COMPOUNDS AND METHODS FOR REDUCING DUX4 EXPRESSION

Abstract

Provided are compounds, pharmaceutical compositions, and methods of use for reducing the amount or activity of DUX4 RNA in a cell or animal, and in certain instances reducing the amount of DUX4 protein in a cell or animal. Such compounds, methods, and pharmaceutical compositions are useful to ameliorate at least one symptom or hallmark of a muscular dystrophy. Such symptoms and hallmarks include muscle weakness and/or muscle wasting in facio, scapula, and/or humeral muscle that can progress to the muscles of the trunk and/or lower limbs. Such muscular dystrophies include Facioscapulohumeral muscular dystrophy (FSHD).

Description

SEQUENCE LISTING

The present application is being filed along with a Sequence Listing in electronic format. The Sequence Listing is provided as a file entitled BIOL0415WOSEQ_ST25.txt, created on Jan. 11, 2022, which is 356 KB in size. The information in the electronic format of the sequence listing is incorporated herein by reference in its entirety.

FIELD

Provided are compounds, methods, and pharmaceutical compositions for reducing the amount or activity of DUX4 RNA in a cell or animal, and in certain instances reducing the amount of DUX4 protein in a cell or animal. Such compounds, methods, and pharmaceutical compositions are useful to ameliorate at least one symptom or hallmark of a muscular dystrophy or a neuromuscular disorder. Such symptoms and hallmarks include muscle weakness and muscle wasting in facio, scapula, and/or humeral muscle that can progress to the muscles of the trunk and/or lower limbs.

Such muscular dystrophies include Facioscapulohumeral muscular dystrophy (FSHD).

BACKGROUND

Facioscapulohumeral muscular dystrophy (FSHD) is a progressive skeletal muscle disorder affecting the facial, scapular, and/or humeral muscles. FSHD is characterized by a clinical variety of symptoms, including but not limited to muscle weakness and muscle wasting in facio, scapula, and/or humeral muscles that can progress to the muscles of the trunk and lower limbs. The disorder is caused by the aberrant expression of double homeobox 4 (DUX4) in skeletal muscle cells.

Currently there is a lack of acceptable options for treating muscular dystrophies such as FSHD. It is therefore an object herein to provide compounds, methods, and pharmaceutical compositions for the treatment of such diseases or disorders.

SUMMARY

Provided herein are compounds, pharmaceutical compositions, and methods of use for reducing the amount or activity of DUX4 RNA, and in certain embodiments reducing the amount of DUX4 protein in a cell or animal. In certain embodiments, the animal has a disease or disorder associated with DUX4. In certain embodiments, the animal has a muscular dystrophy. In certain embodiments, the animal has a neuromuscular disorder. In certain embodiments, the animal has facioscapulohumeral muscular dystrophy (FSHD). In certain embodiments, compounds useful for reducing the amount or activity of DUX4 RNA are oligomeric compounds. In certain embodiments, compounds useful for reducing the amount or activity of DUX4 RNA are modified oligonucleotides.

Also provided are methods useful for ameliorating at least one symptom or hallmark of a disease or disorder associated with DUX4. In certain embodiments, the disease or disorder associated with DUX4 is a neuromuscular disorder. In certain embodiments, the disease or disorder associated with DUX4 is a muscular dystrophy. In certain embodiments, the muscular dystrophy is Facioscapulohumeral muscular dystrophy (FSHD). In certain embodiments, the symptom or hallmark includes muscle weakness and/or muscle wasting in facio, scapula, and/or humeral muscle that can progress to the muscles of the trunk and/or lower limbs.

DETAILED DESCRIPTION

It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive. Herein, the use of the singular includes the plural unless specifically stated otherwise. As used herein, the use of “or” means “and/of” unless stated otherwise. Furthermore, the use of the term “including” as well as other forms, such as “includes” and “included”, is not limiting. Also, terms such as “element” or “component” encompass both elements and components comprising one unit and elements and components that comprise more than one subunit, unless specifically stated otherwise.

The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described. All documents, or portions of documents, cited in this application, including, but not limited to, patents, patent applications, articles, books, and treatises, are hereby expressly incorporated by reference for the portions of the document discussed herein, as well as in their entirety.

Definitions

Unless specific definitions are provided, the nomenclature used in connection with, and the procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well-known and commonly used in the art. Where permitted, all patents, applications, published applications and other publications and other data referred to throughout the disclosure are incorporated by reference herein in their entirety.

Unless otherwise indicated, the following terms have the following meanings:

As used herein, “2′-deoxynucleoside” means a nucleoside comprising a 2′-H(H) deoxyribosyl sugar moiety. In certain embodiments, a 2′-deoxynucleoside is a 2′-β-D-deoxynucleoside and comprises a 2′-β-D-deoxyribosyl sugar moiety, which has the β-D ribosyl configuration as found in naturally occurring deoxyribonucleic acids (DNA). In certain embodiments, a 2′-deoxynucleoside or a nucleoside comprising an unmodified 2′-deoxyribosyl sugar moiety may comprise a modified nucleobase or may comprise an RNA nucleobase (uracil).

As used herein, “2′-MOE” means a 2′-OCH₂CH₂OCH₃ group in place of the 2′—OH group of a ribosyl sugar moiety. A “2′-MOE sugar moiety” or a “2′-O-methoxyethyl sugar moiety” means a sugar moiety with a 2′-OCH₂CH₂OCH₃ group in place of the 2′—OH group of a ribosyl sugar moiety. Unless otherwise indicated, a 2′-MOE sugar moiety is in the f-D configuration. “MOE” means O-methoxyethyl.

As used herein, “2′-MOE nucleoside” or “2′-O(CH₂)₂OCH₃ nucleoside” means a nucleoside comprising a 2′-MOE sugar moiety (or 2′-O(CH₂)₂OCH₃ ribosyl sugar moiety).

As used herein, “2′-OMe” means a 2′-OCH₃ group in place of the 2′—OH group of a ribosyl sugar moiety. A “2′-O-methyl sugar moiety” means a sugar moiety with a 2′-OCH₃ group in place of the 2′—OH group of a ribosyl sugar moiety. Unless otherwise indicated, a 2′-OMe has the β-D ribosyl stereochemical configuration.

As used herein, “2′-OMe nucleoside” means a nucleoside comprising a 2′-OMe sugar moiety.

As used herein, “2′-F” means a 2′-fluoro group in place of the 2′—OH group of a ribosyl sugar moiety. A “2′-F sugar moiety” or “2′-fluororibosyl sugar moiety” means a sugar moiety with a 2′—F group in place of the 2′-OH group of a ribosyl sugar moiety. Unless otherwise indicated, a 2′-F has the β-D ribosyl stereochemical configuration.

As used herein, “2′-F nucleoside” means a nucleoside comprising a 2′-F sugar moiety.

As used herein, “2′-substituted nucleoside” means a nucleoside comprising a 2′-substituted furanosyl sugar moiety. As used herein, “2′-substituted” in reference to a sugar moiety means a sugar moiety comprising at least one 2′-substituent group other than H or OH.

As used herein, “3′ target site” refers to the 3′-most nucleotide of a target nucleic acid which is complementary to an antisense oligonucleotide, when the antisense oligonucleotide is hybridized to the target nucleic acid.

As used herein, “5′ target site” refers to the 5′-most nucleotide of a target nucleic acid which is complementary to an antisense oligonucleotide, when the antisense oligonucleotide is hybridized to the target nucleic acid.

As used herein, “5-methylcytosine” means a cytosine modified with a methyl group attached to the 5 position. A 5-methylcytosine is a modified nucleobase.

As used herein, “abasic sugar moiety” means a sugar moiety of a nucleoside that is not attached to a nucleobase. Such abasic sugar moieties are sometimes referred to in the art as “abasic nucleosides.”

As used herein, “administration” or “administering” means providing a pharmaceutical agent or composition to an animal.

As used herein, “ameliorate” in reference to a treatment means improvement in at least one symptom or hallmark relative to the same symptom or hallmark in the absence of the treatment. In certain embodiments, amelioration is the reduction in the severity or frequency of a symptom or hallmark or the delayed onset or slowing of progression in the severity or frequency of a symptom or hallmark. In certain embodiments, the symptom or hallmark is muscle weakness or muscle wasting in facio, scapula, and/or humeral muscle that can progress to the muscles of the trunk and lower limbs. The progression or severity of indicators may be determined by subjective or objective measures, which are known to those skilled in the art.

As used herein, “animal” means a human or non-human animal.

As used herein, “antisense activity” means any detectable and/or measurable change attributable to the hybridization of an antisense compound to its target nucleic acid. In certain embodiments, antisense activity is a decrease in the amount or expression of a target nucleic acid or protein encoded by such target nucleic acid compared to target nucleic acid levels or target protein levels in the absence of the antisense compound.

As used herein, “antisense agent” means an antisense compound and optionally one or more additional features, such as a sense compound.

As used herein, “antisense compound” means an antisense oligonucleotide and optionally one or more additional features, such as a conjugate group.

As used herein, “sense compound” means a sense oligonucleotide and optionally one or more additional features, such as a conjugate group.

As used herein, “antisense oligonucleotide” means an oligonucleotide, including the oligonucleotide portion of an antisense compound, that is capable of hybridizing to a target nucleic acid and is capable of at least one antisense activity. Antisense oligonucleotides include but are not limited to antisense RNAi oligonucleotides and antisense RNase H oligonucleotides.

As used herein, “sense oligonucleotide” means an oligonucleotide, including the oligonucleotide portion of a sense compound, that is capable of hybridizing to an antisense oligonucleotide.

As used herein, “bicyclic nucleoside” or “BNA” means a nucleoside comprising a bicyclic sugar moiety.

As used herein, “bicyclic sugar” or “bicyclic sugar moiety” means a modified sugar moiety comprising two rings, wherein the second ring is formed via a bridge connecting two of the atoms in the first ring thereby forming a bicyclic structure. In certain embodiments, the first ring of the bicyclic sugar moiety is a furanosyl sugar moiety. In certain embodiments, the furanosyl sugar moiety is a ribosyl sugar moiety. In certain embodiments, the bicyclic sugar moiety does not comprise a furanosyl sugar moiety.

As used herein, “blunt” or “blunt ended” in reference to an oligomeric duplex formed by two oligonucleotides means that there are no terminal unpaired nucleotides (i.e. no overhanging nucleotides). One or both ends of a double-stranded RNAi agent can be blunt.

As used herein, “cell-targeting moiety” means a conjugate group or portion of a conjugate group that is capable of binding to a particular cell type or particular cell types.

As used herein, “cerebrospinal fluid” or “CSF” means the fluid filling the space around the brain and spinal cord. “Artificial cerebrospinal fluid” or “aCSF” means a prepared or manufactured fluid that has certain properties (e.g., osmolarity, pH, and/or electrolytes) similar to cerebrospinal fluid and is biocompatible with CSF.

As used herein, “chirally enriched population” means a plurality of molecules of identical molecular formula, wherein the number or percentage of molecules within the population that contain a particular stereochemical configuration at a particular chiral center is greater than the number or percentage of molecules expected to contain the same particular stereochemical configuration at the same particular chiral center within the population if the particular chiral center were stereorandom. Chirally enriched populations of molecules having multiple chiral centers within each molecule may contain one or more stereorandom chiral centers. In certain embodiments, the molecules are modified oligonucleotides. In certain embodiments, the molecules are oligomeric compounds comprising modified oligonucleotides.

As used herein, “cleavable moiety” means a bond or group of atoms that is cleaved under physiological conditions, for example, inside a cell, an animal, or a human.

As used herein, “complementary” in reference to an oligonucleotide means that at least 70% of the nucleobases of the oligonucleotide or one or more portions thereof and the nucleobases of another nucleic acid or one or more portions thereof are capable of hydrogen bonding with one another when the nucleobase sequence of the oligonucleotide and the other nucleic acid are aligned in opposing directions. As used herein, “complementary nucleobases” means nucleobases that are capable of forming hydrogen bonds with one another. Complementary nucleobase pairs include adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), 5-methylcytosine (^mC) and guanine (G). Certain modified nucleobases that pair with natural nucleobases or with other modified nucleobases are known in the art. For example, inosine can pair with adenosine, cytosine, or uracil. Complementary oligonucleotides and/or nucleic acids need not have nucleobase complementarity at each nucleoside. Rather, some mismatches are tolerated. As used herein, “fully complementary” or “100% complementary” in reference to an oligonucleotide, or a portion thereof, means that the oligonucleotide, or portion thereof, is complementary to another oligonucleotide or nucleic acid at each nucleobase of the shorter of the two oligonucleotides, or at each nucleoside if the oligonucleotides are the same length.

As used herein, “complementary region” in reference to an oligonucleotide is the range of nucleobases of the oligonucleotide that is complementary with a second oligonucleotide or target nucleic acid.

As used herein, “conjugate group” means a group of atoms that is directly attached to an oligonucleotide. Conjugate groups include a conjugate moiety and a conjugate linker that attaches the conjugate moiety to the oligonucleotide.

As used herein, “conjugate linker” means a single bond or a group of atoms comprising at least one bond that connects a conjugate moiety to an oligonucleotide.

As used herein, “conjugate moiety” means a group of atoms that is attached to an oligonucleotide via a conjugate linker.

As used herein, “contiguous” in the context of an oligonucleotide refers to nucleosides, nucleobases, sugar moieties, or internucleoside linkages that are immediately adjacent to each other. For example, “contiguous nucleobases” means nucleobases that are immediately adjacent to each other in a sequence.

As used herein, “constrained ethyl” or “cEt” or “cEt modified sugar moiety” means a β-D ribosyl bicyclic sugar moiety wherein the second ring of the bicyclic sugar is formed via a bridge connecting the 4′-carbon and the 2′-carbon of the β-D ribosyl sugar moiety, wherein the bridge has the formula 4′-CH(CH₃)—O-2′, and wherein the methyl group of the bridge is in the S configuration.

As used herein, “cEt nucleoside” means a nucleoside comprising a cEt modified sugar moiety.

As used herein, “deoxy region” means a region of 5-12 contiguous nucleotides, wherein at least 70% of the nucleosides are 2′-β-D-deoxynucleosides. In certain embodiments, each nucleoside is selected from a 2′-β-D-deoxynucleoside, a bicyclic nucleoside, and a 2′-substituted nucleoside. In certain embodiments, a deoxy region supports RNase H activity. In certain embodiments, a deoxy region is the gap or internal region of a gapmer.

As used herein, “diluent” means an ingredient in a composition that lacks pharmacological activity, but is pharmaceutically necessary or desirable. For example, the diluent in an injected composition can be a liquid, e.g. aCSF, PBS, or saline solution.

As used herein, “double-stranded” in reference to a region or an oligonucleotide means a duplex formed by complementary strands of nucleic acids (including, but not limited to oligonucleotides) hybridized to one another. In certain embodiments, the two strands of a double-stranded region are separate molecules. In certain embodiments, the two strands are regions of the same molecule that has folded onto itself (e.g., a hairpin structure).

As used herein, “duplex” or “duplex region” means the structure formed by two oligonucleotides or portions thereof that are hybridized to one another.

As used herein, “gapmer” means a modified oligonucleotide comprising an internal region having a plurality of nucleosides that support RNase H cleavage positioned between external regions having one or more nucleosides, wherein the nucleosides comprising the internal region are chemically distinct from the nucleoside or nucleosides comprising the external regions. The internal region may be referred to as the “gap” and the external regions may be referred to as the “wings” or “wing segments.” In certain embodiments, the internal region is a deoxy region. The positions of the internal region or gap refer to the order of the nucleosides of the internal region and are counted starting from the 5′-end of the internal region. Unless otherwise indicated, “gapmer” refers to a sugar motif. In certain embodiments, each nucleoside of the gap is a 2′-β-D-deoxynucleoside. In certain embodiments, the gap comprises one 2′-substituted nucleoside at position 1, 2, 3, 4, or 5 of the gap, and the remainder of the nucleosides of the gap are 2′-β-D-deoxynucleosides. As used herein, the term “MOE gapmer” indicates a gapmer having a gap comprising 2′-β-D-deoxynucleosides and wings comprising 2′-MOE nucleosides. As used herein, the term “mixed wing gapmer” indicates a gapmer having wings comprising modified nucleosides comprising at least two different sugar modifications. Unless otherwise indicated, a gapmer may comprise one or more modified internucleoside linkages and/or modified nucleobases and such modifications do not necessarily follow the gapmer pattern of the sugar modifications.

As used herein, “hotspot region” is a range of nucleobases on a target nucleic acid that is amenable to oligomeric agent or oligomeric compound-mediated reduction of the amount or activity of the target nucleic acid.

As used herein, “hybridization” means the annealing of oligonucleotides and/or nucleic acids. While not limited to a particular mechanism, the most common mechanism of hybridization involves hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleobases. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, an antisense compound and a nucleic acid target. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, an oligonucleotide and a nucleic acid target.

As used herein, “internucleoside linkage” means the covalent linkage between contiguous nucleosides in an oligonucleotide. As used herein, “modified internucleoside linkage” means any internucleoside linkage other than a phosphodiester internucleoside linkage. “Phosphorothioate internucleoside linkage” or “PS internucleoside linkage” is a modified internucleoside linkage in which one of the non-bridging oxygen atoms of a phosphodiester internucleoside linkage is replaced with a sulfur atom.

As used herein, “inverted nucleoside” means a nucleotide having a 3′ to 3′ and/or 5′ to 5′ internucleoside linkage, as shown herein.

As used herein, “inverted sugar moiety” means the sugar moiety of an inverted nucleoside or an abasic sugar moiety having a 3′ to 3′ and/or 5′ to 5′ internucleoside linkage.

As used herein, “linked nucleosides” are nucleosides that are connected in a contiguous sequence (i.e., no additional nucleosides are presented between those that are linked).

As used herein, “linker-nucleoside” means a nucleoside that links, either directly or indirectly, an oligonucleotide to a conjugate moiety. Linker-nucleosides are located within the conjugate linker of an oligomeric compound. Linker-nucleosides are not considered part of the oligonucleotide portion of an oligomeric compound even if they are contiguous with the oligonucleotide.

As used herein, “mismatch” or “non-complementary” means a nucleobase of a first nucleic acid sequence that is not complementary with the corresponding nucleobase of a second nucleic acid sequence or target nucleic acid when the first and second nucleic acid sequences are aligned in opposing directions.

As used herein, “motif” means the pattern of unmodified and/or modified sugar moieties, nucleobases, and/or internucleoside linkages, in an oligonucleotide.

As used herein, “non-bicyclic modified sugar moiety” means a modified sugar moiety that comprises a modification, such as a substituent, that does not form a bridge between two atoms of the sugar to form a second ring.

As used herein, “nucleobase” means an unmodified nucleobase or a modified nucleobase. As used herein an “unmodified nucleobase” is adenine (A), thymine (T), cytosine (C), uracil (U), or guanine (G). As used herein, a “modified nucleobase” is a group of atoms other than unmodified A, T, C, U, or G capable of pairing with at least one unmodified nucleobase. A “5-methylcytosine” is a modified nucleobase. A universal base is a modified nucleobase that can pair with any one of the five unmodified nucleobases.

As used herein, “nucleobase sequence” means the order of contiguous nucleobases in a target nucleic acid or oligonucleotide independent of any sugar or internucleoside linkage modification.

As used herein, “nucleoside” means a compound, or fragment of a compound, comprising a nucleobase and a sugar moiety. The nucleobase and sugar moiety are each, independently, unmodified or modified.

As used herein, “modified nucleoside” means a nucleoside comprising a modified nucleobase and/or a modified sugar moiety. Modified nucleosides include abasic nucleosides, which lack a nucleobase. “Linked nucleosides” are nucleosides that are connected in a contiguous sequence (i.e., no additional nucleosides are presented between those that are linked).

As used herein, “oligomeric agent” means an oligomeric compound and optionally one or more additional features, such as a second oligomeric compound. An oligomeric agent may be a single-stranded oligomeric compound or may be an oligomeric duplex formed by two complementary oligomeric compounds.

As used herein, “oligomeric compound” means an oligonucleotide and optionally one or more additional features, such as a conjugate group or terminal group. An oligomeric compound may be paired with a second oligomeric compound that is complementary to the first oligomeric compound or may be unpaired. A “singled-stranded oligomeric compound” is an unpaired oligomeric compound.

The term “oligomeric duplex” means a duplex formed by two oligomeric compounds having complementary nucleobase sequences. Each oligomeric compound of an oligomeric duplex may be referred to as a “duplexed oligomeric compound.”

As used herein, “oligonucleotide” means a strand of linked nucleosides connected via internucleoside linkages, wherein each nucleoside and internucleoside linkage may be modified or unmodified. Unless otherwise indicated, oligonucleotides consist of 8-50 linked nucleosides. As used herein, “modified oligonucleotide” means an oligonucleotide, wherein at least one nucleoside or internucleoside linkage is modified. As used herein, “unmodified oligonucleotide” means an oligonucleotide that does not comprise any nucleoside modifications or internucleoside modifications. An oligonucleotide may be paired with a second oligonucleotide that is complementary to the oligonucleotide or it may be unpaired. A “single-stranded oligonucleotide” is an unpaired oligonucleotide. A “double-stranded oligonucleotide” is an oligonucleotide that is paired with a second oligonucleotide.

As used herein, “modified oligonucleotide” means an oligonucleotide, wherein at least one nucleoside or internucleoside linkage is modified. As used herein, “unmodified oligonucleotide” means an oligonucleotide that does not comprise any nucleoside modifications or internucleoside modifications.

As used herein, “pharmaceutically acceptable carrier or diluent” means any substance suitable for use in administering to an animal. Certain such carriers enable pharmaceutical compositions to be formulated as, for example, tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspension and lozenges for the oral ingestion by an animal. In certain embodiments, a pharmaceutically acceptable carrier or diluent is sterile water, sterile saline, sterile buffer solution or sterile artificial cerebrospinal fluid.

As used herein “pharmaceutically acceptable salts” means physiologically and pharmaceutically acceptable salts of compounds. Pharmaceutically acceptable salts retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto.

As used herein “pharmaceutical composition” means a mixture of substances suitable for administering to a subject. For example, a pharmaceutical composition may comprise an oligomeric compound and a sterile aqueous solution. In certain embodiments, a pharmaceutical composition shows activity in free uptake assay in certain cell lines.

As used herein “prodrug” means a therapeutic agent in a first form outside the body that is converted to a second form within an animal or cells thereof. Typically, conversion of a prodrug within the animal is facilitated by the action of an enzymes (e.g., endogenous or viral enzyme) or chemicals present in cells or tissues and/or by physiologic conditions. In certain embodiments, the first form of the prodrug is less active than the second form.

As used herein, “reducing or inhibiting the amount or activity” refers to a reduction or blockade of the transcriptional expression or activity relative to the transcriptional expression or activity in an untreated or control sample and does not necessarily indicate a total elimination of transcriptional expression or activity.

As used herein, “RNA” means an RNA transcript and includes pre-mRNA and mature mRNA unless otherwise specified.

As used herein, “RNAi agent” means an antisense agent that acts, at least in part, through RISC or Ago2 to modulate a target nucleic acid and/or protein encoded by a target nucleic acid. RNAi agents include, but are not limited to double-stranded siRNA, single-stranded RNA (ssRNAi), and microRNA, including microRNA mimics. RNAi agents may comprise conjugate groups and/or terminal groups. In certain embodiments, an RNAi agent modulates the amount, activity, and/or splicing of a target nucleic acid. The term RNAi agent excludes antisense agents that act through RNase H.

As used herein, “RNase H agent” means an antisense agent that acts through RNase H to modulate a target nucleic acid and/or protein encoded by a target nucleic acid. In certain embodiments, RNase H agents are single-stranded. In certain embodiments, RNase H agents are double-stranded. RNase H agents may comprise conjugate groups and/or terminal groups. In certain embodiments, an RNase H agent modulates the amount and/or activity of a target nucleic acid. The term RNase H agent excludes antisense agents that act principally through RISC/Ago2.

As used herein, “antisense RNase H oligonucleotide” means an oligonucleotide comprising a region that is complementary to a target sequence, and which includes at least one chemical modification suitable for RNase H-mediated nucleic acid reduction.

As used herein, “antisense RNAi oligonucleotide” means an oligonucleotide comprising a region that is complementary to a target sequence, and which includes at least one chemical modification suitable for RNAi-mediated nucleic acid reduction.

As used herein, “self-complementary” in reference to an oligonucleotide means an oligonucleotide that at least partially hybridizes to itself.

As used herein, “single-stranded” means a nucleic acid (including but not limited to an oligonucleotide) that is unpaired and is not part of a duplex. Single-stranded compounds are capable of hybridizing with complementary nucleic acids to form duplexes, at which point they are no longer single-stranded.

As used herein, “stabilized phosphate group” means a 5′-phosphate analog that is metabolically more stable than a 5′-phosphate as naturally occurs on DNA or RNA.

As used herein, “standard in vitro assay” means the assay described in Examples 1, 2, or 13 and reasonable variations thereof. In certain embodiments, “standard in vitro RNase H assay” means an in vitro assay for use with RNase H agents, and can include the assay described in Example 1 or Example 2 and reasonable variations thereof. In certain embodiments, “standard in vitro RNAi assay” means an in vitro assay for use with RNAi agents, and can include the assay described in Example 13 and reasonable variations thereof.

As used herein, “standard in vivo assay” means the assay described in Example 6 and reasonable variations thereof.

As used herein, “stereorandom chiral center” in the context of a population of molecules of identical molecular formula means a chiral center having a random stereochemical configuration. For example, in a population of molecules comprising a stereorandom chiral center, the number of molecules having the (S) configuration of the stereorandom chiral center may be but is not necessarily the same as the number of molecules having the (R) configuration of the stereorandom chiral center. The stereochemical configuration of a chiral center is considered random when it is the result of a synthetic method that is not designed to control the stereochemical configuration. In certain embodiments, a stereorandom chiral center is a stereorandom phosphorothioate internucleoside linkage.

As used herein, “subject” means a human or non-human animal. In certain embodiments, the subject is a human.

As used herein, “sugar moiety” means an unmodified sugar moiety or a modified sugar moiety. As used herein, “unmodified sugar moiety” means a 2′-OH(H) β-D-ribosyl sugar moiety, as found in RNA (an “unmodified RNA sugar moiety”), or a 2′-H(H) β-D-deoxyribosyl sugar moiety, as found in DNA (an “unmodified DNA sugar moiety”). Unmodified sugar moieties have one hydrogen at each of the 1′, 3′, and 4′ positions, an oxygen at the 3′ position, and two hydrogens at the 5′ position. As used herein, “modified sugar moiety” or “modified sugar” means a modified furanosyl sugar moiety or a sugar surrogate.

As used herein, “sugar surrogate” means a modified sugar moiety having other than a furanosyl moiety that can link a nucleobase to another group, such as an internucleoside linkage, conjugate group, or terminal group in an oligonucleotide. Modified nucleosides comprising sugar surrogates can be incorporated into one or more positions within an oligonucleotide and such oligonucleotides are capable of hybridizing to complementary oligomeric compounds or target nucleic acids.

As used herein, “symptom or hallmark” means any physical feature or test result that indicates the existence or extent of a disease or disorder. In certain embodiments, a symptom is apparent to a subject or to a medical professional examining or testing said subject. In certain embodiments, a hallmark is apparent upon invasive diagnostic testing, including, but not limited to, post-mortem tests. In certain embodiments, symptoms and hallmarks include muscle weakness and muscle wasting in facio, scapula, and/or humeral muscle that can progress to the muscles of the trunk and lower limbs.

As used herein, “target nucleic acid” and “target RNA” mean a nucleic acid that an antisense compound is designed to affect. Target RNA means an RNA transcript and includes pre-mRNA and mature mRNA unless otherwise specified.

As used herein, “target region” means a portion of a target nucleic acid to which an oligomeric compound is designed to hybridize.

As used herein, “terminal group” means a chemical group or group of atoms that is covalently linked to a terminus of an oligonucleotide.

As used herein, “treating” means improving a subject's disease or condition by administering an oligomeric agent or oligomeric compound described herein. In certain embodiments, treating a subject improves a symptom relative to the same symptom in the absence of the treatment. In certain embodiments, treatment reduces in the severity or frequency of a symptom, or delays the onset of a symptom, slows the progression of a symptom, or slows the severity or frequency of a symptom.

As used herein, “therapeutically effective amount” means an amount of a pharmaceutical agent or composition that provides a therapeutic benefit to an animal. For example, a therapeutically effective amount improves a symptom of a disease.

CERTAIN EMBODIMENTS

The present disclosure provides the following non-limiting numbered embodiments:

Embodiment 1. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides wherein the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to an equal length portion of a DUX4 RNA, and wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage.

Embodiment 2. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides and having a nucleobase sequence comprising at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 nucleobases of any of SEQ ID NOs: 20-172, wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage.

Embodiment 3. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides and having a nucleobase sequence comprising at least 12, at least 13, at least 14, at least 15, or 16 nucleobases of any of SEQ ID NOs: 173-1171, wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage.

Embodiment 4. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides and having a nucleobase sequence comprising at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or 23 nucleobases of any of SEQ ID NOs: 1176-1241, 1308, 1310-1473, or 1638, wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage.

Embodiment 5. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or 23 nucleobases complementary to:

• • nucleobases 2697-2730 of SEQ ID NO: 1;
  • nucleobases 2756-2778 of SEQ ID NO: 1;
  • nucleobases 2732-2760 of SEQ ID NO: 1;
  • nucleobases 2783-2806 of SEQ ID NO: 1 and/or nucleobases 10-33 of SEQ ID NO: 2;
  • nucleobases 2833-2853 of SEQ ID NO: 1 and/or nucleobases 60-80 of SEQ ID NO: 2;
  • nucleobases 2953-2975 of SEQ ID NO: 1 and/or nucleobases 180-202 of SEQ ID NO: 2;
  • nucleobases 3097-3136 of SEQ ID NO: 1 and/or nucleobases 324-363 of SEQ ID NO: 2;
  • nucleobases 3174-3210 of SEQ ID NO: 1 and/or nucleobases 401-437 of SEQ ID NO: 2;
  • nucleobases 3361-3400 of SEQ ID NO: 1 and/or nucleobases 588-627 of SEQ ID NO: 2;
  • nucleobases 3883-3926 of SEQ ID NO: 1 and/or nucleobases 1110-1153 of SEQ ID NO: 2;
  • nucleobases 4007-4029 of SEQ ID NO: 1 and/or nucleobases 1234-1256 of SEQ ID NO: 2;
  • nucleobases 4103-4134 of SEQ ID NO: 1 and/or nucleobases 1330-1361 of SEQ ID NO: 2;
  • nucleobases 4503-4522 of SEQ ID NO: 1;
  • nucleobases 4509-4530 of SEQ ID NO: 1;
  • nucleobases 4667-4694 of SEQ ID NO: 1 and/or nucleobases 1532-1559 of SEQ ID NO: 2;
  • nucleobases 4828-4850 of SEQ ID NO: 1 and/or nucleobases 1693-1710 of SEQ ID NO: 2;
  • nucleobases 768-787 of SEQ ID NO: 2;
  • nucleobases 2955-2984 of SEQ ID NO: 1 and/or nucleobases 182-211 of SEQ ID NO: 2;
  • nucleobases 3099-3128 of SEQ ID NO: 1 and/or nucleobases 326-355 of SEQ ID NO: 2;
  • nucleobases 3171-3209 of SEQ ID NO: 1 and/or nucleobases 398-436 of SEQ ID NO: 2; or
  • nucleobases 3859-3888 of SEQ ID NO: 1 and/or nucleobases 1086-1115 of SEQ ID NO: 2;
  • wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage.

Embodiment 6. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or 23 nucleobases of a sequence selected from:

• • SEQ ID NOs:24, 98, 318-320, 359-361, 398-400, 438-440, 852, and 857;
  • SEQ ID NOs: 323, 324, 364, 404, 443, and 444;
  • SEQ ID NOs: 73, 148, 327, 367, 407, 408, 208, and 447;
  • SEQ ID NOs: 299, 340, 379, and 420-421;
  • SEQ ID NOs: 300-301, 341-342, 380, 422, and 1002;
  • SEQ ID NOs: 331, 332, 370, 371, 412, 413, 451, and 452;
  • SEQ ID NOs: 326, 366, 406, 446, and 777;
  • SEQ ID NOs: 100, 186, 321, 362, 645, 719, 791, 796, 867, 873, 943, 946, and 1019;
  • SEQ ID NOs: 802, 880, and 1088-1090;
  • SEQ ID NOs: 668, 742, 815, 893, 966, and 1040;
  • SEQ ID NOs: 673, 747-748, 822, 898, 971, and 1045;
  • SEQ ID NOs: 39, 678-681, 753-755, 827-829, 903-905, 976-978, 1050-1052, and 1135-1136;
  • SEQ ID NOs: 117, 684, 758, 1056, and 1141-1144;
  • SEQ ID NOs: 123, 695-697, 769-771, 843, 844, 919, 920, 992, 993, 1066, and 1067;
  • SEQ ID NOs: 67, 141, 646-647, 720-721, 793-794, 870-871, 945, 947-948, and 1020-1021;
  • SEQ ID NOs: 652, 726, 799, 876, 953, 1026, and 1079;
  • SEQ ID NOs: 163, 658, 732, 883, 957, 1031, and 1105-1112;
  • SEQ ID NOs: 1424 and 1425;
  • SEQ ID NOs: 1214 and 1410;
  • SEQ ID NOs: 1405, 1209, and 1210; and
  • SEQ ID NOs: 1197 and 1335.

Embodiment 7. The oligomeric compound of any of embodiments 1-6, wherein the modified oligonucleotide has a nucleobase sequence that is at least 85%, at least 90%, at least 95%, or 100% complementary to any of the nucleobase sequences of SEQ ID NOs: 1-4 when measured across the entire nucleobase sequence of the modified oligonucleotide.

Embodiment 8. The oligomeric compound of any of embodiments 1-7, wherein the modified oligonucleotide consists of 12 to 20, 12 to 25, 12 to 30, 12 to 50, 13 to 20, 13 to 25, 13 to 30, 13 to 50, 14 to 20, 14 to 25, 14 to 30, 14 to 50, 15 to 20, 15 to 25, 15 to 30, 15 to 50, 16 to 18, 16 to 20, 16 to 25, 16 to 30, 16 to 50, 17 to 20, 17 to 25, 17 to 30, 17 to 50, 18 to 20, 18 to 25, 18 to 30, 18 to 50, 19 to 20, 19 to 25, 19 to 30, 19 to 50, 20 to 25, 20 to 30, 20 to 50, 21 to 25, 21 to 30, 21 to 50, 22 to 25, 22 to 30, 22 to 50, 23 to 25, 23 to 30, or 23 to 50 linked nucleosides.

Embodiment 9. The oligomeric compound of any of embodiments 1-8, wherein the modified oligonucleotide comprises at least one modified nucleoside.

Embodiment 10. The oligomeric compound of embodiment 9, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a modified sugar moiety.

Embodiment 11. The oligomeric compound of embodiment 10, wherein the modified sugar moiety comprises a bicyclic sugar moiety.

Embodiment 12. The oligomeric compound of embodiment 11, wherein the bicyclic sugar moiety comprises a 2′-4′ bridge selected from —O—CH₂—; and —O—CH(CH₃)—.

Embodiment 13. The oligomeric compound of any of embodiments 10-12, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a non-bicyclic modified sugar moiety.

Embodiment 14. The oligomeric compound of embodiment 13, wherein the non-bicyclic modified sugar moiety is a 2′-O(CH₂)₂OCH₃ ribosyl sugar moiety, a cEt sugar moiety, a 2′-OMe sugar moiety, or a 2′-F sugar moiety.

Embodiment 15. The oligomeric compound of any of embodiments 10-14, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a sugar surrogate.

Embodiment 16. The oligomeric compound of embodiment 15, wherein the sugar surrogate is any of morpholino, modified morpholino, PNA, THP, and F-HNA.

Embodiment 17. The oligomeric compound of any of embodiments 1-16, wherein the modified oligonucleotide has a sugar motif comprising:

• • a 5′-region consisting of 1-6 linked 5′-region nucleosides;
  • a central region consisting of 6-10 linked central region nucleosides; and
  • a 3′-region consisting of 1-6 linked 3′-region nucleosides; wherein each of the 5′-region nucleosides and each of the 3′-region nucleosides comprises a modified sugar moiety and each of the central region nucleosides comprises a 2′-β-D-deoxyribosyl sugar moiety.

Embodiment 18. The oligomeric compound of any of embodiments 1-16, wherein the modified oligonucleotide has a sugar motif comprising:

• • a 5′-region consisting of 3 linked 5′-region nucleosides;
  • a central region consisting of 10 linked central region nucleosides; and
  • a 3′-region consisting of 3 linked 3′-region nucleosides; wherein each of the 5′-region nucleosides and each of the 3′-region nucleosides comprises a modified sugar moiety and each of the central region nucleosides comprises a 2′-β-D-deoxyribosyl sugar moiety.

Embodiment 19. The oligomeric compound of any of embodiments 1-16, wherein the modified oligonucleotide has a sugar motif comprising:

• • a 5′-region consisting of 5 linked 5′-region nucleosides;
  • a central region consisting of 10 linked central region nucleosides; and
  • a 3′-region consisting of 5 linked 3′-region nucleosides; wherein each of the 5′-region nucleosides and each of the 3′-region nucleosides comprises a modified sugar moiety and each of the central region nucleosides comprises a 2′-β-D-deoxyribosyl sugar moiety.

Embodiment 20. The oligomeric compound of embodiment 17, wherein the modified oligonucleotide has a 5′-region consisting of 3 linked 5′-region nucleosides;

• • a central region consisting of 10 linked central region nucleosides; and
  • a 3′-region consisting of 3 linked 3′-region nucleosides; wherein
  • each of the 5′-region nucleosides and each of the 3′-region nucleosides comprises a cEt sugar moiety and each of the central region nucleosides comprises a 2′-β-D-deoxyribosyl sugar moiety.

Embodiment 21. The oligomeric compound of embodiment 17, wherein the modified oligonucleotide has

• • a 5′-region consisting of 5 linked 5′-region nucleosides;
  • a central region consisting of 10 linked central region nucleosides; and
  • a 3′-region consisting of 5 linked 3′-region nucleosides; wherein
  • each of the 5′-region nucleosides and each of the 3′-region nucleosides comprises a 2′-O(CH₂)₂OCH₃ ribosyl sugar moiety and each of the central region nucleosides comprises a 2′-β-D-deoxyribosyl sugar moiety.

Embodiment 22. The oligomeric compound of any of embodiments 1-21, wherein the modified oligonucleotide comprises at least one modified internucleoside linkage.

Embodiment 23. The oligomeric compound of embodiment 22, wherein each internucleoside linkage of the modified oligonucleotide is a modified internucleoside linkage.

Embodiment 24. The oligomeric compound of embodiment 22 or embodiment 23, wherein at least one internucleoside linkage is a phosphorothioate internucleoside linkage.

Embodiment 25. The oligomeric compound of embodiment 23, wherein each internucleoside linkage of the modified oligonucleotide is a phosphorothioate internucleoside linkage.

Embodiment 26. The oligomeric compound of embodiment 22 or embodiment 24, wherein each internucleoside linkage is independently selected from a phosphodiester internucleoside linkage and a phosphorothioate internucleoside linkage.

Embodiment 27. The oligomeric compound of any of embodiments 22-26, wherein the internucleoside linkage motif of the modified oligonucleotide is selected from: 5′-sssssssssssssssssss-3′ and 5′-sssssssssssssss-3′, wherein each “s” represents a phosphorothioate internucleoside linkage.

Embodiment 28. The oligomeric compound of any of embodiments 1-27, wherein the modified oligonucleotide comprises a modified nucleobase.

Embodiment 29. The oligomeric compound of embodiment 28, wherein the modified nucleobase is a 5-methylcytosine.

Embodiment 30. The oligomeric compound of any of embodiments 1-29, wherein the modified oligonucleotide consists of 12-30, 12-22, 12-20,14-18, 14-20, 15-17, 15-25, 16-20, 18-22 or 18-20 linked nucleosides, or a pharmaceutically acceptable salt thereof.

Embodiment 31. The oligomeric compound of embodiment 30, which is a pharmaceutically acceptable salt comprising one or more cations selected from sodium, potassium, calcium, and magnesium.

Embodiment 32. The oligomeric compound of any of embodiments 1-31, wherein the modified oligonucleotide consists of 16 linked nucleosides.

Embodiment 33. The oligomeric compound of any of embodiments 1-31, wherein the modified oligonucleotide consists of 20 linked nucleosides.

Embodiment 34. The oligomeric compound of any of embodiments 1-31, wherein the modified oligonucleotide consists of 23 linked nucleosides.

Embodiment 35. The oligomeric compound of any of embodiments 1-33, wherein the oligomeric compound activates RNase H.

Embodiment 36. The oligomeric compound of any of embodiments 1-35, consisting of the modified oligonucleotide.

Embodiment 37. The oligomeric compound of any of embodiments 1-35, consisting of the modified oligonucleotide and a conjugate group.

Embodiment 38. The oligomeric compound of embodiment 37, wherein the conjugate group comprises a conjugate moiety and a conjugate linker.

Embodiment 39. The oligomeric compound of embodiment 38, wherein the conjugate moiety is a lipophilic group.

Embodiment 40. The oligomeric compound of embodiment 38, wherein the conjugate moiety is selected from a C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, C10 alkenyl, C21 alkenyl, C19 alkenyl, C18 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, C11 alkenyl, C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 alkenyl, and C5 alkenyl.

Embodiment 41. The oligomeric compound of embodiment 38, wherein the conjugate moiety is a 6-palmitamidohexyl conjugate moiety.

Embodiment 42. The oligomeric compound of any of embodiments 38-41, wherein the conjugate linker is a phosphodiester linker.

Embodiment 43. The oligomeric compound of any of embodiments 37-42, wherein the conjugate group has the following structure:

Embodiment 44. The oligomeric compound of any of embodiments 38-43, wherein the conjugate linker consists of a single bond.

Embodiment 45. The oligomeric compound of any of embodiments 38-44, wherein the conjugate linker is cleavable.

Embodiment 46. The oligomeric compound of any of embodiments 38-45, wherein the conjugate linker comprises 1-3 linker-nucleosides.

Embodiment 47. The oligomeric compound of any of embodiments 37-46, wherein the conjugate group is attached to the modified oligonucleotide at the 5′-end of the modified oligonucleotide.

Embodiment 48. The oligomeric compound of any of embodiments 37-46, wherein the conjugate group is attached to the modified oligonucleotide at the 3′-end of the modified oligonucleotide.

Embodiment 49. The oligomeric compound of any of embodiments 1-48, comprising a terminal group.

Embodiment 50. The oligomeric compound of any of embodiments 1-45 or 47-49, wherein the oligomeric compound does not comprise linker-nucleosides.

Embodiment 51. An oligomeric compound according to the following chemical structure:

Embodiment 52. The oligomeric compound of embodiment 51, which is a pharmaceutically acceptable salt comprising one or more cations selected from sodium, potassium, calcium, and magnesium.

Embodiment 53. An oligomeric compound according to the following chemical structure:

Embodiment 54. An oligomeric compound comprising a modified oligonucleotide and conjugate group according to the following chemical notation: (6-palmitamidohexyl)-G_ksG_ks^mC_ksG_dsA_dsT_dsG_ds^mC_ds^mC_ds^mC_dsG_dsG_dsG_dsT_ksA_ks^mC_k (SEQ ID NO:248), wherein:

• • A=an adenine nucleobase,
  • ^mC=a 5-methylcytosine nucleobase,
  • G=a guanine nucleobase,
  • T=a thymine nucleobase,
  • k=a cEt sugar moiety,
  • d=a 2′-β-D-deoxyribosyl sugar moiety, and
  • s=a phosphorothioate internucleoside linkage.

Embodiment 55. A chirally enriched population of oligomeric compounds of any of embodiments 1-54, wherein the population is enriched for modified oligonucleotides comprising at least one particular phosphorothioate internucleoside linkage having a particular stereochemical configuration.

Embodiment 56. The chirally enriched population of embodiment 55, wherein the population is enriched for modified oligonucleotides comprising at least one particular phosphorothioate internucleoside linkage having the (Sp) configuration.

Embodiment 57. The chirally enriched population of embodiment 55, wherein the population is enriched for modified oligonucleotides comprising at least one particular phosphorothioate internucleoside linkage having the (Rp) configuration.

Embodiment 58. The chirally enriched population of embodiment 55, wherein the population is enriched for modified oligonucleotides having a particular, independently selected stereochemical configuration at each phosphorothioate internucleoside linkage.

Embodiment 59. The chirally enriched population of embodiment 55, wherein the population is enriched for modified oligonucleotides having the (Sp) configuration at each phosphorothioate internucleoside linkage or for modified oligonucleotides having the (Rp) configuration at each phosphorothioate internucleoside linkage.

Embodiment 60. The chirally enriched population of embodiment 55, wherein the population is enriched for modified oligonucleotides having the (Rp) configuration at one particular phosphorothioate internucleoside linkage and the (Sp) configuration at each of the remaining phosphorothioate internucleoside linkages.

Embodiment 61. The chirally enriched population of embodiment 55, wherein the population is enriched for modified oligonucleotides having at least 3 contiguous phosphorothioate internucleoside linkages in the Sp, Sp, and Rp configurations, in the 5′ to 3′ direction.

Embodiment 62. A population of oligomeric compounds of any of embodiments 1-54, wherein all of the phosphorothioate internucleoside linkages of the modified oligonucleotide are stereorandom.

Embodiment 63. An oligomeric duplex comprising a first oligomeric compound and a second oligomeric compound comprising a second modified oligonucleotide, wherein the first oligomeric compound is an oligomeric compound of any of embodiments 1-54.

Embodiment 64. The oligomeric duplex of embodiment 63, wherein the second modified oligonucleotide consists of 12 to 50 linked nucleosides, and wherein the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 12 nucleobases that is at least 90% complementary to an equal length portion of the first modified oligonucleotide.

Embodiment 65. An oligomeric duplex comprising:

• • a first oligomeric compound comprising a first modified oligonucleotide consisting of 19 to 30 linked nucleosides, wherein the nucleobase sequence of the first modified oligonucleotide comprises at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or 23 contiguous nucleobases of the nucleobase sequence of any of SEQ ID NOs: 1176-1241, 1308, 1310-1473, or 1638; and
  • a second oligomeric compound comprising a second modified oligonucleotide consisting of 15 to 30 linked nucleosides wherein the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 12 nucleobases that is at least 90% complementary to an equal length portion of the first modified oligonucleotide.

Embodiment 66. An oligomeric duplex comprising:

• • a first oligomeric compound comprising a first modified oligonucleotide consisting of 19 to 30 linked nucleosides, wherein the nucleobase sequence of the first modified oligonucleotide comprises at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or 23 contiguous nucleobases of the nucleobase sequence of any of SEQ ID NOs: 1176-1241, 1308, 1310-1473, or 1638; and
  • a second oligomeric compound comprising a second modified oligonucleotide consisting of 15 to 30 linked nucleosides wherein the nucleobase sequence of the second modified oligonucleotide comprises at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or 21 contiguous nucleobases of the nucleobase sequence of any of SEQ ID NOs: 1242-1307, 1309, 1474-1637, or 1639, wherein the nucleobase sequence of the second modified oligonucleotide is at least 90% complementary to an equal length portion of the first modified oligonucleotide.

Embodiment 67. An oligomeric duplex comprising:

• • a first oligomeric compound comprising a first modified oligonucleotide consisting of 23 linked nucleosides, wherein the nucleobase sequence of the first modified oligonucleotide comprises the nucleobase sequence of any of SEQ ID NOs: 1176-1241, 1308, 1310-1473, or 1638; and
  • a second oligomeric compound comprising a second modified oligonucleotide consisting of 21 linked nucleosides, wherein the nucleobase sequence of the second modified oligonucleotide comprises the nucleobase sequence of any of SEQ ID NOs: 1242-1307, 1309, 1474-1637, or 1639, wherein the nucleobase sequence of the second modified oligonucleotide is at least 90% complementary to an equal length portion of the first modified oligonucleotide.

Embodiment 68. The oligomeric duplex of any of embodiments 63-67, wherein the modified oligonucleotide of the first oligomeric compound comprises a 5′-stabilized phosphate group.

Embodiment 69. The oligomeric duplex of embodiment 68, wherein the 5′-stabilized phosphate group comprises a cyclopropyl phosphonate or a vinyl phosphonate.

Embodiment 70. The oligomeric duplex of any of embodiments 63-69, wherein at least one nucleoside of the first modified oligonucleotide comprises a modified sugar moiety.

Embodiment 71. The oligomeric duplex of embodiment 70, wherein the modified sugar moiety of the first modified oligonucleotide comprises a bicyclic sugar moiety.

Embodiment 72. The oligomeric duplex of embodiment 71, wherein the bicyclic sugar moiety comprises a 2′-4′ bridge selected from —O—CH₂—; and —O—CH(CH₃)—.

Embodiment 73. The oligomeric duplex of embodiment 70, wherein the modified sugar moiety of the first modified oligonucleotide comprises a non-bicyclic modified sugar moiety.

Embodiment 74. The oligomeric duplex of embodiment 73, wherein the non-bicyclic modified sugar moiety of the first modified oligonucleotide is a 2′-OMe sugar moiety or a 2′-F sugar moiety.

Embodiment 75. The oligomeric duplex of any of embodiments 63-74, wherein at least one nucleoside of the first modified oligonucleotide comprises a sugar surrogate.

Embodiment 76. The oligomeric duplex of any of embodiments 63-75, wherein the first modified oligonucleotide comprises at least one modified internucleoside linkage.

Embodiment 77. The oligomeric duplex of embodiment 76, wherein at least one modified internucleoside linkage of the first modified oligonucleotide is a phosphorothioate internucleoside linkage.

Embodiment 78. The oligomeric duplex of embodiment 76, wherein each internucleoside linkage of the first modified oligonucleotide is independently selected from a phosphodiester and a phosphorothioate internucleoside linkage.

Embodiment 79. The oligomeric duplex of any of embodiments 63-78, wherein at least one nucleoside of the second modified oligonucleotide comprises a modified sugar moiety.

Embodiment 80. The oligomeric duplex of embodiment 79, wherein the modified sugar moiety of the second modified oligonucleotide comprises a bicyclic sugar moiety.

Embodiment 81. The oligomeric duplex of embodiment 80, wherein the bicyclic sugar moiety comprises a 2′-4′ bridge selected from —O—CH₂—; and —O—CH(CH₃)—.

Embodiment 82. The oligomeric duplex of embodiment 79, wherein the modified sugar moiety of the second modified oligonucleotide comprises a non-bicyclic modified sugar moiety.

Embodiment 83. The oligomeric duplex of embodiment 82, wherein the non-bicyclic modified sugar moiety of the second modified oligonucleotide is a 2′-OMe sugar moiety or a 2′-F sugar moiety.

Embodiment 84. The oligomeric duplex of any of embodiments 63-83, wherein at least one nucleoside of the second modified oligonucleotide comprises a sugar surrogate.

Embodiment 85. The oligomeric duplex of any of embodiments 63-84, wherein the second modified oligonucleotide comprises at least one modified internucleoside linkage.

Embodiment 86. The oligomeric duplex of embodiment 85, wherein at least one modified internucleoside linkage of the second modified oligonucleotide is a phosphorothioate internucleoside linkage.

Embodiment 87. The oligomeric duplex of embodiment 85, wherein each internucleoside linkage of the second modified oligonucleotide is independently selected from a phosphodiester and a phosphorothioate internucleoside linkage.

Embodiment 88. The oligomeric duplex of any of embodiments 63-87, wherein the internucleoside linkage motif of the first modified oligonucleotide is ssooooooooooooooooooss and the internucleoside linkage motif of the second modified oligonucleotide is ssooooooooooooooooss, wherein each “o” represents a phosphodiester internucleoside linkage and each “s” represents a phosphorothioate internucleoside linkage.

Embodiment 89. The oligomeric duplex of any of embodiments 63-88, wherein the first modified oligonucleotide has a sugar motif of 5′-yfyfyfyfyfyfyfyfyfyfyyy-3′ and the second modified oligonucleotide has a sugar motif of 5′-fyfyfyfyfyfyfyfyfyfyf-3′, wherein each “y” represents a 2′-OMe sugar moiety and each “f” represents a 2′-F sugar moiety.

Embodiment 90. The oligomeric duplex of any of embodiments 63-89, wherein the first modified oligonucleotide and the second modified oligonucleotide each independently comprises at least one modified nucleobase.

Embodiment 91. The oligomeric duplex of embodiment 90, wherein the at least one modified nucleobase is 5-methylcytosine.

Embodiment 92. The oligomeric duplex of any of embodiments 63-91, wherein 1-4 3′-most nucleosides of the first modified oligonucleotide are overhanging nucleosides.

Embodiment 93. The oligomeric duplex of any of embodiments 63-92, wherein the duplex is blunt ended at the 5′-end of the first modified oligonucleotide.

Embodiment 94. The oligomeric duplex of any of embodiments 63-93, wherein the second oligomeric compound comprises a conjugate group comprising a conjugate moiety and a conjugate linker.

Embodiment 95. The oligomeric duplex of embodiment 94, wherein the conjugate linker consists of a single bond.

Embodiment 96. The oligomeric duplex of embodiment 94, wherein the conjugate linker is cleavable.

Embodiment 97. The oligomeric duplex of embodiment 94, wherein the conjugate linker comprises 1-3 linker-nucleosides.

Embodiment 98. The oligomeric duplex of any of embodiments 94-97, wherein the conjugate group is attached to the 5′-end of the second modified oligonucleotide.

Embodiment 99. The oligomeric duplex of any of embodiments 94-97, wherein the conjugate group is attached to the 3′-end of the second modified oligonucleotide.

Embodiment 100. The oligomeric duplex of any of embodiments 94-97, wherein the conjugate group is attached via the 2′ position of a ribosyl sugar moiety at an internal position of the second modified oligonucleotide.

Embodiment 101. The oligomeric duplex of any of embodiments 94-101, wherein the conjugate group comprises a C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, C10 alkenyl, C21 alkenyl, C19 alkenyl, C18 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, C11 alkenyl, C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 alkenyl, or C5 alkenyl.

Embodiment 102. The oligomeric duplex of any of embodiments 94-101, wherein the conjugate moiety is a 6-palmitamidohexyl conjugate moiety.

Embodiment 103. The oligomeric duplex of any of embodiments 94 or 96-102, wherein the conjugate linker is a phosphodiester linker.

Embodiment 104. The oligomeric duplex of any one of embodiments 94 or 96-100, wherein the conjugate group has the following structure:

Embodiment 105. The oligomeric duplex of any of embodiments 94-104, wherein the conjugate group comprises a cell-targeting moiety.

Embodiment 106. The oligomeric duplex of any of embodiments 63-105, wherein the second modified oligonucleotide comprises a terminal group.

Embodiment 107. The oligomeric duplex of embodiment 106, wherein the terminal group is an abasic sugar moiety.

Embodiment 108. The oligomeric duplex of any of embodiments 63-107, wherein the second modified oligonucleotide consists of 12 to 20, 12 to 25, 12 to 30, 12 to 50, 13 to 20, 13 to 25, 13 to 30, 13 to 50, 14 to 20, 14 to 25, 14 to 30, 14 to 50, 15 to 20, 15 to 25, 15 to 30, 15 to 50, 16 to 18, 16 to 20, 16 to 25, 16 to 30, 16 to 50, 17 to 20, 17 to 25, 17 to 30, 17 to 50, 18 to 20, 18 to 25, 18 to 30, 18 to 50, 19 to 20, 19 to 25, 19 to 30, 19 to 50, 20 to 25, 20 to 30, 20 to 50, 21 to 25, 21 to 30, 21 to 50, 22 to 25, 22 to 30, 22 to 50, 23 to 25, 23 to 30, or 23 to 50 linked nucleosides.

Embodiment 109. The oligomeric duplex of any of embodiments 63-66 or 68-108, wherein the first modified oligonucleotide consists of 23 linked nucleosides and the second modified oligonucleotide consists of 21 linked nucleosides.

Embodiment 110. An antisense agent comprising or consisting of an antisense compound, wherein the antisense compound is the oligomeric compound of any of embodiments 1-54.

Embodiment 111. An antisense agent, wherein the antisense agent is the oligomeric duplex of any of embodiments 63-109.

Embodiment 112. The antisense agent of embodiment 110 or embodiment 111, wherein the antisense agent is:

• • i) an RNase H agent capable of reducing the amount of DUX4 nucleic acid through the activation of RNase H; or
  • ii) an RNAi agent capable of reducing the amount of DUX4 nucleic acid through the activation of RISC/Ago2.

Embodiment 113. The antisense agent of any of embodiments 110-112, wherein the antisense agent comprises a conjugate group, and wherein the conjugate group comprises a cell-targeting moiety.

Embodiment 114. A pharmaceutical composition comprising an oligomeric compound of any of embodiments 1-54, a population of oligomeric compounds of any of embodiments 55-62, an oligomeric duplex of any of embodiments 63-109, or an antisense agent of any of embodiments 110-113, and a pharmaceutically acceptable diluent.

Embodiment 115. The pharmaceutical composition of embodiment 114, wherein the pharmaceutically acceptable diluent is phosphate buffered saline (PBS).

Embodiment 116. The pharmaceutical composition of embodiment 115, wherein the pharmaceutical composition consists essentially of the oligomeric compound and PBS.

Embodiment 117. The pharmaceutical composition of embodiment 115, wherein the pharmaceutical composition consists essentially of the population of oligomeric compounds and PBS.

Embodiment 118. The pharmaceutical composition of embodiment 115, wherein the pharmaceutical composition consists essentially of the oligomeric duplex or the antisense agent and PBS.

Embodiment 119. A method comprising administering to a subject an oligomeric compound of any of embodiments 1-54, a population of oligomeric compounds of any of embodiments 55-62, an oligomeric duplex of any of embodiments 63-109, an antisense agent of any of embodiments 110-113, or a pharmaceutical composition of any of embodiments 114-118.

Embodiment 120. A method of treating a disease or disorder associated with DUX4 comprising administering to a subject having or at risk for developing a disease or disorder associated with DUX4 a therapeutically effective amount of an oligomeric compound of any of embodiments 1-54, a population of oligomeric compounds of any of embodiments 55-62, an oligomeric duplex of any of embodiments 63-109, an antisense agent of any of embodiments 110-113, or a pharmaceutical composition of any of embodiments 114-118; and thereby treating the disease or disorder associated with DUX4.

Embodiment 121. The method of embodiment 120, where the disease or disorder associated with DUX4 is a muscle dystrophy.

Embodiment 122. The method of embodiment 120, wherein the disease or disorder associated with DUX4 is facioscapulohumeral muscular dystrophy (FSHD).

Embodiment 123. The method of any of embodiments 120-122, wherein at least one symptom or hallmark of the disease or disorder associated with DUX4 is ameliorated.

Embodiment 124. The method of embodiment 123, wherein the symptom or hallmark is muscle weakness or muscle wasting in facio, scapula, and/or humeral muscle.

Embodiment 125. The method of embodiment 124, wherein administering the oligomeric compound of any of embodiments 1-54, the population of oligomeric compounds of any of embodiments 55-62, the oligomeric duplex of any of embodiments 63-109, the antisense agent of any of embodiments 110-113, or the pharmaceutical composition of any of embodiments 114-118 reduces or delays the onset or progression of muscle weakness or muscle wasting in the subject.

Embodiment 126. The method of any of embodiments 119-125, wherein the oligomeric compound of any of embodiments 1-54, the population of oligomeric compounds of any of embodiments 55-62, the oligomeric duplex of any of embodiments 63-109, the antisense agent of any of embodiments 110-113, or the pharmaceutical composition of any of embodiments 114-118 is administered systemically.

Embodiment 127. The method of any of embodiments 119-126, wherein the subject is a human.

Embodiment 128. A method of reducing expression of DUX4 in a cell comprising contacting the cell with an oligomeric compound of any of embodiments 1-54, a population of oligomeric compounds of any of embodiments 55-62, an oligomeric duplex of any of embodiments 63-109, an antisense agent of any of embodiments 110-113, or a pharmaceutical composition of any of embodiments 114-118.

Embodiment 129. The method of embodiment 128, wherein the cell is a muscle cell.

Embodiment 130. The method of embodiment 128 or embodiment 129, wherein the cell is a human cell.

Embodiment 131. Use of the oligomeric compound of any of embodiments 1-54, the population of oligomeric compounds of any of embodiments 55-62, the oligomeric duplex of any of embodiments 63-109, the antisense agent of any of embodiments 110-113, or the pharmaceutical composition of any of embodiments 114-118 for treating a disease or disorder associated with DUX4.

Embodiment 132. Use of the oligomeric compound of any of embodiments 1-54, the population of oligomeric compounds of any of embodiments 55-62, the oligomeric duplex of any of embodiments 63-109, the antisense agent of any of embodiments 110-113, or the pharmaceutical composition of any of embodiments 114-118 in the manufacture of a medicament for treating a disease or disorder associated with DUX4.

Embodiment 133. The use of embodiment 131 or embodiment 132, wherein the disease or disorder associated with DUX4 is FSHD.

Certain Oligomeric Agents and Oligomeric Compounds Certain embodiments provide oligomeric agents targeted to a DUX4 nucleic acid. In certain embodiments, the DUX4 nucleic acid has the sequence set forth in SEQ ID NO: 1 (GENBANK Accession No. NC_000004.12, truncated from nucleotides 190171001 to 190187000), SEQ ID NO: 2 (GENBANK Accession No. NM_001306068.2), SEQ ID NO: 3 (GENBANK Accession No. FJ439133.1), or SEQ ID NO: 4 (GENBANK Accession No. NM_001293798.2), each of which is incorporated by reference in its entirety. In certain embodiments, the oligomeric agent is a single-stranded oligomeric compound. In certain embodiments, the oligomeric agent is oligomeric duplex.

Certain embodiments provide an oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides wherein the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to an equal length portion of a DUX4 RNA, and wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage. In certain embodiments, the DUX4 nucleic acid has the nucleobase sequence of SEQ ID NO: 1, 2, 3, or 4.

Certain embodiments provide an oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides and having a nucleobase sequence comprising at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 nucleobases of any of SEQ ID NOs: 20-172.

Certain embodiments provide an oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides and having a nucleobase sequence comprising at least 12, at least 13, at least 14, at least 15, or 16 nucleobases of any of SEQ ID NOs: 173-1171.

Certain embodiments provide an oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides and having a nucleobase sequence comprising at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or 23 nucleobases of any of SEQ ID NOs: 1176-1241, 1308, 1310-1473, or 1638.

In any of the oligomeric compounds provided herein, the nucleobase sequence of the modified oligonucleotide can be at least 85%, at least 90%, at least 95%, or 100% complementary to an equal length portion of a DUX4 nucleic acid, wherein the DUX4 nucleic acid has the nucleobase sequences of any of SEQ ID NOs: 1-4.

In any of the oligomeric compounds provided herein, the modified oligonucleotide consists of 12 to 20, 12 to 25, 12 to 30, 12 to 50, 13 to 20, 13 to 25, 13 to 30, 13 to 50, 14 to 20, 14 to 25, 14 to 30, 14 to 50, 15 to 20, 15 to 25, 15 to 30, 15 to 50, 16 to 18, 16 to 20, 16 to 25, 16 to 30, 16 to 50, 17 to 20, 17 to 25, 17 to 30, 17 to 50, 18 to 20, 18 to 25, 18 to 30, 18 to 50, 19 to 20, 19 to 25, 19 to 30, 19 to 50, 20 to 25, 20 to 30, 20 to 50, 21 to 25, 21 to 30, 21 to 50, 22 to 25, 22 to 30, 22 to 50, 23 to 25, 23 to 30, or 23 to 50 linked nucleosides.

In any of the oligomeric compounds provided herein, at least one nucleoside of the modified oligonucleotide can comprise a modified sugar moiety. In certain embodiments, the modified sugar moiety comprises a bicyclic sugar moiety, such as a 2′-4′ bridge selected from —O—CH₂—; and —O—CH(CH₃)—. In certain embodiments, the modified sugar moiety comprises a non-bicyclic sugar moiety, such as a 2′-MOE sugar moiety, a cEt sugar moiety, a 2′-OMe sugar moiety, or a 2′-F sugar moiety.

In any of the oligomeric compounds provided herein, at least one nucleoside of the modified oligonucleotide compound can comprise a sugar surrogate.

In any of the oligomeric compounds provided herein, at least one internucleoside linkage of the modified oligonucleotide can comprise a modified internucleoside linkage, such as a phosphorothioate internucleoside linkage. In certain embodiments, each internucleoside linkage of the modified oligonucleotide can be a modified internucleoside linkage or each internucleoside linkage of the modified oligonucleotide can be a phosphorothioate internucleoside linkage. In certain embodiments, at least one internucleoside linkage of the modified oligonucleotide can be a phosphodiester internucleoside linkage. In certain embodiments, each internucleoside linkage of the modified oligonucleotide can be independently selected from a phosphodiester or a phosphorothioate internucleoside linkage. In certain embodiments, at least 2, at least 3, at least 4, at least 5, or at least 6 internucleoside linkages of the modified oligonucleotide can be phosphodiester internucleoside linkages. In certain embodiments, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 internucleoside linkages of the modified oligonucleotide can be phosphorothioate internucleoside linkages.

In any of the oligomeric compounds provided herein, at least one nucleobase of the modified oligonucleotide can be a modified nucleobase, such as 5-methylcytosine. In certain embodiments, each cytosine is 5-methylcytosine.

In any of the oligomeric compounds provided herein, the modified oligonucleotide can comprise a deoxy region consisting of 5-12 contiguous 2′-deoxynucleosides. In certain embodiments, each nucleoside of the deoxy region is a 2′-β-D-deoxynucleoside. In certain embodiments, the deoxy region consists of 7, 8, 9, 10, or 7-10 linked nucleosides. In certain embodiments, each nucleoside immediately adjacent to the deoxy region comprises a modified sugar moiety. In certain embodiments, the deoxy region is flanked on the 5′-side by a 5′-region consisting of 1-6 linked 5′-region nucleosides and on the 3′-side by a 3′-region consisting of 1-6 linked 3′-region nucleosides; wherein the 3′- most nucleoside of the 5′-region comprises a modified sugar moiety; and the 5′-most nucleoside of the 3′-region comprises a modified sugar moiety. In certain embodiments, each nucleoside of the 3′-region comprises a modified sugar moiety. In certain embodiments, each nucleoside of the 5′-region comprises a modified sugar moiety.

In certain embodiments, a compound comprises or consists of a modified oligonucleotide consisting of 16 to 50 linked nucleobases and having a nucleobase sequence comprising the nucleobase sequence recited in any one of SEQ ID NOs: 20-172, wherein the modified oligonucleotide has:

• • a 5′-region consisting of 5 linked 5′-region nucleosides;
  • a central region consisting of 10 linked central region nucleosides; and a 3′-region consisting of 5 linked 3′-region nucleosides;
  • wherein each of the 5′-region nucleosides and each of the 3′-region nucleosides comprises a 2′-MOE sugar moiety, each of the central region nucleosides comprises a 2′-β-D-deoxyribosyl sugar moiety, and wherein each cytosine is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide consists of 15 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 20 linked nucleosides.

In certain embodiments, a compound comprises or consists of a modified oligonucleotide consisting of 16 to 50 linked nucleobases and having a nucleobase sequence comprising the nucleobase sequence recited in any one of SEQ ID NOs: 173-1171, wherein the modified oligonucleotide has:

• • a 5′-region consisting of 3 linked 5′-region nucleosides;
  • a central region consisting of 10 linked central region nucleosides; and
  • a 3′-region consisting of 3 linked 3′-region nucleosides;wherein each of the 5′-region nucleosides and each of the 3′-region nucleosides comprises a 2′-cEt sugar moiety, each of the central region nucleosides comprises a 2′-β-D-deoxyribosyl sugar moiety, and wherein each cytosine is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide consists of 15 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.

In certain embodiments, an oligomeric compound comprises a conjugate group. In certain embodiments, the conjugate group comprises a conjugate linker and a conjugate moiety. In certain embodiments, the conjugate linker consists of a single bond, the conjugate linker is cleavable, the conjugate linker comprises 1-3 linker-nucleosides, the conjugate linker does not comprise any linker nucleosides, the conjugate group is attached to the modified oligonucleotide at the 5′-end of the modified oligonucleotide, or the conjugate group is attached to the modified oligonucleotide at the 3′-end of the modified oligonucleotide.

In certain embodiments, the conjugate group comprises a cell-targeting moiety having an affinity for transferrin receptor (TfR), also known as TfR1 and CD71. In certain embodiments, the conjugate group comprises an anti-TfR1 antibody or fragment thereof. In certain embodiments, the conjugate group comprises a protein or peptide capable of binding TfR1. In certain embodiments, the conjugate group comprises an aptamer capable of binding TfR1. In certain embodiments, conjugate groups may be selected from any of a C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, C10 alkenyl, C21 alkenyl, C19 alkenyl, C18 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, C11 alkenyl, C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 alkenyl, or C5 alkenyl. In certain embodiments, conjugate groups may be selected from any of C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, and C5 alkyl, where the alkyl chain has one or more unsaturated bonds.

In certain embodiments, the conjugate group has the following structure:

Certain Oligomeric Duplexes

Certain embodiments are directed to oligomeric duplexes comprising a first oligomeric compound and a second oligomeric compound.

In certain embodiments, an oligomeric duplex comprises:

• • a first oligomeric compound comprising a first modified oligonucleotide consisting of 12 to 50 linked nucleosides, wherein the nucleobase sequence of the first modified oligonucleotide is at least 80% complementary to an equal length portion within nucleobases sequence of any of SEQ ID NOs: 20-1171; and
  • a second oligomeric compound comprising a second modified oligonucleotide consisting of 12 to 50 linked nucleosides wherein the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 8 nucleobases that is at least 90% complementary to an equal length portion of the first modified oligonucleotide.

In certain embodiments, an oligomeric duplex comprises:

• • a first oligomeric compound comprising a first modified oligonucleotide consisting of 12 to 50 linked nucleosides wherein the nucleobase sequence of the first modified oligonucleotide comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, or at least 16 contiguous nucleobases of the nucleobase sequence of any of SEQ ID NOs: 20-1171, wherein each thymine is replaced by uracil; and
  • a second oligomeric compound comprising a second modified oligonucleotide consisting of 12 to 50 linked nucleosides wherein the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 8 nucleobases that is at least 90% complementary to an equal length portion of the first modified oligonucleotide.

In certain embodiments, the first oligomeric compound is an antisense compound. In certain embodiments, the first modified oligonucleotide is an antisense oligonucleotide. In certain embodiments, the second oligomeric compound is a sense compound. In certain embodiments, the second modified oligonucleotide is a sense oligonucleotide.

In certain embodiments, an oligomeric duplex comprises:

• • a first oligomeric compound comprising a first modified oligonucleotide consisting of 16 to 50 linked nucleosides wherein the nucleobase sequence of the first modified oligonucleotide comprises the nucleobase sequence of any of SEQ ID NOs: 20-1171, wherein each thymine is replaced by uracil; and
  • a second oligomeric compound comprising a second modified oligonucleotide consisting of 16 to 50 linked nucleosides wherein the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 16 nucleobases that is at least 90% complementary to an equal length portion of the first modified oligonucleotide.

In certain embodiments, the first oligomeric compound is an antisense compound. In certain embodiments, the first modified oligonucleotide is an antisense oligonucleotide. In certain embodiments, the second oligomeric compound is a sense compound. In certain embodiments, the second modified oligonucleotide is a sense oligonucleotide.

In certain embodiments, an oligomeric duplex comprises:

• • a first oligomeric compound comprising a first modified oligonucleotide consisting of 19 to 30 linked nucleosides wherein the nucleobase sequence of the first modified oligonucleotide comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or 23 contiguous nucleobases of the nucleobase sequence of any of SEQ ID NOs: 1176-1241, 1308, 1310-1473, or 1638; and
  • a second oligomeric compound comprising a second modified oligonucleotide consisting of 15 to 30 linked nucleosides wherein the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 8 nucleobases that is at least 90% complementary to an equal length portion of the first modified oligonucleotide.

In certain embodiments, the first oligomeric compound is an antisense compound. In certain embodiments, the first modified oligonucleotide is an antisense oligonucleotide. In certain embodiments, the second oligomeric compound is a sense compound. In certain embodiments, the second modified oligonucleotide is a sense oligonucleotide.

In certain embodiments, an oligomeric duplex comprises:

• • a first oligomeric compound comprising a first modified oligonucleotide consisting of 19 to 30 linked nucleosides wherein the nucleobase sequence of the first modified oligonucleotide comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or 23 contiguous nucleobases of the nucleobase sequence of any of SEQ ID NOs: 1176-1241, 1308, 1310-1473, or 1638; and
  • a second oligomeric compound comprising a second modified oligonucleotide consisting of 15 to 30 linked nucleosides wherein the nucleobase sequence of the second modified oligonucleotide comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or 21 contiguous nucleobases of the nucleobase sequence of any of SEQ ID NOs: 1242-1307, 1309, 1474-1637, or 1639, wherein the nucleobase sequence of the second modified oligonucleotide is at least 90% complementary to an equal length portion of the first modified oligonucleotide.

In certain embodiments, the first oligomeric compound is an antisense compound. In certain embodiments, the first modified oligonucleotide is an antisense oligonucleotide. In certain embodiments, the second oligomeric compound is a sense compound. In certain embodiments, the second modified oligonucleotide is a sense oligonucleotide.

In certain embodiments, an oligomeric duplex comprises:

• • a first oligomeric compound comprising a first modified oligonucleotide consisting of 23 linked nucleosides wherein the nucleobase sequence of the first modified oligonucleotide comprises the nucleobase sequence of any of SEQ ID NOs: 1176-1241, 1308, 1310-1473, or 1638; and
  • a second oligomeric compound comprising a second modified oligonucleotide consisting of 21 linked nucleosides wherein the nucleobase sequence of the second modified oligonucleotide comprises the nucleobase sequence of any of SEQ ID NOs: 1242-1307, 1309, 1474-1637, or 1639, wherein the nucleobase sequence of the second modified oligonucleotide is at least 90% complementary to an equal length portion of the first modified oligonucleotide.

In certain embodiments, the first oligomeric compound is an antisense compound. In certain embodiments, the first modified oligonucleotide is an antisense oligonucleotide. In certain embodiments, the second oligomeric compound is a sense compound. In certain embodiments, the second modified oligonucleotide is a sense oligonucleotide.

In certain embodiments, an oligomeric duplex comprises a first oligomeric compound comprising a first modified oligonucleotide consisting of 19 to 30 linked nucleosides and a second oligomeric compound comprising a second modified oligonucleotide consisting of 15 to 30 linked nucleosides, wherein the nucleobase sequence of the first modified oligonucleotide and the nucleobase sequence of the second modified oligonucleotide each comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 contiguous nucleobases of any of the following pairs of nucleobase sequences recited in: SEQ ID NOs: 1176-1639, wherein the nucleobase sequence of the first modified oligonucleotide comprises the nucleobase sequence of the first SEQ ID NO recited in the pair and the nucleobase sequence of the second modified oligonucleotide comprises the nucleobase sequence of the second SEQ ID NO recited in the pair. In certain embodiments, the first oligomeric compound is an antisense compound. In certain embodiments, the first modified oligonucleotide is an antisense oligonucleotide. In certain embodiments, the second oligomeric compound is a sense compound. In certain embodiments, the second modified oligonucleotide is a sense oligonucleotide.

In certain embodiments, an oligomeric duplex comprises a first oligomeric compound comprising a first modified oligonucleotide consisting of 19 to 30 linked nucleosides and a second oligomeric compound comprising a second modified oligonucleotide consisting of 15 to 30 linked nucleosides, wherein the nucleobase sequences of the first modified oligonucleotide and second modified oligonucleotide comprise any of the following pairs of nucleobase sequences recited in: SEQ ID NOs: 1176-1639, wherein the nucleobase sequence of the first modified oligonucleotide comprises the nucleobase sequence of the first SEQ ID NO recited in the pair and the nucleobase sequence of the second modified oligonucleotide comprises the nucleobase sequence of the second SEQ ID NO recited in the pair. In certain embodiments, the first oligomeric compound is an antisense compound. In certain embodiments, the first modified oligonucleotide is an antisense oligonucleotide. In certain embodiments, the second oligomeric compound is a sense compound. In certain embodiments, the second modified oligonucleotide is a sense oligonucleotide.

In certain embodiments, an oligomeric duplex comprises a first oligomeric compound comprising a first modified oligonucleotide consisting of 23 linked nucleosides and a second oligomeric compound comprising a second modified oligonucleotide consisting of 21 linked nucleosides, wherein the nucleobase sequences of the first modified oligonucleotide and second modified oligonucleotide consist of any of the following pairs of nucleobase sequences recited in: SEQ ID NOs: 1176-1639, wherein the nucleobase sequence of the first modified oligonucleotide comprises the nucleobase sequence of the first SEQ ID NO recited in the pair and the nucleobase sequence of the second modified oligonucleotide comprises the nucleobase sequence of the second SEQ ID NO recited in the pair. In certain embodiments, the first oligomeric compound is an antisense compound. In certain embodiments, the first modified oligonucleotide is an antisense oligonucleotide. In certain embodiments, the second oligomeric compound is a sense compound. In certain embodiments, the second modified oligonucleotide is a sense oligonucleotide.

In any of the oligomeric duplexes described herein, at least one nucleoside of the first modified oligonucleotide and/or the second modified oligonucleotide can comprise a modified sugar moiety. Examples of suitable modified sugar moieties include, but are not limited to, a bicyclic sugar moiety, such as a 2′-4′ bridge selected from —O—CH2-; and —O—CH(CH3)-, and a non-bicyclic sugar moiety, such as a 2′-MOE sugar moiety, a 2′-F sugar moiety, a 2′-OMe sugar moiety, or a 2′-NMA sugar moiety. In certain embodiments, at least 80%, at least 90%, or 100% of the nucleosides of the first modified oligonucleotide and/or the second modified oligonucleotide comprises a modified sugar moiety selected from 2′-F and 2′-OMe.

In any of the oligomeric duplexes described herein, at least one nucleoside of the first modified oligonucleotide and/or the second modified oligonucleotide can comprise a sugar surrogate. Examples of suitable sugar surrogates include, but are not limited to, morpholino, peptide nucleic acid (PNA), glycol nucleic acid (GNA), and unlocked nucleic acid (UNA). In certain embodiments, at least one nucleoside of the first modified oligonucleotide comprises a sugar surrogate, which can be a GNA.

In any of the oligomeric duplexes described herein, at least one internucleoside linkage of the first modified oligonucleotide and/or the second modified oligonucleotide can comprise a modified internucleoside linkage. In certain embodiments, the modified internucleoside linkage is a phosphorothioate internucleoside linkage. In certain embodiments, at least one of the first, second, or third internucleoside linkages from the 5′ end and/or the 3′ end of the first modified oligonucleotide comprises a phosphorothioate linkage. In certain embodiments, at least one of the first, second, or third internucleoside linkages from the 5′ end and/or the 3′ end of the second modified oligonucleotide comprises a phosphorothioate linkage.

In any of the oligomeric duplexes described herein, at least one internucleoside linkage of the first modified oligonucleotide and/or the second modified oligonucleotide can comprise a phosphodiester internucleoside linkage.

In any of the oligomeric duplexes described herein, each internucleoside linkage of the first modified oligonucleotide and/or the second modified oligonucleotide can be independently selected from a phosphodiester or a phosphorothioate internucleoside linkage.

In any of the oligomeric duplexes described herein, the internucleoside linkage motif of the first modified oligonucleotide can be ssooooooooooooooooooss and the internucleoside linkage motif of the second modified oligonucleotide can be ssooooooooooooooooss, wherein each “o” represents a phosphodiester internucleoside linkage and each “s” represents a phosphorothioate internucleoside linkage.

In any of the oligomeric duplexes described herein, at least one nucleobase of the first modified oligonucleotide and/or the second modified oligonucleotide can be modified nucleobase. In certain embodiments, the modified nucleobase is 5-methylcytosine.

In any of the oligomeric duplexes described herein, the first modified oligonucleotide can comprise a stabilized phosphate group attached to the 5′ position of the 5′-most nucleoside. In certain embodiments, the stabilized phosphate group comprises a cyclopropyl phosphonate or an (E)-vinyl phosphonate.

In any of the oligomeric duplexes described herein, the first modified oligonucleotide can comprise a conjugate group. In certain embodiments, the conjugate group comprises a conjugate linker and a conjugate moiety. In certain embodiments, the conjugate group is attached to the first modified oligonucleotide at the 5′-end of the modified oligonucleotide. In certain embodiments, the conjugate group is attached to the first modified oligonucleotide at the 3′-end of the modified oligonucleotide. In certain embodiments, the conjugate group comprises N-acetyl galactosamine. In certain embodiments, the conjugate group comprises a cell-targeting moiety having an affinity for transferrin receptor (TfR), also known as TfR1 and CD71. In certain embodiments, the conjugate group comprises an anti-TfR1 antibody or fragment thereof. In certain embodiments, the conjugate group comprises a protein or peptide capable of binding TfR1. In certain embodiments, the conjugate group comprises an aptamer capable of binding TfR1. In certain embodiments, conjugate groups may be selected from any of a C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, C10 alkenyl, C21 alkenyl, C19 alkenyl, C18 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, CIt alkenyl, C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 alkenyl, or C5 alkenyl. In certain embodiments, conjugate groups may be selected from any of C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, and C5 alkyl, where the alkyl chain has one or more unsaturated bonds.

In any of the oligomeric duplexes described herein, the second modified oligonucleotide can comprise a conjugate group. In certain embodiments, the conjugate group comprises a conjugate linker and a conjugate moiety. In certain embodiments, the conjugate group is attached to the second modified oligonucleotide at the 5′-end of the modified oligonucleotide. In certain embodiments, the conjugate group is attached to the second modified oligonucleotide at the 3′-end of the modified oligonucleotide. In certain embodiments, the conjugate group comprises N-acetyl galactosamine. In certain embodiments, the conjugate group comprises a cell-targeting moiety having an affinity for transferrin receptor (TfR), also known as TfR1 and CD71. In certain embodiments, the conjugate group comprises an anti-TfR1 antibody or fragment thereof. In certain embodiments, the conjugate group comprises a protein or peptide capable of binding TfR1. In certain embodiments, the conjugate group comprises an aptamer capable of binding TfR1. In certain embodiments, conjugate groups may be selected from any of a C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, C10 alkenyl, C21 alkenyl, C19 alkenyl, C18 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, C11 alkenyl, C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 alkenyl, or C5 alkenyl. In certain embodiments, conjugate groups may be selected from any of C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, and C5 alkyl, where the alkyl chain has one or more unsaturated bonds.

In certain embodiments, an antisense agent comprises an antisense compound, which comprises an oligomeric compound or an oligomeric duplex described herein. In certain embodiments, an antisense agent, which can comprise an oligomeric compound or an oligomeric duplex described herein, is an RNAi agent capable of reducing the amount of DUX4 nucleic acid through the activation of RISC/Ago2.

Certain embodiments provide an oligomeric agent comprising two or more oligomeric duplexes. In certain embodiments, an oligomeric agent comprises two or more of any of the oligomeric duplexes described herein. In certain embodiments, an oligomeric agent comprises two or more of the same oligomeric duplex, which can be any of the oligomeric duplexes described herein. In certain embodiments, the two or more oligomeric duplexes are linked together. In certain embodiments, the two or more oligomeric duplexes are covalently linked together. In certain embodiments, the second modified oligonucleotides of two or more oligomeric duplexes are covalently linked together. In certain embodiments, the second modified oligonucleotides of two or more oligomeric duplexes are covalently linked together at their 3′ ends. In certain embodiments, the two or more oligomeric duplexes are covalently linked together by a glycol linker, such as a tetraethylene glycol linker. Certain such compounds are described in, e.g., Alterman, et al., Nature Biotech., 37:844-894, 2019.

I. Certain Oligonucleotides

In certain embodiments, provided herein are oligomeric compounds comprising oligonucleotides, which consist of linked nucleosides. Oligonucleotides may be unmodified oligonucleotides (RNA or DNA) or may be modified oligonucleotides. Modified oligonucleotides comprise at least one modification relative to unmodified RNA or DNA. That is, modified oligonucleotides comprise at least one modified nucleoside (comprising a modified sugar moiety and/or a modified nucleobase) and/or at least one modified internucleoside linkage. Certain modified nucleosides and modified internucleoside linkages suitable for use in modified oligonucleotides are described below.

A. Certain Modified Nucleosides

Modified nucleosides comprise a modified sugar moiety or a modified nucleobase or both a modified sugar moiety and a modified nucleobase. In certain embodiments, modified nucleosides comprising the following modified sugar moieties and/or the following modified nucleobases may be incorporated into antisense oligonucleotides.

1. Certain Sugar Moieties

In certain embodiments, modified sugar moieties are non-bicyclic modified sugar moieties. In certain embodiments, modified sugar moieties are bicyclic or tricyclic sugar moieties. In certain embodiments, modified sugar moieties are sugar surrogates. Such sugar surrogates may comprise one or more substitutions corresponding to those of other types of modified sugar moieties.

In certain embodiments, modified sugar moieties are non-bicyclic modified furanosyl sugar moieties comprising one or more acyclic substituent, including, but not limited, to substituents at the 2′, 3′, 4′, and/or 5′ positions. In certain embodiments, the furanosyl sugar moiety is a ribosyl sugar moiety. In certain embodiments, one or more acyclic substituent of non-bicyclic modified sugar moieties is branched. In certain embodiments, non-bicyclic modified sugar moieties comprise a substituent group at the 2′-position. Examples of substituent groups suitable for the 2′-position of modified sugar moieties include but are not limited to: —F, —OCH₃ (“OMe” or “O-methyl”), and —O(CH₂)₂OCH₃ (“MOE”). In certain embodiments, 2′-substituent groups are selected from among: halo, allyl, amino, azido, SH, CN, OCN, CF₃, OCF₃, O—C₁-C₁₀ alkoxy, O—C₁-C₁₀ substituted alkoxy, O—C₁-C₁₀ alkyl, O—C₁-C₁₀ substituted alkyl, S-alkyl, N(R_m)-alkyl, O-alkenyl, S-alkenyl, N(R_m)-alkenyl, O-alkynyl, S-alkynyl, N(R_m)-alkynyl, O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, O(CH₂)₂SCH₃, O(CH₂)₂₀N(R_m)(R_n) or OCH₂C(═O)—N(R_m)(R_n), where each R_m and R_n is, independently, H, an amino protecting group, or substituted or unsubstituted C₁-C₁₀ alkyl, —O(CH₂)₂ON(CH₃)₂ (“DMAOE”), 2′-O(CH₂)₂O(CH₂)₂N(CH₃)₂ (“DMAEOE”), and the 2′-substituent groups described in Cook et al., U.S. Pat. No. 6,531,584; Cook et al., U.S. Pat. No. 5,859,221; and Cook et al., U.S. Pat. No. 6,005,087. Certain embodiments of these 2′-substituent groups can be further substituted with one or more substituent groups independently selected from among: hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro (NO₂), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl and alkynyl.

In certain embodiments, a 2′-substituted non-bicyclic modified nucleoside comprises a sugar moiety comprising a non-bridging 2′-substituent group selected from: F, NH₂, N₃, OCF₃, OCH₃, O(CH₂)₃NH₂, CH₂CH═CH₂, OCH₂CH═CH₂, OCH₂CH₂OCH₃, O(CH₂)₂SCH₃, O(CH₂)₂₀N(R_m)(R_n), O(CH₂)₂O(CH₂)₂N(CH₃)₂, and N-substituted acetamide (OCH₂C(═O)—N(R_m)(R_n)), where each R_m and R_n is, independently, H, an amino protecting group, or substituted or unsubstituted C₁-C₁₀ alkyl.

In certain embodiments, a 2′-substituted nucleoside non-bicyclic modified nucleoside comprises a sugar moiety comprising a non-bridging 2′-substituent group selected from: F, OCF₃, OCH₃, OCH₂CH₂OCH₃, O(CH₂)₂SCH₃, O(CH₂)₂₀N(CH₃)₂, O(CH₂)₂O(CH₂)₂N(CH₃)₂, O(CH₂)₂ON(CH₃)₂ (“DMAOE”), O(CH₂)₂O(CH₂)₂N(CH₃)₂ (“DMAEOE”) and OCH₂C(═O)—N(H)CH₃ (“NMA”).

In certain embodiments, a 2′-substituted non-bicyclic modified nucleoside comprises a sugar moiety comprising a non-bridging 2′-substituent group selected from: F, OCH₃, OCH₂CH₂OCH₃, O(CH₂)₂SCH₃, O(CH₂)₂₀N(CH3)₂, O(CH₂)₂O(CH₂)₂N(CH₃)₂, and OCH₂C(═O)—N(H)CH₃ (“NMA”).

In certain embodiments, a 2′-substituted non-bicyclic modified nucleoside comprises a sugar moiety comprising a non-bridging 2′-substituent group selected from: F, OCH₃, and OCH₂CH₂OCH₃.

In certain embodiments, modified furanosyl sugar moieties and nucleosides incorporating such modified furanosyl sugar moieties are further defined by isomeric configuration. For example, a 2′-deoxyfuranosyl sugar moiety may be in seven isomeric configurations other than the naturally occurring β-D-deoxyribosyl configuration. Such modified sugar moieties are described in, e.g., WO 2019/157531, incorporated by reference herein. A 2′-modified sugar moiety has an additional stereocenter at the 2′-position relative to a 2′-deoxyfuranosyl sugar moiety; therefore, such sugar moieties have a total of sixteen possible isomeric configurations. 2′-modified sugar moieties described herein are in the ρ3-D-ribosyl isomeric configuration unless otherwise specified.

In certain embodiments, non-bicyclic modified sugar moieties comprise a substituent group at the 4′-position. Examples of substituent groups suitable for the 4′-position of modified sugar moieties include but are not limited to alkoxy (e.g., methoxy), alkyl, and those described in Manoharan et al., WO 2015/106128.

In certain embodiments, non-bicyclic modified sugar moieties comprise a substituent group at the 3′-position. Examples of substituent groups suitable for the 3′-position of modified sugar moieties include but are not limited to alkoxy (e.g., methoxy), alkyl (e.g., methyl, ethyl).

In certain embodiments, non-bicyclic modified sugar moieties comprise a substituent group at the 5′-position. Examples of substituent groups suitable for the 5′-position of modified sugar moieties include but are not limited to vinyl, alkoxy (e.g., methoxy), alkyl (e.g., methyl (R or S), ethyl).

In certain embodiments, non-bicyclic modified sugar moieties comprise more than one non-bridging sugar substituent, for example, 2′-F-5′-methyl sugar moieties and the modified sugar moieties and modified nucleosides described in Migawa et al., WO 2008/101157 and Rajeev et al., US2013/0203836).

In naturally occurring nucleic acids, sugars are linked to one another 3′ to 5′. In certain embodiments, oligonucleotides include one or more nucleoside or sugar moiety linked at an alternative position, for example at the 2′ position or inverted 5′ to 3′. For example, where the linkage is at the 2′ position, the 2′-substituent groups may instead be at the 3′-position.

Certain modified sugar moieties comprise a substituent that bridges two atoms of the furanosyl ring to form a second ring, resulting in a bicyclic sugar moiety. In certain embodiments, the bicyclic sugar moiety comprises abridge between the 4′ and the 2′ furanose ring atoms. Examples of such 4′ to 2′ bridging sugar substituents include but are not limited to: 4′-CH₂—2′, 4′-(CH₂)₂-2′, 4′-(CH₂)₃-2′, 4′-CH₂—O-2′ (“LNA”), 4′-CH₂—S-2′, 4′-(CH₂)₂—O-2′ (“ENA”), 4′-CH(CH₃)—O-2′ (referred to as “constrained ethyl” or “cEt”), 4′-CH₂—O—CH₂—2′, 4′-CH₂—N(R)-2′, 4′-CH(CH₂OCH₃)—O-2′ (“constrained MOE” or “cMOE”) and analogs thereof (see, e.g., Seth et al., U.S. Pat. No. 7,399,845, Bhat et al., U.S. Pat. No. 7,569,686, Swayze et al., U.S. Pat. No. 7,741,457, and Swayze et al., U.S. Pat. No. 8,022,193), 4′-C(CH₃)(CH₃)—O-2′ and analogs thereof (see, e.g., Seth et al., U.S. Pat. No. 8,278,283), 4′-CH₂—N(OCH₃)-2′ and analogs thereof (see, e.g., Prakash et al., U.S. Pat. No. 8,278,425), 4′-CH₂—O—N(CH₃)—2′ (see, e.g., Allerson et al., U.S. Pat. No. 7,696,345 and Allerson et al., U.S. Pat. No. 8,124,745), 4′-CH₂—C(H)(CH₃)—2′ (see, e.g., Zhou, et al., J. Org. Chem., 2009, 74, 118-134), 4′-CH₂—C(═CH₂)-2′ and analogs thereof (see e.g., Seth et al., U.S. Pat. No. 8,278,426), 4′-C(R_aR_b)—N(R)—O-2′, 4′-C(R_aR_b)—O—N(R)-2′, 4′-CH₂—O—N(R)-2′, and 4′-CH₂—N(R)—O-2′, wherein each R, R_a, and R_b is, independently, H, a protecting group, or C₁-C₁₂ alkyl (see, e.g. Imanishi et al., U.S. Pat. No. 7,427,672).

In certain embodiments, such 4′ to 2′ bridges independently comprise from 1 to 4 linked groups independently selected from: —[C(R_a)(R_b)]_n—, —[C(R_a)(R_b)]_n—O—, —C(R_a)═C(R_b)—, —C(R_a)═N—, —C(═NR_a)—, —C(═O)—, —C(═S)—, —O—, —Si(R_a)₂—, —S(═O)_x—, and —N(R_a)—;

• • wherein:
  • x is 0, 1, or 2;
  • n is 1, 2, 3, or 4;
  • each R_a and R_b is, independently, H, a protecting group, hydroxyl, C₁-C₁₂ alkyl, substituted C₁-C₁₂ alkyl, C₂-C₁₂ alkenyl, substituted C₂-C₁₂ alkenyl, C₂-C₁₂ alkynyl, substituted C₂-C₁₂ alkynyl, C₅-C₂₀ aryl, substituted C₅-C₂₀ aryl, heterocycle radical, substituted heterocycle radical, heteroaryl, substituted heteroaryl, C₅-C₇ alicyclic radical, substituted C₅-C₇ alicyclic radical, halogen, OJ₁, NJ₁J₂, SJ_i, N₃, COOJ₁, acyl (C(═O)—H), substituted acyl, CN, sulfonyl (S(═O)₂-J₁), or sulfoxyl (S(═O)-J₁); and
  • each J₁ and J₂ is, independently, H, C₁-C₁₂ alkyl, substituted C₁-C₁₂ alkyl, C₂-C₁₂ alkenyl, substituted C₂-C₁₂ alkenyl, C₂-C₁₂ alkynyl, substituted C₂-C₁₂ alkynyl, C₅-C₂₀ aryl, substituted C₅-C₂₀ aryl, acyl (C(═O)—H), substituted acyl, a heterocycle radical, a substituted heterocycle radical, C₁-C₁₂ aminoalkyl, substituted C₁-C₁₂ aminoalkyl, or a protecting group.

Additional bicyclic sugar moieties are known in the art, see, for example: Freier et al., Nucleic Acids Research, 1997, 25(22), 4429-4443, Albaek et al., J. Org. Chem., 2006, 71, 7731-7740, Singh et al., Chem. Commun., 1998, 4, 455-456; Koshkin et al., Tetrahedron, 1998, 54, 3607-3630; Wahlestedt et al., Proc. Natl. Acad. Sci. U.S.A, 2000, 97, 5633-5638; Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222; Singh et al., J. Org. Chem., 1998, 63, 10035-10039; Srivastava et al., J. Am. Chem. Soc., 2007, 129, 8362-8379; Elayadi et al., Curr. Opinion Invens. Drugs, 2001, 2, 558-561; Braasch et al., Chem. Biol., 2001, 8, 1-7; Orum et al., Curr. Opinion Mol. Ther., 2001, 3, 239-243; Wengel et al., U.S. Pat. No. 7,053,207, Imanishi et al., U.S. Pat. No. 6,268,490, Imanishi et al. U.S. Pat. No. 6,770,748, Imanishi et al., U.S. RE44,779; Wengel et al., U.S. Pat. No. 6,794,499, Wengel et al., U.S. Pat. No. 6,670,461; Wengel et al., U.S. Pat. No. 7,034,133, Wengel et al., U.S. Pat. No. 8,080,644; Wengel et al., U.S. Pat. No. 8,034,909; Wengel et al., U.S. Pat. No. 8,153,365; Wengel et al., U.S. Pat. No. 7,572,582; and Ramasamy et al., U.S. Pat. No. 6,525,191, Torsten et al., WO 2004/106356, Wengel et al., WO 1999/014226; Seth et al., WO 2007/134181; Seth et al., U.S. Pat. No. 7,547,684; Seth et al., U.S. Pat. No. 7,666,854; Seth et al., U.S. Pat. No. 8,088,746; Seth et al., U.S. Pat. No. 7,750,131; Seth et al., U.S. Pat. No. 8,030,467; Seth et al., U.S. Pat. No. 8,268,980; Seth et al., U.S. Pat. No. 8,546,556; Seth et al., U.S. Pat. No. 8,530,640; Migawa et al., U.S. Pat. No. 9,012,421; Seth et al., U.S. Pat. No. 8,501,805; Allerson et al., US2008/0039618; and Migawa et al., US2015/0191727.

In certain embodiments, bicyclic sugar moieties and nucleosides incorporating such bicyclic sugar moieties are further defined by isomeric configuration. For example, an LNA nucleoside (described herein) may be in the α-L configuration or in the β-D configuration.

α-L-methyleneoxy (4′-CH₂—O-2′) or α-L-LNA bicyclic nucleosides have been incorporated into oligonucleotides that showed antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372). The addition of locked nucleic acids to siRNAs has been shown to increase siRNA stability in serum, and to reduce off-target effects (Elmen, J. et al., (2005) Nucleic Acids Research 33(1):439-447; Mook, O R. et al., (2007) Mal Cane Ther 6(3):833-843; Gmunweller, A. et al., (2003) Nucleic Acids Research 31(12):3185-3193). Herein, general descriptions of bicyclic nucleosides include both isomeric configurations. When the positions of specific bicyclic nucleosides (e.g., LNA or cEt) are identified in exemplified embodiments herein, they are in the β-D configuration, unless otherwise specified.

In certain embodiments, modified sugar moieties comprise one or more non-bridging sugar substituent and one or more bridging sugar substituent (e.g., 5′-substituted and 4′-2′ bridged sugars).

In certain embodiments, modified sugar moieties are sugar surrogates. In certain such embodiments, the oxygen atom of the sugar moiety is replaced, e.g., with a sulfur, carbon or nitrogen atom. In certain such embodiments, such modified sugar moieties also comprise bridging and/or non-bridging substituents as described herein. For example, certain sugar surrogates comprise a 4′-sulfur atom and a substitution at the 2-position (see, e.g., Bhat et al., U.S. Pat. No. 7,875,733 and Bhat et al., U.S. Pat. No. 7,939,677) and/or the 5′ position.

In certain embodiments, sugar surrogates comprise rings having other than 5 atoms. For example, in certain embodiments, a sugar surrogate comprises a six-membered tetrahydropyran (“THP”). Such tetrahydropyrans may be further modified or substituted. Nucleosides comprising such modified tetrahydropyrans include but are not limited to hexitol nucleic acid (“HNA”), anitol nucleic acid (“ANA”), manitol nucleic acid (“MNA”) (see, e.g., Leumann, CJ. Bioorg. & Med. Chem. 2002, 10, 841-854), fluoro HNA:

(“F-HNA”, see e.g. Swayze et al., U.S. Pat. No. 8,088,904; Swayze et al., U.S. Pat. No. 8,440,803; Swayze et al., U.S. Pat. No. 8,796,437; and Swayze et al., U.S. Pat. No. 9,005,906; F-HNA can also be referred to as a F-THP or 3′-fluoro tetrahydropyran), and nucleosides comprising additional modified THP compounds having the formula:

• • wherein, independently, for each of said modified THP nucleoside:
  • Bx is a nucleobase moiety;
  • T₃ and T₄ are each, independently, an internucleoside linking group linking the modified THP nucleoside to the remainder of an oligonucleotide or one of T₃ and T₄ is an internucleoside linking group linking the modified THP nucleoside to the remainder of an oligonucleotide and the other of T₃ and T₄ is H, a hydroxyl protecting group, a linked conjugate group, or a 5′ or 3′-terminal group;
  • q₁, q₂, q₃, q₄, q₅, q₆ and q₇ are each, independently, H, C₁-C₆ alkyl, substituted C₁-C₆ alkyl, C₂-C₆ alkenyl, substituted C₂-C₆ alkenyl, C₂-C₆ alkynyl, or substituted C₂-C₆ alkynyl; and each of R₁ and R₂ is independently selected from among: hydrogen, halogen, substituted or unsubstituted alkoxy, NJ₁J₂, SJ₁, N₃, OC(═X)J₁, OC(═X)NJ₁J₂, NJ₃C(═X)NJ₁J₂, and CN, wherein X is O, S or NJ₁, and each J₁, J₂, and J₃ is, independently, H or C₁-C₆ alkyl.

In certain embodiments, modified THP nucleosides are provided wherein q₁, q₂, q₃, q₄, q₅, q₆ and q₇ are each H. In certain embodiments, at least one of q₁, q₂, q₃, q₄, q₅, q₆ and q₇ is other than H. In certain embodiments, at least one of q₁, q₂, q₃, q₄, q₅, q₆ and q₇ is methyl. In certain embodiments, modified THP nucleosides are provided wherein one of R₁ and R₂ is F. In certain embodiments, R₁ is F and R₂ is H, in certain embodiments, R₁ is methoxy and R₂ is H, and in certain embodiments, R₁ is methoxyethoxy and R₂ is H.

In certain embodiments, sugar surrogates comprise rings having more than 5 atoms and more than one heteroatom. For example, nucleosides comprising morpholino sugar moieties and their use in oligonucleotides have been reported (see, e.g., Braasch et al., Biochemistry, 2002, 41, 4503-4510 and Summerton et al., U.S. Pat. No. 5,698,685; Summerton et al., U.S. Pat. No. 5,166,315; Summerton et al., U.S. Pat. No. 5,185,444; and Summerton et al., U.S. Pat. No. 5,034,506). As used here, the term “morpholino” means a sugar surrogate having the following structure:

In certain embodiments, morpholinos may be modified, for example by adding or altering various substituent groups from the above morpholino structure. Such sugar surrogates are referred to herein as “modified morpholinos.”

In certain embodiments, sugar surrogates comprise acyclic moieties. Examples of nucleosides and oligonucleotides comprising such acyclic sugar surrogates include, but are not limited to: peptide nucleic acid (“PNA”), acyclic butyl nucleic acid (see, e.g., Kumar et al., Org. Biomol. Chem., 2013, 11, 5853-5865), and nucleosides and oligonucleotides described in Manoharan et al., WO2011/133876. In certain embodiments, sugar surrogates comprise acyclic moieties. Examples of nucleosides and oligonucleotides comprising such acyclic sugar surrogates include, but are not limited to: peptide nucleic acid (“PNA”), acyclic butyl nucleic acid (see, e.g., Kumar et al., Org. Biomol. Chem., 2013, 11, 5853-5865), and nucleosides and oligonucleotides described in Manoharan et al., US2013/130378. Representative U.S. patents that teach the preparation of PNA compounds include, but are not limited to, U.S. Pat. Nos. 5,539,082; 5,714,331; and 5,719,262. Additional PNA compounds suitable for use in the oligonucleotides of the invention are described in, for example, in Nielsen et al., Science, 1991, 254, 1497-1500.

In certain embodiments, sugar surrogates are the “unlocked” sugar structure of UNA (unlocked nucleic acid) nucleosides. UNA is an unlocked acyclic nucleic acid, wherein any of the bonds of the sugar has been removed, forming an unlocked sugar surrogate. Representative U.S. publications that teach the preparation of UNA include, but are not limited to, U.S. Pat. No. 8,314,227; and US Patent Publication Nos. 2013/0096289; 2013/0011922; and 2011/0313020, the entire contents of each of which are hereby incorporated herein by reference.

In certain embodiments, sugar surrogates are the glycerol as found in GNA (glycol nucleic acid) nucleosides as depicted below:

(S)-GNA

where Bx represents any nucleobase.

Many other bicyclic and tricyclic sugar and sugar surrogates are known in the art that can be used in modified nucleosides.

2. Certain Modified Nucleobases

In certain embodiments, modified oligonucleotides comprise one or more nucleoside comprising an unmodified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more nucleoside comprising a modified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more nucleoside that does not comprise a nucleobase, referred to as an abasic nucleoside. In certain embodiments, modified oligonucleotides comprise one or more inosine nucleosides (i.e., nucleosides comprising a hypoxanthine nucleobase).

In certain embodiments, modified nucleobases are selected from: 5-substituted pyrimidines, 6-azapyrimi-dines, alkyl or alkynyl substituted pyrimidines, alkyl substituted purines, and N-2, N-6 and O-6 substituted purines. In certain embodiments, modified nucleobases are selected from: 5-methylcytosine, 2-aminopropyladenine, 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl (—C≡C—CH₃) uracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-ribosyluracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, 8-aza and other 8-substituted purines, 5-halo, particularly 5-bromo, 5-trifluoromethyl, 5-halouracil, and 5-halocytosine, 7-methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, 6-N-benzoyladenine, 2-N-isobutyrylguanine, 4-N-benzoylcytosine, 4-N-benzoyluracil, 5-methyl 4-N-benzoylcytosine, 5-methyl 4-N-benzoyluracil, universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases. Further modified nucleobases include tricyclic pyrimidines, such as 1,3-diazaphenoxazine-2-one, 1,3-diazaphenothiazine-2-one and 9-(2-aminoethoxy)-1,3-diazaphenoxazine-2-one (G-clamp). Modified nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone. Further nucleobases include those disclosed in Merigan et al., U.S. Pat. No. 3,687,808, those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, Kroschwitz, J. I., Ed., John Wiley & Sons, 1990, 858-859; Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613; Sanghvi, Y. S., Chapter 15, Antisense Research and Applications, Crooke, S. T. and Lebleu, B., Eds., CRC Press, 1993, 273-288; and those disclosed in Chapters 6 and 15, Antisense Drug Technology, Crooke S. T., Ed., CRC Press, 2008, 163-166 and 442-443.

Publications that teach the preparation of certain of the above noted modified nucleobases as well as other modified nucleobases include without limitation, Manoharan et al., US2003/0158403; Manoharan et al., US2003/0175906; Dinh et al., U.S. Pat. No. 4,845,205; Spielvogel et al., U.S. Pat. No. 5,130,302; Rogers et al., U.S. Pat. No. 5,134,066; Bischofberger et al., U.S. Pat. No. 5,175,273; Urdea et al., U.S. Pat. No. 5,367,066; Benner et al., U.S. Pat. No. 5,432,272; Matteucci et al., U.S. Pat. No. 5,434,257; Gmeiner et al., U.S. Pat. No. 5,457,187; Cook et al., U.S. Pat. No. 5,459,255; Froehler et al., U.S. Pat. No. 5,484,908; Matteucci et al., U.S. Pat. No. 5,502,177; Hawkins et al., U.S. Pat. No. 5,525,711; Haralambidis et al., U.S. Pat. No. 5,552,540; Cook et al., U.S. Pat. No. 5,587,469; Froehler et al., U.S. Pat. No. 5,594,121; Switzer et al., U.S. Pat. No. 5,596,091; Cook et al., U.S. Pat. No. 5,614,617; Froehler et al., U.S. Pat. No. 5,645,985; Cook et al., U.S. Pat. No. 5,681,941; Cook et al., U.S. Pat. No. 5,811,534; Cook et al., U.S. Pat. No. 5,750,692; Cook et al., U.S. Pat. No. 5,948,903; Cook et al., U.S. Pat. No. 5,587,470; Cook et al., U.S. Pat. No. 5,457,191; Matteucci et al., U.S. Pat. No. 5,763,588; Froehler et al., U.S. Pat. No. 5,830,653; Cook et al., U.S. Pat. No. 5,808,027; Cook et al., U.S. Pat. No. 6,166,199; and Matteucci et al., U.S. Pat. No. 6,005,096.

3. Certain Modified Internucleoside Linkages

The naturally occurring internucleoside linkage of RNA and DNA is a 3′ to 5′ phosphodiester linkage. In certain embodiments, nucleosides of modified oligonucleotides may be linked together using one or more modified internucleoside linkages. The two main classes of internucleoside linking groups are defined by the presence or absence of a phosphorus atom. Representative phosphorus-containing internucleoside linkages include but are not limited to phosphodiesters, which contain a phosphodiester bond (“P═O”) (also referred to as unmodified or naturally occurring linkages), phosphotriesters, methylphosphonates, phosphoramidates, phosphorothioates (“P═S”), and phosphorodithioates (“HS-P═S”). Representative non-phosphorous containing internucleoside linking groups include but are not limited to methylenemethylimino (—CH₂—N(CH₃)—O—CH₂—), thiodiester, thionocarbamate (—O—C(═O)(NH)—S—); siloxane (—O—SiH₂—O—); and N,N′-dimethylhydrazine (—CH₂—N(CH₃)—N(CH₃)—). Modified internucleoside linkages, compared to naturally occurring phosphodiester internucleoside linkages, can be used to alter, typically increase, nuclease resistance of the oligonucleotide. In certain embodiments, internucleoside linkages having a chiral atom can be prepared as a racemic mixture, or as separate enantiomers. Methods of preparation of phosphorous-containing and non-phosphorous-containing internucleoside linkages are well known to those skilled in the art.

In certain embodiments, a modified internucleoside linkage is any of those described in WO/2021/030778, incorporated by reference herein. In certain embodiments, a modified internucleoside linkage comprises the formula:

wherein independently for each internucleoside linking group of the modified oligonucleotide:

• • X is selected from O or S;
  • R₁ is selected from H, C₁-C₆ alkyl, and substituted C₁-C₆ alkyl; and
  • T is selected from SO₂R₂, C(═O)R₃, and P(═O)R₄R₅, wherein:
  • R₂ is selected from an aryl, a substituted aryl, a heterocycle, a substituted heterocycle, an aromatic heterocycle, a substituted aromatic heterocycle, a diazole, a substituted diazole, a C₁-C₆ alkoxy, C₁-C₆ alkyl, C₁-C₆ alkenyl, C₁-C₆ alkynyl, substituted C₁-C₆ alkyl, substituted C₁-C₆ alkenyl substituted C₁-C₆ alkynyl, and a conjugate group;
  • R₃ is selected from an aryl, a substituted aryl, CH₃, N(CH₃)₂, OCH₃ and a conjugate group;
  • R₄ is selected from OCH₃, OH, C₁-C₆ alkyl, substituted C₁-C₆ alkyl and a conjugate group; and
  • R₅ is selected from OCH₃, OH, C₁-C₆ alkyl, and substituted C₁-C₆ alkyl.

In certain embodiments, a modified internucleoside linkage comprises a mesyl phosphoramidate linking group having a formula:

In certain embodiments, a mesyl phosphoramidate internucleoside linkage may comprise a chiral center. In certain embodiments, modified oligonucleotides comprising (Rp) and/or (Sp) mesyl phosphoramidates comprise one or more of the following formulas, respectively, wherein “B” indicates a nucleobase:

Representative internucleoside linkages having a chiral center include but are not limited to alkylphosphonates and phosphorothioates. Modified oligonucleotides comprising internucleoside linkages having a chiral center can be prepared as populations of modified oligonucleotides comprising stereorandom internucleoside linkages, or as populations of modified oligonucleotides comprising phosphorothioate linkages in particular stereochemical configurations. In certain embodiments, populations of modified oligonucleotides comprise phosphorothioate internucleoside linkages wherein all of the phosphorothioate internucleoside linkages are stereorandom. Such modified oligonucleotides can be generated using synthetic methods that result in random selection of the stereochemical configuration of each phosphorothioate linkage. Nonetheless, each individual phosphorothioate of each individual oligonucleotide molecule has a defined stereoconfiguration. In certain embodiments, populations of modified oligonucleotides are enriched for modified oligonucleotides comprising one or more particular phosphorothioate internucleoside linkages in a particular, independently selected stereochemical configuration. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 65% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 70% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 80% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 90% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 99% of the molecules in the population. Such chirally enriched populations of modified oligonucleotides can be generated using synthetic methods known in the art, e.g., methods described in Oka et al., JACS 125, 8307 (2003), Wan et al. Nuc. Acid. Res. 42, 13456 (2014), and WO 2017/015555. In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one indicated phosphorothioate in the (Sp) configuration. In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one phosphorothioate in the (Rp) configuration. In certain embodiments, modified oligonucleotides comprising (Rp) and/or (Sp) phosphorothioates comprise one or more of the following formulas, respectively, wherein “B” indicates a nucleobase:

Unless otherwise indicated, chiral internucleoside linkages of modified oligonucleotides described herein can be stereorandom or in a particular stereochemical configuration.

Neutral internucleoside linkages include, without limitation, phosphotriesters, methylphosphonates, MMI (3′—CH₂—N(CH₃)—O-5′), amide-3 (3′—CH₂—C(═O)—N(H)-5′), amide-4 (3′—CH₂—N(H)—C(═O)-5′), formacetal (3′-O—CH₂-0-5′), methoxypropyl (MOP), and thioformacetal (3′-S—CH₂—O-5′). Further neutral internucleoside linkages include nonionic linkages comprising siloxane (dialkylsiloxane), carboxylate ester, carboxamide, sulfide, sulfonate ester and amides (See for example: Carbohydrate Modifications in Antisense Research; Y. S. Sanghvi and P. D. Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65). Further neutral internucleoside linkages include nonionic linkages comprising mixed N, O, S and CH₂ component parts.

In certain embodiments, modified oligonucleotides comprise one or more inverted nucleoside, as shown below:

wherein each Bx independently represents any nucleobase.

In certain embodiments, an inverted nucleoside is terminal (i.e., the last nucleoside on one end of an oligonucleotide) and so only one internucleoside linkage depicted above will be present. In certain such embodiments, additional features (such as a conjugate group) may be attached to the inverted nucleoside. Such terminal inverted nucleosides can be attached to either or both ends of an oligonucleotide.

In certain embodiments, such groups lack a nucleobase and are referred to herein as inverted sugar moieties. In certain embodiments, an inverted sugar moiety is terminal (i.e., attached to the last nucleoside on one end of an oligonucleotide) and so only one internucleoside linkage above will be present. In certain such embodiments, additional features (such as a conjugate group) may be attached to the inverted sugar moiety. Such terminal inverted sugar moieties can be attached to either or both ends of an oligonucleotide.

In certain embodiments, nucleic acids can be linked 2′ to 5′ rather than the standard 3′ to 5′ linkage. Such a linkage is illustrated below.

wherein each Bx represents any nucleobase.

B. Certain Motifs

In certain embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising a modified sugar moiety. In certain embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising a modified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more modified internucleoside linkage. In such embodiments, the modified, unmodified, and differently modified sugar moieties, nucleobases, and/or internucleoside linkages of a modified oligonucleotide define a pattern or motif. In certain embodiments, the patterns of sugar moieties, nucleobases, and internucleoside linkages are each independent of one another. Thus, a modified oligonucleotide may be described by its sugar motif, nucleobase motif and/or internucleoside linkage motif (as used herein, nucleobase motif describes the modifications to the nucleobases independent of the sequence of nucleobases).

1. Certain Sugar Motifs

In certain embodiments, oligonucleotides comprise one or more type of modified sugar and/or unmodified sugar moiety arranged along the oligonucleotide or region thereof in a defined pattern or sugar motif. In certain instances, such sugar motifs include but are not limited to any of the sugar modifications discussed herein.

Uniformly Modified Oligonucleotides

In certain embodiments, modified oligonucleotides comprise or consist of a region having a fully modified sugar motif. In such embodiments, each nucleoside of the fully modified region of the modified oligonucleotide comprises a modified sugar moiety. In certain embodiments, each nucleoside of the entire modified oligonucleotide comprises a modified sugar moiety. In certain embodiments, modified oligonucleotides comprise or consist of a region having a fully modified sugar motif, wherein each nucleoside within the fully modified region comprises the same modified sugar moiety, referred to herein as a uniformly modified sugar motif. In certain embodiments, a fully modified oligonucleotide is a uniformly modified oligonucleotide. In certain embodiments, each nucleoside of a uniformly modified nucleotide comprises the same 2′-modification.

Gapmer Oligonucleotides

In certain embodiments, modified oligonucleotides comprise or consist of a region having a gapmer motif, which is defined by two external regions or “wings” and a central or internal region or “gap.” The three regions of a gapmer motif (the 5′-wing, the gap, and the 3′-wing) form a contiguous sequence of nucleosides wherein at least some of the sugar moieties of the nucleosides of each of the wings differ from at least some of the sugar moieties of the nucleosides of the gap. Specifically, at least the sugar moieties of the nucleosides of each wing that are closest to the gap (the 3′-most nucleoside of the 5′-wing and the 5′-most nucleoside of the 3′-wing) differ from the sugar moiety of the neighboring gap nucleosides, thus defining the boundary between the wings and the gap (i.e., the wing/gap junction). In certain embodiments, the sugar moieties within the gap are the same as one another. In certain embodiments, the gap includes one or more nucleoside having a sugar moiety that differs from the sugar moiety of one or more other nucleosides of the gap. In certain embodiments, the sugar motifs of the two wings are the same as one another (symmetric gapmer). In certain embodiments, the sugar motif of the 5′-wing differs from the sugar motif of the 3′-wing (asymmetric gapmer).

In certain embodiments, the wings of a gapmer comprise 1-6 nucleosides. In certain embodiments, each nucleoside of each wing of a gapmer comprises a modified sugar moiety. In certain embodiments, at least one nucleoside of each wing of a gapmer comprises a modified sugar moiety. In certain embodiments, at least two nucleosides of each wing of a gapmer comprises a modified sugar moiety. In certain embodiments, at least three nucleosides of each wing of a gapmer comprises a modified sugar moiety. In certain embodiments, at least four nucleosides of each wing of a gapmer comprises a modified sugar moiety. In certain embodiments, at least five nucleosides of each wing of a gapmer comprises a modified sugar moiety.

In certain embodiments, the gap of a gapmer comprises 7-12 nucleosides. In certain embodiments, each nucleoside of the gap of a gapmer comprises a 2′-β-D-deoxyribosyl sugar moiety. In certain embodiments, at least one nucleoside of the gap of a gapmer comprises a modified sugar moiety.

In certain embodiments, the gapmer is a deoxy gapmer. In certain embodiments, the nucleosides on the gap side of each wing/gap junction comprise 2′-β-D-deoxyribosyl sugar moieties and the nucleosides on the wing sides of each wing/gap junction comprise modified sugar moieties. In certain embodiments, each nucleoside of the gap comprises a 2′-β-D-deoxyribosyl sugar moiety. In certain embodiments, each nucleoside of each wing of a gapmer comprises a modified sugar moiety. In certain embodiments, at least one nucleoside of the gap of a gapmer comprises a modified sugar moiety. In certain embodiments, at least one nucleoside of the gap of a gapmer comprises a 2′-OMe sugar moiety.

In certain embodiments, modified oligonucleotides comprise or consist of a portion having a fully modified sugar motif. In such embodiments, each nucleoside of the fully modified portion of the modified oligonucleotide comprises a modified sugar moiety. In certain embodiments, each nucleoside of the entire modified oligonucleotide comprises a modified sugar moiety. In certain embodiments, modified oligonucleotides comprise or consist of a portion having a fully modified sugar motif, wherein each nucleoside within the fully modified portion comprises the same modified sugar moiety, referred to herein as a uniformly modified sugar motif. In certain embodiments, a fully modified oligonucleotide is a uniformly modified oligonucleotide. In certain embodiments, each nucleoside of a uniformly modified oligonucleotide comprises the same 2′-modification.

Herein, the lengths (number of nucleosides) of the three regions of a gapmer may be provided using the notation [# of nucleosides in the 5′-wing]-[# of nucleosides in the gap]-[# of nucleosides in the 3′-wing]. Thus, a 3-10-3 gapmer consists of 3 linked nucleosides in each wing and 10 linked nucleosides in the gap. Where such nomenclature is followed by a specific modification, that modification is the modification in each sugar moiety of each wing and the gap nucleosides comprise 2′-β-D-deoxyribosyl sugar moieties. Thus, a 5-10-5 MOE gapmer consists of 5 linked 2′-MOE nucleosides in the 5′-wing, 10 linked 2′-β-D-deoxynucleosides in the gap, and 5 linked 2′-MOE nucleosides in the 3′-wing. A 3-10-3 cEt gapmer consists of 3 linked cEt nucleosides in the 5′-wing, 10 linked 2′-β-D-deoxynucleosides in the gap, and 3 linked cEt nucleosides in the 3′-wing. A 5-8-5 gapmer consists of 5 linked nucleosides comprising a modified sugar moiety in the 5′-wing, 8 linked 2′-β-D-deoxynucleosides in the gap, and 5 linked nucleosides comprising a modified sugar moiety in the 3′-wing. A 5-8-5 mixed gapmer has at least two different modified sugar moieties in the 5′- and/or the 3′-wing.

In certain embodiments, modified oligonucleotides are 5-10-5 MOE gapmers. In certain embodiments, modified oligonucleotides are 3-10-3 BNA gapmers. In certain embodiments, modified oligonucleotides are 3-10-3 cEt gapmers. In certain embodiments, modified oligonucleotides are 3-10-3 LNA gapmers.

In certain embodiments, modified oligonucleotides have a sugar motif selected from 5′-eeeeeddddddddddeeeee-3′ or 5′-kkkddddddddddkkk-3′, wherein each “d” represents a 2′-β-D-deoxyribosyl sugar moiety, each “e” represents a 2′-MOE sugar moiety, and each “k” represents a cEt sugar moiety. In certain embodiments, modified oligonucleotides have the following sugar motif: 5′-eeeeeddddddddddeeeee-3′, wherein each “d” represents a 2′-β-D-deoxyribosyl sugar moiety and each “e” represents a 2′-MOE sugar moiety. In certain embodiments, modified oligonucleotides have the following sugar motif: 5′-kkkddddddddddkkk-3′, wherein each “d” represents a 2′-β-D-deoxyribosyl sugar moiety and each “k” represents a cEt sugar moiety.

Antisense RNAi Oligonucleotides

In certain embodiments, the sugar moiety of at least one nucleoside of an antisense RNAi oligonucleotide is a modified sugar moiety.

In certain embodiments, at least one nucleoside of the antisense RNAi oligonucleotide comprises a 2′-OMe sugar moiety. In certain embodiments, at least 2 nucleosides comprise 2′-OMe sugar moieties. In certain embodiments, at least 3 nucleosides comprise 2′-OMe sugar moieties. In certain embodiments, at least 4 nucleosides comprise 2′-OMe sugar moieties. In certain embodiments, at least 5 nucleosides comprise 2′-OMe sugar moieties. In certain embodiments, at least 6 nucleosides comprise 2′-OMe sugar moieties. In certain embodiments, at least 7 nucleosides comprise 2′-OMe sugar moieties. In certain embodiments, at least 8 nucleosides comprise 2′-OMe sugar moieties. In certain embodiments, at least 9 nucleosides comprise 2′-OMe sugar moieties. In certain embodiments, at least 10 nucleosides comprise 2′-OMe sugar moieties. In certain embodiments, at least 11 nucleosides comprise 2′-OMe sugar moieties. In certain embodiments, at least 12 nucleosides comprise 2′-OMe sugar moieties. In certain embodiments, at least 13 nucleosides comprise 2′-OMe sugar moieties. In certain embodiments, at least 14 nucleosides comprise 2′-OMe sugar moieties. In certain embodiments, at least 15 nucleosides comprise 2′-OMe sugar moieties. In certain embodiments, at least 17 nucleosides comprise 2′-OMe sugar moieties. In certain such embodiments, at least 18 nucleosides comprise 2′-OMe sugar moieties. In certain such embodiments, at least 20 nucleosides comprise 2′-OMe sugar moieties. In certain embodiments, at least 21 nucleosides comprise 2′-OMe sugar moieties. In certain embodiments, 1 or 2 nucleosides comprise 2′-OMe sugar moieties. In certain embodiments, 1-3 nucleosides comprise 2′-OMe sugar moieties. In certain embodiments, 1-4 nucleosides comprise 2′-OMe sugar moieties. In certain embodiments, 1-5 nucleosides comprise 2′-OMe sugar moieties. In certain embodiments, 1-7 nucleosides comprise 2′-OMe sugar moieties. In certain embodiments, 1-10 nucleosides comprise 2′-OMe sugar moieties. In certain embodiments, 1-12 nucleosides comprise 2′-OMe sugar moieties. In certain embodiments, 1-13 nucleosides comprise 2′-OMe sugar moieties. In certain embodiments, 13 nucleosides comprise 2′-OMe sugar moieties and 3 of those 2′-OMe nucleosides are contiguous. In certain such embodiments, the remainder of the nucleosides are 2′-F modified.

In certain embodiments, at least one nucleoside of the antisense RNAi oligonucleotide comprises a 2′-F sugar moiety. In certain embodiments, at least 2 nucleosides comprise 2′-F sugar moieties. In certain embodiments, at least 3 nucleosides comprise 2′-F sugar moieties. In certain embodiments, at least 4 nucleosides comprise 2′-F sugar moieties. In certain embodiments, at least 5 nucleosides comprise 2′-F sugar moieties. In certain embodiments, at least 6 nucleosides comprise 2′-F sugar moieties. In certain embodiments, at least 7 nucleosides comprise 2′-F sugar moieties. In certain embodiments, at least 8 nucleosides comprise 2′-F sugar moieties. In certain embodiments, at least 9 nucleosides comprise 2′-F sugar moieties. In certain embodiments, at least 10 nucleosides comprise 2′-F sugar moieties. In certain embodiments, at least 11 nucleosides comprise 2′-F sugar moieties. In certain embodiments, at least 12 nucleosides comprise 2′-F sugar moieties. In certain embodiments, at least 13 nucleosides comprise 2′-F sugar moieties. In certain embodiments, at least 14 nucleosides comprise 2′-F sugar moieties. In certain embodiments, at least 16 nucleosides comprise 2′-F sugar moieties. In certain embodiments, at least 18 nucleosides comprise 2′-F sugar moieties. In certain embodiments, at least 20 nucleosides comprise 2′-F sugar moieties. In certain embodiments, at least 21 nucleosides comprise 2′-F sugar moieties. In certain embodiments, 1 or 2 nucleosides comprise 2′-F sugar moieties. In certain embodiments, 1-3 nucleosides comprise 2′-F sugar moieties. In certain embodiments, at least 1-4 nucleosides comprise 2′-F sugar moieties. In certain embodiments, 1-5 nucleosides comprise 2′-F sugar moieties. In certain embodiments, 1-7 nucleosides comprise 2′-F sugar moieties. In certain embodiments, 1-10 nucleosides comprise 2′-F sugar moieties. In certain embodiments, every other nucleosides of an antisense RNAi oligonucleotide are 2′-F nucleosides. In certain such embodiments, the remainder of the nucleosides are 2′-OMe modified.

In certain embodiments, at least one nucleoside of the antisense RNAi oligonucleotide comprises a 2′-OMe sugar moiety and at least one nucleoside comprises a 2′-F sugar moiety. In certain embodiments, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13 nucleosides comprises a 2′-OMe sugar moiety and at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleosides comprises a 2′-F sugar moiety. In certain embodiments, the antisense RNAi oligonucleotide comprises a sugar motif of fyf or yfy, wherein each “f” represents a 2′-F sugar moiety and each “y” represents a 2′-OMe sugar moiety. In certain embodiments, the antisense RNAi oligonucleotide has a sugar motif of yfyfyfyfyfyfyfyfyfyfyyy, wherein each “f” represents a 2′-F sugar moiety and each “y” represents a 2′-OMe sugar moiety.

In certain embodiments, one nucleoside of an antisense RNAi oligonucleotide is a UNA. In certain embodiments, one nucleoside of an antisense RNAi oligonucleotide is a GNA. In certain embodiments, 1-4 nucleosides of an antisense RNAi oligonucleotide is/are DNA. In certain such embodiments, the 1-4 DNA nucleosides are at one or both ends of the antisense RNAi oligonucleotide.

Sense RNAi Oligonucleotides

In certain embodiments, the sugar moiety of at least one nucleoside of a sense RNAi oligonucleotide is a modified sugar moiety.

In certain such embodiments, at least one nucleoside of the sense RNAi oligonucleotide comprises a 2′-OMe sugar moiety. In certain embodiments, at least 2 nucleosides comprise 2′-OMe sugar moieties. In certain embodiments, at least 3 nucleosides comprise 2′-OMe sugar moieties. In certain embodiments, at least 4 nucleosides comprise 2′-OMe sugar moieties. In certain embodiments, at least 5 nucleosides comprise 2′-OMe sugar moieties. In certain embodiments, at least 6 nucleosides comprise 2′-OMe sugar moieties. In certain embodiments, at least 7 nucleosides comprise 2′-OMe sugar moieties. In certain embodiments, at least 8 nucleosides comprise 2′-OMe sugar moieties. In certain embodiments, at least 9 nucleosides comprise 2′-OMe sugar moieties. In certain embodiments, at least 10 nucleosides comprise 2′-OMe sugar moieties. In certain embodiments, at least 12 nucleosides comprise 2′-OMe sugar moieties. In certain embodiments, at least 14 nucleosides comprise 2′-OMe sugar moieties. In certain embodiments, at least 15 nucleosides comprise 2′-OMe sugar moieties. In certain embodiments, at least 17 nucleosides comprise 2′-OMe sugar moieties. In certain such embodiments, at least 18 nucleosides comprise 2′-OMe sugar moieties. In certain such embodiments, at least 20 nucleosides comprise 2′-OMe sugar moieties. In certain embodiments, 1 or 2 nucleosides comprise 2′-OMe sugar moieties. In certain embodiments, 1-3 nucleosides comprise 2′-OMe sugar moieties. In certain embodiments, 1-4 nucleosides comprise 2′-OMe sugar moieties. In certain embodiments, 1-5 nucleosides comprise 2′-OMe sugar moieties. In certain embodiments, 1-7 nucleosides comprise 2′-OMe sugar moieties. In certain embodiments, 1-10 nucleosides comprise 2′-OMe sugar moieties. In certain embodiments, every other nucleosides of a sense RNAi oligonucleotide are 2′-OMe nucleosides. In certain such embodiments, the remainder of the nucleosides are 2′-F modified.

In certain embodiments, at least one nucleoside of the sense RNAi oligonucleotide comprises a 2′-F sugar moiety. In certain embodiments, at least 2 nucleosides comprise 2′-F sugar moieties. In certain embodiments, at least 3 nucleosides comprise 2′-F sugar moieties. In certain embodiments, at least 4 nucleosides comprise 2′-F sugar moieties. In certain embodiments, at least 5 nucleosides comprise 2′-F sugar moieties. In certain embodiments, at least 6 nucleosides comprise 2′-F sugar moieties. In certain embodiments, at least 7 nucleosides comprise 2′-F sugar moieties. In certain embodiments, at least 8 nucleosides comprise 2′-F sugar moieties. In certain embodiments, at least 9 nucleosides comprise 2′-F sugar moieties. In certain embodiments, at least 10 nucleosides comprise 2′-F sugar moieties. In certain embodiments, at least 11 nucleosides comprise 2′-F sugar moieties. In certain embodiments, 1 or 2 nucleosides comprise 2′-F sugar moieties. In certain embodiments, 1-3 nucleosides comprise 2′-F sugar moieties. In certain embodiments, at least 1-4 nucleosides comprise 2′-F sugar moieties. In certain embodiments, at least 1-5 nucleosides comprise 2′-F sugar moieties. In certain embodiments, at least 1-7 nucleosides comprise 2′-F sugar moieties. In certain embodiments, at least 1-10 nucleosides comprise 2′-F sugar moieties. In certain embodiments, at least 1-11 nucleosides comprise 2′-F sugar moieties. In certain embodiments, every other nucleosides of a sense RNAi oligonucleotide are 2′-F nucleosides. In certain embodiments, the remainder of the nucleosides are 2′OMe modified.

In certain embodiments, at least one nucleoside of the sense RNAi oligonucleotide comprises a 2′-OMe sugar moiety and at least one nucleoside comprises a 2′-F sugar moiety. In certain embodiments, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleosides comprises a 2′-OMe sugar moiety and at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 nucleosides comprises a 2′-F sugar moiety. In certain embodiments, the sense RNAi oligonucleotide comprises a sugar motif of fyf or yfy, wherein each “f” represents a 2′-F sugar moiety and each “y” represents a 2′-OMe sugar moiety. In certain embodiments, the sense RNAi oligonucleotide has a sugar motif of fyfyfyfyfyfyfyfyfyf, wherein each “f” represents a 2′-F sugar moiety and each “y” represents a 2′-OMe sugar moiety.

In certain embodiments, one nucleoside of a sense RNAi oligonucleotide is a UNA. In certain embodiments, one nucleoside of a sense RNAi oligonucleotide is a GNA. In certain embodiments, 1-4 nucleosides of a sense RNAi oligonucleotide is/are DNA. In certain such embodiments, the 1-4 DNA nucleosides are at one or both ends of the sense RNAi oligonucleotide.

2. Certain Nucleobase Motifs

In certain embodiments, oligonucleotides comprise modified and/or unmodified nucleobases arranged along the oligonucleotide or region thereof in a defined pattern or motif. In certain embodiments, each nucleobase is modified. In certain embodiments, none of the nucleobases are modified. In certain embodiments, each purine or each pyrimidine is modified. In certain embodiments, each adenine is modified. In certain embodiments, each guanine is modified. In certain embodiments, each thymine is modified. In certain embodiments, each uracil is modified. In certain embodiments, each cytosine is modified. In certain embodiments, some or all of the cytosine nucleobases in a modified oligonucleotide are 5-methylcytosines. In certain embodiments, all of the cytosine nucleobases are 5-methylcytosines and all of the other nucleobases of the modified oligonucleotide are unmodified nucleobases.

In certain embodiments, modified oligonucleotides comprise a block of modified nucleobases. In certain such embodiments, the block is at the 3′-end of the oligonucleotide. In certain embodiments the block is within 3 nucleosides of the 3′-end of the oligonucleotide. In certain embodiments, the block is at the 5′-end of the oligonucleotide. In certain embodiments the block is within 3 nucleosides of the 5′-end of the oligonucleotide.

Gapmer Oligonucleotides

In certain embodiments, oligonucleotides having a gapmer motif comprise a nucleoside comprising a modified nucleobase. In certain such embodiments, one nucleoside comprising a modified nucleobase is in the central gap of an oligonucleotide having a gapmer motif. In certain such embodiments, the sugar moiety of said nucleoside is a 2′-β-D-deoxyribosyl sugar moiety. In certain embodiments, the modified nucleobase is selected from: a 2-thiopyrimidine and a 5-propynepyrimidine.

3. Certain Internucleoside Linkage Motifs

In certain embodiments, oligonucleotides comprise modified and/or unmodified internucleoside linkages arranged along the oligonucleotide or region thereof in a defined pattern or motif. In certain embodiments, each internucleoside linking group is a phosphodiester internucleoside linkage (P═O). In certain embodiments, each internucleoside linking group of a modified oligonucleotide is a phosphorothioate internucleoside linkage (P═S). In certain embodiments, each internucleoside linkage of a modified oligonucleotide is independently selected from a phosphorothioate internucleoside linkage and phosphodiester internucleoside linkage. In certain embodiments, each phosphorothioate internucleoside linkage is independently selected from a stereorandom phosphorothioate a (Sp) phosphorothioate, and a (Rp) phosphorothioate.

Gapmer Oligonucleotides

In certain embodiments, the sugar motif of a modified oligonucleotide is a gapmer and the internucleoside linkages within the gap are all modified. In certain embodiments, some or all of the internucleoside linkages in the wings are unmodified phosphodiester internucleoside linkages. In certain embodiments, the terminal internucleoside linkages are modified. In certain embodiments, the sugar motif of a modified oligonucleotide is a gapmer, and the internucleoside linkage motif comprises at least one phosphodiester internucleoside linkage in at least one wing, wherein the at least one phosphodiester linkage is not a terminal internucleoside linkage, and the remaining internucleoside linkages are phosphorothioate internucleoside linkages. In certain such embodiments, all of the phosphorothioate linkages are stereorandom. In certain embodiments, all of the phosphorothioate linkages in the wings are (Sp) phosphorothioates, and the gap comprises at least one Sp, Sp, or Rp motif. In certain embodiments, populations of modified oligonucleotides are enriched for modified oligonucleotides comprising such internucleoside linkage motifs.

In certain embodiments, modified oligonucleotides have an internucleoside linkage motif of sssssssssssssss or sssssssssssssssssss, wherein each “s” represents a phosphorothioate internucleoside linkage. In certain embodiments, modified oligonucleotides have an internucleoside linkage motif of sssssssssssssss. In certain embodiments, modified oligonucleotides have an internucleoside linkage motif of sssssssssssssssssss.

In certain embodiments, modified oligonucleotides have an internucleoside linkage motif comprising one or more mesyl phosphoramidate linking groups. In certain embodiments, one or more phosphorothioate internucleoside linkages or one or more phosphodiester internucleoside linkages of the internucleoside linkage motifs herein is substituted with a mesyl phosphoramidates linking group.

Antisense RNAi Oligonucleotides

In certain embodiments, at least one linkage of the antisense RNAi oligonucleotide is a modified linkage. In certain embodiments, the 5′-most linkage (i.e., linking the first nucleoside from the 5′-end to the second nucleoside from the 5′-end) is modified. In certain embodiments, the two 5′-most linkages are modified. In certain embodiments, the first one or 2 linkages from the 3′-end are modified. In certain embodiments, the modified linkage is a phosphorothioate linkage. In certain embodiments, the remaining linkages are all unmodified phosphodiester linkages. In certain embodiments, antisense RNAi oligonucleotides have an internucleoside linkage motif of ssooooooooooooooooooss, wherein each “s” represents a phosphorothioate internucleoside linkage and each “o” represents a phosphodiester internucleoside linkage.

In certain embodiments, at least one linkage of the antisense RNAi oligonucleotide is an inverted linkage.

Sense RNAi Oligonucleotides

In certain embodiments, at least one linkage of the sense RNAi oligonucleotides is a modified linkage. In certain embodiments, the 5′-most linkage (i.e., linking the first nucleoside from the 5′-end to the second nucleoside from the 5′-end) is modified. In certain embodiments, the two 5′-most linkages are modified. In certain embodiments, the first one or 2 linkages from the 3′-end are modified. In certain embodiments, the modified linkage is a phosphorothioate linkage. In certain embodiments, the remaining linkages are all unmodified phosphodiester linkages. In certain embodiments, sense RNAi oligonucleotides have an internucleoside linkage motif of ssooooooooooooooooss, wherein each “s” represents a phosphorothioate internucleoside linkage and each “o” represents a phosphodiester internucleoside linkage.

In certain embodiments, at least one linkage of the sense RNAi oligonucleotides is an inverted linkage.

C. Certain Lengths

It is possible to increase or decrease the length of an oligonucleotide without eliminating activity. For example, in Woolf et al. (Proc. Natl. Acad. Sci. USA 89:7305-7309, 1992), a series of oligonucleotides 13-25 nucleobases in length were tested for their ability to induce cleavage of a target RNA in an oocyte injection model. Oligonucleotides 25 nucleobases in length with 8 or 11 mismatch bases near the ends of the oligonucleotides were able to direct specific cleavage of the target RNA, albeit to a lesser extent than the oligonucleotides that contained no mismatches. Similarly, target specific cleavage was achieved using 13 nucleobase oligonucleotides, including those with 1 or 3 mismatches.

In certain embodiments, oligonucleotides (including modified oligonucleotides) can have any of a variety of ranges of lengths. In certain embodiments, oligonucleotides consist of X to Y linked nucleosides, where X represents the fewest number of nucleosides in the range and Y represents the largest number nucleosides in the range. In certain such embodiments, X and Y are each independently selected from 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50; provided that X≤Y. For example, in certain embodiments, oligonucleotides consist of 12 to 13, 12 to 14, 12 to 15, 12 to 16, 12 to 17, 12 to 18, 12 to 19, 12 to 20, 12 to 21, 12 to 22, 12 to 23, 12 to 24, 12 to 25, 12 to 26, 12 to 27, 12 to 28, 12 to 29, 12 to 30, 13 to 14, 13 to 15, 13 to 16, 13 to 17, 13 to 18, 13 to 19, 13 to 20, 13 to 21, 13 to 22, 13 to 23, 13 to 24, 13 to 25, 13 to 26, 13 to 27, 13 to 28, 13 to 29, 13 to 30, 14 to 15, 14 to 16, 14 to 17, 14 to 18, 14 to 19, 14 to 20, 14 to 21, 14 to 22, 14 to 23, 14 to 24, 14 to 25, 14 to 26, 14 to 27, 14 to 28, 14 to 29, 14 to 30, 15 to 16, 15 to 17, 15 to 18, 15 to 19, 15 to 20, 15 to 21, 15 to 22, 15 to 23, 15 to 24, 15 to 25, 15 to 26, 15 to 27, 15 to 28, 15 to 29, 15 to 30, 16 to 17, 16 to 18, 16 to 19, 16 to 20, 16 to 21, 16 to 22, 16 to 23, 16 to 24, 16 to 25, 16 to 26, 16 to 27, 16 to 28, 16 to 29, 16 to 30, 17 to 18, 17 to 19, 17 to 20, 17 to 21, 17 to 22, 17 to 23, 17 to 24, 17 to 25, 17 to 26, 17 to 27, 17 to 28, 17 to 29, 17 to 30, 18 to 19, 18 to 20, 18 to 21, 18 to 22, 18 to 23, 18 to 24, 18 to 25, 18 to 26, 18 to 27, 18 to 28, 18 to 29, 18 to 30, 19 to 20, 19 to 21, 19 to 22, 19 to 23, 19 to 24, 19 to 25, 19 to 26, 19 to 29, 19 to 28, 19 to 29, 19 to 30, 20 to 21, 20 to 22, 20 to 23, 20 to 24, 20 to 25, 20 to 26, 20 to 27, 20 to 28, 20 to 29, 20 to 30, 21 to 22, 21 to 23, 21 to 24, 21 to 25, 21 to 26, 21 to 27, 21 to 28, 21 to 29, 21 to 30, 22 to 23, 22 to 24, 22 to 25, 22 to 26, 22 to 27, 22 to 28, 22 to 29, 22 to 30, 23 to 24, 23 to 25, 23 to 26, 23 to 27, 23 to 28, 23 to 29, 23 to 30, 24 to 25, 24 to 26, 24 to 27, 24 to 28, 24 to 29, 24 to 30, 25 to 26, 25 to 27, 25 to 28, 25 to 29, 25 to 30, 26 to 27, 26 to 28, 26 to 29, 26 to 30, 27 to 28, 27 to 29, 27 to 30, 28 to 29, 28 to 30, or 29 to 30 linked nucleosides.

In certain embodiments, oligonucleotides (including modified oligonucleotides) consist of 16 linked nucleosides. In certain embodiments, oligonucleotides (including modified oligonucleotides) consist of 17 linked nucleosides. In certain embodiments, oligonucleotides (including modified oligonucleotides) consist of 18 linked nucleosides. In certain embodiments, oligonucleotides (including modified oligonucleotides) consist of 19 linked nucleosides. In certain embodiments, oligonucleotides (including modified oligonucleotides) consist of 20 linked nucleosides.

Gapmer Oligonucleotides

In certain embodiments, a modified oligonucleotide is a gapmer. In certain embodiments, the gapmer consists of X to Y linked nucleosides, where X represents the fewest number of nucleosides in the range and Y represents the largest number nucleosides in the range. In certain embodiments, X and Y are each independently selected from 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50; provided that X≤Y. For example, in certain embodiments, gapmers consist of 12 to 13, 12 to 14, 12 to 15, 12 to 16, 12 to 17, 12 to 18, 12 to 19, 12 to 20, 12 to 21, 12 to 22, 12 to 23, 12 to 24, 12 to 25, 12 to 26, 12 to 27, 12 to 28, 12 to 29, 12 to 30, 13 to 14, 13 to 15, 13 to 16, 13 to 17, 13 to 18, 13 to 19, 13 to 20, 13 to 21, 13 to 22, 13 to 23, 13 to 24, 13 to 25, 13 to 26, 13 to 27, 13 to 28, 13 to 29, 13 to 30, 14 to 15, 14 to 16, 14 to 17, 14 to 18, 14 to 19, 14 to 20, 14 to 21, 14 to 22, 14 to 23, 14 to 24, 14 to 25, 14 to 26, 14 to 27, 14 to 28, 14 to 29, 14 to 30, 15 to 16, 15 to 17, 15 to 18, 15 to 19, 15 to 20, 15 to 21, 15 to 22, 15 to 23, 15 to 24, 15 to 25, 15 to 26, 15 to 27, 15 to 28, 15 to 29, 15 to 30, 16 to 17, 16 to 18, 16 to 19, 16 to 20, 16 to 21, 16 to 22, 16 to 23, 16 to 24, 16 to 25, 16 to 26, 16 to 27, 16 to 28, 16 to 29, 16 to 30, 17 to 18, 17 to 19, 17 to 20, 17 to 21, 17 to 22, 17 to 23, 17 to 24, 17 to 25, 17 to 26, 17 to 27, 17 to 28, 17 to 29, 17 to 30, 18 to 19, 18 to 20, 18 to 21, 18 to 22, 18 to 23, 18 to 24, 18 to 25, 18 to 26, 18 to 27, 18 to 28, 18 to 29, 18 to 30, 19 to 20, 19 to 21, 19 to 22, 19 to 23, 19 to 24, 19 to 25, 19 to 26, 19 to 29, 19 to 28, 19 to 29, 19 to 30, 20 to 21, 20 to 22, 20 to 23, 20 to 24, 20 to 25, 20 to 26, 20 to 27, 20 to 28, 20 to 29, 20 to 30, 21 to 22, 21 to 23, 21 to 24, 21 to 25, 21 to 26, 21 to 27, 21 to 28, 21 to 29, 21 to 30, 22 to 23, 22 to 24, 22 to 25, 22 to 26, 22 to 27, 22 to 28, 22 to 29, 22 to 30, 23 to 24, 23 to 25, 23 to 26, 23 to 27, 23 to 28, 23 to 29, 23 to 30, 24 to 25, 24 to 26, 24 to 27, 24 to 28, 24 to 29, 24 to 30, 25 to 26, 25 to 27, 25 to 28, 25 to 29, 25 to 30, 26 to 27, 26 to 28, 26 to 29, 26 to 30, 27 to 28, 27 to 29, 27 to 30, 28 to 29, 28 to 30, or 29 to 30 linked nucleosides.

In certain embodiments, a gapmer consists of 16 linked nucleosides. In certain embodiments, a gapmer consists of 17 linked nucleosides. In certain embodiments, a gapmer consists consist of 18 linked nucleosides. In certain embodiments, a gapmer consists of 19 linked nucleosides. In certain embodiments, a gapmer consists of 20 linked nucleosides.

Antisense RNAi Oligonucleotides

In certain embodiments, antisense RNAi oligonucleotides consist of 17-30 linked nucleosides. In certain embodiments, antisense RNAi oligonucleotides consist of 17-25 linked nucleosides. In certain embodiments, antisense RNAi oligonucleotides consist of 17-23 linked nucleosides. In certain embodiments, antisense RNAi oligonucleotides consist of 17-21 linked nucleosides. In certain embodiments, antisense RNAi oligonucleotides consist of 18-30 linked nucleosides. In certain embodiments, antisense RNAi oligonucleotides consist of 20-30 linked nucleosides. In certain embodiments, antisense RNAi oligonucleotides consist of 21-30 linked nucleosides. In certain embodiments, antisense RNAi oligonucleotides consist of 23-30 linked nucleosides. In certain embodiments, antisense RNAi oligonucleotides consist of 18-25 linked nucleosides. In certain embodiments, antisense RNAi oligonucleotides consist of 20-22 linked nucleosides. In certain embodiments, antisense RNAi oligonucleotides consist of 21-23 linked nucleosides. In certain embodiments, antisense RNAi oligonucleotides consist of 23-24 linked nucleosides. In certain embodiments, antisense RNAi oligonucleotides consist of 20 linked nucleosides. In certain embodiments, antisense RNAi oligonucleotides consist of 21 linked nucleosides. In certain embodiments, antisense RNAi oligonucleotides consist of 22 linked nucleosides. In certain embodiments, antisense RNAi oligonucleotides consist of 23 linked nucleosides.

Sense RNAi Oligonucleotides

In certain embodiments, sense RNAi oligonucleotides consist of 17-30 linked nucleosides. In certain embodiments, sense RNAi oligonucleotides consist of 17-25 linked nucleosides. In certain embodiments, sense RNAi oligonucleotides consist of 17-23 linked nucleosides. In certain embodiments, sense RNAi oligonucleotides consist of 17-21 linked nucleosides. In certain embodiments, sense RNAi oligonucleotides consist of 18-30 linked nucleosides. In certain embodiments, sense RNAi oligonucleotides consist of 20-30 linked nucleosides. In certain embodiments, sense RNAi oligonucleotides consist of 21-30 linked nucleosides. In certain embodiments, sense RNAi oligonucleotides consist of 23-30 linked nucleosides. In certain embodiments, sense RNAi oligonucleotides consist of 18-25 linked nucleosides. In certain embodiments, sense RNAi oligonucleotides consist of 20-22 linked nucleosides. In certain embodiments, sense RNAi oligonucleotides consist of 21-23 linked nucleosides. In certain embodiments, sense RNAi oligonucleotides consist of 23-24 linked nucleosides. In certain embodiments, sense RNAi oligonucleotides consist of 20 linked nucleosides. In certain embodiments, sense RNAi oligonucleotides consist of 21 linked nucleosides. In certain embodiments, sense RNAi oligonucleotides consist of 22 linked nucleosides. In certain embodiments, sense RNAi oligonucleotides consist of 23 linked nucleosides.

D. Certain Modified Oligonucleotides

In certain embodiments, the above modifications (sugar, nucleobase, internucleoside linkage) are incorporated into a modified oligonucleotide. In certain embodiments, modified oligonucleotides are characterized by their modification motifs and overall lengths. In certain embodiments, such parameters are each independent of one another. Thus, unless otherwise indicated, each internucleoside linkage of an oligonucleotide having a gapmer sugar motif may be modified or unmodified and may or may not follow the gapmer modification pattern of the sugar modifications. For example, the internucleoside linkages within the wing regions of a sugar gapmer may be the same or different from one another and may be the same or different from the internucleoside linkages of the gap region of the sugar motif. Likewise, such sugar gapmer oligonucleotides may comprise one or more modified nucleobase independent of the gapmer pattern of the sugar modifications. Unless otherwise indicated, all modifications are independent of nucleobase sequence.

E. Certain Populations of Modified Oligonucleotides

Populations of modified oligonucleotides in which all of the modified oligonucleotides of the population have the same molecular formula can be stereorandom populations or chirally enriched populations. All of the chiral centers of all of the modified oligonucleotides are stereorandom in a stereorandom population. In a chirally enriched population, at least one particular chiral center is not stereorandom in the modified oligonucleotides of the population. In certain embodiments, the modified oligonucleotides of a chirally enriched population are enriched for β-D ribosyl sugar moieties, and all of the phosphorothioate internucleoside linkages are stereorandom. In certain embodiments, the modified oligonucleotides of a chirally enriched population are enriched for both R-D ribosyl sugar moieties and at least one, particular phosphorothioate internucleoside linkage in a particular stereochemical configuration.

F. Nucleobase Sequence

In certain embodiments, oligonucleotides (unmodified or modified oligonucleotides) are further described by their nucleobase sequence. In certain embodiments oligonucleotides have a nucleobase sequence that is complementary to a second oligonucleotide or an identified reference nucleic acid, such as a target nucleic acid. In certain such embodiments, a region of an oligonucleotide has a nucleobase sequence that is complementary to a second oligonucleotide or an identified reference nucleic acid, such as a target nucleic acid. In certain embodiments, the nucleobase sequence of a region or entire length of an oligonucleotide is at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to the second oligonucleotide or nucleic acid, such as a target nucleic acid.

II. Certain Oligomeric Compounds

In certain embodiments, provided herein are oligomeric compounds, which consist of an oligonucleotide (modified or unmodified) and optionally one or more conjugate groups and/or terminal groups. Conjugate groups consist of one or more conjugate moiety and a conjugate linker which links the conjugate moiety to the oligonucleotide. Conjugate groups may be attached to either or both ends of an oligonucleotide and/or at any internal position. In certain embodiments, conjugate groups are attached to the 2-position of a nucleoside of a modified oligonucleotide. In certain embodiments, conjugate groups that are attached to either or both ends of an oligonucleotide are terminal groups. In certain such embodiments, conjugate groups or terminal groups are attached at the 3′ and/or 5′-end of oligonucleotides. In certain such embodiments, conjugate groups (or terminal groups) are attached at the 3′-end of oligonucleotides. In certain embodiments, conjugate groups are attached near the 3′-end of oligonucleotides. In certain embodiments, conjugate groups (or terminal groups) are attached at the 5′-end of oligonucleotides. In certain embodiments, conjugate groups are attached near the 5′-end of oligonucleotides.

Examples of terminal groups include but are not limited to conjugate groups, capping groups, phosphate moieties, protecting groups, modified or unmodified nucleosides, and two or more nucleosides that are independently modified or unmodified.

A. Certain Conjugate Groups

In certain embodiments, oligonucleotides are covalently attached to one or more conjugate groups. In certain embodiments, conjugate groups modify one or more properties of the attached oligonucleotide, including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge and clearance.

In certain embodiments, conjugation of one or more carbohydrate moieties to a modified oligonucleotide can optimize one or more properties of the modified oligonucleotide. In certain embodiments, the carbohydrate moiety is attached to a modified subunit of the modified oligonucleotide. For example, the ribose sugar of one or more ribonucleotide subunits of a modified oligonucleotide can be replaced with another moiety, e.g. a non-carbohydrate (preferably cyclic) carrier to which is attached a carbohydrate ligand. A ribonucleotide subunit in which the ribose sugar of the subunit has been so replaced is referred to herein as a ribose replacement modification subunit (RRMS), which is a modified sugar moiety. A cyclic carrier may be a carbocyclic ring system, i.e., one or more ring atoms may be a heteroatom, e.g., nitrogen, oxygen, sulphur. The cyclic carrier may be a monocyclic ring system, or may contain two or more rings, e.g. fused rings. The cyclic carrier may be a fully saturated ring system, or it may contain one or more double bonds. In certain embodiments, the modified oligonucleotide is a gapmer.

In certain embodiments, conjugate groups impart a new property on the attached oligonucleotide, e.g., fluorophores or reporter groups that enable detection of the oligonucleotide. Certain conjugate groups and conjugate moieties have been described previously, for example: cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4, 1053-1060), a thioether, e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Lett., 1993, 3, 2765-2770), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), an aliphatic chain, e.g., do-decan-diol or undecyl residues (Saison-Behmoaras et al., EMBO J, 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethyl-ammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783), a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetic acid a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937), a tocopherol group (Nishina et al., Molecular Therapy Nucleic Acids, 2015, 4, e220; and Nishina et al., Molecular Therapy, 2008, 16, 734-740), or a GalNAc cluster (e.g., WO2014/179620).

In certain embodiments, conjugate groups may be selected from any of a C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, C10 alkenyl, C21 alkenyl, C19 alkenyl, C18 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, C11 alkenyl, C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 alkenyl, or C5 alkenyl.

In certain embodiments, conjugate groups may be selected from any of C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, and C5 alkyl, where the alkyl chain has one or more unsaturated bonds.

In certain embodiments, a conjugate group is a lipid having the following structure:

1. Conjugate Moieties

Conjugate moieties include, without limitation, intercalators, reporter molecules, polyamines, polyamides, peptides, carbohydrates (e.g., GalNAc), antibodies, vitamin moieties, polyethylene glycols, thioethers, polyethers, cholesterols, thiocholesterols, cholic acid moieties, folate, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluoresceins, rhodamines, coumarins, fluorophores, and dyes.

In certain embodiments, a conjugate moiety comprises an active drug substance, for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fen-bufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, fingolimod, flufenamic acid, folinic acid, a benzothiadiazide, chlorothiazide, a diazepine, indo-methicin, a barbiturate, a cephalosporin, a sulfa drug, an antidiabetic, an antibacterial or an antibiotic.

2. Conjugate Linkers

Conjugate moieties are attached to oligonucleotides through conjugate linkers. In certain oligomeric compounds, the conjugate linker is a single chemical bond (i.e., the conjugate moiety is attached directly to an oligonucleotide through a single bond). In certain embodiments, the conjugate linker comprises a chain structure, such as a hydrocarbyl chain, or an oligomer of repeating units such as ethylene glycol, nucleosides, or amino acid units.

In certain embodiments, a conjugate linker comprises pyrrolidine.

In certain embodiments, a conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino. In certain such embodiments, the conjugate linker comprises groups selected from alkyl, amino, oxo, amide and ether groups. In certain embodiments, the conjugate linker comprises groups selected from alkyl and amide groups. In certain embodiments, the conjugate linker comprises groups selected from alkyl and ether groups. In certain embodiments, the conjugate linker comprises at least one phosphorus moiety. In certain embodiments, the conjugate linker comprises at least one phosphate group. In certain embodiments, the conjugate linker includes at least one neutral linking group.

In certain embodiments, conjugate linkers, including the conjugate linkers described above, are bifunctional linking moieties, e.g., those known in the art to be useful for attaching conjugate groups to compounds, such as the oligonucleotides provided herein. In general, a bifunctional linking moiety comprises at least two functional groups. One of the functional groups is selected to bind to a particular site on a compound and the other is selected to bind to a conjugate group. Examples of functional groups used in a bifunctional linking moiety include but are not limited to electrophiles for reacting with nucleophilic groups and nucleophiles for reacting with electrophilic groups. In certain embodiments, bifunctional linking moieties comprise one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl.

Examples of conjugate linkers include but are not limited to pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl) cyclohexane-1-carboxylate (SMCC) and 6-aminohexanoic acid (AHEX or AHA). Other conjugate linkers include but are not limited to substituted or unsubstituted C₁-C₁₀ alkyl, substituted or unsubstituted C₂-C₁₀ alkenyl or substituted or unsubstituted C₂-C₁₀ alkynyl, wherein a nonlimiting list of preferred substituent groups includes hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and alkynyl.

In certain embodiments, conjugate linkers comprise 1-10 linker-nucleosides. In certain embodiments, conjugate linkers comprise 2-5 linker-nucleosides. In certain embodiments, conjugate linkers comprise exactly 3 linker-nucleosides. In certain embodiments, conjugate linkers comprise the TCA motif. In certain embodiments, such linker-nucleosides are modified nucleosides. In certain embodiments such linker-nucleosides comprise a modified sugar moiety. In certain embodiments, linker-nucleosides are unmodified. In certain embodiments, linker-nucleosides comprise an optionally protected heterocyclic base selected from a purine, substituted purine, pyrimidine or substituted pyrimidine. In certain embodiments, a cleavable moiety is a nucleoside selected from uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methylcytosine, 4-N-benzoyl-5-methyl cytosine, adenine, 6-N-benzoyladenine, guanine and 2-N-isobutyrylguanine. It is typically desirable for linker-nucleosides to be cleaved from the oligomeric compound after it reaches a target tissue. Accordingly, linker-nucleosides are typically linked to one another and to the remainder of the oligomeric compound through cleavable bonds. In certain embodiments, such cleavable bonds are phosphodiester bonds.

Herein, linker-nucleosides are not considered to be part of the oligonucleotide. Accordingly, in embodiments in which an oligomeric compound comprises an oligonucleotide consisting of a specified number or range of linked nucleosides and/or a specified percent complementarity to a reference nucleic acid and the oligomeric compound also comprises a conjugate group comprising a conjugate linker comprising linker-nucleosides, those linker-nucleosides are not counted toward the length of the oligonucleotide and are not used in determining the percent complementarity of the oligonucleotide for the reference nucleic acid. For example, an oligomeric compound may comprise (1) a modified oligonucleotide consisting of 8-30 nucleosides and (2) a conjugate group comprising 1-10 linker-nucleosides that are contiguous with the nucleosides of the modified oligonucleotide. The total number of contiguous linked nucleosides in such an oligomeric compound is more than 30. Alternatively, an oligomeric compound may comprise a modified oligonucleotide consisting of 8-30 nucleosides and no conjugate group. The total number of contiguous linked nucleosides in such an oligomeric compound is no more than 30. Unless otherwise indicated conjugate linkers comprise no more than 10 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 5 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 3 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 2 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 1 linker-nucleoside.

In certain embodiments, it is desirable for a conjugate group to be cleaved from the oligonucleotide. For example, in certain circumstances oligomeric compounds comprising a particular conjugate moiety are better taken up by a particular cell type, but once the oligomeric compound has been taken up, it is desirable that the conjugate group be cleaved to release the unconjugated or parent oligonucleotide. Thus, certain conjugate linkers may comprise one or more cleavable moieties. In certain embodiments, a cleavable moiety is a cleavable bond. In certain embodiments, a cleavable moiety is a group of atoms comprising at least one cleavable bond. In certain embodiments, a cleavable moiety comprises a group of atoms having one, two, three, four, or more than four cleavable bonds. In certain embodiments, a cleavable moiety is selectively cleaved inside a cell or subcellular compartment, such as a lysosome. In certain embodiments, a cleavable moiety is selectively cleaved by endogenous enzymes, such as nucleases.

In certain embodiments, a cleavable bond is selected from among: an amide, an ester, an ether, one or both esters of a phosphodiester, a phosphate ester, a carbamate, or a disulfide. In certain embodiments, a cleavable bond is one or both of the esters of a phosphodiester. In certain embodiments, a cleavable moiety comprises a phosphate or phosphodiester. In certain embodiments, the cleavable moiety is a phosphate linkage between an oligonucleotide and a conjugate moiety or conjugate group.

In certain embodiments, a cleavable moiety comprises or consists of one or more linker-nucleosides. In certain such embodiments, the one or more linker-nucleosides are linked to one another and/or to the remainder of the oligomeric compound through cleavable bonds. In certain embodiments, such cleavable bonds are unmodified phosphodiester bonds. In certain embodiments, a cleavable moiety is 2′-deoxynucleoside that is attached to either the 3′ or 5′-terminal nucleoside of an oligonucleotide by a phosphate internucleoside linkage and covalently attached to the remainder of the conjugate linker or conjugate moiety by a phosphate or phosphorothioate linkage. In certain such embodiments, the cleavable moiety is 2′-deoxyadenosine.

3. Cell-Targeting Moieties

In certain embodiments, a conjugate group comprises a cell-targeting moiety. In certain embodiments, a conjugate group has the general formula:

wherein n is from 1 to about 3, m is 0 when n is 1, m is 1 when n is 2 or greater, j is 1 or 0, and k is 1 or 0.

In certain embodiments, n is 1, j is 1 and k is 0. In certain embodiments, n is 1, j is 0 and k is 1. In certain embodiments, n is 1, j is 1 and k is 1. In certain embodiments, n is 2, j is 1 and k is 0. In certain embodiments, n is 2, j is 0 and k is 1. In certain embodiments, n is 2, j is 1 and k is 1. In certain embodiments, n is 3, j is 1 and k is 0. In certain embodiments, n is 3, j is 0 and k is 1. In certain embodiments, n is 3, j is 1 and k is 1.

In certain embodiments, conjugate groups comprise cell-targeting moieties that have at least one tethered ligand. In certain embodiments, cell-targeting moieties comprise two tethered ligands covalently attached to a branching group. In certain embodiments, cell-targeting moieties comprise three tethered ligands covalently attached to a branching group.

In certain embodiments, each ligand of a cell-targeting moiety has an affinity for at least one type of receptor on a target cell. In certain embodiments, each ligand has an affinity for at least one type of receptor on the surface of a mammalian liver cell. In certain embodiments, each ligand has an affinity for the hepatic asialoglycoprotein receptor (ASGP-R). In certain embodiments, each ligand is a carbohydrate.

In certain embodiments, a conjugate group comprises a cell-targeting conjugate moiety. In certain embodiments, a conjugate group has the general formula:

wherein n is from 1 to about 3, m is 0 when n is 1, m is 1 when n is 2 or greater, j is 1 or 0, and k is 1 or 0.

In certain embodiments, n is 1, j is 1 and k is 0. In certain embodiments, n is 1, j is 0 and k is 1. In certain embodiments, n is 1, j is 1 and k is 1. In certain embodiments, n is 2, j is 1 and k is 0. In certain embodiments, n is 2, j is 0 and k is 1. In certain embodiments, n is 2, j is 1 and k is 1. In certain embodiments, n is 3, j is 1 and k is 0. In certain embodiments, n is 3, j is 0 and k is 1. In certain embodiments, n is 3, j is 1 and k is 1.

In certain embodiments, conjugate groups comprise cell-targeting moieties that have at least one tethered ligand. In certain embodiments, cell-targeting moieties comprise two tethered ligands covalently attached to a branching group. In certain embodiments, cell-targeting moieties comprise three tethered ligands covalently attached to a branching group.

In certain embodiments, the cell-targeting moiety targets neurons. In certain embodiments, the cell-targeting moiety targets a neurotransmitter receptor. In certain embodiments, the cell targeting moiety targets a neurotransmitter transporter. In certain embodiments, the cell targeting moiety targets a GABA transporter. See e.g., WO 2011/131693, WO 2014/064257.

In certain embodiments, conjugate groups comprise cell-targeting moieties that have affinities for transferrin receptor (TfR) (also referred to herein as TfR1 and CD71). In certain embodiments, a conjugate group described herein comprises an anti-TfR1 antibody or fragment thereof. In certain embodiments, the conjugate group comprises a protein or peptide capable of binding TfR1. In certain embodiments, the conjugate group comprises an aptamer capable of binding TfR1. In certain embodiments, the anti-TfR1 antibody or fragment thereof can be any known in the art including but not limited to those described in WO1991/004753; WO2013/103800; WO2014/144060; WO2016/081643; WO2016/179257; WO2016/207240; WO2017/221883; WO2018/129384; WO2018/124121; WO2019/151539; WO2020/132584; WO2020/028864; U.S. Pat. Nos. 7,208,174; 9,034,329; and 10,550,188. In certain embodiments, a fragment of an anti-TfR1 antibody is F(ab′)₂, Fab, Fab′, Fv, or scFv.

In certain embodiments, the conjugate group comprises a protein or peptide capable of binding TfR1. In certain embodiments, the protein or peptide capable of binding TfR1 can be any known in the art including but not limited to those described in WO2019/140050; WO2020/037150; WO2020/124032; and U.S. Pat. No. 10,138,483.

In certain embodiments, the conjugate group comprises an aptamer capable of binding TfR1. In certain embodiments, the aptamer capable of binding TfR1 can be any known in the art including but not limited to those described in WO2013/163303; WO2019/033051; and WO2020/245198.

B. Certain Terminal Groups

In certain embodiments, oligomeric compounds comprise one or more terminal groups. In certain such embodiments, oligomeric compounds comprise a stabilized 5′-phosphate. Stabilized 5′-phosphates include, but are not limited to 5′-phosphonates, including, but not limited to 5′-vinylphosphonates. In certain embodiments, terminal groups comprise one or more abasic sugar moieties and/or inverted nucleosides. In certain embodiments, terminal groups comprise one or more 2′-linked nucleosides or sugar moieties. In certain such embodiments, the 2′-linked group is an abasic sugar moiety.

III. Antisense Activity

In certain embodiments, oligomeric compounds and oligomeric duplexes are capable of hybridizing to a target nucleic acid, resulting in at least one antisense activity; such oligomeric compounds and oligomeric duplexes are antisense compounds. In certain embodiments, antisense compounds have antisense activity when they reduce or inhibit the amount or activity of a target nucleic acid by 25% or more in the standard in vitro assay. In certain embodiments, antisense compounds selectively affect one or more target nucleic acid. Such antisense compounds comprise a nucleobase sequence that hybridizes to one or more target nucleic acid, resulting in one or more desired antisense activity and does not hybridize to one or more non-target nucleic acid or does not hybridize to one or more non-target nucleic acid in such a way that results in significant undesired antisense activity.

In certain antisense activities, hybridization of an antisense compound to a target nucleic acid results in recruitment of a protein that cleaves the target nucleic acid. For example, certain antisense compounds result in RNase H mediated cleavage of the target nucleic acid. RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. The DNA in such an RNA:DNA duplex need not be unmodified DNA. In certain embodiments, described herein are antisense compounds that are sufficiently “DNA-like” to elicit RNase H activity. In certain embodiments, one or more non-DNA-like nucleoside in the gap of a gapmer is tolerated.

In certain antisense activities, an antisense compound or a portion of an antisense compound is loaded into an RNA-induced silencing complex (RISC), ultimately resulting in cleavage of the target nucleic acid. For example, certain antisense compounds result in cleavage of the target nucleic acid by Argonaute. Antisense compounds that are loaded into RISC are RNAi agents. RNAi agents may be double-stranded (siRNA or dsRNAi) or single-stranded (ssRNAi).

In certain embodiments, hybridization of an antisense compound to a target nucleic acid does not result in recruitment of a protein that cleaves that target nucleic acid. In certain embodiments, hybridization of the antisense compound to the target nucleic acid results in alteration of splicing of the target nucleic acid. In certain embodiments, hybridization of an antisense compound to a target nucleic acid results in inhibition of a binding interaction between the target nucleic acid and a protein or other nucleic acid. In certain embodiments, hybridization of an antisense compound to a target nucleic acid results in alteration of translation of the target nucleic acid.

Antisense activities may be observed directly or indirectly. In certain embodiments, observation or detection of an antisense activity involves observation or detection of a change in an amount of a target nucleic acid or protein encoded by such target nucleic acid, a change in the ratio of splice variants of a nucleic acid or protein and/or a phenotypic change in a cell or subject.

IV. Certain Target Nucleic Acids

In certain embodiments, oligomeric compounds comprise or consist of an oligonucleotide comprising a region that is complementary to a target nucleic acid. In certain embodiments, the target nucleic acid is an endogenous RNA molecule. In certain embodiments, the target nucleic acid encodes a protein. In certain such embodiments, the target nucleic acid is selected from: a mature mRNA and a pre-mRNA, including intronic, exonic and untranslated regions. In certain embodiments, the target RNA is a mature mRNA. In certain embodiments, the target nucleic acid is a pre-mRNA. In certain embodiments, the target region is entirely within an intron. In certain embodiments, the target region spans an intron/exon junction. In certain embodiments, the target region is at least 50% within an intron. In certain embodiments, the target nucleic acid is the RNA transcriptional product of a retrogene. In certain embodiments, the target nucleic acid is a non-coding RNA. In certain embodiments, the target non-coding RNA is selected from: a long non-coding RNA, a short non-coding RNA, an intronic RNA molecule.

A. Complementarity/Mismatches to the Target Nucleic Acid and Duplex Complementarity

In certain embodiments, oligonucleotides are complementary to the target nucleic acid over the entire length of the oligonucleotide. In certain embodiments, oligonucleotides are 99%, 95%, 90%, 85%, or 80% complementary to the target nucleic acid. In certain embodiments, oligonucleotides are at least 80% complementary to the target nucleic acid over the entire length of the oligonucleotide and comprise a region that is 100% or fully complementary to a target nucleic acid. In certain embodiments, the region of full complementarity is from 6 to 20, 10 to 18, or 18 to 20 nucleobases in length.

It is possible to introduce mismatch bases without eliminating activity. For example, Gautschi et al (J. Natl. Cancer Inst. 93:463-471, March 2001) demonstrated the ability of an oligonucleotide having 100% complementarity to the bcl-2 mRNA and having 3 mismatches to the bcl-xL mRNA to reduce the expression of both bcl-2 and bcl-xL in vitro and in vivo. Furthermore, this oligonucleotide demonstrated potent anti-tumor activity in vivo. Maher and Dolnick (Nuc. Acid. Res. 16:3341-3358, 1988) tested a series of tandem 14 nucleobase oligonucleotides, and 28 and 42 nucleobase oligonucleotides comprised of the sequence of two or three of the tandem oligonucleotides, respectively, for their ability to arrest translation of human DHFR in a rabbit reticulocyte assay. Each of the three 14 nucleobase oligonucleotides alone was able to inhibit translation, albeit at a more modest level than the 28 or 42 nucleobase oligonucleotides.

In certain embodiments, oligonucleotides comprise one or more mismatched nucleobases relative to the target nucleic acid. In certain embodiments, antisense activity against the target is reduced by such mismatch, but activity against a non-target is reduced by a greater amount. Thus, in certain embodiments selectivity of the oligonucleotide is improved.

Gapmer Oligonucleotides

In certain embodiments, a mismatch is specifically positioned within an oligonucleotide having a gapmer motif. In certain embodiments, the mismatch is at position 1, 2, 3, 4, 5, 6, 7, or 8 from the 5′-end of the gap region. In certain embodiments, the mismatch is at position 9, 8, 7, 6, 5, 4, 3, 2, 1 from the 3′-end of the gap region. In certain embodiments, the mismatch is at position 1, 2, 3, or 4 from the 5′-end of the wing region. In certain embodiments, the mismatch is at position 4, 3, 2, or 1 from the 3′-end of the wing region.

Antisense RNAi Oligonucleotides

In certain embodiments, antisense RNAi oligonucleotides comprise one or more mismatched nucleobases relative to the target nucleic acid. In certain embodiments, RNAi activity against the target is reduced by such mismatch, but activity against a non-target is reduced by a greater amount. Thus, in certain embodiments selectivity of the antisense RNAi oligonucleotides is improved.

In certain embodiments, antisense RNAi oligonucleotides comprise a targeting region complementary to the target nucleic acid. In certain embodiments, the targeting region comprises or consists of at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 contiguous nucleotides. In certain embodiments, the targeting region constitutes 70%, 80%, 85%, 90%, or 95% of the nucleosides of the antisense RNAi oligonucleotide. In certain embodiments, the targeting region constitutes all of the nucleosides of the antisense RNAi oligonucleotide. In certain embodiments, the targeting region of the antisense RNAi oligonucleotide is at least 99%, 95%, 90%, 85%, or 80% complementary to the target nucleic acid. In certain embodiments, the targeting region of the antisense RNAi oligonucleotide is 100% complementary to the target nucleic acid.

Sense RNAi Oligonucleotides

In certain embodiments, RNAi agents comprise a sense RNAi oligonucleotide. In such embodiments, sense RNAi oligonucleotides comprise a region complementary to the antisense RNAi oligonucleotide. In certain embodiments, the complementary region comprises or consists of at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 contiguous nucleotides. In certain embodiments, the complementary region constitutes 70%, 80%, 85%, 90%, or 95% of the nucleosides of the sense RNAi oligonucleotide. In certain embodiments, the complementary region constitutes all of the nucleosides of the sense RNAi oligonucleotide. In certain embodiments, the complementary region of the sense RNAi oligonucleotide is at least 99%, 95%, 90%, 85%, or 80% complementary to the antisense RNAi oligonucleotide. In certain embodiments, the complementary region of the sense RNAi oligonucleotide is 100% complementary to the antisense RNAi oligonucleotide.

The complementary region of a sense RNAi oligonucleotide hybridizes with the antisense RNAi oligonucleotide to form a duplex region. In certain embodiments, such duplex region consists of 7 hybridized pairs of nucleosides (one of each pair being on the antisense RNAi oligonucleotide and the other of each pair bien on the sense RNAi oligonucleotide). In certain embodiments, a duplex region comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 hybridized pairs. In certain embodiments, each nucleoside of antisense RNAi oligonucleotide is within the duplex region (i.e., the antisense RNAi oligonucleotide has no overhanging nucleosides). In certain embodiments, the antisense RNAi oligonucleotide includes unpaired nucleosides at the 3′-end and/or the 5′end (overhanging nucleosides). In certain embodiments, each nucleoside of sense RNAi oligonucleotide is within the duplex region (i.e., the sense RNAi oligonucleotide has no overhanging nucleosides). In certain embodiments, the sense RNAi oligonucleotide includes unpaired nucleosides at the 3′-end and/or the 5′end (overhanging nucleosides). In certain embodiments, duplexes formed by the antisense RNAi oligonucleotide and the sense RNAi oligonucleotide do not include any overhangs at one or both ends. Such ends without overhangs are referred to as blunt ends. In certain embodiments wherein the antisense RNAi oligonucleotide has overhanging nucleosides, one or more of those overhanging nucleosides are complementary to the target nucleic acid. In certain embodiments wherein the antisense RNAi oligonucleotide has overhanging nucleosides, one or more of those overhanging nucleosides are not complementary to the target nucleic acid.

B. DUX4

In certain embodiments, oligomeric compounds comprise or consist of an oligonucleotide comprising a region that is complementary to a target nucleic acid, wherein the target nucleic acid is DUX4. In certain embodiments, DUX4 nucleic acid has the sequence set forth SEQ ID NO: 1 (GENBANK Accession No. NC_000004.12, truncated from nucleotides 190171001 to 190187000) or SEQ ID NO: 2 (GENBANK Accession No. NM_001306068.2). In certain embodiments, DUX4 nucleic acid has the sequence set forth in any of the known splice variants of DUX4, including but not limited to SEQ ID NO: 3 (GENBANK Accession No. FJ439133.1) and SEQ ID NO: 4 (GENBANK Accession No. NM_001293798.2). In certain embodiments, contacting a cell with an oligomeric compound complementary to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, or SEQ ID NO: 4 reduces the amount of DUX4 RNA, and in certain embodiments reduces the amount of DUX4 protein. In certain embodiments, the oligomeric compound consists of a modified oligonucleotide. In certain embodiments, the oligomeric compound consists of a modified oligonucleotide and a conjugate group.

In certain embodiments, contacting a cell with an oligomeric compound complementary to any one of SEQ ID NOs: 1-4 reduces the amount of DUX4 RNA in a cell. In certain embodiments, contacting a cell with an oligomeric compound complementary to any one of SEQ ID NOs: 1-4 reduces the amount of DUX4 protein in a cell. In certain embodiments, the cell is in vitro. In certain embodiments, the cell is in a subject. In certain embodiments, the oligomeric compound consists of a modified oligonucleotide. In certain embodiments, contacting a cell in a subject with an oligomeric compound complementary to any one of SEQ ID NOs: 1-4 ameliorates one or more symptoms or hallmarks of a disease or disorder associated with DUX4. In certain embodiments, the disease or disorder associated DUX4 is a neuromuscular disorder. In certain embodiments, the disease or disorder associated DUX4 is a muscular dystrophy. In certain embodiments, the muscular dystrophy is Facioscapulohumeral muscular dystrophy (FSHD).

In certain embodiments, an oligomeric compound complementary to any one of SEQ ID NOs: 1-4 is capable of reducing the among of DUX4 RNA in vitro by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% when administered according to the standard in vitro assay. In certain embodiments, an oligomeric compound complementary to any one of SEQ ID NOs: 1-4 is capable of reducing the amount of DUX4 RNA in vivo by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% when administered according to the standard in vivo assay. In certain embodiments, an oligomeric compound complementary to any one of SEQ ID NOs: 1-4 is capable of reducing the among of DUX4 protein in vitro by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% when administered according to the standard in vitro assay. In certain embodiments, an oligomeric compound complementary to any one of SEQ ID NOs: 1-4 is capable of reducing the amount of DUX4 protein in vivo by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% when administered according to the standard in vivo assay. In certain embodiments, an oligomeric compound complementary to any one of SEQ ID NOs: 1-4 is capable of reducing the among of DUX4 RNA in the muscle of a subject by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. In certain embodiments, an oligomeric compound complementary to any one of SEQ ID NOs: 1-4 is capable of reducing the amount of DUX4 protein in the muscle of a subject by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%.

C. Certain Target Nucleic Acids in Certain Tissues

In certain embodiments, oligomeric compounds comprise or consist of an oligonucleotide comprising a region that is complementary to a target nucleic acid, wherein the target nucleic acid is expressed in a pharmacologically relevant tissue. In certain embodiments, the pharmacologically relevant tissues are muscle cells and muscle tissues. Such muscle tissues include all skeletal muscles including, but not limited to, upper and lower limbs, trunk, head, and neck.

V. Certain Methods and Uses

Certain embodiments provided herein relate to methods of reducing or inhibiting DUX4 expression or activity, which can be useful for treating, preventing, or ameliorating a disease or disorder associated with DUX4. In certain embodiments, the disease or disorder associated DUX4 is a neuromuscular disorder. In certain embodiments, the disease or disorder associated DUX4 is a muscular dystrophy. In certain embodiments, the muscular dystrophy is Facioscapulohumeral muscular dystrophy (FSHD).

In certain embodiments, a method comprises administering to a subject an oligomeric compound, a modified oligonucleotide, an oligomeric duplex, or an antisense agent, any of which having a nucleobase sequence complementary to a DUX4 nucleic acid. In certain embodiments, the subject has or is at risk for developing a disease or disorder associated with DUX4. In certain embodiments, the subject has a neuromuscular disorder. In certain embodiments, the subject has a muscular dystrophy. In certain embodiments, the subject has Facioscapulohumeral muscular dystrophy (FSHD).

In certain embodiments, a method for treating a disease or disorder associated with DUX4 comprises administering to a subject an oligomeric compound, a modified oligonucleotide, an oligomeric duplex, or an antisense agent, any of which having a nucleobase sequence complementary to a DUX4 nucleic acid. In certain embodiments, the subject has or is at risk for developing a disease or disorder associated with DUX4. In certain embodiments, the subject has a neuromuscular disorder. In certain embodiments, the subject has a muscular dystrophy. In certain embodiments, the subject has Facioscapulohumeral muscular dystrophy (FSHD). In certain embodiments, at least one symptom or hallmark of the disease or disorder associated with DUX4 is ameliorated. In certain embodiments, the at least one symptom or hallmark is muscle weakness or muscle wasting in facio, scapula, and/or humeral muscle that can progress to the muscles of the trunk and/or lower limbs. In certain embodiments, administration of the oligomeric compound, the modified oligonucleotide, the oligomeric duplex, or the antisense agent to the subject reduces or delays the onset or progression of muscle weakness or muscle wasting in facio, scapula, and/or humeral muscle or further reduces or delays the onset or progression of muscle weakness or muscle wasting into the muscles of the trunk and/or lower limbs.

In certain embodiments, a method of reducing expression of DUX4 nucleic acid, for example RNA, or reducing expression of DUX4 protein in a cell comprises contacting the cell with an oligomeric compound, a modified oligonucleotide, an oligomeric duplex, or an antisense agent, any of which having a nucleobase sequence complementary to a DUX4 nucleic acid. In certain embodiments, the subject has or is at risk for developing a disease or disorder associated with DUX4. In certain embodiments, the subject has or is at risk for developing a neuromuscular disorder. In certain embodiments, the subject has or is at risk for developing a muscular dystrophy. In certain embodiments, the subject has or is at risk for developing Facioscapulohumeral muscular dystrophy (FSHD). In certain embodiments, the cell is a muscle cell. In certain embodiments, the cell is a human cell.

Certain embodiments are drawn to an oligomeric compound, a modified oligonucleotide, an oligomeric duplex, or an antisense agent, any of which having a nucleobase sequence complementary to a DUX4 nucleic acid, for use in treating a disease or disorder associated with DUX4 or for use in the manufacture of a medicament for treating a disease or disorder associated with DUX4. In certain embodiments, the disease or disorder associated with DUX4 is a neuromuscular disorder. In certain embodiments, the disease or disorder associated with DUX4 is a muscular dystrophy. In certain embodiments, the disease or disorder associated with DUX4 is Facioscapulohumeral muscular dystrophy (FSHD).

In any of the methods or uses described herein, the oligomeric compound, the modified oligonucleotide, the oligomeric duplex, or the antisense agent can be any described herein.

VI. Certain Pharmaceutical Compositions

In certain embodiments, described herein are pharmaceutical compositions comprising one or more oligomeric compounds. In certain embodiments, the one or more oligomeric compounds each consists of a modified oligonucleotide. In certain embodiments, the pharmaceutical composition comprises a pharmaceutically acceptable diluent or carrier. In certain embodiments, a pharmaceutical composition comprises or consists of a sterile saline solution and one or more oligomeric compound. In certain embodiments, the sterile saline is pharmaceutical grade saline. In certain embodiments, a pharmaceutical composition comprises or consists of one or more oligomeric compound and sterile water. In certain embodiments, the sterile water is pharmaceutical grade water. In certain embodiments, a pharmaceutical composition comprises or consists of one or more oligomeric compound and phosphate-buffered saline (PBS). In certain embodiments, the sterile PBS is pharmaceutical grade PBS. In certain embodiments, a pharmaceutical composition comprises or consists of one or more oligomeric compound and artificial cerebrospinal fluid (“artificial CSF” or “aCSF”). In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical grade.

In certain embodiments, a pharmaceutical composition comprises a modified oligonucleotide and artificial cerebrospinal fluid (aCSF). In certain embodiments, a pharmaceutical composition consists of a modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, a pharmaceutical composition consists essentially of a modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical grade.

In certain embodiments, aCSF comprises sodium chloride, potassium chloride, sodium dihydrogen phosphate dihydrate, sodium phosphate dibasic anhydrous, calcium chloride dihydrate, and magnesium chloride hexahydrate. In certain embodiments, the pH of an aCSF solution is modulated with a suitable pH-adjusting agent, for example, with acids such as hydrochloric acid and alkalis such as sodium hydroxide, to a range of from about 7.1-7.3, or to about 7.2.

In certain embodiments, pharmaceutical compositions comprise one or more oligomeric compound and one or more excipients. In certain embodiments, excipients are selected from water, salt solutions, alcohol, polyethylene glycols, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose and polyvinylpyrrolidone.

In certain embodiments, oligomeric compounds may be admixed with pharmaceutically acceptable active and/or inert substances for the preparation of pharmaceutical compositions or formulations. Compositions and methods for the formulation of pharmaceutical compositions depend on a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.

In certain embodiments, pharmaceutical compositions comprising an oligomeric compound encompass any pharmaceutically acceptable salts of the oligomeric compound, esters of the oligomeric compound, or salts of such esters. In certain embodiments, pharmaceutical compositions comprising oligomeric compounds comprising one or more oligonucleotide, upon administration to an animal, including a human, are capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to pharmaceutically acceptable salts of oligomeric compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. In certain embodiments, pharmaceutically acceptable salts comprise inorganic salts, such as monovalent or divalent inorganic salts. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium, potassium, calcium, and magnesium salts. In certain embodiments, prodrugs comprise one or more conjugate group attached to an oligonucleotide, wherein the conjugate group is cleaved by endogenous nucleases within the body.

In certain embodiments, oligomeric compounds are lyophilized and isolated as sodium salts. In certain embodiments, the sodium salt of an oligomeric compound is mixed with a pharmaceutically acceptable diluent. In certain embodiments, the pharmaceutically acceptable diluent comprises sterile saline, sterile water, PBS, or aCSF. In certain embodiments, the sodium salt of an oligomeric compound is mixed with PBS. In certain embodiments, the sodium salt of an oligomeric compound is mixed with aCSF.

Lipid moieties have been used in nucleic acid therapies in a variety of methods. In certain such methods, the nucleic acid, such as an oligomeric compound, is introduced into preformed liposomes or lipoplexes made of mixtures of cationic lipids and neutral lipids. In certain methods, DNA complexes with mono- or poly-cationic lipids are formed without the presence of a neutral lipid. In certain embodiments, a lipid moiety is selected to increase distribution of a pharmaceutical agent to a particular cell or tissue. In certain embodiments, a lipid moiety is selected to increase distribution of a pharmaceutical agent to fat tissue. In certain embodiments, a lipid moiety is selected to increase distribution of a pharmaceutical agent to muscle tissue.

In certain embodiments, pharmaceutical compositions comprise a delivery system. Examples of delivery systems include, but are not limited to, liposomes and emulsions. Certain delivery systems are useful for preparing certain pharmaceutical compositions including those comprising hydrophobic compounds. In certain embodiments, certain organic solvents such as dimethylsulfoxide are used.

In certain embodiments, pharmaceutical compositions comprise one or more tissue-specific delivery molecules designed to deliver the one or more pharmaceutical agents of the present invention to specific tissues or cell types. For example, in certain embodiments, pharmaceutical compositions include liposomes coated with a tissue-specific antibody.

In certain embodiments, pharmaceutical compositions comprise a co-solvent system. Certain of such co-solvent systems comprise, for example, benzyl alcohol, a nonpolar surfactant, a water-miscible organic polymer, and an aqueous phase. In certain embodiments, such co-solvent systems are used for hydrophobic compounds. A non-limiting example of such a co-solvent system is the VPD co-solvent system, which is a solution of absolute ethanol comprising 3% w/v benzyl alcohol, 8% w/v of the nonpolar surfactant Polysorbate 80™ and 65% w/v polyethylene glycol 300. The proportions of such co-solvent systems may be varied considerably without significantly altering their solubility and toxicity characteristics. Furthermore, the identity of co-solvent components may be varied: for example, other surfactants may be used instead of Polysorbate 80™; the fraction size of polyethylene glycol may be varied; other biocompatible polymers may replace polyethylene glycol, e.g., polyvinyl pyrrolidone; and other sugars or polysaccharides may substitute for dextrose.

In certain embodiments, pharmaceutical compositions are prepared for oral administration. In certain embodiments, pharmaceutical compositions are prepared for buccal administration. In certain embodiments, a pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, intrathecal (IT), intracerebroventricular (ICV), etc.). In certain of such embodiments, a pharmaceutical composition comprises a carrier and is formulated in aqueous solution, such as water or physiologically compatible buffers such as Hanks's solution, Ringer's solution, or physiological saline buffer. In certain embodiments, other ingredients are included (e.g., ingredients that aid in solubility or serve as preservatives). In certain embodiments, injectable suspensions are prepared using appropriate liquid carriers, suspending agents and the like. Certain pharmaceutical compositions for injection are presented in unit dosage form, e.g., in ampoules or in multi-dose containers. Certain pharmaceutical compositions for injection are suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents. Certain solvents suitable for use in pharmaceutical compositions for injection include, but are not limited to, lipophilic solvents and fatty oils, such as sesame oil, synthetic fatty acid esters, such as ethyl oleate or triglycerides, and liposomes.

Under certain conditions, certain compounds disclosed herein act as acids. Although such compounds may be drawn or described in protonated (free acid) form, or ionized and in association with a cation (salt) form, aqueous solutions of such compounds exist in equilibrium among such forms. For example, a phosphodiester linkage of an oligonucleotide in aqueous solution exists in equilibrium among free acid, anion and salt forms. Unless otherwise indicated, compounds described herein are intended to include all such forms. Moreover, certain oligonucleotides have several such linkages, each of which is in equilibrium. Thus, oligonucleotides in solution exist in an ensemble of forms at multiple positions all at equilibrium. The term “oligonucleotide” is intended to include all such forms. Drawn structures necessarily depict a single form. Nevertheless, unless otherwise indicated, such drawings are likewise intended to include corresponding forms. Herein, a structure depicting the free acid of a compound followed by the term “or a pharmaceutically acceptable salt thereof” expressly includes all such forms that may be fully or partially protonated/de-protonated/in association with a cation or a combination of cations. In certain embodiments, one or more specific cation is identified. The cations include, but are not limited to, sodium, potassium, calcium, and magnesium. In certain embodiments, a structure depicting the free acid of a compound followed by the term “or a pharmaceutically acceptable salt thereof” expressly includes all such forms that may be fully or partially protonated/de-protonated/in association with one or more cations selected from sodium, potassium, calcium, and magnesium.

In certain embodiments, modified oligonucleotides or oligomeric compounds are in aqueous solution with sodium. In certain embodiments, modified oligonucleotides or oligomeric compounds are in aqueous solution with potassium. In certain embodiments, modified oligonucleotides or oligomeric compounds are in PBS. In certain embodiments, modified oligonucleotides or oligomeric compounds are in water. In certain such embodiments, the pH of the solution is adjusted with NaOH and/or HCl to achieve a desired pH.

Herein, certain specific doses are described. A dose may be in the form of a dosage unit. For clarity, a dose (or dosage unit) of a modified oligonucleotide or an oligomeric compound in milligrams indicates the mass of the free acid form of the modified oligonucleotide or oligomeric compound. As described above, in aqueous solution, the free acid is in equilibrium with anionic and salt forms. However, for the purpose of calculating dose, it is assumed that the modified oligonucleotide or oligomeric compound exists as a solvent-free, sodium-acetate free, anhydrous, free acid.

In certain embodiments, where a modified oligonucleotide or an oligomeric compound is in solution comprising sodium (e.g., saline), the modified oligonucleotide or oligomeric compound may be partially or fully de-protonated and in association with sodium ions. However, the mass of the protons is nevertheless counted toward the weight of the dose, and the mass of the sodium ions is not counted toward the weight of the dose. Thus, for example, a dose, or dosage unit, of 10 mg of Compound No. 541106 or Compound No. 613801 equals the number of fully protonated molecules that weighs 10 mg. This would be equivalent to 10.58 mg of solvent-free, sodium acetate-free, anhydrous sodiated Compound No. 541106 or 10.61 mg of solvent-free, sodium acetate-free, anhydrous sodiated Compound No. 613801.

In certain embodiments, where a modified oligonucleotide or oligomeric compound is in a solution, such as aCSF, comprising sodium, potassium, calcium, and magnesium, the modified oligonucleotide or oligomeric compound may be partially or fully de-protonated and in association with sodium, potassium, calcium, and/or magnesium. However, the mass of the protons is nevertheless counted toward the weight of the dose, and the mass of the sodium, potassium, calcium, and magnesium ions is not counted toward the weight of the dose.

In certain embodiments, when an oligomeric compound comprises a conjugate group, the mass of the conjugate group may be included in calculating the dose of such oligomeric compound. If the conjugate group also has an acid, the conjugate group is likewise assumed to be fully protonated for the purpose of calculating dose.

VII. Certain Hotspot Regions

1. Nucleobases 2697-2730 of SEQ ID NO: 1

In certain embodiments, nucleobases 2697-2730 of SEQ ID NO: 1 comprise a hotspot region. In certain embodiments, modified oligonucleotides are complementary within nucleobases 2697-2730 of SEQ ID NO: 1. In certain embodiments, modified oligonucleotides are 16 nucleobases in length. In certain embodiments, modified oligonucleotides are 20 nucleobases in length. In certain embodiments, modified oligonucleotides are gapmers. In certain embodiments, modified oligonucleotides are 5-10-5 or 3-10-3 gapmers. In certain embodiments, the gapmers are MOE gapmers. In certain embodiments, the gapmers are cEt gapmers. In certain embodiments, the sugar motif for the gapmers is (from 5′ to 3′): eeeeeddddddddddeeeee; wherein each “d” represents a 2′-β-D-deoxyribosyl sugar moiety, and each “e” represents a 2′-MOE sugar moiety. In certain embodiments, the sugar motif for the gapmers is (from 5′ to 3′): kkkddddddddddkkk; wherein each “d” represents a 2′-β-D-deoxyribosyl sugar moiety, and each “k” represents a cEt sugar moiety. Each cytosine residue is a 5-methylcytosine.

In certain embodiments, the nucleosides of the modified oligonucleotides are linked by phosphorothioate internucleoside linkages.

The nucleobase sequences of SEQ ID NOs: 24, 98, 318-320, 359-361, 398-400, 438-440, 852, and 857 are complementary within nucleobases 2697-2730 of SEQ ID NO: 1.

Compounds 541110, 541187, 1099107-1099118, 1582921, and 1582472 are complementary within nucleobases 2697-2730 of SEQ ID NO: 1.

In certain embodiments, modified oligonucleotides complementary within nucleobases 2697-2730 of SEQ ID NO: 1 achieve at least 27% reduction of DUX4 RNA in the standard in vitro RNase H assay. In certain embodiments, modified oligonucleotides complementary within nucleobases 2697-2730 of SEQ ID NO: 1 achieve an average of 56% reduction of DUX4 RNA in the standard in vitro RNase H assay.

2. Nucleobases 2756-2778 of SEQ ID NO: 1

In certain embodiments, nucleobases 2756-2778 of SEQ ID NO: 1 comprise a hotspot region. In certain embodiments, modified oligonucleotides are complementary within nucleobases 2756-2778 of SEQ ID NO: 1. In certain embodiments, modified oligonucleotides are 16 nucleobases in length. In certain embodiments, modified oligonucleotides are gapmers. In certain embodiments, modified oligonucleotides are 3-10-3 gapmers. In certain embodiments, the gapmers are cEt gapmers. In certain embodiments, the sugar motif for the gapmers is (from 5′ to 3′): kkkddddddddddkkk; wherein each “d” represents a 2′-β-D-deoxyribosyl sugar moiety, and each “k” represents a cEt sugar moiety. Each cytosine residue is a 5-methylcytosine.

In certain embodiments, the nucleosides of the modified oligonucleotides are linked by phosphorothioate internucleoside linkages.

The nucleobase sequences of SEQ ID NOs: 323, 324, 364, 404, 443, and 444 are complementary within nucleobases 2756-2778 of SEQ ID NO: 1.

Compounds 1099128-1099133 are complementary within nucleobases 2756-2778 of SEQ ID NO: 1.

In certain embodiments, modified oligonucleotides complementary within nucleobases 2756-2778 of SEQ ID NO: 1 achieve at least 25% reduction of DUX4 RNA in the standard in vitro RNase H assay. In certain embodiments, modified oligonucleotides complementary within nucleobases 2756-2778 of SEQ ID NO: 1 achieve an average of 57% reduction of DUX4 RNA in the standard in vitro RNase H assay.

3. Nucleobases 4103-4134 of SEQ ID NO: 1 and/or 1330-1361 of SEO ID NO: 2

In certain embodiments, 4103-4134 of SEQ ID NO: 1 and/or 1330-1361 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, modified oligonucleotides are complementary within nucleobases 4103-4134 of SEQ ID NO: 1 and/or 1330-1361 of SEQ ID NO: 2. In certain embodiments, modified oligonucleotides are 16 nucleobases in length. In certain embodiments, modified oligonucleotides are 20 nucleobases in length. In certain embodiments, modified oligonucleotides are gapmers. In certain embodiments, modified oligonucleotides are 5-10-5 or 3-10-3 gapmers. In certain embodiments, the gapmers are MOE gapmers. In certain embodiments, the gapmers are cEt gapmers. In certain embodiments, the sugar motif for the gapmers is (from 5′ to 3′): eeeeeddddddddddeeeee; wherein each “d” represents a 2′-β-D-deoxyribosyl sugar moiety, and each “e” represents a 2′-MOE sugar moiety. In certain embodiments, the sugar motif for the gapmers is (from 5′ to 3′): kkkddddddddddkkk; wherein each “d” represents a 2′-β-D-deoxyribosyl sugar moiety, and each “k” represents a cEt sugar moiety. Each cytosine residue is a 5-methylcytosine.

In certain embodiments, the nucleosides of the modified oligonucleotides are linked by phosphorothioate internucleoside linkages.

The nucleobase sequences of SEQ ID NOs: 73, 148, 327, 367, 407, 408, 208, and 447 are complementary within nucleobases 4103-4134 of SEQ ID NO: 1 and/or 1330-1361 of SEQ ID NO: 2.

Compounds 541160, 541238, 613853, and 1099147-1099151 are complementary within nucleobases 4103-4134 of SEQ ID NO: 1 and/or 1330-1361 of SEQ ID NO: 2.

In certain embodiments, modified oligonucleotides complementary within nucleobases 4103-4134 of SEQ ID NO: 1 and/or 1330-1361 of SEQ ID NO: 2 achieve at least 14% reduction of DUX4 RNA in the standard in vitro RNase H assay. In certain embodiments, modified oligonucleotides complementary within nucleobases 4103-4134 of SEQ ID NO: 1 and/or 1330-1361 of SEQ ID NO: 2 achieve an average of 52% reduction of DUX4 RNA in the standard in vitro RNase H assay.

4. Nucleobases 4503-4522 of SEQ ID NO: 1

In certain embodiments, nucleobases 4503-4522 of SEQ ID NO: 1 comprise a hotspot region. In certain embodiments, modified oligonucleotides are complementary within nucleobases 4503-4522 of SEQ ID NO: 1. In certain embodiments, modified oligonucleotides are 16 nucleobases in length. In certain embodiments, modified oligonucleotides are gapmers. In certain embodiments, modified oligonucleotides are 3-10-3 gapmers. In certain embodiments, the gapmers are cEt gapmers. In certain embodiments, the sugar motif for the gapmers is (from 5′ to 3′): kkkddddddddddkkk; wherein each “d” represents a 2′-β-D-deoxyribosyl sugar moiety, and each “k” represents a cEt sugar moiety. Each cytosine residue is a 5-methylcytosine.

In certain embodiments, the nucleosides of the modified oligonucleotides are linked by phosphorothioate internucleoside linkages.

The nucleobase sequences of SEQ ID NOs: 299, 340, 379, and 420-421 are complementary within nucleobases 4503-4522 of SEQ ID NO: 1.

Compounds 1098903-1098907 are complementary within nucleobases 4503-4522 of SEQ ID NO: 1.

In certain embodiments, modified oligonucleotides complementary within nucleobases 4503-4522 of SEQ ID NO: 1 achieve at least 34% reduction of DUX4 RNA in the standard in vitro RNase H assay. In certain embodiments, modified oligonucleotides complementary within nucleobases 4503-4522 of SEQ ID NO: 1 achieve an average of 55% reduction of DUX4 RNA in the standard in vitro RNase H assay.

5. Nucleobases 4509-4530 of SEQ ID NO: 1

In certain embodiments, nucleobases 4509-4530 of SEQ ID NO: 1 comprise a hotspot region. In certain embodiments, modified oligonucleotides are complementary within nucleobases 4509-4530 of SEQ ID NO: 1. In certain embodiments, modified oligonucleotides are 16 nucleobases in length. In certain embodiments, modified oligonucleotides are gapmers. In certain embodiments, modified oligonucleotides are 3-10-3 gapmers. In certain embodiments, the gapmers are cEt gapmers. In In certain embodiments, the sugar motif for the gapmers is (from 5′ to 3′): kkkddddddddddkkk; wherein each “d” represents a 2′-β-D-deoxyribosyl sugar moiety, and each “k” represents a cEt sugar moiety. Each cytosine residue is a 5-methylcytosine.

In certain embodiments, the nucleosides of the modified oligonucleotides are linked by phosphorothioate internucleoside linkages.

The nucleobase sequences of SEQ ID NOs: 300-301, 341-342, 380, 422, and 1002 are complementary within nucleobases 4509-4530 of SEQ ID NO: 1.

Compounds 1098908-1098913 and 1582464 are complementary within nucleobases 4509-4530 of SEQ ID NO: 1.

In certain embodiments, modified oligonucleotides complementary within nucleobases 4509-4530 of SEQ ID NO: 1 achieve at least 43% reduction of DUX4 RNA in the standard in vitro RNase H assay. In certain embodiments, modified oligonucleotides complementary within nucleobases 4509-4530 of SEQ ID NO: 1 achieve an average of 61% reduction of DUX4 RNA in the standard in vitro RNase H assay.

6. Nucleobases 4828-4850 of SEQ ID NO: 1 and/or 1693-1710 of SEQ ID NO: 2

In certain embodiments, 4828-4850 of SEQ ID NO: 1 and/or 1693-1710 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, modified oligonucleotides are complementary within nucleobases 4828-4850 of SEQ ID NO: 1 and/or 1693-1710 of SEQ ID NO: 2. In certain embodiments, modified oligonucleotides are 16 nucleobases in length. In certain embodiments, modified oligonucleotides are gapmers. In certain embodiments, modified oligonucleotides are 3-10-3 gapmers. In certain embodiments, the gapmers are cEt gapmers. In certain embodiments, the sugar motif for the gapmers is (from 5′ to 3′): kkkddddddddddkkk; wherein each “d” represents a 2′-β-D-deoxyribosyl sugar moiety, and each “k” represents a cEt sugar moiety. Each cytosine residue is a 5-methylcytosine.

In certain embodiments, the nucleosides of the modified oligonucleotides are linked by phosphorothioate internucleoside linkages.

The nucleobase sequences of SEQ ID NOs: 331, 332, 370, 371, 412, 413, 451, and 452 are complementary within nucleobases 4828-4850 of SEQ ID NO: 1 and/or 1693-1710 of SEQ ID NO: 2.

Compounds 1099177-1099184 are complementary within nucleobases 4828-4850 of SEQ ID NO: 1 and/or 1693-1710 of SEQ ID NO: 2.

In certain embodiments, modified oligonucleotides complementary within nucleobases 4828-4850 of SEQ ID NO: 1 and/or 1693-1710 of SEQ ID NO: 2 achieve at least 44% reduction of DUX4 RNA in the standard in vitro RNase H assay. In certain embodiments, modified oligonucleotides complementary within nucleobases 4828-4850 of SEQ ID NO: 1 and/or 1693-1710 of SEQ ID NO: 2 achieve an average of 55% reduction of DUX4 RNA in the standard in vitro RNase H assay.

7. Nucleobases 768-787 of SEO ID NO: 2

In certain embodiments, nucleobases 768-787 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, modified oligonucleotides are complementary within nucleobases 768-787 of SEQ ID NO: 2. In certain embodiments, modified oligonucleotides are 16 nucleobases in length. In certain embodiments, modified oligonucleotides are gapmers. In certain embodiments, the gapmers are cEt gapmers. In certain embodiments, the sugar motif for the gapmers is (from 5′ to 3′): kkkddddddddddkkk; wherein each “d” represents a 2′-β-D-deoxyribosyl sugar moiety, and each “k” represents a cEt sugar moiety. Each cytosine residue is a 5-methylcytosine.

In certain embodiments, the nucleosides of the modified oligonucleotides are linked by phosphorothioate internucleoside linkages.

The nucleobase sequences of SEQ ID NOs: 326, 366, 406, 446, and 777 are complementary within nucleobases 768-787 of SEQ ID NO: 2.

Compounds 1099138-1099141 and 1582913 are complementary within nucleobases 768-787 of SEQ ID NO: 2.

In certain embodiments, modified oligonucleotides complementary within nucleobases 768-787 of SEQ ID NO: 2 achieve at least 53% reduction of DUX4 RNA in the standard in vitro RNase H assay. In certain embodiments, modified oligonucleotides complementary within nucleobases 768-787 of SEQ ID NO: 2 achieve an average of 65% reduction of DUX4 RNA in the standard in vitro RNase H assay.

8. Nucleobases 2732-2760 of SEQ ID NO: 1

In certain embodiments, nucleobases 2732-2760 of SEQ ID NO: 1 comprise a hotspot region. In certain embodiments, modified oligonucleotides are complementary within nucleobases 2732-2760 of SEQ ID NO: 1. In certain embodiments, modified oligonucleotides are 16 nucleobases in length. In certain embodiments, modified oligonucleotides are 20 nucleobases in length. In certain embodiments, modified oligonucleotides are gapmers. In certain embodiments, modified oligonucleotides are 5-10-5 or 3-10-3 gapmers. In certain embodiments, the gapmers are MOE gapmers. In certain embodiments, the gapmers are cEt gapmers. In certain embodiments, the sugar motif for the gapmers is (from 5′ to 3′): eeeeeddddddddddeeeee; wherein each “d” represents a 2′-β-D-deoxyribosyl sugar moiety, and each “e” represents a 2′-MOE sugar moiety. In certain embodiments, the sugar motif for the gapmers is (from 5′ to 3′): kkkddddddddddkkk; wherein each “d” represents a 2′-β-D-deoxyribosyl sugar moiety, and each “k” represents a cEt sugar moiety. Each cytosine residue is a 5-methylcytosine.

In certain embodiments, the nucleosides of the modified oligonucleotides are linked by phosphorothioate internucleoside linkages.

The nucleobase sequences of SEQ ID NOs: 100, 186, 321, 362, 645, 719, 791, 796, 867, 873, 943, 946, and 1019 are complementary within nucleobases 2732-2760 of SEQ ID NO: 1.

Compounds 541189, 613830, 1099121-1099122, 1582534-1582535, 1582543, 1582548-1582549, 1582551, 1582557, 1582566, and 1582568 are complementary within nucleobases 2732-2760 of SEQ ID NO: 1.

In certain embodiments, modified oligonucleotides complementary within nucleobases 2732-2760 of SEQ ID NO: 1 achieve at least 13% reduction of DUX4 RNA in the standard in vitro RNase H assay. In certain embodiments, modified oligonucleotides complementary within nucleobases 2732-2760 of SEQ ID NO: 1 achieve an average of 69% reduction of DUX4 RNA in the standard in vitro RNase H assay.

9. Nucleobases 2783-2806 of SEO ID NO: 1 and/or nucleobases 10-33 of SEO ID NO: 2

In certain embodiments, nucleobases 2783-2806 of SEQ ID NO: 1 and/or nucleobases 10-33 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, modified oligonucleotides are complementary within nucleobases 2783-2806 of SEQ ID NO: 1 and/or nucleobases 10-33 of SEQ ID NO: 2. In certain embodiments, modified oligonucleotides are 16 nucleobases in length. In certain embodiments, modified oligonucleotides are gapmers. In certain embodiments, the gapmers are cEt gapmers. In certain embodiments, the sugar motif for the gapmers is (from 5′ to 3′): kkkddddddddddkkk; wherein each “d” represents a 2′-β-D-deoxyribosyl sugar moiety, and each “k” represents a cEt sugar moiety. Each cytosine residue is a 5-methylcytosine.

In certain embodiments, the nucleosides of the modified oligonucleotides are linked by phosphorothioate internucleoside linkages.

The nucleobase sequences of SEQ ID NOs: 802, 880, 1088-1090 are complementary within nucleobases 2783-2806 of SEQ ID NO: 1 and/or nucleobases 10-33 of SEQ ID NO: 2.

Compounds 1582611-1582612 and 1604089-1604091 are complementary within nucleobases 2783-2806 of SEQ ID NO: 1 and/or nucleobases 10-33 of SEQ ID NO: 2.

In certain embodiments, modified oligonucleotides complementary within nucleobases 2783-2806 of SEQ ID NO: 1 and/or nucleobases 10-33 of SEQ ID NO: 2 achieve at least 71% reduction of DUX4 RNA in the standard in vitro RNase H assay. In certain embodiments, modified oligonucleotides complementary within nucleobases 2783-2806 of SEQ ID NO: 1 and/or nucleobases 10-33 of SEQ ID NO: 2 achieve an average of 79% reduction of DUX4 RNA in the standard in vitro RNase H assay.

10. Nucleobases 2833-2853 of SEO ID NO: 1 and/or nucleobases 60-80 of SEO ID NO: 2

In certain embodiments, nucleobases 2833-2853 of SEQ ID NO: 1 and/or nucleobases 60-80 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, modified oligonucleotides are complementary within nucleobases 2833-2853 of SEQ ID NO: 1 and/or nucleobases 60-80 of SEQ ID NO: 2. In certain embodiments, modified oligonucleotides are 16 nucleobases in length. In certain embodiments, modified oligonucleotides are gapmers. In certain embodiments, the gapmers are cEt gapmers. In certain embodiments, the sugar motif for the gapmers is (from 5′ to 3′): kkkddddddddddkkk; wherein each “d” represents a 2′-β-D-deoxyribosyl sugar moiety, and each “k” represents a cEt sugar moiety. Each cytosine residue is a 5-methylcytosine.

In certain embodiments, the nucleosides of the modified oligonucleotides are linked by phosphorothioate internucleoside linkages.

The nucleobase sequences of SEQ ID NOs: 668, 742, 815, 893, 966, and 1040 are complementary within nucleobases 2833-2853 of SEQ ID NO: 1 and/or nucleobases 60-80 of SEQ ID NO: 2.

Compounds 1582702-1582707 are complementary within nucleobases 2833-2853 of SEQ ID NO: 1 and/or nucleobases 60-80 of SEQ ID NO: 2.

In certain embodiments, modified oligonucleotides complementary within nucleobases 2833-2853 of SEQ ID NO: 1 and/or nucleobases 60-80 of SEQ ID NO: 2 achieve at least 59% reduction of DUX4 RNA in the standard in vitro RNase H assay. In certain embodiments, modified oligonucleotides complementary within nucleobases 2833-2853 of SEQ ID NO: 1 and/or nucleobases 60-80 of SEQ ID NO: 2 achieve an average of 79% reduction of DUX4 RNA in the standard in vitro RNase H assay.

11. Nucleobases 2953-2975 of SEQ ID NO: 1 and/or nucleobases 180-202 of SEQ ID NO: 2

In certain embodiments, nucleobases 2953-2975 of SEQ ID NO: 1 and/or nucleobases 180-202 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, modified oligonucleotides are complementary within nucleobases 2953-2975 of SEQ ID NO: 1 and/or nucleobases 180-202 of SEQ ID NO: 2. In certain embodiments, modified oligonucleotides are 16 nucleobases in length. In certain embodiments, modified oligonucleotides are gapmers. In certain embodiments, the gapmers are cEt gapmers. In certain embodiments, the sugar motif for the gapmers is (from 5′ to 3′): kkkddddddddddkkk; wherein each “d” represents a 2′-β-D-deoxyribosyl sugar moiety, and each “k” represents a cEt sugar moiety. Each cytosine residue is a 5-methylcytosine.

In certain embodiments, the nucleosides of the modified oligonucleotides are linked by phosphorothioate internucleoside linkages.

The nucleobase sequences of SEQ ID NOs: 673, 747-748, 822, 898, 971, and 1045 are complementary within nucleobases 2953-2975 of SEQ ID NO: 1 and/or nucleobases 180-202 of SEQ ID NO: 2.

Compounds 1582734-1582740 are complementary within nucleobases 2953-2975 of SEQ ID NO: 1 and/or nucleobases 180-202 of SEQ ID NO: 2.

In certain embodiments, modified oligonucleotides complementary within nucleobases 2953-2975 of SEQ ID NO: 1 and/or nucleobases 180-202 of SEQ ID NO: 2 achieve at least 73% reduction of DUX4 RNA in the standard in vitro RNase H assay. In certain embodiments, modified oligonucleotides complementary within nucleobases 2953-2975 of SEQ ID NO: 1 and/or nucleobases 180-202 of SEQ ID NO: 2 achieve an average of 78% reduction of DUX4 RNA in the standard in vitro RNase H assay.

12. Nucleobases 3097-3136 of SEQ ID NO: 1 and/or nucleobases 324-363 of SEQ ID NO: 2

In certain embodiments, nucleobases 3097-3136 of SEQ ID NO: 1 and/or nucleobases 324-363 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, modified oligonucleotides are complementary within nucleobases 3097-3136 of SEQ ID NO: 1 and/or nucleobases 324-363 of SEQ ID NO: 2. In certain embodiments, modified oligonucleotides are 16 nucleobases in length. In certain embodiments, modified oligonucleotides are 20 nucleobases in length. In certain embodiments, modified oligonucleotides are gapmers. In certain embodiments, modified oligonucleotides are 5-10-5 or 3-10-3 gapmers. In certain embodiments, the gapmers are MOE gapmers. In certain embodiments, the gapmers are cEt gapmers. In certain embodiments, the sugar motif for the gapmers is (from 5′ to 3′): eeeeeddddddddddeeeee; wherein each “d” represents a 2′-β-D-deoxyribosyl sugar moiety, and each “e” represents a 2′-MOE sugar moiety. In certain embodiments, the sugar motif for the gapmers is (from 5′ to 3′): kkkddddddddddkkk; wherein each “d” represents a 2′-D-D-deoxyribosyl sugar moiety, and each “k” represents a cEt sugar moiety. Each cytosine residue is a 5-methylcytosine.

In certain embodiments, the nucleosides of the modified oligonucleotides are linked by phosphorothioate internucleoside linkages.

The nucleobase sequences of SEQ ID NOs: 39, 678-681, 753-755, 827-829, 903-905, 976-978, 1050-1052, and 1135-1136 are complementary within nucleobases 3097-3136 of SEQ ID NO: 1 and/or nucleobases 324-363 of SEQ ID NO: 2.

Compounds 541125, 1582765-1582783, and 1604144-1604145 are complementary within nucleobases 3097-3136 of SEQ ID NO: 1 and/or nucleobases 324-363 of SEQ ID NO: 2.

In certain embodiments, modified oligonucleotides complementary within nucleobases 3097-3136 of SEQ ID NO: 1 and/or nucleobases 324-363 of SEQ ID NO: 2 achieve at least 30% reduction of DUX4 RNA in the standard in vitro RNase H assay. In certain embodiments, modified oligonucleotides complementary within nucleobases 3097-3136 of SEQ ID NO: 1 and/or nucleobases 324-363 of SEQ ID NO: 2 achieve an average of 76% reduction of DUX4 RNA in the standard in vitro RNase H assay.

13. Nucleobases 3174-3210 of SEO ID NO: 1 and/or nucleobases 401-437 of SEO ID NO: 2

In certain embodiments, nucleobases 3174-3210 of SEQ ID NO: 1 and/or nucleobases 401-437 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, modified oligonucleotides are complementary within nucleobases 3174-3210 of SEQ ID NO: 1 and/or nucleobases 401-437 of SEQ ID NO: 2. In certain embodiments, modified oligonucleotides are 16 nucleobases in length. In certain embodiments, modified oligonucleotides are 20 nucleobases in length. In certain embodiments, modified oligonucleotides are gapmers. In certain embodiments, modified oligonucleotides are 5-10-5 or 3-10-3 gapmers. In certain embodiments, the gapmers are MOE gapmers. In certain embodiments, the gapmers are cEt gapmers. In certain embodiments, the sugar motif for the gapmers is (from 5′ to 3′): eeeeeddddddddddeeeee; wherein each “d” represents a 2′-β-D-deoxyribosyl sugar moiety, and each “e” represents a 2′-MOE sugar moiety. In certain embodiments, the sugar motif for the gapmers is (from 5′ to 3′): kkkddddddddddkkk; wherein each “d” represents a 2′-β-D-deoxyribosyl sugar moiety, and each “k” represents a cEt sugar moiety. Each cytosine residue is a 5-methylcytosine.

In certain embodiments, the nucleosides of the modified oligonucleotides are linked by phosphorothioate internucleoside linkages.

The nucleobase sequences of SEQ ID NOs: 117, 684, 758, 1056, and 1141-1144 are complementary within nucleobases 3174-3210 of SEQ ID NO: 1 and/or nucleobases 401-437 of SEQ ID NO: 2.

Compounds 541206, 1582800-1582802, and 1604150-1604153 are complementary within nucleobases 3174-3210 of SEQ ID NO: 1 and/or nucleobases 401-437 of SEQ ID NO: 2.

In certain embodiments, modified oligonucleotides complementary within nucleobases 3174-3210 of SEQ ID NO: 1 and/or nucleobases 401-437 of SEQ ID NO: 2 achieve at least 53% reduction of DUX4 RNA in the standard in vitro RNase H assay. In certain embodiments, modified oligonucleotides complementary within nucleobases 3174-3210 of SEQ ID NO: 1 and/or nucleobases 401-437 of SEQ ID NO: 2 achieve an average of 84% reduction of DUX4 RNA in the standard in vitro RNase H assay.

14. Nucleobases 3361-3400 of SEO ID NO: 1 and/or nucleobases 588-627 of SEO ID NO: 2

In certain embodiments, nucleobases 3361-3400 of SEQ ID NO: 1 and/or nucleobases 588-627 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, modified oligonucleotides are complementary within nucleobases 3361-3400 of SEQ ID NO: 1 and/or nucleobases 588-627 of SEQ ID NO: 2. In certain embodiments, modified oligonucleotides are 16 nucleobases in length. In certain embodiments, modified oligonucleotides are 20 nucleobases in length. In certain embodiments, modified oligonucleotides are gapmers. In certain embodiments, modified oligonucleotides are 5-10-5 or 3-10-3 gapmers. In certain embodiments, the gapmers are MOE gapmers. In certain embodiments, the gapmers are cEt gapmers. In certain embodiments, the sugar motif for the gapmers is (from 5′ to 3′): eeeeeddddddddddeeeee; wherein each “d” represents a 2′-β-D-deoxyribosyl sugar moiety, and each “e” represents a 2′-MOE sugar moiety. In certain embodiments, the sugar motif for the gapmers is (from 5′ to 3′): kkkddddddddddkkk; wherein each “d” represents a 2′-β-D-deoxyribosyl sugar moiety, and each “k” represents a cEt sugar moiety. Each cytosine residue is a 5-methylcytosine.

In certain embodiments, the nucleosides of the modified oligonucleotides are linked by phosphorothioate internucleoside linkages.

The nucleobase sequences of SEQ ID NOs: 123, 695-697, 769-771, 843, 844, 919, 920, 992, 993, 1066, and 1067 are complementary within nucleobases 3361-3400 of SEQ ID NO: 1 and/or nucleobases 588-627 of SEQ ID NO: 2.

Compounds 541212, 1582863-1582873, and 1582875-1582877 are complementary within nucleobases 3361-3400 of SEQ ID NO: 1 and/or nucleobases 588-627 of SEQ ID NO: 2.

In certain embodiments, modified oligonucleotides complementary within nucleobases 3361-3400 of SEQ ID NO: 1 and/or nucleobases 588-627 of SEQ ID NO: 2 achieve at least 37% reduction of DUX4 RNA in the standard in vitro RNase H assay. In certain embodiments, modified oligonucleotides complementary within nucleobases 3361-3400 of SEQ ID NO: 1 and/or nucleobases 588-627 of SEQ ID NO: 2 achieve an average of 70% reduction of DUX4 RNA in the standard in vitro RNase H assay.

15. Nucleobases 3883-3926 of SEQ ID NO: 1 and/or nucleobases 1110-1153 of SEQ ID NO: 2

In certain embodiments, nucleobases 3883-3926 of SEQ ID NO: 1 and/or nucleobases 1110-1153 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, modified oligonucleotides are complementary within nucleobases 3883-3926 of SEQ ID NO: 1 and/or nucleobases 1110-1153 of SEQ ID NO: 2. In certain embodiments, modified oligonucleotides are 16 nucleobases in length. In certain embodiments, modified oligonucleotides are 20 nucleobases in length. In certain embodiments, modified oligonucleotides are gapmers. In certain embodiments, modified oligonucleotides are 5-10-5 or 3-10-3 gapmers. In certain embodiments, the gapmers are MOE gapmers. In certain embodiments, the gapmers are cEt gapmers. In certain embodiments, the sugar motif for the gapmers is (from 5′ to 3′): eeeeeddddddddddeeeee; wherein each “d” represents a 2′-β-D-deoxyribosyl sugar moiety, and each “e” represents a 2′-MOE sugar moiety. In certain embodiments, the sugar motif for the gapmers is (from 5′ to 3′): kkkddddddddddkkk; wherein each “d” represents a 2′-β-D-deoxyribosyl sugar moiety, and each “k” represents a cEt sugar moiety. Each cytosine residue is a 5-methylcytosine.

In certain embodiments, the nucleosides of the modified oligonucleotides are linked by phosphorothioate internucleoside linkages.

The nucleobase sequences of SEQ ID NOs: 67, 141, 646-647, 720-721, 793-794, 870-871, 945, 947-948, and 1020-1021 are complementary within nucleobases 3883-3926 of SEQ ID NO: 1 and/or nucleobases 1110-1153 of SEQ ID NO: 2.

Compounds 541153, 541230, 1582550, 1582552-1582556, and 1582558-1582564 are complementary within nucleobases 3883-3926 of SEQ ID NO: 1 and/or nucleobases 1110-1153 of SEQ ID NO: 2.

In certain embodiments, modified oligonucleotides complementary within nucleobases 3883-3926 of SEQ ID NO: 1 and/or nucleobases 1110-1153 of SEQ ID NO: 2 achieve at least 27% reduction of DUX4 RNA in the standard in vitro RNase H assay. In certain embodiments, modified oligonucleotides complementary within nucleobases 3883-3926 of SEQ ID NO: 1 and/or nucleobases 1110-1153 of SEQ ID NO: 2 achieve an average of 71% reduction of DUX4 RNA in the standard in vitro RNase H assay.

16. Nucleobases 4007-4029 of SEO ID NO: 1 and/or nucleobases 1234-1256 of SEO ID NO: 2

In certain embodiments, nucleobases 4007-4029 of SEQ ID NO: 1 and/or nucleobases 1234-1256 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, modified oligonucleotides are complementary within nucleobases 4007-4029 of SEQ ID NO: 1 and/or nucleobases 1234-1256 of SEQ ID NO: 2. In certain embodiments, modified oligonucleotides are 16 nucleobases in length. In certain embodiments, modified oligonucleotides are gapmers. In certain embodiments, the gapmers are cEt gapmers. In certain embodiments, the sugar motif for the gapmers is (from 5′ to 3′): kkkddddddddddkkk; wherein each “d” represents a 2′-D-D-deoxyribosyl sugar moiety, and each “k” represents a cEt sugar moiety. Each cytosine residue is a 5-methylcytosine.

In certain embodiments, the nucleosides of the modified oligonucleotides are linked by phosphorothioate internucleoside linkages.

The nucleobase sequences of SEQ ID NOs: 652, 726, 799, 876, 953, 1026, and 1079 are complementary within nucleobases 4007-4029 of SEQ ID NO: 1 and/or nucleobases 1234-1256 of SEQ ID NO: 2.

Compounds 1582589-1582594 and 1604080 are complementary within nucleobases 4007-4029 of SEQ ID NO: 1 and/or nucleobases 1234-1256 of SEQ ID NO: 2.

In certain embodiments, modified oligonucleotides complementary within nucleobases 4007-4029 of SEQ ID NO: 1 and/or nucleobases 1234-1256 of SEQ ID NO: 2 achieve at least 65% reduction of DUX4 RNA in the standard in vitro RNase H assay. In certain embodiments, modified oligonucleotides complementary within nucleobases 4007-4029 of SEQ ID NO: 1 and/or nucleobases 1234-1256 of SEQ ID NO: 2 achieve an average of 82% reduction of DUX4 RNA in the standard in vitro RNase H assay.

17. Nucleobases 4667-4694 of SEQ ID NO: 1 and/or nucleobases 1532-1559 of SEQ ID NO: 2

In certain embodiments, nucleobases 4667-4694 of SEQ ID NO: 1 and/or nucleobases 1532-1559 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, modified oligonucleotides are complementary within nucleobases 4667-4694 of SEQ ID NO: 1 and/or nucleobases 1532-1559 of SEQ ID NO: 2. In certain embodiments, modified oligonucleotides are 16 nucleobases in length. In certain embodiments, modified oligonucleotides are 20 nucleobases in length. In certain embodiments, modified oligonucleotides are gapmers. In certain embodiments, modified oligonucleotides are 5-10-5 or 3-10-3 gapmers. In certain embodiments, the gapmers are MOE gapmers. In certain embodiments, the gapmers are cEt gapmers. In certain embodiments, the sugar motif for the gapmers is (from 5′ to 3′): eeeeeddddddddddeeeee; wherein each “d” represents a 2′-D-D-deoxyribosyl sugar moiety, and each “e” represents a 2′-MOE sugar moiety. In certain embodiments, the sugar motif for the gapmers is (from 5′ to 3′): kkkddddddddddkkk; wherein each “d” represents a 2′-β-D-deoxyribosyl sugar moiety, and each “k” represents a cEt sugar moiety. Each cytosine residue is a 5-methylcytosine.

In certain embodiments, the nucleosides of the modified oligonucleotides are linked by phosphorothioate internucleoside linkages.

The nucleobase sequences of SEQ ID NOs: 163, 658, 732, 883, 957, 1031, and 1105-1112 are complementary within nucleobases 4667-4694 of SEQ ID NO: 1 and/or nucleobases 1532-1559 of SEQ ID NO: 2.

Compounds 541256, 1582645-1582649, and 1604114-1604121 are complementary within nucleobases 4667-4694 of SEQ ID NO: 1 and/or nucleobases 1532-1559 of SEQ ID NO: 2.

In certain embodiments, modified oligonucleotides complementary within nucleobases 4667-4694 of SEQ ID NO: 1 and/or nucleobases 1532-1559 of SEQ ID NO: 2 achieve at least 63% reduction of DUX4 RNA in the standard in vitro RNase H assay. In certain embodiments, modified oligonucleotides complementary within nucleobases 4667-4694 of SEQ ID NO: 1 and/or nucleobases 1532-1559 of SEQ ID NO: 2 achieve an average of 83% reduction of DUX4 RNA in the standard in vitro RNase H assay.

18. Nucleobases 2955-2984 of SEQ ID NO: 1 and/or nucleobases 182-211 of SEQ ID NO: 2

In certain embodiments, nucleobases 2955-2984 of SEQ ID NO: 1 and/or nucleobases 182-211 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, modified oligonucleotides (e.g., antisense RNAi oligonucleotides) are complementary within nucleobases 2955-2984 of SEQ ID NO: 1 and/or nucleobases 182-211 of SEQ ID NO: 2. In certain embodiments, modified oligonucleotides (e.g., antisense RNAi oligonucleotides) are 23 nucleobases in length. In certain embodiments, modified oligonucleotides (e.g., antisense RNAi oligonucleotides) comprise one or more sugar modifications. In certain embodiments, modified oligonucleotides (e.g., antisense RNAi oligonucleotides) comprise one or more 2′-OMe sugar moieties, one or more 2′-F sugar moieties, or a combination thereof. In certain embodiments, the sugar motif of the modified oligonucleotides (e.g., antisense RNAi oligonucleotides) is (from 5′ to 3′): yfyfyfyfyfyfyfyfyfyfyyy, wherein each “y” represents a 2′-OMe sugar moiety and each “f” represents a 2′-F sugar moiety. Each cytosine residue is a 5-methylcytosine.

In certain embodiments, the nucleosides of the modified oligonucleotides (e.g., antisense RNAi oligonucleotides) are linked by an internucleoside linkage selected from a phosphodiester or a phosphorothioate internucleoside linkage.

The nucleobase sequences of SEQ ID NOs: 1425 and 1424 (antisense RNAi oligonucleotides) are complementary within nucleobases 2955-2984 of SEQ ID NO: 1 and/or nucleobases 182-211 of SEQ ID NO: 2.

Compounds 1588626 and 1588623 (RNAi agents) are complementary within nucleobases 2955-2984 of SEQ ID NO: 1 and/or nucleobases 182-211 of SEQ ID NO: 2.

In certain embodiments, modified oligonucleotides (e.g., antisense RNAi oligonucleotides) within nucleobases 2955-2984 of SEQ ID NO: 1 and/or nucleobases 182-211 of SEQ ID NO: 2 achieve at least 87% reduction of DUX4 RNA in the standard in vitro RNAi assay. In certain embodiments, modified oligonucleotides (e.g., antisense RNAi oligonucleotides) within nucleobases 2955-2984 of SEQ ID NO: 1 and/or nucleobases 182-211 of SEQ ID NO: 2 achieve an average of 90% reduction of DUX4 RNA in the standard in vitro RNAi assay.

19. Nucleobases 3099-3128 of SEQ ID NO: 1 and/or nucleobases 326-355 of SEQ ID NO: 2

In certain embodiments, nucleobases 3099-3128 of SEQ ID NO: 1 and/or nucleobases 326-355 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, modified oligonucleotides (e.g., antisense RNAi oligonucleotides) are complementary within nucleobases 3099-3128 of SEQ ID NO: 1 and/or nucleobases 326-355 of SEQ ID NO: 2. In certain embodiments, modified oligonucleotides (e.g., antisense RNAi oligonucleotides) are 23 nucleobases in length. In certain embodiments, modified oligonucleotides (e.g., antisense RNAi oligonucleotides) comprise one or more sugar modifications. In certain embodiments, modified oligonucleotides (e.g., antisense RNAi oligonucleotides) comprise one or more 2′-OMe sugar moieties, one or more 2′-F sugar moieties, or a combination thereof. In certain embodiments, the sugar motif of the modified oligonucleotides (e.g., antisense RNAi oligonucleotides) is (from 5′ to 3′): yfyfyfyfyfyfyfyfyfyfyyy, wherein each “y” represents a 2′-OMe sugar moiety and each “f” represents a 2′-F sugar moiety. Each cytosine residue is a 5-methylcytosine.

In certain embodiments, the nucleosides of the modified oligonucleotides (e.g., antisense RNAi oligonucleotides) are linked by an internucleoside linkage selected from a phosphodiester or a phosphorothioate internucleoside linkage.

The nucleobase sequences of SEQ ID NOs: 1214 and 1410 (antisense RNAi oligonucleotides) are complementary within nucleobases 3099-3128 of SEQ ID NO: 1 and/or nucleobases 326-355 of SEQ ID NO: 2.

Compounds 1588572 and 1588569 (RNAi agents) are complementary within nucleobases 3099-3128 of SEQ ID NO: 1 and/or nucleobases 326-355 of SEQ ID NO: 2.

In certain embodiments, modified oligonucleotides (e.g., antisense RNAi oligonucleotides) within nucleobases 3099-3128 of SEQ ID NO: 1 and/or nucleobases 326-355 of SEQ ID NO: 2 achieve at least 63% reduction of DUX4 RNA in the standard in vitro RNAi assay. In certain embodiments, modified oligonucleotides (e.g., antisense RNAi oligonucleotides) within nucleobases 3099-3128 of SEQ ID NO: 1 and/or nucleobases 326-355 of SEQ ID NO: 2 achieve an average of 77% reduction of DUX4 RNA in the standard in vitro RNAi assay.

20. Nucleobases 3171-3209 of SEO ID NO: 1 and/or nucleobases 398-436 of SEO ID NO: 2

In certain embodiments, nucleobases 3171-3209 of SEQ ID NO: 1 and/or nucleobases 398-436 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, modified oligonucleotides (e.g., antisense RNAi oligonucleotides) are complementary within nucleobases 3171-3209 of SEQ ID NO: 1 and/or nucleobases 398-436 of SEQ ID NO: 2. In certain embodiments, modified oligonucleotides (e.g., antisense RNAi oligonucleotides) are 23 nucleobases in length. In certain embodiments, modified oligonucleotides (e.g., antisense RNAi oligonucleotides) comprise one or more sugar modifications. In certain embodiments, modified oligonucleotides (e.g., antisense RNAi oligonucleotides) comprise one or more 2′-OMe sugar moieties, one or more 2′-F sugar moieties, or a combination thereof. In certain embodiments, the sugar motif of the modified oligonucleotides (e.g., antisense RNAi oligonucleotides) is (from 5′ to 3′): yfyfyfyfyfyfyfyfyfyyy, wherein each “y” represents a 2′-OMe sugar moiety and each “f” represents a 2′-F sugar moiety. Each cytosine residue is a 5-methylcytosine.

In certain embodiments, the nucleosides of the modified oligonucleotides (e.g., antisense RNAi oligonucleotides) are linked by an internucleoside linkage selected from a phosphodiester or a phosphorothioate internucleoside linkage.

The nucleobase sequences of SEQ ID NOs: 1405, 1210, and 1209 (antisense RNAi oligonucleotides) are complementary within nucleobases 3171-3209 of SEQ ID NO: 1 and/or nucleobases 398-436 of SEQ ID NO: 2.

Compounds 1588545, 1588542, and 1588539 (RNAi agents) are complementary within nucleobases 3171-3209 of SEQ ID NO: 1 and/or nucleobases 398-436 of SEQ ID NO: 2.

In certain embodiments, modified oligonucleotides (e.g., antisense RNAi oligonucleotides) within nucleobases 3171-3209 of SEQ ID NO: 1 and/or nucleobases 398-436 of SEQ ID NO: 2 achieve at least 64% reduction of DUX4 RNA in the standard in vitro RNAi assay. In certain embodiments, modified oligonucleotides (e.g., antisense RNAi oligonucleotides) within nucleobases 3171-3209 of SEQ ID NO: 1 and/or nucleobases 398-436 of SEQ ID NO: 2 achieve an average of 83% reduction of DUX4 RNA in the standard in vitro RNAi assay.

21. Nucleobases 3859-3888 of SEO ID NO: 1 and/or nucleobases 1086-1115 of SEO ID NO: 2

In certain embodiments, nucleobases 3859-3888 of SEQ ID NO: 1 and/or nucleobases 1086-1115 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, modified oligonucleotides (e.g., antisense RNAi oligonucleotides) are complementary within nucleobases 3859-3888 of SEQ ID NO: 1 and/or nucleobases 1086-1115 of SEQ ID NO: 2. In certain embodiments, modified oligonucleotides (e.g., antisense RNAi oligonucleotides) are 23 nucleobases in length. In certain embodiments, modified oligonucleotides (e.g., antisense RNAi oligonucleotides) comprise one or more sugar modifications. In certain embodiments, modified oligonucleotides (e.g., antisense RNAi oligonucleotides) comprise one or more 2′-OMe sugar moieties, one or more 2′-F sugar moieties, or a combination thereof. In certain embodiments, the sugar motif of the modified oligonucleotides (e.g., antisense RNAi oligonucleotides) is (from 5′ to 3′): yfyfyfyfyfyfyfyfyfyfyyy, wherein each “y” represents a 2′-OMe sugar moiety and each “f” represents a 2′-F sugar moiety. Each cytosine residue is a 5-methylcytosine.

In certain embodiments, the nucleosides of the modified oligonucleotides (e.g., antisense RNAi oligonucleotides) are linked by an internucleoside linkage selected from a phosphodiester or a phosphorothioate internucleoside linkage.

The nucleobase sequences of SEQ ID NOs: 1197 and 1335 (antisense RNAi oligonucleotides) are complementary within nucleobases 3859-3888 of SEQ ID NO: 1 and/or nucleobases 1086-1115 of SEQ ID NO: 2.

Compounds 1588286 and 1588283 (RNAi agents) are complementary within nucleobases 3859-3888 of SEQ ID NO: 1 and/or nucleobases 1086-1115 of SEQ ID NO: 2.

In certain embodiments, modified oligonucleotides (e.g., antisense RNAi oligonucleotides) within nucleobases 3859-3888 of SEQ ID NO: 1 and/or nucleobases 1086-1115 of SEQ ID NO: 2 achieve at least 60% reduction of DUX4 RNA in the standard in vitro RNAi assay. In certain embodiments, modified oligonucleotides (e.g., antisense RNAi oligonucleotides) within nucleobases 3859-3888 of SEQ ID NO: 1 and/or nucleobases 1086-1115 of SEQ ID NO: 2 achieve an average of 70% reduction of DUX4 RNA in the standard in vitro RNAi assay.

Nonlimiting Disclosure and Incorporation by Reference

Each of the literature and patent publications listed herein is incorporated by reference in its entirety.

While certain compounds, compositions and methods described herein have been described with specificity in accordance with certain embodiments, the following examples serve only to illustrate the compounds described herein and are not intended to limit the same. Each of the references, GenBank accession numbers, ENSEMBL identifiers, and the like recited in the present application is incorporated herein by reference in its entirety.

Although the sequence listing accompanying this filing identifies each sequence as either “RNA” or “DNA” as required, in reality, those sequences may be modified with any combination of chemical modifications. One of skill in the art will readily appreciate that such designation as “RNA” or “DNA” to describe modified oligonucleotides is, in certain instances, arbitrary. For example, an oligonucleotide comprising a nucleoside comprising a 2′-OH sugar moiety and a thymine base could be described as a DNA having a modified sugar (2′-OH in place of one 2′-H of DNA) or as an RNA having a modified base (thymine(methylated uracil) in place of an uracil of RNA). Accordingly, nucleic acid sequences provided herein, including, but not limited to those in the sequence listing, are intended to encompass nucleic acids containing any combination of natural or modified RNA and/or DNA, including, but not limited to such nucleic acids having modified nucleobases. By way of further example and without limitation, an oligomeric compound having the nucleobase sequence “ATCGATCG” encompasses any oligomeric compounds having such nucleobase sequence, whether modified or unmodified, including, but not limited to, such compounds comprising RNA bases, such as those having sequence “AUCGAUCG” and those having some DNA bases and some RNA bases such as “AUCGATCG” and oligomeric compounds having other modified nucleobases, such as “AT^mCGAUCG,” wherein ^mC indicates a cytosine base comprising a methyl group at the 5-position.

Certain compounds described herein (e.g., modified oligonucleotides) have one or more asymmetric center and thus give rise to enantiomers, diastereomers, and other stereoisomeric configurations that may be defined, in terms of absolute stereochemistry, as (R) or (S), as a or 3 such as for sugar anomers, or as (D) or (L), such as for amino acids, etc. Compounds provided herein that are drawn or described as having certain stereoisomeric configurations include only the indicated compounds. Compounds provided herein that are drawn or described with undefined stereochemistry include all such possible isomers, including their stereorandom and optically pure forms, unless specified otherwise. Likewise, tautomeric forms of the compounds herein are also included unless otherwise indicated. Unless otherwise indicated, compounds described herein are intended to include corresponding salt forms.

The compounds described herein include variations in which one or more atoms are replaced with a non-radioactive isotope or radioactive isotope of the indicated element. For example, compounds herein that comprise hydrogen atoms encompass all possible deuterium substitutions for each of the ¹H hydrogen atoms. Isotopic substitutions encompassed by the compounds herein include but are not limited to: ²H or ³H in place of ¹H, ¹³C or ¹⁴C in place of ¹²C, ¹⁵N in place of ¹⁴N, ¹⁷O or ¹⁸O in place of ¹⁶O, and ³³S, ³⁴S, ³⁵S, or ³⁶S in place of ³²S. In certain embodiments, non-radioactive isotopic substitutions may impart new properties on the oligomeric compound that are beneficial for use as a therapeutic or research tool. In certain embodiments, radioactive isotopic substitutions may make the compound suitable for research or diagnostic purposes such as imaging.

EXAMPLES

The following examples illustrate certain embodiments of the present disclosure and are not limiting. Moreover, where specific embodiments are provided, the inventors have contemplated generic application of those specific embodiments. For example, disclosure of an oligonucleotide having a particular motif provides reasonable support for additional oligonucleotides having the same or similar motif. And, for example, where a particular high-affinity modification appears at a particular position, other high-affinity modifications at the same position are considered suitable, unless otherwise indicated.

Example 1: Effect of 5-10-5 MOE Uniform Phosphorothioate Modified Oligonucleotides on Human DUX4 RNA In Vitro, Single Dose

Modified oligonucleotides complementary to human DUX4 nucleic acid were designed and tested for their single dose effects on DUX4 RNA in vitro. The modified oligonucleotides were tested in a series of experiments that had the same culture conditions.

The modified oligonucleotides in the table below are 5-10-5 MOE gapmers with uniform phosphorothioate internucleoside linkages. The gapmers are 20 nucleosides in length, wherein the central gap segment consists of ten 2′-β-D-deoxynucleosides, and wherein the 5′ and 3′ wing segments each consist of five 2′-MOE nucleosides. The sugar motif for the gapmers is (from 5′ to 3′): eeeeeddddddddddeeeee; wherein each “d” represents a 2′-β-D-deoxyribosyl sugar moiety, and each “e” represents a 2′-MOE sugar moiety. The internucleoside linkage motif for the gapmers is (from 5′ to 3′): sssssssssssssssssss; wherein each “s” represents a phosphorothioate internucleoside linkage. Each cytosine residue is a 5-methylcytosine.

“Start site” indicates the 5′-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. “Stop site” indicates the 3′-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. Each modified oligonucleotide listed in the tables below is 100% complementary to SEQ ID NO: 1 (GENBANK Accession No. NC_000004.12, truncated from nucleotides 190171001 to 190187000), to SEQ ID NO: 2 (GENBANK Accession No. NM_001306068.2), to SEQ ID NO: 3 (GENBANK Accession No. FJ439133.1), or to any combination of these SEQ ID NOs. “N/A” indicates that the modified oligonucleotide is not 100% complementary to that particular target nucleic acid sequence.

54-2 cells (Resnick et al., 2019, Cell Reports 29, 1812-1820) were cultured in F10 nutrient media (Gibco #11550) containing 20% FBS, 1 μM dexamethasone, and 10 ng/mL human FGF (Promega rhFGF G5071). The cells were plated at 6,000 cells per well and allowed to come to 100% confluence before media was changed to F-10 media containing 1% horse serum, 10 μg/mL insulin, and 10 μg/mL holo-transferrin to induce differentiation. Cells were allowed to differentiate for 72 hours before transfection of modified oligonucleotides. Differentiated 54-2 cells were treated with modified oligonucleotide at a concentration of 100 nM using cytofectin. After a treatment period of approximately 24 hours, total RNA was isolated from the cells and DUX4 RNA levels were measured by quantitative real-time RTPCR. DUX4 RNA levels were measured by human primer-probe set RTS3502 (forward sequence CCCGGCTGACGTGCAA, designated herein as SEQ ID NO: 11; reverse sequence AGCCAGAATTTCACGGAAGAAC, designated herein as SEQ ID NO: 12; probe sequence AGCTCGCTGGCCTCTCTGTGCC, designated herein as SEQ ID NO: 13). DUX4 RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Reduction of DUX4 RNA is presented in the tables below as percent DUX4 RNA relative to the amount of DUX4 RNA in untreated control cells (% UTC). The values marked with an “t” indicate that the modified oligonucleotide is complementary to the amplicon region of the primer probe set. Additional assays may be used to measure the potency and efficacy of the modified oligonucleotides complementary to the amplicon region.

Each separate experimental analysis described in this example is identified by a letter ID from A through B in the table column labeled “Analysis ID”.

TABLE 1
Reduction of DUX4 RNA by 5-10-5 MOE gapmers with uniform phosphorothioate internucleoside
linkages in differentiated 54-2 cells
	SEQ	SEQ	SEQ	SEQ
	ID	ID	ID	ID
	No: 1	No: 1	No: 2	No: 2				SEQ
Compound	Start	Stop	Start	Stop		DUX4	Analysis	ID
Number	Site	Site	Site	Site	Sequence (5′ to 3′)	(% UTC)	ID	NO
541106	2616	2635	N/A	N/A	CCAGCCGCCCTTGTAAAGGC	89	A	20
541107	2642	2661	N/A	N/A	GCCCGGACAGCCAGCCAGCC	71	A	21
541108	2664	2683	N/A	N/A	GGCAGGTGCAGCCAGGAGGC	72	A	22
541109	2686	2705	N/A	N/A	CCTCAGCCGGACTGTGCACT	51	A	23
541110	2708	2727	N/A	N/A	GAGGCCGGCGGGCTCCCGTG	67	A	24
541111	2730	2749	N/A	N/A	CACGGACGGACGCGGGCAGA	66	A	25
541112	2752	2771	N/A	N/A	CGGTGAGCCCCGGCCGGAAT	64	A	26
541113	2808	2827	35	54	TCGTCCCCGGGCTTCCGCGG	69	A	27
541114	2830	2849	57	76	AAACGAGTCTCCGTCGCCGT	52	A	28
541115	2866	2885	93	112	AGCAGGCTCGCAGGGCCTCG	103	A	29
541116	2897	2916	124	143	GTGGCGATGCCCGGGTACGG	67	A	30
541117	2919	2938	146	165	GGCCTGGGCCAGCCGTTCTC	48	A	31
541118	2941	2960	168	187	CCCTGGGCTCCGGAATGCCG	72	A	32
541119	2963	2982	190	209	TCATTCTGAAACCAAATCTG	93	A	33
541120	2985	3004	212	231	CTGCCTCAGCTGGCGTGACC	56	A	34
541121	3007	3026	234	253	AGGGCCGAGATTCCCGCCGG	55	A	35
541122	3035	3054	262	281	CCTTCTGGCGGGCCGCGTCT	83	A	36
541123	3057	3076	284	303	GACGGCGGTCCGCTTTCGCC	76	A	37
541124	3085	3104	312	331	GGAGGAGCAGGGCGGTCTGG	113	A	38
541125	3107	3126	334	353	AAGCGATCCTTCTCAAAGGC	70	A	39
541126	3129	3148	356	375	CTCCCGGGCGGCGATGCCTG	66	A	40
541127	3151	3170	378	397	GGCCCGTCTCTCTGGCCAGC	64	A	41
541128	3173	3192	400	419	ATCTGAATCCTGGACTCCGG	63	A	42
541129	3195	3214	422	441	GGCCCTTCGATTCTGAAACC	61	A	43
541130	3217	3236	444	463	TGCCACCCTGTCCCGGGTGC	77	A	44
541131	3239	3258	466	485	CCGCCTGCCTGCGCGGGCGC	83	A	45
541132	3290	3309	517	536	GCGACCCACGAGGGAGCAGG	93	A	46
541133	3312	3331	539	558	CCACGCGCCGGTGTGGGCGA	82	A	47
541134	3352	3371	579	598	CAGGCGCGCAGGGCACGTGG	79	A	48
541135	3385	3404	612	631	CCTGGCTCACGAAAGCCCCC	51	A	49
541136	3420	3439	647	666	CTGGCTGGGCTGCAGCGCGG	59	A	50
541137	3442	3461	669	688	AGATCCCCTCTGCCGGCGCG	65	A	51
541138	3472	3491	699	718	CGAAATCCCCGCGCGCCGGG	79	A	52
541139	3502	3521	729	748	CCCCGTCCGGAGGAGCCGGG	90	A	53
541140	N/A	N/A	756	775	AGCGAGGAGCCTGAGGGTGG	83	A	54
541141	3551	3570	778	797	CTTTTGCCCGGGTGCGGAGG	85	A	55
541142	3573	3592	800	819	CTGCGGGTCCCGGTCCTCCC	53	A	56
541143	3611	3630	838	857	GGCTGTGCCACCGCGCAGGG	61	A	57
541144	3633	3652	860	879	CGGCCCCGCTTGAGCGGGCC	75	A	58
541145	3655	3674	882	901	GCGCAAGCACCCCTTGGCCC	67	A	59
541146	3678	3697	905	924	CGGACTCCCCTGGGACGTGG	52	A	60
541147	3700	3719	927	946	GACCCCGGCCCCAGCCCCAC	99	A	61
541148	3747	3766	974	993	TGGAGCTGCCCCGGCTTGGG	62	A	62
541149	3795	3814	1022	1041	CCCCTGCCGCGCGGAGGCGG	71	A	63
541150	3817	3836	1044	1063	GCGCCGGGATGCCTTGCATC	61	A	64
541151	3848	3867	1075	1094	CAGGGCGCCGGCTCCTGGAG	64	A	65
541152	3878	3897	1105	1124	TCCAGCAGCAGGCCGCAGGG	61	A	66
541153	3900	3919	1127	1146	CTCCGGGCTCGCCAGGAGCT	73	A	67
541154	3922	3941	1149	1168	GAGGTTGCGCCTGCTGCAGA	68	A	68
541155	3958	3977	1185	1204	AGGCCTCCAGCTCCCCCGGG	57	A	69
541156	4016	4035	1243	1262	AGCAGAGCCCGGTATTCTTC	57	A	70
541157	4038	4057	1265	1284	CCCCGCGTCCTAAAGCTCCT	65	A	71
541158	4060	4079	1287	1306	GAACCACCCGACCCCGTCCC	89	A	72
541160	4104	4123	1331	1350	CCAGCCAGGTGTTCCCCGCG	53	A	73
541161	4126	4145	1353	1372	GCGGAGACACGCCCCTCCGT	116	A	74
541162	4163	4182	1390	1409	GGAATCCCAGGCCGGTCAGC	106	A	75
541163	4185	4204	1412	1431	CCGGGCCTAGACCTAGAAGG	95	A	76
541164	N/A	N/A	1434	1453	CTCCGCGGTGTGGAGTCTCT	71	A	77
541165	N/A	N/A	1456	1475	TGCCCAGGAAAGAATGGCAG	86	A	78
541166	4251	4270	1478	1497	GCCGGCTCTGGGATCCCCGG	68	A	79
541167	4284	4303	N/A	N/A	TGCGCAGTAGGCGGCCCACC	65	A	80
541168	4306	4325	N/A	N/A	CGGCTGCCCGCAAACCCGCG	58	A	81
541169	4328	4347	N/A	N/A	CGGGCTGCTCCCACAGCCCA	85	A	82
541170	4350	4369	N/A	N/A	GGAGAGGCAGGAGAGCTCTG	57	A	83
541171	4439	4458	N/A	N/A	GGTCTCCACCCAGCCCAGGG	66	A	84
541172	4481	4500	N/A	N/A	AGGCCCGGACGCTGCGCGGG	73	A	85
541174	4535	4554	N/A	N/A	GGCGGGCGACGGTGGCGCGG	66	A	86
541176	4598	4617	N/A	N/A	AGGTATGCTTTTGACCGCCA	50	A	87
541177	4620	4639	N/A	N/A	GGAAGCGGGCAAAGACAGAC	95	A	88
541178	4642	4661	N/A	N/A	GCACTGCGCGCAGGTCTAGC	66	A	89
541179	4677	4696	1542	1561	GGCCAGCGAGCTCCCTTGCA	48†	A	90
541180	4699	4718	1564	1583	CGGAAGAACAAGGGCACAGA	52†	A	91
541181	4743	4762	1608	1627	AGACAGCGTCGGAAGGTGGG	69	A	92
541182	4765	4784	1630	1649	TAACTCTAATCCAGGTTTGC	56	A	93
541183	4787	4806	1652	1671	TGAACTAATCATCCAGGAGA	54	A	94
541184	2627	2646	N/A	N/A	CAGCCAGCCAGCCAGCCGCC	66	B	95
541185	2653	2672	N/A	N/A	CCAGGAGGCCTGCCCGGACA	65	B	96
541186	2675	2694	N/A	N/A	CTGTGCACTGCGGCAGGTGC	63	B	97
541187	2697	2716	N/A	N/A	GCTCCCGTGCACCTCAGCCG	56	B	98
541188	2719	2738	N/A	N/A	GCGGGCAGAGAGAGGCCGGC	84	B	99
541189	2741	2760	N/A	N/A	GGCCGGAATTTCACGGACGG	49	B	100
541190	2763	2782	N/A	N/A	GAGGGCCATCGCGGTGAGCC	66	B	101
541191	2819	2838	46	65	CGTCGCCGTCCTCGTCCCCG	61	B	102
541192	2855	2874	82	101	AGGGCCTCGCTTTGGCTCGG	56	B	103
541193	2877	2896	104	123	GTTCCGCTCAAAGCAGGCTC	62	B	104
541194	2908	2927	135	154	GCCGTTCTCTGGTGGCGATG	53	B	105
541195	2930	2949	157	176	GGAATGCCGATGGCCTGGGC	70	B	106
541196	2952	2971	179	198	CCAAATCTGGACCCTGGGCT	59	B	107
541197	2974	2993	201	220	GGCGTGACCTCTCATTCTGA	49	B	108
541198	2996	3015	223	242	TCCCGCCGGTGCTGCCTCAG	51	B	109
541199	3024	3043	251	270	GCCGCGTCTCCCGGGCCAGG	53	B	110
541200	3046	3065	273	292	GCTTTCGCCGGCCTTCTGGC	51	B	111
541201	3068	3087	295	314	TGGGATCCGGTGACGGCGGT	76	B	112
541202	3096	3115	323	342	CTCAAAGGCTCGGAGGAGCA	69	B	113
541203	3118	3137	345	364	CGATGCCTGGAAAGCGATCC	60	B	114
541204	3140	3159	367	386	CTGGCCAGCTCCTCCCGGGC	40	B	115
541205	3162	3181	389	408	GGACTCCGGGAGGCCCGTCT	33	B	116
541206	3184	3203	411	430	TCTGAAACCAGATCTGAATC	47	B	117
541207	3206	3225	433	452	CCCGGGTGCCTGGCCCTTCG	54	B	118
541208	3228	3247	455	474	CGCGGGCGCCCTGCCACCCT	59	B	119
541209	3276	3295	503	522	AGCAGGGTGACCCCCGCCGG	51	B	120
541210	3301	3320	528	547	TGTGGGCGAAGGCGACCCAC	73	B	121
541211	3323	3342	550	569	AGCCCCGTTCCCCACGCGCC	50	B	122
541212	3374	3393	601	620	AAAGCCCCCTGTGGGAGAGC	63	B	123
541213	3396	3415	623	642	GGCCCTCGCTGCCTGGCTCA	54	B	124
541214	3431	3450	658	677	GCCGGCGCGGCCTGGCTGGG	65	B	125
541215	3453	3472	680	699	GGCAGGTTGGGAGATCCCCT	50	B	126
541216	3483	3502	710	729	GGCGGCGTAGGCGAAATCCC	53	B	127
541217	3513	3532	740	759	GTGGGAGAGCGCCCCGTCCG	46	B	128
541218	N/A	N/A	767	786	GTGCGGAGGCCAGCGAGGAG	75	B	129
541219	3562	3581	789	808	GGTCCTCCCGGCTTTTGCCC	56	B	130
541220	3584	3603	811	830	AGGCCGTCGCGCTGCGGGTC	73	B	131
541221	3622	3641	849	868	GAGCGGGCCCAGGCTGTGCC	57	B	132
541222	3644	3663	871	890	CCTTGGCCCTGCGGCCCCGC	39	B	133
541223	3666	3685	893	912	GGACGTGGGTGGCGCAAGCA	58	B	134
541224	3689	3708	916	935	CAGCCCCACCACGGACTCCC	68	B	135
541225	3720	3739	947	966	CGCCGCCCCGGCGACCTGGG	57	B	136
541226	3784	3803	1011	1030	CGGAGGCGGAGGCGTCCGGG	79	B	137
541227	3806	3825	1033	1052	CCTTGCATCTGCCCCTGCCG	60	B	138
541228	3837	3856	1064	1083	CTCCTGGAGCGCCTGGGAGG	82	B	139
541229	3859	3878	1086	1105	GGAGTGCAGACCAGGGCGCC	67	B	140
541230	3889	3908	1116	1135	CCAGGAGCTCATCCAGCAGC	56	B	141
541231	3911	3930	1138	1157	TGCTGCAGAAACTCCGGGCT	71	B	142
541232	3933	3952	1160	1179	CGTTTCTAGGAGAGGTTGCG	54	B	143
541233	4005	4024	1232	1251	GTATTCTTCCTCGCTGAGGG	56	B	144
541234	4027	4046	1254	1273	AAAGCTCCTCCAGCAGAGCC	66	B	145
541235	4049	4068	1276	1295	CCCCGTCCCAACCCCGCGTC	80	B	146
541237	4093	4112	1320	1339	TTCCCCGCGAAAGAGAGGCC	46	B	147
541238	4115	4134	1342	1361	CCCCTCCGTAGCCAGCCAGG	53	B	148
541239	4152	4171	1379	1398	CCGGTCAGCCCGGTGGAGGG	104	B	149
541240	4174	4193	1401	1420	CCTAGAAGGCAGGAATCCCA	97	B	150
541241	4196	4215	1423	1442	GGAGTCTCTCACCGGGCCTA	45	B	151
541242	N/A	N/A	1445	1464	GAATGGCAGTTCTCCGCGGT	67	B	152
541243	4240	4259	1467	1486	GATCCCCGGGATGCCCAGGA	63	B	153
541244	4273	4292	N/A	N/A	CGGCCCACCTGCTGGTACCT	80	B	154
541245	4295	4314	N/A	N/A	AAACCCGCGCGTGCGCAGTA	63	B	155
541246	4317	4336	N/A	N/A	CACAGCCCAGGCGGCTGCCC	83	B	156
541247	4339	4358	N/A	N/A	AGAGCTCTGCCCGGGCTGCT	77	B	157
541248	4361	4380	N/A	N/A	GGTGGGCTGGTGGAGAGGCA	80	B	158
541249	4460	4479	N/A	N/A	CCCGGTGTTTCGCGGGACGG	63	B	159
541252	4565	4584	N/A	N/A	GGCAGCTGGGAGGCTGCAGG	97	B	160
541254	4609	4628	N/A	N/A	AAGACAGACAGAGGTATGCT	80	B	161
541255	4631	4650	N/A	N/A	AGGTCTAGCCAGGAAGCGGG	46	B	162
541256	4666	4685	1531	1550	TCCCTTGCACGTCAGCCGGG	44†	B	163
541257	4688	4707	1553	1572	GGGCACAGAGAGGCCAGCGA	49†	B	164
541258	4710	4729	1575	1594	CCAGAATTTCACGGAAGAAC	62†	B	165
541259	4754	4773	1619	1638	CAGGTTTGCCTAGACAGCGT	41	B	166
541260	4776	4795	1641	1660	TCCAGGAGATGTAACTCTAA	45	B	167
541261	4798	4817	1663	1682	TAATATATCTCTGAACTAAT	87	B	168

TABLE 2
Reduction of DUX4 RNA by 5-10-5 MOE gapmers with uniform phosphorothioate internucleoside
linkages in differentiated 54-2 cells
	SEQ	SEQ
	ID	ID
	No:	No:
	3	3		DUX4		SEQ
Compound	Start	Stop		(%	Analysis	ID
Number	Site	Site	Sequence (5′ to 3′)	UTC)	ID	NO
541159	7314	7333	AGAGAGGCCACGGCCCTGCC	86	A	169
541175	7808	7827	AGCTCCGCGCTGGCAGCTGG	62	A	170
541236	7303	7322	GGCCCTGCCCCGAACCACCC	81	B	171
541253	7819	7838	TGACCGCCAGGAGCTCCGCG	68	B	172

Example 2: Effect of 3-10-3 cEt Uniform Phosphorothioate Modified Oligonucleotides on Human DUX4 RNA In Vitro, Single Dose

Modified oligonucleotides complementary to human DUX4 nucleic acid were designed and tested for their single dose effects on DUX4 RNA in vitro. The modified oligonucleotides were tested in a series of experiments that had the same culture conditions.

The modified oligonucleotides in the tables below are 3-10-3 cEt gapmers with uniform phosphorothioate internucleoside linkages. The gapmers are 16 nucleosides in length, wherein the central gap segment consists of ten 2′-β-D-deoxynucleosides, and wherein the 5′ and 3′ wing segments each consist of three cEt nucleosides. The sugar motif for the gapmers is (from 5′ to 3′): kkkddddddddddkkk; wherein each “d” represents a 2′-β-D-deoxyribosyl sugar moiety, and each “k” represents a cEt sugar moiety. The internucleoside linkage motif for the gapmers is (from 5′ to 3′): sssssssssssssss; wherein each “s” represents a phosphorothioate internucleoside linkage. Each cytosine residue is a 5-methylcytosine.

“Stat site” indicates the 5′-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. “Stop site” indicates the 3′-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. Each modified oligonucleotide listed in the tables below is 100% complementary to SEQ ID NO: 1 (described herein above), to SEQ ID NO: 2 (described herein above), to SEQ ID NO: 3 (described herein above), or to any combination of these SEQ ID NOs. “N/A” indicates that the modified oligonucleotide is not 100% complementary to that particular target nucleic acid sequence.

54-2 cells plated at a density of 10,000 cells per well, were differentiated as described herein above, and were treated with modified oligonucleotide at a concentration of 100 nM using cytofectin. After a treatment period of approximately 24 hours, total RNA was isolated from the cells and DUX4 RNA levels were measured by quantitative real-time RTPCR. DUX4 RNA levels were measured by human primer-probe set RTS3502 (described herein in Example 1). DUX4 RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Reduction of DUX4 RNA is presented in the tables below as percent DUX4 RNA relative to the amount of DUX4 RNA in untreated control cells (% UTC). The values marked with an “t” indicate that the modified oligonucleotide is complementary to the amplicon region of the primer probe set. Additional assays may be used to measure the potency and efficacy of the modified oligonucleotides complementary to the amplicon region.

Each separate experimental analysis described in this example is identified by a letter ID from C through H in the table column labeled “Analysis ID”.

In the tables below, Compound No. 541114 (described herein above) was used as a benchmark.

TABLE 3
Reduction of DUX4 RNA by 3-10-3 cEt gapmers with uniform phosphorothioate internucleoside
linkages in differentiated 54-2 cells
	SEQ	SEQ	SEQ	SEQ
	ID	ID	ID	ID
	No: 1	No: 1	No: 2	No: 2				SEQ
Compound	Start	Stop	Start	Stop		DUX4 (%	Analysis	ID
Number	Site	Site	Site	Site	Sequence (5′ to 3′)	UTC)	ID	NO
541114	2830	2849	57	76	AAACGAGTCTCCGTCGCCGT	69	C	28
613801	4276	4291	N/A	N/A	GGCCCACCTGCTGGTA	68	C	173
613802	4321	4336	N/A	N/A	CACAGCCCAGGCGGCT	76	C	174
613803	4365	4380	N/A	N/A	GGTGGGCTGGTGGAGA	106	C	175
613804	4460	4475	N/A	N/A	GTGTTTCGCGGGACGG	53	C	176
613805	4508	4523	N/A	N/A	AGGCGAGCCGCCGGAG	98	C	177
613822	2172	2187	N/A	N/A	CGTTGCCGGGACGGTC	115	C	178
613823	2232	2247	N/A	N/A	GGGAGTCTTGAGTGTG	78	C	179
613824	2292	2307	N/A	N/A	TCGGCAGCAGGGAGAA	124	C	180
613825	2322	2337	N/A	N/A	ACGGGAAGCCGCTCTC	90	C	181
613826	2416	2431	N/A	N/A	CGGAGAGACGAAGAGG	89	C	182
613827	2570	2585	N/A	N/A	AATGGCGGTGAGCCCC	100	C	183
613828	2622	2637	N/A	N/A	AGCCAGCCGCCCTTGT	91	C	184
613829	2669	2684	N/A	N/A	CGGCAGGTGCAGCCAG	115	C	185
613830	2739	2754	N/A	N/A	AATTTCACGGACGGAC	87	C	186
613831	2832	2847	59	74	ACGAGTCTCCGTCGCC	70	C	187
613832	2876	2891	103	118	GCTCAAAGCAGGCTCG	88	C	188
613833	2914	2929	141	156	CAGCCGTTCTCTGGTG	106	C	189
613834	2935	2950	162	177	CGGAATGCCGATGGCC	81	C	190
613835	3042	3057	269	284	CGGCCTTCTGGCGGGC	101	C	191
613836	3096	3111	323	338	AAGGCTCGGAGGAGCA	122	C	192
613837	3142	3157	369	384	GGCCAGCTCCTCCCGG	84	C	193
613838	3164	3179	391	406	ACTCCGGGAGGCCCGT	98	C	194
613839	3246	3261	473	488	AGGCCGCCTGCCTGCG	85	C	195
613840	3331	3346	558	573	GGGAAGCCCCGTTCCC	111	C	196
613841	3446	3461	673	688	AGATCCCCTCTGCCGG	77	C	197
613842	3505	3520	732	747	CCCGTCCGGAGGAGCC	104	C	198
613843	3553	3568	780	795	TTTGCCCGGGTGCGGA	86	C	199
613844	3611	3626	838	853	GTGCCACCGCGCAGGG	77	C	200
613845	3646	3661	873	888	TTGGCCCTGCGGCCCC	107	C	201
613846	3720	3735	947	962	GCCCCGGCGACCTGGG	108	C	202
613847	3816	3831	1043	1058	GGGATGCCTTGCATCT	88	C	203
613848	3882	3897	1109	1124	TCCAGCAGCAGGCCGC	89	C	204
613849	3936	3951	1163	1178	GTTTCTAGGAGAGGTT	79	C	205
613850	3988	4003	1215	1230	TGCTTCCAGCGAGGCG	100	C	206
613851	4051	4066	1278	1293	CCGTCCCAACCCCGCG	73	C	207
613853	4116	4131	1343	1358	CTCCGTAGCCAGCCAG	86	C	208
613854	4155	4170	1382	1397	CGGTCAGCCCGGTGGA	116	C	209
613855	4195	4210	1422	1437	CTCTCACCGGGCCTAG	69	C	210
613856	4239	4254	1466	1481	CCGGGATGCCCAGGAA	84	C	211
613857	4275	4290	N/A	N/A	GCCCACCTGCTGGTAC	115	C	212
613858	4311	4326	N/A	N/A	GCGGCTGCCCGCAAAC	110	C	213
613859	4332	4347	N/A	N/A	CGGGCTGCTCCCACAG	97	C	214
613860	4463	4478	N/A	N/A	CCGGTGTTTCGCGGGA	98	C	215
613862	4606	4621	N/A	N/A	ACAGAGGTATGCTTTT	113	C	216
613863	4647	4662	1512	1527	CGCACTGCGCGCAGGT	81	C	217
613864	4706	4721	1571	1586	TCACGGAAGAACAAGG	84†	C	218
613865	4755	4770	1620	1635	GTTTGCCTAGACAGCG	84	C	219
613866	4778	4793	1643	1658	CAGGAGATGTAACTCT	93	C	220
	6419	6434
613867	4826	4841	1691	1706	AGGATCCACAGGGAGG	72	C	221
613868	4876	4891	N/A	N/A	TATTGTGACATATCTC	110	C	222
	8835	8850
	10001	10016
613870	4975	4990	N/A	N/A	TAACCATTCTCTAGGT	100	C	223
613871	5026	5041	N/A	N/A	CTGTCTACACGAGAAT	93	C	224
613872	5096	5111	N/A	N/A	CTCTGCCTACAGGAGG	117	C	225
	11107	11122
613873	5148	5163	N/A	N/A	TTTGTGAGATATCTCT	104	C	226
613874	5181	5196	N/A	N/A	TGTAACCCTTGTCAAG	121	C	227
613875	5219	5234	N/A	N/A	GGCTTTGTGATATATA	84	C	228
613876	5273	5288	N/A	N/A	CTCTCCAATGCTCACT	125	C	229
613877	5316	5331	N/A	N/A	TAACACTTGTCTAAGC	119	C	230
613878	5378	5393	N/A	N/A	CTGTCTAGGTTCAGAC	89	C	231
541114	2830	2849	57	76	AAACGAGTCTCCGTCGCCGT	79	D	28
613879	4289	4304	N/A	N/A	GTGCGCAGTAGGCGGC	73	D	232
613880	4343	4358	N/A	N/A	AGAGCTCTGCCCGGGC	99	D	233
613881	4380	4395	N/A	N/A	GCGGTCAGGCGGCGGG	86	D	234
613882	4493	4508	N/A	N/A	GCGGTGTCAGGCCCGG	76	D	235
613883	4534	4549	N/A	N/A	GCGACGGTGGCGCGGG	89	D	236
613899	2158	2173	N/A	N/A	TCTCGCACACGCAGGC	157	D	237
613900	2207	2222	N/A	N/A	CTCTCCGTGAAGGAGG	126	D	238
613901	2251	2266	N/A	N/A	TGTGGAACTGAACCTC	100	D	239
613902	2308	2323	N/A	N/A	TCTGGGCTCCCACGCG	89	D	240
613903	2349	2364	N/A	N/A	CCGGACCTCTCCAGGG	100	D	241
613904	2533	2548	N/A	N/A	CCGGAAGGGACCCAGG	120	D	242
613905	2607	2622	N/A	N/A	TAAAGGCCCACAGGCA	115	D	243
613906	2647	2662	N/A	N/A	TGCCCGGACAGCCAGC	127	D	244
613907	2692	2707	N/A	N/A	CACCTCAGCCGGACTG	110	D	245
613908	2754	2769	N/A	N/A	GTGAGCCCCGGCCGGA	127	D	246
613909	2859	2874	86	101	AGGGCCTCGCTTTGGC	87	D	247
613910	2899	2914	126	141	GGCGATGCCCGGGTAC	74	D	248
613911	2921	2936	148	163	CCTGGGCCAGCCGTTC	84	D	249
613912	2997	3012	224	239	CGCCGGTGCTGCCTCA	83	D	250
613913	3073	3088	300	315	CTGGGATCCGGTGACG	74	D	251
613914	3122	3137	349	364	CGATGCCTGGAAAGCG	128	D	252
613915	3160	3175	387	402	CGGGAGGCCCGTCTCT	98	D	253
613916	3199	3214	426	441	GGCCCTTCGATTCTGA	82	D	254
613917	3303	3318	530	545	TGGGCGAAGGCGACCC	101	D	255
613918	3388	3403	615	630	CTGGCTCACGAAAGCC	111	D	256
613919	3480	3495	707	722	TAGGCGAAATCCCCGC	110	D	257
613920	N/A	N/A	761	776	CAGCGAGGAGCCTGAG	121	D	258
613921	3596	3611	823	838	GGCCCGGCAGGCCGTC	149	D	259
613922	3628	3643	855	870	TTGAGCGGGCCCAGGC	83	D	260
613923	3657	3672	884	899	GCAAGCACCCCTTGGC	91	D	261
613924	3748	3763	975	990	AGCTGCCCCGGCTTGG	85	D	262
613925	3860	3875	1087	1102	GTGCAGACCAGGGCGC	93	D	263
613926	3921	3936	1148	1163	TGCGCCTGCTGCAGAA	116	D	264
613927	3973	3988	1200	1215	GGCCTCTTCCGAGGCC	135	D	265
613928	4015	4030	1242	1257	AGCCCGGTATTCTTCC	111	D	266
613929	4066	4081	1293	1308	CCGAACCACCCGACCC	115	D	267
613930	4098	4113	1325	1340	GTTCCCCGCGAAAGAG	110	D	268
613931	4131	4146	1358	1373	GGCGGAGACACGCCCC	134	D	269
613932	4176	4191	1403	1418	TAGAAGGCAGGAATCC	132	D	270
613933	N/A	N/A	1451	1466	AAGAATGGCAGTTCTC	104	D	271
613934	4260	4275	1487	1502	CCTGGGCCGGCTCTGG	104	D	272
613935	4288	4303	N/A	N/A	TGCGCAGTAGGCGGCC	196	D	273
613936	4312	4327	N/A	N/A	GGCGGCTGCCCGCAAA	131	D	274
613937	4490	4505	N/A	N/A	GTGTCAGGCCCGGACG	108	D	275
613938	4600	4615	N/A	N/A	GTATGCTTTTGACCGC	107	D	276
613940	4684	4699	1549	1564	AGAGGCCAGCGAGCTC	76†	D	277
613941	4721	4736	1586	1601	CATTCAGCCAGAATTT	86†	D	278
613942	4770	4785	1635	1650	GTAACTCTAATCCAGG	57	D	279
613943	4802	4817	1667	1682	TAATATATCTCTGAAC	120	D	280
613944	4842	4857	N/A	N/A	GATGCAAATCTTCTAT	130	D	281
613946	4960	4975	N/A	N/A	TTCAGTCTACTATGGA	112	D	282
613947	4998	5013	N/A	N/A	CTACACTGATCACCTA	120	D	283
613948	5041	5056	N/A	N/A	ACAATTGTCTAGGCTC	96	D	284
613949	5111	5126	N/A	N/A	GAACACTTGCCTACAC	83	D	285
613950	5166	5181	N/A	N/A	GGTTTGGCTTATAGGG	121	D	286
613951	5207	5222	N/A	N/A	TATATTTCCACTGCTC	107	D	287
613952	5238	5253	N/A	N/A	CTGGGCTTTGTCTACA	108	D	288
613953	5284	5299	N/A	N/A	TTGTGACAGATCTCTC	124	D	289
613955	5394	5409	N/A	N/A	CAAGGTGATGTAACTC	145	D	290
613956	2764	2779	N/A	N/A	GGCCATCGCGGTGAGC	63	D	291
613910	2899	2914	126	141	GGCGATGCCCGGGTAC	32	E	248
1098874	4304	4319	N/A	N/A	CCCGCAAACCCGCGCG	51	E	292
1098878	4308	4323	N/A	N/A	GCTGCCCGCAAACCCG	46	E	293
1098882	4314	4329	N/A	N/A	CAGGCGGCTGCCCGCA	30	E	294
1098887	4382	4397	N/A	N/A	GGGCGGTCAGGCGGCG	51	E	295
1098891	4467	4482	N/A	N/A	GGGCCCGGTGTTTCGC	76	E	296
1098896	4495	4510	N/A	N/A	GAGCGGTGTCAGGCCC	41	E	297
1098900	4500	4515	N/A	N/A	CGCCGGAGCGGTGTCA	47	E	298
1098904	4504	4519	N/A	N/A	GAGCCGCCGGAGCGGT	32	E	299
1098908	4509	4524	N/A	N/A	GAGGCGAGCCGCCGGA	36	E	300
1098912	4513	4528	N/A	N/A	AGAGGAGGCGAGCCGC	25	E	301
1098916	4536	4551	N/A	N/A	GGGCGACGGTGGCGCG	46	E	302
1099049	2167	2182	N/A	N/A	CCGGGACGGTCTCGCA	80	E	303
1099053	2176	2191	N/A	N/A	TCGCCGTTGCCGGGAC	56	E	304
1099057	2214	2229	N/A	N/A	AGGCCCTCTCTCCGTG	61	E	305
1099061	2355	2370	N/A	N/A	GGCTCTCCGGACCTCT	50	E	306
1099065	2359	2374	N/A	N/A	GGCCGGCTCTCCGGAC	80	E	307
1099069	2538	2553	N/A	N/A	CCACCCCGGAAGGGAC	78	E	308
1099073	2543	2558	N/A	N/A	CCGCCCCACCCCGGAA	53	E	309
1099077	2560	2575	N/A	N/A	AGCCCCCCTGGGACAG	55	E	310
1099081	2566	2581	N/A	N/A	GCGGTGAGCCCCCCTG	35	E	311
1099085	2609	2624	N/A	N/A	TGTAAAGGCCCACAGG	83	E	312
1099089	2613	2628	N/A	N/A	CCCTTGTAAAGGCCCA	66	E	313
1099093	2617	2632	N/A	N/A	GCCGCCCTTGTAAAGG	83	E	314
1099097	2646	2661	N/A	N/A	GCCCGGACAGCCAGCC	45	E	315
1099101	2652	2667	N/A	N/A	AGGCCTGCCCGGACAG	58	E	316
1099105	2695	2710	N/A	N/A	GTGCACCTCAGCCGGA	60	E	317
1099109	2704	2719	N/A	N/A	CGGGCTCCCGTGCACC	33	E	318
1099113	2708	2723	N/A	N/A	CCGGCGGGCTCCCGTG	44	E	319
1099117	2713	2728	N/A	N/A	AGAGGCCGGCGGGCTC	37	E	320
1099121	2732	2747	N/A	N/A	CGGACGGACGCGGGCA	35	E	321
1099125	2752	2767	N/A	N/A	GAGCCCCGGCCGGAAT	75	E	322
1099129	2759	2774	N/A	N/A	TCGCGGTGAGCCCCGG	41	E	323
1099133	2763	2778	N/A	N/A	GCCATCGCGGTGAGCC	28	E	324
1099137	2768	2783	N/A	N/A	GGAGGGCCATCGCGGT	55	E	325
1099141	N/A	N/A	772	787	GGTGCGGAGGCCAGCG	39	E	326
1099149	4105	4120	1332	1347	GCCAGGTGTTCCCCGC	34	E	327
1099153	4192	4207	1419	1434	TCACCGGGCCTAGACC	36	E	328
1099169	4649	4664	1514	1529	TGCGCACTGCGCGCAG	112	E	329
1099174	4681	4696	1546	1561	GGCCAGCGAGCTCCCT	36†	E	330
1099178	4829	4844	1694	1709	TATAGGATCCACAGGG	38	E	331
1099182	4833	4848	N/A	N/A	CTTCTATAGGATCCAC	43	E	332
613910	2899	2914	126	141	GGCGATGCCCGGGTAC	34	F	248
1098875	4305	4320	N/A	N/A	GCCCGCAAACCCGCGC	47	F	333
1098879	4309	4324	N/A	N/A	GGCTGCCCGCAAACCC	43	F	334
1098883	4340	4355	N/A	N/A	GCTCTGCCCGGGCTGC	61	F	335
1098888	4464	4479	N/A	N/A	CCCGGTGTTTCGCGGG	53	F	336
1098892	4489	4504	N/A	N/A	TGTCAGGCCCGGACGC	41	F	337
1098897	4496	4511	N/A	N/A	GGAGCGGTGTCAGGCC	59	F	338
1098901	4501	4516	N/A	N/A	CCGCCGGAGCGGTGTC	42	F	339
1098905	4505	4520	N/A	N/A	CGAGCCGCCGGAGCGG	38	F	340
1098909	4510	4525	N/A	N/A	GGAGGCGAGCCGCCGG	33	F	341
1098913	4515	4530	N/A	N/A	GCAGAGGAGGCGAGCC	53	F	342
1098917	4537	4552	N/A	N/A	CGGGCGACGGTGGCGC	53	F	343
1099050	2173	2188	N/A	N/A	CCGTTGCCGGGACGGT	50	F	344
1099054	2177	2192	N/A	N/A	GTCGCCGTTGCCGGGA	57	F	345
1099058	2315	2330	N/A	N/A	GCCGCTCTCTGGGCTC	58	F	346
1099062	2356	2371	N/A	N/A	CGGCTCTCCGGACCTC	70	F	347
1099066	2360	2375	N/A	N/A	GGGCCGGCTCTCCGGA	96	F	348
1099070	2539	2554	N/A	N/A	CCCACCCCGGAAGGGA	90	F	349
1099074	2552	2567	N/A	N/A	TGGGACAGCCCGCCCC	95	F	350
1099078	2561	2576	N/A	N/A	GAGCCCCCCTGGGACA	60	F	351
1099082	2567	2582	N/A	N/A	GGCGGTGAGCCCCCCT	56	F	352
1099086	2610	2625	N/A	N/A	TTGTAAAGGCCCACAG	67	F	353
1099090	2614	2629	N/A	N/A	GCCCTTGTAAAGGCCC	80	F	354
1099094	2618	2633	N/A	N/A	AGCCGCCCTTGTAAAG	58	F	355
1099098	2649	2664	N/A	N/A	CCTGCCCGGACAGCCA	51	F	356
1099102	2653	2668	N/A	N/A	GAGGCCTGCCCGGACA	30	F	357
1099106	2696	2711	N/A	N/A	CGTGCACCTCAGCCGG	65	F	358
1099110	2705	2720	N/A	N/A	GCGGGCTCCCGTGCAC	34	F	359
1099114	2709	2724	N/A	N/A	GCCGGCGGGCTCCCGT	37	F	360
1099118	2715	2730	N/A	N/A	AGAGAGGCCGGCGGGC	39	F	361
1099122	2733	2748	N/A	N/A	ACGGACGGACGCGGGC	50	F	362
1099126	2753	2768	N/A	N/A	TGAGCCCCGGCCGGAA	34	F	363
1099130	2760	2775	N/A	N/A	ATCGCGGTGAGCCCCG	42	F	364
1099134	2765	2780	N/A	N/A	GGGCCATCGCGGTGAG	55	F	365
1099138	N/A	N/A	768	783	CGGAGGCCAGCGAGGA	29	F	366
1099150	4106	4121	1333	1348	AGCCAGGTGTTCCCCG	32	F	367
1099170	4650	4665	1515	1530	GTGCGCACTGCGCGCA	68	F	368
1099175	4682	4697	1547	1562	AGGCCAGCGAGCTCCC	18†	F	369
1099179	4830	4845	1695	1710	CTATAGGATCCACAGG	46	F	370
1099183	4834	4849	N/A	N/A	TCTTCTATAGGATCCA	35	F	371
613910	2899	2914	126	141	GGCGATGCCCGGGTAC	32	G	248
1098876	4306	4321	N/A	N/A	TGCCCGCAAACCCGCG	78	G	372
1098880	4310	4325	N/A	N/A	CGGCTGCCCGCAAACC	88	G	373
1098884	4341	4356	N/A	N/A	AGCTCTGCCCGGGCTG	128	G	374
1098889	4465	4480	N/A	N/A	GCCCGGTGTTTCGCGG	140	G	375
1098894	4492	4507	N/A	N/A	CGGTGTCAGGCCCGGA	42	G	376
1098898	4498	4513	N/A	N/A	CCGGAGCGGTGTCAGG	89	G	377
1098902	4502	4517	N/A	N/A	GCCGCCGGAGCGGTGT	151	G	378
1098906	4506	4521	N/A	N/A	GCGAGCCGCCGGAGCG	66	G	379
1098910	4511	4526	N/A	N/A	AGGAGGCGAGCCGCCG	57	G	380
1098914	4518	4533	N/A	N/A	GGCGCAGAGGAGGCGA	74	G	381
1098918	4538	4553	N/A	N/A	GCGGGCGACGGTGGCG	103	G	382
1098923	4581	4596	N/A	N/A	GCGCTCCGTGCTGGCA	142	G	383
1099051	2174	2189	N/A	N/A	GCCGTTGCCGGGACGG	74	G	384
1099055	2178	2193	N/A	N/A	CGTCGCCGTTGCCGGG	88	G	385
1099059	2341	2356	N/A	N/A	CTCCAGGGATCCCGCG	147	G	386
1099063	2357	2372	N/A	N/A	CCGGCTCTCCGGACCT	88	G	387
1099067	2534	2549	N/A	N/A	CCCGGAAGGGACCCAG	84	G	388
1099071	2541	2556	N/A	N/A	GCCCCACCCCGGAAGG	168	G	389
1099075	2553	2568	N/A	N/A	CTGGGACAGCCCGCCC	94	G	390
1099079	2562	2577	N/A	N/A	TGAGCCCCCCTGGGAC	150	G	391
1099083	2568	2583	N/A	N/A	TGGCGGTGAGCCCCCC	98	G	392
1099087	2611	2626	N/A	N/A	CTTGTAAAGGCCCACA	106	G	393
1099091	2615	2630	N/A	N/A	CGCCCTTGTAAAGGCC	132	G	394
1099095	2619	2634	N/A	N/A	CAGCCGCCCTTGTAAA	96	G	395
1099099	2650	2665	N/A	N/A	GCCTGCCCGGACAGCC	65	G	396
1099103	2675	2690	N/A	N/A	GCACTGCGGCAGGTGC	87	G	397
1099107	2697	2712	N/A	N/A	CCGTGCACCTCAGCCG	33	G	398
1099111	2706	2721	N/A	N/A	GGCGGGCTCCCGTGCA	73	G	399
1099115	2711	2726	N/A	N/A	AGGCCGGCGGGCTCCC	63	G	400
1099119	2716	2731	N/A	N/A	GAGAGAGGCCGGCGGG	120	G	401
1099123	2750	2765	N/A	N/A	GCCCCGGCCGGAATTT	64	G	402
1099127	2755	2770	N/A	N/A	GGTGAGCCCCGGCCGG	71	G	403
1099131	2761	2776	N/A	N/A	CATCGCGGTGAGCCCC	75	G	404
1099135	2766	2781	N/A	N/A	AGGGCCATCGCGGTGA	76	G	405
1099139	N/A	N/A	770	785	TGCGGAGGCCAGCGAG	47	G	406
1099147	4103	4118	1330	1345	CAGGTGTTCCCCGCGA	49	G	407
1099151	4114	4129	1341	1356	CCGTAGCCAGCCAGGT	48	G	408
1099167	4646	4661	1511	1526	GCACTGCGCGCAGGTC	81	G	409
1099172	4652	4667	1517	1532	GGGTGCGCACTGCGCG	91†	G	410
1099176	4683	4698	1548	1563	GAGGCCAGCGAGCTCC	57†	G	411
1099180	4831	4846	N/A	N/A	TCTATAGGATCCACAG	56	G	412
1099184	4835	4850	N/A	N/A	ATCTTCTATAGGATCC	39	G	413
613910	2899	2914	126	141	GGCGATGCCCGGGTAC	37	H	248
1098877	4307	4322	N/A	N/A	CTGCCCGCAAACCCGC	37	H	414
1098881	4313	4328	N/A	N/A	AGGCGGCTGCCCGCAA	31	H	415
1098886	4344	4359	N/A	N/A	GAGAGCTCTGCCCGGG	78	H	416
1098890	4466	4481	N/A	N/A	GGCCCGGTGTTTCGCG	77	H	417
1098895	4494	4509	N/A	N/A	AGCGGTGTCAGGCCCG	30	H	418
1098899	4499	4514	N/A	N/A	GCCGGAGCGGTGTCAG	60	H	419
1098903	4503	4518	N/A	N/A	AGCCGCCGGAGCGGTG	56	H	420
1098907	4507	4522	N/A	N/A	GGCGAGCCGCCGGAGC	33	H	421
1098911	4512	4527	N/A	N/A	GAGGAGGCGAGCCGCC	37	H	422
1098915	4535	4550	N/A	N/A	GGCGACGGTGGCGCGG	39	H	423
1099052	2175	2190	N/A	N/A	CGCCGTTGCCGGGACG	56	H	424
1099056	2213	2228	N/A	N/A	GGCCCTCTCTCCGTGA	83	H	425
1099060	2354	2369	N/A	N/A	GCTCTCCGGACCTCTC	73	H	426
1099064	2358	2373	N/A	N/A	GCCGGCTCTCCGGACC	61	H	427
1099068	2535	2550	N/A	N/A	CCCCGGAAGGGACCCA	62	H	428
1099072	2542	2557	N/A	N/A	CGCCCCACCCCGGAAG	77	H	429
1099076	2554	2569	N/A	N/A	CCTGGGACAGCCCGCC	41	H	430
1099080	2565	2580	N/A	N/A	CGGTGAGCCCCCCTGG	36	H	431
1099084	2569	2584	N/A	N/A	ATGGCGGTGAGCCCCC	56	H	432
1099088	2612	2627	N/A	N/A	CCTTGTAAAGGCCCAC	62	H	433
1099092	2616	2631	N/A	N/A	CCGCCCTTGTAAAGGC	81	H	434
1099096	2621	2636	N/A	N/A	GCCAGCCGCCCTTGTA	44	H	435
1099100	2651	2666	N/A	N/A	GGCCTGCCCGGACAGC	52	H	436
1099104	2693	2708	N/A	N/A	GCACCTCAGCCGGACT	39	H	437
1099108	2698	2713	N/A	N/A	CCCGTGCACCTCAGCC	32	H	438
1099112	2707	2722	N/A	N/A	CGGCGGGCTCCCGTGC	48	H	439
1099116	2712	2727	N/A	N/A	GAGGCCGGCGGGCTCC	37	H	440
1099120	2731	2746	N/A	N/A	GGACGGACGCGGGCAG	49	H	441
1099124	2751	2766	N/A	N/A	AGCCCCGGCCGGAATT	44	H	442
1099128	2756	2771	N/A	N/A	CGGTGAGCCCCGGCCG	42	H	443
1099132	2762	2777	N/A	N/A	CCATCGCGGTGAGCCC	32	H	444
1099136	2767	2782	N/A	N/A	GAGGGCCATCGCGGTG	56	H	445
1099140	N/A	N/A	771	786	GTGCGGAGGCCAGCGA	26	H	446
1099148	4104	4119	1331	1346	CCAGGTGTTCCCCGCG	32	H	447
1099152	4191	4206	1418	1433	CACCGGGCCTAGACCT	59	H	448
1099168	4648	4663	1513	1528	GCGCACTGCGCGCAGG	68	H	449
1099173	4680	4695	1545	1560	GCCAGCGAGCTCCCTT	10†	H	450
1099177	4828	4843	1693	1708	ATAGGATCCACAGGGA	55	H	451
1099181	4832	4847	N/A	N/A	TTCTATAGGATCCACA	45	H	452
1099185	4836	4851	N/A	N/A	AATCTTCTATAGGATC	85	H	453

TABLE 4
Reduction of DUX4 RNA by 3-10-3 cEt gapmers with uniform phosphorothioate internucleoside
linkages in differentiated 54-2 cells
	SEQ	SEQ
	ID	ID
	No: 3	No: 3				SEQ
Compound	Start	Stop		DUX4	Analysis	ID
Number	Site	Site	Sequence (5′ to 3′)	(% UTC)	ID	NO
613806	1208	1223	GGCACCTGGGCGGCTG	90	C	454
	4504	4519
613807	1256	1271	TGTGCGCCGGGCCTGG	70	C	455
	4552	4567
613808	1332	1347	CGCCCCTCTAGGTCTC	82	C	456
	4628	4643
613809	1366	1381	TCCCTCCCTCCTAACG	93	C	457
	4662	4677
613810	1441	1456	GGCTCCCTCCCGCCCG	128	C	458
	4737	4752
613811	1533	1548	CGCTGACCGTTTTCCC	97	C	459
	4826	4841
613812	4887	4902	ATGGGTGGTGCCCCGC	110	C	460
613813	1630	1645	AGGAAACCGCCCACTC	117	C	461
	4926	4941
613814	1693	1708	GCGGTCTGTGAACCGC	115	C	462
	4989	5004
613815	1733	1748	TCGGCCTCGCGCCGCG	123	C	463
	5029	5044
613816	1796	1811	CCACGCGGAAACCAAA	96	C	464
	5092	5107
613817	1856	1871	TGGCCAGCCTTTCGGG	96	C	465
	5152	5167
613818	1921	1936	CGGGCTTGCACCCTTC	111	C	466
	5217	5232
613819	1969	1984	GCAGTGTGGCCGGTTT	95	C	467
	5265	5280
613820	2031	2046	AGATGCCTCCCCGGCG	122	C	468
	5327	5342
613821	2060	2075	TAGAAGACCAGAGCGA	118	C	469
	5356	5371
613852	7318	7333	AGAGAGGCCACGGCCC	95	C	470
613861	7808	7823	CCGCGCTGGCAGCTGG	110	C	471
613869	8156	8171	TGATCACCGAAGTTAT	115	C	472
613884	1232	1247	TTCCGCCGCCAGGCGC	100	D	473
	4528	4543
613885	1302	1317	ATCTCTGCCCGCCTTC	77	D	474
	4598	4613
613886	1347	1362	CTCCGCCCGTCCTTCC	58	D	475
	4643	4658
613887	1403	1418	GTCTTTCCCTCCGTTC	81	D	476
	4699	4714
613888	1494	1509	CCGGAGGCCGAGGACC	91	D	477
	4787	4802
613889	1569	1584	CGGCGGCTGTGGGCCC	145	D	478
	4862	4877
613890	4910	4925	CCTGGGCCCCGGAACC	147	D	479
613891	1661	1676	CGGCAACCCGAGTCCC	152	D	480
	4957	4972
613892	5013	5028	TTGCAGGGCTGAGCCT	148	D	481
613893	1753	1768	CTCCTCCGTGGCCGGG	125	D	482
	5049	5064
613894	1825	1840	AGCAACAGGCCGCCTT	106	D	483
	5121	5136
613895	1878	1893	CTCCGGGAGCAAACAG	77	D	484
	5174	5189
613896	1954	1969	TGGAACCTGGCAAGGA	109	D	485
	5250	5265
613897	2006	2021	GACGATGGATTCCCGC	132	D	486
	5302	5317
613898	2047	2062	CGAGACCCCAGAGAGG	133	D	487
	5343	5358
613945	8141	8156	TGTAAACCAATTTCAG	120	D	488
613954	8585	8600	GTTTTGACATATCTCT	105	D	489
1098920	1209	1224	TGGCACCTGGGCGGCT	52	E	490
	4505	4520
1098925	1234	1249	CGTTCCGCCGCCAGGC	61	E	491
	4530	4545
1098929	1260	1275	CCGGTGTGCGCCGGGC	54	E	492
	4556	4571
1098933	1264	1279	GTCCCCGGTGTGCGCC	46	E	493
	4560	4575
1098937	1305	1320	TCCATCTCTGCCCGCC	42	E	494
	4601	4616
1098941	1333	1348	CCGCCCCTCTAGGTCT	35	E	495
	4629	4644
1098945	1339	1354	GTCCTTCCGCCCCTCT	70	E	496
	4635	4650
1098950	1344	1359	CGCCCGTCCTTCCGCC	45	E	497
	4640	4655
1098954	1349	1364	CCCTCCGCCCGTCCTT	70	E	498
	4645	4660
1098958	4746	4761	CCGTCCCCCGGCTCCC	63	E	499
1098962	1491	1506	GAGGCCGAGGACCGCT	49	E	500
	4784	4799
1098966	1500	1515	CTACTCCCGGAGGCCG	39	E	501
	4793	4808
1098970	1505	1520	TCCCGCTACTCCCGGA	64	E	502
	4798	4813
1098974	1546	1561	AGCCCGCGCCGGACGC	48	E	503
	4839	4854
1098979	1552	1567	GCCCTCAGCCCGCGCC	129	E	504
	4845	4860
1098983	1571	1586	CGCGGCGGCTGTGGGC	90	E	505
	4864	4879
1098987	1575	1590	CCGGCGCGGCGGCTGT	53	E	506
	4868	4883
1098992	4885	4900	GGGTGGTGCCCCGCCG	64	E	507
1098996	4911	4926	CCCTGGGCCCCGGAAC	44	E	508
1099000	1656	1671	ACCCGAGTCCCGGTCT	69	E	509
	4952	4967
1099004	1667	1682	ACCCGACGGCAACCCG	62	E	510
	4963	4978
1099008	1735	1750	TGTCGGCCTCGCGCCG	49	E	511
	5031	5046
1099012	1739	1754	GGGCTGTCGGCCTCGC	63	E	512
	5035	5050
1099016	1815	1830	CGCCTTGCGGAGGGCA	48	E	513
	5111	5126
1099020	1819	1834	AGGCCGCCTTGCGGAG	46	E	514
	5115	5130
1099024	1884	1899	GCAGAGCTCCGGGAGC	80	E	515
	5180	5195
1099028	1889	1904	TGCCCGCAGAGCTCCG	56	E	516
	5185	5200
1099033	1894	1909	CCGGGTGCCCGCAGAG	63	E	517
	5190	5205
1099037	1898	1913	GTTTCCGGGTGCCCGC	42	E	518
	5194	5209
1099041	5222	5237	CGTGCCGGGCTTGCAC	89	E	519
1099045	5229	5244	AAGGCACCGTGCCGGG	61	E	520
1099145	7315	7330	GAGGCCACGGCCCTGC	45	E	521
1099157	7811	7826	GCTCCGCGCTGGCAGC	46	E	522
1099161	7815	7830	AGGAGCTCCGCGCTGG	68	E	523
1099165	7819	7834	CGCCAGGAGCTCCGCG	41	E	524
1098922	1219	1234	CGCTCCGTGCTGGCAC	45	F	525
	4515	4530
1098926	1257	1272	GTGTGCGCCGGGCCTG	60	F	526
	4553	4568
1098930	1261	1276	CCCGGTGTGCGCCGGG	58	F	527
	4557	4572
1098934	1265	1280	CGTCCCCGGTGTGCGC	51	F	528
	4561	4576
1098938	1329	1344	CCCTCTAGGTCTCCCG	55	F	529
	4625	4640
1098942	1334	1349	TCCGCCCCTCTAGGTC	75	F	530
	4630	4645
1098946	1340	1355	CGTCCTTCCGCCCCTC	63	F	531
	4636	4651
1098951	1345	1360	CCGCCCGTCCTTCCGC	58	F	532
	4641	4656
1098955	1351	1366	GTCCCTCCGCCCGTCC	60	F	533
	4647	4662
1098959	4747	4762	CCCGTCCCCCGGCTCC	89	F	534
1098963	1493	1508	CGGAGGCCGAGGACCG	44	F	535
	4786	4801
1098967	1501	1516	GCTACTCCCGGAGGCC	57	F	536
	4794	4809
1098971	1506	1521	GTCCCGCTACTCCCGG	52	F	537
	4799	4814
1098975	1548	1563	TCAGCCCGCGCCGGAC	66	F	538
	4841	4856
1098980	1553	1568	AGCCCTCAGCCCGCGC	91	F	539
	4846	4861
1098984	1572	1587	GCGCGGCGGCTGTGGG	105	F	540
	4865	4880
1098988	4881	4896	GGTGCCCCGCCGGCCG	89	F	541
1098993	4886	4901	TGGGTGGTGCCCCGCC	48	F	542
1098997	4912	4927	TCCCTGGGCCCCGGAA	53	F	543
1099001	1659	1674	GCAACCCGAGTCCCGG	77	F	544
	4955	4970
1099005	4964	4979	GACCCGACGGCAACCC	86	F	545
1099009	1736	1751	CTGTCGGCCTCGCGCC	32	F	546
	5032	5047
1099013	1754	1769	GCTCCTCCGTGGCCGG	73	F	547
	5050	5065
1099017	1816	1831	CCGCCTTGCGGAGGGC	73	F	548
	5112	5127
1099021	1820	1835	CAGGCCGCCTTGCGGA	59	F	549
	5116	5131
1099025	1886	1901	CCGCAGAGCTCCGGGA	80	F	550
	5182	5197
1099029	1890	1905	GTGCCCGCAGAGCTCC	65	F	551
	5186	5201
1099034	1895	1910	TCCGGGTGCCCGCAGA	57	F	552
	5191	5206
1099038	1923	1938	GCCGGGCTTGCACCCT	66	F	553
	5219	5234
1099042	5223	5238	CCGTGCCGGGCTTGCA	43	F	554
1099046	5230	5245	GAAGGCACCGTGCCGG	91	F	555
1099142	7307	7322	GGCCCTGCCCCGAACC	51	F	556
1099146	7316	7331	AGAGGCCACGGCCCTG	47	F	557
1099154	7807	7822	CGCGCTGGCAGCTGGG	79	F	558
1099158	7812	7827	AGCTCCGCGCTGGCAG	54	F	559
1099162	7816	7831	CAGGAGCTCCGCGCTG	68	F	560
1099166	7822	7837	GACCGCCAGGAGCTCC	49	F	561
1098927	1258	1273	GGTGTGCGCCGGGCCT	107	G	562
	4554	4569
1098931	1262	1277	CCCCGGTGTGCGCCGG	105	G	563
	4558	4573
1098935	1285	1300	CTCCCGCCTGGAACGC	89	G	564
	4581	4596
1098939	1330	1345	CCCCTCTAGGTCTCCC	69	G	565
	4626	4641
1098943	1335	1350	TTCCGCCCCTCTAGGT	80	G	566
	4631	4646
1098947	1341	1356	CCGTCCTTCCGCCCCT	63	G	567
	4637	4652
1098952	1346	1361	TCCGCCCGTCCTTCCG	76	G	568
	4642	4657
1098956	1352	1367	CGTCCCTCCGCCCGTC	100	G	569
	4648	4663
1098960	4748	4763	CCCCGTCCCCCGGCTC	70	G	570
1098964	1495	1510	CCCGGAGGCCGAGGAC	72	G	571
	4788	4803
1098968	1502	1517	CGCTACTCCCGGAGGC	73	G	572
	4795	4810
1098972	1507	1522	GGTCCCGCTACTCCCG	97	G	573
	4800	4815
1098976	1549	1564	CTCAGCCCGCGCCGGA	64	G	574
	4842	4857
1098981	1554	1569	CAGCCCTCAGCCCGCG	154	G	575
	4847	4862
1098985	1573	1588	GGCGCGGCGGCTGTGG	128	G	576
	4866	4881
1098989	4882	4897	TGGTGCCCCGCCGGCC	91	G	577
1098994	4908	4923	TGGGCCCCGGAACCGG	118	G	578
1098998	1635	1650	CCCGGAGGAAACCGCC	149	G	579
	4931	4946
1099002	1660	1675	GGCAACCCGAGTCCCG	64	G	580
	4956	4971
1099006	4975	4990	GCGCGGGTGAAGACCC	167	G	581
1099010	1737	1752	GCTGTCGGCCTCGCGC	63	G	582
	5033	5048
1099014	1755	1770	GGCTCCTCCGTGGCCG	112	G	583
	5051	5066
1099018	1817	1832	GCCGCCTTGCGGAGGG	101	G	584
	5113	5128
1099022	1821	1836	ACAGGCCGCCTTGCGG	64	G	585
	5117	5132
1099026	1887	1902	CCCGCAGAGCTCCGGG	183	G	586
	5183	5198
1099031	1892	1907	GGGTGCCCGCAGAGCT	110	G	587
	5188	5203
1099035	1896	1911	TTCCGGGTGCCCGCAG	108	G	588
	5192	5207
1099039	1924	1939	TGCCGGGCTTGCACCC	105	G	589
	5220	5235
1099043	5224	5239	ACCGTGCCGGGCTTGC	60	G	590
1099047	5232	5247	GCGAAGGCACCGTGCC	112	G	591
1099143	7308	7323	CGGCCCTGCCCCGAAC	120	G	592
1099155	7809	7824	TCCGCGCTGGCAGCTG	94	G	593
1099159	7813	7828	GAGCTCCGCGCTGGCA	103	G	594
1099163	7817	7832	CCAGGAGCTCCGCGCT	87	G	595
1098919	1207	1222	GCACCTGGGCGGCTGC	84	H	596
	4503	4518
1098924	1233	1248	GTTCCGCCGCCAGGCG	78	H	597
	4529	4544
1098928	1259	1274	CGGTGTGCGCCGGGCC	78	H	598
	4555	4570
1098932	1263	1278	TCCCCGGTGTGCGCCG	59	H	599
	4559	4574
1098936	1286	1301	CCTCCCGCCTGGAACG	77	H	600
	4582	4597
1098940	1331	1346	GCCCCTCTAGGTCTCC	68	H	601
	4627	4642
1098944	1338	1353	TCCTTCCGCCCCTCTA	63	H	602
	4634	4649
1098949	1343	1358	GCCCGTCCTTCCGCCC	46	H	603
	4639	4654
1098953	1348	1363	CCTCCGCCCGTCCTTC	68	H	604
	4644	4659
1098957	4745	4760	CGTCCCCCGGCTCCCT	69	H	605
1098961	4749	4764	CCCCCGTCCCCCGGCT	79	H	606
1098965	1499	1514	TACTCCCGGAGGCCGA	60	H	607
	4792	4807
1098969	1504	1519	CCCGCTACTCCCGGAG	58	H	608
	4797	4812
1098973	1508	1523	GGGTCCCGCTACTCCC	84	H	609
	4801	4816
1098977	1550	1565	CCTCAGCCCGCGCCGG	61	H	610
	4843	4858
1098982	1570	1585	GCGGCGGCTGTGGGCC	75	H	611
	4863	4878
1098986	1574	1589	CGGCGCGGCGGCTGTG	49	H	612
	4867	4882
1098990	4883	4898	GTGGTGCCCCGCCGGC	65	H	613
1098995	4909	4924	CTGGGCCCCGGAACCG	67	H	614
1098999	1655	1670	CCCGAGTCCCGGTCTT	61	H	615
	4951	4966
1099003	1666	1681	CCCGACGGCAACCCGA	51	H	616
	4962	4977
1099007	1734	1749	GTCGGCCTCGCGCCGC	76	H	617
	5030	5045
1099011	1738	1753	GGCTGTCGGCCTCGCG	90	H	618
	5034	5049
1099015	1760	1775	CGTGTGGCTCCTCCGT	24	H	619
	5056	5071
1099019	1818	1833	GGCCGCCTTGCGGAGG	73	H	620
	5114	5129
1099023	1863	1878	GTCGGCATGGCCAGCC	113	H	621
	5159	5174
1099027	1888	1903	GCCCGCAGAGCTCCGG	87	H	622
	5184	5199
1099032	1893	1908	CGGGTGCCCGCAGAGC	91	H	623
	5189	5204
1099036	1897	1912	TTTCCGGGTGCCCGCA	41	H	62
	5193	5208
1099040	5221	5236	GTGCCGGGCTTGCACC	81	H	625
1099044	5226	5241	GCACCGTGCCGGGCTT	60	H	626
1099048	2034	2049	AGGAGATGCCTCCCCG	46	H	627
	5330	5345
1099144	7309	7324	ACGGCCCTGCCCCGAA	93	H	628
1099156	7810	7825	CTCCGCGCTGGCAGCT	47	H	629
1099160	7814	7829	GGAGCTCCGCGCTGGC	82	H	630
1099164	7818	7833	GCCAGGAGCTCCGCGC	59	H	631

Example 3: Dose-Dependent Inhibition of Human DUX4 in 54-2 Cells by Modified Oligonucleotides

Modified oligonucleotides selected from the examples above were tested at various doses in 54-2 cells (described herein above). 54-2 cells plated at a density of 6,000 cells per well were differentiated (as described herein above) and treated using cytofectin with various concentrations of modified oligonucleotide as specified in the table below. After a treatment period of approximately 24 hours, total RNA was isolated from the cells and DUX4 RNA levels were measured by quantitative real-time RTPCR. Human DUX4 primer-probe set RTS3502 (described herein above) was used to measure RNA levels as described above. DUX4 RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Reduction of DUX4 RNA is presented in the table below as percent DUX4 RNA, relative to the amount of DUX4 RNA in untreated control cells (% UTC).

The half maximal inhibitory concentration (IC₅₀) of each modified oligonucleotide was calculated using a linear regression on a log/linear plot of the data in Excel and is also presented in the table below.

TABLE 5
Dose-dependent reduction of human DUX4 RNA
in 54-2 cells by modified oligonucleotides
	DUX4 RNA (% UTC)
Compound	18.75	37.5	75.0	150.0	300.0	IC50
No.	nM	nM	nM	nM	nM	(μM)
541109	104	103	88	63	36	0.23
541114	101	100	71	44	17	0.13
541117	89	85	77	62	28	0.18
541135	87	88	81	62	33	0.21
541146	114	96	90	60	35	0.21
541170	124	120	98	79	51	>0.3
541176	104	100	83	40	20	0.14
541200	100	113	81	56	36	0.21
541204	88	76	62	43	30	0.12
541205	80	80	65	46	29	0.12
541222	90	95	63	39	29	0.13
541255	134	111	108	87	59	>0.3
541259	116	111	89	44	29	0.17
541260	100	95	90	42	18	0.14

Example 4: Dose-Dependent Inhibition of Human DUX4 in 54-2 Cells by Modified Oligonucleotides

Modified oligonucleotides selected from the examples above were tested at various doses in 54-2 cells (described herein above). 54-2 cells plated at a density of 10,000 cells per well, were differentiated (as described herein above) and treated using cytofectin with various concentrations of modified oligonucleotide as specified in the tables below. After a treatment period of approximately 24 hours, total RNA was isolated from the cells and DUX4 RNA levels were measured by quantitative real-time RTPCR. Human DUX4 primer-probe set RTS3502 (described herein above) was used to measure RNA levels as described above. DUX4 RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Reduction of DUX4 RNA is presented in the tables below as percent DUX4 RNA relative to the amount of DUX4 RNA in untreated control cells (% UTC). The modified oligonucleotides were tested in a series of experiments that had the same culture conditions, and the results for each experiment are presented in separate tables below.

The half maximal inhibitory concentration (IC₅₀) of each modified oligonucleotide was calculated using a linear regression on a log/linear plot of the data in Excel and is also presented in the tables below.

TABLE 6
Dose-dependent reduction of human DUX4 RNA
in 54-2 cells by modified oligonucleotides
	DUX4 RNA (% UTC)
Compound	25.0	50.0	100.0	200.0	400.0	IC50
No.	nM	nM	nM	nM	nM	(μM)
541114	83	62	69	42	20	0.13
613801	98	98	74	52	28	0.21
613802	99	78	93	56	58	>0.4
613804	70	59	51	33	23	0.08
613807	90	91	68	54	25	0.19
613823	102	102	93	75	43	>0.4
613831	75	55	46	21	15	0.07
613834	89	69	67	50	31	0.18
613841	97	65	50	35	17	0.11
613844	96	80	50	49	26	0.15
613849	93	87	77	62	29	0.24
613851	72	59	53	46	31	0.12
613855	90	69	59	40	24	0.13
613867	76	74	59	48	23	0.14

TABLE 7
Dose-dependent reduction of human DUX4 RNA
in 54-2 cells by modified oligonucleotides
	DUX4 RNA (% UTC)
Compound	25.0	50.0	100.0	200.0	400.0	IC50
No.	nM	nM	nM	nM	nM	(μM)
541114	82	64	77	46	31	0.18
613879	94	79	62	56	28	0.18
613882	90	86	96	68	30	0.34
613885	67	82	80	39	27	0.16
613886	96	67	58	61	33	0.20
613887	90	64	57	45	34	0.15
613895	78	85	82	66	51	>0.4
613910	79	89	46	45	13	0.12
613913	85	94	75	61	36	0.29
613916	101	69	60	56	41	0.22
613922	90	66	69	49	45	0.25
613942	40	41	31	28	13	<0.025
613949	118	77	92	79	52	>0.4
613956	91	81	70	48	42	0.24

TABLE 8
Dose-dependent reduction of human DUX4 RNA
in 54-2 cells by modified oligonucleotides
Compound	DUX4 RNA (% UTC)	IC50
No.	19 nM	56 nM	167 nM	500 nM	(μM)
613910	65	38	21	15	0.04
1098882	80	50	19	8	0.06
1098904	99	52	20	7	0.08
1098909	83	68	63	77	>0.5
1098912	47	25	13	9	<0.02
1098941	40	28	13	13	<0.02
1099009	74	59	22	6	0.06
1099081	63	37	20	11	0.03
1099102	64	43	28	22	0.04
1099109	104	64	22	12	0.10
1099110	78	55	39	33	0.11
1099121	64	48	34	26	0.05
1099126	79	43	18	7	0.05
1099133	70	54	27	15	0.06
1099138	69	38	15	7	0.04
1099149	92	44	19	9	0.07
1099150	72	36	19	9	0.04
1099183	86	51	18	11	0.07

TABLE 9
Dose-dependent reduction of human DUX4 RNA
in 54-2 cells by modified oligonucleotides
Compound	DUX4 RNA (% UTC)	IC50
No.	19 nM	56 nM	167 nM	500 nM	(μM)
1098881	80	71	31	10	0.09
1098894	111	81	19	6	0.11
1098895	65	45	23	13	0.04
1098907	82	58	21	7	0.07
1098910	61	40	17	8	0.03
1099015	68	45	16	6	0.04
1099043	40	24	8	4	<0.02
1099080	118	82	25	13	0.13
1099107	42	24	10	4	<0.02
1099108	67	62	26	10	0.06
1099132	69	61	31	9	0.07
1099139	152	90	15	5	0.13
1099140	57	33	15	8	0.02
1099147	151	64	18	8	0.13
1099148	60	39	31	18	0.03
1099151	163	92	20	5	0.14
1099180	95	38	16	9	0.06
1099184	76	54	20	11	0.06

Example 5: Design of a Modified Oligonucleotides Complementary to a Human DUX4 Nucleic Acid

A modified oligonucleotide complementary to a human DUX4 nucleic acid was designed, as described in the table below.

The modified oligonucleotide in Table 10 is a 3-10-3 cEt gapmer conjugated to a 6-palmitamidohexyl conjugate moiety attached to the 5′-OH of the oligonucleotide through a phosphodiester linker. The structure for the conjugate group is:

The gapmer is 16 nucleosides in length, wherein the central gap segment consists of ten 2′-β-D-deoxynucleosides and the 5′ and 3′ wings each consists of three cEt nucleosides. The sugar motif for the gapmer is (from 5′ to 3′): kkkddddddddddkkk; wherein ‘d’ represents a 2′-β-D-deoxyribosyl sugar moiety; and ‘k’ represents a cEt sugar moiety. Each internucleoside linkages is a phosphorothioate internucleoside linkage. Each cytosine residue is a 5-methylcytosine.

“Start site” indicates the 5′-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. “Stop site” indicates the 3′-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. The modified oligonucleotide listed in the table below is 100% complementary to SEQ ID NO: 1 (described herein above), and to SEQ ID NO: 2 (described herein above).

TABLE 10
6-Palmitamidohexyl conjugated 3-10-3 cEt gapmer with PS internucleoside linkages complementary
to human DUX4
		SEQ	SEQ	SEQ	SEQ
		ID	ID	ID	ID
		NO:	NO:	NO:	NO:
		1	1	2	2		SEQ
Compound	Parent	Start	Stop	Start	Stop		ID
ID	Compound	Site	Site	Site	Site	Sequence (5′ to 3′)	NO
941806	613910	2899	2914	126	141	GGCGATGCCCGGGTAC	248

Example 6: Activity of Modified Oligonucleotides Complementary to Human DUX4 in Transgenic Mice

Transgenic mice expressing human DUX4 were used to test activity of modified oligonucleotides described above. The transgenic mouse model was developed using random integration of a linearized modified human DUX4 gene. The clone was digested at AseI and XhoI restriction sites to produce a region containing Mck (muscle specific) promoter driven human DUX4 transgene with a single amino acid mutation of F67A. The gene fragment was introduced into fertilized eggs from C57BL6NJ strain mice by pronuclear injection to produce 7 founder lines. Line 9111 was used in the experiments described herein. Human DUX4 RNA expression is found in the muscle in this model.

Treatment

Each animal in a group of 4 transgenic mice was administered 50 mg/kg of Compound No. 941806 by subcutaneous injection twice a week for a total of six injections. A group of 4 mice received PBS as a negative control.

RNA Analysis

Mice were sacrificed 72 hours after the final dose, and RNA was extracted from the quadriceps muscle, transverse abdominal muscle (TA), and gastrocnemius muscle for RTPCR analysis to measure amount of DUX4 RNA using human primer probe set RTS3502 (described herein above). Results are presented as percent human DUX4 RNA relative to PBS control, normalized to mouse GAPDH (% control). Mouse GAPDH RNA was amplified using mouse prime probe set mGapdh_LTS00102 (forward sequence GGCAAATTCAACGGCACAGT, designated herein as SEQ ID NO: 14; reverse sequence GGGTCTCGCTCCTGGAAGAT, designated herein as SEQ ID NO: 15; probe sequence AAGGCCGAGAATGGGAAGCTTGTCATC, designated herein as SEQ ID NO: 16).

TABLE 11
Reduction of human DUX4 RNA in transgenic mice
	Compound	DUX4 RNA (% control)
	ID	Quadriceps	TA	Gastrocnemius
	PBS	100	100	100
	941806	17	32	25

Example 7: Effect of 3-10-3 cEt Modified Oligonucleotides with Uniform Phosphorothioate Internucleoside Linkages on Human DUX4 RNA In Vitro, Single Dose

Modified oligonucleotides complementary to human DUX4 nucleic acid were designed and tested for their single dose effects on human DUX4 RNA in vitro. The modified oligonucleotides were tested in a series of experiments that had the same culture conditions.

The modified oligonucleotides in the table below are 3-10-3 cET modified oligonucleotides with uniform phosphorothioate internucleoside linkages. The modified oligonucleotides are 16 nucleosides in length. The sugar motif for the modified oligonucleotides is (from 5′ to 3′): kkkddddddddddkkk; wherein each “d” represents a 2′-β-D-deoxyribosyl sugar moiety, and each “k” represents a cEt modified sugar moiety. The internucleoside linkage motif for the modified oligonucleotides is (from 5′ to 3′): sssssssssssssss; wherein each “s” represents a phosphorothioate internucleoside linkage. Each cytosine residue is a 5-methylcytosine. “Start site” indicates the 5′-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. “Stop site” indicates the 3′-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. Each modified oligonucleotide listed in the tables below is 100% complementary to one or more of the following SEQ ID NOs: SEQ ID NO: 1 (described herein above), to SEQ ID NO: 2 (describe herein above), to SEQ ID NO: 3 (described herein above). “N/A” indicates that the modified oligonucleotide is not 100% complementary to that particular target nucleic acid sequence.

54-2 cells plated at a density of 10,000 cells per well, were differentiated as described herein above, and were treated with modified oligonucleotide at a concentration of 200 nM using cytofectin. After a treatment period of approximately 24 hours, total RNA was isolated from the cells and human DUX4 RNA levels were measured by quantitative real-time RTPCR. Human DUX4 RNA levels were measured by probe set RTS40199 (forward sequence CTCTCTGTGCCCTTGTTCTT, designated herein as SEQ ID NO: 17; reverse sequence CATCCAGGAGATGTAACTCTAATCC, designated herein as SEQ ID NO: 18; probe sequence CCTTCCGACGCTGTCTAGGCAAA, designated herein as SEQ ID NO: 19). Human DUX4 RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Reduction of human DUX4 RNA is presented in the tables below as percent DUX4 RNA relative to the amount of DUX4 RNA in untreated control cells (% UTC). The values marked with a “t” indicate that the modified oligonucleotide is complementary to the amplicon region of the primer probe set. Additional assays may be used to measure the potency and efficacy of the modified oligonucleotides complementary to the amplicon region. “N.D.” in the tables below refers to instances where the value was Not Defined.

Each separate experiment described in this example is identified by an Assay Identification letter in the table column labeled “Analysis ID”.

TABLE 12
Reduction of human DUX4 RNA by 3-10-3 cEt modified oligonucleotides with uniform phosphorothioate
internucleoside linkages in differentiated 54-2 cells
	SEQ ID	SEQ ID	SEQ ID	SEQ ID
	NO: 1	NO: 1	NO: 2	NO: 2		DUX4		SEQ
Compound	Start	Stop	Start	Stop		(%	Analysis	ID
No.	Site	Site	Site	Site	Sequence (5′ to 3′)	UTC)	ID	NO
1098912	4513	4528	N/A	N/A	AGAGGAGGCGAGCCGC	25	I	301
1582463	4841	4856	N/A	N/A	ATGCAAATCTTCTATA	55	I	632
1582480	3632	3647	859	874	CCGCTTGAGCGGGCCC	28	I	633
1582486	3639	3654	866	881	TGCGGCCCCGCTTGAG	39	I	634
1582493	3658	3673	885	900	CGCAAGCACCCCTTGG	22	I	635
1582496	2718	2733	N/A	N/A	CAGAGAGAGGCCGGCG	38	I	636
1582500	3684	3699	911	926	CACGGACTCCCCTGGG	39	I	637
1582506	3721	3736	948	963	CGCCCCGGCGACCTGG	66	I	638
1582513	3727	3742	954	969	CCACGCCGCCCCGGCG	66	I	639
1582519	2729	2744	N/A	N/A	ACGGACGCGGGCAGAG	79	I	640
1582525	3793	3808	1020	1035	CCGCGCGGAGGCGGAG	57	I	641
1582531	3820	3835	1047	1062	CGCCGGGATGCCTTGC	29	I	642
1582539	3847	3862	1074	1089	CGCCGGCTCCTGGAGC	73	I	643
1582546	3857	3872	1084	1099	CAGACCAGGGCGCCGG	35	I	644
1582549	2740	2755	N/A	N/A	GAATTTCACGGACGGA	22	I	645
1582555	3898	3913	1125	1140	GCTCGCCAGGAGCTCA	20	I	646
1582562	3909	3924	1136	1151	AGAAACTCCGGGCTCG	16	I	647
1582570	3931	3946	1158	1173	TAGGAGAGGTTGCGCC	53	I	648
1582576	3938	3953	1165	1180	CCGTTTCTAGGAGAGG	25	I	649
1582579	2747	2762	N/A	N/A	CCGGCCGGAATTTCAC	46	I	650
1582586	3982	3997	1209	1224	CAGCGAGGCGGCCTCT	20	I	651
1582592	4012	4027	1239	1254	CCGGTATTCTTCCTCG	35	I	652
1582598	4021	4036	1248	1263	CAGCAGAGCCCGGTAT	17	I	653
1582610	N/A	N/A	1440	1455	TTCTCCGCGGTGTGGA	54	I	654
1582617	2809	2824	36	51	TCCCCGGGCTTCCGCG	59	I	655
1582628	4602	4617	N/A	N/A	AGGTATGCTTTTGACC	38	I	656
1582634	4622	4637	N/A	N/A	AAGCGGGCAAAGACAG	35	I	657
1582646	4671	4686	1536	1551	CTCCCTTGCACGTCAG	20	I	658
1582652	4703	4718	1568	1583	CGGAAGAACAAGGGCA	11†	I	659
1582658	4710	4725	1575	1590	AATTTCACGGAAGAAC	19†	I	660
1582664	4717	4732	1582	1597	CAGCCAGAATTTCACG	15	I	661
1582671	4748	4763	1613	1628	TAGACAGCGTCGGAAG	12†	I	662
1582677	4764	4779	1629	1644	CTAATCCAGGTTTGCC	5†	I	663
1582683	4771	4786	1636	1651	TGTAACTCTAATCCAG	10	I	664
1582689	4780	4795	1645	1660	TCCAGGAGATGTAACT	12	I	665
1582695	4788	4803	1653	1668	ACTAATCATCCAGGAG	11	I	666
1582701	4794	4809	1659	1674	CTCTGAACTAATCATC	21	I	667
1582704	2835	2850	62	77	CAAACGAGTCTCCGTC	18	I	668
1582710	2865	2880	92	107	GCTCGCAGGGCCTCGC	21	I	669
1582716	2877	2892	104	119	CGCTCAAAGCAGGCTC	47	I	670
1582722	2897	2912	124	139	CGATGCCCGGGTACGG	11	I	671
1582729	2934	2949	161	176	GGAATGCCGATGGCCT	22	I	672
1582735	2955	2970	182	197	CAAATCTGGACCCTGG	20	I	673
1582741	2980	2995	207	222	CTGGCGTGACCTCTCA	24	I	674
1582747	3008	3023	235	250	GCCGAGATTCCCGCCG	65	I	675
1582753	3033	3048	260	275	GGCGGGCCGCGTCTCC	65	I	676
1582759	3068	3083	295	310	ATCCGGTGACGGCGGT	24	I	677
1582765	3097	3112	324	339	AAAGGCTCGGAGGAGC	29	I	678
1582771	3104	3119	331	346	CCTTCTCAAAGGCTCG	13	I	679
1582777	3115	3130	342	357	TGGAAAGCGATCCTTC	20	I	680
1582783	3121	3136	348	363	GATGCCTGGAAAGCGA	20	I	681
1582789	3132	3147	359	374	TCCCGGGCGGCGATGC	69	I	682
1582795	3162	3177	389	404	TCCGGGAGGCCCGTCT	40	I	683
1582801	3176	3191	403	418	TCTGAATCCTGGACTC	11	I	684
1582807	3221	3236	448	463	TGCCACCCTGTCCCGG	43	I	685
1582813	3235	3250	462	477	CTGCGCGGGCGCCCTG	61	I	686
1582819	3260	3275	487	502	GGGCCGCGCTGCACAG	32	I	687
1582825	3294	3309	521	536	GCGACCCACGAGGGAG	47	I	688
1582831	3300	3315	527	542	GCGAAGGCGACCCACG	24	I	689
1582837	3313	3328	540	555	CGCGCCGGTGTGGGCG	50	I	690
1582843	3320	3335	547	562	TTCCCCACGCGCCGGT	24	I	691
1582850	3333	3348	560	575	GCGGGAAGCCCCGTTC	69	I	692
1582853	2686	2701	N/A	N/A	AGCCGGACTGTGCACT	45	I	693
1582858	3355	3370	582	597	AGGCGCGCAGGGCACG	20	I	694
1582864	3362	3377	589	604	GAGCCCCAGGCGCGCA	20	I	695
1582870	3379	3394	606	621	GAAAGCCCCCTGTGGG	44	I	696
1582877	3385	3400	612	627	GCTCACGAAAGCCCCC	16	I	697
1582883	3445	3460	672	687	GATCCCCTCTGCCGGC	88	I	698
1582890	3475	3490	702	717	GAAATCCCCGCGCGCC	33	I	699
1582896	3483	3498	710	725	GCGTAGGCGAAATCCC	26	I	700
1582902	3502	3517	729	744	GTCCGGAGGAGCCGGG	28	I	701
1582908	3509	3524	736	751	GCGCCCCGTCCGGAGG	55	I	702
1582914	3549	3564	776	791	CCCGGGTGCGGAGGCC	74	I	703
1582920	3577	3592	804	819	CTGCGGGTCCCGGTCC	38	I	704
1582927	3597	3612	824	839	GGGCCCGGCAGGCCGT	81	I	705
1098912	4513	4528	N/A	N/A	AGAGGAGGCGAGCCGC	27	J	301
1582462	4840	4855	N/A	N/A	TGCAAATCTTCTATAG	55	J	706
1582479	3631	3646	858	873	CGCTTGAGCGGGCCCA	78	J	707
1582484	3638	3653	865	880	GCGGCCCCGCTTGAGC	44	J	708
1582489	2717	2732	N/A	N/A	AGAGAGAGGCCGGCGG	43	J	709
1582492	3656	3671	883	898	CAAGCACCCCTTGGCC	37	J	710
1582499	3683	3698	910	925	ACGGACTCCCCTGGGA	52	J	711
1582505	3692	3707	919	934	AGCCCCACCACGGACT	20	J	712
1582512	3726	3741	953	968	CACGCCGCCCCGGCGA	58	J	713
1582518	2728	2743	N/A	N/A	CGGACGCGGGCAGAGA	37	J	714
1582524	3792	3807	1019	1034	CGCGCGGAGGCGGAGG	70	J	715
1582530	3818	3833	1045	1060	CCGGGATGCCTTGCAT	52	J	716
1582538	3842	3857	1069	1084	GCTCCTGGAGCGCCTG	35	J	717
1582545	3856	3871	1083	1098	AGACCAGGGCGCCGGC	48	J	718
1582548	2738	2753	N/A	N/A	ATTTCACGGACGGACG	12	J	719
1582554	3897	3912	1124	1139	CTCGCCAGGAGCTCAT	13	J	720
1582561	3908	3923	1135	1150	GAAACTCCGGGCTCGC	15	J	721
1582569	3929	3944	1156	1171	GGAGAGGTTGCGCCTG	18	J	722
1582575	3937	3952	1164	1179	CGTTTCTAGGAGAGGT	64	J	723
1582578	2746	2761	N/A	N/A	CGGCCGGAATTTCACG	63	J	724
1582585	3981	3996	1208	1223	AGCGAGGCGGCCTCTT	14	J	725
1582591	4011	4026	1238	1253	CGGTATTCTTCCTCGC	10	J	726
1582597	4019	4034	1246	1261	GCAGAGCCCGGTATTC	22	J	727
1582609	N/A	N/A	1439	1454	TCTCCGCGGTGTGGAG	57	J	728
1582616	2808	2823	35	50	CCCCGGGCTTCCGCGG	69	J	729
1582627	4598	4613	N/A	N/A	ATGCTTTTGACCGCCA	17	J	730
1582633	4621	4636	N/A	N/A	AGCGGGCAAAGACAGA	17	J	731
1582645	4666	4681	1531	1546	TTGCACGTCAGCCGGG	96	J	732
1582651	4688	4703	1553	1568	ACAGAGAGGCCAGCGA	17†	J	733
1582657	4709	4724	1574	1589	ATTTCACGGAAGAACA	13†	J	734
1582663	4716	4731	1581	1596	AGCCAGAATTTCACGG	7	J	735
1582670	4747	4762	1612	1627	AGACAGCGTCGGAAGG	8†	J	736
1582676	4763	4778	1628	1643	TAATCCAGGTTTGCCT	8	J	737
1582682	4769	4784	1634	1649	TAACTCTAATCCAGGT	18	J	738
1582688	4776	4791	1641	1656	GGAGATGTAACTCTAA	11	J	739
1582694	4787	4802	1652	1667	CTAATCATCCAGGAGA	10†	J	740
1582700	4793	4808	1658	1673	TCTGAACTAATCATCC	19†	J	741
1582703	2834	2849	61	76	AAACGAGTCTCCGTCG	13	J	742
1582709	2864	2879	91	106	CTCGCAGGGCCTCGCT	31	J	743
1582715	2875	2890	102	117	CTCAAAGCAGGCTCGC	23	J	744
1582721	2887	2902	114	129	GTACGGGTTCCGCTCA	46	J	745
1582728	2933	2948	160	175	GAATGCCGATGGCCTG	16	J	746
1582734	2953	2968	180	195	AATCTGGACCCTGGGC	27	J	747
1582740	2960	2975	187	202	GAAACCAAATCTGGAC	12	J	748
1582746	3003	3018	230	245	GATTCCCGCCGGTGCT	14	J	749
1582752	3028	3043	255	270	GCCGCGTCTCCCGGGC	51	J	750
1582758	3061	3076	288	303	GACGGCGGTCCGCTTT	14	J	751
1582764	3093	3108	320	335	GCTCGGAGGAGCAGGG	29	J	752
1582770	3102	3117	329	344	TTCTCAAAGGCTCGGA	16	J	753
1582776	3114	3129	341	356	GGAAAGCGATCCTTCT	35	J	754
1582782	3120	3135	347	362	ATGCCTGGAAAGCGAT	28	J	755
1582788	3131	3146	358	373	CCCGGGCGGCGATGCC	90	J	756
1582794	3161	3176	388	403	CCGGGAGGCCCGTCTC	47	J	757
1582800	3175	3190	402	417	CTGAATCCTGGACTCC	6	J	758
1582806	3212	3227	439	454	GTCCCGGGTGCCTGGC	45	J	759
1582812	3234	3249	461	476	TGCGCGGGCGCCCTGC	74	J	760
1582818	3259	3274	486	501	GGCCGCGCTGCACAGG	56	J	761
1582824	3293	3308	520	535	CGACCCACGAGGGAGC	36	J	762
1582830	3299	3314	526	541	CGAAGGCGACCCACGA	28	J	763
1582836	3312	3327	539	554	GCGCCGGTGTGGGCGA	45	J	764
1582842	3318	3333	545	560	CCCCACGCGCCGGTGT	20	J	765
1582844	2684	2699	N/A	N/A	CCGGACTGTGCACTGC	61	J	766
1582849	3332	3347	559	574	CGGGAAGCCCCGTTCC	54	J	767
1582857	3354	3369	581	596	GGCGCGCAGGGCACGT	46	J	768
1582863	3361	3376	588	603	AGCCCCAGGCGCGCAG	23	J	769
1582869	3378	3393	605	620	AAAGCCCCCTGTGGGA	45	J	770
1582876	3384	3399	611	626	CTCACGAAAGCCCCCT	15	J	771
1582882	3436	3451	663	678	TGCCGGCGCGGCCTGG	50	J	772
1582889	3474	3489	701	716	AAATCCCCGCGCGCCG	35	J	773
1582895	3482	3497	709	724	CGTAGGCGAAATCCCC	17	J	774
1582901	3488	3503	715	730	GGGCGGCGTAGGCGAA	56	J	775
1582907	3508	3523	735	750	CGCCCCGTCCGGAGGA	19	J	776
1582913	N/A	N/A	769	784	GCGGAGGCCAGCGAGG	36	J	777
1582919	3562	3577	789	804	CTCCCGGCTTTTGCCC	31	J	778
1582926	3595	3610	822	837	GCCCGGCAGGCCGTCG	78	J	779
1098912	4513	4528	N/A	N/A	AGAGGAGGCGAGCCGC	20	K	301
1582461	4839	4854	N/A	N/A	GCAAATCTTCTATAGG	37	K	780
1582478	3629	3644	856	871	CTTGAGCGGGCCCAGG	20	K	781
1582485	3636	3651	863	878	GGCCCCGCTTGAGCGG	132	K	782
1582491	3654	3669	881	896	AGCACCCCTTGGCCCT	22	K	783
1582498	3680	3695	907	922	GACTCCCCTGGGACGT	22	K	784
1582504	3688	3703	915	930	CCACCACGGACTCCCC	29	K	785
1582511	3725	3740	952	967	ACGCCGCCCCGGCGAC	39	K	786
1582517	2727	2742	N/A	N/A	GGACGCGGGCAGAGAG	58	K	787
1582523	3787	3802	1014	1029	GGAGGCGGAGGCGTCC	32	K	788
1582529	3800	3815	1027	1042	GCCCCTGCCGCGCGGA	26	K	789
1582537	3841	3856	1068	1083	CTCCTGGAGCGCCTGG	19	K	790
1582543	2737	2752	N/A	N/A	TTTCACGGACGGACGC	17	K	791
1582544	3855	3870	1082	1097	GACCAGGGCGCCGGCT	21	K	792
1582553	3896	3911	1123	1138	TCGCCAGGAGCTCATC	21	K	793
1582560	3907	3922	1134	1149	AAACTCCGGGCTCGCC	20	K	794
1582567	3913	3928	1140	1155	CTGCAGAAACTCCGGG	39	K	795
1582568	2744	2759	N/A	N/A	GCCGGAATTTCACGGA	13	K	796
1582574	3935	3950	1162	1177	TTTCTAGGAGAGGTTG	20	K	797
1582583	3970	3985	1197	1212	CTCTTCCGAGGCCTCC	22	K	798
1582590	4008	4023	1235	1250	TATTCTTCCTCGCTGA	17	K	799
1582596	4017	4032	1244	1259	AGAGCCCGGTATTCTT	16	K	800
1582608	N/A	N/A	1438	1453	CTCCGCGGTGTGGAGT	60	K	801
1582612	2784	2799	11	26	CTGTCCGAGGGTGTCG	18	K	802
1582626	4597	4612	N/A	N/A	TGCTTTTGACCGCCAG	26	K	803
1582632	4620	4635	N/A	N/A	GCGGGCAAAGACAGAC	40	K	804
1582644	4643	4658	N/A	N/A	CTGCGCGCAGGTCTAG	74	K	805
1582650	4686	4701	1551	1566	AGAGAGGCCAGCGAGC	7†	K	806
1582656	4708	4723	1573	1588	TTTCACGGAAGAACAA	12†	K	807
1582662	4715	4730	1580	1595	GCCAGAATTTCACGGA	10†	K	808
1582669	4745	4760	1610	1625	ACAGCGTCGGAAGGTG	8†	K	809
1582675	4752	4767	1617	1632	TGCCTAGACAGCGTCG	5†	K	810
1582681	4768	4783	1633	1648	AACTCTAATCCAGGTT	13	K	811
1582687	4775	4790	1640	1655	GAGATGTAACTCTAAT	19	K	812
1582693	4786	4801	1651	1666	TAATCATCCAGGAGAT	15	K	813
1582699	4792	4807	1657	1672	CTGAACTAATCATCCA	12	K	814
1582702	2833	2848	60	75	AACGAGTCTCCGTCGC	17	K	815
1582708	2863	2878	90	105	TCGCAGGGCCTCGCTT	37	K	816
1582714	2874	2889	101	116	TCAAAGCAGGCTCGCA	37	K	817
1582720	2886	2901	113	128	TACGGGTTCCGCTCAA	17	K	818
1582724	2644	2659	N/A	N/A	CCGGACAGCCAGCCAG	42	K	819
1582727	2932	2947	159	174	AATGCCGATGGCCTGG	18	K	820
1582733	2939	2954	166	181	GCTCCGGAATGCCGAT	19	K	821
1582739	2959	2974	186	201	AAACCAAATCTGGACC	26	K	822
1582745	3001	3016	228	243	TTCCCGCCGGTGCTGC	19	K	823
1582751	3013	3028	240	255	CCAGGGCCGAGATTCC	27	K	824
1582757	3060	3075	287	302	ACGGCGGTCCGCTTTC	22	K	825
1582763	3091	3106	318	333	TCGGAGGAGCAGGGCG	29	K	826
1582769	3101	3116	328	343	TCTCAAAGGCTCGGAG	21	K	827
1582775	3113	3128	340	355	GAAAGCGATCCTTCTC	18	K	828
1582781	3119	3134	346	361	TGCCTGGAAAGCGATC	18	K	829
1582787	3130	3145	357	372	CCGGGCGGCGATGCCT	22	K	830
1582793	3157	3172	384	399	GAGGCCCGTCTCTCTG	23	K	831
1582799	3173	3188	400	415	GAATCCTGGACTCCGG	21	K	832
1582805	3211	3226	438	453	TCCCGGGTGCCTGGCC	58	K	833
1582811	3233	3248	460	475	GCGCGGGCGCCCTGCC	20	K	834
1582817	3258	3273	485	500	GCCGCGCTGCACAGGC	22	K	835
1582823	3292	3307	519	534	GACCCACGAGGGAGCA	26	K	836
1582829	3298	3313	525	540	GAAGGCGACCCACGAG	29	K	837
1582835	3311	3326	538	553	CGCCGGTGTGGGCGAA	33	K	838
1582841	3317	3332	544	559	CCCACGCGCCGGTGTG	17	K	839
1582848	3329	3344	556	571	GAAGCCCCGTTCCCCA	38	K	840
1582856	3353	3368	580	595	GCGCGCAGGGCACGTG	47	K	841
1582862	3360	3375	587	602	GCCCCAGGCGCGCAGG	44	K	842
1582868	3377	3392	604	619	AAGCCCCCTGTGGGAG	22	K	843
1582875	3383	3398	610	625	TCACGAAAGCCCCCTG	16	K	844
1582881	3435	3450	662	677	GCCGGCGCGGCCTGGC	29	K	845
1582888	3473	3488	700	715	AATCCCCGCGCGCCGG	23	K	846
1582894	3479	3494	706	721	AGGCGAAATCCCCGCG	23	K	847
1582900	3487	3502	714	729	GGCGGCGTAGGCGAAA	27	K	848
1582906	3507	3522	734	749	GCCCCGTCCGGAGGAG	23	K	849
1582912	3516	3531	743	758	TGGGAGAGCGCCCCGT	26	K	850
1582918	3560	3575	787	802	CCCGGCTTTTGCCCGG	81	K	851
1582921	2710	2725	N/A	N/A	GGCCGGCGGGCTCCCG	48	K	852
1582925	3594	3609	821	836	CCCGGCAGGCCGTCGC	21	K	853
1098912	4513	4528	N/A	N/A	AGAGGAGGCGAGCCGC	29	L	301
1582460	4838	4853	N/A	N/A	CAAATCTTCTATAGGA	50	L	854
1582466	4517	4532	N/A	N/A	GCGCAGAGGAGGCGAG	95	L	855
1582469	2575	2590	N/A	N/A	TCATGAATGGCGGTGA	45	L	856
1582472	2699	2714	N/A	N/A	TCCCGTGCACCTCAGC	30	L	857
1582477	3626	3641	853	868	GAGCGGGCCCAGGCTG	47	L	858
1582483	3635	3650	862	877	GCCCCGCTTGAGCGGG	66	L	859
1582490	3653	3668	880	895	GCACCCCTTGGCCCTG	30	L	860
1582497	3678	3693	905	920	CTCCCCTGGGACGTGG	31	L	861
1582503	3687	3702	914	929	CACCACGGACTCCCCT	27	L	862
1582510	3724	3739	951	966	CGCCGCCCCGGCGACC	40	L	863
1582516	2726	2741	N/A	N/A	GACGCGGGCAGAGAGA	11	L	864
1582522	3786	3801	1013	1028	GAGGCGGAGGCGTCCG	40	L	865
1582528	3796	3811	1023	1038	CTGCCGCGCGGAGGCG	21	L	866
1582535	2735	2750	N/A	N/A	TCACGGACGGACGCGG	23	L	867
1582536	3838	3853	1065	1080	CTGGAGCGCCTGGGAG	52	L	868
1582542	3851	3866	1078	1093	AGGGCGCCGGCTCCTG	30	L	869
1582552	3895	3910	1122	1137	CGCCAGGAGCTCATCC	26	L	870
1582559	3906	3921	1133	1148	AACTCCGGGCTCGCCA	38	L	871
1582565	3912	3927	1139	1154	TGCAGAAACTCCGGGC	45	L	872
1582566	2743	2758	N/A	N/A	CCGGAATTTCACGGAC	20	L	873
1582573	3934	3949	1161	1176	TTCTAGGAGAGGTTGC	18	L	874
1582582	3967	3982	1194	1209	TTCCGAGGCCTCCAGC	39	L	875
1582589	4007	4022	1234	1249	ATTCTTCCTCGCTGAG	22	L	876
1582595	4016	4031	1243	1258	GAGCCCGGTATTCTTC	15	L	877
1582601	4033	4048	1260	1275	CTAAAGCTCCTCCAGC	31	L	878
1582607	N/A	N/A	1436	1451	CCGCGGTGTGGAGTCT	58	L	879
1582611	2783	2798	10	25	TGTCCGAGGGTGTCGG	17	L	880
1582625	4596	4611	N/A	N/A	GCTTTTGACCGCCAGG	17	L	881
1582631	4609	4624	N/A	N/A	CAGACAGAGGTATGCT	23	L	882
1582649	4679	4694	1544	1559	CCAGCGAGCTCCCTTG	23	L	883
1582655	4707	4722	1572	1587	TTCACGGAAGAACAAG	12	L	884
1582661	4714	4729	1579	1594	CCAGAATTTCACGGAA	15†	L	885
1582666	2826	2841	53	68	CTCCGTCGCCGTCCTC	28	L	886
1582668	4744	4759	1609	1624	CAGCGTCGGAAGGTGG	10†	L	887
1582674	4751	4766	1616	1631	GCCTAGACAGCGTCGG	2†	L	888
1582680	4767	4782	1632	1647	ACTCTAATCCAGGTTT	9†	L	889
1582686	4774	4789	1639	1654	AGATGTAACTCTAATC	13†	L	890
1582692	4783	4798	1648	1663	TCATCCAGGAGATGTA	23†	L	891
1582698	4791	4806	1656	1671	TGAACTAATCATCCAG	14†	L	892
1582707	2838	2853	65	80	GTCCAAACGAGTCTCC	41	L	893
1582713	2873	2888	100	115	CAAAGCAGGCTCGCAG	43	L	894
1582719	2885	2900	112	127	ACGGGTTCCGCTCAAA	25	L	895
1582726	2931	2946	158	173	ATGCCGATGGCCTGGG	20	L	896
1582732	2938	2953	165	180	CTCCGGAATGCCGATG	20	L	897
1582738	2958	2973	185	200	AACCAAATCTGGACCC	26	L	898
1582744	3000	3015	227	242	TCCCGCCGGTGCTGCC	22	L	899
1582750	3012	3027	239	254	CAGGGCCGAGATTCCC	28	L	900
1582756	3051	3066	278	293	CGCTTTCGCCGGCCTT	18	L	901
1582762	3088	3103	315	330	GAGGAGCAGGGCGGTC	76	L	902
1582768	3100	3115	327	342	CTCAAAGGCTCGGAGG	27	L	903
1582774	3112	3127	339	354	AAAGCGATCCTTCTCA	25	L	904
1582780	3118	3133	345	360	GCCTGGAAAGCGATCC	28	L	905
1582786	3128	3143	355	370	GGGCGGCGATGCCTGG	25	L	906
1582792	3135	3150	362	377	TCCTCCCGGGCGGCGA	78	L	907
1582798	3171	3186	398	413	ATCCTGGACTCCGGGA	46	L	908
1582804	3198	3213	425	440	GCCCTTCGATTCTGAA	24	L	909
1582810	3232	3247	459	474	CGCGGGCGCCCTGCCA	37	L	910
1582816	3257	3272	484	499	CCGCGCTGCACAGGCC	29	L	911
1582822	3291	3306	518	533	ACCCACGAGGGAGCAG	34	L	912
1582828	3297	3312	524	539	AAGGCGACCCACGAGG	16	L	913
1582834	3304	3319	531	546	GTGGGCGAAGGCGACC	78	L	914
1582840	3316	3331	543	558	CCACGCGCCGGTGTGG	55	L	915
1582847	3328	3343	555	570	AAGCCCCGTTCCCCAC	33	L	916
1582854	3352	3367	579	594	CGCGCAGGGCACGTGG	67	L	917
1582861	3359	3374	586	601	CCCCAGGCGCGCAGGG	54	L	918
1582867	3376	3391	603	618	AGCCCCCTGTGGGAGA	39	L	919
1582873	3382	3397	609	624	CACGAAAGCCCCCTGT	24	L	920
1582880	3434	3449	661	676	CCGGCGCGGCCTGGCT	51	L	921
1582886	3472	3487	699	714	ATCCCCGCGCGCCGGG	50	L	922
1582893	3478	3493	705	720	GGCGAAATCCCCGCGC	47	L	923
1582899	3486	3501	713	728	GCGGCGTAGGCGAAAT	28	L	924
1582905	3506	3521	733	748	CCCCGTCCGGAGGAGC	21	L	925
1582911	3514	3529	741	756	GGAGAGCGCCCCGTCC	23	L	926
1582917	3556	3571	783	798	GCTTTTGCCCGGGTGC	34	L	927
1582924	3593	3608	820	835	CCGGCAGGCCGTCGCG	61	L	928
1098912	4513	4528	N/A	N/A	AGAGGAGGCGAGCCGC	20	M	301
1582465	4516	4531	N/A	N/A	CGCAGAGGAGGCGAGC	43	M	929
1582468	2574	2589	N/A	N/A	CATGAATGGCGGTGAG	68	M	930
1582471	2690	2705	N/A	N/A	CCTCAGCCGGACTGTG	35	M	931
1582474	4837	4852	N/A	N/A	AAATCTTCTATAGGAT	55	M	932
1582476	3625	3640	852	867	AGCGGGCCCAGGCTGT	56	M	933
1582482	3634	3649	861	876	CCCCGCTTGAGCGGGC	120	M	934
1582488	3650	3665	877	892	CCCCTTGGCCCTGCGG	27	M	935
1582495	3660	3675	887	902	GGCGCAAGCACCCCTT	17	M	936
1582502	3686	3701	913	928	ACCACGGACTCCCCTG	16	M	937
1582509	3723	3738	950	965	GCCGCCCCGGCGACCT	25	M	938
1582515	2725	2740	N/A	N/A	ACGCGGGCAGAGAGAG	33	M	939
1582521	3785	3800	1012	1027	AGGCGGAGGCGTCCGG	39	M	940
1582527	3795	3810	1022	1037	TGCCGCGCGGAGGCGG	20	M	941
1582533	3822	3837	1049	1064	GGCGCCGGGATGCCTT	45	M	942
1582534	2734	2749	N/A	N/A	CACGGACGGACGCGGG	33	M	943
1582541	3849	3864	1076	1091	GGCGCCGGCTCCTGGA	58	M	944
1582550	3883	3898	1110	1125	ATCCAGCAGCAGGCCG	20	M	945
1582557	2742	2757	N/A	N/A	CGGAATTTCACGGACG	13	M	946
1582558	3904	3919	1131	1146	CTCCGGGCTCGCCAGG	24	M	947
1582564	3911	3926	1138	1153	GCAGAAACTCCGGGCT	29	M	948
1582572	3933	3948	1160	1175	TCTAGGAGAGGTTGCG	27	M	949
1582581	3966	3981	1193	1208	TCCGAGGCCTCCAGCT	49	M	950
1582584	2749	2764	N/A	N/A	CCCCGGCCGGAATTTC	37	M	951
1582588	3985	4000	1212	1227	TTCCAGCGAGGCGGCC	26	M	952
1582594	4014	4029	1241	1256	GCCCGGTATTCTTCCT	21	M	953
1582600	4032	4047	1259	1274	TAAAGCTCCTCCAGCA	24	M	954
1582622	2811	2826	38	53	CGTCCCCGGGCTTCCG	48	M	955
1582630	4608	4623	N/A	N/A	AGACAGAGGTATGCTT	21	M	956
1582648	4678	4693	1543	1558	CAGCGAGCTCCCTTGC	25	M	957
1582654	4705	4720	1570	1585	CACGGAAGAACAAGGG	11	M	958
1582660	4713	4728	1578	1593	CAGAATTTCACGGAAG	16	M	959
1582667	4743	4758	1608	1623	AGCGTCGGAAGGTGGG	9†	M	960
1582673	4750	4765	1615	1630	CCTAGACAGCGTCGGA	17†	M	961
1582679	4766	4781	1631	1646	CTCTAATCCAGGTTTG	9	M	962
1582685	4773	4788	1638	1653	GATGTAACTCTAATCC	21†	M	963
1582691	4782	4797	1647	1662	CATCCAGGAGATGTAA	25	M	964
1582697	4790	4805	1655	1670	GAACTAATCATCCAGG	12†	M	965
1582706	2837	2852	64	79	TCCAAACGAGTCTCCG	25	M	966
1582712	2872	2887	99	114	AAAGCAGGCTCGCAGG	32	M	967
1582718	2881	2896	108	123	GTTCCGCTCAAAGCAG	26	M	968
1582725	2929	2944	156	171	GCCGATGGCCTGGGCC	34	M	969
1582731	2937	2952	164	179	TCCGGAATGCCGATGG	31	M	970
1582737	2957	2972	184	199	ACCAAATCTGGACCCT	23	M	971
1582743	2999	3014	226	241	CCCGCCGGTGCTGCCT	27	M	972
1582749	3011	3026	238	253	AGGGCCGAGATTCCCG	52	M	973
1582755	3049	3064	276	291	CTTTCGCCGGCCTTCT	31	M	974
1582761	3085	3100	312	327	GAGCAGGGCGGTCTGG	35	M	975
1582767	3099	3114	326	341	TCAAAGGCTCGGAGGA	18	M	976
1582773	3111	3126	338	353	AAGCGATCCTTCTCAA	33	M	977
1582779	3117	3132	344	359	CCTGGAAAGCGATCCT	14	M	978
1582785	3127	3142	354	369	GGCGGCGATGCCTGGA	17	M	979
1582791	3134	3149	361	376	CCTCCCGGGCGGCGAT	44	M	980
1582797	3165	3180	392	407	GACTCCGGGAGGCCCG	36	M	981
1582803	3196	3211	423	438	CCTTCGATTCTGAAAC	27	M	982
1582809	3230	3245	457	472	CGGGCGCCCTGCCACC	39	M	983
1582815	3252	3267	479	494	CTGCACAGGCCGCCTG	49	M	984
1582821	3290	3305	517	532	CCCACGAGGGAGCAGG	38	M	985
1582827	3296	3311	523	538	AGGCGACCCACGAGGG	30	M	986
1582833	3302	3317	529	544	GGGCGAAGGCGACCCA	41	M	987
1582839	3315	3330	542	557	CACGCGCCGGTGTGGG	23	M	988
1582846	3327	3342	554	569	AGCCCCGTTCCCCACG	40	M	989
1582852	3335	3350	562	577	GTGCGGGAAGCCCCGT	35	M	990
1582860	3357	3372	584	599	CCAGGCGCGCAGGGCA	27	M	991
1582866	3373	3388	600	615	CCCCTGTGGGAGAGCC	21	M	992
1582872	3381	3396	608	623	ACGAAAGCCCCCTGTG	29	M	993
1582879	3402	3417	629	644	GCGGCCCTCGCTGCCT	43	M	994
1582885	3455	3470	682	697	CAGGTTGGGAGATCCC	22	M	995
1582892	3477	3492	704	719	GCGAAATCCCCGCGCG	41	M	996
1582898	3485	3500	712	727	CGGCGTAGGCGAAATC	25	M	997
1582904	3504	3519	731	746	CCGTCCGGAGGAGCCG	37	M	998
1582910	3511	3526	738	753	GAGCGCCCCGTCCGGA	84	M	999
1582916	3552	3567	779	794	TTGCCCGGGTGCGGAG	76	M	1000
1582923	3589	3604	816	831	CAGGCCGTCGCGCTGC	32	M	1001
1098912	4513	4528	N/A	N/A	AGAGGAGGCGAGCCGC	18	N	301
1582464	4514	4529	N/A	N/A	CAGAGGAGGCGAGCCG	39	N	1002
1582467	2573	2588	N/A	N/A	ATGAATGGCGGTGAGC	56	N	1003
1582470	2687	2702	N/A	N/A	CAGCCGGACTGTGCAC	21	N	1004
1582473	4827	4842	1692	1707	TAGGATCCACAGGGAG	32	N	1005
1582475	3623	3638	850	865	CGGGCCCAGGCTGTGC	90	N	1006
1582481	3633	3648	860	875	CCCGCTTGAGCGGGCC	38	N	1007
1582487	3640	3655	867	882	CTGCGGCCCCGCTTGA	42	N	1008
1582494	3659	3674	886	901	GCGCAAGCACCCCTTG	31	N	1009
1582501	3685	3700	912	927	CCACGGACTCCCCTGG	37	N	1010
1582507	3722	3737	949	964	CCGCCCCGGCGACCTG	36	N	1011
1582508	2724	2739	N/A	N/A	CGCGGGCAGAGAGAGG	76	N	1012
1582514	3729	3744	956	971	TCCCACGCCGCCCCGG	24	N	1013
1582520	2730	2745	N/A	N/A	GACGGACGCGGGCAGA	42	N	1014
1582526	3794	3809	1021	1036	GCCGCGCGGAGGCGGA	38	N	1015
1582532	3821	3836	1048	1063	GCGCCGGGATGCCTTG	61	N	1016
1582540	3848	3863	1075	1090	GCGCCGGCTCCTGGAG	73	N	1017
1582547	3858	3873	1085	1100	GCAGACCAGGGCGCCG	43	N	1018
1582551	2741	2756	N/A	N/A	GGAATTTCACGGACGG	31	N	1019
1582556	3902	3917	1129	1144	CCGGGCTCGCCAGGAG	39	N	1020
1582563	3910	3925	1137	1152	CAGAAACTCCGGGCTC	29	N	1021
1582571	3932	3947	1159	1174	CTAGGAGAGGTTGCGC	80	N	1022
1582577	3940	3955	1167	1182	CTCCGTTTCTAGGAGA	60	N	1023
1582580	2748	2763	N/A	N/A	CCCGGCCGGAATTTCA	38	N	1024
1582587	3983	3998	1210	1225	CCAGCGAGGCGGCCTC	32	N	1025
1582593	4013	4028	1240	1255	CCCGGTATTCTTCCTC	19	N	1026
1582599	4022	4037	1249	1264	CCAGCAGAGCCCGGTA	31	N	1027
1582618	2810	2825	37	52	GTCCCCGGGCTTCCGC	27	N	1028
1582629	4605	4620	N/A	N/A	CAGAGGTATGCTTTTG	28	N	1029
1582635	4623	4638	N/A	N/A	GAAGCGGGCAAAGACA	33	N	1030
1582647	4677	4692	1542	1557	AGCGAGCTCCCTTGCA	37	N	1031
1582653	4704	4719	1569	1584	ACGGAAGAACAAGGGC	33	N	1032
1582659	4712	4727	1577	1592	AGAATTTCACGGAAGA	19	N	1033
1582665	4723	4738	1588	1603	GACATTCAGCCAGAAT	15†	N	1034
1582672	4749	4764	1614	1629	CTAGACAGCGTCGGAA	9†	N	1035
1582678	4765	4780	1630	1645	TCTAATCCAGGTTTGC	10†	N	1036
1582684	4772	4787	1637	1652	ATGTAACTCTAATCCA	12†	N	1037
1582690	4781	4796	1646	1661	ATCCAGGAGATGTAAC	11†	N	1038
1582696	4789	4804	1654	1669	AACTAATCATCCAGGA	18†	N	1039
1582705	2836	2851	63	78	CCAAACGAGTCTCCGT	14	N	1040
1582711	2871	2886	98	113	AAGCAGGCTCGCAGGG	71	N	1041
1582717	2880	2895	107	122	TTCCGCTCAAAGCAGG	25	N	1042
1582723	2917	2932	144	159	GGCCAGCCGTTCTCTG	51	N	1043
1582730	2936	2951	163	178	CCGGAATGCCGATGGC	49	N	1044
1582736	2956	2971	183	198	CCAAATCTGGACCCTG	18	N	1045
1582742	2986	3001	213	228	CCTCAGCTGGCGTGAC	21	N	1046
1582748	3010	3025	237	252	GGGCCGAGATTCCCGC	32	N	1047
1582754	3047	3062	274	289	TTCGCCGGCCTTCTGG	27	N	1048
1582760	3069	3084	296	311	GATCCGGTGACGGCGG	33	N	1049
1582766	3098	3113	325	340	CAAAGGCTCGGAGGAG	31	N	1050
1582772	3110	3125	337	352	AGCGATCCTTCTCAAA	19	N	1051
1582778	3116	3131	343	358	CTGGAAAGCGATCCTT	12	N	1052
1582784	3126	3141	353	368	GCGGCGATGCCTGGAA	32	N	1053
1582790	3133	3148	360	375	CTCCCGGGCGGCGATG	41	N	1054
1582796	3163	3178	390	405	CTCCGGGAGGCCCGTC	19	N	1055
1582802	3195	3210	422	437	CTTCGATTCTGAAACC	22	N	1056
1582808	3229	3244	456	471	GGGCGCCCTGCCACCC	51	N	1057
1582814	3236	3251	463	478	CCTGCGCGGGCGCCCT	38	N	1058
1582820	3281	3296	508	523	GAGCAGGGTGACCCCC	25	N	1059
1582826	3295	3310	522	537	GGCGACCCACGAGGGA	50	N	1060
1582832	3301	3316	528	543	GGCGAAGGCGACCCAC	22	N	1061
1582838	3314	3329	541	556	ACGCGCCGGTGTGGGC	19	N	1062
1582845	3326	3341	553	568	GCCCCGTTCCCCACGC	22	N	1063
1582851	3334	3349	561	576	TGCGGGAAGCCCCGTT	31	N	1064
1582859	3356	3371	583	598	CAGGCGCGCAGGGCAC	29	N	1065
1582865	3363	3378	590	605	AGAGCCCCAGGCGCGC	36	N	1066
1582871	3380	3395	607	622	CGAAAGCCCCCTGTGG	34	N	1067
1582878	3386	3401	613	628	GGCTCACGAAAGCCCC	33	N	1068
1582884	3450	3465	677	692	TGGGAGATCCCCTCTG	31	N	1069
1582891	3476	3491	703	718	CGAAATCCCCGCGCGC	31	N	1070
1582897	3484	3499	711	726	GGCGTAGGCGAAATCC	17	N	1071
1582903	3503	3518	730	745	CGTCCGGAGGAGCCGG	30	N	1072
1582909	3510	3525	737	752	AGCGCCCCGTCCGGAG	50	N	1073
1582915	3551	3566	778	793	TGCCCGGGTGCGGAGG	83	N	1074
1582922	3587	3602	814	829	GGCCGTCGCGCTGCGG	51	N	1075
1604077	3917	3932	1144	1159	CCTGCTGCAGAAACTC	24	O	1076
1604078	3926	3941	1153	1168	GAGGTTGCGCCTGCTG	12	O	1077
1604079	3927	3942	1154	1169	AGAGGTTGCGCCTGCT	9	O	1078
1604080	4010	4025	1237	1252	GGTATTCTTCCTCGCT	4	O	1079
1604081	N/A	N/A	1433	1448	CGGTGTGGAGTCTCTC	30	O	1080
1604082	N/A	N/A	1437	1452	TCCGCGGTGTGGAGTC	10	O	1081
1604083	N/A	N/A	1441	1456	GTTCTCCGCGGTGTGG	15	O	1082
1604084	N/A	N/A	1442	1457	AGTTCTCCGCGGTGTG	11	O	1083
1604085	N/A	N/A	1443	1458	CAGTTCTCCGCGGTGT	11	O	1084
1604086	N/A	N/A	1444	1459	GCAGTTCTCCGCGGTG	7	O	1085
1604087	N/A	N/A	1445	1460	GGCAGTTCTCCGCGGT	11	O	1086
1604088	N/A	N/A	1447	1462	ATGGCAGTTCTCCGCG	6	O	1087
1604089	2785	2800	12	27	GCTGTCCGAGGGTGTC	17	O	1088
1604090	2788	2803	15	30	GGTGCTGTCCGAGGGT	25	O	1089
1604091	2791	2806	18	33	GAGGGTGCTGTCCGAG	29	O	1090
1604092	2792	2807	19	34	GGAGGGTGCTGTCCGA	50	O	1091
1604093	4532	4547	N/A	N/A	GACGGTGGCGCGGGGG	61	O	1092
1604094	4559	4574	N/A	N/A	AGGCTGCAGGGGCCCG	27	O	1093
1604096	4599	4614	N/A	N/A	TATGCTTTTGACCGCC	7	O	1094
1604097	4601	4616	N/A	N/A	GGTATGCTTTTGACCG	30	O	1095
1604098	4624	4639	N/A	N/A	GGAAGCGGGCAAAGAC	142	O	1096
1604106	4644	4659	N/A	N/A	ACTGCGCGCAGGTCTA	22	O	1097
1604107	4645	4660	1510	1525	CACTGCGCGCAGGTCT	6	O	1098
1604108	4654	4669	1519	1534	CGGGGTGCGCACTGCG	36	O	1099
1604109	4655	4670	1520	1535	CCGGGGTGCGCACTGC	24	O	1100
1604110	4656	4671	1521	1536	GCCGGGGTGCGCACTG	70	O	1101
1604111	4662	4677	1527	1542	ACGTCAGCCGGGGTGC	52	O	1102
1604112	4663	4678	1528	1543	CACGTCAGCCGGGGTG	21	O	1103
1604113	4664	4679	1529	1544	GCACGTCAGCCGGGGT	49	O	1104
1604114	4667	4682	1532	1547	CTTGCACGTCAGCCGG	11	O	1105
1604115	4668	4683	1533	1548	CCTTGCACGTCAGCCG	4	O	1106
1604116	4669	4684	1534	1549	CCCTTGCACGTCAGCC	8	O	1107
1604117	4670	4685	1535	1550	TCCCTTGCACGTCAGC	12	O	1108
1604118	4672	4687	1537	1552	GCTCCCTTGCACGTCA	12	O	1109
1604119	4674	4689	1539	1554	GAGCTCCCTTGCACGT	15	O	1110
1604120	4675	4690	1540	1555	CGAGCTCCCTTGCACG	23	O	1111
1604121	4676	4691	1541	1556	GCGAGCTCCCTTGCAC	10	O	1112
1604122	4685	4700	1550	1565	GAGAGGCCAGCGAGCT	14†	O	1113
1604123	4687	4702	1552	1567	CAGAGAGGCCAGCGAG	20†	O	1114
1604124	4724	4739	1589	1604	AGACATTCAGCCAGAA	N.D.†	O	1115
1604125	4727	4742	1592	1607	GGGAGACATTCAGCCA	3†	O	1116
1604126	4728	4743	1593	1608	GGGGAGACATTCAGCC	22†	O	1117
1604127	2825	2840	52	67	TCCGTCGCCGTCCTCG	7	O	1118
1604128	4741	4756	1606	1621	CGTCGGAAGGTGGGGG	15†	O	1119
1604129	4742	4757	1607	1622	GCGTCGGAAGGTGGGG	11†	O	1120
1604130	4746	4761	1611	1626	GACAGCGTCGGAAGGT	N.D.†	O	1121
1604131	4756	4771	1621	1636	GGTTTGCCTAGACAGC	23†	O	1122
1604132	4759	4774	1624	1639	CCAGGTTTGCCTAGAC	9†	O	1123
1604133	4760	4775	1625	1640	TCCAGGTTTGCCTAGA	N.D.†	O	1124
1604134	4800	4815	1665	1680	ATATATCTCTGAACTA	27	O	1125
1604135	4801	4816	1666	1681	AATATATCTCTGAACT	19	O	1126
1604136	4813	4828	1678	1693	AGGGGGCATTTTAATA	87	O	1127
1604137	4814	4829	1679	1694	GAGGGGGCATTTTAAT	131	O	1128
1604138	2867	2882	94	109	AGGCTCGCAGGGCCTC	47	O	1129
1604139	2882	2897	109	124	GGTTCCGCTCAAAGCA	8	O	1130
1604140	2969	2984	196	211	TCTCATTCTGAAACCA	7	O	1131
1604141	2975	2990	202	217	GTGACCTCTCATTCTG	27	O	1132
1604142	2981	2996	208	223	GCTGGCGTGACCTCTC	5	O	1133
1604143	2993	3008	220	235	GGTGCTGCCTCAGCTG	4	O	1134
1604144	3103	3118	330	345	CTTCTCAAAGGCTCGG	23	O	1135
1604145	3105	3120	332	347	TCCTTCTCAAAGGCTC	7	O	1136
1604146	3137	3152	364	379	GCTCCTCCCGGGCGGC	N.D.	O	1137
1604147	3145	3160	372	387	TCTGGCCAGCTCCTCC	11	O	1138
1604148	3151	3166	378	393	CGTCTCTCTGGCCAGC	8	O	1139
1604149	3152	3167	379	394	CCGTCTCTCTGGCCAG	11	O	1140
1604150	3174	3189	401	416	TGAATCCTGGACTCCG	8	O	1141
1604151	3180	3195	407	422	CAGATCTGAATCCTGG	18	O	1142
1604152	3181	3196	408	423	CCAGATCTGAATCCTG	10	O	1143
1604153	3193	3208	420	435	TCGATTCTGAAACCAG	7	O	1144
1604154	3206	3221	433	448	GGTGCCTGGCCCTTCG	N.D.	O	1145

TABLE 13
Reduction of DUX4 RNA by 3-10-3 cEt modified oligonucleotides with uniform phosphorothioate
internucleoside linkages in differentiated 54-2 cells
	SEQ ID	SEQ ID
	NO: 3	NO: 3				SEQ
Compound	Start	Stop		DUX4	Analysis	ID
No.	Site	Site	Sequence (5′ to 3′)	(% UTC)	ID	NO
1582604	7320	7335	AAAGAGAGGCCACGGC	25	I	1146
1582621	7823	7838	TGACCGCCAGGAGCTC	27	I	1147
1582603	7319	7334	AAGAGAGGCCACGGCC	25	J	1148
1582620	7821	7836	ACCGCCAGGAGCTCCG	32	J	1149
1582602	7310	7325	CACGGCCCTGCCCCGA	48	K	1150
1582619	7820	7835	CCGCCAGGAGCTCCGC	12	K	1151
1582606	7322	7337	CGAAAGAGAGGCCACG	19	M	1152
1582624	7827	7842	CTTTTGACCGCCAGGA	20	M	1153
1582605	7321	7336	GAAAGAGAGGCCACGG	35	N	1154
1582623	7825	7840	TTTGACCGCCAGGAGC	27	N	1155
1604095	7824	7839	TTGACCGCCAGGAGCT	6	o	1156

The compounds in the table below have a single mismatch to SEQ ID NO: 1 (described herein above) located at the position indicated in the column labeled “Position of mismatch on Compound (5′ to 3′)”. Additionally, the mismatched nucleobase is marked as bold and underlined in the column labeled “Sequence (5′ to 3′).”

TABLE 14
Reduction of DUX4 RNA by 3-10-3 cEt modified oligonucleotides with uniform phosphorothioate
internucleoside linkages in differentiated 54-2 cells
	Position of	SEQ
	mismatch	ID	SEQ ID
	on	NO: 1	NO: 1		DUX4
Compound	Compound	Start	Stop		(%	Analysis	SEQ ID
No.	(5′ to 3′)	Site	Site	Sequence (5′ to 3′)	UTC)	ID	NO
1582640	10	4636	4651	CAGGTCTAGTCAGGAA	31	I	1157
1582639	7	4633	4648	GTCTAGTCAGGAAGCG	35	J	1158
1582638	5	4631	4646	CTAGTCAGGAAGCGGG	65	K	1159
1582637	4	4630	4645	TAGTCAGGAAGCGGGC	38	L	1160
1582643	16	4642	4657	TGCGCGCAGGTCTAGT	77	L	1161
1582636	3	4629	4644	AGTCAGGAAGCGGGCA	54	M	1162
1582642	14	4640	4655	CGCGCAGGTCTAGTCA	81	M	1163
1582641	13	4639	4654	GCGCAGGTCTAGTCAG	46	N	1164
1604099	2	4628	4643	GTCAGGAAGCGGGCAA	25	O	1165
1604100	6	4632	4647	TCTAGTCAGGAAGCGG	9	O	1166
1604101	8	4634	4649	GGTCTAGTCAGGAAGC	32	O	1167
1604102	9	4635	4650	AGGTCTAGTCAGGAAG	26	O	1168
1604103	11	4637	4652	GCAGGTCTAGTCAGGA	21	O	1169
1604104	12	4638	4653	CGCAGGTCTAGTCAGG	8	O	1170
1604105	15	4641	4656	GCGCGCAGGTCTAGTC	58	O	1171

Example 8: Dose-Dependent Inhibition of Human DUX4 in 54-2 Cells by Modified Oligonucleotides

Modified oligonucleotides selected from the example above were tested at various doses in 54-2 cells (described herein above). 54-2 cells plated at a density of 20,000 cells per well were differentiated (as described herein above) and treated using cytofectin with various concentrations of modified oligonucleotide as specified in the table below. After a treatment period of approximately 24 hours, total RNA was isolated from the cells and DUX4 RNA levels were measured by quantitative real-time RTPCR. Human DUX4 primer-probe set RTS40199 (described herein above) was used to measure RNA levels as described above. DUX4 RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Reduction of DUX4 RNA is presented in the table below as percent DUX4 RNA relative to the amount of DUX4 RNA in untreated control cells (% UTC).

The half maximal inhibitory concentration (IC₅₀) of each modified oligonucleotide was calculated using a linear regression on a log/linear plot of the data in Excel and is also presented in the table below. “N.D.” in the table below refers to instances where the value was Not Defined.

TABLE 15
Dose-dependent reduction of human DUX4 RNA
in 54-2 cells by modified oligonucleotides
Compound	DMPK RNA (% UTC)	IC50
No.	15 nM	44 nM	133 nM	400 nM	(μM)
1582502	72	49	4	4	0.04
1582516	104	27	4	2	0.05
1582548	80	27	2	1	0.03
1582554	132	40	7	2	0.07
1582557	83	32	3	3	0.03
1582561	88	39	5	2	0.04
1582562	96	49	5	2	0.05
1582568	82	37	5	3	0.04
1582585	63	29	3	8	0.02
1582590	102	99	17	5	0.09
1582591	107	42	8	5	0.06
1582595	86	47	7	1	0.04
1582596	106	59	14	3	0.07
1582598	89	40	5	3	0.04
1582619	84	44	10	8	0.04
1582654	56	9	3	1	<0.02

TABLE 16
Dose-dependent reduction of human DUX4 RNA
in 54-2 cells by modified oligonucleotides
Compound	DMPK RNA (% UTC)	IC50
No.	15 nM	44 nM	133 nM	400 nM	(μM)
1582728	75	46	11	2	0.04
1582740	131	71	15	3	0.09
1582746	84	42	8	7	0.04
1582758	105	56	20	14	0.07
1582770	86	56	9	4	0.05
1582771	85	53	7	3	0.05
1582778	82	51	14	3	0.05
1582779	74	37	6	2	0.03
1582785	26	27	11	13	<0.02
1582800	99	36	10	3	0.05
1582801	84	45	5	4	0.04
1582828	92	53	23	8	0.06
1582875	84	56	16	2	0.05
1582876	92	83	18	4	0.08
1582877	79	47	11	1	0.04

TABLE 17
Dose-dependent reduction of human DUX4 RNA
in 54-2 cells by modified oligonucleotides
Compound		DMPK RNA (% UTC)	IC50
No.	6 nM	25 nM	100 nM	400 nM	(μM)
1604078	28	15	4	10	<0.01
1604079	36	20	7	4	<0.01
1604080	34	10	5	16	<0.01
1604082	47	17	10	7	<0.01
1604084	29	7	8	14	<0.01
1604085	23	5	6	8	<0.01
1604086	13	2	3	4	<0.01
1604087	22	4	5	11	<0.01
1604088	28	29	6	9	<0.01
1604095	108	49	20	26	0.05
1604096	57	27	8	17	0.01
1604100	70	26	28	14	0.01
1604104	57	23	25	27	<0.01
1604107	45	17	2	1	<0.01
1604114	28	19	12	25	<0.01

TABLE 18
Dose-dependent reduction of human DUX4 RNA
in 54-2 cells by modified oligonucleotides
Compound		DMPK RNA (% UTC)	IC50
No.	6 nM	25 nM	100 nM	400 nM	(μM)
1604115	38	6	2	15	<0.01
1604116	35	10	5	11	<0.01
1604121	65	16	4	80	<0.01
1604127	19	6	0	28	>0.4
1604139	18	3	8	8	<0.01
1604140	48	6	1	2	<0.01
1604142	5	2	3	13	>0.4
1604143	12	9	1	4	<0.01
1604145	38	25	2	3	<0.01
1604147	27	3	15	11	<0.01
1604148	9	12	3	10	<0.01
1604149	18	3	5	6	<0.01
1604150	53	15	8	33	<0.01
1604152	19	2	4	2	<0.01
1604153	2	1	3	2	>0.4

TABLE 19
Dose-dependent reduction of human DUX4 RNA
in 54-2 cells by modified oligonucleotides
Compound	DMPK RNA (% UTC)	IC50
No.	15 nM	44 nM	133 nM	400 nM	(μM)
1582655	55	26	4	1	0.02
1582660	61	45	6	3	0.03
1582663	29	11	2	N.D.	<0.02
1582664	70	14	2	2	0.02
1582676	85	31	16	1	0.04
1582679	57	30	3	2	0.02
1582681	43	24	7	4	<0.02
1582683	48	22	5	N.D.	<0.02
1582688	102	27	5	2	0.05
1582689	43	15	5	10	<0.02
1582693	84	36	10	2	0.04
1582695	55	25	4	2	<0.02
1582699	108	26	5	N.D.	0.04
1582703	74	22	2	4	0.02
1582705	92	28	6	2	0.04
1582722	49	15	5	6	<0.02

Example 9: Design of an RNAi Compound that Targets a Human DUX4 Nucleic Acid

RNAi compounds comprising antisense RNAi oligonucleotides complementary to a human DUX4 nucleic acid, and sense RNAi oligonucleotides complementary to the antisense RNAi oligonucleotides were designed as follows.

“Start site” indicates the 5′-most nucleoside to which the antisense RNAi oligonucleotide is complementary in the human gene sequence. “Stop site” indicates the 3′-most nucleoside to which the antisense RNAi oligonucleotide is complementary in the human gene sequence. Each antisense RNAi oligonucleotide listed in the table below is 100% complementary to SEQ ID NO: 1 (described herein above), and to SEQ ID NO: 2 (described herein above).

The antisense RNAi oligonucleotide in the table below is 25 nucleosides in length; wherein the sugar motif for the antisense RNAi oligonucleotide is (from 5′ to 3′): rrrrrrrrrrrrrrrrrrrrrrrrr, wherein each “r” represents a ribosyl sugar moiety. The internucleoside linkage motif for the antisense RNAi oligonucleotides is (from 5′ to 3′): oooooooooooooooooooooooo, wherein each “o” represents a phosphodiester internucleoside linkage.

The sense RNAi oligonucleotide in the table below is 25 nucleosides in length; wherein the sugar motif for the antisense RNAi oligonucleotide is (from 5′ to 3′): rrrrrrrrrrrrrrrrrrrrrrrrr, wherein each “r” represents a ribosyl sugar moiety. The internucleoside linkage motif for the antisense RNAi oligonucleotides is (from 5′ to 3′): oooooooooooooooooooooooo, wherein each “o” represents a phosphodiester internucleoside linkage.

The sense RNAi oligonucleotide is 100% complementary to the antisense RNAi oligonucleotide (from 5′ to 3′).

TABLE 20
Design of an RNAi compound targeted to human DUX4
				SEQ	SEQ	SEQ	SEQ
				ID NO:	ID NO:	ID NO:	ID NO:	Sense
	Antisense	Antisense		1 Anti-	1 Anti-	2 Anti-	2 Anti-	Strand
Duplex	Strand	strand	SEQ	sense	sense	sense	sense	Com-	Sense strand
Compound	Compound	Sequence	ID	Start	Stop	Start	Stop	pound	Sequence	SEQ
Number	Number	(5′ to 3′)	NO	Site	Site	Site	Site	Number	(5′ to 3′)	ID NO
1586340	1586145	AAAGCGAU	1172	3103	3127	330	354	1586338	CCGAGCC	1173
		CCUUCUCA							UUUGAGA
		AAGGCUCG							AGGAUCG
		G							CUUU

Example 10: Design of an RNAi Compound that Targets a Human DUX4 Nucleic Acid

RNAi compounds comprising antisense RNAi oligonucleotides complementary to a human DUX4 nucleic acid, and sense RNAi oligonucleotides complementary to the antisense RNAi oligonucleotides were designed as follows.

“Start site” indicates the 5′-most nucleoside to which the antisense RNAi oligonucleotide is complementary in the human gene sequence. “Stop site” indicates the 3′-most nucleoside to which the antisense RNAi oligonucleotide is complementary in the human gene sequence. Each antisense RNAi oligonucleotide listed in the table below is 100% complementary to SEQ ID NO: 1 (described herein above), and to SEQ ID NO: 2 (described herein above).

The antisense RNAi oligonucleotide in the table below is 19 nucleosides in length; wherein the sugar motif for the antisense RNAi oligonucleotide is (from 5′ to 3′): rrrrrrrrrrrrrrrrrrrrrrrrr, wherein each “r” represents a ribosyl sugar moiety. The internucleoside linkage motif for the antisense RNAi oligonucleotides is (from 5′ to 3′): oooooooooooooooooo, wherein each “o” represents a phosphodiester internucleoside linkage.

The sense RNAi oligonucleotide in the table below is 19 nucleosides in length; wherein the sugar motif for the antisense RNAi oligonucleotide is (from 5′ to 3′): rrrrrrrrrrrrrrrrrrrrrrrrr, wherein each “r” represents a ribosyl sugar moiety. The internucleoside linkage motif for the antisense RNAi oligonucleotides is (from 5′ to 3′): oooooooooooooooooo, wherein each “o” represents a phosphodiester internucleoside linkage.

The sense RNAi oligonucleotide is 100% complementary to the antisense RNAi oligonucleotide (from 5′ to 3′).

TABLE 21
Design of an RNAi compound targeted to human DUX4
				SEQ	SEQ	SEQ	SEQ
				ID NO:	ID NO:	ID NO:	ID NO:	Sense
	Antisense	Antisense		1 Anti-	1 Anti-	2 Anti-	2 Anti-	Strand
Duplex	Strand	strand	SEQ	sense	sense	sense	sense	Com-	Sense strand	SEQ
Compound	Compound	Sequence	ID	Start	Stop	Start	Stop	pound	Sequence	ID
Number	Number	(5′ to 3′)	NO	Site	Site	Site	Site	Number	(5′ to 3′)	NO
1586341	1586147	UUCCGCUC	1174	2877	2895	104	122	1586339	GAGCCUG	1175
		AAAGCAG							CUUUGAG
		GCUC							CGGAA

Example 11: Design of an RNAi Compound that Targets a Human DUX4 Nucleic Acid

RNAi compounds comprising antisense RNAi oligonucleotides complementary to a human DUX4 nucleic acid, and sense RNAi oligonucleotides complementary to the antisense RNAi oligonucleotides were designed as follows.

“Start site” indicates the 5′-most nucleoside to which the antisense RNAi oligonucleotide is complementary in the human gene sequence. “Stop site” indicates the 3′-most nucleoside to which the antisense RNAi oligonucleotide is complementary in the human gene sequence. Each antisense RNAi oligonucleotide listed in the table below is 100% complementary to SEQ ID NO: 1 (described herein above), to SEQ ID NO: 2 (described herein above), or to both. “N/A” indicates that the antisense RNAi oligonucleotide is not 100% complementary to that particular target nucleic acid sequence

The antisense RNAi oligonucleotide in the table below is 23 nucleosides in length; wherein the sugar motif for the antisense RNAi oligonucleotide is (from 5′ to 3′ yfyfyfyfyfyfyfyfyfyfyyy, wherein each “y” represents a 2′-O-methylribosyl sugar moiety, and each “f” represents a 2′-fluororibosyl sugar moiety. The internucleoside linkage motif for the antisense RNAi oligonucleotides is (from 5′ to 3′ ssooooooooooooooooooss, wherein each “o” represents a phosphodiester internucleoside linkage, and each “s” represents a phosphorothioate internucleoside linkage.

The sense RNAi oligonucleotide in the table below is 21 nucleosides in length; wherein the sugar motif for the antisense RNAi oligonucleotide is (from 5′ to 3′): fyfyfyfyfyfyfyfyfyfyf, wherein each “y” represents a 2′-O-methylribosyl sugar moiety, and each “f” represents a 2′-fluororibosyl sugar moiety. The internucleoside linkage motif for the antisense RNAi oligonucleotides is (from 5′ to 3′): ssooooooooooooooooss, wherein each “o” represents a phosphodiester internucleoside linkage, and each “s” represents a phosphorothioate internucleoside linkage.

Each sense RNAi oligonucleotide is complementary to the first of the 21 nucleosides of the antisense RNAi oligonucleotide (from 5′ to 3′) wherein the last two 3′-nucleosides of the antisense RNAi oligonucleotides are unpaired overhanging nucleosides.

TABLE 22
Design of RNAi compounds targeted to human DUX4, SEQ ID NO: 1 and/or SEQ ID NO: 2
				SEQ	SEQ	SEQ	SEQ
				ID NO:	ID NO:	ID NO:	ID NO:	Sense
	Antisense	Antisense		1 Anti-	1 Anti-	2 Anti-	2 Anti-	Strand
Duplex	Strand	strand	SEQ	sense	sense	sense	sense	Com-	Sense strand	SEQ
Compound	Compound	Sequence	ID	Start	Stop	Start	Stop	pound	Sequence	ID
Number	Number	(5′ to 3′)	NO	Site	Site	Site	Site	Number	(5′ to 3′)	NO
1588121	1588119	UUUAAUA	1176	4797	4819	1662	1684	1588120	UUAGUUC	1242
		UAUCUCU							AGAGAUA
		GAACUAA							UAUUAAA
		UC
1588124	1588122	AUCUCUG	1177	4789	4811	1654	1676	1588123	CUGGAUG	1243
		AACUAAU							AUUAGUU
		CAUCCAG							CAGAGAU
		GA
1588127	1588125	ACUAAUC	1178	4781	4803	1646	1668	1588126	UACAUCU	1244
		AUCCAGG							CCUGGAU
		AGAUGUA							GAUUAGU
		AC
1588130	1588128	UCCAGGA	1179	4773	4795	1638	1660	1588129	AUUAGAG	1245
		GAUGUAA							UUACAUC
		CUCUAAU							UCCUGGA
		CC
1588133	1588131	AUGUAAC	1180	4765	4787	1630	1652	1588132	AAACCUG	1246
		UCUAAUC							GAUUAGA
		CAGGUUU							GUUACAU
		GC
1588142	1588140	UAGACAG	1181	4741	4763	1606	1628	1588141	CCCACCU	1247
		CGUCGGA							UCCGACG
		AGGUGGG							CUGUCUA
		GG
1588151	1588149	AGACAUU	1182	4717	4739	1582	1604	1588150	UGAAAUU	1248
		CAGCCAG							CUGGCUG
		AAUUUCA							AAUGUCU
		CG
1588154	1588152	AGCCAGA	1183	4709	4731	1574	1596	1588153	UUCUUCC	1249
		AUUUCAC							GUGAAAU
		GGAAGAA							UCUGGCU
		CA
1588157	1588155	UUUCACG	1184	4701	4723	1566	1588	1588156	UGCCCUU	1250
		GAAGAAC							GUUCUUC
		AAGGGCA							CGUGAAA
		CA
1588160	1588158	AAGAACA	1185	4693	4715	1558	1580	1588159	CCUCUCU	1251
		AGGGCAC							GUGCCCU
		AGAGAGG							UGUUCUU
		CC
1588166	1588164	AGAGGCC	1186	4677	4699	1542	1564	1588165	CAAGGGA	1252
		AGCGAGC							GCUCGCU
		UCCCUUG							GGCCUCU
		CA
1588190	1588188	UGGGCCG	1187	4251	4273	1478	1500	1588189	GGGGAUC	1253
		GCUCUGG							CCAGAGC
		GAUCCCC							CGGCCCA
		GG
1588196	1588194	UCCCCGG	1188	4235	4257	1462	1484	1588195	CUUUCCU	1254
		GAUGCCC							GGGCAUC
		AGGAAAG							CCGGGGA
		AA
1588226	1588224	UCCUCCA	1189	4019	4041	1246	1268	1588225	AUACCGG	1255
		GCAGAGC							GCUCUGC
		CCGGUAU							UGGAGGA
		UC
1588235	1588233	UCCUCGC	1190	3995	4017	1222	1244	1588234	GGAAGCA	1256
		UGAGGGG							CCCCUCA
		UGCUUCC							GCGAGGA
		AG
1588250	1588248	AGGCCUC	1191	3955	3977	1182	1204	1588249	CCCCGGG	1257
		CAGCUCC							GGAGCUG
		CCCGGGG							GAGGCCU
		CC
1588253	1588251	AGCUCCC	1192	3947	3969	1174	1196	1588252	AACGGAG	1258
		CCGGGGC							GCCCCGG
		CUCCGUU							GGGAGCU
		UC
1588262	1588260	AGGAGAG	1193	3923	3945	1150	1172	1588261	GCAGCAG	1259
		GUUGCGC							GCGCAAC
		CUGCUGC							CUCUCCU
		AG
1588265	1588263	UUGCGCC	1194	3915	3937	1142	1164	1588264	GAGUUUC	1260
		UGCUGCA							UGCAGCA
		GAAACUC							GGCGCAA
		CG
1588271	1588269	AACUCCG	1195	3899	3921	1126	1148	1588270	GCUCCUG	1261
		GGCUCGC							GCGAGCC
		CAGGAGC							CGGAGUU
		UC
1588280	1588278	UCCAGCA	1196	3875	3897	1102	1124	1588279	CCCCUGC	1262
		GCAGGCC							GGCCUGC
		GCAGGGG							UGCUGGA
		AG
1588286	1588284	AGGGGAG	1197	3859	3881	1086	1108	1588285	CGCCCUG	1263
		UGCAGAC							GUCUGCA
		CAGGGCG							CUCCCCU
		CC
1588298	1588296	AGCGCCU	1198	3827	3849	1054	1076	1588297	CCCGGCG	1264
		GGGAGGG							CCCUCCC
		CGCCGGG							AGGCGCU
		AU
1588328	1588326	AGGUGGA	1199	3747	3769	974	996	1588327	CAAGCCG	1265
		GCUGCCC							GGGCAGC
		CGGCUUG							UCCACCU
		GG
1588338	1588336	UUCCCAC	1200	3723	3745	950	972	1588337	GUCGCCG	1266
		GCCGCCC							GGGCGGC
		CGGCGAC							GUGGGAA
		CU
1588383	1588381	UGCCACC	1201	3603	3625	830	852	1588382	CCGGGCC	1267
		GCGCAGG							CCUGCGC
		GGCCCGG							GGUGGCA
		CA
1588398	1588396	UCCCGGU	1202	3563	3585	790	812	1588397	CAAAAGC	1268
		CCUCCCG							CGGGAGG
		GCUUUUG							ACCGGGA
		CC
1588416	1588414	UGAGGGU	1203	3515	3537	742	764	1588415	CGGGGCG	1269
		GGGAGAG							CUCUCCC
		CGCCCCG							ACCCUCA
		UC
1588434	1588432	AAAUCCC	1204	3467	3489	694	716	1588433	UGCCCCG	1270
		CGCGCGC							GCGCGCG
		CGGGGCA							GGGAUUU
		GG
1588443	1588441	UGGGAGA	1205	3443	3465	670	692	1588442	GCCGGCA	1271
		UCCCCUC							GAGGGGA
		UGCCGGC							UCUCCCA
		GC
1588470	1588468	AAAGCCC	1206	3371	3393	598	620	1588469	GGCUCUC	1272
		CCUGUGG							CCACAGG
		GAGAGCC							GGGCUUU
		CC
1588494	1588492	ACGCGCC	1207	3307	3329	534	556	1588493	CCUUCGC	1273
		GGUGUGG							CCACACC
		GCGAAGG							GGCGCGU
		CG
1588524	1588522	UGCGCGG	1208	3227	3249	454	476	1588523	GGGUGGC	1274
		GCGCCCU							AGGGCGC
		GCCACCC							CCGCGCA
		UG
1588539	1588537	UUCGAUU	1209	3187	3209	414	436	1588538	AGAUCUG	1275
		CUGAAAC							GUUUCAG
		CAGAUCU							AAUCGAA
		GA
1588542	1588540	UGAAACC	1210	3179	3201	406	428	1588541	CAGGAUU	1276
		AGAUCUG							CAGAUCU
		AAUCCUG							GGUUUCA
		GA
1588548	1588546	UCCUGGA	1211	3163	3185	390	412	1588547	CGGGCCU	1277
		CUCCGGG							CCCGGAG
		AGGCCCG							UCCAGGA
		UC
1588551	1588549	UCCGGGA	1212	3155	3177	382	404	1588550	CAGAGAG	1278
		GGCCCGU							ACGGGCC
		CUCUCUG							UCCCGGA
		GC
1588560	1588558	AGCUCCU	1213	3131	3153	358	380	1588559	CAUCGCC	1279
		CCCGGGC							GCCCGGG
		GGCGAUG							AGGAGCU
		CC
1588572	1588570	AUCCUUC	1214	3099	3121	326	348	1588571	CUCCGAG	1280
		UCAAAGG							CCUUUGA
		CUCGGAG							GAAGGAU
		GA
1588584	1588582	UCUGGGA	1215	3067	3089	294	316	1588583	CCGCCGU	1281
		UCCGGUG							CACCGGA
		ACGGCGG							UCCCAGA
		UC
1588599	1588597	UGGCGGG	1216	3027	3049	254	276	1588598	CCCGGGA	1282
		CCGCGUC							GACGCGG
		UCCCGGG							CCCGCCA
		CC
1588611	1588609	AUUCCCG	1217	2995	3017	222	244	1588610	UGAGGCA	1283
		CCGGUGC							GCACCGG
		UGCCUCA							CGGGAAU
		GC
1588629	1588627	AAAUCUG	1218	2947	2969	174	196	1588628	CGGAGCC	1284
		GACCCUG							CAGGGUC
		GGCUCCG							CAGAUUU
		GA
1588632	1588630	ACCCUGG	1219	2939	2961	166	188	1588631	CGGCAUU	1285
		GCUCCGG							CCGGAGC
		AAUGCCG							CCAGGGU
		AU
1588638	1588636	UGCCGAU	1220	2923	2945	150	172	1588637	GGCUGGC	1286
		GGCCUGG							CCAGGCC
		GCCAGCC							AUCGGCA
		GU
1588659	1588657	UCAAAGC	1221	2867	2889	94	116	1588658	GGCCCUG	1287
		AGGCUCG							CGAGCCU
		CAGGGCC							GCUUUGA
		UC
1588674	1588672	AAACGAG	1222	2827	2849	54	76	1588673	GACGGCG	1288
		UCUCCGU							ACGGAGA
		CGCCGUC							CUCGUUU
		CU
1588692	1588690	UGCUGUC	1223	2779	2801	6	28	1588691	UCCCGAC	1289
		CGAGGGU							ACCCUCG
		GUCGGGA							GACAGCA
		GG
1588710	1588708	AUUUCAC	1224	2731	2753	N/A	N/A	1588709	GCCCGCG	1290
		GGACGGA							UCCGUCC
		CGCGGGC							GUGAAAU
		AG
1588749	1588747	AGCCAGC	1225	2623	2645	N/A	N/A	1588748	AGGGCGG	1291
		CAGCCAG							CUGGCUG
		CCGCCCU							GCUGGCU
		UG
1588752	1588750	AGCCAGC	1226	2615	2637	N/A	N/A	1588751	CCUUUAC	1292
		CGCCCUU							AAGGGCG
		GUAAAGG							GCUGGCU
		CC
1588758	1588756	AGGGGGC	1227	4806	4828	1671	1693	1588757	AGAUAUA	1293
		AUUUUAA							UUAAAAU
		UAUAUCU							GCCCCCU
		CU
1588764	1588762	AAUCCAG	1228	4755	4777	1620	1642	1588763	CUGUCUA	1294
		GUUUGCC							GGCAAAC
		UAGACAG							CUGGAUU
		CG
1588767	1588765	ACAGCGU	1229	4738	4760	1603	1625	1588766	CCCCCCA	1295
		CGGAAGG							CCUUCCG
		UGGGGGG							ACGCUGU
		AG
1588776	1588774	AAGGGCA	1230	4687	4709	1552	1574	1588775	CGCUGGC	1296
		CAGAGAG							CUCUCUG
		GCCAGCG							UGCCCUU
		AG
1588779	1588777	AGCGAGC	1231	4670	4692	1535	1557	1588778	UGACGUG	1297
		UCCCUUG							CAAGGGA
		CACGUCA							GCUCGCU
		GC
1588788	1588786	UGGGAUC	1232	4240	4262	1467	1489	1588787	CUGGGCA	1298
		CCCGGGA							UCCCGGG
		UGCCCAG							GAUCCCA
		GA
1588794	1588792	UUCUCCG	1233	4206	4228	N/A	N/A	1588793	GAGACUC	1299
		CGGAGUG							CACUCCG
		GAGUCUC							CGGAGAA
		UC
1588797	1588795	UCUCUCA	1234	4189	4211	1416	1438	1588796	AGGUCUA	1300
		CCGGGCC							GGCCCGG
		UAGACCU							UGAGAGA
		AG
1588800	1588798	ACCUAGA	1235	4172	4194	1399	1421	1588799	UGGGAUU	1301
		AGGCAGG							CCUGCCU
		AAUCCCA							UCUAGGU
		GG
1588812	1588810	UAGCCAG	1236	4104	4126	1331	1353	1588811	CGGGGAA	1302
		CCAGGUG							CACCUGG
		UUCCCCG							CUGGCUA
		CG
1588181	1588179	ACUGCGC	1237	N/A	N/A	1502	1524	1588180	ACCAGCA	1303
		GCAGGUC							GACCUGC
		UGCUGGU							GCGCAGU
		AC
1588199	1588197	AUGCCCA	1238	N/A	N/A	1454	1476	1588198	CUGCCAU	1304
		GGAAAGA							UCUUUCC
		AUGGCAG							UGGGCAU
		UU
1588208	1588206	UCCGCGG	1239	N/A	N/A	1430	1452	1588207	UGAGAGA	1305
		UGUGGAG							CUCCACA
		UCUCUCA							CCGCGGA
		CC
1588404	1588402	UUUUGCC	1240	N/A	N/A	774	796	1588403	GGCCUCC	1306
		CGGGUGC							GCACCCG
		GGAGGCC							GGCAAAA
		AG
1588410	1588408	AGGCCAG	1241	N/A	N/A	758	780	1588409	CCUCAGG	1307
		CGAGGAG							CUCCUCG
		CCUGAGG							CUGGCCU
		GU

“Start site” indicates the 5′-most nucleoside to which the antisense RNAi oligonucleotide is complementary in the human gene sequence. “Stop site” indicates the 3′-most nucleoside to which the antisense RNAi oligonucleotide is complementary in the human gene sequence. The antisense RNAi oligonucleotide listed in the table below is 100% complementary to SEQ ID NO: 4 (GENBANK Accession No. NM_001293798.2).

TABLE 23
Design of RNAi compounds targeted to human DUX4, SEQ ID NO: 4
	Antisense	Antisense		SEQ ID	SEQ ID	Sense	Sense
Duplex	Strand	Strand		NO: 4	NO: 4	Strand	Strand	SEQ
Compound	Compound	Sequence	SEQ	Antisense	Antisense	Compound	Sequence	ID
Number	Number	(5′ to 3′)	ID NO	Start Site	Stop Site	Number	(5′ to 3′)	NO
1588214	1588212	UCUCACCG	1308	1278	1300	1588213	CGGGGUC	1309
		GGCCUAGA					UAGGCCC
		CCCCGCG					GGUGAGA

Example 12: Design of an RNAi Compound that Targets a Human DUX4 Nucleic Acid

RNAi compounds comprising antisense RNAi oligonucleotides complementary to a human DUX4 nucleic acid, and sense RNAi oligonucleotides complementary to the antisense RNAi oligonucleotides were designed as follows.

“Start site” indicates the 5′-most nucleoside to which the antisense RNAi oligonucleotide is complementary in the human gene sequence. “Stop site” indicates the 3′-most nucleoside to which the antisense RNAi oligonucleotide is complementary in the human gene sequence. Each antisense RNAi oligonucleotide listed in the table below is complementary to SEQ ID NO: 1 (described herein above), to SEQ ID NO: 2 (described herein above), or to both, with the exception of a single mismatch at position 1 (from 5′ to 3′) of the antisense RNAi oligonucleotide. ‘N/A’ indicates that the modified oligonucleotide has two or more mismatches to that particular target nucleic acid sequence in the table below.

The antisense RNAi oligonucleotide in the table below is 23 nucleosides in length; wherein the sugar motif for the antisense RNAi oligonucleotide is (from 5′ to 3′ yfyfyfyfyfyfyfyfyfyfyyy, wherein each “y” represents a 2′-O-methylribosyl sugar moiety, and each “f” represents a 2′-fluororibosyl sugar moiety. The internucleoside linkage motif for the antisense RNAi oligonucleotides is (from 5′ to 3′ ssooooooooooooooooooss, wherein each “o” represents a phosphodiester internucleoside linkage, and each “s” represents a phosphorothioate internucleoside linkage.

The sense RNAi oligonucleotide in the table below is 21 nucleosides in length; wherein the sugar motif for the antisense RNAi oligonucleotide is (from 5′ to 3′): 2fyfyfyfyfyfyfyfyfyf, wherein each “y” represents a methylribosyl sugar moiety, and each “f” represents a 2′-fluororibosyl sugar moiety. The internucleoside linkage motif for the antisense RNAi oligonucleotides is (from 5′ to 3′): ssooooooooooooooooss, wherein each “o” represents a phosphodiester internucleoside linkage, and each “s” represents a phosphorothioate internucleoside linkage.

Each sense RNAi oligonucleotide is complementary to the first of the 21 nucleosides of the antisense RNAi oligonucleotide (from 5′ to 3′) wherein the last two 3′-nucleosides of the antisense RNAi oligonucleotides are unpaired overhanging nucleosides.

TABLE 24
Design of RNAi compounds targeted to human DUX4, SEQ ID NO: 1 and/or SEQ ID NO: 2
				SEQ	SEQ	SEQ	SEQ
				ID NO:	ID NO:	ID NO:	ID NO:	Sense
	Antisense	Antisense		1 Anti-	1 Anti-	2 Anti-	2 Anti-	Strand
Duplex	Strand	strand	SEQ	sense	sense	sense	sense	Com-	Sense strand	SEQ
Compound	Compound	Sequence	ID	Start	Stop	Start	Stop	pound	Sequence	ID
Number	Number	(5′ to 3′)	NO	Site	Site	Site	Site	Number	(5′ to 3′)	NO
1588136	1588134	AUAAUCC	1310	4757	4778	1622	1643	1588135	GUCUAGG	1474
		AGGUUUG							CAAACCU
		CCUAGAC							GGAUUAU
		AG
1588139	1588137	AGUUUGC	1311	4749	4770	1614	1635	1588138	CCGACGC	1475
		CUAGACA							UGUCUAG
		GCGUCGG							GCAAACU
		AA
1588145	1588143	AUCGGAA	1312	4733	4754	1598	1619	1588144	UGUCUCC	1476
		GGUGGGG							CCCCACC
		GGAGACA							UUCCGAU
		UU
1588148	1588146	AUGGGGG	1313	4725	4746	1590	1611	1588147	UGGCUGA	1477
		GAGACAU							AUGUCUC
		UCAGCCA							CCCCCAU
		GA
1588163	1588161	AGGCACA	1314	4685	4706	1550	1571	1588162	CUCGCUG	1478
		GAGAGGC							GCCUCUC
		CAGCGAG							UGUGCCU
		CU
1588169	1588167	ACGAGCU	1315	4669	4690	1534	1555	1588168	CUGACGU	1479
		CCCUUGCA							GCAAGGG
		CGUCAGCC							AGCUCGU
1588172	1588170	ACUUGCA	1316	4661	4682	1526	1547	1588171	CACCCCG	1480
		CGUCAGCC							GCUGACG
		GGGGUGC							UGCAAGU
		G
1588175	1588173	AUCAGCC	1317	4653	4674	1518	1539	1588174	GCAGUGC	1481
		GGGGUGC							GCACCCC
		GCACUGC							GGCUGAU
		GC
1588178	1588176	AGGUGCG	1318	4645	4666	1510	1531	1588177	ACCUGCG	1482
		CACUGCGC							CGCAGUG
		GCAGGUC							CGCACCU
		U
1588187	1588185	AUGGUAC	1319	4259	4280	1486	1507	1588186	CAGAGCC	1483
		CUGGGCC							GGCCCAG
		GGCUCUG							GUACCAU
		GG
1588193	1588191	AUCUGGG	1320	4243	4264	1470	1491	1588192	GGCAUCC	1484
		AUCCCCGG							CGGGGAU
		GAUGCCC							CCCAGAU
		A
1588211	1588209	AUGGAGU	1321	4195	4216	1422	1443	1588210	AGGCCCG	1485
		CUCUCACC							GUGAGAG
		GGGCCUA							ACUCCAU
		G
1588220	1588218	ACCCGCGU	1322	4035	4056	1262	1283	1588219	GAGGAGC	1486
		CCUAAAG							UUUAGGA
		CUCCUCCA							CGCGGGU
1588223	1588221	ACUAAAG	1323	4027	4048	1254	1275	1588222	CUCUGCU	1487
		CUCCUCCA							GGAGGAG
		GCAGAGC							CUUUAGU
		C
1588229	1588227	AAGAGCC	1324	4011	4032	1238	1259	1588228	GAGGAAG	1488
		CGGUAUU							AAUACCG
		CUUCCUCG							GGCUCUU
		C
1588232	1588230	AGUAUUC	1325	4003	4024	1230	1251	1588231	CCCUCAG	1489
		UUCCUCGC							CGAGGAA
		UGAGGGG							GAAUACU
		U
1588238	1588236	AAGGGGU	1326	3987	4008	1214	1235	1588237	GCCUCGC	1490
		GCUUCCA							UGGAAGC
		GCGAGGC							ACCCCUU
		GG
1588241	1588239	AUUCCAG	1327	3979	4000	1206	1227	1588240	AAGAGGC	1491
		CGAGGCG							CGCCUCG
		GCCUCUUC							CUGGAAU
		C
1588244	1588242	AAGGCGG	1328	3971	3992	1198	1219	1588243	GGCCUCG	1492
		CCUCUUCC							GAAGAGG
		GAGGCCU							CCGCCUU
		C
1588247	1588245	AUCUUCC	1329	3963	3984	1190	1211	1588246	GAGCUGG	1493
		GAGGCCU							AGGCCUC
		CCAGCUCC							GGAAGAU
		C
1588256	1588254	AGGGGCC	1330	3939	3960	1166	1187	1588255	CUCCUAG	1494
		UCCGUUU							AAACGGA
		CUAGGAG							GGCCCCU
		AG
1588259	1588257	ACGUUUC	1331	3931	3952	1158	1179	1588258	CGCAACC	1495
		UAGGAGA							UCUCCUA
		GGUUGCG							GAAACGU
		CC
1588268	1588266	ACUGCAG	1332	3907	3928	1134	1155	1588267	CGAGCCC	1496
		AAACUCC							GGAGUUU
		GGGCUCG							CUGCAGU
		CC
1588274	1588272	ACUCGCCA	1333	3891	3912	1118	1139	1588273	CUGGAUG	1497
		GGAGCUC							AGCUCCU
		AUCCAGC							GGCGAGU
		A
1588277	1588275	AGAGCUC	1334	3883	3904	1110	1131	1588276	GCCUGCU	1498
		AUCCAGC							GCUGGAU
		AGCAGGC							GAGCUCU
		CG
1588283	1588281	AAGGCCG	1335	3867	3888	1094	1115	1588282	UCUGCAC	1499
		CAGGGGA							UCCCCUG
		GUGCAGA							CGGCCUU
		CC
1588289	1588287	ACAGACC	1336	3851	3872	1078	1099	1588288	GGAGCCG	1500
		AGGGCGC							GCGCCCU
		CGGCUCCU							GGUCUGU
		G
1588292	1588290	AGGCGCC	1337	3843	3864	1070	1091	1588291	GCGCUCC	1501
		GGCUCCU							AGGAGCC
		GGAGCGC							GGCGCCU
		CU
1588295	1588293	ACUCCUG	1338	3835	3856	1062	1083	1588294	CCUCCCA	1502
		GAGCGCC							GGCGCUC
		UGGGAGG							CAGGAGU
		GC
1588301	1588299	AGAGGGC	1339	3819	3840	1046	1067	1588300	CAAGGCA	1503
		GCCGGGA							UCCCGGC
		UGCCUUG							GCCCUCU
		CA
1588304	1588302	ACGGGAU	1340	3811	3832	1038	1059	1588303	GGCAGAU	1504
		GCCUUGC							GCAAGGC
		AUCUGCCC							AUCCCGU
		C
1588307	1588305	ACUUGCA	1341	3803	3824	1030	1051	1588306	GCGGCAG	1505
		UCUGCCCC							GGGCAGA
		UGCCGCGC							UGCAAGU
1588310	1588308	AUGCCCCU	1342	3795	3816	1022	1043	1588309	GCCUCCG	1506
		GCCGCGCG							CGCGGCA
		GAGGCGG							GGGGCAU
1588313	1588311	ACCGCGCG	1343	3787	3808	1014	1035	1588312	ACGCCUC	1507
		GAGGCGG							CGCCUCC
		AGGCGUC							GCGCGGU
		C
1588316	1588314	AAGGCGG	1344	3779	3800	1006	1027	1588315	GCCCCCG	1508
		AGGCGUC							GACGCCU
		CGGGGGC							CCGCCUU
		GC
1588319	1588317	AGCGUCC	1345	3771	3792	998	1019	1588318	CAGCCCG	1509
		GGGGGCG							CGCCCCC
		CGGGCUG							GGACGCU
		GG
1588322	1588320	AGGGCGC	1346	3763	3784	990	1011	1588321	CACCUCC	1510
		GGGCUGG							CCAGCCC
		GGAGGUG							GCGCCCU
		GA
1588325	1588323	AGCUGGG	1347	3755	3776	982	1003	1588324	GGCAGCU	1511
		GAGGUGG							CCACCUC
		AGCUGCCC							CCCAGCU
		C
1588332	1588329	AUGCCCCG	1348	3739	3760	966	987	1588330	GGGAACC	1512
		GCUUGGG							CCAAGCC
		GUUCCCAC							GGGGCAU
1588335	1588333	ACUUGGG	1349	3731	3752	958	979	1588334	GGCGGCG	1513
		GUUCCCAC							UGGGAAC
		GCCGCCCC							CCCAAGU
1588341	1588339	ACGCCCCG	1350	3715	3736	942	963	1588340	GUCCCCA	1514
		GCGACCU							GGUCGCC
		GGGGACC							GGGGCGU
		C
1588344	1588342	ACGACCU	1351	3707	3728	934	955	1588343	GGGCCGG	1515
		GGGGACC							GGUCCCC
		CCGGCCCC							AGGUCGU
		A
1588347	1588345	AGGACCCC	1352	3699	3720	926	947	1588346	UGGGGCU	1516
		GGCCCCAG							GGGGCCG
		CCCCACC							GGGUCCU
1588350	1588348	AGCCCCAG	1353	3691	3712	918	939	1588349	GUCCGUG	1517
		CCCCACCA							GUGGGGC
		CGGACUC							UGGGGCU
1588353	1588351	ACCCACCA	1354	3683	3704	910	931	1588352	CCAGGGG	1518
		CGGACUCC							AGUCCGU
		CCUGGGA							GGUGGGU
1588356	1588354	AGGACUC	1355	3675	3696	902	923	1588355	CCCACGU	1519
		CCCUGGG							CCCAGGG
		ACGUGGG							GAGUCCU
		UG
1588359	1588357	ACUGGGA	1356	3667	3688	894	915	1588358	UUGCGCC	1520
		CGUGGGU							ACCCACG
		GGCGCAA							UCCCAGU
		GC
1588362	1588360	AUGGGUG	1357	3659	3680	886	907	1588361	AGGGGUG	1521
		GCGCAAG							CUUGCGC
		CACCCCUU							CACCCAU
		G
1588365	1588363	AGCAAGC	1358	3651	3672	878	899	1588364	CAGGGCC	1522
		ACCCCUUG							AAGGGGU
		GCCCUGCG							GCUUGCU
1588368	1588366	ACCCUUG	1359	3643	3664	870	891	1588367	CGGGGCC	1523
		GCCCUGCG							GCAGGGC
		GCCCCGCU							CAAGGGU
1588371	1588369	ACCUGCG	1360	3635	3656	862	883	1588370	CGCUCAA	1524
		GCCCCGCU							GCGGGGC
		UGAGCGG							CGCAGGU
		G
1588374	1588372	ACCCGCUU	1361	3627	3648	854	875	1588373	CCUGGGC	1525
		GAGCGGG							CCGCUCA
		CCCAGGCU							AGCGGGU
1588377	1588375	AAGCGGG	1362	3619	3640	846	867	1588376	UGGCACA	1526
		CCCAGGCU							GCCUGGG
		GUGCCACC							CCCGCUU
1588380	1588378	ACAGGCU	1363	3611	3632	838	859	1588379	CUGCGCG	1527
		GUGCCACC							GUGGCAC
		GCGCAGG							AGCCUGU
		G
1588386	1588384	AGCAGGG	1364	3595	3616	822	843	1588385	ACGGCCU	1528
		GCCCGGCA							GCCGGGC
		GGCCGUC							CCCUGCU
		G
1588389	1588387	ACCGGCA	1365	3587	3608	814	835	1588388	GCAGCGC	1529
		GGCCGUC							GACGGCC
		GCGCUGC							UGCCGGU
		GG
1588392	1588390	ACCGUCGC	1366	3579	3600	806	827	1588391	CGGGACC	1530
		GCUGCGG							CGCAGCG
		GUCCCGG							CGACGGU
		U
1588395	1588393	ACUGCGG	1367	3571	3592	798	819	1588394	GGGAGGA	1531
		GUCCCGG							CCGGGAC
		UCCUCCCG							CCGCAGU
		G
1588401	1588399	AUCCCGGC	1368	3555	3576	782	803	1588400	CACCCGG	1532
		UUUUGCC							GCAAAAG
		CGGGUGC							CCGGGAU
		G
1588413	1588411	AAGGAGC	1369	3523	3544	750	771	1588412	UCUCCCA	1533
		CUGAGGG							CCCUCAG
		UGGGAGA							GCUCCUU
		GC
1588419	1588417	AGAGAGC	1370	3507	3528	734	755	1588418	CCUCCGG	1534
		GCCCCGUC							ACGGGGC
		CGGAGGA							GCUCUCU
		G
1588422	1588420	ACCCGUCC	1371	3499	3520	726	747	1588421	CCCCGGC	1535
		GGAGGAG							UCCUCCG
		CCGGGGC							GACGGGU
		G
1588425	1588423	AGAGGAG	1372	3491	3512	718	739	1588424	CUACGCC	1536
		CCGGGGC							GCCCCGG
		GGCGUAG							CUCCUCU
		GC
1588428	1588426	AGGGGCG	1373	3483	3504	710	731	1588427	GAUUUCG	1537
		GCGUAGG							CCUACGC
		CGAAAUC							CGCCCCU
		CC
1588431	1588429	AGUAGGC	1374	3475	3496	702	723	1588430	CGCGCGG	1538
		GAAAUCC							GGAUUUC
		CCGCGCGC							GCCUACU
		C
1588437	1588435	ACGCGCCG	1375	3459	3480	686	707	1588436	UCCCAAC	1539
		GGGCAGG							CUGCCCC
		UUGGGAG							GGCGCGU
		A
1588440	1588438	AGGCAGG	1376	3451	3472	678	699	1588439	AGGGGAU	1540
		UUGGGAG							CUCCCAA
		AUCCCCUC							CCUGCCU
		U
1588446	1588444	ACCCUCUG	1377	3435	3456	662	683	1588445	CAGGCCG	1541
		CCGGCGCG							CGCCGGC
		GCCUGGC							AGAGGGU
1588449	1588447	ACGGCGC	1378	3427	3448	654	675	1588448	AGCCCAG	1542
		GGCCUGG							CCAGGCC
		CUGGGCU							GCGCCGU
		GC
1588452	1588450	ACCUGGC	1379	3419	3440	646	667	1588451	CGCGCUG	1543
		UGGGCUG							CAGCCCA
		CAGCGCG							GCCAGGU
		GG
1588455	1588453	AGGCUGC	1380	3411	3432	638	659	1588454	GCCGCCC	1544
		AGCGCGG							CCGCGCU
		GGGCGGC							GCAGCCU
		CC
1588458	1588456	ACGCGGG	1381	3403	3424	630	651	1588457	CAGCGAG	1545
		GGCGGCCC							GGCCGCC
		UCGCUGCC							CCCGCGU
1588461	1588459	ACGGCCCU	1382	3395	3416	622	643	1588460	GAGCCAG	1546
		CGCUGCCU							GCAGCGA|
		GGCUCAC							GGGCCGU
1588464	1588462	AGCUGCC	1383	3387	3408	614	635	1588463	GCUUUCG	1547
		UGGCUCA							UGAGCCA
		CGAAAGC							GGCAGCU
		CC
1588467	1588465	AGCUCAC	1384	3379	3400	606	627	1588466	CACAGGG	1548
		GAAAGCC							GGCUUUC
		CCCUGUG							GUGAGCU
		GG
1588473	1588471	AUGUGGG	1385	3363	3384	590	611	1588472	GCGCCUG	1549
		AGAGCCCC							GGGCUCU
		AGGCGCG							CCCACAU
		C
1588476	1588474	AAGCCCCA	1386	3355	3376	582	603	1588475	UGCCCUG	1550
		GGCGCGC							CGCGCCU
		AGGGCAC							GGGGCUU
		G
1588479	1588477	AGCGCGC	1387	3347	3368	574	595	1588478	ACCCCAC	1551
		AGGGCAC							GUGCCCU
		GUGGGGU							GCGCGCU
		GC
1588482	1588480	AGGCACG	1388	3339	3360	566	587	1588481	CUUCCCG	1552
		UGGGGUG							CACCCCA
		CGGGAAG							CGUGCCU
		CC
1588485	1588483	AGGGUGC	1389	3331	3352	558	579	1588484	GAACGGG	1553
		GGGAAGC							GCUUCCC
		CCCGUUCC							GCACCCU
		C
1588488	1588486	AGAAGCC	1390	3323	3344	550	571	1588487	CGCGUGG	1554
		CCGUUCCC							GGAACGG
		CACGCGCC							GGCUUCU
1588491	1588489	AGUUCCCC	1391	3315	3336	542	563	1588490	CACACCG	1555
		ACGCGCCG							GCGCGUG
		GUGUGGG							GGGAACU
1588497	1588495	AUGUGGG	1392	3299	3320	526	547	1588496	GUGGGUC	1556
		CGAAGGC							GCCUUCG
		GACCCACG							CCCACAU
		A
1588500	1588498	AAAGGCG	1393	3291	3312	518	539	1588499	GCUCCCU	1557
		ACCCACGA							CGUGGGU
		GGGAGCA							CGCCUUU
		G
1588503	1588501	ACCACGA	1394	3283	3304	510	531	1588502	GUCACCC	1558
		GGGAGCA							UGCUCCC
		GGGUGAC							UCGUGGU
		CC
1588506	1588504	AGAGCAG	1395	3275	3296	502	523	1588505	CGGCGGG	1559
		GGUGACC							GGUCACC
		CCCGCCGG							CUGCUCU
		G
1588509	1588507	AUGACCCC	1396	3267	3288	494	515	1588508	GCGGCCC	1560
		CGCCGGG							CCGGCGG
		GGCCGCGC							GGGUCAU
1588512	1588510	AGCCGGG	1397	3259	3280	486	507	1588511	UGUGCAG	1561
		GGCCGCGC							CGCGGCC
		UGCACAG							CCCGGCU
		G
1588515	1588513	ACCGCGCU	1398	3251	3272	478	499	1588514	AGGCGGC	1562
		GCACAGG							CUGUGCA
		CCGCCUGC							GCGCGGU
1588518	1588516	ACACAGG	1399	3243	3264	470	491	1588517	GCGCAGG	1563
		CCGCCUGC							CAGGCGG
		CUGCGCG							CCUGUGU
		G
1588521	1588519	AGCCUGCC	1400	3235	3256	462	483	1588520	GGGCGCC	1564
		UGCGCGG							CGCGCAG
		GCGCCCUG							GCAGGCU
1588527	1588525	AGCCCUGC	1401	3219	3240	446	467	1588526	CCGGGAC	1565
		CACCCUGU							AGGGUGG
		CCCGGGU							CAGGGCU
1588530	1588528	AACCCUG	1402	3211	3232	438	459	1588529	CCAGGCA	1566
		UCCCGGG							CCCGGGA
		UGCCUGG							CAGGGUU
		CC
1588533	1588531	ACCGGGU	1403	3203	3224	430	451	1588532	UCGAAGG	1567
		GCCUGGCC							GCCAGGC
		CUUCGAU							ACCCGGU
		U
1588536	1588534	ACUGGCCC	1404	3195	3216	422	443	1588535	UUUCAGA	1568
		UUCGAUU							AUCGAAG
		CUGAAAC							GGCCAGU
		C
1588545	1588543	AAUCUGA	1405	3171	3192	398	419	1588544	CCGGAGU	1569
		AUCCUGG							CCAGGAU
		ACUCCGG							UCAGAUU
		GA
1588554	1588552	ACCCGUCU	1406	3147	3168	374	395	1588553	GAGCUGG	1570
		CUCUGGCC							CCAGAGA
		AGCUCCU							GACGGGU
1588557	1588555	AUCUGGC	1407	3139	3160	366	387	1588556	CCCGGGA	1571
		CAGCUCCU							GGAGCUG
		CCCGGGCG							GCCAGAU
1588563	1588561	ACGGGCG	1408	3123	3144	350	371	1588562	UUUCCAG	1572
		GCGAUGC							GCAUCGC
		CUGGAAA							CGCCCGU
		GC
1588566	1588564	AGAUGCC	1409	3115	3136	342	363	1588565	AGGAUCG	1573
		UGGAAAG							CUUUCCA
		CGAUCCU							GGCAUCU
		UC
1588569	1588567	AGAAAGC	1410	3107	3128	334	355	1588568	CUUUGAG	1574
		GAUCCUU							AAGGAUC
		CUCAAAG							GCUUUCU
		GC
1588575	1588573	AAAAGGC	1411	3091	3112	318	339	1588574	CCCUGCU	1575
		UCGGAGG							CCUCCGA
		AGCAGGG							GCCUUUU
		CG
1588578	1588576	AGGAGGA	1412	3083	3104	310	331	1588577	CCAGACC	1576
		GCAGGGC							GCCCUGC
		GGUCUGG							UCCUCCU
		GA
1588581	1588579	AAGGGCG	1413	3075	3096	302	323	1588580	ACCGGAU	1577
		GUCUGGG							CCCAGAC
		AUCCGGU							CGCCCUU
		GA
1588587	1588585	ACGGUGA	1414	3059	3080	286	307	1588586	AAAGCGG	1578
		CGGCGGU							ACCGCCG
		CCGCUUUC							UCACCGU
		G
1588590	1588588	AGCGGUC	1415	3051	3072	278	299	1588589	GGCCGGC	1579
		CGCUUUC							GAAAGCG
		GCCGGCCU							GACCGCU
		U
1588593	1588591	ACUUUCG	1416	3043	3064	270	291	1588592	CGCCAGA	1580
		CCGGCCUU							AGGCCGG
		CUGGCGG							CGAAAGU
		G
1588596	1588594	AGGCCUU	1417	3035	3056	262	283	1588595	ACGCGGC	1581
		CUGGCGG							CCGCCAG
		GCCGCGUC							AAGGCCU
		U
1588602	1588600	AGCGUCU	1418	3019	3040	246	267	1588601	GGCCCUG	1582
		CCCGGGCC							GCCCGGG
		AGGGCCG							AGACGCU
		A
1588605	1588603	ACGGGCC	1419	3011	3032	238	259	1588604	GGAAUCU	1583
		AGGGCCG							CGGCCCU
		AGAUUCC							GGCCCGU
		CG
1588608	1588606	AGGCCGA	1420	3003	3024	230	251	1588607	CACCGGC	1584
		GAUUCCC							GGGAAUC
		GCCGGUG							UCGGCCU
		CU
1588614	1588612	AGGUGCU	1421	2987	3008	214	235	1588613	ACGCCAG	1585
		GCCUCAGC							CUGAGGC
		UGGCGUG							AGCACCU
		A
1588617	1588615	ACUCAGC	1422	2979	3000	206	227	1588616	GAGAGGU	1586
		UGGCGUG							CACGCCA
		ACCUCUCA							GCUGAGU
		U
1588620	1588618	AGCGUGA	1423	2971	2992	198	219	1588619	UUCAGAA	1587
		CCUCUCAU							UGAGAGG
		UCUGAAA							UCACGCU
		C
1588623	1588621	AUCUCAU	1424	2963	2984	190	211	1588622	GAUUUGG	1588
		UCUGAAA							UUUCAGA
		CCAAAUC							AUGAGAU
		UG
1588626	1588624	AUGAAAC	1425	2955	2976	182	203	1588625	AGGGUCC	1589
		CAAAUCU							AGAUUUG
		GGACCCU							GUUUCAU
		GG
1588635	1588633	AUCCGGA	1426	2931	2952	158	179	1588634	CAGGCCA	1590
		AUGCCGA							UCGGCAU
		UGGCCUG							UCCGGAU
		GG
1588641	1588639	ACCUGGG	1427	2915	2936	142	163	1588640	CAGAGAA	1591
		CCAGCCGU							CGGCUGG
		UCUCUGG							CCCAGGU
		U
1588644	1588642	AAGCCGU	1428	2907	2928	134	155	1588643	AUCGCCA	1592
		UCUCUGG							CCAGAGA
		UGGCGAU							ACGGCUU
		GC
1588647	1588645	AUCUGGU	1429	2899	2920	126	147	1588646	ACCCGGG	1593
		GGCGAUG							CAUCGCC
		CCCGGGU							ACCAGAU
		AC
1588650	1588648	ACGAUGC	1430	2891	2912	118	139	1588649	GAACCCG	1594
		CCGGGUA							UACCCGG
		CGGGUUC							GCAUCGU
		CG
1588653	1588651	AGGGUAC	1431	2883	2904	110	131	1588652	UUUGAGC	1595
		GGGUUCC							GGAACCC
		GCUCAAA							GUACCCU
		GC
1588656	1588654	AGUUCCG	1432	2875	2896	102	123	1588655	GAGCCUG	1596
		CUCAAAG							CUUUGAG
		CAGGCUC							CGGAACU
		GC
1588662	1588660	AGCUCGC	1433	2859	2880	86	107	1588661	CAAAGCG	1597
		AGGGCCU							AGGCCCU
		CGCUUUG							GCGAGCU
		GC
1588665	1588663	AGGCCUC	1434	2851	2872	78	99	1588664	CCCCGAG	1598
		GCUUUGG							CCAAAGC
		CUCGGGG							GAGGCCU
		UC
1588668	1588666	AUUUGGC	1435	2843	2864	70	91	1588667	CGUUUGG	|1599
		UCGGGGU							ACCCCGA
		CCAAACG							GCCAAAU
		AG
1588671	1588669	AGGGGUC	1436	2835	2856	62	83	1588670	CGGAGAC	1600
		CAAACGA							UCGUUUG
		GUCUCCG							GACCCCU
		UC
1588677	1588675	AUCCGUC	1437	2819	2840	46	67	1588676	GGGACGA	1601
		GCCGUCCU							GGACGGC
		CGUCCCCG							GACGGAU
1588680	1588678	ACGUCCUC	1438	2811	2832	38	59	1588679	GAAGCCC	1602
		GUCCCCGG							GGGGACG
		GCUUCCG							AGGACGU
1588683	1588681	AUCCCCGG	1439	2803	2824	30	51	1588682	UCCCCGC	1603
		GCUUCCGC							GGAAGCC
		GGGGAGG							CGGGGAU
1588686	1588684	ACUUCCGC	1440	2795	2816	22	43	1588685	CAGCACC	1604
		GGGGAGG							CUCCCCG
		GUGCUGU							CGGAAGU
		C
1588689	1588687	AGGGAGG	1441	2787	2808	14	35	1588688	CCCUCGG	1605
		GUGCUGU							ACAGCAC
		CCGAGGG							CCUCCCU
		UG
1588695	1588693	AAGGGUG	1442	2771	2792	N/A	N/A	1588694	GAUGGCC	1606
		UCGGGAG							CUCCCGA
		GGCCAUC							CACCCUU
		GC
1588698	1588696	AGGGAGG	1443	2763	2784	N/A	N/A	1588697	CUCACCG	1607
		GCCAUCGC							CGAUGGC
		GGUGAGC							CCUCCCU
		C
1588701	1588699	ACAUCGC	1444	2755	2776	N/A	N/A	1588700	GGCCGGG	1608
		GGUGAGC							GCUCACC
		CCCGGCCG							GCGAUGU
		G
1588704	1588702	AUGAGCC	1445	2747	2768	N/A	N/A	1588703	GAAAUUC	1609
		CCGGCCGG							CGGCCGG
		AAUUUCA							GGCUCAU
		C
1588707	1588705	AGGCCGG	1446	2739	2760	N/A	N/A	1588706	CCGUCCG	1610
		AAUUUCA							UGAAAUU
		CGGACGG							CCGGCCU
		AC
1588713	1588711	AACGGAC	1447	2723	2744	N/A	N/A	1588712	CUCUCUC	1611
		GCGGGCA							UGCCCGC
		GAGAGAG							GUCCGUU
		GC
1588716	1588714	AGGGCAG	1448	2715	2736	N/A	N/A	1588715	CCGCCGG	1612
		AGAGAGG							CCUCUCU
		CCGGCGG							CUGCCCU
		GC
1588719	1588717	AAGAGGC	1449	2707	2728	N/A	N/A	1588718	ACGGGAG	1613
		CGGCGGG							CCCGCCG
		CUCCCGUG							GCCUCUU
		C
1588722	1588720	AGCGGGC	1450	2699	2720	N/A	N/A	1588721	UGAGGUG	1614
		UCCCGUGC							CACGGGA
		ACCUCAGC							GCCCGCU
1588725	1588723	ACCGUGC	1451	2691	2712	N/A	N/A	1588724	AGUCCGG	1615
		ACCUCAGC							CUGAGGU
		CGGACUG							GCACGGU
		U
1588728	1588726	ACUCAGCC	1452	2683	2704	N/A	N/A	1588727	CAGUGCA	1616
		GGACUGU							CAGUCCG
		GCACUGC							GCUGAGU
		G
1588731	1588729	AGACUGU	1453	2675	2696	N/A	N/A	1588730	ACCUGCC	1617
		GCACUGC							GCAGUGC
		GGCAGGU							ACAGUCU
		GC
1588734	1588732	AACUGCG	1454	2667	2688	N/A	N/A	1588733	CUGGCUG	1618
		GCAGGUG							CACCUGC
		CAGCCAG							CGCAGUU
		GA
1588737	1588735	AAGGUGC	1455	2659	2680	N/A	N/A	1588736	CAGGCCU	1619
		AGCCAGG							CCUGGCU
		AGGCCUG							GCACCUU
		CC
1588740	1588738	ACCAGGA	1456	2651	2672	N/A	N/A	1588739	UGUCCGG	1620
		GGCCUGCC							GCAGGCC
		CGGACAG							UCCUGGU
		C
1588743	1588741	ACCUGCCC	1457	2643	2664	N/A	N/A	1588742	UGGCUGG	1621
		GGACAGC							CUGUCCG
		CAGCCAGC							GGCAGGU
1588746	1588744	AGACAGC	1458	2635	2656	N/A	N/A	1588745	UGGCUGG	1622
		CAGCCAGC							CUGGCUG
		CAGCCAGC							GCUGUCU
1588755	1588753	AUAUAGG	1459	4823	4844	1688	1709	1588754	CCCUCCC	1623
		AUCCACA							UGUGGAU
		GGGAGGG							CCUAUAU
		GG
1588761	1588759	ACAGGAG	1460	4772	4793	1637	1658	1588760	GAUUAGA	1624
		AUGUAAC							GUUACAU
		UCUAAUC							CUCCUGU
		CA
1588770	1588768	AGGGAGA	1461	4721	4742	1586	1607	1588769	AUUCUGG	1625
		CAUUCAG							CUGAAUG
		CCAGAAU							UCUCCCU
		UU
1588773	1588771	AAAUUUC	1462	4704	4725	1569	1590	1588772	CCUUGUU	1626
		ACGGAAG							CUUCCGU
		AACAAGG							GAAAUUU
		GC
1588785	1588783	AGUACCU	1463	4257	4278	1484	1505	1588784	CCCAGAG	1627
		GGGCCGG							CCGGCCC
		CUCUGGG							AGGUACU
		AU
1588791	1588789	ACAGGAA	1464	4223	4244	N/A	N/A	1588790	AGAACUG	1628
		AGAAAGG							CCUUUCU
		CAGUUCU							UUCCUGU
		CC
1588803	1588801	ACCAGGCC	1465	4155	4176	1382	1403	1588802	CACCGGG	1629
		GGUCAGC							CUGACCG
		CCGGUGG							GCCUGGU
		A
1588806	1588804	AGUGGAG	1466	4138	4159	1365	1386	1588805	CUCCGCC	1630
		GGGGCGG							CCGCCCC
		GGCGGAG							CUCCACU
		AC
1588809	1588807	AGAGACA	1467	4121	4142	1348	1369	1588808	GCUACGG	1631
		CGCCCCUC							AGGGGCG
		CGUAGCC							UGUCUCU
		A
1588815	1588813	ACCGCGA	1468	4087	4108	1314	1335	1588814	CGGUGGC	1632
		AAGAGAG							CUCUCUU
		GCCACCGC							UCGCGGU
		C
1588184	1588182	AAGGUCU	1469	N/A	N/A	1494	1515	1588183	GCCCAGG	1633
		GCUGGUA							UACCAGC
		CCUGGGCC							AGACCUU
		G
1588202	1588200	AAAAGAA	1470	N/A	N/A	1446	1467	1588201	GCGGAGA	1634
		UGGCAGU							ACUGCCA
		UCUCCGCG							UUCUUUU
		G
1588205	1588203	AGCAGUU	1471	N/A	N/A	1438	1459	1588204	UCCACAC	1635
		CUCCGCGG							CGCGGAG
		UGUGGAG							AACUGCU
		U
1588407	1588405	AGGUGCG	1472	N/A	N/A	766	787	1588406	UCCUCGC	1636
		GAGGCCA							UGGCCUC
		GCGAGGA							CGCACCU
		GC
1588782	1588780	AUGCGCG	1473	N/A	N/A	1501	1522	1588781	UACCAGC	1637
		CAGGUCU							AGACCUG
		GCUGGUA							CGCGCAU
		CC

“Start site” indicates the 5′-most nucleoside to which the antisense RNAi oligonucleotide is complementary in the human gene sequence. “Stop site” indicates the 3′-most nucleoside to which the antisense RNAi oligonucleotide is complementary in the human gene sequence. The antisense RNAi oligonucleotide listed in the table below is complementary to SEQ ID NO: 4 (GENBANK Accession No. NM_001293798.2), with the exception of a single mismatch at position 1 (from 5′ to 3′) of the antisense RNAi oligonucleotide.

TABLE 25
Design of RNAi compounds targeted to human DUX4, SEQ ID NO: 4
		Antisense		SEQ ID	SEQ ID		Sense
Duplex	Antisense	Strand		NO: 4	NO: 4	Sense	Strand	SEQ
Compound	Strand	Sequence	SEQ	Antisense	Antisense	Strand	Sequence	ID
Number	Oligo ID	(5′ to 3′)	ID NO	Start Site	Stop Site	Oligo ID	(5′ to 3′)	NO
1588217	1588215	AGCCUAGA	1638	1270	1291	1588216	UUAGGAC	1639
		CCCCGCGUC					GCGGGGU
		CUAAAG					CUAGGCU

Example 13: Effect of RNAi Compounds on Human DUX4 RNA In Vitro, Single Dose

RNAi compounds described herein above were tested in 54-2 cells (Resnick et al., 2019, Cell Reports 29, 1812-1820). The RNAi compounds were tested in a series of experiments that had the same culture conditions.

54-2 cells were differentiated as described herein above and transfected with RNAi compounds at a concentration of 200 nM using Lipofectin. After a treatment period of approximately 24 hours, total RNA was isolated from the cells and DUX4 RNA levels were measured by quantitative real-time RTPCR.

DUX4 RNA was measured by primer probe set RTS40199 (described herein above). DUX4 RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. The level of DUX4 RNA is presented in the tables below as percent DUX4 RNA relative to the amount of DUX4 RNA in untreated control cells (% UTC). Each table represents results from an individual assay plate. The values marked with a “?” indicate that the RNAi compound is complementary to the amplicon region of the primer probe set.

TABLE 26
Reduction of human DUX4 RNA by RNAi compounds
in differentiated 54-2 cells
Compound No. DUX4 (% UTC)
1586340      13
1586341      17
1588142      15†
1588166      114†
1588190      140
1588196      66
1588199      76
1588226      107
1588235      85
1588250      110
1588253      109
1588617      83
1588620      45
1588623      8
1588626      13
1588629      259
1588632      64
1588635      137
1588638      97
1588641      130
1588644      60
1588647      110
1588650      72
1588653      74
1588656      43
1588659      96
1588662      56
1588665      57
1588668      78
1588671      68
1588674      21
1588677      100
1588680      92
1588683      93
1588686      73
1588689      111
1588692      52
1588695      93
1588698      107
1588701      154
1588704      63
1588707      55
1588710      20
1588713      105
1588716      72
1588719      116
1588722      71
1588725      145
1588728      107
1588731      81
1588734      50
1588737      117
1588740      88
1588743      96
1588746      81
1588749      184
1588752      86
1588755      79
1588758      23
1588761      11†
1588764      26†
1588767      56†
1588770      48†
1588773      12†
1588776      68†
1588779      221
1588782      96
1588785      83
1588788      102
1588791      133
1588794      90
1588797      107
1588800      116
1588803      130
1588806      49
1588809      80
1588812      108
1588815      81

TABLE 27
Reduction of human DUX4 RNA by RNAi compounds
in differentiated 54-2 cells
Compound No. DUX4 (% UTC)
1588383      216
1588386      86
1588389      108
1588392      170
1588395      150
1588398      129
1588401      175
1588404      85
1588407      53
1588410      120
1588413      62
1588416      92
1588419      50
1588422      80
1588425      75
1588428      93
1588431      29
1588434      45
1588437      50
1588440      93
1588443      51
1588446      110
1588449      79
1588452      111
1588455      88
1588458      145
1588461      59
1588464      86
1588467      16
1588470      72
1588473      108
1588476      110
1588479      40
1588482      112
1588485      90
1588488      56
1588491      44
1588494      101
1588497      71
1588500      98
1588503      72
1588506      80
1588509      46
1588512      98
1588515      71
1588518      230
1588521      78
1588524      88
1588527      128
1588530      218
1588533      114
1588536      58
1588539      7
1588542      7
1588545      36
1588548      107
1588551      162
1588554      42
1588557      77
1588560      85
1588563      127
1588566      73
1588569      9
1588572      37
1588575      105
1588578      42
1588581      96
1588584      83
1588587      112
1588590      80
1588593      75
1588596      79
1588599      81
1588602      75
1588605      104
1588608      98
1588611      69
1588614      50

TABLE 28
Reduction of human DUX4 RNA by RNAi compounds
in differentiated 54-2 cells
Compound No. DUX4 (% UTC)
1588121      7†
1588124      23†
1588127      5†
1588130      22†
1588133      4†
1588136      25†
1588139      10†
1588145      12†
1588148      39†
1588151      16†
1588154      2†
1588157      12†
1588160      17†
1588163      36†
1588169      76
1588172      44
1588175      92
1588178      58
1588181      77
1588184      115
1588187      95
1588193      75
1588202      94
1588205      48
1588208      87
1588211      99
1588214      112
1588217      79
1588220      90
1588223      75
1588229      34
1588232      36
1588238      41
1588241      50
1588244      131
1588247      32
1588256      63
1588259      49
1588262      51
1588265      78
1588268      55
1588271      82
1588274      62
1588277      83
1588280      71
1588283      40
1588286      20
1588289      109
1588292      102
1588295      146
1588298      60
1588301      85
1588304      89
1588307      29
1588310      84
1588313      33
1588316      53
1588319      152
1588322      11
1588325      236
1588328      91
1588332      105
1588335      109
1588338      109
1588341      193
1588344      91
1588347      43
1588350      76
1588353      123
1588356      57
1588359      88
1588362      83
1588365      126
1588368      129
1588371      31
1588374      117
1588377      59
1588380      80

Claims

1.-4. (canceled)

5. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or 23 nucleobases complementary to: wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage.

6. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or 23 nucleobases of a sequence selected from: wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage.

7. The oligomeric compound of claim 5, wherein the modified oligonucleotide has a nucleobase sequence that is at least 8500, at least 900%, at least 9500, or 100% complementary to any of the nucleobase sequences of SEQ ID NOs: 1-4 when measured across the entire nucleobase sequence of the modified oligonucleotide.

8. The oligomeric compound of claim 5, wherein the modified oligonucleotide consists of 12 to 20, 12 to 25, 12 to 30, 12 to 50, 13 to 20, 13 to 25, 13 to 30, 13 to 50, 14 to 20, 14 to 25, 14 to 30, 14 to 50, 15 to 20, 15 to 25, 15 to 30, 15 to 50, 16 to 18, 16 to 20, 16 to 25, 16 to 30, 16 to 50, 17 to 20, 17 to 25, 17 to 30, 17 to 50, 18 to 20, 18 to 25, 18 to 30, 18 to 50, 19 to 20, 19 to 25, 19 to 30, 19 to 50, 20 to 25, 20 to 30, 20 to 50, 21 to 25, 21 to 30, 21 to 50, 22 to 25, 22 to 30, 22 to 50, 23 to 25, 23 to 30, or 23 to 50 linked nucleosides.

9. The oligomeric compound of claim 5, wherein the modified oligonucleotide comprises at least one modified nucleoside.

10. The oligomeric compound of claim 9, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a modified sugar moiety.

11. The oligomeric compound of claim 10, wherein the modified sugar moiety is a bicyclic sugar moiety.

12. The oligomeric compound of claim 11, wherein the bicyclic sugar moiety comprises a 2′-4′ bridge selected from —O—CH2—; and —O—CH(CH3)—.

13. The oligomeric compound of claim 10, wherein the modified sugar moiety is a non-bicyclic modified sugar moiety.

14. The oligomeric compound of claim 13, wherein the non-bicyclic modified sugar moiety is a 2′-O(CH2)2OCH3 ribosyl sugar moiety, a cEt sugar moiety, a 2′-OMe sugar moiety, or a 2′-F sugar moiety.

15. The oligomeric compound of claim 10, wherein the modified sugar moiety is a sugar surrogate.

16. The oligomeric compound of claim 15, wherein the sugar surrogate is any of morpholino, modified morpholino, PNA, THP, and F-HNA.

17. The oligomeric compound of claim 5, wherein the modified oligonucleotide has a sugar motif comprising: a 5′-region consisting of 1-6 linked 5′-region nucleosides;a central region consisting of 6-10 linked central region nucleosides; anda 3′-region consisting of 1-6 linked 3′-region nucleosides; whereineach of the 5′-region nucleosides and each of the 3′-region nucleosides comprises a modified sugar moiety and each of the central region nucleosides comprises a 2′-β-D-deoxyribosyl sugar moiety.

18.-21. (canceled)

22. The oligomeric compound of claim 5, wherein the modified oligonucleotide comprises at least one modified internucleoside linkage.

23. (canceled)

24. The oligomeric compound of claim 22, wherein at least one internucleoside linkage is a phosphorothioate internucleoside linkage.

25. (canceled)

26. The oligomeric compound of claim 22, wherein each internucleoside linkage is independently selected from a phosphodiester internucleoside linkage and a phosphorothioate internucleoside linkage.

27. (canceled)

28. The oligomeric compound of claim 5, wherein the modified oligonucleotide comprises a modified nucleobase.

29. The oligomeric compound of claim 28, wherein the modified nucleobase is a 5-methylcytosine.

30. The oligomeric compound of claim 5, wherein the modified oligonucleotide consists of 12-30, 12-22, 12-20,14-18, 14-20, 15-17, 15-25, 16-20, 18-22 or 18-20 linked nucleosides, or a pharmaceutically acceptable salt thereof.

31. The oligomeric compound of claim 30, which is a pharmaceutically acceptable salt comprising one or more cations selected from sodium, potassium, calcium, and magnesium.

32.-35. (canceled)

36. The oligomeric compound of claim 5, consisting of the modified oligonucleotide.

37. The oligomeric compound of claim 5, consisting of the modified oligonucleotide and a conjugate group.

38.-113. (canceled)

114. A pharmaceutical composition comprising an oligomeric compound of claim 5 and a pharmaceutically acceptable diluent.

115. The pharmaceutical composition of claim 114, wherein the pharmaceutically acceptable diluent is phosphate buffered saline (PBS).

116. The pharmaceutical composition of claim 115, wherein the pharmaceutical composition consists essentially of the oligomeric compound and PBS.

117.-133. (canceled)

134. The oligomeric compound of claim 6, wherein the modified sugar moiety is a bicyclic modified sugar moiety.

135. The oligomeric compound of claim 6, wherein the modified sugar moiety is a non-bicyclic modified sugar moiety.

136. The oligomeric compound of claim 6, wherein the modified internucleoside linkage is a phosphorothioate internucleoside linkage.

137. A pharmaceutical composition comprising an oligomeric compound of claim 6 and a pharmaceutically acceptable diluent.

138. The pharmaceutical composition of claim 137, wherein the pharmaceutically acceptable diluent is phosphate buffered saline (PBS).