The present invention relates to the field of modified polynucleotides configured to inhibit gene silencing by RNA interference. More particularly, the present invention relates to polynucleotides that can interact with target miRNA or siRNA so as to inhibit silencing of a target gene.
RNA interference (RNAi) is a near-ubiquitous pathway involved in post-transcriptional gene modulation. The key effector molecule of RNAi is the microRNA (miRNA or miR). These small, non-coding RNAs are transcribed as primary miRNAs (pri-miRNA,
To better understand the mechanism of RNAi, the targets of microRNAs, and the roles that miRNAs and their targets play in disease, cellular differentiation and homeostasis, development of molecular tools, such as miRNA inhibitors and mimics, are valuable. Inhibitors should be potent, stable, highly specific, and easily introduced into cells under in vivo (e.g., whole animal and in culture), and induce silencing for extended periods of times.
Several groups have previously described a class of miRNA inhibitors (see Meister, G. et al, (2004) RNA 10(3):544-50; Hutvagner, G. et al. (2004) PLoS Biol. April; 2(4):E98. Epub 2004 Feb. 24). These molecules are single stranded, range in size from 21-31 nucleotides (nts) in length, and contain O-methyl substitutions at the 2′ position of the ribose ring. More recently, a variant of this original design called “antagomirs” were developed and include the addition of a cholesterol to single stranded 21-23 nt inhibitors (Krutzfeldt, J. et al (2005) Nature 438:685-689), and novel designs that include the incorporation of locked nucleic acids (LNAs, see Orom et al, (2006) Gene 372:137-141).
Short, single stranded RNAi inhibitors and single stranded RNAi inhibitors conjugated to cholesterol suffer from dissimilar shortcomings. The short single stranded molecules described by Hutvagner (2004) and Meister (2004) are as a whole fairly ineffectual in inhibiting the intended target. As shown in
To address the shortcomings of the currently available miRNA inhibitors, the inventors have identified two new general designs that greatly enhance the overall performance of RNAi inhibitors. The first design is a modified, single stranded inhibitor in which the length of the molecule has been greatly extended. These long, single stranded inhibitors more closely mimic the natural targets (e.g., messenger RNA) and represent improved substrates for the RNAi pathway. The second design represents a double stranded RNAi inhibitor that significantly enhances overall functionality. Incorporation of regions of double stranded oligonucleotides into the inhibitor design greatly increases overall potency and longevity of the molecules without altering specificity. In addition, the second design is compatible with manufacturing processes that greatly minimize the complications associated with previous designs. The polynucleotides of the double stranded inhibitors can be modified or unmodified.
In the most general of terms, the molecules of the invention can be used to inhibit gene silencing by the RNAi pathway. The inhibitors described herein can inhibit endogenous targets, including but not limited to microRNAs, or piRNAs, or can be used to inhibit the effects of exogenously introduced molecules, such as synthetic siRNAs, siRNAs expressed from vector constructs (e.g., viral expression systems), or siRNAs generated by enzymatic methods. In addition, the molecules of the invention can be used to inhibit microRNAs that are expressed by pathogens. Inhibition is specific, potent, prolonged, and can be performed on a single target or multiple targets simultaneously.
The inhibitor molecules of the invention comprise any design that includes a reverse complement (RC) nucleotide sequence to the target molecule of interest (e.g., miRNA) in association with either: (1) an extended flanking region(s) that is single stranded, or (2) a flanking region(s) having double stranded nucleic acid. Thus, for instance, in the case of double stranded (ds) inhibitors, the double stranded region can result from a hairpin associated with the 5′ and/or 3′ terminus of the RC region, or from the annealing of a second or third oligonucleotide to regions that flank the 5′ and/or 3′ terminus of the RC. In yet another variant, the double stranded region can result from 5′ and 3′ regions flanking the RC annealing together. The molecules of the invention can be RNA, modified RNA, DNA, modified DNA, or any combination thereof. Nucleotide modifications applicable for the inhibitors of the invention are disclosed in WO2005/097992 and WO2005/078094. In addition, the molecules of the invention can be conjugated to one or more molecules that enhance cellular delivery. This conjugate can be attached directly to the inhibitor or associated through a linker molecule.
More specifically, the single stranded inhibitors of the invention comprise a modified oligonucleotide that contains three domains (e.g., a 5′ flanking domain, a central domain, and a 3′ flanking domain) and ranges in length between 41 and 68 nucleotides (nts). An embodiment of a single stranded inhibitor can include the following:
1. The central region ranges in length between about 17 and about 32 nucleotides and is substantially similar to the reverse complement of the mature, RISC-entering strand of the miRNA and regions bordering the mature strand.
2. The 5′ flanking region is: (1) about 12 to about 20 nucleotides in length; (2) is not rich in pyrimidines (e.g., preferably not more than about 70%, more preferably not more than about 60%, even more preferably not more than about 50%, still more preferably not more than about 40%, and most preferably less than about 30% pyrimidines); (3) is 5′ of the central region; and (4) has minimal complementarity with the primary miRNA sequence that is 3′ of the mature miRNA sequence.
3. The 3′ flanking region is: (1) about 12 to about 20 nucleotides in length; (2) is not rich in pyrimidines (e.g., preferably not more than about 70%, more preferably not more than about 60%, even more preferably not more than about 50%, still more preferably not more than about 40%, and most preferably less than about 30% pyrimidines); (3) is 3′ of the central region; and (4) has minimal complementarity with the primary miRNA sequence that is 5′ of the mature miRNA sequence.
In addition, the inhibitors of the present invention having double stranded region(s) comprise one or more of the following:
1. A first oligonucleotide comprising:
a. A central region ranging in length between about 6 to about 37 nucleotides that contains sequences that are substantially similar to the reverse complement of the mature, RISC-entering strand of a miRNA, or the mature strand plus regions bordering the mature strand of a pri-miRNA or the RISC entering strand of an siRNA, or piRNA.
b. A 5′ flanking region, about 10 to about 40 nucleotides in length, is 5′ of the central region, and is capable of: (1) annealing to itself to create a duplex region, (2) annealing to the 3′ flanking region to create a duplex region, (3) annealing to a second oligonucleotide, which may also be referred to as a first enhancer sequence, to create a 5′ double stranded region, or (4) has little or no secondary structure.
c. A 3′ flanking region that is about 10 to about 40 nucleotides in length, is 3′ of the central region, and is capable of (1) annealing to itself to create a hairpin structure, (2) annealing to the 5′ flanking region, (3) annealing to a third oligonucleotide, which may also be referred to as the second enhancer sequence, to create a 3′ double stranded region, or (4) has little or no secondary structure at all.
2. A second oligonucleotide (i.e., first enhancer sequence or oligonucleotide) that is substantially complementary to, and capable of annealing with, all or portions of the 5′ flanking region.
3. A third oligonucleotide (i.e., second enhancer sequence or oligonucleotide) that is substantially complementary to, and capable of annealing with, all or portions of the 3′ flanking region.
Alternatively, the double stranded inhibitors can comprise:
a. A central region ranging in length between about 17 and about 37 nucleotides that contains sequences that are substantially similar to the reverse complement of the mature, RISC-entering strand of a miRNA, or the mature strand plus regions bordering the mature strand of a pri-miRNA or the RISC entering strand of an siRNA, or piRNA.
b. A fourth oligonucleotide that is substantially complementary to and capable of annealing with all or portions of the central region.
In one embodiment, one or more of the nucleotides of the inhibitor molecule of the invention are modified and/or contain a conjugate. The preferred modifications include: (a) 2′-O-alkyl modifications; (b) 2′-orthoester modifications, and/or (c) 2′-ACE (i.e., 2′-O-acetoxyethoxy) modifications of the ribose ring of some or all nucleotides. Preferably, the oligonucleotide(s) are modified polyribonucleotides, and the conjugates are hydrophobic molecules. More preferably, the modification is a 2′-O-alkyl modification of the ribose ring of some or all nucleotides and the conjugate is cholesterol. Conjugates can be attached directly to the 5′ end, 3′ end, or internal regions of any of the oligonucleotides or be attached through a linker molecule associated with the 5′ end, 3′ end, and/or internal regions of any of the oligonucleotides of the invention.
According to another embodiment, the invention describes methods of inhibiting the ability of an miRNA, a piRNA, or siRNA to modulate gene expression using compositions described in the previous embodiments.
The present invention also provides kits and pharmaceutical compositions containing the inventive inhibitors.
The preferred embodiments of the present invention have been chosen for purposes of illustration and description, but are not intended to restrict the scope of the invention in any way. The benefits of the preferred embodiments of certain aspects of the invention are shown in the accompanying figures, wherein:
Table 1 represents a list of preferred inhibitor sequences targeting miRNAs from the human, mouse, and rat genomes. The sequences consist of the central or reverse complement (RC) region and can be associated with either the single stranded or double stranded designs. For long single stranded inhibitors, the full inhibitor sequences contain the central region, as well as common 5′ flanking (5′) and 3′ flanking (3′) regions. In this case, all of the nucleotides in the inhibitor central and flanking sequences are O-methylated at the 2′ carbon of the ribose ring. Table 1 also provides the accession number of the mature and precursor miR to which each inhibitor targets.
Table 2 provides the list of sequences that were tested to determine the optimal length of the inhibitors.
Table 3 provides the list of sequences that were tested to determine the optimal position of flanking sequences.
Table 4 provides a list of sequences that were used to test the importance of flanking sequence content.
Table 5 provides the list of sequences that were used in these studies to test the efficacy of different double stranded inhibitor designs.
The present invention will now be described in connection with preferred embodiments. These embodiments are presented to aid in an understanding of the present invention and are not intended, and should not be construed, to limit the invention in any way. All alternatives, modifications and equivalents that may become apparent to those of ordinary skill upon reading this disclosure are included within the spirit and scope of the present invention. This disclosure is not a primer on compositions and methods for performing RNA interference. Basic concepts known to those skilled in the art have previously been set forth in detail.
The present invention is directed to compositions and methods for inhibiting RNA interference, including siRNA, piRNA, and miRNA-induced gene silencing. Through the use of the present invention, modified polynucleotides, and derivatives thereof, one may improve the efficacy of RNA interference applications.
Unless stated otherwise, the following terms and phrases have the meanings provided below:
As used herein, “alkyl” refers to a hydrocarbyl moiety that can be saturated or unsaturated, and substituted or unsubstituted. It may comprise moieties that are linear, branched, cyclic and/or heterocyclic, and contain functional groups such as ethers, ketones, aldehydes, carboxylates, etc. Unless otherwise specified, alkyl groups are not cyclic, heterocyclic, or comprise functional groups. Exemplary alkyl groups include but are not limited to substituted and unsubstituted groups of methyl, ethyl, propyl, butyl, pentyl, hexyl, heptyl, octyl, nonyl, decyl, undecyl, dodecyl, tridecyl, tetradecyl, pentadecyl, hexadecyl, heptadecyl, octadecyl, nonadecyl, eicosyl and alkyl groups of higher number of carbons, as well as 2-methylpropyl, 2-methyl-4-ethylbutyl, 2,4-diethylpropyl, 3-propylbutyl, 2,8-dibutyldecyl, 6,6-dimethyloctyl, 6-propyl-6-butyloctyl, 2-methylbutyl, 2-methylpentyl, 3-methylpentyl, and 2-ethylhexyl. The term alkyl also encompasses alkenyl groups, such as vinyl, allyl, aralkyl and alkynyl groups. Unless otherwise specified, alkyl groups are not substituted.
Substitutions within alkyl groups, when specified as present, can include any atom or group that can be tolerated in the alkyl moiety, including but not limited to halogens, sulfurs, thiols, thioethers, thioesters, amines (primary, secondary, or tertiary), amides, ethers, esters, alcohols and oxygen. The alkyl groups can by way of example also comprise modifications such as azo groups, keto groups, aldehyde groups, carboxyl groups, nitro, nitroso or nitrile groups, heterocycles such as imidazole, hydrazino or hydroxylamino groups, isocyanate or cyanate groups, and sulfur containing groups such as sulfoxide, sulfone, sulfide, and disulfide. Unless otherwise specified, alkyl groups do not comprise halogens, sulfurs, thiols, thioethers, thioesters, amines, amides, ethers, esters, alcohols, oxygen, or the modifications listed above.
Further, alkyl groups may also contain hetero substitutions, which are substitutions of carbon atoms, by for example, nitrogen, oxygen or sulfur. Heterocyclic substitutions refer to alkyl rings having one or more heteroatoms. Examples of heterocyclic moieties include but are not limited to morpholino, imidazole, and pyrrolidino. Unless otherwise specified, alkyl groups do not contain hetero substitutions or alkyl rings with one or more heteroatoms (i.e., heterocyclic substitutions). The preferred alkyl group for a 2′ modification is a methyl group with an O-linkage to the 2′ carbon of a ribosyl moiety (i.e., a 2′-O-alkyl that comprises a 2′-O-methyl group).
As used herein, “2′-O-alkyl modified nucleotide” refers to a nucleotide unit having a sugar moiety, for example a deoxyribosyl moiety that is modified at the 2′ position such that an oxygen atom is attached both to the carbon atom located at the 2′ position of the sugar and to an alkyl group. In various embodiments, the alkyl moiety consists essentially of carbons and hydrogens. A particularly preferred embodiment is one wherein the alkyl moiety is methyl moiety.
As used herein, “antisense strand” as used herein, refers to a polynucleotide or region of a polynucleotide that is substantially (e.g., 80% or more) or completely (100%) complementary to a target nucleic acid of interest. An antisense strand may be comprised of a polynucleotide region that is RNA, DNA or chimeric RNA/DNA. For example, an antisense strand may be complementary, in whole or in part, to a molecule of messenger RNA, an RNA sequence that is not mRNA (e.g., tRNA, rRNA and hnRNA) or a sequence of DNA that is either coding, non-coding, transcribed, or untranscribed. The phrase “antisense strand” includes the antisense region of the polynucleotides that are formed from two separate strands, as well as unimolecular siRNAs that are capable of forming hairpin structures. The phrases “antisense strand” and “antisense region” are intended to be equivalent and are used interchangeably. The antisense strand can be modified with a diverse group of small molecules and/or conjugates.
As used herein, “complementary” and “complementarity” are interchangeable and refer to the ability of polynucleotides to form base pairs with one another. Base pairs are typically formed by hydrogen bonds between nucleotide units in antiparallel polynucleotide strands or regions. Complementary polynucleotide strands or regions can base pair in the Watson-Crick manner (e.g., A to T, A to U, C to G). Perfect complementarity or 100% complementarity refers to the situation in which each nucleotide unit of one polynucleotide strand or region can hydrogen bond with each nucleotide unit of a second polynucleotide strand or region. Less than perfect complementarity refers to the situation in which some, but not all, nucleotide units of two strands or two regions can hydrogen bond with each other. Substantial complementarity refers to polynucleotide strands or regions exhibiting 80% or greater complementarity.
As used herein, “central region” refers to the area or region of an inhibitor molecule of the invention that is the reverse complement (RC) of mature miRNA, a piRNA, or an siRNA. When prescribed, the central region can also refer to the area or region of an inhibitor molecule of the invention that is the reverse complement of a mature miRNA and regions that border the mature miRNA in e.g. the primary miRNA. Preferably, the central region of inhibitors are substantially complementary to the mature miRNA or mature miRNA and regions that border the mature miRNA in the primary miRNA, or piRNA. More preferably, the central region of inhibitors are 100% complementary to the mature miRNA or mature miRNA and regions that border the mature miRNA in the primary miRNA.
As used herein, “duplex” and “duplex region” are interchangeable and refer to structures that are formed when two regions of one or more oligonucleotides, modified oligonucleotides, or modified and conjugated oligonucleotides anneal together.
As used herein, “enhancer sequence” and “enhancer oligonucleotide” are interchangeable and refer to oligonucleotides that can anneal to the 5′ and/or 3′ flanking regions of the first oligonucleotide.
As used herein, “flanking region” refers to one or more regions of the first oligonucleotide of the invention that borders the central region which is the reverse complement to a mature miRNA, a mature miRNA and regions that border the mature miRNA in the primary miRNA, or the RISC entering strand of a piRNA.
As used herein, “hairpin” refers a stem-loop structure. The stem results from two sequences of nucleic acid or modified nucleic acid annealing together to generate a duplex. The loop is a single stranded region that lies between the two strands comprising the stem.
As used herein, “mature strand” refers to the strand of a fully processed miRNA, a piRNA, or an siRNA that enters RISC. In some cases, miRNAs have a single mature strand that can vary in length between about 17-28 nucleotides in length. In other instances, miRNAs can have two mature strands, and again, the length of the strands can vary between about 17 and 28 nucleotides.
As used herein, “microRNA”, “miRNA”, and “MiR” are interchangeable and refer to endogenous or synthetic non-coding RNAs that are capable of entering the RNAi pathway and regulating gene expression. “Primary miRNAs” or “pri-miRNA” represent the non-coding transcript prior to Drosha processing and include the hairpin(s) structure as well as 5′ and 3′ sequences. “Pre-miRNA” represent the non-coding transcript after Drosha processing of the pri-miRNA. The term “mature miRNA” can refer to the double stranded product resulting from Dicer processing of pre-miRNA or the single stranded product that is introduced into RISC following Dicer processing. In some cases, only a single strand of an pre-miRNA enters the RNAi pathway. In other cases, each strand of a pre-miRNA are capable of entering the RNAi pathway. In addition, piRNAs are a recently discovered small ribonucleotides that also play a role in regulating genes. The inhibitor designed described in this application are expected to work equally well to inhibit the function of these molecules.
As used herein, “microRNA inhibitor”, “miR inhibitor”, and “inhibitor” are interchangeable and refer to polynucleotides or modified polynucleotides that interfere with the ability of specific miRNAs, piRNAs, or siRNAs to silence their intended targets. The mechanism(s) of action of an inhibitor are not limited and may include acting as an artificial substrate, inhibition of RISC action, inhibition of Drosha action, and/or inhibition of one or more additional steps associated with the RNAi pathway.
As used herein, “micro RNA reporter”, “miR reporter”, and “reporter” are interchangeable and refer to a vector or plasmid construct that encodes one or more reporter genes including but not limited to firefly luciferase, Renilla luciferase, secreted alkaline phosphatase, green fluorescent protein, yellow fluorescent protein, or others, and has miRNA target sites (also referred to as “miRNA recognition elements (MREs), piRNA recognition sites (PREs), or siRNA recognition elements (SREs) inserted into the 5′ UTR, ORF, and/or 3′UTR of one or more of the reporter genes.
As used herein, “nucleotide” refers to a ribonucleotide or a deoxyribonucleotide or modified form thereof, as well as an analog thereof. Nucleotides include species that comprise purines, e.g., adenine, hypoxanthine, guanine, and their derivatives and analogs, as well as pyrimidines, e.g., cytosine, uracil, thymine, and their derivatives and analogs. Preferably, a “nucleotide” comprises a cytosine, uracil, thymine, adenine, or guanine moiety.
Nucleotide analogs include nucleotides having modifications in the chemical structure of the base, sugar and/or phosphate, including, but not limited to, 5-position pyrimidine modifications, 8-position purine modifications, modifications at cytosine exocyclic amines, and substitution of 5-bromo-uracil; and 2′-position sugar modifications, including but not limited to, sugar-modified ribonucleotides in which the 2′-OH or H is replaced by a group such as an OR, R, halo, SH, SR, NH2, NHR, NR2, or CN, wherein R is an alkyl moiety as defined herein. Nucleotide analogs are also meant to include nucleotides with bases such as inosine, queuosine, xanthine, sugars such as 2′-methyl ribose, non-natural phosphodiester linkages such as methylphosphonates, phosphorothioates and peptides.
Modified bases refer to nucleotide bases such as, for example, adenine, guanine, cytosine, thymine, and uracil, xanthine, inosine, and queuosine that have been modified by the replacement or addition of one or more atoms or groups. Some examples of types of modifications that can comprise nucleotides that are modified with respect to the base moieties, include but are not limited to, alkylated, halogenated, thiolated, aminated, amidated, or acetylated bases, in various combinations. More specific modified bases include, for example, 5-propynyluridine, 5-propynylcytidine, 6-methyladenine, 6-methylguanine, N,N-dimethyladenine, 2-propyladenine, 2-propylguanine, 2-aminoadenine, 1-methylinosine, 3-methyluridine, 5-methylcytidine, 5-methyluridine and other nucleotides having a modification at the 5 position, 5-(2-amino)propyl uridine, 5-halocytidine, 5-halouridine, 4-acetylcytidine, 1-methyladenosine, 2-methyladenosine, 3-methylcytidine, 6-methyluridine, 2-methylguanosine, 7-methylguanosine, 2,2-dimethylguanosine, 5-methylaminoethyluridine, 5-methyloxyuridine, deazanucleotides such as 7-deaza-adenosine, 6-azouridine, 6-azocytidine, 6-azothymidine, 5-methyl-2-thiouridine, other thio bases such as 2-thiouridine and 4-thiouridine and 2-thiocytidine, dihydrouridine, pseudouridine, queuosine, archaeosine, naphthyl and substituted naphthyl groups, any O- and N-alkylated purines and pyrimidines such as N6-methyladenosine, 5-methylcarbonylmethyluridine, uridine 5-oxyacetic acid, pyridine-4-one, pyridine-2-one, phenyl and modified phenyl groups such as aminophenol or 2,4,6-trimethoxy benzene, modified cytosines that act as G-clamp nucleotides, 8-substituted adenines and guanines, 5-substituted uracils and thymines, azapyrimidines, carboxyhydroxyalkyl nucleotides, carboxyalkylaminoalkyl nucleotides, and alkylcarbonylalkylated nucleotides. Modified nucleotides also include those nucleotides that are modified with respect to the sugar moiety, as well as nucleotides having sugars or analogs thereof that are not ribosyl. For example, the sugar moieties may be, or be based on, mannoses, arabinoses, glucopyranoses, galactopyranoses, 4′-thioribose, and other sugars, heterocycles, or carbocycles. The term nucleotide is also meant to include what are known in the art as universal bases. By way of example, universal bases include but are not limited to 3-nitropyrrole, 5-nitroindole, or nebularine. Further, the term nucleotide also includes those species that have a detectable label, such as for example a radioactive or fluorescent moiety, or mass label attached to the nucleotide.
As used herein, “polynucleotide” refers to polymers of nucleotides, and includes but is not limited to DNA, RNA, DNA/RNA hybrids and modifications of these kinds of polynucleotides wherein the attachment of various entities or moieties to the nucleotide units at any position are included. Unless otherwise specified, or clear from context, the term “polynucleotide” includes both unimolecular siRNAs, piRNAs, and miRNAs and siRNAs, miRNAs, and piRNAs comprised of two separate strands.
As used herein, “piRNAs” refers to Piwi-interacting RNAs, a class of small RNAs that are believed to be involved in transcriptional silencing (see Lau, N. C. et al (2006) Science, 313:305-306).
As used herein, the “reverse complement” of an oligonucleotide sequence is a sequence that will anneal/basepair or substantially anneal/basepair to a second oligonucleotide according to the rules defined by Watson-Crick base pairing and the antiparallel nature of the DNA-DNA, RNA-RNA, and RNA-DNA double helices. Thus, as an example, the reverse complement of the RNA sequence 5′-AAUUUGC would be 5′-GCAAAUU. Alternative base pairing schemes including but not limited to G-U pairings can also be included in reverse complements.
As used herein, “RISC” refers to the set of proteins that complex with single-stranded polynucleotides such as mature miRNA, piRNA, or siRNA, to target nucleic acid molecules (e.g. mRNA) for cleavage, translation attenuation, methylation, and/or other alterations. Known, non-limiting components of RISC include Dicer, R2D2 and the Argonaute family of proteins, as well as strands of siRNAs, piRNAs, and miRNAs.
As used herein, “RNA interference” and “RNAi” are interchangeable and refer to the process by which a polynucleotide (e.g., an miRNA, a piRNA, or siRNA) comprising at least one ribonucleotide unit exerts an effect on a biological process. The process includes, but is not limited to, gene silencing by degrading mRNA, attenuating translation, interactions with tRNA, rRNA, hnRNA, cDNA and genomic DNA, as well as methylation of DNA with ancillary proteins.
As used herein, “sense strand” refers to a polynucleotide or region that has the same nucleotide sequence, in whole or in part, as a target nucleic acid such as a messenger RNA or a sequence of DNA. The phrase “sense strand” includes the sense region of both polynucleotides that are formed from two separate strands, as well as unimolecular siRNAs that are capable of forming hairpin structures. When a sequence is provided, by convention, unless otherwise indicated, it is the sense strand (or region), and the presence of the complementary antisense strand (or region) is implicit. The phrases “sense strand” and “sense region” are intended to be equivalent and are used interchangeably.
As used herein, “siRNA” and “short interfering RNA” are interchangeable and refer to unimolecular nucleic acids and to nucleic acids comprised of two separate strands that are capable of performing RNAi and that have a duplex region that is between 18 and 30 base pairs in length. Additionally, the term siRNA and the phrase “short interfering RNA” include nucleic acids that also contain moieties other than ribonucleotide moieties, including, but not limited to, modified nucleotides, modified internucleotide linkages, non-nucleotides, deoxynucleotides and analogs of the aforementioned nucleotides. siRNAs can be duplexes, and can also comprise short hairpin RNAs, RNAs with loops as long as, for example, 4 to 23 or more nucleotides, RNAs with stem loop bulges, micro-RNAs, and short temporal RNAs. RNAs having loops or hairpin loops can include structures where the loops are connected to the stem by linkers such as flexible linkers. Flexible linkers can be comprised of a wide variety of chemical structures, as long as they are of sufficient length and materials to enable effective intramolecular hybridization of the stem elements. Typically, the length to be spanned is at least about 10-24 atoms. When the siRNAs are hairpins, the sense strand and antisense strand are part of one longer molecule.
As used herein, “target” refers to a range of molecules including but not limited to an miRNA, an siRNA, a piRNA, an mRNA, rRNA, tRNA, hnRNA, cDNA and genomic DNA
In one embodiment, the present invention is directed to a composition comprising single stranded RNAi inhibitors. As such, the RNAi inhibitor can be a modified or unmodified oligonucleotide that contains three domains (e.g., a 5′ flanking domain, a central domain, and a 3′ flanking domain) and ranges in length between about 41 and about 68 nucleotides. The three domains can be as described below.
1. The central region ranges in length between about 17 and about 32 nucleotides and is substantially similar to the reverse complement of the mature, RISC-entering strand of the miRNA and regions bordering the mature strand. More preferably, the central region ranges from about 22 to about 28 nucleotides. Most preferably, the central region ranges from about 25 to about 28 nucleotides.
2. The 5′ flanking region is: (1) is about 12 to about 20 nucleotides in length; (2) is not rich in pyrimidines (e.g., preferably not more than about 70%, more preferably not more than about 60%, even more preferably not more than about 50%, still more preferably not more than about 40%, and most preferably less than about 30% pyrimidines); (3) is 5′ of the central region; and (4) has minimal complementarity with the primary miRNA sequence that is 3′ of the mature miRNA sequence. In one instance, the 5′ flanking region does not interact with the miRNA.
3. The 3′ flanking region is: (1) is about 12 to about 20 nucleotides in length; (2) is not rich in pyrimidines (e.g., preferably not more than about 70%, more preferably not more than about 60%, even more preferably not more than about 50%, still more preferably not more than about 40%, and most preferably less than about 30% pyrimidines); (3) is 3′ of the central region; and (4) has minimal complementarity with the primary miRNA sequence that is 5′ of the mature miRNA sequence. In one instance, the 3′ flanking region does not interact with the miRNA. Furthermore, the preferred modifications of the oligonucleotide of the invention are: (a) 2′ O-alkyl modification, and/or (b) 2′-ACE (i.e., 2′-O— acetoxyethoxy) modifications of the ribose ring of all nucleotides.
1. The Central Region of Single Stranded Inhibitors
The sequences of the central region of miRNA inhibitors are the reverse complement of mature miRNA. Alternatively, the sequence of the central region of an miRNA inhibitor of the invention comprise those that are the reverse complement of the mature miRNA plus about 1 to about 5 additional nucleotides associated with the 5′ and 3′ ends of the sequence that are the reverse complement to the mature miRNA and are complementary to the 3′ and 5′ regions that border the mature miRNA sequence. Preferably, the central region of an miRNA inhibitor of the invention has substantial (e.g., about 80% or greater) complementarity to the mature strand and/or the mature strand and regions that border the mature strand in the pri-miRNA. More preferably, the central region of an miRNA inhibitor of the invention has greater than about 90% complementarity to the mature strand and/or the mature strand and regions that border the mature strand in the pri-miRNA. Most preferably, the central region of an miRNA inhibitor of the invention has about 100% complementarity to the mature strand and/or the mature strand and regions that border the mature strand in the pri-miRNA. Addition of sequences that are complementary to regions of the primary miRNA that border the mature sequence can disrupt Drosha processing, and further enhance the inhibitory properties of the molecules of the invention. Moreover, the authors of the invention recognize that cloning is an imperfect science and that on infrequently occasions; the true length and sequence of the mature miRNA is miscalculated and extends beyond the boundaries that are reported in one or more databases. Extending the central region to include sequences that anneal to regions that border the mature miRNA sequence compensates for possible errors in the mapping of the true boundaries of the mature miRNA (
Preferably, the length of the central region varies between about 17 to about 32 nucleotides and the region that is complementary to the mature miRNA sequence is centered or nearly centered in the middle of the central region sequence. More preferably, the length of the central region is between about 22 and about 28 nucleotides and the region that is complementary to the mature miRNA sequence is centered or nearly centered in the middle of the central region sequence. Even more preferably, the length of the central region is between about 25 and about 28 nucleotides and the region that is complementary to the mature miRNA sequence is centered or nearly centered in the middle of the central region sequence. Most preferably, the length of the central region is about 28 nucleotides in length and the region that is complementary to the mature miRNA sequence being centered or nearly centered in the middle of the central region sequence.
A list of preferred central region nucleotide sequences of miRNA inhibitor molecules for human, mouse, and rat miRNA is presented in Table 1. In, cases where two mature strands evolve from a single miRNA, two inhibitor molecules with different central region sequences can be designed and synthesized. The list of sequences provided in Table 1 is not intended to be limiting in any fashion and can include variants. In most cases, the region of the central sequence that is the reverse complement of the mature miRNA is centered between sequences that are complementary to regions that border the mature miRNA in the primary miRNA. While this is the preferred organization of the central region, the inventors envision cases where the region of the central sequence that is the reverse complement of the mature miRNA is not evenly centered between sequences that are complementary to regions that border the mature miRNA in the primary miRNA. Thus, for instance, in the case where the mature miR sequence is about 21 nucleotides in length, then four and three nucleotides could be added to the 5′ and 3′ ends respectively. Lastly, the list of sequences presented in Table I are not intended to be limiting as it is predicted to increase as the number of miRNA sequences in all species expands.
2. The 5′ Flanking Region of Single Stranded Inhibitors
As mentioned above, the 5′ flanking region has minimal complementarity to sequences bordering the 3′ end of known mature miRNAs. Furthermore, the 5′ flanking region is not rich in pyrimidines (e.g., preferably not more than about 70%, more preferably not more than about 60%, even more preferably not more than about 50%, still more preferably not more than about 40%, and most preferably less than about 30% pyrimidines), and/or mimics the composition of native mRNA. Preferably, the 5′ flanking region is about 12 to about 20 nucleotides in length. More preferably, the 5′ flanking region is about 12 to about 18 nucleotides in length. Even more preferably, the 5′ flanking region is about 12 to about 16 nucleotides in length. Most preferably, the 5′ flanking region is about 14 nucleotides in length. Preferably, the nucleotide content of the 5′ flanking region is designed to match the overall content of mRNA coding sequences (i.e., about 25% G, C, A, and U), is designed to mimic a true mRNA substrate, and is sufficiently long that it, in conjunction with the central and 3′ flanking regions, can be recognized by RISC and other proteins associated with the RNAi machinery. Most preferably, the sequence of the 5′ flanking region is 5′-AGCUCUCAUCCAUG (SEQ ID NO: 4).
3. The 3′ Flanking Region of Single Stranded Inhibitors
The 3′ flanking region has minimal complementarity to sequences bordering the 5′ end of known mature miRNAs, and is not rich in pyrimidines (e.g., preferably not more than about 70%, more preferably not more than about 60%, even more preferably not more than about 50%, still more preferably not more than about 40%, and most preferably less than about 30% pyrimidines). Preferably, the 3′ flanking region is about 12 to about 20 nucleotides in length. More preferably, the 3′ flanking region is about 12 to about 18 nucleotides in length. Even more preferably, the 3′ flanking region is about 12 to about 16 nucleotides in length. Most preferably, the 3′ flanking region is about 14 nucleotides in length. Preferably, the nucleotide content of the 3′ flanking region is designed to match the overall content of mRNA coding sequences (i.e., about 25% G, C, A, and U), is designed to mimic a true mRNA substrate, and is sufficiently long that it, in conjunction with the central and 5′ flanking regions, can be recognized by RISC and other proteins associated with the RNAi machinery. Most preferably, the sequence of the 3′ flanking region is 5′-GUACCUACUCUCGA (SEQ ID NO: 5).
One example of inhibitors containing the preferred 5′ and 3′ flanking regions is provided as follows: 5′-agcucucauccaugUAAAACUAUACAACCUACUACCUCAUCCguaccuacucucga (SEQ ID NO: 12), where the capital letters represent the central region for miR accession no. MIMAT0000062 (e.g., precursor accession no MI0000060) and the preferred sequence of 5′ flanking region—central region—3′ flanking region are in lower case letters.
In one embodiment, the present invention includes RNAi inhibitors that include at least one duplex region. As such, the RNAi inhibitors can include a composition comprising one or more of the following:
1. A first oligonucleotide comprising:
a. A central region ranging in length between about 6 and about 37 nucleotides that is substantially similar to the reverse complement of a mature (i.e., RISC-entering) strand of the miRNA or piRNA, or the mature strand plus regions bordering the mature strand of a pri-miRNA, or the RISC entering strand of an siRNA.
b. A 5′ flanking region that is about 10 to about 40 nucleotides in length, is 5′ of the central region, and is capable of: (1) annealing to itself to create a duplex region, (2) annealing to the 3′ flanking region to create a duplex region, (3) annealing to a second oligonucleotide (i.e., first enhancer sequence or 5′ enhancer) to create a double stranded region, or (4) has little or no secondary structure.
c. A 3′ flanking region that is about 10 to about 40 nucleotides in length, is 3′ of the central region, and is capable of: (1) annealing to itself to create a hairpin structure, (2) annealing to the 5′ flanking region, (3) annealing to a third oligonucleotide (i.e., second enhancer sequence or 3′ enhancer), or (4) has little or no secondary structure at all.
2. A second oligonucleotide (i.e., first enhancer sequence or 5′ enhancer oligonucleotide) that is substantially complementary to, and capable of annealing with all or portions of the 5′ flanking region.
3. A third oligonucleotide (i.e., second enhancer sequence or 3′ enhancer oligonucleotide) that is substantially complementary to and capable of annealing with all or portions of the 3′ flanking region.
Referring to
Preferably, one or more of the oligonucleotides of the invention are modified. The preferred modification is an O-alkyl modification of some or all of the 2′ carbons of the ribose ring of some or all of the oligonucleotides. In addition, preferably one or more of the oligonucleotides or modified oligonucleotides of the invention are conjugated to a hydrophobic molecule (e.g. cholesterol).
The RNAi inhibitors of the invention exhibit multiple improvements over those previously known including: (1) longevity of inhibition, and (2) potency of silencing. In addition, while previous inhibitor designs exhibit some functionality when targeting miRNAs that are poorly expressed, these older designs fail to efficiently target highly expressed targets. The newer designs described below efficiently inhibit targets that are expressed at both high and low concentrations.
The sequences of the central region of inhibitors are single stranded and the reverse complement of some or all of the mature miRNA, a piRNA, the RISC entering strand of siRNA, or any other regulating RNA that utilizes the RNAi pathway. Alternatively, the sequence of the central region of the invention comprise sequences that are the reverse complement of the mature miRNA plus about 1 to about 10 additional nucleotides (e.g., associated with the 5′ and/or 3′ end(s) of said sequence) that are complementary to the 3′ and 5′ regions, respectively, that border the mature miRNA sequence in the pri-miRNA. The motivation behind adding sequences other than those that are the reverse complement of the reported mature miRNA stems from an understanding of cloning. The inventors recognize that cloning is an imperfect science and that on occasion, the true length and sequence of the mature miRNA is misjudged and extends beyond the boundaries that are reported in one or more databases. For this reason, expanding the central region to include sequences that anneal to regions that border the mature miRNA sequence in the pri-miRNA compensates for possible errors in the mapping of the true boundaries of the mature miRNA. Furthermore, addition of sequences on the 5′ and 3′ end of the central region extends the overall length of the inhibitor molecules. As described in this document and in previous documents (see U.S. Ser. No. 60/774,350) the performance of longer inhibitors is superior to those of smaller (e.g. 21 nucleotide) inhibitors having the same chemical modifications (e.g., 2′-O-methyl).)
For these reasons, the preferred length of the central region varies between about 6 to about 37 nucleotides. More preferably, the length of the central region is between about 22 to about 32 nucleotides. Even more preferably, the length of the central region is between about 26 to about 32 nucleotides. Most preferably, the length of the central region is between about 28 to about 32 nucleotides. Though it is not required, preferably in all of the instances, the region that is complementary to the mature miRNA sequence is centered or nearly centered in the middle of the central region sequence.
Preferably, the central region of an inhibitor of the invention has substantial (e.g., 80% or greater) complementarity to the mature strand of an miRNA, a piRNA, the mature strand of an miRNA or piRNA and regions that border the mature strand in the pri-miRNA or pri-piRNA, or the RISC-entering strand of an siRNA. More preferably the central region of an RNAi inhibitor of the invention has greater than about 90% complementarity to the mature strand of an miRNA, or piRNA, the mature strand of an miRNA and regions that border the mature strand in the pri-miRNA or pri-piRNA, or the RISC-entering strand of an siRNA. Most preferably the central region of an inhibitor of the invention has about 100% complementarity to the mature strand of an miRNA, the mature strand miRNA and regions that border the mature strand in the pri-miRNA, or the RISC-entering strand of an siRNA.
Additionally, the central region nucleotide sequences of double stranded RNAi inhibitor molecules targeting human, mouse, and rat miRNA are presented in Table 1, and can be the same as sequences for single stranded RNAi inhibitor molecules.
As mentioned above, the 5′ flanking region is between about 10 to about 40 nts in length, is 5′ of the central region, and is capable of: (1) annealing to itself to create a duplex region, (2) annealing to the 3′ flanking region to create a double stranded region, (3) annealing to a second oligonucleotide (i.e., first enhancer sequence or 5′ enhancer oligonucleotide) to create a double stranded region, or (4) has little or no secondary structure. The first three of these alternatives (e.g., annealing back upon itself, annealing to the 3′ flanking region, and annealing to a first enhancer oligonucleotide) create a region of double stranded RNA which, as demonstrated in Examples 6-19, greatly enhances the functional properties of the inhibitor in an unexpected way.
The inventors have observed that inhibitors that have duplex structures resulting from sequences in the 5′ flanking region annealing with other sequences present in the 5′ flanking region perform better than short single stranded inhibitors (see Example 6). Preferably, in these cases a hairpin structure is formed (see
Lastly, though the distance between the 5′ terminus of the duplex region and the 5′-most boundary of the central region can vary greatly, preferably the duplex region of the 5′ flanking sequence is adjacent to the boundary of the central region. Without wishing to be restricted to a particular theory or model, the inventors believe that in cases where segments of single stranded nucleotides flank the central region, the possibility of secondary structures resulting from base pairing between the central region and sequences of the single stranded 5′ flanking region can occur, thus disrupting the overall functionality of the inhibitor. By having the double stranded region immediately adjacent to the border of the central region, this risk is minimized.
The inventors have also discovered that inhibitors that comprise regions of double stranded RNA resulting from base pairing between sequences in the 5′ and 3′ flanking regions perform better than short, single stranded inhibitors (see Example 7 and
In addition, the inventors have discovered that inhibitors that comprise regions of double stranded RNA resulting from base pairing between sequences of the 5′ flanking region and a second oligonucleotide (i.e., first enhancer sequence or 5′ enhancer oligonucleotide) can also perform better than short, single stranded inhibitors. In cases where a first enhancer sequence is used to generate a double stranded region, though the position and extent of the duplex region within the 5′ flanking region can vary, the minimal length of the enhancer is important. Studies have been performed using enhancer sequences of both 8 and 16 nucleotides in length. In the case of the shorter enhancer sequence of 8 nts, no enhanced function (e.g., characteristic of inhibitors with double stranded regions) was observed. In contrast, similar studies performed with enhancers that were 16 nucleotides in length can lead to improved performance (see Example 8). Though not wanting to be limited by any one theory, the inventors speculate that differences in the thermodynamic stability of duplexes formed between the 5′ flanking region and the two enhancer sequences are responsible for the observed changes in performance. Specifically, duplexes resulting from the 8 nucleotide enhancer are thought to be unstable and therefore do not consistently generate a lasting duplex region with the first oligonucleotide. In contrast, increasing the length to 16 nucleotides allowed for stable duplexes to be formed, thus providing superior performance over the single stranded counterpart. For this reason, the first enhancer sequence must be greater than 8 nts in length, and can be long as 35 nucleotides. Preferably, the first enhancer sequence has at least greater than about 80% complementarity to the 5′ flanking region or portions of the 5′ flanking region to which it is designed to anneal to. More preferably the first enhancer sequence has at least greater than about 90% complementarity to the 5′ flanking region or portions of the 5′ flanking region to which it is designed to anneal to. Most preferably, the first enhancer sequence is about 100% complementary to the 5′ flanking region or portions of the 5′ flanking region to which it is designed to anneal to. In addition, as was the case in which the duplex region results from two regions in the 5′ flanking region annealing with each other, the distance between the duplex region and the 5′-most boundary of the central region can vary greatly; preferably the duplex region of the 5′ flanking sequence is adjacent to the boundaries of the central region.
Designs that incorporate enhancer sequences are also desirable from the perspective that they eliminate the effects that sequence or nucleotide content can have on inhibitor function. Studies disclosed in this document (and in U.S. Ser. No. 60/774,350) show that the sequence of the flanking regions of single stranded molecules can play a major role in determining functionality. Specifically, the inventors have previously observed that single stranded inhibitors that have unstructured (e.g., pyrimidines rich) flanking regions are less functional than inhibitors that have flanking regions that more closely match mRNA nucleotide content (i.e., referred to as “arbitrary sequences”). As shown in Example 11, such limitations do not apply to the current invention; inhibitors of the invention with either unstructured or mRNA-like flanking regions annealed to enhancer sequences perform equally.
Many of the traits and/or properties associated with 3′ flanking sequences are similar to those described for 5′ flanking regions. As mentioned above, the 3′ flanking region is between about 10 to about 40 nts in length, is 3′ of the central region, and is capable of: (1) annealing to itself to create a duplex region, (2) annealing to the 5′ flanking region to create a duplex region, (3) annealing to a third oligonucleotide (i.e., second enhancer sequence or 3′ enhancer oligonucleotide) to create a double stranded region, or (4) has little or no secondary structure. As was the case with the 5′ flanking region, the first three alternatives (e.g., annealing to itself, annealing to the opposing (5′) flanking region, and annealing to a second enhancer oligonucleotide) creates a region of double stranded RNA which, as demonstrated in Examples 6-19, greatly enhances the functional properties of the inhibitor in an unexpected way. Many of the properties associated with 5′ flanking sequences and associated enhancers are similarly applicable to 3′ flanking sequences.
In cases where duplex structures present in the 3′ flanking region result from sequences present in the 3′ flanking region annealing with other sequences present in the 3′ flanking region, preferably a hairpin structure is formed. As described above, hairpins comprise a loop structure and a stem region (i.e., a duplex region) that results from base pairing of two separate regions (e.g., having sufficient levels of complementarity) separated by a non-base pairing region. Preferably, the length of the duplex region is between about 4 and about 20 base pairs in length and the level of complementarity is at least greater than about 80%. More preferably, the length of the duplex is about 6 to about 15 base pairs and the level of complementarity is at least greater than about 80%. More preferably, the length of the duplex is between about 6 and about 10 base pairs in length and the level of complementarity is about 100%. The loop can also vary in size (e.g., ranging from about 4 to about 15 nucleotides in length) and sequence.
As was the case with similar structures in the 5′ flanking region, the distance between the 3′ terminus of the duplex region and the 3′-most boundary of the central region can vary greatly, preferably the duplex region of the 3′ flanking sequence is adjacent to the boundary of the central region. By having the double stranded region immediately adjacent to the border of the central region, the possibility of secondary structures resulting from interactions between the central region and single stranded sequences of the 3′ flanking region is minimized.
As stated above, the inventors have also discovered that RNAi inhibitors that comprise regions of double stranded RNA resulting from base pairing between sequences in the 3′ and 5′ flanking regions perform better than short single stranded inhibitors (see descriptions of 5′ flanking region and Example 7).
In addition, the inventors have discovered that inhibitors that comprise double stranded regions resulting from base pairing between sequences of the 3′ flanking region and a third oligonucleotide (i.e., second enhancer sequence or 3′ enhancer oligonucleotide) can also exhibit superior performance over single stranded inhibitors (see Example 9). Again, though the position and extent of the duplex region in the 3′ flanking region can vary (as discussed previously), in cases where a second enhancer sequence is used to generate a region of double stranded RNA, the minimal length of the enhancer is critical. Thus, as was the case with the first enhancer sequence, the second enhancer sequence can be as long as about 35 nucleotides, yet must be longer than about 8 nucleotides. Preferably, the second enhancer sequence has at least greater than about 80% complementarity to the 3′ flanking region or portions of the 3′ flanking region to which it is designed to anneal to. More preferably, the second enhancer sequence has at least greater than about 90% complementarity to the 3′ flanking region or portions of the 3′ flanking region to which it is designed to anneal to. Most preferably, the second enhancer sequence has about 100% complementarity to the 3′ flanking region or portions of the 3′ flanking region to which it is designed to anneal to.
The inventors have discovered that the duplex region of this new generation of RNAi inhibitors can be presented in multiple ways and still give rise to enhanced functionality. As shown in multiple examples, inhibitors having duplexes have enhanced functionality compared to short, single stranded (21-32 nt) 2′-O-methyl inhibitor designs that are the reverse complement of the primary miRNA. Such double stranded inhibitors can include the following: (1) hairpins in the 5′ flanking region, (2) hairpins in the 3′ flanking regions, (3) hairpins in both the 5′ and 3′ flanking regions, (4) hairpins resulting from annealing the 5′ and 3′ flanking regions, (5) 5′ flanking regions annealing to enhancer sequences, (6) 3′ flanking regions annealing to enhancer sequences, (7) 3′ and 5′ flanking regions annealing to separate enhancer sequences, and (8) any combination of the above (e.g., hairpins in the 5′ flanking region plus 3′ flanking regions annealing to enhancer sequences). In addition, truncated designs having a duplex region can also exhibit superior performance compared to short (e.g., 21 to 32 nt) single stranded 2′-O-methyl modified inhibitors. Such truncated designs having a duplex region can include a central region and any of the following: (1) a 5′ flanking region capable of annealing back upon itself to create a duplex region, (2) a 5′ flanking region annealed to a second oligonucleotide (i.e., first enhancer sequence or 5′ enhancer oligonucleotide) to create a double stranded region, (3) a 3′ flanking region capable of annealing back upon itself to create a duplex region, or (4) a 3′ flanking region annealed to a third oligonucleotide (i.e., second enhancer sequence or 3′ enhancer oligonucleotide) to create a double stranded region. In another alternative, the sequence of the 5′ and 3′ flanking sequence can be the same, thus enabling a single enhancer sequence to be used so that both flanking regions embody a double stranded nature. In cases where an enhancer sequence is used to create the double stranded region, complexes can be blunt ended, or have 3′ or 5′ overhangs.
In addition to the double stranded inhibitor designs described above, the inventors have also discovered short double stranded inhibitors. These molecules can include a first strand that includes a modified central region ranging in length between about 17 and about 37 nucleotides annealed to a second strand that includes an oligonucleotide having substantial complementarity to the first strand. Usually, neither the first strand nor the second strand includes a 3′ or 5′ flanking region. There are several variants of this design that can also exhibit enhanced functionality and delivery. These variants include any of the following: (1) inclusion of one or more bulges or mismatches in the duplex structure, (2) addition of a 2′-O-alkyl group at the C2 position of the ribose ring of the first and/or second 5′ nucleotides (e.g., counting from the 5′ terminus) of the second strand, or (3) mismatches between the first and second strands at the 5′ end of the first strand. One or more of these variations can be combined to enhance inhibitor function. Also, the 2′-O-alkyl modification of the central region can be included on each nucleotide or on a portion of the nucleotides as described in other embodiments of inhibitors. While the second strand can include modifications, it can be beneficial for the second strand to be unmodified or otherwise susceptible to degradation. Additionally, the central region of the first strand includes a sequence that has at least partial complementarity to a functional strand of a target miRNA or siRNA. The complementarity of the central region can be substantially the same as described herein with regard to other embodiments of inhibitors. As such, the central region of the first strand can hybridize with the functional strand of the target miRNA or siRNA so as to inhibit the functional strand from regulating a gene through RNAi-mediated gene silencing.
For example, a short double stranded inhibitor can include a first oligonucleotide with a reverse complement region having 3′ and 5′ ends, and having a reverse complement sequence that is from about 17 to about 37 nucleotides and having at least about 80% complementarity with a target RNA sequence that is capable of silencing a target gene. Additionally, the short double stranded inhibitor can include a second oligonucleotide annealed to and having at least about 80% complementarity with the first oligonucleotide, wherein the second oligonucleotide has from about 17 to about 37 nucleotides.
In one embodiment, at least about 30% of nucleotides in the first oligonucleotide have a 2′ modification. In another embodiment, about 100% of nucleotides in the first oligonucleotide have the 2′ modification. In yet another embodiment, less than about 30% of nucleotides in the second oligonucleotide have a 2′ modification. In still another embodiment, the second oligonucleotide is substantially devoid of having the 2′ modification. In any of the embodiments, the 2′ modification is a 2′-O-alkyl, 2′ orthoester, or 2′ ACE modification.
In one embodiment, one or more bulges are included between the first and second oligonucleotides.
In one embodiment, the short double stranded inhibitor can include a conjugate coupled to at least one oligonucleotide of the RNAi inhibitor. That is, a conjugate can be coupled to the first oligonucleotide and/or the second oligonucleotide. Such a conjugate can be at the 5′ or 3′ end of oligonucleotide. Optionally, the conjugate is conjugated to an end of the second oligonucleotide so as to inhibit the conjugated end from entering RISC. Also, the conjugate can be coupled to the oligonucleotide via a linker.
In addition, the inventors have identified inhibitor designs that are compatible with various conjugate chemistries that enhance delivery and/or performance of the inhibitor molecule. Such conjugates can be directly associated with the inhibitor molecules, or can be associated with the inhibitor through a linker molecule.
Previous studies by several groups (e.g., Soutschek, J. et al (2004) Nature 432: 173) have used conventional linker chemistries (e.g., cholesterol-aminocaproic acid-pyrrolidine linker) to attach conjugates to nucleic acids (e.g., siRNAs). As such, the inventors have performed a detailed study of the importance of linker length, and have demonstrated that the overall functionality of nucleic acid-conjugate design is highly dependent on using linkers that have a narrow window of lengths. For this reason, one embodiment of this application is the use of linkers having specific numbers of atoms between the nucleic acid (e.g., inhibitor molecule) and the conjugate (e.g., cholesterol). Preferably, the number of atoms is between about 4 and about 8 in number. More preferably, the number of atoms is between about 4 and about 7 in number. More preferably, the number of atoms is between about 4 and about 6. Most preferably, the number of atoms between the cholesterol and the nucleic acid (e.g., inhibitor molecule) is about 5. It is important to note that in this application the length of the linker is described by counting the number atoms that represents the shortest distance between the nitrogen of the carbamate linkage of the conjugate and the terminal phosphate moiety associated with the oligonucleotide. In cases where ring structures are present, counting the atoms around the ring that represent the shortest path is preferred.
While preferred structures of the linker used in the invention include Chol-05, Chol-PIP, and Chol-ABA, the inventors understand that alternative chemistries can be used and provide a similar length linker. Thus linkers/linker chemistries that are based on ω-amino-1,3-diols, hydroxyprolinols, ω-amino-alkanols, diethanolamines, ω-hydroxy-1,3-diols, ω-hydroxy-1,2-diols, ω-thio-1,3-diols, ω-thio-1,2-diols, ω-carboxy-1,3-diols, ω-carboxy-1,2-diols, ω-hydroxy-alkanols, ω-thio-alkanols, ω-carboxy-alkanols, functionalized oligoethylene glycols, allyl amines, acrylic acids, allyl alcohols, propargyl amines, propargyl alcohols, and the like can be applied in this context to generate linkers of the appropriate length. Similarly, while the molecular structure of the chemical bond between the linker and the conjugate moiety is currently a carbamate linkage, alternative chemistries including those based on carbamates, ethers, esters, amides, disulfides, thioethers, phosphodiesters, phosphorothioates, phosphorodithioate, sulfonamides, sulfonates, fulfones, sulfoxides, ureas, hydrazides, oximes, photolabile linkages, C—C bond forming groups such as diels-alder cyclo-addition pairs or ring-closing metathesis pairs, and Michael reaction pairs. Lastly, linkers that have the same length, but are capable of associating with two or more conjugates, are also envisioned. Descriptions of the various cholesterol-linker-nucleic acid structures that have been tested for the ability to enhance delivery and functionality and the chemistries used to link conjugates with nucleic acids (e.g., inhibitors) can be found in U.S. Provisional Application No. 60/826,702, which is incorporated herein by reference.
The position of the linker-conjugate moiety on the inhibitor can vary with respect to the following: the strand or strands that are conjugated (e.g., first, second, and/or third oligonucleotides); the position or positions within the strand that are modified (i.e., the nucleotide positions within the strand or strands); and the position on the nucleotide(s) that are modified (e.g., the sugar and/or the base). Linker-conjugates can be placed on the 5′ and/or 3′ terminus of one or more of the strands of the invention and/or can be conjugated to internal positions. In addition, multiple positions on the nucleotides including the 5-position of uridine, 5-position of cytidine, 4-position of cytidine, 7-position of guanosine, 7-position of adenosine, 8-position of guanosine, 8-position of adenosine, 6-position of adenosine, 2′-position of ribose, 5′-position of ribose, 3′-position of ribose, can be employed for attachment of the conjugate to the nucleic acid. Preferably, the position of the conjugate or linker-conjugate attachment point is not within the central region of the first oligonucleotide of the inhibitor because this position may disrupt the ability of this molecule to interact with siRNA or miRNA. In cases where the inhibitor comprises a 5′ and/or 3′ flanking region having a hairpin, the conjugate can be associated with one or more positions on the stem region, the loop region, and/or the terminal region. In cases where the 5′ and/or 3′ flanking regions are associated with an enhancer region, a conjugate and/or linker conjugate can be associated with the 5′,3′ and/or internal positions of the flanking region of the first oligonucleotide, and/or the enhancer region of the second and/or third oligonucleotide. Each of these variants and any combination of the above, are envisioned by the inventors.
Conjugates of the invention can vary widely and target entry into the cell by a variety of means. For instance, conjugates can be lipid in nature and deliver their payload (e.g., inhibitor), by inserting themselves into the membrane and being absorbed into the cell by one of several mechanisms including endocytosis. Accordingly, lipid-based conjugates can include cationic lipids, neutral lipids, sphingolipids, and fatty acids such as stearic, oleic, elaidic, linoleic, linoleaidic, linolenic, and myristic fatty acids. Alternatively, the conjugates can be proteinaceous in nature, such as peptides that are membrane translocating (e.g., TAT, penetratin, or MAP) or cationic (e.g., poly(lys), poly(arg), poly(his), poly (lys/arg/his), or protamine).
Alternatively, the conjugate can be a small molecule that, for instance, targets a particular receptor or is capable of inserting itself into the membrane and being absorbed by endocytic pathways. Thus, small molecules based on adamantanes, polyaromatic hydrocarbons (e.g., napthalenes, phenanthrenes, or pyrenes), macrocycles, steroidal, or other chemical backbones, are all potential conjugates for the invention.
In yet another alternative, conjugates can be based on cationic polymers. Numerous studies have demonstrated that cationic polymers such as cationic albumin can greatly enhance delivery to particular cell types and/or tissues (e.g. brain delivery; see Lu, W. et. al. (2005) J of Control Release 107:428-448). Given the benefits of these molecules, the conjugate can be a cationic polymers such as polyethyleneimine, dendrimers, poly(alkylpyridinium salts, or cationic albumin.
In some cases, the conjugates are ligands for receptors or can associate with molecules that in turn associate with receptors. Included in this class are conjugates that are steroidal in nature (e.g., cholesterol, pregnolones, progesterones, corticosterones, aldosterones, testosterones, estradiols, ergosterols, and the like), bile acids, small molecule drug ligands, vitamins, aptamers, carbohydrates, peptides (e.g., hormones, proteins, protein fragments, antibodies or antibody fragments), viral proteins (e.g., capsids), toxins (e.g., bacterial toxins), and the like. In the case of cholesterol, the molecule can associate with one or more proteins or protein complexes in blood or other body fluid (e.g., albumin, LDLs, HDLs, IDLs, VLDLs, chylomicron remnants, and chylomicrons) and can be delivered to the cell through association with the appropriate receptor for that complex (e.g., low density lipoprotein receptor (LDLR)). The example of delivery via the cholesterol-LDL association is particularly attractive since the opportunity for dozens or hundreds of inhibitors to be delivered in a single LDL particle is feasible. For that reason, the inventors can envision packaging cholesterol conjugated inhibitors, or inhibitors conjugated to derivatives of cholesterol, in one or more natural carriers (e.g., LDLs) in vitro, and using this as an in vivo delivery system.
In one embodiment, the conjugates that target a particular receptor are modified to eliminate the possible loss of the conjugated nucleic acid (e.g., the inhibitor) to other sources. For instance, when cholesterol-conjugated nucleic acids are placed in the presence of normal serum, a significant fraction of this material will associate with the albumin and/or other proteins in the serum, thus making the inhibitor unavailable for interactions with LDLs. For this reason, it is conceivable that the conjugates of the invention can be modified in such a way that they continue to bind or associate with their intended target (e.g., LDLs) but have lesser affinities with unintended binding partners (e.g., serum albumin).
In one embodiment, a target miRNA can silence their target gene by inducing either transcript cleavage (e.g., in cases where the mature miRNA and target sequence are 100% complementary) or translation attenuation (e.g., in cases where the mature miRNA and target sequence are less than 100% complementary). As shown in multiple examples, the inhibitors of the invention exhibit potent activity irrespective of the mode of action. Thus, when the reverse complement region of the inhibitor is 100% complementary to the target miRNA, inhibitors of the invention are capable of preventing transcript cleavage. In cases where the reverse complement region of the inhibitor has less than 100% complementarity to the miRNA, inhibitors of the invention are potent inhibitors of translation attenuation.
Without wishing to be tied to any one theory as to why the double stranded inhibitors of the invention perform with enhanced potency, the inventors have noted that many of the proteins that mediate RNAi contain double stranded RNA binding domains (e.g., Dicer). Therefore, the inventors speculate that inclusion of double stranded regions in the inhibitor designs facilitates assembly of the RNAi machinery around the inhibitor and thus enhances overall functionality of the inhibitor.
The composition of the oligonucleotides of the invention can vary greatly and can include homogeneous nucleic acids (e.g., all RNA), heterogeneous nucleic acids (e.g., RNA and DNA), modified nucleic acids, and unmodified nucleic acids (e.g., see Example 13). In some instances, the oligonucleotides of the invention include a mixture of modified and unmodified RNA and/or DNA. More preferably, the oligonucleotides of the invention include modified RNA. Even more preferably, the oligonucleotides of the invention comprise 2′-O-alkyl modified ribonucleotides. Most preferably, the oligonucleotides of the invention comprise 2′-O-methyl modified ribonucleotides. In other embodiments, the compositions of the present invention can comprise at least one 2′-orthoester modification, wherein the 2′-orthoester modification is preferably a 2′-bis(hydroxy ethyl) orthoester modification. Alternatively, modifications of the invention can include 2′ halogen modifications, or locked nucleic acids (LNAs).
In one embodiment, any of the inhibitor oligonucleotides can include a conjugate. While the conjugate can be selected from a large group consisting of amino acids, peptides, polypeptides, proteins, sugars, carbohydrates, lipids (e.g., cholesterol, see Example 16), polymers (e.g. PEG), nucleotides, polynucleotides, targeted small molecules, and combinations thereof.
One preferred inhibitor design includes a first oligonucleotide containing a central region, a 5′ flanking region, and a 3′ flanking region. Optionally, the inhibitor can include a truncated first oligonucleotide containing a central region and a 5′ flanking region or a central region and a 3′ flanking region.
In one embodiment, the inhibitor can include a second oligonucleotide (i.e., first enhancer sequence or 5′ enhancer oligonucleotide) that can anneal to the 5′ flanking region of the first oligonucleotide. The second oligonucleotide can be modified on the 5′ terminus, the 3′ terminus, and/or at one or more internal regions with a nucleotide modification described herein. Also, the second oligonucleotide can be conjugated at the 5′ terminus, 3′ terminus, and/or at one or more internal regions with a conjugate, such as a hydrophobic group (e.g., a cholesterol, a hydrophobic alkyl chain, such as C3 or longer, or a hydrophobic dye).
In one embodiment, the inhibitor can include a third oligonucleotide (i.e., second enhancer sequence or 3′ enhancer oligonucleotide) that can anneal to the 3′ flanking region of the first oligonucleotide. The third oligonucleotide can be modified on the 5′ terminus, the 3′ terminus, and/or at one or more internal regions with a nucleotide modification described herein. Also, the third oligonucleotide can be conjugated at the 5′ terminus, 3′ terminus, and/or at one or more internal regions with a conjugate, such as a hydrophobic group (e.g., a cholesterol, a hydrophobic alkyl chain, such as C3 or longer, or a hydrophobic dye).
As shown in Examples 10, 16 and 17, several of the preferred inhibitor designs exhibit enhanced functionality due to the inclusion of double stranded regions within the design and minimizes the hurdles associated with manufacturing a large number of individual single stranded inhibitors (e.g., a library of inhibitors) with conjugates (e.g., antagomirs). Instead, by designing all the first oligonucleotides with the same 5′ and/or 3′ flanking regions, the complexities and costs associated with conjugating hydrophobic molecules to a large number of modified oligonucleotide strands can be limited by having only one or two strands (e.g., first enhancer and/or second enhancer) containing the conjugate. Such conjugates can be linked to the appropriate strand using any one of a number art proven chemistries and linkers. Preferably, the linker is similar to the structure shown in
The conjugate can further comprise a label, such as, for example, a fluorescent label, a radioactive label, or a mass label. In cases where the label is a fluorescent label, the label can be selected from the group consisting of TAMRA, BODIPY, Cy3, Cy5, fluoroscein, and Dabsyl. Alternatively, the fluorescent label can be any fluorescent label known in the art.
In other embodiments, any of the compositions of the present invention can further comprise a 5′ and/or 3′ overhang, stabilized 5′ and/or 3′ overhangs, 3′ or 5′ cap (e.g., inverted deoxythymidine) as well as additional modifications that stabilize the oligonucleotides against RNase degradation (e.g., internucleotide linkage modifications such as phosphorothioates and methylphosphonates).
The inhibitor oligonucleotides of the invention can be synthesized by any method that is now known or that comes to be known and that from reading this disclosure a person of ordinary skill in the art would appreciate would be useful to synthesize the molecules of the present invention. For example, oligonucleotides of the invention containing the specified modifications may be chemically synthesized using compositions of matter and methods described in Scaringe, S. A. (2000) “Advanced 5′-silyl-2′-orthoester approach to RNA oligonucleotide synthesis,” Methods Enzymol. 317, 3-18; Scaringe, S. A. (2001) “RNA oligonucleotide synthesis via 5′-silyl-2′-orthoester chemistry,” Methods 23, 206-217; U.S. Pat. No. 5,889,136; U.S. Pat. No. 6,008,400; U.S. Pat. No. 6,111,086; and U.S. Pat. No. 6,590,093, which are all incorporated herein by reference. Newly synthesized oligonucleotides of the invention may be retained in a dried form at −20° C. until they are ready for use.
The synthesis method utilizes nucleoside base-protected 5′-O-silyl-2′-O-orthoester-3′-O-phosphoramidites to assemble the desired unmodified oligonucleotide sequences on a solid support in the 3′ to 5′ direction. Briefly, synthesis of the required phosphoramidites begins from standard base-protected ribonucleosides (e.g., uridine, N4-acetylcytidine, N2-isobutyrylguanosine, and N6-isobutyryladenosine). Introduction of the 5′-O-silyl and 2′-O-orthoester protecting groups, as well as the reactive 3′-O-phosphoramidite moiety is then accomplished in five steps, including: (1) Simultaneous transient blocking of the 5′- and 3′-hydroxyl groups of the nucleoside sugar with Markiewicz reagent (1,3-dichloro-1,1,3,3-tetraisopropyldisiloxane [TIPS—Cl2]) in pyridine solution (see, Markiewicz, W. T. (1979) “Tetraisopropyldisiloxane-1,3-diyl, a Group for Simultaneous Protection of 3′- and 5′-Hydroxy Functions of Nucleosides,” J. Chem. Research(S), 24-25), followed by chromatographic purification; (2) Regiospecific conversion of the 2′-hydroxyl of the TIPS-nucleoside sugar to the bis(acetoxyethyl)orthoester [ACE derivative] using tris(acetoxyethyl)-orthoformate in dichloromethane with pyridinium p-toluenesulfonate as catalyst, followed by chromatographic purification; (3) Liberation of the 5′- and 3′-hydroxyl groups of the nucleoside sugar by specific removal of the TIPS-protecting group using hydrogen fluoride and N,N,N″N′-tetramethylethylene diamine in acetonitrile, followed chromatographic purification; (4) Protection of the 5′-hydroxyl as a 5′-O-silyl ether using benzhydroxy-bis(trimethylsilyloxy)silyl chloride [BzH-Cl] in dichloromethane, followed by chromatographic purification; and (5) Conversion to the 3′-O-phosphoramidite derivative using bis(N,N-diisopropylamino)methoxyphosphine and 5-ethylthio-1H-tetrazole in dichloromethane/acetonitrile, followed by chromatographic purification.
The phosphoramidite derivatives are typically thick, colorless to pale yellow syrups. For compatibility with automated RNA synthesis instrumentation, each of the products is dissolved in a pre-determined volume of anhydrous acetonitrile, and this solution is aliquoted into the appropriate number of serum vials to yield a 1.0 mmole quantity of phosphoramidite in each vial. The vials are then placed in a suitable vacuum desiccator and the solvent removed under high vacuum overnight. The atmosphere is then replaced with dry argon, the vials are capped with rubber septa, and the packaged phosphoramidites are stored at −20° C. until needed. Each phosphoramidite is dissolved in sufficient anhydrous acetonitrile to give the desired concentration prior to installation on the synthesis instrument.
The synthesis of the desired oligoribonucleotide is carried out using automated synthesis instrumentation. It begins with the 3′-terminal nucleoside covalently bound via its 3′-hydroxyl to a solid beaded polystyrene support through a cleavable linkage. The appropriate quantity of support for the desired synthesis scale is measured into a reaction cartridge, which is then affixed to synthesis instrument. The bound nucleoside is protected with a 5′-O-dimethoxytrityl moiety, which is removed with anhydrous acid (3% [v/v] dichloroacetic acid in dichloromethane) in order to free the 5′-hydroxyl for chain assembly.
Subsequent nucleosides in the sequence to be assembled are sequentially added to the growing chain on the solid support using a four-step cycle, consisting of the following general reactions:
1. Coupling: the appropriate phosphoramidite is activated with 5-ethylthio-1H-tetrazole and allowed to react with the free 5′-hydroxyl of the support bound nucleoside or oligonucleotide. Optimization of the concentrations and molar excesses of these two reagents, as well as of the reaction time, results in coupling yields generally in excess of 98% per cycle.
2. Oxidation: the internucleotide linkage formed in the coupling step leaves the phosphorous atom in its P(III) [phosphite] oxidation state. The biologically-relevant oxidation state is P(V) [phosphate]. The phosphorous is therefore oxidized from P(III) to P(V) using a solution of tert-butylhydroperoxide in toluene.
3. Capping: the small quantity of residual un-reacted 5′-hydroxyl groups must be blocked from participation in subsequent coupling cycles in order to prevent the formation of deletion-containing sequences. This is accomplished by treating the support with a large excess of acetic anhydride and 1-methylimidazole in acetonitrile, which efficiently blocks residual 5′-hydroxyl groups as acetate esters.
4. De-silylation: the silyl-protected 5′-hydroxyl must be deprotected prior to the next coupling reaction. This is accomplished through treatment with triethylamine trihydrogen fluoride in N,N-dimethylformamide, which rapidly and specifically liberates the 5′-hydroxyl without concomitant removal of other protecting groups (2′-O-ACE, N-acyl base-protecting groups, or phosphate methyl).
It should be noted that in between the above four reaction steps are several washes with acetonitrile, which are employed to remove the excess of reagents and solvents prior to the next reaction step. The above cycle is repeated the necessary number of times until the unmodified portion of the oligoribonucleotide has been assembled. The above synthesis method is only exemplary and should not be construed as limited the means by which the molecules may be made. Any method that is now known or that comes to be known for synthesizing siRNA and that from reading this disclosure one skilled in the art would conclude would be useful in connection with the present invention may be employed.
The oligonucleotides of certain embodiments include modified nucleosides (e.g., 2′-O-methyl derivatives). The 5′-O-silyl-2′-O-methyl-3′-O-phosphoramidite derivatives required for the introduction of these modified nucleosides are prepared using procedures similar to those described previously (e.g., steps 4 and 5 above), starting from base-protected 2′-O-methyl nucleosides (e.g., 2′-O-methyl-uridine, 2′-O-methyl-N4-acetylcytidine, 2′-O-methyl-N2-isobutyrylguanosine and 2′-O-methyl-N6-isobutyryladenosine). The absence of the 2′-hydroxyl in these modified nucleosides eliminates the need for ACE protection of these compounds. As such, introduction of the 5′-O-silyl and the reactive 3′-O-phosphoramidite moiety is accomplished in two steps, including: (1) Protection of the 5′-hydroxyl as a 5′-O-silyl ether using benzhydroxy-bis(trimethylsilyloxy)silyl chloride (BzH-Cl) in N,N-dimethylformamide, followed by chromatographic purification; and (2) Conversion to the 3′-O-phosphoramidite derivative using bis(N,N-diisopropylamino)methoxyphosphine and 5-ethylthio-1H-tetrazole in dichloromethane/acetonitrile, followed by chromatographic purification.
Post-purification packaging of the phosphoramidites is carried out using the procedures described previously for the standard nucleoside phosphoramidites. Similarly, the incorporation of the two 5′-O-silyl-2′-O-methyl nucleosides via their phosphoramidite derivatives is accomplished by twice applying the same four-step cycle described previously for the standard nucleoside phosphoramidites.
The oligonucleotides of certain embodiments can, but need not, include a phosphate moiety at the 5′-end of the strand. If desired, this phosphate is introduced chemically as the final coupling to the sequence. The required phosphoramidite derivative (e.g., bis(cyanoethyl)-N,N-diisopropyl amino phosphoramidite) is synthesized as follows. Briefly, phosphorous trichloride is treated one equivalent of N,N-diisopropylamine in anhydrous tetrahydrofuran in the presence of excess triethylamine. Then, two equivalents of 3-hydroxypropionitrile are added and allowed to react completely. Finally, the product is purified by chromatography. Post-purification packaging of the phosphoramidite is carried out using the procedures described previously for the standard nucleoside phosphoramidites. Similarly, the incorporation of the phosphoramidite at the 5′-end of the strand is accomplished by applying the same four-step cycle described previously for the standard nucleoside phosphoramidites.
The modified, protected oligoribonucleotide remains linked to the solid support at the finish of chain assembly. A two-step rapid cleavage/deprotection procedure is used to remove the phosphate methyl protecting groups, cleave the oligoribonucleotide from the solid support, and remove the N-acyl base-protecting groups. It should be noted that this procedure also removes the cyanoethyl protecting groups from the 5′-phosphate on the strand. Additionally, the procedure removes the acetyl functionalities from the ACE orthoester, converting the 2′-O-ACE protecting group into the bis(2-hydroxyethyl)orthoester. This new orthoester is significantly more labile to mild acid as well as more hydrophilic than the parent ACE group. The two-step procedure is briefly as follows:
1. The support-bound oligoribonucleotide is treated with a solution of disodium 2-carbamoyl-2-cyanoethylene-1,1-dithiolate trihydrate in N,N-dimethylformamide. This reagent rapidly and efficiently removes the methyl protecting groups from the internucleotide phosphate linkages without cleaving the oligoribonucleotide from the solid support. The support is then washed with water to remove excess dithiolate.
2. The oligoribonucleotide is cleaved from the solid support with 40% (w/v) aqueous methylamine at room temperature. The methylamine solution containing the crude oligoribonucleotide is then heated to 55° C. to remove the protecting groups from the nucleoside bases. The crude orthoester-protected oligoribonucleotide is obtained following solvent removal in vacuo.
When desired, removal of the 2′-orthoesters is the final step in the synthesis process. This is accomplished by treating the crude oligoribonucleotide with an aqueous solution of acetic acid and N,N,N′,N′-tetramethyl ethylene diamine, pH 3.8, at 55° C. for 35 minutes. The completely deprotected oligoribonucleotide is then desalted by ethanol precipitation and isolated by centrifugation. In cases where retention of this group is preferred, this step is omitted.
While the preferred composition of the invention comprises a ribonucleotide where all of the nucleotides contain an alkyl modification (e.g., preferably a 2′-O-methyl modification) at the 2′ carbon of the ribose ring, the inventors recognize that in some cases, mixtures of 2′-O-alkyl and 2′-ACE modified nucleotides are desired. Such hybrid modified molecules are easily synthesized by introducing the appropriate precursors at the appropriate time during synthesis. In addition, supplementary modifications, including 2′ halogen modifications (e.g., F, Cl, Br, I), internucleotide modifications such as methylphosphonates and phosphorothioates, and base analogs can be included in the design of the inhibitors of the invention. Examples of positions of the nucleotide which may be derivatized include the following: the 5 position, such as 5-(2-amino)propyl uridine, 5-bromo uridine, 5-propyne uridine, 5-propenyl uridine, etc.; the 6 position, such as 6-(2-amino)propyl uridine; and the 8-position for adenosine and/or guanosines, such as 8-bromo guanosine, 8-chloro guanosine, 8-fluoroguanosine, etc. Nucleotide analogs also include the following: deaza nucleotides, such as 7-deaza-adenosine; 0- and N-modified (e.g., alkylated, e.g., N6-methyl adenosine, or as otherwise known in the art) nucleotides; and other heterocyclically modified nucleotide analogs such as those described in Herdewijn, Antisense Nucleic Acid Drug Dev., 2000 Aug. 10(4):297-310.
In addition, inhibitor oligonucleotides of the invention can by synthesized with an array of conjugates that enhance delivery, or allow visualization of the molecule in a cell or organism. Preferred conjugates for delivery include cholesterol, PEG, peptides, proteins, sugars, carbohydrates, and moieties or combinations of moieties that enhance cellular uptake. Additional conjugates can include fluorescent labels, such as fluorescein, lissamine, phycoerythrin, rhodamine (Perkin Elmer Cetus™), Cy2, Cy3, Cy3.5, Cy5, Cy5.5, Cy7, Fluor X (Amersham™) and others (see, Kricka (1992) Nonisotopic DNA Probe Techniques, Academic Press San Diego, Calif.). Other labels include radioactive labels or mass labels. All of the before mentioned conjugates or labels can be associated with the 5′ or 3′ end of the molecule or can be conjugated to internal regions using methods described in the U.S. patent application 60/603,472, filed Aug. 20, 2004, which is incorporated herein by reference.
The inhibitors of the present invention may be administered to a cell by any method that is now known or that comes to be known and that from reading this disclosure, one skilled in the art would conclude would be useful with the present invention. For example, the inhibitor molecules of the invention may be passively delivered to cells. Passive uptake of an inhibitor can be modulated, for example, by the presence of a conjugate such as a polyethylene glycol moiety or a cholesterol moiety, or any other hydrophobic moiety associated with the 5′ terminus, the 3′ terminus, or internal regions of the first oligonucleotide, and/or one or more of the enhancer oligonucleotides. Other methods for inhibitor delivery include, but are not limited to, transfection techniques (e.g., using forward or reverse transfection techniques) employing DEAE-Dextran, calcium phosphate, cationic lipids/liposomes, microinjection, electroporation, immunoporation, and coupling of the inhibitors to specific conjugates or ligands such as antibodies, peptides, antigens, or receptors.
The method of assessing the level of inhibition is not limited. Thus, the effects of any inhibitor can be studied by one of any number of art tested procedures including but not limited to Northern analysis, RT PCR, expression profiling, and others. In one preferred method, a vector or plasmid encoding reporter whose protein product is easily assayed is modified to contain the target site (e.g., reverse complement of the mature miRNA, piRNA, or siRNA) in the 5′ UTR, ORF, or 3′UTR of the sequence. Such reporter genes include alkaline phosphatase (AP), beta galactosidase (LacZ), chloramphenicol acetyltransferase (CAT), green fluorescent protein (GFP), variants of luciferase (Luc), and derivatives thereof. In the absence of the inhibitor, endogenous (or exogenously added) miRNAs target the reporter mRNA for silencing (e.g., either by transcript cleavage or translation attenuation) thus leading to an overall low level of reporter expression. In contrast, in the presence of the inhibitors of the invention, miRNA, piRNA, or siRNA mediated targeting is suppressed, thus giving rise to a heightened level of reporter expression. Preferred reporter constructs include the psiCHECK-2 dual luciferase reporter (Promega).
The inhibitors of the present invention may be used in a diverse set of applications, including basic research. For example, the inhibitors of the present invention may be used to validate whether one or more miRNAs or targets of miRNA may be involved in cell maintenance, cell differentiation, development, or a target for drug discovery or development. Inventive inhibitors that are specific for inhibiting a particular miRNA are introduced into a cell or organism and said cell or organism is maintained under conditions that allow for specific inhibition of the targeted molecule. The extent of any decreased expression or activity of the target is then measured, along with the effect of such decreased expression or activity, and a determination is made that if expression or activity is decreased, then the target is an agent for drug discovery or development. In this manner, phenotypically desirable effects can be associated with inhibition of particular target of interest, and in appropriate cases toxicity and pharmacokinetic studies can be undertaken and therapeutic preparations developed.
The inhibitors of the invention can be used to inhibit single or multiple targets simultaneously. The ability to inhibit multiple targets is one of the innovations of the invention (see Examples 4 and 19). The authors recognize that previous inhibitor designs lacked potency and as such, required high concentrations to partially inhibit a single miRNA. Introduction of pools of inhibitors using previous designs would require excessively high concentrations because there are limited amounts of RISC available in cells, high concentrations of inhibitors can be cytotoxic, and addition of high levels of inhibitors could lead to a global disruption of the RNAi pathway and non-specific effects. In contrast, the enhanced potency of the inhibitors of the invention enables users to inhibit one or more specific targets at concentrations that preserve the overall functionality of the RNAi pathway with minimal non-specific effects. Knockdown of multiple targets can take place by introducing pools of inhibitors targeting different molecules. Alternatively, inhibitors can be designed such that single inhibitor molecules can inhibit multiple targets. In one non-limiting example, inhibitors designs can include the following: a 5′ flanking region; a central region targeting gene A; a central region targeting gene B, and a first enhancer sequence capable of binding the 5′ flanking region.
Because the inhibitors of the invention act independent of the cell type or species into which they are introduced, the present invention is applicable across a broad range of organisms. For example, the inhibitors can be used in plants, animals, protozoa, bacteria, viruses, and fungi. The present invention is particularly advantageous for use in mammals such as cattle, horse, goats, pigs, sheep, canines, rodents such as hamsters, mice, and rats, and primates such as, gorillas, bush babies, chimpanzees, and humans.
The present invention may be used advantageously with diverse cell types, such as primary cells, germ cell lines, and somatic cells. For example, the cell types may be embryonic cells, oocytes, sperm cells, adipocytes, fibroblasts, myocytes, cardiomyocytes, endothelium, neurons, glia, blood cells, megakaryocytes, lymphocytes, macrophages, neutrophils, eosinophils, basophils, mast cells, leukocytes, granulocytes, keratinocytes, chondrocytes, osteoblasts, osteoclasts, hepatocytes and cells of the endocrine or exocrine glands.
Advantageously, the present invention can be used to inhibit a broad range of miRNA, piRNA, and siRNAs. For example, the inhibitors can be used to inhibit miRNA and/or piRNAs of the human genome implicated in diseases, such as diabetes, Alzheimer's, and cancer, and miRNA and/or piRNAs associated with the genomes of pathogens (e.g., pathogenic viruses).
Additionally, the inhibitors of the present invention may be used in RNA interference applications, such as diagnostics, prophylactics, and therapeutics. This can include using inhibitors in the manufacture of a medicament for prevention and/or treatment of animals, such as mammals (e.g., humans). In particular, the inhibitors of the invention can be used to reverse the action of siRNAs, miRNAs, or piRNAs that are being used as therapeutic agents.
In the case of therapeutic or prophylactic purposes, dosages of medicaments manufactured in accordance with the present invention may vary from micrograms per kilogram to hundreds of milligrams per kilogram of a subject. As is known in the art, dosage will vary according to the mass of the mammal receiving the dose, the nature of the mammal receiving the dose, the severity of the disease or disorder, and the stability of the medicament in the serum of the subject, among other factors well known to persons of ordinary skill in the art. For these applications, an organism suspected of having a disease or disorder that is amenable to modulation by manipulation of a particular target nucleic acid of interest is treated by administering inhibitors of the invention. Results of the treatment may be ameliorative, palliative, prophylactic, and/or diagnostic of a particular disease or disorder.
Therapeutic or prophylactic applications of the present invention can be performed with a variety of therapeutic inhibitor compositions and methods of inhibitor administration. Pharmaceutically acceptable carriers and diluents are known to persons skilled in the art. Methods of administration to cells and organisms are also known to persons skilled in the art. Dosing regimens, for example, are known to depend on the severity and degree of responsiveness of the disease or disorder to be treated, with a course of treatment spanning from days to months, or until the desired effect on the disorder or disease state is achieved. Chronic administration of inhibitors of the invention may be required for lasting desired effects with some diseases or disorders. Suitable dosing regimens can be determined by, for example, administering varying amounts of one or more inhibitors in a pharmaceutically acceptable carrier or diluent, by a pharmaceutically acceptable delivery route, and amount of drug accumulated in the body of the recipient organism can be determined at various times following administration. Similarly, the desired effect can be measured at various times following administration of the inhibitor, and this data can be correlated with other pharmacokinetic data, such as body or organ accumulation. Those of ordinary skill can determine optimum dosages, dosing regimens, and the like. Those of ordinary skill may employ EC50 data from in vivo and in vitro animal models as guides for human studies.
The inhibitors of the invention can be administered in a cream or ointment topically, an oral preparation such as a capsule or tablet or suspension or solution, and the like. The route of administration may be intravenous, intramuscular, dermal, subdermal, cutaneous, subcutaneous, intranasal, oral, rectal, by eye drops, by tissue implantation of a device that releases the inhibitor at an advantageous location, such as near an organ or tissue or cell type harboring a target nucleic acid of interest.
Having described the invention with a degree of particularity, examples will now be provided. These examples are not intended to and should not be construed to limit the scope of the claims in any way. Although the invention may be more readily understood through reference to the following examples, they are provided by way of illustration and are not intended to limit the present invention unless specified.
For most of the experiments reported, quantitation of the level of inhibition was performed using the dual luciferase reporter system, psiCheck 2 (Promega). Briefly, the psiCheck plasmid encodes for two variants of luciferase, Renilla and Firefly. Target sequences were inserted into the multiple cloning site of the 3′ UTR of the Renilla luciferase gene, thus allowing the Firefly sequence to be used as an internal control. To determine the practicality of different inhibitor designs, the oligonucleotide(s) of the invention and the modified psiCheck 2 plasmid were co-transfected into cells (100 ng of reporter DNA per well, 25-100 nM inhibitor, 0.3 microliters Lipofectamine 2000, Invitrogen). Twenty-four to ninety-six hours later cells were lysed and the relative amounts of each luciferase was determined using the Dual Glo Assay (Promega). For all experiments, unless otherwise specified, the transfection efficiency was ensured to be over 95%, and no significant levels of cellular toxicity were observed.
Firefly and Renilla luciferase activities were measured using the Dual-Glo™ Luciferase Assay System (Promega, Cat. #E2980) according to manufacturer's instructions with slight modification. When lysing cells, growth media was aspirated from the cells prior to adding 50 uL of firefly luciferase substrate and 50 uL Renilla luciferase substrate.
The Luciferase assays were all read with a Wallac Victor2 1420 multilabel counter (Perkin Elmer) using programs as recommended by the manufacturers.
All treatments were run in triplicate. In addition, each experimental treatment with a reporter plasmid was duplicated with the psiCHECK™-2 control plasmid (no insert). To account for non-specific effects on reporter plasmids, experimental results are expressed as a normalized ratio (Rluc/Fluc)norm: the ratio of Renilla luciferase expression to firefly luciferase expression for a given miRNA reporter plasmid (Rluc/Fluc)miRNA divided by the (Rluc/Fluc)control ratio for the identically treated psiCHECK™-2 reporter plasmid. The maximum values obtained from the reporter plasmid vary due to sequence; ideally values around 1 indicate low miRNA function, while values close to zero indicate high miRNA function. Data are reported as the average of the three wells and the error bars are the standard deviation of the three (Rluc/Fluc)miRNA ratios from the experimental treatment, scaled by the normalizing factor (the average of (Rluc/Fluc)control). We recognize that ratios do not follow a Normal distribution, but feel that the standard deviation values give a good sense of the variability of the data.
In cases where values between different miRNA reporter plasmids are compared, the maximum normalized (Rluc/Fluc)norm ratio was used as an additional scaling factor so that all reporters have a maximum of approximately 1. The additional scaling was performed for ease of comparison and does not affect the results.
To study the effectiveness of 2′-ACE modified inhibitors, in vitro studies were performed to assess the ability of these molecules to prevent the cleavage of a labeled artificial substrate. Specifically reaction mixtures containing a radio labeled let-7 target molecule were incubated with HeLa cell extracts (3 micrograms of protein in 50 mM Tris buffer, pH 7.5, 0.1% NP-40, 1 microgram tRNA, 5 mM ATP, 2 mM MgCl2, 37° C.) in the presence of 2′-O-methylated or 2′-ACE modified 31 nucleotide inhibitor molecules. Following a 10-minute incubation, reactions were analyzed on a native polyacrylamide gel to determine the level of miRNA target cleavage.
Cells were grown under standard conditions and released from the solid support by trypsinization. For most assays, cells were diluted to 1×105 cells/ml, followed by the addition of 100 μL of cells/well. Plates were then incubated overnight at 37° C., 5% CO2.
Inhibitors were synthesized using modifications of 2′ ACE chemistry described previously.
To determine the optimal length of inhibitors, fully 2′ O-methyl modified oligonucleotides targeting miR-21 and let-7c were synthesized with varying lengths (see Table II below). The additional sequences (underlined) were: 1) simultaneously added to both the 5′ and 3′ ends of the molecule, and 2) were the reverse complement of sequences bordering the mature sequence in the primary miRNA.
UAAACCAUACAACCUACCUCAAC
UCUAAACCAUACAACCUACUACCUCAACCC
ACUCUAAACCAUACAACCUACUACCUCAACCCGG
UAACUCUAAACCAUACAACCUACUACCUCAACCCGGAU
UGUAACUCUAAACCAUACAACCUACUACCUCAACCCGGAUGC
GGUGUAACUCUAAACCAUACAACCUACUACCUCAACCCGGAUGCAC
AGGGUGUAACUCUAAACCAUACAACCUACUACCUCAACCCGGAUGCACAC
CCAGGGUGUAACUCUAAACCAUACAACCUACUACCUCAACCCGGAUGCACACAAG
AGUCAACAUCAGUCUGAUAAGCUACC
ACAGUCAACAUCAGUCUGAUAAGCUACCCG
CAACAGUCAACAUCAGUCUGAUAAGCUACCCGAC
UUCAACAGUCAACAUCAGUCUGAUAAGCUACCCGACAA
GAUUCAACAGUCAACAUCAGUCUGAUAAGGUACCCGACAAGG
GAGAUUCAACAGUCAACAUCAGUCUGAUAAGCUACCCGACAAGGUG
AUGAGAUUCAACAGUCAACAUCAGUCUGAUAAGCUACCCGACAAGGUG
GU
CCAUGAGAUUCAACAGUCAACAUCAGUCUGAUAAGCUACCCGACAAGG
UGGUAC
Subsequently, the sequences were co-transfected into cells at 100, 50 and 25 nM concentrations along with the appropriate psiCheck reporter construct (target sequence inserted into psiCheck multiple cloning site=let-7c target site: sense strand 5′-TCGAATGACCAACCATACAACCTACTACCTCACTCGAGCTGC (SEQ ID NO: 13); miR-21 target site: sense strand, 5′-TCGAATGACCTCAACATCAGTCTGATAAGCTAC TCGAGCTGC (SEQ ID NO: 14); sites inserted into the NotI-XhoI digest of psiCHECK2) and the level of expression of the reporter was assessed at 48 hours. Results of these studies identified that previous 21 nts and 31 nts designs were suboptimal and that longer molecules were far more potent (
To assess whether the positioning of the flanking sequences was critical for the enhanced inhibitory effects, a second set of experiments was performed to determine whether performance was enhanced by preferentially adding the nucleotides to the 5′ or 3′ end of the sequence that was the reverse complement of the mature miRNA sequence. Specifically, inhibitor molecules containing the reverse complement (RC) of the mature let-7c or miR21 sequences were synthesized with 16 modified nucleotides associated with a) the 5′ (16+RC+0) end of the sequence, b) the 3′ end of the molecule (0+RC+16), or c) both ends of the molecule (16+C+16). In all cases, the additional sequences were the reverse complement of the appropriate primary miRNA sequences that bordered the mature miRNA sequence. See Table 3 below.
CCAGGGUGUAACUCUAAACCAUACAACCUACUACCUCAACCCGGAUGCACACAG
CCAGGGUGUAACUCUAAACCAUACAACCUACUACCUCA
CCAUGAGAUUCAACAGUCAACAUCAGUCUGAUAAGCUACCCGACAAGGUGGUAC
CCAUGAGAUUCAACAGUCAACAUCAGUCUGAUAAGCUA
The level of inhibition induced by these molecules was studied by co-transfecting each inhibitor into cells along with the appropriate psiCheck reporter construct. As shown in
An experiment was designed to test the importance of the following: (1) central region sequences of the inhibitor that anneal to sequences that flank the mature miRNA; and (2) 5′ and 3′ flanking regions of inhibitors that have nucleotide contents that mimic mRNA. Inhibitors were designed with a central region that was the reverse complement of miR21 or let-7c and contained the following: (1) 16 nucleotide flanking regions that were the reverse complement of sequences bordering each of the mature miRNA sequences (16+RC+16), (2) 16 nucleotide flanking regions that were representative of mRNA (˜25% A, T, G, and C, 16AR+RC+16AR), or (3) 16 nucleotide flanking regions that were not representative of mRNA (i.e., polypyrimidine flanks, 16US+RC+16US). The flanking sequences that were representative of mRNA were based on cel-miR-51 sequences that have no human homolog. (See Table 4). The level of inhibition induced by these molecules was then studied by co-transfecting each inhibitor into cells along with the appropriate psiCheck reporter construct.
CCUCUCCUCUCCCUCUAACCAUACAACCUACUACCUCACCU
CUCCUCUCCCUCU
CCUCUCCUCUCCCUCUUCAACAUCAGUCUGAUAAGCUAAC
In most cases, inhibitors that had 16 nucleotide 5′ and 3′ flanking regions that were the reverse complement of the regions that bordered the mature miRNA sequence performed equally to those that had 16 nucleotide flanking regions that were representative of mRNA (see
In addition, it was observed that molecules that comprised polypyrimidine flanking regions performed more poorly than sequences that more closely match the nucleotide content of mRNAs. Overall, these findings suggest that the nucleotide content of flanking regions can play a role in overall inhibitor functionality.
Due to the heightened potency of inhibitor molecules of the invention, it was predicted that the new design would be capable of simultaneously targeting multiple miR5 while previous designs could not. To test this, 21 nucleotide 2′-O-methyl modified, or 56 nts 2′-O-methyl modified inhibitors (28 nts central region, 14 nts 5′ flanking region (5′-AGCUCUCAUCC AUG (SEQ ID NO: 4)) and 14 nts 3′ flanking regions (5′-GUACCUACUCUCGA (SEQ ID NO: 5))) targeting miR-18, miR-22, and Let-7c were simultaneously transfected into cells (10K cells, Lipofectamine 2000, 100, 50, and 25 nM) along with one of the three reporter constructs (miR-18, miR-22, or Let-7c target sites) designed to detect function of each of the miR5. Subsequently, the level of luciferase activity was measured to determine the ability of each inhibitor to function in the presence of inhibitors targeting different miRNA.
The results of these studies are shown in
To test the ability of ACE-modified nucleotides to function as inhibitors, an in vitro assay was performed to test the ability of these molecules to inhibit cleavage of a labeled, artificial target. Specifically a 41 nucleotide P32-labeled let-7 target molecule was incubated with HeLa cell extracts (3 micrograms of protein in 50 mM Tris buffer, pH 7.5, 0.1% NP-40, 1 microgram tRNA, 5 mM ATP, 2 mM MgCl2, 37° C.) in the presence of 25, 2.5, or 0.25 nanomolar 2′-O-methylated or 2′-ACE modified 31 nucleotide inhibitor molecules. Following a 10-minute incubation, reactions were analyzed on a native polyacrylamide gel to determine the level of miRNA target cleavage. As shown in
To test the effects of double stranded regions on inhibitor functionality, the 5′ flanking region, 3′ flanking region, or both 5′ and 3′ flanking regions of let7c and miR21 inhibitors were designed so that each respective flanking sequence would fold back upon itself to create a hairpin structure. All of the oligonucleotides were synthesized with a 2′-O-methyl modification at each position and sequences for each of the inhibitors tested are found in Table 5. Subsequently, the functionality of each inhibitor design was compared with short reverse complement (e.g., RC, 22 nts in length), and longer inhibitor designs consisting of the RC plus 5′ and 3′ flanking regions of equivalent length (e.g., 16 nts) that do not form hairpin structures by transfecting each design into HeLa cells (e.g., 50 and 25 nM) and assessing the degree of inhibition using the dual luciferase assay.
TCGAATGACCAACCATACAACCTACTACCTCACTCGAGCTGC(GGCC)
TCGAATGACCTCAACATCAGTCTGATAAGCTACTCGAGCTGC(GGCC)
TCGAATGACCTCAACATCAGTCTGCTCTATAAGCTACTCGAGCTGC(GGCC) †
TCGAATGACCTCACTACCTGCACTGTAAGCACTTTGACCTCGAGCTGC(GGCC)
TCGAATGACCACTATCTGCACTAGATCCACCTTAGACTCGAGCTGC(GGCC)
TCGAATGACCCATCAGTTTTGCATAGATTTGCACAACCTCGAGCTGC(GGCC)
TCGAATGACCCACTACCTGCACTATAAGCACTTTAGTCTCGAGCTGC(GGCC)
TCGAATGACCACTCAGTTTTGCATGGATTTGCACAGCCTCGAGCTGC(GGCC)
TCGAATGACCAACAGGCCGGGACAAGTGCAATACCCTCGAGCTGC(GGCC)
TCGAATGACCACAGTTCTTCAACTGGCAGCTTCTCGAGCTGC(GGCC)
TCGAATGACCTTCGCCCTCTCAACCCACCTTTTCTCGAGCTGC(GGCC)
The underlined sequence on the left is the 5′ overhang on the sense strand (shown) that is the compatible cohesive end for the XhoI site. The antisense strand (not shown) will be the reverse complement of the remainder of the sense strand and will have a 5′ overhang that is the reverse complement of the sequence shown underlined in parentheses to make the compatible cohesive end for the NotI site. Note that the original XhoI site is disabled by the replacement of the final G with an A. A new XhoI site (in bold) is introduced after the miRNA target site before the final NotI site. † The four nucleotides inserted to create an ‘attenuation site’ are indicated in non-bold. For multiple attenuation sites, the XhoI and NotI sites in the new insert are cut, and the identical insert is put in, this can be repeated as many times as desired to insert any number of sites.
The results of the studies are found in
To further test the effects of double stranded regions on inhibitor functionality, the 5′ flanking and 3′ flanking regions for both let7c and miR21 inhibitors were designed so that the respective sequences could anneal to each other. This design, also known as a lollipop design, contains a large loop region that includes the central region associated with a stem having a duplex region. As was the case in Example 1, all of the oligonucleotides were synthesized with a 2′-O-methyl modification at each position. Sequences for each of the inhibitors tested are found in Table 5. The functionality of each inhibitor design was then compared with 1) short reverse complement (e.g., RC, 22 nts in length) 2′-O-methyl inhibitors, and 2) longer inhibitor designs (e.g., 54 nts) comprising the RC (e.g., 22 nts) plus 5′ and 3′ flanking regions of equivalent length (e.g., 16 nts) that do not anneal with each other (e.g., ARB), using the dual luciferase assay.
Let7c inhibitors having the lollipop design described above (e.g., structure 4) were more potent than non-annealing inhibitors of equivalent length (e.g., ARB) and short, reverse complement oligonucleotides (RC) at both of the concentrations tested (see
To further test the effects of double stranded regions on inhibitor functionality, first oligonucleotide sequences containing central (e.g., 22 nts), 5′ flanking (e.g., 14 nts), and 3′ flanking (e.g., 14 nts) regions and targeting miR21 and let7c were designed and synthesized with complementary enhancer sequences capable of annealing to the 5′ and/or 3′ flanking regions. Subsequently, the functionality of inhibitors consisting of 1) the first oligonucleotide plus a first enhancer sequence, 2) first oligonucleotide plus a second enhancer sequence, or 3) the first oligonucleotide plus both a first and second enhancer sequences were compared with single stranded inhibitors of equivalent length. All of the oligonucleotides (e.g., first oligonucleotide, the first enhancer sequence, and the second enhancer sequence) were synthesized with a 2′-O-methyl modification at each position (see Table 5 for sequences) and the functionality of each design was compared using the dual luciferase assay. Smaller RC designs (e.g., 22 nt 2′-O-methylated molecules) were not considered due to the proven absence of functionality under the conditions of the assay (low concentrations, 48 hour time point).
The results for these studies are provided in
To further test the effects of double stranded regions on inhibitor functionality, truncated first oligonucleotide sequences containing a central region targeting miR21 plus either a 5′ or 3′ flanking region targeting miR21 were synthesized along with complementary enhancer sequences to the appropriate region. Subsequently, truncated inhibitors annealed to the appropriate enhancer (e.g., 5′ flanking region—central region+the 5′ enhancer sequence; or central region—3′ flanking region+3′ flanking region) were compared to 1) full length first oligonucleotides (e.g., 5′ flanking region—central region—3′ flanking region), 2) full length first oligonucleotides annealed to 5′ and 3′ enhancers, and 3) simple RC (central region) inhibitors. All of the oligonucleotides were synthesized with a 2′-O-methyl modification at each position and are reported in Table 5.
The results for these studies are provided in
To test the efficacy of the double stranded inhibitor design in the context of hydrophobic conjugates, cholesterol or the fluorescent dye, Cy3, was conjugated to the 5′ or 3′ terminus of enhancer sequences that anneal to the flanking sequences of inhibitors targeting let-7c and miR21. As was the case in all previous experiments, all of the oligonucleotides were synthesized with a 2′-O-methyl modification at each position (see Table 5 for sequences) and overall functionality was assessed using the dual luciferase assay. All of the molecules were transfected into cells using standard lipid transfection protocols and schematic representations of each molecule are shown in
Previous studies have shown that 1) the functionality of single stranded inhibitors is improved by incorporating flanking regions around the reverse complement of the target sequences (i.e., extending the length of the single stranded inhibitor), and 2) not all flanking sequences perform equally. Specifically, flanking sequences that are rich in polypyrimidine sequences were found to be less functional than sequences that more closely reflected mRNA (i.e., also referred to as “arbitrary sequences”). To determine whether these limitations were also a part of the double stranded design, the following designs were generated against miR21:
1. a single stranded inhibitor consisting of first oligonucleotide comprising an 8 nucleotide 5′ flanking region consisting of a polypyrimidine sequence, a central region, and an 8 nucleotide 3′ flanking region consisting of a polypyrimidine sequence.
2. a double stranded inhibitor consisting of first oligonucleotide comprising a polypyrimidine 5′ flanking region that folds back upon itself to form a hairpin, a central region, a polypyrimidine 3′ flanking region that folds back upon itself to form a hairpin.
3. a single stranded inhibitor consisting of first oligonucleotide comprising an 16 nucleotide 5′ flanking region consisting of a polypyrimidine sequence, a central region, and an 16 nucleotide 3′ flanking region consisting of a polypyrimidine sequence.
4. a double stranded inhibitor consisting of first oligonucleotide comprising an 16 nucleotide 5′ flanking region consisting of a polypyrimidine sequence, a central region, and an 16 nucleotide 3′ flanking region consisting of a polypyrimidine sequence, plus the appropriate first and second enhancer sequences that are capable of annealing to the 5′ and 3′ flanking sequences.
In addition, the four designs described above were also generated using “arbitrary sequences” in the flanking regions that mimic natural mRNA nucleotide content. As was the case in all previous experiments, all of the oligonucleotides were synthesized with a 2′-O-methyl modification at each position (see Table 5 for sequences) and overall functionality was assessed using the dual luciferase assay.
The results of these studies are presented in
1. Single stranded inhibitors with polypyrimidine flanking regions exhibit poorer performance than those that have arbitrary sequences.
2. Double stranded inhibitors (generated by addition of enhancer sequences or by incorporation of hairpin designs in the flanking regions perform better than equivalent single stranded inhibitors.
3. Conversion of single stranded inhibitors to double stranded inhibitors eliminates the functional differences that result from flanking region sequence content.
These results demonstrate a novel attribute of the double stranded inhibitor design that is not present in single stranded designs.
To compare the functionality of single stranded inhibitors with double stranded inhibitors in the context of multigene targeting, three inhibitor designs (e.g., simple single stranded RC designs, long single stranded designs, and inhibitors having 5′ and 3′ flanking hairpins) were synthesized to target six different miRNAs (e.g., miR17-5p, miR18a-5p, miR19a, miR20a, miR19b-1, and miR92-1). Subsequently, pools of each design were simultaneously co-transfected into HeLa cells (total concentration=0.8 nM total) along with one of the six respective luciferase reporter constructs containing the appropriate target site in the 3′ UTR. Results of these experiments (see
To test whether double stranded inhibitors containing mixtures of modified and unmodified nucleotides perform well, miR21-targeting inhibitors in which 1) the 3′ flanking region was altered so as to promote annealing with the 5′ flanking region (e.g., structure 4), or 2) the 5′ flanking region was altered so as to promote annealing with the 3′ flanking region (e.g., structure 5), were designed. In all cases the central region was modified with 2′-O-methyl groups, but designs deviated on the basis of whether the stem region was modified or unmodified (see Table 5 for sequences and modification patterns). In addition, unmodified single stranded inhibitors were not included in this study due to the lack of stability of these molecules.
The results of these experiments are presented in
Reporter constructs were designed to determine whether double stranded inhibitors functioned to prevent both target cleavage and translation attenuation. To assess the inhibitor molecules ability to affect miRNA mediated cleavage, an exact complement to the miR21 target site was inserted into the 3′ UTR of the Renilla luciferase gene of the psi-CHECK2 reporter. To determine the effectiveness of double stranded inhibitors on translation attenuation, one (or three) natural attenuation sites were cloned into the 3′ UTR of the luciferase reporter gene (See
The results of these studies are presented in
In cases where a cleavage site was inserted into the 3′ UTR of the reporter gene:
1. short single stranded inhibitors (InmiR21_RC) proved effective only at high concentrations in both B-DNA and luciferase assays.
2. double stranded inhibitors (miR21_struc1) exhibited strong performance over a range of concentrations as detected by both the BDNA-, and luciferase-based assays.
In cases where a single attenuation site was inserted into the 3′ UTR of the reporter gene:
1. in the BDNA assay, neither short single stranded inhibitors or double stranded inhibitors exhibited significant levels of functionality as compared to controls.
2. in the protein assay, short, single stranded inhibitors functioned well at high concentrations, but exhibited significant losses in functionality at lower concentrations.
3. in the protein assay, double stranded inhibitors remained active at all concentrations tested.
In cases where three attenuation sites were inserted into the 3′ UTR of the reporter genes:
1. in the BDNA assay, the short single stranded inhibitors exhibited only minor levels of activity at higher concentrations as compared to controls. In contrast, double stranded inhibitors exhibited higher levels of inhibition at all of the concentrations tested, suggesting that this novel inhibitor design is capable of preventing transcript degradation characteristic of this mode of action.
2. in the protein assay, short, single stranded inhibitors again functioned at higher concentrations, but exhibited a precipitous loss in functionality at lower concentrations. In contrast, double stranded inhibitors of the invention performed strongly at all of the concentrations tested.
These studies demonstrate the superior performance of double stranded inhibitors of the invention in both miRNA-based cleavage and translation attenuation mechanisms.
To examine the longevity of inhibition induced by 1) short 21 nt, 2′-O-methyl modified reverse complement (RC) inhibitors and 2) double stranded 2′-O-methyl inhibitors (e.g., hairpin design, 6 bp stems, 4 nt loops, 21 nt central region) molecules of both designs were synthesized (e.g., let7c target) and transfected into HeLa cells at 50 and 25 nM concentrations, respectively, with the appropriate reporter dual luciferase reporter construct. The higher concentrations used for RC designs were required due to the lower potency of these molecules.
As shown in
Double stranded inhibitors can be delivered to cells to inhibit the action of either an siRNA or miRNA. To test the efficacy of compositions of the invention in this context, an siRNA targeting PPIB and having a 3′ C8 conjugated cholesterol on the sense strand (hPPIB #3 Sense: 5′-ACAGCAAAUUCCAUCGUGU (SEQ ID NO: 17)) was mixed with an inhibitor having the design shown in
The results of these studies are shown in
To test whether cholesterol conjugated double stranded inhibitors could be passively delivered to inhibit RNAi, two different inhibitor molecules directed toward a DBI-targeting shRNA and having different patterns of cholesterol modification, were synthesized (see
The results of these experiments are presented in
To test the effectiveness of short ds inhibitors in a passive delivery system 2.5K HT1080 cells that stably expressed an shRNA targeting DBI were plated in each well of a 96 well plate (DMEM+10% serum). Twenty-four hours later, cells were exposed to a cholesterol conjugated inhibitor (e.g., 1 uM) directed against the DBI targeting shRNA construct in HyClone reduced serum media (sequence of modified strand: 5′-mG.*.mG.*.mA.mA.mU.mG.mA.mG.mC.mU.mG.mA.mA.mA.mG.mG.mG.mA.mC.mU.mU.mC.mC.mA.*.mA.*.mG.C5-Choi (SEQ ID NO: 18); sequence of unmodified strand: 5′ CUUGGAAGUCCCUUUCAGCUCAUUCC (SEQ ID NO: 19); “m”=2′-O-methyl modified nucleotide, “*” refers to phosphorothioate internucleotide linkage). Cells were then cultured for 72 hours, and then DBI expression was analyzed using the branched DNA assay.
The results of this work are shown in
To test the effectiveness of ds inhibitors to target multiple miRNA simultaneously, three inhibitor designs (e.g., reverse complement to the mature miRNA (RC), 54-nucleotide reverse complement (16+RC+16), and a hairpin-containing sequences) were tested for the ability to simultaneously silence all of the members of a polycistronic miRNA cluster encoding 6 separate miRNAs (
The present invention may be embodied in other specific forms without departing from its spirit or essential characteristics. The described embodiments are to be considered in all respects only as illustrative and not restrictive. The scope of the invention is, therefore, indicated by the appended claims rather than by the foregoing description. All changes which come within the meaning and range of equivalency of the claims are to be embraced within their scope. Additionally, various references have been cited herein, and each cited reference is incorporated herein in its entirety by specific reference.
This PCT patent application claims benefit of U.S. Provisional Ser. No. 60/870,815, which was filed on Dec. 19, 2006, U.S. Provisional Ser. No. 60/865,508, which was filed on Nov. 13, 2006, U.S. Provisional Ser. No. 60/826,702, which was filed on Sep. 22, 2006, and U.S. Provisional Ser. No. 60/774,350, which was filed on Feb. 17, 2006, wherein such provisional patent applications are each incorporated in their entirety by specific reference.
| Filing Document | Filing Date | Country | Kind | 371c Date |
|---|---|---|---|---|
| PCT/US07/04223 | 2/16/2007 | WO | 00 | 6/5/2009 |
| Number | Date | Country | |
|---|---|---|---|
| 60870815 | Dec 2006 | US | |
| 60865508 | Nov 2006 | US | |
| 60826702 | Sep 2006 | US | |
| 60774350 | Feb 2006 | US |