Patent Application
20240263191
The present invention relates to a nucleic acid construct allowing to drive the expression of a transcription factor in rod cells or cone cells thereby silencing the expression of a gene which mutated form is responsible for a retinal dystrophy and its medical use, relative expression vector, host cell, viral particle and pharmaceutical composition.
Transcription factors (TFs) control space- and time-dependent activation or repression of genes to control biological functions (1). They regulate these genetic programs by genome-wide scanning of DNA sequences and eventually binding to discrete motifs present in gene regulatory regions (promoters and enhancers) (2, 3). TFs have an intrinsic ability to recognize primary nucleotide DNA sequence motifs (a base readout (4) of typically 5-15 bp). The principles of TF protein-DNA recognition have enabled the determination of their DNA binding preferences and the design of synthetic TFs directed to specific genomic DNA sequences (5, 6). However, individual TFs and TF family members show differential DNA binding preferences indicating that the TF-DNA recognition code is far from being fully elucidated (7), particularly in vivo. Local and distal chromosomal features, protein-protein interactions, and nuclear topography are emerging as determinants conditioning the DNA accessibility, binding and ultimately activity of TFs (8-10). These features are inherent to cell-specific composition and may be envisaged as extrinsic co-factors that complement the intrinsic TF recognition properties for DNA base readout: somatic cells of an individual organism have the same DNA sequence (syngeneic) while expressing cell-specific factors.
The retina is a layered structure composed of six neuronal and one glial cell type, which are organized in three cellular layers: the ganglion cell layer, comprising retinal ganglion (RGC) and displaced amacrine cells, the inner nuclear layer (INL), which contains bipolar, horizontal and amacrine interneurons and Müller glial cells, and the outer nuclear layer (ONL), where rod and cone photoreceptors are located. The retina is immediately adjacent to the retinal pigment epithelium (RPE), a pigmented cell layer that nourishes retinal visual cells, and is firmly attached to the underlying choroid and overlying retinal visual cells.
Rod and cone photoreceptors are the first and key transducer of light in electrical responses thus are essential for vision. Rod and cone photoreceptors display similar phenotypic features to capture and transduce light stimuli. Cones show high sensitivity for bright light, while rods show sensitivity for dim light. Rod and cone photoreceptors are anatomically located next one another and biochemically share several proteins of phototransduction cascade while others are cone and rod specific. Mutation affecting cone-specific genes typically generate cone dystrophies (COD) and cone-rod dystrophies (CORD). Mutation affecting rod-specific genes typically generate Retinitis Pigmentosa (RP), Leber Congenital Amaurosis (LCA) or rod-cone dystrophy (RCD).
Inherited retinal dystrophies (IRDs) represent one of the most frequent causes of genetic blindness in the western world. The primary condition that underlies this group of diseases is the degeneration of photoreceptors, i.e., the cells that convert the light information into chemical and electrical signals that are then transmitted to the brain through the visual circuits. There are two types of photoreceptor cells in the human retina: rods and cones. Rods represent about 95% of photoreceptor cells in the human retina and are responsible for sensing contrast, brightness and motion, whereas fine resolution, spatial resolution and color vision are perceived by cones.
IRDs can be subdivided into different groups of diseases, namely Retinitis Pigmentosa (RP), Leber Congenital Amaurosis (LCA), cone-rod dystrophies (CORD) and cone dystrophies (COD), rod-cone dystrophy (RCD).
RP is the most frequent form of inherited retinal dystrophy with an approximate frequency of about 1 in 4,000 individuals (E. L. Berson, Invest Ophtalmol Vis Sci 34, 1659 (1993)). At its clinical onset, RP is characterized by night blindness and progressive degeneration of photoreceptors accompanied by bone spicule-like pigmentary deposits and a reduced or absent electroretinogram (ERG). RP is characterized by primary loss in rod photoreceptors, later followed by the secondary loss in cone photoreceptors; it can be either isolated or syndromic, i.e., associated with extraocular manifestations such as in Usher syndrome or in Bardet-Biedle syndrome. From a genetic point of view, RP is highly heterogeneous, with autosomal dominant, autosomal recessive and X-linked patterns of inheritance. A significant percentage of RP patients, however, are apparently sporadic. To date, around 50 causative genes/loci have been found to be responsible for non-syndromic forms of RP and over 25 for syndromic RPs (RETnet web site: http://www.sph.uth.tmc.edu/RetNet/).
LCA has a prevalence of about 2-3 in 100,000 individuals and is characterized by a severe visual impairment that starts in the first months/years of life (F. P. Cremers, et al., Hum. Mol. Genet. 11, 1169 (May 15, 2002). LCA has retinal, ocular as well as extraocular features, and occasionally systemic associations. LCA is genetically heterogeneous. The autosomal dominant Leber congenital amaurosis, is due to mutations in the Inosine-5′-monophosphate dehydrogenase 1 (IMPDH1), OTX2 and CRX genes. While IMPDH1 is ubiquitously expressed, OTX2 and CRX are mainly retinal-specific and affect primarily photoreceptors.
IRDs of interest for the present invention are due to the degeneration and subsequent death of photoreceptor cells, primarily rod photoreceptors, followed by a secondary degeneration of cones. Genes responsible for IRDs of interest to the present inventions are expressed predominantly in photoreceptors, particularly in rods the main consequence that derives from the dysfunction of these genes is a damage of photoreceptor function, which then translate into photoreceptor degeneration and death. For most forms of the above-mentioned diseases an effective therapy is currently unavailable.
IRDs of interest for the present invention are due to the degeneration and subsequent death of photoreceptor cells, primarily rod photoreceptors, followed by a secondary degeneration of cones. Genes responsible for IRDs of interest to the present inventions are expressed predominantly in photoreceptors, particularly in rods the main consequence that derives from the dysfunction of these genes is a damage of photoreceptor function, which then translate into photoreceptor degeneration and death. For most forms of the above-mentioned diseases an effective therapy is currently unavailable.
IRDs with dominant pattern of inheritance have been associated to genes expressed predominantly in the retina; of particular interest to the present invention are the Rhodopsin (RHO), Peripherin 2 (PRPH2), Retinitis Pigmentosa 1 protein (RP1), Cone-Rod homeobox (CRX) nuclear receptor subfamily 2 group E3 (NR2E3), neural retina leucine zipper (NRL), retinal outer segment membrane protein 1 (ROM1).
Known genes causing autosomal dominant IRDs and associated proteins names are listed in Table 1.
Currently, there are no effective treatments for IRDs. Nutritional therapy featuring vitamin A or vitamin A plus docosahexaenoic acid reduces the rate of degeneration in some patients. Retinal analogs and pharmaceuticals functioning as chaperones show some progress in protecting the retina in animal models, and several antioxidant studies have shown lipophilic antioxidant taurousodeoxycholic acid (TUDCA), metallocomplex zinc desferrioxamine, N-acetyl-cysteine, and a mixture of antioxidants slow retinal degeneration in rodent rd1, rd10, and Q344ter models. A clinical trial is under way to test the efficacy of the protein deacetylase inhibitor valproic acid as a treatment for retinitis pigmentosa. Valproic acid blocks T-type calcium channels and voltage-gated sodium channels and is associated with significant side effects such as hearing loss and diarrhea. Thus, the use of valproic acid as a treatment for retinitis pigmentosa has been questioned (Rossmiller et al. Molecular Vision 2012; 18:2479-2496).
Therefore, there is still the need for a treatment of retinal dystrophies that is efficient and selective.
Cone-rod dystrophies (CRDs) have a prevalence of 1/40,000 individuals and are characterized by retinal pigment deposits visible upon fundus examination, predominantly localized to the macular region. In contrast to typical RP, which is characterized by primary loss in rod photoreceptors, later followed by the secondary loss in cone photoreceptors, CRDs reflect the opposite sequence of events. CRD is characterized by a primary cone involvement, that explains the predominant symptoms of CRDs: decreased visual acuity, color vision defects, photo-aversion and decreased sensitivity in the central visual field, later followed by progressive loss in peripheral vision and night blindness (C. P. Hamel, Orphanet J Rare Dis 2, 7 (2007). Mutations in at least 20 different genes have been associated with CRD (RETnet web site: http://www.sph.uth.tmc.edu/RetNet/).
Cone dystrophies (CD) are conditions in which cone photoreceptors display a selective dysfunction that does not extend to rods. They are characterized by visual deficit, abnormalities of color vision, visual field loss, and a variable degree of nystagmus and photophobia. In CDs, cone function is absent or severely impaired on electroretinography (ERG) and psychophysical testing (M. Michaelides, et al. Surv. Ophthalmol. 51, 232 (May-June, 2006). Similar to the other forms of inherited retinal dystrophies, CDs are heterogeneous conditions that can be caused by mutations in at least 10 different genes (RETnet web site: http://www.sph.uth.tmc.edu/RetNet/).
Cone dystrophies and cone-rod dystrophies have been associated to genes expressed predominantly in the retina; of particular interest to the present invention are retinal guanylate cyclase 2D (GUCY2D), and, guanylate cyclase activator 1A (GUCA1A)
The genome-wide activity of transcription factors (TFs) on multiple regulatory elements precludes their use as gene specific regulators. The present inventors surprisingly show that ectopic expression of a TF in a cell-specific context can be used to silence the expression of a specific gene as a therapeutic approach to regulate gene expression in human disease.
Surprisingly, the present inventors found that cell-specific context conditioning of the activity of a TF can be successfully applied to somatic gene-targeted manipulation and gene therapy of retinal diseases, particularly inherited retinal dystrophies, more particularly retinal dystrophies wherein the primary disease is a rod disease or a cone disease, eg a disease affecting primarily rod or cone photoreceptors.
DNA constructs of the present invention therefore comprise a nucleotide sequence encoding a first promoter which is operably linked to and drives the expression of a transcription factor to rod cells or cone cells in the retina, where said transcription factor is not physiologically expressed. Further, the transcription factor of the constructs of the invention recognizes at least one nucleotide sequence of a gene which mutation is responsible for a retinal dystrophy, preferably selected from retinitis pigmentosa or Leber's congenital amaurosis, cone dystrophy or cone-rod dystrophy, thereby silencing the expression of said gene.
Furthermore, the same construct or alternatively a second construct may deliver a replacement cDNA for the mutated gene, eg a nucleotide sequence coding for a wild-type form of a mutated coding sequence, wherein said mutated coding sequence is responsible for the retinal dystrophy.
Ectopic expression of a gene is an abnormal gene expression in a cell type, tissue type, or developmental stage in which said gene is not usually expressed.
The invention relies on the use of ectopic expression of endogenous transcription factors (TFs) in rod photoreceptors or in cone cells. Said TFs, which are not physiologically expressed in rod photoreceptors or in cone photoreceptors, are used to repress genes expression of retinal diseases genes affecting the retina and preferably rod photoreceptors or cone photoreceptors. Repression of diseases gene expression by ectopic TFs is expected to prevent the toxic effect causing said retinal diseases.
In a preferred embodiment, the retinal dystrophy is characterized by photoreceptor degeneration, preferably rod cells degeneration or cone cells degeneration. Preferably, the retinal dystrophy is an inherited retinal dystrophy. Still preferably the inherited retinal degeneration is selected from the group consisting of dominant forms of: Retinitis Pigmentosa (RP), and Leber Congenital Amaurosis (LCA) with rod primary disease; alternatively, the retinal degeneration is a cone dystrophy or a cone-rod dystrophy.
Preferably, one or more wild-type forms of the coding sequence responsible for the retinal dystrophy is selected from the group consisting of any one of SEQ ID NO: 416 to SEQ ID No. 427. Any combination of SEQ ID NO: 416 to SEQ ID No. 427 is suitable for the present invention.
It is contemplated that the therapeutic methods of the present invention may be used in combination with another method of treating a retinal dystrophy. Additional therapeutic agents may include a neuroprotective molecule such as: growth factors such as ciliary neurotrophic factor (CNTF), glial-derived neurotrophic factor (GDNF), cardiotrophin-1, brain-derived neurotrophic factor (BDNF) and basic fibroblast growth factor (bFGF) or the rod-derived cone viability factors such as RdCVF and RdCVF2.
In the present invention the wild-type form of the coding sequence responsible for the retinal dystrophy, in particular characterized by photoreceptor degeneration, in particular inherited retinal dystrophy are selected from the group consisting of the following genes: RHO, PRPH2, CRX, RP1, GUCA1B, RDH12, NR2E3, NRLROM1, GUCY2D, CUGA1A.
In an embodiment of the invention the promoter is a rod specific promoter, in a still preferred embodiment the promoter is selected from: hGNAT1 (SEQ ID No. 12), or any one of SEQ ID No. 13 to 23.
In an alternative embodiment of the invention the promoter is a cone specific promoter, preferably the red opsin gene promoter.
The compositions of the present invention may be in form of a solution, e.g. an injectable solution, a cream, ointment, tablet, suspension or the like. The composition may be administered in any suitable way, e.g. by injection, particularly by intraocular injection, preferably by subretinal injection, by oral, topical, nasal, rectal application etc. The carrier may be any suitable pharmaceutical carrier. Preferably, a carrier is used, which is capable of increasing the efficacy of the DNA molecules to enter the target-cells. Suitable examples of such carriers are liposomes, particularly cationic liposomes.
By “biologically compatible form suitable for administration in vivo” is meant a form of the substance to be administered in which any toxic effects are outweighed by the therapeutic effects. Administration of a therapeutically active amount of the pharmaceutical compositions of the present invention, or an “effective amount”, is defined as an amount effective at dosages and for periods of time, necessary to achieve the desired result of increasing/decreasing the production of proteins. A therapeutically effective amount of a substance may vary according to factors such as the disease state/health, age, sex, and weight of the recipient, and the inherent ability of the particular polypeptide, nucleic acid coding therefore, or recombinant virus to elicit the desired response. Dosage regimen may be adjusted to provide the optimum therapeutic response. For example, several divided doses may be administered daily or at periodic intervals, and/or the dose may be proportionally reduced as indicated by the exigencies of the therapeutic situation. Suitable administration routes are intramuscular injections, subcutaneous injections, intravenous injections or intraperitoneal injections, oral and intranasal administration. In the case of IRD, injecting the constructs of the invention into the retina of the subject may be preferred. The composition of the invention may also be provided via implants, which can be used for slow release of the composition over time.
In the case of photoreceptor degeneration, such as in IRDs (in particular, Retinitis Pigmentosa (RP), Leber Congenital Amaurosis (LCA), cone-rod dystrophies and cone dystrophies), the compositions of the invention may be administered topically to the eye in effective volumes of from about 5 microliters to about 75 microliters, for example from about 7 microliters to about 50 microliters, preferably from about 10 microliters to about 30 microliters. The constructs of the invention may be highly soluble in aqueous solutions. Topical instillation in the eye of compositions of the invention in volumes greater than 75 microliters may result in loss of composition from the eye through spillage and drainage. Thus, it is preferred to administer a high concentration of composition (e.g., from 1 nM to 100 μM, with a preferred range between 10 and 1000 nM) by topical instillation to the eye in volumes of from about 5 microliters to about 75 microliters.
In one aspect, the parenteral administration route may be intraocular administration. Intraocular administration of the present composition can be accomplished by injection or direct (e.g., topical) administration to the eye, as long as the administration route allows the miRNA to enter the eye. In addition to the topical routes of administration to the eye described above, suitable intraocular routes of administration include intravitreal, intraretinal, subretinal, subtenon, peri- and retro-orbital, trans-corneal and trans-scleral administration. Such intraocular administration routes are within the skill in the art (Acheampong A A et al, 2002, Drug Metabol. and Disposition 30: 421-429; Bennett J, Pakola S, Zeng Y, Maguire A M. Hum Gene Ther. 1996; 7:1763-1769; Ambatia, J., and Adamis, A. P., Progress in Retinal and Eye Res. 2002; 21: 145-151 and Cheng Y, Ji R, Yue J, et al. Am J Pathol 2007; 170: 1831-1840).
The inventors have selected transcription factors based on their ability to recognize specific DNA sequence motifs present in the promoter of certain genes responsible for autosomal dominant forms of retinal dystrophies, their lack of expression in terminally differentiated rod photoreceptors or cone photoreceptors and their ability to silence said genes.
In an example, the inventors have selected the TF Kruppel-like factor 15 (KLF15) based on its putative ability to recognize a specific DNA sequence motif present in the RHODOPSIN (RHO) promoter and its lack of expression in terminally differentiated rod photoreceptors (the RHO-expressing cells). The inventors have surprisingly found that adeno-associated virus (AAV) vector-mediated ectopic expression of KLF15 in rod photoreceptors enables Rho silencing with limited genome-wide transcriptional perturbations. Suppression of a RHO mutant allele by KLF15 corrects the phenotype of a mouse model of retinitis pigmentosa (RP) with no observed toxicity.
The invention will be now illustrated by means of non-limiting examples referring to the following figures.
The present invention provides a nucleic acid construct comprising:
Preferably the gene which mutated form is responsible for the retinal dystrophy is selected from RHO, PRPH2, CRX, RP1, GUCA1B, RDH12, N2RE3, NRL, ROM1, OTX2, GUCA1A, GUCY2D.
Preferably the transcription factor is selected from:
Preferably the nucleic acid construct further comprises a nucleotide sequence coding for a wild-type form of a mutated coding sequence, wherein said mutated coding sequence is responsible for the retinal dystrophy, preferably said wild-type form of a mutated coding sequence is selected from the group consisting of RHO, PRPH2, CRX, RP1, GUCA1B, RDH12, N2RE3, NRL, ROM1, OTX2, GUCA1A, GUCY2D or the nucleic acid construct according to any one of claims 1 to 3 in combination with a second nucleic acid construct comprising a nucleotide sequence coding for a wild-type form of a mutated coding sequence, wherein said mutated coding sequence is responsible for the retinal dystrophy, preferably said wild-type form of a mutated coding sequence is selected from the group consisting of RHO, PRPH2, CRX, RP1, GUCA1B, RDH12, N2RE3, NRL, ROM1, OTX2, GUCA1A, GUCY2D.
In other words, the nucleotide sequence coding for a wild-type form of a mutated coding sequence may be part of the same construct as the Transcription factor or may be used in combination, as a separate independent construct.
Preferably said nucleotide sequence coding for a wild-type form of a mutated coding sequence is under the control of a nucleotide sequence of a second promoter.
Preferably the first and/or second promoter is GNAT1 or a promoter of a gene is selected from RHO, PRPH2, CRX, RP1, GUCA1B, RDH12, N2RE3, NRL, ROM1, OTX2, GUCA1A, GUCY2D.
Preferably the nucleotide sequence of the construct comprises any one of SEQ ID No. 837 to SEQ ID No. 881.
Preferably the retinal dystrophy is selected from retinitis pigmentosa, Leber's congenital amaurosis, cone dystrophy or cone-rod dystrophy.
The present invention also provides an expression vector that comprises the nucleic acid construct according to the invention, the expression vector may also comprise a second nucleic acid construct comprising a nucleotide sequence coding for a wild-type form of a mutated coding sequence, wherein said mutated coding sequence is responsible for the retinal dystrophy.
Preferably the vector is selected from the group consisting of: adenoviral vector, lentiviral vector, retroviral vector, Adeno associated vector (AAV) or naked plasmid DNA vector.
The present invention also provides a host cell comprising the nucleic acid construct, or an expression vector of the invention.
The present invention also provides viral particle that comprises a nucleic acid construct according to the invention or an expression vector according to the invention.
Preferably the viral particle comprises capsid proteins of an AAV.
More preferably the viral particle comprises capsid proteins of an AAV of a serotype selected from one or more of the groups consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8 AAV9 and AAV 10, preferably from the AAV2 or AAV8 serotype.
The present invention also provides pharmaceutical composition that comprises a nucleic acid construct or an expression vector or a host cell or a viral particle as defined above and a pharmaceutically acceptable carrier.
The present invention also provides a kit comprising a nucleic acid construct, an expression vector, a host cell or a viral particle or a pharmaceutical composition as defined above in one or more containers, optionally further comprising instructions or packaging materials that describe how to administer the nucleic acid construct, vector, host cell, viral particle or pharmaceutical composition to a patient.
The present invention also provides a nucleic acid construct, an expression vector, a host cell or a viral particle as defined above, for use as a medicament, preferably for use in the treatment of retinal dystrophy, preferably the retinal dystrophy is selected from retinitis pigmentosa, Leber's congenital amaurosis, cone dystrophy or cone-rod dystrophy.
The present invention also provides a nucleic acid construct, or an expression vector as defined above for the production of viral particles.
Rod-cone dystrophies, also known as retinitis pigmentosa (RP), are a clinically and genetically heterogeneous group of progressive inherited retinal disorders, which often starts with night blindness and leads to visual field constriction and secondary macular involvement.
In many cases, it may eventually result in loss of central vision and complete blindness [Wright et al., 2010]. RP occurs in one of 4,000 births and affects more than 1 million individuals worldwide. The mode of inheritance can be X-linked (xl), autosomal dominant (ad), or autosomal recessive (ar). In addition, many patients represent isolated cases, due to the absence of family history of RP. To date, mutations in 23 different genes are associated with adRP (http://www.sph.uth.tmc.edu/Retnet/) and the majority of prevalence studies reveal rhodopsin (RHO; MIM #180380) being the most frequently mutated gene in adRP [Audo et al. 2010b; Sullivan et al. 2006]. In addition, PRPF31 (MIM #606419), PRPH2 (MIM #179605), and RP1 (MIM #603937) were proposed to represent major genes underlying this form of RP [Audo et al., 2010a; Sullivan et al., 2006].
RHO mutations may be dominant for either of two reasons (Wilson and Wensel 2003; Mendes et al. 2005). Rhodopsin forms dimeric complexes in the disc membrane (Fotiadis et al. 2003), and mutant proteins might interfere with the function of normal rhodopsin or its assembly in the membrane, thereby exerting dominant negative effects.
Alternatively, gain-of-function mutations could cause rhodopsin to be intrinsically damaging to the rod cell. It may be possible to treat dominant negative mutations by increasing the level of the normal protein (supplementation). For mutations that cause rhodopsin to be injurious, however, suppressing the expression of the mutant proteins may also be required.
Still preferred disease genes are: CRX, Peripherin 2 (PRPH2), Retinitis pigmentosa 1 protein (RP1), Nuclear receptor subfamily 2 group E3 (N2RE3), Neural retina leucine zipper http://www.ncbi.nlm.nih.gov/gene/4901 (NRL)
This gene is a member of a photoreceptor-specific gene family and encodes an integral membrane protein found in the photoreceptor disk rim of the eye Mutations therein are responsible for rod dystrophies: OTX2, GUCA1B, RDH12; Mutations in the following genes are responsible for cone dystrophies: GUCA1A, guanylate cyclase activator 1A, GUCY2D, guanylate cyclase 2D, retinal.
Promoters of the invention are rod specific promoters including hGNAT1 promoter of SEQ ID NO. 12, and rod specific promoters of SEQ ID from 13 to 23, also disclosed in WO2017137493, included herein by reference.
Further promoters of the invention are cone-specific promoters, for instance red opsin gene regulatory region described in LI Q et al., Vision Research 48 (2008) 332-338, incorporated herein by reference: a 1 kb fragment of the upstream sequence of human red opsin gene containing a 1.6 kb BamHI-StuI fragment, extending from −3.1 to −4.6 kb joined to a proximal promoter of 495 bp of the human red pigment gene.
Suitable transcription factors of the present invention are endogenous transcription factors which recognize the proximal regulatory region, preferably within the core promoter element, of a disease gene of the invention as defined herein and are not expressed in rod-photoreceptor cells.
Said regulatory region is defined as a DNA sequence within the proximal promoter region upstream or downstream of the transcription start site (TSS) (−250 from TSS and +150 from the TSS, total 400 bp). The TF may target DNA sequences which are either on the plus or minus strands of the said regulatory region.
The proximal promoter targeted sequence may include:
The proximal promoter targeted sequence may further include:
The transcription factors of the invention are as indicated in Tables 2, 3, 4, 5, 6, 7 with their respective sequences.
Preferred transcription factors are as follows.
hKLF15
KLF15 belongs to the Kruppel-like factor (KLF) gene family (16), which possess a zinc-finger structure (KRAB-ZNF TFs) and recognize the core motif CACCC present in the hRHOcis (16).
KLF15 has a wide matrix sequence highly overlapping the ZF6-cis sequence (Table 2) and is expressed throughout the retina but not in photoreceptors (17) and thus can be excluded from having a regulatory function in these cells. In addition, although KLF15 exerts a wide range of regulatory functions in different organs and in system homeostasis (18-20), the mouse knock-out does not exhibit prominent phenotypes (21)
Binds the hPRP2 promoter not expressed in the retina
Bind hCRX promoter, not expressed in the retina
Binds hRP1 promoter, not expressed in the retina
Binds GUCA1B promoter, not expressed in the retina
Bind RDH12 promoter, not expressed in the retina
Binds GUCA1A promoter, not expressed in the retina
In order to identify transcription factors suitable for ectopic expression in rod cells in order to silence the Rhodopsin gene, the inventors searched initially for endogenous TFs with a DNA-binding preference for the ZF6-cis sequence motif ((−88 to −58 from the transcription start site, TSS), a 20 bp DNA sequence motif in the RHO promoter as defined in (12, 13) but that are not expressed in rod photoreceptors (the RHO-expressing cells). To retrieve TFs the inventors used Transfac analysis (15), which provides data on eukaryotic TF consensus binding sequences (based on Positional Weight Matrices, PWM), using as bait a 32 bp DNA sequence centred on the ZF6-cis sequence of the human RHO promoter (−88 to −58 from the RHO TSS, here named hRHO-cis). Among the set of retrieved TFs (
The inventors confirmed that Klf15 is not expressed in terminally differentiated rod photoreceptors using immunofluorescence analysis in mouse, porcine and human retina (
The inventors used the wild-type porcine retina to investigate the ability of KLF15 to repress Rho expression. The hRHO-cis sequence is highly conserved between pigs and humans (
To test whether RHO repression mediated by the ectopic expression of hKLF15 could produce a therapeutic effect, the inventors delivered AAV8-GNAT1-hKLF15 into the transgenic RHO-P347S mouse model of adRP (23). This adRP mouse model harbors the P347S human RHO mutant allele, including the hRHO-cis motif, and the endogenous murine Rho alleles (23). Interestingly, despite extensive promoter conservation with humans, the murine Rho promoter diverges in the hRHO-cis sequence motif (
In this study the inventors have shown that the cell-specific factors, in which a TF ectopically expressed operates, restrict its activity. In particular, ectopic expression of KLF15, which is involved in a wide variety of organ functions, in terminally differentiated rod photoreceptors silenced RHO expression with limited off-targeting effects. The results show that the cell-specific context may limit TF activities that control wide and coherent genetic programs, which, for instance, determine developmental and somatic photoreceptor identity transitions in the mammalian retina (1, 25, 26). KLF15 belongs to the largest TF group (KRAB-ZNF TFs) in the mammalian genome with an estimated repertoire of around 400 KRAB-ZNF TFs. In addition, KRAB-ZNF TFs shows highly differential tissue patterns of expression (27, 28). Thus, in principle, this TF somatic ectopic gene transfer approach could be extended to other gene targets by combining TF preferences with cell-specific expression and genome accessibility maps (10, 14). Of note, gene expression profiles in diverse tissues of the human body and across individuals are being increasingly identified (29).
Ectopic expression of KLF15 resulted in efficient Rho silencing similar to that shown by synthetic TFs (12, 13). Silencing of the severe RHO-P347S gain-of-function mutation in the adRP mouse model translated into structural and functional protection of the retina from degeneration. Coupling Rho transcriptional silencing with replacement, as others and the inventors described (30) and the safety and efficacy of AAV retinal gene transfer (31), supports further development of this strategy for the treatment of adRP. In summary, the inventors provided a proof-of-concept of a novel mode to efficiently and specifically silence a gene by ectopic expression of a TF in a novel cell-specific context.
The inventors obtained similar results as per
The promoter sequence of RHO was analyzed using Transfac® with the “Vertebrate” database using high quality matrices and a “Core score” and “Matrix score” higher than 0.95. The sequence analyzed was Chr3:129528551-129528581 corresponding to −88 to −58 from the Transcriptional Start Site (TSS) of human Rhodopsin.
The human KLF15 CDS and the murine KLF15 CDS were synthetized by Eurofins MWG®. The fragments were cloned in pAAV2.1 under the control of the CMV or hGNAT1 promoter using NotI and HindIII restriction enzymes.
AAV vectors were produced by the TIGEM AAV Vector Core, by triple transfection of HEK293 cells followed by two rounds of CsCl2 purification. For each viral preparation, physical titers [genome copies (GC)/mL] were determined by averaging the titer achieved by dot-blot analysis and by PCR quantification using TaqMan (Applied Biosystems, Carlsbad, CA, USA) (12, 13).
All procedures were performed in accordance with institutional guidelines for animal research and all of the animal studies were approved by the authors. P347S+/+ animals (23) and C57BL/6 were bred in the animal facility of the Biotechnology Centre of the Cardarelli Hospital (Naples, Italy) with C57BL/6 mice (Charles Rivers Laboratories, Calco, Italy), to obtain the P347S+/− mice.
Intraperitoneal injection of ketamine and medetomidine were administered (100 mg/kg and 0.25 mg/kg respectively), then AAV vectors were delivered sub-retinally via a trans-scleral transchoroidal approach (12, 13).
Eleven-week-old Large White (LW) female piglets were used. Pigs were fasted overnight leaving water ad libitum. The anaesthetic and surgical procedures for pigs were previously described (12). Each viral vector was injected in a total volume of 100 μl, resulting in the formation of a subretinal bleb with a typical ‘dome-shaped’ retinal detachment, with a size corresponding to 5 optical discs (12, 13).
In collaboration with the Eye Bank of Venice, the inventors collected retina samples from a donor in compliance with the tenets of the Declaration of Helsinki and after obtaining the informed consent from the donor's next of kin.
DNA fragments encoding the sequence of the engineered transcription factors ZF6-DB and hKLF15, to be expressed as maltose-binding protein (MBP) fusion were generated by PCR using the plasmids pAAV2.1 CMV-hKLF15 and pAAV2.1 CMV-ZF6-DB as a DNA template. The following oligonucleotides were used as primers: primer 1, (GGAATTCCATATGGTGGACCACTTACTTCCAG, SEQ ID No. 1) and primer 2, (CGGGATCCTCAGTTCACGGAGCGCACGGAG, SEQ ID No. 2), for hKLF15 primer 3, (GGAATTCCATATGCTGGAACCTGGCGAAAAACCG, SEQ ID No. 3) and primer 4, (CGGGATCCCTATCTAGAAGTCTTTTTACCGGTATG, SEQ ID No. 4) for ZF6-DB. All PCR products were digested with the restriction enzymes Ndel and BamH1 and cloned into an Ndel BamH1-digested pMal C5G (New England Biolabs) bacterial expression vector. All the plasmids obtained were sequenced to confirm that there were no mutations in the coding sequences. The fusion proteins were expressed in the Escherichia coli BL21DE3 host strain. The transformed cells were grown in rich medium plus 0.2% glucose (according to the protocol from New England Biolabs) at 37° C. until the absorbance at 600 nm was 0.6-0.8, at which time the medium was supplemented with 200 μM ZnSO4, and protein expression was induced with 0.3 mM isopropyl 1-thio-β-D-galactopyranoside and was allowed to proceed for 2 h. The cells were then harvested, resuspended in 1×PBS (pH 7.4), 1 mM phenylmethylsulfonyl fluoride, 1 μM leupeptin, 1 μM aprotinin, and 10 μg/ml lysozyme, sonicated, and centrifuged for 30 min at 27,500 rpm. The supernatant was then loaded on an amylose resin (New England Biolabs) according to the manufacturer's protocol. To remove the MBP from the proteins, bound fusion proteins were cleaved in situ on the amylose resin with Factor Xa (1 unit/20 μg of MBP fusion protein) in FXa buffer (20 mM Tris, pH 8.0, 100 mM NaCl, 2 mM CaCl2) for 24-48 h at 4° C. and collected in the same buffer after centrifugation at 500 rpm for 5 min. The supernatant containing the protein without the MBP tag was then recovered.
The affinity binding constant of proteins for the hRHO proximal promoter sequence was measured by a gel mobility shift assay by performing a titration of the proteins with the oligonucleotides. The purified proteins were incubated for 15 min on ice with a hRHO 65 bp duplex oligonucleotide in the presence of 25 mM Hepes (pH 7.9), 50 mM KCl, 6.25 mM MgCl2, 1% Nonidet P-40, 5% glycerol. After incubation, the mixture was loaded on a 5% polyacrylamide gel (29:1 acrylamide/bisacrylamide ratio) and run in 0.5 TBE at 4° C. (200 V for 4 h). Protein concentration was determined by a modified version of the Bradford procedure. After electrophoresis, the gel was stained with the fluorescent dye SYBR® Green I Nucleic acid gel stain (Invitrogen) to visualize DNA. 2.5 μM of the hKLF15 protein was incubated with increasing concentrations (145, 150, 170, 175, 190, 195, 200, 220, 240, and 250 nM) of the duplex hRHO 65 bp oligonucleotide. In the case of ZF6-DB, 1.5 μM of the protein was incubated with increasing concentrations (145, 150, 170, 175, 195, 210, 220, 225, 240, and 250 nM) of the duplex hRho 65 bp. Scatchard analysis of the gel shift binding data was performed to obtain the Kd values (12). All numerical values were obtained by computer quantification of the image using a Typhoon FLA 9500 biomolecular imager (GE Healthcare Life Sciences).
gReal Time PCR
RNA from tissues were isolated using RNAeasy Mini Kit (Qiagen), according to the manufacturer's protocol. cDNA was amplified from 1 μg isolated RNA using QuantiTect Reverse Transcription Kit (Qiagen), as indicated in the manufacturer's instructions.
PCR using the cDNA as template was performed in a total volume of 20 μl, using 10 μl LightCycler 480 SYBR Green I Master Mix (Roche) and 400 nM primers under the following conditions: pre-Incubation, 50° C. for 5 min, cycling: 45 cycles of 95° C. for 10 s, 60° C. for 20 s and 72° C. for 20 s. Each sample was analyzed in duplicate in two independent experiments. Transcript levels of pig retinae were measured by real-time PCR using the LightCycler 480 (Roche) and the following primers: pRho_forward (ATCAACTTCCTCACGCTCTAC, SEQ ID No. 5) and pRho_reverse (ATGAAGAGGTCAGCCACTGCC, SEQ ID No. 6), pGnat1_forward (TGTGGAAGGACTCGGGTATC, SEQ ID No. 7) and pGnat1_reverse (GTCTTGACACGTGAGCGTA, SEQ ID No. 8), pArr3_forward (TGACAACTGCGAGAAACAGG, SEQ ID No. 9) and pArr3_reverse (CACAGGACACCATCAGGTTG, SEQ ID No. 10), pCrx_forward (GAGCTGGAGTCCTTGTTTGC, SEQ ID No. 11) and pCrx_reverse (CGTGGAGGATCTTGGAGAAG, SEQ ID No. 24), pNrl_forward (CAGAGCTGCTGCAGTGTCA, SEQ ID No. 25) and pNrl_reverse (GTTCAACTCGCGCACAGAC, SEQ ID No. 26), pKlf15_forward (GCAGGACAGCATCTTGGACT, SEQ ID No. 27) and pKlf15_reverse (ACAGGAGCTGGTGTTTTTCG, SEQ ID No. 28). All of the reactions were standardized against porcine Actp using the following primers: Act_Forward (ACGGCATCGTCACCAACTG, SEQ ID No. 29) and Act_reverse (CTGGGTCATCTTCTCACGG, SEQ ID No. 30). Transcript levels of mouse retinae were measured by real-time PCR using the LightCycler 480 (Roche) and the following primers: mRho_Forward (GACTCTGCCAGCTTTCTTTGCT, SEQ ID No. 31) and mRho_Reverse (GCGTCGTCATCTCCCAGTGGA, SEQ ID No. 32), hRho_Forward (CCATCCCAGCGTTCTTTGCC, SEQ ID No. 33) and hRho_Reverse (CCTCATCGTCACCCAGTGGG, SEQ ID No. 34), mGnat1_Forward (GACCGAGCCTCAGAATACCA, SEQ ID No. 35) and mGnat1_Reverse (GGAGAATTGAGTCTCGATAATACCA, SEQ ID No. 36); All of the reactions were standardized against porcine Acts using the following primers: mAct_Forward (CAAGATCATTGCTCCTCCTGA, SEQ ID No. 37) and mAct_reverse (CATGCTACTCCTGCTTGCTGA, SEQ ID No. 38), mGapdh_forward (GTCGGTGTGAACGGATTTG, SEQ ID No. 39) and mGapdh_reverse (CAATGAAGGGGTCGTTGATG, SEQ ID No. 40).
Frozen retinal sections were washed once with PBS and then fixed for 10 min in 4% PFA. Sections were blocked and permeabilized with 0.3% Triton X-100 and 5% donkey serum in TBS for 1 hour. The primary antibody mouse anti-KLF15 (1:200, abcam, ab185958) was diluted in a blocking solution and incubated overnight at room temperature. The secondary antibody (Alexa Fluor® 594, anti-rabbit 1:1000, Molecular Probes, Invitrogen, Carlsbad, CA) was incubated for 1 hour. Vectashield (Vector Lab Inc., Peterborough, UK) was used to visualize nuclei. Frozen retinal sections were permeabilized with 0.2% Triton X-100 and 1% NGS for 1 hour, rinsed in PBS, blocked in 10% normal goat serum (NGS), and then incubated overnight at 4° C. with rabbit human cone arrestin (hCAR) antibody, kindly provided by Dr. Cheryl M. Craft (Doheny Eye Institute, Los Angeles, CA) diluted 1:10,000 in 10% NGS. After three rinses with 0.1 M PBS, sections were incubated in goat anti-rabbit IgG conjugated with Texas red (Alexa Fluor® 594, anti-rabbit 1:1000, Molecular Probes, Invitrogen, Carlsbad, CA) for 1 hour followed by three rinses with PBS. Frozen retinal sections were permeabilized with 0.1% Triton X-100, rinsed in PBS, blocked in 10% normal goat serum (NGS), and then incubated overnight at 4° C. in a mouse anti-1D4 rhodopsin antibody diluted 1:500 in 10% NGS. After three rinses with 0.1 M PBS, sections were incubated in goat anti-mouse IgG conjugated with Texas red (Alexa Fluor® 594, anti-mouse 1:1000, Molecular Probes, Invitrogen, Carlsbad, CA) for 1 hour followed by three washes with PBS. Frozen retinal sections were permeabilized with 0.1% Triton X-100, rinsed in PBS, blocked in 10% normal goat serum (NGS), and then incubated overnight at 4° C. in a rabbit Gα T1-K20 (1:300, Santa Cruz Biotechnology) in blocking solution. After three rinses with 0.1 M PBS, sections were incubated in goat anti-mouse IgG conjugated with Texas red (Alexa Fluor® 594, anti-rabbit 1:500, Molecular Probes, Invitrogen, Carlsbad, CA) for 1 hour followed by three washes with PBS.
Mouse eyes were enucleated and fixed with 4% formaldehyde in 0.1 M sodium phosphate buffer, pH 7.4 for 16 h at 4° C. The tissues were then dehydrated through a graded sucrose series and embedded in OCT. Sections (12 μm thick) were cut. Hematoxylin and eosin (H&E) staining was performed. Sections were photographed using either a Zeiss 800 Confocal Microscope (Carl Zeiss, Oberkochen, Germany) or a Leica Fluorescence Microscope System (Leica Microsystems GmbH, Wetzlar, Germany).
Western blot analysis was performed on harvested retina. Samples were lysed in hypotonic buffer (10 mM Tris-HCl [pH 7.5], 10 mM NaCl, 1.5 mM MgCl2, 1% CHAPS, 1 mM PMSF, and protease inhibitors) and 20 μg of these lysates were separated by 12% SDS-PAGE. After the blots were obtained, specific proteins were labeled with anti-1D4 antibody anti-Rhodopsin-1D4 (1:1000; Abcam, Cambridge, MA), and anti-β-tubulin (1:10,000; Sigma-Aldrich, Milan, Italy) antibodies.
For ChIP experiments, HEK293 cells were transfected by CaCl2) with pAAV2.1 CMV-hKLF15 or pAAV2.1 CMV-eGFP. The cells were harvested after 48 hours. ChIP was performed as follows: cells were homogenized mechanically and cross linked using 1% formaldehyde in PBS at room temperature for 10 minutes, then quenched by adding glycine at final concentration 125 mM and incubated at room temperature for 5 minutes. Cells were washed three times in cold PBS 1× and then lysed in cell lysis buffer (Pipes 5 mM pH 8.0, Igepal 0.5%, KCl 85 mM) for 15 min. Nuclei were lysed in nucleus lysis buffer (Tris HCl pH8.0 50 mM, EDTA 10 mM, SDS 0.8%) for 30 min. Chromatin was sheared using Covaris s220. The sheared chromatin was immunoprecipitated over night with anti-KLF15 (2G8) ChIP grade (Abcam, ab81604, Cambridge, MA). The immunoprecipitated chromatin was incubated 3 hours with magnetic protein A/G beads (Invitrogen, Carlsbad, CA). Beads were than washed with wash buffers and DNA eluted in elution buffer (Tris HCl pH8 50 mM, EDTA 1 mM, SDS 1%). Real time PCR was performed using primers on rhodopsin TSS, hRHOTSSFw (TGACCTCAGGCTTCCTCCTA, SEQ ID No. 41) and hRHOTSSRv (ATCAGCATCTGGGAGATTGG, SEQ ID No. 42).
Injected porcine retinas with AAV8-GNAT1-eGFP (dose 1×1012 gc) were disaggregated using Papain Dissociation System (Worthington biochemical corporation) following the manufacturer's protocol. Dissociated retinal cells were analysed using BD FACSAria Ill and sorted, dividing eGFP positive cells (rods) from the eGFP negative fraction.
The method used was described previously (12, 13). Briefly, mice were dark reared for three hours and anesthetized. Flash electroretinograms (ERGs) were evoked by 10-ms light flashes generated through a Ganzfeld stimulator (CSO, Costruzione Strumenti Oftalmici, Florence, Italy) and registered as previously described. ERGs and b-wave thresholds were assessed using the following protocol. Eyes were stimulated with light flashes increasing from −5.2 to +1.3 log cd*s/m2 (which correspond to 1×10-5.2 to 20.0 cd*s/m2) in scotopic conditions. The log unit interval between stimuli was 0.3 log from −5.4 to 0.0 log cd*s/m2, and 0.6 log from 0.0 to +1.3 log cd*s/m2. For ERG analysis in scotopic conditions the responses evoked by 11 stimuli (from −4 to +1.3 log cd*s/m2) with an interval of 0.6 log unit were considered. To minimize the noise, three ERG responses were averaged at each 0.6 log unit stimulus from −4 to 0.0 log cd*s/m2 while one ERG response was considered for higher (0.0-+1.3 log cd*s/m2) stimuli. The time interval between stimuli was 10 seconds from −5.4 to 0.7 log cd*s/m2, 30 see from 0.7 to +1 log cd*s/m2, or 120 seconds from +1 to +1.3 log cd*s/m2. a- and b-wave amplitudes recorded in scotopic conditions were plotted as a function of increasing light intensity (from −4 to +1.3 log cd*s/m2). The photopic ERG was recorded after the scotopic session by stimulating the eye with ten 10 ms flashes of 20.0 cd*s/m2 over a constant background illumination of 50 cd/m2.
The 16 libraries were prepared using the TruSeq RNA v2 Kit (Illumina, San Diego, CA) according to the manufacturer's protocol. Libraries were sequenced on the Illumina HiSeq 1000 platform and in 100-nt paired-end format to obtain approximately 30 million read pairs per sample as reported (12, 13).
The dataset was composed of 16 samples and 25,325 genes, divided in 3 experimental groups: 6 Controls, 4 KLF15-treated, 6 ZF6-DB-treated (12, 13).
All analyses, except for the reads quality filtering, alignment and expression estimates, were performed in the R statistical environment (v.3.2.0) (32). Plots were generated with ggplot2 R/Bioconductor package (v.1.0.1) (12, 13).
Data are presented as mean±Error bars indicate standard error mean (SEM). Statistical significance was computed using the Student's two-sided t-test and p-values<0.05 were considered significant. No statistical methods were used to estimate the sample size and no animals were excluded.
Animal experimentation: All procedures were performed in accordance with institutional guidelines for animal research and all of the animal studies were approved by the authors. The protocol was approved by the Italian Ministry for Health (IACUC protocols #114/2015-PR).
The “Fondazione Banca degli Occhi del Veneto” (Eye Bank of Venice) provided retina samples from a donor in compliance with the tenets of the Declaration of Helsinki and after obtaining the informed consent from the donor's next of kin.
| Number | Date | Country | Kind |
|---|---|---|---|
| 17209892.3 | Dec 2017 | EP | regional |
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/EP2018/086782 | 12/21/2018 | WO |
