is an amino acid sequence that tags a protein for import into the cell nucleus by nuclear transport. Typically, this signal consists of one or more short sequences of positively charged lysines or arginines exposed on the protein surface. Different nuclear localized proteins may share the same NLS. A NLS can be added to the C-terminus, N-terminus, or both termini of an RNA-guided DNA endonuclease protein (e.g., NLS-protein, protein-NLS, or NLS-protein-NLS) to ensure nuclease activity in the cell. A NLS sequence can comprise, for example, the sequence of amino acids set forth in SEQ ID NO: 577 (PKKKRKV) or SEQ ID NO:578 (KRPAATKKAGQAKKKKK).
A polynucleotide can also comprise a nucleotide sequence encoding a polypeptide linker sequence. Linkers are short (e.g., about 3 to 20 amino acids) polypeptide sequences that can be used to operably link protein domains. Linkers can comprise flexible amino acid residues (e.g., glycine or serine) in order to permit adjacent protein domains to move freely related to one another. A linker sequence can comprise, for example, the sequence of amino acids set forth in SEQ ID NO:579 (GSSKLSGGGSGGSGS), SEQ ID NO:580 (GGGSGGSGS), or SEQ ID NO:581 (GGGSGGSGSKLGGSGGS).
For example, a polynucleotide can comprise a nucleotide sequence encoding a Cpf1 nuclease-deficient RNA-guided DNA endonuclease protein operably linked to at least one VP64-p65AD (VP) activator domain. A Cpf1 protein can be, for example, from Lachnospiraceae bacterium or Acidaminococcus sp.
An activator domain can be operably linked to the N-terminal and/or C-terminal ends of a nuclease-deficient RNA-guided DNA endonuclease protein, or operably linked in tandem at the N-terminal and/or C-terminal ends of a nuclease-deficient RNA-guided DNA endonuclease protein.
A Cpf1 nuclease-deficient RNA-guided DNA endonuclease protein can be linked at the N-terminal and C-terminal ends to a NLS polypeptide (e.g., NLS-dLbCpf1-NLS). A Cpf1 nuclease-deficient RNA-guided DNA endonuclease protein can comprise a NLS polypeptide operably linked to the N-terminal end of the Cpf1 protein, which is operably linked at the C-terminal end to a NLS polypeptide, which is operably linked at the C-terminal end to at least one VP64-p65AD (VP) activator (e.g., NLS-dLbCpf1-NLS-VP). The NLS polypeptides of the Cpf1 nuclease-deficient RNA-guided DNA endonuclease protein can be the same or different NLS polypeptides.
A Cpf1 nuclease-deficient RNA-guided DNA endonuclease protein can comprise the sequence of amino acids set forth in SEQ ID NO:573 or at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, or 98% sequence identity to the sequence set forth in SEQ ID NO:573. A Cpf1 nuclease-deficient RNA-guided DNA endonuclease protein can be operably linked to at least one VP64-p65AD (VP) activator domain, which can comprise the sequence of amino acids set forth in SEQ ID NO:574 or at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, or 98% sequence identity to the sequence set forth in SEQ ID NO:574. A polynucleotide encoding a Cpf1 nuclease-deficient RNA-guided DNA endonuclease protein operably linked to at least one VP64-p65AD (VP) activator domain can comprise the sequence of nucleic acids set forth in SEQ ID NO:662, or at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%,or 98% sequence identity to the sequence of nucleic acids set forth in SEQ ID NO:662.
Another polynucleotide can comprise a nucleotide sequence encoding a Cas9 nuclease-deficient RNA-guided DNA endonuclease protein operably linked to more than one repression domain. A Cas9 RNA-guided DNA endonuclease protein can be from, for example, Streptococcus pyogenes, Neisseria meningitides, Streptococcus thermophiles, or Staphylococcus aureus. A Cas9 nuclease-deficient RNA-guided DNA endonuclease protein can be operably linked to, for example, a RD1 (TUP1), RD2, RD3, RD4, RD5 (MIG1), RD6, RD7, RD8, RD9, RD10, or RD11 (UME6) repression domain, or combinations thereof.
A polynucleotide can comprise a nucleotide sequence encoding a dSpCas9 protein operably linked to the C-terminal end to a RD11 repression domain, wherein a RD5 repression domain is operably linked to the C-terminal end of the RD11 domain, wherein a RD2 repression domain is operably linked to the C-terminal end of the RD5 domain.
A repression domain can be operably linked to the N-terminal and/or C-terminal ends of a nuclease-deficient RNA-guided DNA endonuclease protein, or operably linked in tandem at the N-terminal and/or C-terminal ends of a nuclease-deficient RNA-guided DNA endonuclease protein.
A Cas9 RNA-guided DNA endonuclease protein can be linked at the N-terminal and C-terminal ends to a NLS polypeptide (e.g., NLS-dLbCpf1-NLS). A Cas9 RNA-guided DNA endonuclease protein can comprise a NLS polypeptide operably linked to the N-terminal end of the Cas9 protein, which is operably linked at the C-terminal end to a NLS polypeptide, which is operably linked at the C-terminal end via a linker to a RD11 polypeptide, which is linked at the C-terminal end via a linker to a RD5 polypeptide, which is linked at the C-terminal end via a linker to a RD2 polypeptide. The NLS polypeptides of the Cas9 RNA-guided DNA endonuclease protein can be the same or different NLS polypeptides.
A Cas9 nuclease-deficient RNA-guided DNA endonuclease protein can comprise the sequence of amino acids set forth in SEQ ID NO:575 or at least 95% sequence identity to the sequence set forth in SEQ ID NO:575. A polynucleotide comprising a nucleotide sequence encoding a Cas9 nuclease-deficient RNA-guided DNA endonuclease protein operably linked to more than one repression domain can comprise the sequence of amino acids set forth in SEQ ID NO:575 or at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, or 98% sequence identity to the sequence set forth in SEQ ID NO:575. A polynucleotide encoding a Cas9 nuclease-deficient RNA-guided DNA endonuclease protein operably linked to more than one repression domain can comprise the sequence of nucleic acids set forth in SEQ ID NO:743, or at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, or 98% sequence identity to the sequence of nucleic acids set forth in SEQ ID NO:743.
Methods of Altering Gene Expression Via CRISPR-AID
Methods of altering the expression of gene products are provided herein. The methods comprise introducing into a cell a system for targeted genome engineering as described herein; wherein the expression of at least one gene product (e.g., about 1, 2, 3, 4, 5, 10, or more) is increased, the expression of at least one gene product (e.g., about 1, 2, 3, 4, 5, 10, or more) is decreased, and the expression of at least one gene product (e.g., about 1, 2, 3, 4, 5, 10, or more) is deleted relative to a cell that has not been transformed or transfected with the system for targeted genome engineering.
The methods can further comprise selecting for successfully transformed or transfected cells by applying selective pressure (e.g., culturing cells in the presence of selective media).
One or more vectors of a system described herein can further comprise a polynucleotide encoding for a marker protein such as an antibiotic resistance protein or a florescence protein.
Transformation or transfection is the directed modification of the genome of a cell by introducing recombinant DNA from another cell of a different genotype, leading to its uptake and integration into the subject cell's genome. In bacteria, the recombinant DNA is not typically integrated into the bacterial chromosome, but instead replicates autonomously as a plasmid. A vector can be introduced into cells to thereby produce transcripts, proteins, or peptides, including fusion proteins or peptides, encoded by nucleic acids as described herein (e.g., clustered regularly interspersed short palindromic repeats (CRISPR) transcripts, proteins, enzymes, mutant forms thereof, fusion proteins thereof, etc.). It will be appreciated by those skilled in the art that the design of the expression vector can depend on such factors as the choice of the host cell to be transformed, the level of expression desired, etc.
Methods for transforming or transfecting a cell with an expression vector may differ depending upon the species of the desired cell. For example, yeast cells may be transformed by lithium acetate treatment (which may further include carrier DNA and PEG treatment) (the LiAc/SS carrier and DNA/PEG method) or electroporation. Mammalian cells can be transfected via liposome-mediated transfection, using non-liposomal transfection agents (e.g., polymers and lipids), or by electroporation. These methods are included for illustrative purposes and are in no way intended to be limiting or comprehensive. Routine experimentation through means well known in the art may be used to determine whether a particular expression vector or transformation method is suited for a given host cell. Furthermore, reagents and vectors suitable for many different host microorganisms are commercially available and/or well known in the art.
Any gene product pathway, combination of pathways, operon, group of related genes, or groups of unrelated genes can be targeted using systems described herein.
The method can occur in vivo or in vitro. The cell can be a eukaryotic cell or a prokaryotic cell. Eukaryotic cells include mammalian cells (e.g., mouse, human, dog, monkey), insect cells (e.g., bee, fruit fly) plant cells, algae cells, and fungal cells (e.g., yeast). The cell can be a yeast cell such as Saccharomyces cerevisiae.
The at least one gene product can be, for example, a protein involved in the mevalonate pathway, either directly or indirectly. Proteins involved in the mevalonate pathway include, but are not limited to, acetoacetyl-CoA thiolase, HMG-CoA synthase, HMG-CoA reductase (HMG-1), mevalonate-5-kinase, mevalonate-3-kinase, mevalonate-3-phosphate-5-kinase, phosphomevalonate kinase, mevalonate-5-pyrophosphate decarboxylase, and sopentenyl pyrophosphate isomerase, ERG9, ROX1, ARP6, SER33, YJL064w, and YPL062w.
A system for genome engineering can simultaneously cause an increase in expression of HMG1, a decrease in expression of ERG9, and the deletion of expression of ROX1. Simultaneously refers to occurring, operating, or done at or about the same time.
A system for genome engineering can, for example, causes increased production of an isoprenoid in a cell. Isoprenoid refers to the class of naturally occurring organic compounds derived from terpene. Examples of isoprenoids include, but are not limited to, carotene, phytol, retinol (vitamin A), tocopherol (vitamin E), dolichols, squalene, ginsenosides, and taxol. In some embodiments, the isoprenoid is β-carotene. In other embodiments, the production of β-carotene is increased by at least 1 fold, 1.5 fold, 2 fold, 2.5 fold, 3 fold, 3.5 fold, 4 fold, 4.5 fold, or 5 fold.
The systems for genome engineering described herein can increase expression of a surface protein on a cell. The expression of PDI1 can be increased, the expression of MNN9 can be decreased, and the expression of PMR1 can be deleted, all simultaneously. In other embodiments, EGII display levels and cellulase activity are increased. Any combination of genes can be targeted by the systems described herein.
Multi-Functional Genome-Wide CRISPR (MAGIC)
Also provided are methods of identifying the genetic basis of one or phenotypes of a host cell using the orthogonal CRISPR-AID system described above. A method of identifying the genetic basis of one or more phenotypes of cells, the method comprising: (i) preparing three genome-scale sgRNA expressing plasmid libraries from oligonucleotides wherein the first genome-scale sgRNA expressing plasmid library is for upregulating genes of the cells, wherein the second genome-scale sgRNA expressing plasmid library is for downregulating genes of the cells, and the third genome-scale sgRNA expressing plasmid library is for deleting genes of the cells; (ii) transforming the three genome-scale sgRNA expressing plasmid libraries into the cells; (iii) introducing into the cells (e.g., by transformation or transfection) a polynucleotide encoding a first nuclease-deficient RNA-guided DNA endonuclease protein that binds to the sgRNA of the first genome-scale sgRNA expressing plasmid library and causes transcriptional activation of genes of the cells, a polynucleotide encoding a second nuclease-deficient RNA-guided DNA endonuclease protein that binds to the sgRNA of the second genome-scale sgRNA expressing plasmid library and causes transcriptional repression of genes of a cell, and a polynucleotide encoding a catalytically active RNA-guided DNA endonuclease protein that binds to a the sgRNA of the third genome-scale sgRNA expressing plasmid library and causes double-stranded nucleic acid breaks and gene deletion of genes of the cells; (iv) isolating transformed cells with one or more phenotypes; and (v) determining the genomic loci of the DNA molecule that causes the one or more phenotypes.
The MAGIC system can comprise more than one sgRNA capable of directing nuclease-deficient RNA-guided DNA endonuclease mediated transcriptional activation of target DNA, more than one sgRNA capable of directing nuclease-deficient RNA-guided DNA endonuclease mediated transcriptional interference of target DNA, and more than one capable of sgRNA capable of directing catalytically active RNA-guided DNA endonuclease mediated gene deletion of target DNA.
A library of sgRNA is a plurality of sgRNAs that are capable of targeting a plurality of genomic loci in a population of cells.
A genome-scale sgRNA expressing plasmid library is a library of sgRNA that can perturb all the genes in a cell at once. For example, a genome-scale sgRNA expressing plasmid library in Saccharomyces cerevisiae can perturb the more than 6000 genes in the yeast genome. A method of identifying the genetic basis of one or more phenotypes of cells can also be performed with a sgRNA expressing plasmid library that is less than genome-scale, for example, 100 genes, 200 genes, 300 genes, 400 genes, 500 genes, 1000 genes, or more.
The first, second, and third genome-scale sgRNA expressing plasmid libraries used in the method of identifying the genetic basis of one or more phenotypes of cells can each target the same genes, either on a genome-scale or less than genome-scale.
Additionally, the first, second, and third sgRNA expressing plasmid libraries can be transformed or transfected into the cell all at once or separately.
Genome-scale sgRNA expressing plasmid libraries can be prepared, for example, by the methods described below in Example 6. In particular, a genome-scale sgRNA expressing plasmid library can be prepared by extracting ORF and RNA coding sequences and their promoter sequences from a genome database of interest (e.g., the Saccharomyces genome database; yeastgenome.org). The promoter sequences, entire sequences, and coding sequences can be used for the design of activation, interference, and deletion guide sequences, respectively. The desired region sequences can be given to the CHOPCHOP program to generate all possible guide sequences. All the generated guide sequences can be ranked according to the binding efficiency, off-target effects, binding position, and the DNA synthesis and cloning considerations. For each gene, the top 3, top 4, top 5, top 6, top 7, top 8, top 9, or top 10 sequences with the highest scores can be selected for transcription activation, transcription repression, and gene deletion or knock-out libraries, respectively.
Adapters containing priming sequences and a restriction enzyme site (e.g., BsaI sites) can be added (by ligation or PCR) to both ends of each oligonucleotide for PCR amplification and Golden Gate assembly. An adapter is a short, chemically synthesized, single-stranded or double-stranded oligonucleotide that can be ligated to the ends of other DNA or RNA molecules and used for library preparation with Next Generation Sequencing (NGS) platforms. Adapters can include platform-specific sequences for fragment recognition by particular sequencer platforms. Adapters can also contain single or dual sample indexes depending on the number of libraries combined for sequencing together and the level of accuracy needed. Sample indexes can permit multiple samples to be sequenced together on the same instrument.
The unique priming sequences allow the construction of each library independently. Next, plasmids (e.g., bacterial plasmids) can be constructed containing the optimal activation, interference, and deletion guide sequences. Each of the plasmid libraries can then be transformed using standard high-efficiency transformation methods (e.g., the LiAc/SS carrier DNA/PEG method) into cells (e.g., yeast cells, mammalian cells, and insect cells) and optionally grown under selective pressure.
Genomic loci associated with certain phenotypes (e.g., yeast surface display of recombinant proteins) can be identified by undergoing multiple rounds of MAGIC screening and confirming that certain genomic loci are associated with certain phenotypes using diagnostic PCR and qPCR. The methods described in Example 7 and Example 8 can be used to determine the genomic loci of the DNA molecule that causes the phenotype. NGS can be used to conduct genotype-phenotype mapping and identify the genetic determinants (genotypes) of complex phenotypes (e.g., furfural tolerance and yeast surface display of recombinant proteins, intracellular accumulation of S-adenosyl-S-methionine, and glucose repression).
Genomic loci refer to a fixed position on a chromosome, like the position of a gene or a marker.
The term “cell” includes progeny thereof. It is also understood that all progeny may not be precisely identical, such as in DNA content, due to deliberate or inadvertent mutation. Variant progeny that have the same function or biological property of interest, as screened for in the original cell, are included.
A phenotype can be any phenotype, for example, furfural tolerance or yeast surface display of recombinant proteins. A phenotype is any observable characteristic or functional effect that can be measured in an assay such as changes in cell growth, proliferation, morphology, increase in protein expression, decrease in protein expression, lack of protein expression, enzyme function, signal transduction, expression patterns, downstream expression patterns, reporter gene activation, hormone release, growth factor release, neurotransmitter release, ligand binding, apoptosis, and product formation. Such assays include, but are not limited to, transformation assays, changes in proliferation, anchorage dependence, growth factor dependence, foci formation, growth in soft agar, tumor proliferation in nude mice, and tumor vascularization in nude mice; apoptosis assays, e.g., DNA laddering and cell death, expression of genes involved in apoptosis; signal transduction assays, e.g., changes in intracellular calcium, cAMP, cGMP, IP3, changes in hormone and neurotransmitter release; receptor assays, e.g., estrogen receptor and cell growth; growth factor assays, e.g., EPO, hypoxia and erythrocyte colony forming units assays; enzyme product assays, e.g., FAD-2 induced oil desaturation; transcription assays, e.g., reporter gene assays; and protein production assays, e.g., VEGF ELISAs. A candidate gene is “associated with” a selected phenotype if modulation of gene expression (e.g., increase in gene expression, decrease in gene expression, or knock out of gene expression) of the candidate gene causes a change in the selected phenotype.
As used herein, the term subject refers to any animal classified as a mammal, including humans, mice, rats, domestic and farm animals, non-human primates, and zoo, sport or pet animals, such as dogs, horses, cats, and cows.
The practice of the present systems and methods employs, unless otherwise indicated, conventional techniques of immunology, biochemistry, chemistry, molecular biology, microbiology, cell biology, genomics and recombinant DNA, which are within the skill of the art. See Sambrook, Fritsch and Maniatis, MOLECULAR CLONING: A LABORATORY MANUAL, 2nd edition (1989); CURRENT PROTOCOLS IN MOLECULAR BIOLOGY (F. M. Ausubel, et al. eds., (1987)); the series METHODS IN ENZYMOLOGY (Academic Press, Inc.): PCR 2: A PRACTICAL APPROACH (M. J. MacPherson, B. D. Hames and G. R. Taylor eds. (1995)), Harlow and Lane, eds. (1988) ANTIBODIES, A LABORATORY MANUAL, and ANIMAL CELL CULTURE (R. I. Freshney, ed. (1987)).
The terminology used herein is for the purpose of exemplifying particular embodiments only and is not intended to limit the scope of the methods and compositions as disclosed herein. Any method and material similar or equivalent to those described herein can be used in the practice of the methods and compositions as disclosed herein and only exemplary methods, devices, and materials are described herein.
The methods and compositions now will be exemplified for the benefit of the artisan by the following non-limiting examples that depict some of the embodiments by and in which the methods and compositions can be practiced.
To construct optimal cell factories using combinatorial metabolic engineering, a synthetic biology toolkit that enables different modes of genetic manipulation of multiple targets in the metabolic and regulatory network, including increased expression, decreased expression, and zero expression, in a modular, parallel and high throughput manner was needed (
To enable fast evaluation of orthogonal genome editing and transcriptional regulation, a reporter yeast strain was constructed: mCherry driven by a medium-strength promoter CYC1p for CRISPRa, mVenus driven by a strong promoter TEF1p for CRISPRi, and ADE2, an endogenous gene whose disruption would result in the formation of red colonies in adenine deficient synthetic medium, for CRISPRd.
Strains and Cultivation Conditions.
E. coli strain DH5a was used to maintain and amplify plasmids and recombinant strains were cultured at 37° C. in Luria broth medium containing 100 μg mL−1 ampicillin. S. cerevisiae CEN.PK2-1C strain (EUROSCARF, Frankfurt, Germany) was used as the host for homologous recombination based cloning, recombinant protein expression and surface display, and β-carotene production. Yeast strains were cultivated in complex medium consisting of 2% peptone and 1% yeast extract supplemented with 2% glucose (YPD). Recombinant strains were grown on synthetic complete medium consisting of 0.17% yeast nitrogen base, 0.5% ammonium sulfate, and the appropriate amino acid drop out mix, supplemented with 2% glucose (SCD). When necessary, 200 μg mL−1 G418 (KSE Scientific, Durham, N.C.) was supplemented to the growth media. Ammonium sulfate was replaced with 0.1% mono-sodium glutamate (SED), when G418 was used in synthetic medium. All restriction enzymes, Q5 polymerase, and the E. coli-S. cerevisiae shuttle vectors were purchased from New England Biolabs (Ipswich, Mass.). All chemicals were purchased from Sigma-Aldrich (St. Louis, Mo.) unless otherwise specified.
Plasmid and Strain Construction.
Recombinant plasmids were constructed using restriction digestion/ligation, Gibson Assembly, Golden-Gate Assembly, or the yeast homologous recombination based DNA assembler method (Shao, Z., et al., Nucleic Acids Res. 37:e16 (2009)). All the recombinant plasmids and gRNA plasmids used in this study were listed in Table 1 and Table 2, respectively.
Synth. Biol. 4: 332-341
Synth. Biol. 5: 689-697
Synth. Biol. 4: 332-341
Synth. Biol. 5: 689-697
Synth. Biol. 4: 332-341
Synth. Biol. 5: 689-697
Synth. Biol. 4: 332-341
Synth. Biol. 5: 689-697
Synth. Biol. 4: 332-341
Synth. Biol. 5: 689-697
Nucleic Acids Res.
Synth. Biol. (2017)
Synth. Biol. (2017)
Methods 12: 326-328
Methods 12: 1051-1054
Synth. Biol. 4: 585-594
Synth. Biol. 4: 585-594
Acad. Sci. U.S.A.
Microbiol.
Microbiol.
Oligonucleotides used for gene amplification, pathway assembly, diagnostic PCR verification, and qPCR analysis were listed in Table 3.
ggagacctcggtctccgatcatttatctacactgc
Oligonucleotides and gBLOCKs (IDT, Coralville, Iowa, USA) used for gRNA construction were listed in Table 4 and Table 5, respectively. Yeast plasmids were isolated using a Zymoprep Yeast Plasmid Miniprep II Kit (Zymo Research, Irvine, Calif.) and amplified in E. coli for verification by both restriction digestion and DNA sequencing.
gatatcaagaggattggaaa
acaacttcgccttaagttgaa
gttcactgcgtataggcagAATTTCTACTAAGTGTAGAT
gcgagcgttggttggtggatcaa
gttcactgccgtataggcaggaccaggatgggcaccacccGTTTTAGAG
gttcactggtataggcagtccacaaggacaatatttgtgacttatgttatgcgcctg
actaccacaggatcttaatag
atctctcagaaatcggtacaa
ttgaaggtatcggtttaggcg
tatgcatttggaacttgaacg
atacgtaataccctatcctgg
The gRNA targeting sequences were underlined, the gRNA scaffold sequences were shown in uppercase, and the Cys4 sites were dotted underlined.
Yeast strains were transformed using the LiAc/SS carrier DNA/PEG method, and transformants were selected on the appropriate agar plates. Recombinant yeast strains constructed in this study were listed in Table 6.
The reporter plasmid p406-CT was constructed by cloning each expression element including CYC1p, mCherry, TEF1t, TEF1p, mVenus, and PGK1t into pRS406 using Gibson Assembly. Other reporter plasmids were constructed by replacing TEF1p in p406-CT with FBA1p (strong promoter, p406-CF), HHF2p (strong promoter, p406-CH), REV1p (weak promoter, p406-CR1), and RNR2p (medium-strength promoter, p406-CR2), respectively. The reporter yeast strains were constructed by integrating EcoRV linearized reporter plasmids into the ura3 locus of the CEN.PK2-1C genome.
For the construction of individual gRNA expression plasmids, several helper plasmids (pSgH2, pSpSgH, pNmSgH, pSt1SgH, pSaSgH, pSpMS2SgH, pSpPP7SgH, and pSpComSgH) containing SNR52p, two BsaI sites, gRNA scaffold sequences, and SUP4t were constructed first based on a modified, BsaI-free pRS423 vector (Bao, Z., et al., ACS Synth. Biol. 4:585-594 (2015)). Then the targeting sequences were synthesized as short oligos, which were annealed and phosphorylated and cloned into the corresponding BsaI digested helper plasmids. To construct multiple gRNAs expression plasmids, the individual gRNA expression cassettes were pieced together using Golden-Gate Assembly (design II), or the gRNA arrays were synthesized as gBLOCKs and cloned into pRS423-H5 (design III) using restriction digestion/ligation.
CRISPR protein expression plasmids were constructed by cloning the PCR amplified fragments into pH1, pH3, pH4, pH5, and pH6 (Lian, J. & Zhao, H., ACS Synth. Biol. 4:332-341 (2015); Lian, J. & Zhao, H., ACS Synth. Biol. 5:689-697 (2016)) using BamHI/XhoI or NcoI/XhoI digestion and ligation. To clone additional NLS into the N-terminus of some CRISPR proteins, adapter (BamHI-NLS-BamHI or NcoI-NLS-NcoI) was inserted into the BamHI or NcoI site. The nuclease-deficient LbCpf1 (E832A) was created by overlap extension PCR and cloned into the NcoI/HindIII site of pTDH3-dSpCas9-MXI1 to construct pTDH3-dLbCpf1-MXI1. MXI1 fragment of pTDH3-dSpCas9-MXI1 and pTDH3-dLbCpf1-MXI1 was replaced by HindIII/XhoI digestion to construct dSpCas9 with different repression domains and dLbCpf1 with various activation domains, respectively. pAID6 was constructed by cloning each CRISPR-AID module (dLbCpf1-VP, Csy4, dSpCas9-RD1152, and SaCas9) into pRS41K-CEN-Delta using DNA Assembler. CEN-iAID6 was constructed by integrating PmeI digested pAID6 into the delta site and selection for G418 resistance. The successful integration of AID6 cassettes was verified by both diagnostic PCR and CRISPR functional assays.
The β-carotene producing strain (CEN-Crt) and Trichoderma reesei endoglucanase II (EGII)-displaying strain (CEN-EGII) were constructed by integrating StuI linearized YIplac211-YB/E/I (Verwaal, R., et al., Appl. Environ. Microbiol. 73:4342-4350 (2007)) and p406-YD-EGII (TEF1p-prepro-HisTag-EGII-AGA1-PGK1t) (Si, T., et al., Nat. Commun. 8:15187 (2017)), respectively, into the ura3 locus of CEN-iAID6 genome and selection on SED-URA/G418.
Fluorescence Intensity Measurement.
Recombinant yeast strains were pre-cultured in the corresponding selective medium for 2 days and then inoculated into the fresh synthetic media with an initial OD of 0.1. Mid-log phase yeast cells were diluted 5-fold in ddH2O and mVenus and mCherry fluorescence signals were measured at 514 nm-528 nm and 587 nm-610 nm, respectively, using a Tecan Infinite M1000 PRO multimode reader (Tecan Trading AG, Switzerland). The fluorescence intensity (relative fluorescence units; RFU) was normalized to cell density that was determined by measuring the absorbance at 600 nm using the same microplate reader.
gRNA design.
gRNA for gene deletion (CRISPRd) was designed using Benchling CRISPR tool (benchling.com), and those with both high on-targeting score and off-targeting score were selected. For CRISPRa and CRISPRi, the gRNA binding position was equally important as the sequence itself. Based on previous studies (Gilbert, L. A., et al., Cell 159:647-661 (2014); Konermann, S., et al., Nature 517:583-588 (2015); Smith, J. D., et al., Genome Biol. 17:45 (2016)) and our empirical experience, ˜250 bp upstream of the coding sequences or ˜200 bp upstream of the transcription starting site (TSS) worked the best for CRISPRa; ˜100-150 bp upstream of the coding sequences or 50-100 bp upstream of TSS worked the best for CRISPRi by blocking transcriptional initiation and those targeting the non-template strand of the coding sequences worked the best for CRISPRi by blocking transcriptional elongation. Since on-targeting score and off-targeting score were not available for Cpf1, the following criteria were considered: GC contents between 35% and 65%, no polyT, no secondary structure, and minimal off-target effect (less than 12 bp match by BLAST to the yeast genome).
Quantitative PCR Analysis.
Mid-log phase yeast cells were collected and used to determine the relative expression levels via qPCR. Total RNAs were isolated using the RNeasy Mini Kit (QIAGEN, Valencia, Calif., USA) following the manufacturer's instructions. 1 μg of the RNA samples were then reversed transcribed into cDNA using the Transcriptor First Strand cDNA Synthesis Kit using oligo-dT primer (Roche, Indianapolis, Ind., USA). The qPCR experiments were carried out using SYBR Green-based method in the QuantStudio 7 Flex Real-Time PCR System (ThermoFisher Scientific).
Results
A CRISPR protein (SpCas9) has been well characterized for genome engineering in yeast (Zalatan, J. G., et al., Cell 160:339-350 (2015); Jakociunas, T., et al., Metab. Eng. 34:44-59 (2016); DiCarlo, J. E., et al., Nucleic Acids Res. 41:4336-4343 (2013); Bao, Z., et al., ACS Synth. Biol. 4:585-594 (2015); Lian, J., et al., Biotechnol. Bioeng. 113:2462-2473 (2016); Liu, Z., et al., ACS Synth. Biol. (2017); Gilbert, L. A., et al., Cell 154:442-451 (2013)), a number of CRISPR protein orthologs were characterized. dSpCas9-VPR (Chavez, A., et al., Nat. Methods 12:326-328 (2015)), dSpCas9-MXI1 (Gilbert, L. A., et al., Cell 154:442-451 (2013)), and SpCas9 (DiCarlo, J. E., et al., Nucleic Acids Res. 41:4336-4343 (2013); Bao, Z., et al., ACS Synth. Biol. 4:585-594 (2015)) were included as the positive controls for the optimization of CRISPR-AID modules. Strain CT was constructed by integrating CYC1p-mCherry-TEF1t and TEF1p-mVenus-PGK1t into the ura3 locus of the CEN.PK2 genome (
Those functional CRISPR proteins were further optimized for transcriptional regulation by engineering the optimal effector domains. To develop the orthogonal tri-functional CRISPR system, at least three functional CRISPR proteins are needed. Thus, a few CRISPR protein orthologs in S. cerevisiae were characterized. Several CRISPR proteins (Table 7) including Cas9 from Streptococcus pyogenes (SpCas9) (Cong, L., et al., Science 339:819-823 (2013); Mali, P., et al., Science 339:823-826 (2013); Bao, Z., et al., ACS Synth. Biol. 4:585-594 (2015)), Neisseria meningitides (NmCas9) (Hou, Z., et al., Proc. Natl. Acad. Sci. U.S.A 110:15644-15649 (2013); Esvelt, K. M., et al., Nat. Methods 10:1116-1121 (2013)), Streptococcus thermophiles (St1Cas9) (Esvelt, K. M., et al., Nat. Methods 10:1116-1121 (2013); Kleinstiver, B. P., et al., Nature 523:481-485 (2015)), and Staphylococcus aureus (SaCas9) (Kleinstiver, B. P., et al., Nature 523:481-485 (2015); Ran, F. A., et al., Nature 520:186-191 (2015)) and Cpf1 (Zetsche, B., et al., Cell 163:759-771 (2015)) from Lachnospiraceae bacterium ND2006 (LbCpf1) and Acidaminococcus sp. BV3L6 (AsCpf1) have been characterized and found to be functional in mammalian cells.
The gRNA structure sequences as well as the PAM sequences are different, both of which endow the activity of these CRISPR proteins to be orthogonal.
Therefore, the nuclease activities of these CRISPR proteins in yeast were characterized using ADE2 deletion as a reporter. Interestingly, although a single nuclear localization sequence (NLS) tag at the C-terminus was sufficient to target the CRISPR proteins to the nucleus of mammalian cells (Esvelt, K. M., et al., Nat. Methods 10:1116-1121 (2013); Kleinstiver, B. P., et al., Nature 523:481-485 (2015); Zetsche, B., et al., Cell 163:759-771 (2015)), it was found that dual-NLSs at both termini were required for nuclease activity of St1Cas9 and LbCpf1 in yeast (Table 8).
Nuclease activity was evaluated by co-transforming 500 ng CRISPR protein plasmid, 500 ng gRNA plasmids, and 500 ng linear DNA donor for the deletion of whole ADE2 coding sequences. The results represented an average of biological triplicates.
Nuclease activity for NmCas9 and AsCpf1 was not detectable under any conditions, probably due to different protein folding environments between yeast and mammalian cells. More than three CRISPR proteins (e.g., SpCas9, St1Cas9, SaCas9, LbCpf1) were found to be functional and orthogonal to each other, i.e. functional only when bound to their own cognate gRNAs (e.g., Sg10, Sg64, Sg95, and Sg122, respectively). In all cases, 500 ng linear donor DNA that resulted in the deletion of the whole ADE2 coding sequences was co-transformed as well. The CRISPR proteins were only functional when their cognate gRNAs were present. 1-2 red colonies might be found on selective agar plates, but not in a reproducible manner, due to the spontaneous homologous recombination between the genome and the linear donor. (
To enable multiplex genome engineering, the previously developed HI-CRISPR design was followed (Bao, Z., et al., ACS Synth. Biol. 4:585-594 (2015)), where the homology donor sequences were integrated into the gRNA expression cassette. It was found that the stable maintenance of the homology donor resulted in a further increase in CRISPRd efficiency: from 80% with Sg10 (Table 8) to ˜98% with Sg11 (
Next, the combination of the CRISPR proteins and the activation domains to achieve maximal CRISPRa was optimized. By testing all possible combinations (
In previous studies, only one repression domain from mammalian cells (MXI1) has been reported and used for CRISPRi in yeast (Gilbert, L. A., et al., Cell 154:442-451 (2013)). Thus, the endogenous repression domain should work better to achieve maximal CRISPRi (
Well-characterized repression domains were chosen. TUP1 (Edmondson, D. G., et al., Genes Dev. 10:1247-1259 (1996)); MIG1 (Ostling, J., et al., Mol. Cell. Biol. 16:753-761 (1996)); CRT1 (Zhang, Z. & Reese, J. C., Mol. Cell. Biol. 25:7399-7411 (2005)); XTC1 (Traven, A., et al., Nucleic Acids Res. 30:2358-2364 (2002)); UME6 (Kadosh, D. & Struhl, K., Cell 89:365-371 (1997)). The repression domain can be small while demonstrating strong transcriptional repression.
Among several repression domains, RD2, RD5, and RD11 worked the best when fused at the C-terminus of dSpCas9 for CRISPRi (
After optimization of the individual modules, all three CRISPR modules were assembled together and integrated them into the yeast genome for stable maintenance. In addition, an endoribonuclease (Csy4) module was included for multiplex processing of gRNAs. In this case, several gRNAs can be transcribed in a single expression cassette, if the Csy4 recognition sites are introduced between neighboring gRNA sequences. Firstly, an array of 3 gRNAs were cloned downstream of SNR52p (design I), a type III promoter commonly used for gRNA expression in yeast. Unfortunately, only the first two gRNAs were found to be functional (
Using the optimized CRISPR-AID system, 5-fold activation of a red fluorescent protein, 5-fold interference of a yellow fluorescent protein, and >95% deletion of an endogenous gene can be achieved simultaneously by transforming a single plasmid into yeast. This strategy enables perturbation of the metabolic and regulatory networks in a modular, parallel, and high throughput manner.
After the proof-of-concept study, to confirm that CRISPR-AID can be stably maintained and used for metabolic engineering applications, CRISPR-AID was tested with a well-known phenotype, the production of β-carotene in yeast.
β-Carotene Production and Quantification.
β-Carotene producing strains with gRNAs were pre-cultured in SED-HIS-URA/G418 medium for approximately 2 days, inoculated into 5 mL fresh medium with an initial OD600 of 0.1 in 14 mL culture tubes, and cultured under aerobic conditions (30° C., 250 rpm) for 5 days. The stationery phase yeast cells were collected by centrifuge at 13,000×g for 1 min and cell precipitates were resuspended in 1 mL of 3N HCl, boiled for 5 min, and then cooled in an ice-bath for 5 min. The lysed cells were washed with ddH2O and resuspended in 400 μL acetone to extract β-carotene. The cell debris was removed by centrifuge and the β-carotene containing supernatant was analyzed for its absorbance at 454 nm. The production of β-carotene was normalized to the cell density.
In previous studies, it has been found that overexpression of HMG1 (Xie, W., et al., Metab. Eng. 28:8-18 (2015); Verwaal, R., et al., Appl. Environ. Microbiol. 73:4342-4350 (2007)), encoding a rate-limiting enzyme of the mevalonate pathway, down-regulation of ERG9 (Xie, W., et al., Metab. Eng. 28:8-18 (2015)), an essential gene at the branching point of the (3-carotene biosynthesis and endogenous sterol biosynthesis, and the deletion of ROX1 (Ozaydin, B., et al., Metab. Eng. 15:174-183 (2013)), encoding a stress responsive transcriptional regulator, could significantly increase the production of β-carotene. Therefore, these three targets were selected for CRISPRa, CRISPRi, and CRISPRd, respectively (
Thus, the application of CRISPR-AID was used for rational metabolic engineering with β-carotene production as a case study, and demonstrated a 3-fold increase in β-carotene production in a single step.
CRISPR-AID was also applied to combinatorial metabolic engineering.
Screening of EGII-Displaying Mutants and Cellulase Activity Assays.
After transforming the combinatorial gRNA library plasmids, the recombinant yeast strains (>105 independent clones with more than 100-fold redundancy) were cultured at 30° C. for 3 days and then subject to immunostaining and flow cytometry analysis (Si, T., et al., Nat. Commun. 8:15187 (2017)). The primary and secondary antibodies were monoclonal mouse anti-histidine tag antibody (1:100 dilution, Bio-Rad, Raleigh, N.C.) and goat anti-mouse IgG (H+L) secondary antibody, Biotin-XX conjugate (1:100 dilution, ThermoFisher Scientific, Rockford, Ill.), respectively. The levels of biotin on the yeast surface were quantified using Streptavidin, R-phycoerythrin conjugate (1:100 dilution, ThermoFisher Scientific). The phycoerythrin (PE) fluorescence was analyzed with a LSR II Flow Cytometer (BD Biosciences, San Jose, Calif.). FACS experiments were performed on a BD FACS Aria III cell sorting system (BD Biosciences, San Jose, Calif.). In the first round of sorting, around 30,000 cells representing the top 1% highest fluorescence were collected. The second round of sorting collected 96 individual yeast cells with the highest fluorescence into a 96-well microplate. Then the plasmids were extracted and retransformed into the CEN-EGII strain with a fresh background, 26 of the retransformed yeast mutants conferred the highest PE fluorescence were further analyzed by the cellulase activity assay. Briefly, 400 μL yeast cells from overnight culture were washed twice with ddH2O and resuspend in the same volume of 1% (w v−1) carboxymethyl cellulose (CMC) solution (0.1 M sodium acetate, pH 5). After incubation at 30° C. for 16 h with vigorous shaking, the supernatant was analyzed using a modified DNS method (Gonçalves, C., et al., Anal. Methods 2:2046-2048 (2010)) to quantify the amount of the reducing sugars, which was normalized to the cell density to represent the EGII enzyme activity.
The recombinant protein expression via yeast surface display phenotype was selected because the entire biological process is very important but rather complicated: proteins are translated in the cytosol, folded in the ER, glycosylated in the Golgi, and sorted and secreted to different compartments, and finally attached to the yeast cell surface (
The empty vector without gRNA sequences was also included in the library, and a library covered all the possible combinations (15*18*6=1620) was created.
A library consisting of all the possible combinations (15*18*6=1620) was generated. Genotyping of several randomly picked colonies indicated that all plasmids were assembled correctly and the library was representative (Table 11).
Since the proteins are expressed on the yeast surface, an antibody was used conjugated with a fluorescent dye to detect the epitope tag and convert protein expression levels to fluorescence signals (
Therefore, the combination of PDI1 up-regulation, MNN9 down-regulation, and PMR1 deletion increased EGII display levels and cellulase activity the most (
The top clones were obtained by FACS sorting of the combinatorial library and cellulase activity assay verification.
Interestingly, none of the components (PDI1 activation, MNN9 interference, and PMR1 deletion) of the best combination increased EGII display level the most in each category when tested individually, indicating possible synergistic interactions among these genomic modifications. To figure out the potential synergistic interactions, all the double mutants were constructed, including AI (PDI1 activation and MNN9 interference), AD (PDI1 activation and PMR1 deletion), and ID (MNN9 interference and PMR1 deletion), and measured their cellulase activities. As shown in
Thus, CRISPR-AID was also demonstrated for combinatorial optimization of the metabolic engineering targets to enhance the expression and display of a recombinant protein on the yeast surface by 2.5-fold as well as exploring the synergistic interactions among these genomic modifications.
As mentioned above, although the CRISPR based genome engineering technology has grown exponentially in recent years, most of the current studies mainly focus on a mono-function CRISPR in a specific biological system.
The initial design of a tri-functional CRISPR system was to combine two strategies: truncated gRNA with the MS2 aptamer to recruit MS2-VP64 for transcriptional activation, truncated gRNA with the Com aptamer to recruit Com-MXI1 for transcriptional interference, and full-length gRNA for gene deletion. gRNAs with different length of targeting sequences were tested in catalytically active SpCas9 containing yeast strain. If the targeting sequences were longer than 16nt, no survival clones could be obtained, due to the introduction of a double strand break in the genome by the catalytically active Cas9. When the targeting sequences were between 16 and 12nt, efficient transcriptional regulation (CRISPRi in this case) could be achieved. If the targeting sequences were shorted than 12nt, CRISPRi efficiency was dramatically decreased.
Thus, compared with that of the full-length gRNA, we found that truncated gRNAs (12-16 nt targeting sequences) resulted in comparable CRISPRi (
In addition, the use of truncated gRNA together with modular RNA scaffold engineering (SpCas9+Sg45+MS2-VP64) worked equally well as one of the optimal CRISPRa designs (dSpCas9-VPR+Sg33 or Sg6). Unfortunately, CRISPRi efficiency was dramatically decreased when an aptamer was added to the gRNA scaffold, which might result from lower binding affinity between Cas9 and the engineered gRNA. The change of repression domains and the use of another aptamer-RNA binding domain pair did not significantly improve CRISPRi efficiency either (
CRISPR-AID was utilized for genome-scale engineering, with potential applications in both metabolic engineering and fundamental studies. Although yeast is one of the most well studied microorganisms, the whole metabolic and regulatory networks are still not clearly understood. In previous metabolic engineering efforts, it was often found that some unknown or unrelated targets resulted in the highest increase in the desired phenotype (Caspeta, L., et al., Science 346:75-78 (2014); Kim, S. R., et al., PLoS One 8:e57048 (2013)). Therefore, genome-scale metabolic engineering is needed to cover all the possible important targets. In the genome-scale CRISPR-AID system, a comprehensive library can be created that can control the expression of any single gene in the yeast genome to different levels (increased expression, decreased expression, and zero expression). Followed by high throughput screening and next generation sequencing, multiple hits that increase the desired phenotype can be obtained, and the process can be repeated iteratively until the construction of optimal microbial cell factories (see Example 6).
In summary, a tri-functional CRISPR-AID system was developed by combining transcriptional activation, transcriptional interference, and gene deletion in a single system, and applied CRISPR-AID for rational and combinatorial metabolic engineering. We also explored synergistic interactions among different genome modifications.
As described above, a tri-functional CRISPR system (CRISPR-AID) was constructed, where three orthogonal CRISPR proteins were integrated to achieve gene activation, interference, and deletion simultaneously (Lian, J., et al., Nat. Commun. 8:1688, (2017)). To further develop a multi-functional genome-wide CRISPR (MAGIC) system, three genome-scale gRNA expressing plasmid libraries from pools of array-synthesized oligos were designed and constructed, each for upregulating, downregulating, and deleting all the genes in the yeast genome, respectively (
Strains, Media, and Cultivation Conditions.
Escherichia coli strain NEB10β (New England Biolabs, Ipswich, Mass.) was used to maintain and amplify plasmids and recombinant strains were cultured at 37° C. in Luria broth medium containing 100 μg/mL ampicillin. S. cerevisiae BY4742 was used as the host for genome-scale engineering of furfural tolerance and surface display of recombinant proteins. Yeast strains were cultivated in complex medium consisting of 2% peptone, 1% yeast extract, and 2% glucose (YPD) or synthetic complete medium consisting of 0.17% yeast nitrogen base, 0.1% mono-sodium glutamate, 0.077% CSM-URA, and 2% glucose (SED-URA) at 30° C., 250 rpm. When necessary, 200 μg/mL G418 (KSE Scientific, Durham, N.C.) was supplemented.
Plasmid and Strain Construction.
SNR52p-BsaI-BsaI-gRNA structural sequences-SUP4t (Lian, J., et al., Nat. Commun. 8:1688, (2017)) were cloned into BsaI-free pRS426 to construct gRNA expression plasmids, including p426*-LbSgH for CRISPRa, p426*-SpSgH for CRISPRi, and p426*-SaSgH for CRISPRd. Then the targeting sequences were synthesized as short oligos and cloned into the BsaI sites of the helper plasmids. Yeast plasmids were isolated using a Zymoprep Yeast Plasmid Miniprep II Kit (Zymo Research, Irvine, Calif.) and amplified in E. coli. All the recombinant plasmids and oligonucleotides used in this study were listed in Table 13 and Table 14, respectively.
For plasmids pAID6, p426*-LbSgH, p426*-SpSgH p426*-SaSgH, see Lian, J., et al., 2017, Nat. Commun. 8:1688.
The CRISPR-AID strain (bAID) was constructed by integrating PmeI digested pAID6 (Lian, J., et al., Nat. Commun. 8:1688, (2017)) into the genome of BY4742 and selection for G418 resistance. The Trichoderma reesei endoglucanase II (EGII)-displaying strain (bAID-EG) was constructed by integrating the TEF1p-prepro-HisTag-EGII-AGA1-PGK1t cassette (Lian, J., et al., Nat. Commun. 8:1688, (2017); Si, T. et al., Nat. Commun. 8:15187, (2017)) into the X4 locus of bAID. The gRNA expression cassettes identified by MAGIC screening were integrated into the predefined loci (Table 15) in a CRISPR-assisted and marker-less manner.
X3
7/8
8/8
15/16
4
pSg335
X4
0
pSg336
XI1
8/8
8/8
16/16
30
pSg337
XI3
8/8
8/8
16/16
1
pSg339
XII2
7/8
8/8
15/16
20
pSg341
XII4
6/8
7/8
13/16
20
pSg342
XII5
8/8
8/8
16/16
1
pSg343
The gRNA targeting efficiency was tested by transforming the gRNA plasmid without any donor to repair the double strand break, and efficient gRNA should result in no survived colonies. The integration efficiency and gRNA expression level were evaluated by co-transforming the reporter strain (bAID-RV) with gRNA plasmid as well as its corresponding linear donor fragment, which contained a gRNA expression cassette to activate the expression of mCherry or to repress the expression of mVenus. Eight colonies were randomly picked up to measure the change in fluorescence intensities. The corresponding results were shown in Example 10 below. The loci and the corresponding gRNAs chosen for CRISPR-assisted and marker-less genome integration are shown in bold in Table 15.
Recombinant yeast strains constructed in this study are listed in Table 16.
Design and Synthesis of the MAGIC Library.
To create a MAGIC library, first all possible guide sequences targeting all ORFs and RNA genes (rRNAs, tRNAs, snRNAs, snoRNAs, and ncRNAs) were obtained and ranked using previously described criteria and empirical experiences (Bao, Z., et al., Nat. Biotechnol. 36:505-508, (2018); Lian, J., et al., Nat. Commun. 8:1688, (2017)) (Table 17). All ORF and RNA coding sequences and their promoter sequences were extracted from the Saccharomyces genome database (yeastgenome.org). The promoter sequences, entire sequences, and coding sequences were used for the design of activation, interference, and deletion guide sequences, respectively. The desired region sequences were given to the CHOPCHOP program to generate all possible guide sequences (Labun, K., et al., Nucleic Acids Res. 44:W272-276, (2016); Montague, T. G., et al., Nucleic Acids Res. 42:W401-407, (2014)).
Different from CRISPRd, the gRNA binding sites relative to the transcriptional starting sites can be equally important as the guide sequences for CRISPRa and CRISPRi (Gilbert, L. A., et al., Cell 159:647-661, (2014); Lian, J., et al.., Nat. Commun. 8:1688, (2017)). Therefore, the following criteria were included to rank the guide sequences, targeting efficiency, targeting positions, GC contents, and off-target effects. The guide sequences containing polyT, polyG, and BsaI sites were excluded. In addition, to make the genome-scale libraries more diversified, only the top ranked guides were kept if multiple guide sequences were clustered together. The ranking criteria were validated using the previously designed gRNAs (Lian, J., et al., Nat. Commun. 8:1688, (2017)) with high efficiency. The ranking criteria are detailed in Table 17 and validated by the previously designed gRNAs showing high efficiency (Table 18).
1Efficiency score is from COPCHOP (Labun, K., Montague, et al., E. Nucleic Acids Res. 44: W272-276, (2016)), and the computational program for the efficiency score of Cpf1 was not available when the library sequences were designed. Therefore, the highest scores for the activation, interference, and deletion gRNA libraries are 3, 4, and 4, respectively.
2X represents the gRNA binding site, with X = 0 presenting the start codon (ATG). Based on previous experience, CRIAPRa is the most active when binding to ~200 bp upstream of the transcription starting site (TSS) or ~250 bp upstream of the start codon); the efficiency of CRISPRi is the highest when targeting to the promoter region (~75 bp upstream of TSS or ~125 bp upstream of the start codon) and the template strand (T) of the coding sequences; for gene disruption, it is better to target the 5′-end of the coding sequences.
3SC and MM scores are from CHOPCHOP. SC, self-complementarity; MM0, no mismatche; MM1, 1 mismatch; MM2, 2 mismatches; MM3, 3 mismatches.
4PolyT may be read as a terminator by the Type III RNA polymerase.
5PolyG is difficult for DNA synthesis.
6BsaI is used for the cloning of the gRNA plasmid libraries.
7The gRNAs cluster together may have similar targeting efficiency and it may result in low library diversity.
Most of the previously designed gRNAs (Lian, J., et al., Nat. Commun. 8:1688, (2017)) with high efficiency was found to be highly ranked in the designed genome-scale CRISPRa, CRISPRi, and CRISPRd libraries.
For each gene, the top-six, top-six, and top-four guide sequences with the highest scores were selected for CRISPRa, CRISPRi, and CRISPRd libraries, respectively. 100 non-targeting guide sequences were included in each library as negative controls. Adapters containing priming sequences and BsaI sites were added to both ends of each oligonucleotide for PCR amplification and Golden Gate assembly. The unique priming sequences allowed the construction of each library independently. The CRISPRa and CRISPRi oligonucleotide libraries were synthesized on a 92918 format chip, while the CRISPRd oligonucleotide library was synthesized on two 12472 format chips (CustomArray, Bothell, Wash.) and mixed at equal molar ratio.
On average, ˜98% of the designed gRNAs showed high scores (
The priming sites are underlined, BsaI sites for golden-gate assembly are highlighted in bold, guide sequences are dotted underlines and the homology donor for HI-CRISPR gene deletion are plain capital letters.
In summary, 37817, 37870, and 24806 unique guide sequences were designed and synthesized for the CRISPRa, CRISPRi, and CRISPRd libraries, respectively (Table 20 and Table 21).
20 + 82 bp
121 + 127 bp
1The length of guide (underlined) and structural sequences.
2Calculated as estimated library size/No. of guide sequences.
3At least one guide for each gene.
Notably, 100 randomly generated guide sequences in each library were not included in this table.
Exemplary guide sequences for the top-six activation guide sequences, the top-six interference guide sequences, and top-four deletion guide sequences for the ACS1, ADE1, AIM2, ATS1, and BDH1 genes are shown in Table 22. The full list of 37817, 37870, and 24806 unique guide sequences that were designed and synthesized for the CRISPRa, CRISPRi, and CRISPRd libraries are not shown for brevity.
Construction of the Plasmid Libraries.
10 ng oligonucleotide pool was used as template for PCR amplification with the corresponding primers (Table 14). 15 ng gel purified PCR products were assembled with 50 ng p426*-LbSgH, p426*-SpSgH, and p426*-SaSgH, respectively, using Golden Gate Assembly method (Bao, Z., et al., Nat. Biotechnol. 36:505-508, (2018); Bao, Z., et al., ACS Synth. Biol. 4:585-594, (2015)). The reaction mixture was transformed into NEB Turbo competent cells (New England Biolabs), yielding at least 5*106 independent clones for each library, with ˜100-fold redundancy (Table 20). Each library was plated onto 25 LB/Amp agar plates and all the bacteria were collected to extract plasmids with a Qiagen Plasmid Maxi Kit.
Construction of the MAGIC Libraries.
The yeast mutant libraries were constructed by transforming 10 μg CRISPRa, 10 μg CRISPRi, and 20 μg CRISPRd plasmid libraries, respectively, into 10 OD600 unit of CRISPR-AID strains using the LiAc/SS carrier DNA/PEG method (Gietz, R. D. & Schiestl, R. H., Nat. Protoc. 2:31-34, (2007)) with minor modification. After heat shock at 42° C. for 1 h, cells were resuspended in 4 mL YPD medium and recovered at 30° C. for ˜4h, which were then diluted 1000-fold and spread into SED-URA agar plates to evaluate the transformation efficiency. The remaining cells were cultured 50 mL SED-URA/G418 medium for ˜2 days. The independent clones for each library should be >106, with at least 30-fold redundancy. The MAGIC libraries were constructed by pooling 1 OD unit cells from each library, which would be subject to growth enrichment under stressed conditions or high throughput screening.
Next Generation Sequencing.
NGS adapters were added to the extracted plasmid libraries using the Nextera Index Kit (Illumina, San Diego, Calif.) with a two-step PCR approach. The first step PCR added the Illumina overhang adapter sequences to all guide sequences (Table 23) using primers AID-NGS-F1 and AID-NGS-R1.
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGcttctccgcagtgaaagataaatgatcAA
TTTCTACTAAGTGTAGATNNNNNNNNNNNNNNNNNNNNNNNtttttttgttttttatgtct
CTCTTATACACATCTCCGAGCCCACGAGAC (SEQ ID NO: 567)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGcttctccgcagtgaaagataaatgatcNN
NNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGAAATAGCAAGTTAAAATAA
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGcttctccgcagtgaaagataaatgatcNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
The 3′-end of SNR52 promoter sequences, SUP4 terminator sequences, and part of the vector sequences are shown in lower case, the gRNA structural sequences are capitalized, the guide sequences are represented as N, and the Illumina overhang adapter sequences were underlined. The 43 bp region extracted from the NGS data for mapping into the reference sequences are shown in bold in Table 23.
The second step PCR attached Nextera indexes to each library, and the resultant products were gel purified and quantitated with Qubit (ThermoFisher). ˜60 ng of each library was pooled, followed by quantitation by qPCR and sequencing on one lane for 161 cycles from one end of the fragments on a HiSeq 2500 using a HiSeq SBS Sequencing Kit Version 4 (Illumina).
NGS Data Processing and Analysis.
Fastq files were generated and demultiplexed with the bcl2fastq v2.17.1.14 Conversion Software (Illumina). A bowtie index was prepared for all the designed 100,493 guide sequences and used as the reference sequences. An exemplary bowtie index for the guide sequences for the top-6 activation guide sequences, the top-6 interference guide sequences, and top-4 deletion guide sequences for the ACS1, ADE1, AIM2, ATS1, and BDH1 genes is shown in Table 24. The full list of 100,493 polynucleotide guide sequences is not shown for brevity.
From this point on, all the sequence manipulations were performed using commands on Galaxy (usegalaxy.org). The reads of 43 bp between SNR52p and SUP4t that contains a unique sequence in all three AID libraries (Table 23) were extracted from the NGS data using FASTQ Trimmer by column (Galaxy Version 1.0.0). Extracted guide sequences were then mapped to the bowtie index using Map with Bowtie for Illumina (Galaxy Version 1.1.2) with the default settings. Unmapped reads were removed and reads mapped to each unique guide sequence were counted. The raw guide count sequence was then mapped to the original reference file and the number of reads for each guide sequences was obtained. The number of reads per guide in each library was normalized to the total read counts of that library. A threshold of one read in all six libraries (biological triplicates for untreated and furfural stressed libraries) and 5-fold enrichment (Normalized No. of guide in the furfural stressed library/Normalized No. of guide in the untreated library) for each replicate was set to keep a guide sequence. The targets with the highest average folds of enrichment were chosen for further verification.
Quantitative PCR Analysis.
Mid-log phase yeast cells were collected to extract total RNAs using the RNeasy Mini Kit (QIAGEN, Valencia, Calif., USA) following the manufacturer's instructions. 2 μg of the RNA samples were then reversed transcribed into cDNA using the Transcriptor First Strand cDNA Synthesis Kit using oligo-dT primer (Roche, Indianapolis, Ind., USA). The qPCR experiments were carried out using SYBR Green-based method using the Roche LightCycler 480 System.
Results
Transforming the plasmid libraries into S. cerevisiae (Lian, J., et al., Nat. Commun. 8:1688, (2017)) resulted in the construction of the MAGIC library (
The pooled oligonucleotides were amplified by PCR and cloned into the corresponding gRNA expression plasmids. The plasmid libraries were sequenced and it was found that ˜87% of the CRISPRa and CRISPRi libraries and ˜73% of the CRISPRd libraries had the correct guide sequences. Lower mapping ratio of the CRISPRd library should result from higher synthesis error rate for longer oligos. As a result, nearly all gRNAs and genes were covered in the CRISPRa and CRISPRi plasmid libraries, while there was at least one gRNA for ˜98% of the yeast genes in the CRISPRd library (Table 20). The coverage of the genome-scale CRISPR-AID libraries were significantly higher than the previously reported cDNA based genome-scale libraries (Si, T., et al., Nat. Commun. 8:15187, (2017)).
Also described herein is a multi-functional genome-wide CRISPR (MAGIC) system for high throughput genotype-phenotype mapping. To determine if MAGIC could be used to identify genetic determinants of complex phenotypes, such as furfural tolerance, the MAGIC library was screened in the presence of 5 mM furfural and many enriched guide sequences were observed as compared to that under the reference conditions.
MAGIC Screening of Furfural Tolerance.
The MAGIC libraries in triplicates were inoculated into 50 mL SED-URA/G418 medium with or without furfural in a 250 mL baffled flask. 1 OD of the mid-log phase growing cells from each of the untreated and stressed libraries was collected and the plasmids were extracted for NGS analysis. 5 mM, 10 mM, and 15 mM furfural were used for the first, second, and third round of MAGIC screening, respectively. Single (T1, T2, and T3), double (T1+T2, T1+T3, and T2+T3), and triple (T1+T2+T3) mutants were constructed to investigate the synergistic interactions among SIZ1i, NAT1a, and/or PDR1i for enhanced tolerance against different concentrations (7.5, 12.5, and 17.5 mM) of furfural. Due to the lower metabolic burdens than the plasmid bearing strains, the integrated strains (i.e. R1, R2, and R3) were evaluated with a furfural concentration of 7.5 mM, 12.5 mM, and 17.5 mM, respectively (
Fermentation and HPLC Analysis.
A single colony of WT and R3 were inoculated into 3 mL SED/G418 medium and cultured until saturation, which was then transferred into 50 mL fresh SED/G418 medium with or without the supplementation of 17.5 mM furfural in a 250 mL un-baffled shaker flask with an initial OD of 0.05. Fermentation was performed under oxygen-limited conditions (30° C. and 100 rpm), and samples were taken every 24h and analyzed by HPLC. Cell growth was determined by measuring the absorbance at 600 nm using a Tecan Infinite M1000 PRO microplate reader (Tecan Trading AG, Switzerland). Glucose, ethanol, furfural, and furfuryl alcohol were quantified using a Shimadzu HPLC (Columbia, Md.) equipped with an Aminex HPX-87H column (Bio-Rad) and Shimadzu RID-10A refractive index detector. The column was kept at 65° C. with 0.5 mM sulfuric acid solution at a flow rate of 0.6 ml/min as the mobile phase.
Results
The MAGIC library was subject to iterative rounds of screening under gradually increased furfural concentration, 5 mM, 10 mM, and 15 mM for the first (
These results highlighted the roles of protein degradation and histone modification in furfural tolerance. As SIZ1i improved furfural tolerance the most, we constructed strain R1 by integrating the SIZ1i cassette into the X4 locus of the genome (Table 15). A second round of MAGIC screening was performed and enriched several new guide sequences, which could further increase the growth rate in the presence of 10 mM furfural (
After 3 rounds of genome-scale engineering, not only were genetic determinants of furfural tolerance profiled, but also an engineered strain showing ready growth at high furfural concentrations was obtained. As shown in
Finally, synergistic interactions among the genetic determinants identified in iterative rounds of MAGIC screening were identified. Using the engineered furfural tolerant strain R3 as an example, single (T1, T2, and T3), double (T1+T2, T1+T3, and T2+T3), and triple (T1+T2+T3) mutants were constructed and compared their tolerance against different concentrations of furfural. As shown in
The fermentation performance of the wild-type (WT) and the engineered (R3) strain were also compared (
Besides furfural tolerance, the application of MAGIC for functional profiling of another complex phenotype, yeast surface display of recombinant proteins was also demonstrated (
MAGIC Screening of Yeast Surface Display Mutants.
The MAGIC library was cultured at 30° C. for 2 days and then subject to immunostaining and fluorescence activated cell sorting (FACS), following a previously developed protocol (Lian, J., et al., Nat. Commun. 8:1688, (2017); Si, T., et al., Nat. Commun. 8:15187, (2017)). The primary and secondary antibodies were monoclonal mouse anti-histidine tag antibody (1:100 dilution, Bio-Rad, Raleigh, N.C., catalog # MCA1396GA) and goat anti-mouse IgG (H+L) secondary antibody, Biotin-XX conjugate (1:100 dilution, ThermoFisher Scientific, Rockford, Ill., catalog # B-2763), respectively. Streptavidin, R-phycoerythrin conjugate (1:100 dilution, ThermoFisher Scientific, catalog # S866) was used to quantify the amount of biotin on the yeast surface. BD FACS Aria III cell sorting system (BD Biosciences, San Jose, Calif.) was used for collecting the most fluorescent yeast mutants. In the first round of sorting, 30,000 cells representing the top 1% highest fluorescence were collected. The second round sorted 96 individual yeast cells with the highest fluorescence. Then the plasmids were extracted and retransformed into the bAID-EG strain, the resulting recombinant strains were further analyzed by the cellulase activity assay. Briefly, 400 μL yeast cells were washed twice with ddH2O and resuspend in the same volume of 1% (w/v) carboxymethyl cellulose (CMC) solution (0.1 M sodium acetate, pH 5). After incubation at 30° C. for 16 h with vigorous shaking, the amount of reducing sugars in the supernatant was quantified by a modified DNS method (Lian, J., et al., Nat. Commun. 8:1688, (2017); Si, T., et al., Nat. Commun. 8:15187, (2017)). The gRNA plasmids enabling higher cellulase activity were sent for DNA sequencing.
Using the Trichoderma reesei endoglucanase (EGII) (Lian, J., et al., Nat. Commun. 8:1688, (2017); Si, T., et al., Nat. Commun. 8:15187, (2017)) as an example, HOCld was the highest enriched target to enhance protein secretion and surface display levels, followed by UBP3i and MNN9i. HOC1 and MNN9 are both subunits of the Golgi mannosyltransferase complex, the disruption of which minimized protein super-glycosylation and enhanced protein secretion (Tang, H., et al., Sci. Rep. 6:25654, (2016)) (
Compared with the traditional genome-scale engineering strategies, such as cDNA overexpression libraries (Liu, H., et al., Genetics 132:665-673 (1992)) and knock out collections (Giaever, G., et al., Nature 418:387-391 (2002)), CRISPR based technology offers a more flexible alternative for constructing a genome-wide set of mutants under different strain backgrounds. Although there are prior CRISPR-enabled genome-scale engineering attempts, the genotypic diversity is only limited to the targets that share the same type of genomic alteration.
To address this limitation, MAGIC for mapping synergistic interactions among overexpression, repression, and deletion targets in a genome-wide manner in S. cerevisiae was developed. Taken the furfural tolerant phenotype for example, the genome-wide RNAi technology (RAGE) failed to identify new targets after one round screening with 5 mM furfural (Xiao, H. & Zhao, H., Biotechnol. Biofuels 7:78 (2014)), and another genome-scale CRISPRd system (CHAnGE) could not obtain enriched targets after two rounds of screening at 10 mM furfural (Bao, Z., et al., Nat. Biotechnol. 36:505-508 (2018)), while MAGIC continued to enrich novel genetic determinants even after 4 rounds of screening at 20 mM furfural (data not shown). In addition, although screened under the same conditions (10 mM furfural and two rounds of evolution), the MAGIC engineered strain (SIZ1i-NAT1a) performed much better than the CHAnGE modified strain (SIZ1d-LCB3d) (
Recently, cDNA overexpression and RNA interference (RNAi) was combined to achieve combinatorial genome-scale engineering of complex phenotypes in yeast (Lian, J., et al. Metab. Eng., (2018)). Both strategies enable the exploration of the gain- and loss-of-function combinations that work synergistically to improve the desired phenotypes. Nevertheless, MAGIC not only introduces a third mode of genome engineering (gene deletion), but also offers several advantages of the CRISPR system. Most importantly, MAGIC represents the most comprehensive library ever created, with an average of >99% coverage of all ORFs and RNA genes for genome-wide overexpression, repression, and deletion (Table 20); while the cDNA based library covers ˜92% of all ORFs (Lian, J., et al. Metab. Eng., (2018)), as not all genes will be expressed under a given condition and RNA genes will not be included. MAGIC is less biased than the cDNA library, as all the MAGIC cassettes have the same or similar size to minimize cloning and transformation bias. In addition, the regulation mechanisms are different, CRISPRi blocks transcription in the nucleus while RNAi affects mRNA stability and translation in the cytosol.
Thus, by combining the tri-functional CRISPR system and array-synthesized oligo pools, MAGIC was used to create the most diversified library and identify novel genetic determinants of complex phenotypes, particularly those with synergistic interactions when regulated to different expression levels. Overall, MAGIC represents a powerful and generally applicable strategy to investigate fundamental biological questions as well as engineer complex phenotypes for biotechnological applications in yeast and possibly higher eukaryotes.
Previously characterized integration loci (Mikkelsen, M. D. et al. Metab. Eng. 14:104-111, (2012)) were chosen, which were flanked by highly expressed essential genes to enable efficient and stable expression of heterologous genes and pathways. Ten gRNA plasmids based on SaCas9 were constructed to integrate heterologous cassettes into X2, X3, X4, XI1, XI2, XI3, XII1, XII2, XII4, and XII5 loci, respectively.
To characterize the integration and gRNA expression efficiency of the pre-selected genomic loci, the integration efficiency and gRNA expression level were evaluated by co-transforming the reporter strain (bAID-RV) with gRNA plasmid as well as its corresponding linear donor fragment, which contained a gRNA expression cassette to activate the expression of mCherry or to repress the expression of mVenus. The gRNA targeting efficiency was tested by transforming the gRNA plasmid without any donor to repair the double strand break, and efficient gRNA should result in no survived colonies.
Eight colonies were randomly picked up to measure the change in fluorescence intensities. The mVenus and mCherry fluorescence signals were measured at 514-528 nm and 587-610 nm, respectively, using a Tecan Infinite M1000 PRO multimode reader (Tecan Trading AG, Switzerland). The fluorescence intensity (relative fluorescence units; RFU) was normalized to cell density that was determined by measuring the absorbance at 600 nm using the same microplate reader. The higher activation or repression efficiency of the integrated gRNA than its plasmid counterpart might result from lower metabolic burdens.
As shown in
This application claims priority to U.S. Provisional Patent Application No. 62/585,533, filed Nov. 13, 2017, the disclosure of which is hereby incorporated by cross-reference in its entirety.
This application was made with United States government support awarded by U.S. Department of Energy (DE-SC0018260). The United States government has certain rights in this invention.
| Number | Date | Country | |
|---|---|---|---|
| 62585533 | Nov 2017 | US |
